Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
shown in fig1 is a multi - card processor for calculating the fast fourier transform ( fft ). in particular , a series of cards 11 , 13 , 15 , 17 , 19 is shown , representative of a number of identical cards , say 32 , which constitute the processor . in addition in i / o board 21 and a control and test board 23 complete the processor unit . each processor card , such as card 11 , has memory units 25 and 29 which store input words which are fed to switch 33 . during one entire iteration of the fft one memory unit supplies pairs of complex words to the butterfly unit 35 via the switch 33 , while the other receives pairs of complex words from other processor boards via the switch 37 . at the end of the iteration the switches change positions and the roles of the two memories reverse for the next iteration . thus roles alternate from one iteration to the next . each memory unit is further subdivided into four sections , as described later , to permit parallel access of pairs of complex words . the memory units 25 , 29 are standard semiconductor integrated circuits in the form of random access memories or shift registers . butterfly 35 is similarly a semiconductor integrated circuit which performs a complex multiplication , and a complex addition and subtraction in a well - known way . to perform the operation , a complex weighting coefficient is supplied by the sine / cosine generator 39 just prior to the time that the butterfly operation is performed . output signals from butterfly 35 are taken along the line 41 and fed as inputs to two other boards as described below . both the butterfly 35 and the sine / cosine generator are available as semiconductor integrated circuits . an i / o register 43 is used to input data to the memories prior to performing a transform and to output data following a transform . during these operations a direct data path exists between the i / o registers and the memories , that takes precedence over the above - mentioned paths . a data bus 45 is common to similar i / o registers on each board , and transfer of data over this bus is performed in a time - division multiplexed manner . the i / o board 21 controls transfer of data between devices external to the fft processor and the various processor boards . it may also perform preprocessing functions , such as scaling input data or multiplying such data by a specified set of coefficients . the i / o board also can transfer internally generated test data to processor boards in lieu of normal data . the number of boards in fig1 depends mainly on the required processing speed of the overall processor . in general , this size will be a power of the radix ( 2 , for the present case ) and in the preferred embodiment , 32 boards are required for the example described herein . however , this number is not critical and more or fewer boards could be used . thirty - two boards would result in a processing speed increase somewhat less than 32 times that for a single board and would permit an increase of transform size by a factor of 32 . in fig1 a control and self - test board 23 is also shown to be connected to the other boards . the control board contains a master clock for providing timing signals , as well as interrupt logic for truncating arithmetic operations after a desired number of iterations , or for other desired purposes which may be programmed into such logic . optionally , the test board may contain a microprocessor for exercising the system in accord with a set of instructions and for performing diagnostic operations which may designate a malfunction . the relationship between the test and control board and the i / o board and the processor cards may be seen in fig2 . with reference to fig2 i / o board 21 and test and control board 23 may be seen connected to exchange words of test data along lines 47 , 49 . signals from the master clock are fed from board 23 to board 21 along line 51 , while acknowledging responses from the i / o board 21 to the test board 23 are received along line 53 . i / o board 21 receives external data from analog to digital converters , external to the processor , along lines 55 and has a pair of output ports for either serial word outputs taken along line 57 or channelized outputs along lines 59 . for block floating point arithmetic , scale factor data is transmitted outwardly along line 61 and data indicating word count is transmitted through line 63 . as previously mentioned , a data bus 45 connects the i / o board with the identical processor cards , illustrated in fig1 . each of the identical processor cards 11 - 19 also receives control signals along line 46 and sends responses along line 48 , with respect to test and control board 23 . the output from each board is taken along two paths which are connected to two neighboring boards as explained hereinafter . data is manipulated by the processor of the present invention in accord with singleton &# 39 ; s algorithm . fig3 a , 3b and 4 show a convenient arrangement for input and output files which are organized into the memory units shown in fig1 for each processor card . in fig3 a , the input file 57 is shown to have two rows 61 , 63 wherein words are stored for transmission to a butterfly . output is from the right hand side of the input file . after the butterfly is performed words are stored in the output file 65 , with words entered from the right hand side in the two levels 67 , 69 . this same routing is used at each stage of the algorithm . it will be seen that the words 0 , 32 from input file 57 are stored in the upper level 67 of the output file after the butterfly is performed . since only one word can be entered at a time , it is advantageous to split the output file into two portions so that the word 0 and the word 32 can be written simultaneously in two output files . the input file must be split similarly since at the next stage the roles of the two files are reversed . in fig3 b , the input and output files have been divided as mentioned above . now , input files 71 , 73 have interleaved input data while output files 75 , 77 have interleaved output data . in the example mentioned above , the input words &# 34 ; 0 &# 34 ;, &# 34 ; 32 &# 34 ; may be accessed from the input file 73 and the &# 34 ; 0 &# 34 ; stored in output file 77 , while the word &# 34 ; 32 &# 34 ; is written in output file 75 . in this way , both output words may be written at the same time because they are written in separate memory units . fig4 shows an even further subdivision of the memory files which is possible if four butterflies are performed in parallel . all files with a common number in their designation can be placed on one circuit board together with a butterfly unit . four such circuit boards are then required by the subdivision of fig4 . each of the input files a1a , a1b , a1c and a1d can be regarded to be a separate memory unit which is connected to a butterfly , with one pair of memory units being connected to a butterfly at a time through a switch , such as shown in fig1 . for example , the input files a1c and a1d may be connected to a butterfly for input of the words &# 34 ; 0 &# 34 ; and &# 34 ; 32 &# 34 ; at one time . one cycle later the input files a1a , a1b are connected to the butterfly for input of the words &# 34 ; 4 &# 34 ; and &# 34 ; 36 &# 34 ;. in the first instance , the words &# 34 ; 0 &# 34 ; and &# 34 ; 32 &# 34 ; are processed by the butterfly and transmitted to output files b1c and b2c , as shown . the input words &# 34 ; 4 &# 34 ; and &# 34 ; 36 &# 34 ; are then processed and placed in the next storage location of the same output files , b1c and b2c . while the first butterfly processes words &# 34 ; 0 &# 34 ; and &# 34 ; 32 &# 34 ; the second processes &# 34 ; 1 &# 34 ; and &# 34 ; 33 &# 34 ;, the third processes &# 34 ; 2 &# 34 ; and &# 34 ; 34 &# 34 ; and the fourth processes &# 34 ; 3 &# 34 ; and &# 34 ; 35 &# 34 ;. the resulting data words are sent in parallel to the output files shown in fig4 . the sequence for operation of the files illustrated in fig4 is shown in fig5 . on odd - numbered passes , data is taken from files with &# 34 ; a &# 34 ; in their designations , passed through butterflies and transmitted to files with &# 34 ; b &# 34 ; in their designations . on even - numbered passes the roles of these files are reversed . this procedure is repeated until the fft processing is complete . fig6 a and 6b show the interconnection of 32 processor cards . this is the direct extension of fig4 . each processor card contains an input file and an output file , each of which is divided into four subfiles in the manner of fig4 . fig6 a and 6b are divided so that the interconnection between boards may be clearly seen . however , to understand the interconnections fig6 a and 6b should be mentally superposed , one atop the other . a geometric regularity may be seen with respect to the interconnections . processor cards with numbers i in the region 1 to 16 transmit data to cards 2i - 1 , and 2i and those with numbers between 17 and 32 transmit data to cards 2i - 1 - 32 and 2i - 32 . this fixed interconnection of cards implements singleton &# 39 ; s algorithm for carrying out all stages of the fft . the processor design is highly modular , allowing quick replacement of processor cards which become defective . fig7 shows a block diagram of a processor card . the memory 83 is divided into eight sections in accordance with the previous discussion of fig4 . the files are denoted 1el , 1ol , etc . the first number specifies whether the file is an input or output file . when &# 34 ; 1 &# 34 ; is an input file , &# 34 ; 2 &# 34 ; is an output file , and vice versa . the designation e and o refers to even and odd . this implements the splitting of input files into two files containing even and odd numbered or indexed words , in accordance with fig3 b . finally , the designation u and l refers to upper and lower . this segments data so that two words may be sent simultaneously to the butterfly unit 85 . the designation comes from the fact that one word of the pair has index less than n / 2 ( beginning with index 0 ) and the other index greater than or equal to n / 2 , where n is the number of points of the fft . in normal operation , let 1 be the input file and 2 the output file . then 1 transmits words to the butterfly unit of fig7 by alternately supplying pairs of words first from memory segments 1el and 1eu and then on the next clock cycle from 1ol and 1ou . words within a given memory segment are accessed in a normal sequential manner . simultaneously , memory segments 2 are receiving data from other processor boards following performance of butterfly operations on these boards . data is stored in these segments by placing pairs of data words in segments 2el and 2ol for n / 2 clock cycles until these memories are completely filled . within each segment memory words are accessed in normal order . next , memory segments 2eu and 2ou receive pairs of data words until these memories are filled . a transform stage , or iteration , is them complete and the roles of memories 1 and 2 are reversed . addressing of memory and read / write commands may be derived directly from an address counter 91 via some logic , termed a &# 34 ; switch matrix &# 34 ; 93 in fig7 . as seen in this figure , the processor boards contain sine / cosine generators 87 in the form of semiconductor read - only memory look - up tables . these tables are also addressed by signals derived from the same address counter 91 . as the transform proceeds from one stage to the next the number of different words addressed in this memory doubles . the masking circuit 89 of fig7 following the address counter 91 uncovers one additional bit per iteration from the address counter , thus implementing the required number of words to be accessed . the butterfly unit 85 multiplies one of its complex inputs by the complex exponential supplied by the sine / cosine generator 87 , and then forms two complex words by adding and subtracting the result from the second complex word fed to the butterfly . overflow predict circuit 97 determines the magnitude of output words and scales data by one bit following the butterflies of the next iteration if any word has magnitude exceeding one - half full scale . the remaining circuitry in fig7 comprises two sets of registers 81 and 99 , one receiving data from the i / o board and one transmitting data to that board , and an i / o counter 95 . these registers are to be used to initially load data into the memories prior to performance of a transform and to transfer data out of the processor boards to the i / o board following the completion of a transform . such flow of data can occur in place of normal flow of data between processor boards ( during performane of transforms ), or it can occur during performance of a transform of previously entered data . in the latter case transfer of data between the i / o board and memories occurs on a cycle stealing basis , that is , normal flow of data between processor boards is interrupted for one cycle in order to permit the transfer of one word to memory from the i / o board and one word to the i / o board from memory . in such cases the memories must be further partitioned into two halves -- one half being used in the performance of a transform and the other half used as a buffer for transfer of data between the i / o board and memory . such buffering permits a doubling of the speed of operation of the processor at the expense of halving the transform size . in addition , such buffering permits continuous computation of transforms of adjacent blocks of data with no gaps of time between such computations . addressing for transfer of data between the memories and the i / o board is facilitated by a separate i / o counter resident on the processor boards and read write commands sent to thse boards from the control board . as indicated previously , variations exist on the basic structure described above . the interconnections of processor boards in such variations has been described previously . alterations in the processor boards are straightforward . if data is initially provided in bit - reversed index order , then the main change to the structure of fig7 is that the interconnection of signal lines at the memory inputs is similar to that of the memory outputs of fig7 . a similar role reversal occurs for interconnection of memory output lines . performance of decimation - in - time versus decimation - in - frequency algorithms is determined by the structure of the butterfly unit and the sequence of accessing sinusoids from the sine / cosine generators . finally , the extension to higher radix systems requires the use of butterfly units with a number of inputs and outputs equal to the radix , and processor memories are segmented into a number of sections equal to twice the square of the radix .	6
the present invention utilizes an optimal , minimum cost two - dimensional detector geometry , characterized by an exposure window which is limited vertically by the two nearest turns of the helical source trajectory . both the motivation for and the exploitation of this detector window differs greatly from the ones given in [ tam95 ] and [ eber95 ]. to explain the specific virtue of this exposure window , we refer again to fig1 which shows a perspective view of a source s , a detector 11 wrapped around the helix cylinder 12 and inside this an object cylinder 13 . in the sequel , unless stated otherwise , we assume that the object cylinder is rotating counter - clock - wise as shown around the z - axis and translated upwards in a right - handed helix , while the source s and the detector 11 are fixed in the space ( x , y , z ). fig6 shows the arrangement as seen from above , while fig7 shows the detector window unwrapped and rolled out on a plane . note that fig1 and 7 are consistent only if the rays in fig7 are understood to be coming from the source towards the viewer . fig2 shows the detector placed on the source cylinder 41 centered in s and having a radius which is twice as large as the helix cylinder 12 . fig1 is a pictorial representation of a two - dimensional detector and point - shaped ray source moving synchronously around an object in a helical trajectory ; fig2 is a depiction of a detector wrapped onto the surface of the source cylinder , centered in s ; fig3 is a depiction of a vertical section of the parallel scanning system described herein ; fig5 is a depiction of a parallel projection unwrapped and rolled out onto a 2 - d sheet ; fig6 is a depiction of the arrangement of fig1 as seen from above ; fig7 is a detector surface unwrapped and rolled out on a plane of the detector of fig1 ; fig8 is a straight side view of the depiction of fig1 ; fig9 is a straight top view of the depiction of fig1 ; fig1 a , 10 b are depictions of a rebinning parallel projection ; fig1 a , 12 b and 12 c depict 3 orthogonal views a , b and c of the parallel projection system of the invention ; fig1 is a view from above the fig1 representation where the object is fixed and the source and detector are rotating ; fig1 depicts a detector window of the helix cylinder rolled out on a plane of a sheet ; and fig1 is a depiction of the detector in fig1 reduced in height to a single row of detector elements . as mentioned , the 2d - detector 11 in fig1 is wrapped onto the helix cylinder 12 . unwrapped and rolled out on the plane of the sheet , the same detector surface 11 in fig7 is seen to be bounded by four straight lines , two vertical ones 31 and 32 , and two slanted ones 33 and 34 . within this area the object 17 is projected , i . e ., rays from the cone - beam source reaches active detector elements . horizontally , this area has to be extended to cover the object cylinder 13 , which translates to a certain width , or fan angle γ max , as seen from the source . as an example we have assumed that this object cylinder has a radius r = r 2 where r is the radius of the helix cylinder 12 . this means that horizontally on 12 the detector covers a rotation angle of 180 degrees out of 360 , and that seen from the source the detector 11 covers a fan angle from − 45 to + 45 degrees . in principle the detector may be extended to a full turn which then has a fan - angle from − 90 to + 90 degrees and would allow for an object cylinder that extends all the way to the helix . the slanted lines 33 and 34 are intersecting the cylinder surface 12 at the slope tan   ɛ = v ω   r = h 2  π   r ( 1 ) where v is the vertical translation velocity , w is the angular velocity for the rotation , and h is the pitch of the helix . at the core of the invention is the following property of the detector - exposure window . every point in a cylindrical long object , with a radius that fits inside the boundaries of the detector window , will be exposed ( projected ) during a rotation angle which is exactly 180 degrees , seen from the actual point in the object . a conjecture of this new sufficiency condition is that as soon as one point or a set of points ( i . e . a part of the long object ) has been fully exposed in the above sense , the reconstruction of this part can take place . this is in contradiction to the situation in [ tam95 ] and [ eber95 ]] where the whole roi has to be exposed to make the radon space complete before the actual reconstruction is commenced . an example of this 180 degree exposure is the line 18 in fig1 . it contains the three object points q 1 − q − q 2 and it is shown in two positions where the exposure starts and ends , respectively . note that the end points of this line is sliding and touching the outer cylinder so that during the rotation , both ends will coincide with the source s . any such line will be called a − line this line is also shown in fig6 in the same two positions . assume as before that the object is moving upwards and rotating counter - clockwise when seen from above . in the detector window of fig7 the line q 1 − q − q 2 crosses the lower boundary 34 as a single point at q in . after a rotation with the angle π + 2γ around the axis 14 this line will be seen as a single point again from the source leaving the detector at q out on the upper boundary 33 clearly , between entrance and exit the source has rotated exactly 180 degrees as seen from any point on this line . since we have chosen this line quite arbitrarily , the same thing is true for all points in the object which belong to fully exposed − lines . in fig6 and fig7 but not in fig1 we have inserted another − line p 1 − p − p 2 . in the fixed source - detector system of fig2 this line p enters and exits in positions which are exactly the reverse of the corresponding positions for the line q . the line p is therefore closer to the source than line q during its exposure , which takes place during a rotation angle of π − 2γ around the axis 121 . the points on line p travels over the detector surface along different and shorter curves as shown in fig7 but seen from any of these points , the source rotates around them exactly 180 degrees . every object point belongs to one and only one line . therefore , the detector system in fig . 1 gives us a complete and perfectly balanced data capture for every point and hence also for the whole object . furthermore , from the conjecture above follows that it should be possible to reconstruct the object at the same pace as an incremental part ( each new set of − lines ) of the long object is fully exposed . the physical implementation and placement of the detector can of course be made in various ways as indicated in fig2 . for instance , it may be placed on the helix cylinder 12 itself , on the source cylinder 41 or on a plane 42 . in any case , the detected and utilized data must be restricted to the window defined by fig7 . in our invention , using the same detector data , the elaborate reconstruction in [ tam95 ] and [ eber95 ] will be replaced by a much simpler procedure . to describe this procedure , we do not have to limit the ongoing scanning and reconstruction to a predetermined roi , nor do we have to specify a 3d origin for the process . instead , scanning and reconstruction is like a constantly ongoing flow , in principle without beginning or end , where each new projection is absorbed and incorporated seamless to the previous result . for this purpose , the following is the general reconstruction procedure for every new projection . 3 . one - dimensional filtering with a ramp - filter across the detector ( where the filter design is dependent on rebinning and detector type ) 4 . back - projection along incoming ray direction with magnification factors , depending on type of rebinning as well as on detector type : plane , cylindrical , etc . a special case of this procedure is rebinning to parallel projections which we will describe in more detail . fig8 shows a straight side - view of fig1 with six rays 51 , 52 , 53 , 54 , 55 , and 56 coming from the source s positioned at the x - axis . fig6 shows a view from above where the object is fixed and the source and detector is rotating . with the source in the position s α we observe three fan - beams 61 , 62 , and 63 ( seen as rays in this view ), which comprises the six rays in fig8 and which produce the three projection sets t ( α , γ 1 ), t ( α , 0 ), t ( α ,− γ 1 ). the two outer rays are parallel to two other rays , 64 and 65 , coming from two other source positions which produce the projections t ( α + γ 1 , 0 ) and t ( α − γ 1 , 0 ) respectively clearly , we may resample our projection data so that data from such parallel fan - beams ( seen as rays ) are brought together . this can be done with either of the following two equivalent assignments . as shown in fig9 we are then free to see the data set p as generated by a parallel beam in the − direction . without loss of generality , this direction is horizontal in fig9 . perpendicular to these rays we place a virtual detector 72 on a vertical plane . the detector window 71 for the parallel projection in fig7 is unwrapped and rolled out into the sheet of fig5 . note that the complete detector positions for the parallel projection are put together from vertical lines 83 , 84 , and 85 each one stemming from different cone - beam detector positions . the resulting parallel beam detector area has the same slant as the cone - beam detector but is shortened with a factor of two in the − direction . the uppermost and lowermost part of the detector 81 and 82 in fig5 outlines another detector window included here for comparison only . to the best of our understanding , this window corresponds to the minimum size detector in [ scha96 ] and [ scha97 ] when mapped onto the helix cylinder 12 . for the given pitch = h and the given maximum fan angle γ max the height of this detector window is 2  v  ( π + γ max ) ω   r   cos   γ max = h cos   γ max  π + γ max π = h  ( 1 + γ max π cos   γ max ) ( 3 ) this formula indicates that the detector redundancy in [ scha96 ] and [ scha97 ] grows rather quickly for increasing fan - angles . the rays in the parallel projection emanate from a set of sources with vertical fan - beams , located on a specific section of the helix . rolled out in the plane of the sheet this part 73 of the source helix is superimposed on the detector 71 in fig5 . it takes the form of a line with the same slant as the detector but with opposite sign . because of this fact , in the present invention , the virtual detector 72 in the vertical mid - plane is bounded by a perfect rectangle with a width that equals the object cylinder diameter and a height which is exactly half the pitch = h / 2 . this is illustrated in fig1 , where an upward tilt of the source path 73 is exactly compensated for by a downward tilt of the detector . furthermore , since the distance from the virtual detector 72 to the source is everywhere identical to the distance to the real detector , the real detector height h is always demagnified to exactly h / 2 at the virtual detector . fig5 illustrates the second part of the rebinning - resampling procedure , namely from equidistant grid points in r to equidistant grid points iny = r sinγ and y are used as coordinates also for the rebinned parallel projection system .) the aforementioned property of the virtual detector area being a perfect rectangle is further illustrated in fig1 , which shows three orthogonal views a , b , and c of the parallel projection system . seven source positions are indicated . in a , b we can see the projection from one of the source positions s as a line d - e . clearly , in view b we see that all the three points s , d , and e are on the helix . furthermore , the plane of the virtual detector intersects the helix in two points which are exactly halfway between s and d at the upper ray 111 and halfway between s and e at the lower ray 112 . therefore the height of the vertical detector is h / 2 with its midpoint on the x - axis for any s . this proofs that the virtual detector is a rectangle with horizontal boundaries . thus , using the insight that there is a special detector window which delivers sufficient and non - redundant data , we capture cone - beam projection data on this detector and rebin them into parallel projection data to create an advantageous situation for the actual reconstruction . the complete procedure consists of the following three steps . 1 . rebinning to parallel projections as described by the fig6 , 8 , 9 , 10 , and 11 . 2 . filtering with a conventional ramp - filter along horizontal rows in the virtual detector plane . 3 . back - projection in the direction of the original rays using a constant magnification factor . in the present invention , after parallel rebinning , the one - dimensional filtering takes place along horizontal rows in the virtual detector 72 of fig5 . in contrast , in [ scha96 ] and [ scha97 ] the filtering takes place along horizontal rows of a real detector placed on the source cylinder , shown as the arc 41 in fig4 . fig4 shows this detector mapped onto the virtual detector plane 121 . the horizontal rows in the real detector are mapped onto curves in 121 which are neither horizontal nor straight . clearly , after filtering along such curves in the virtual detector plane rather than along straight horizontal rows as in the present invention the reconstruction result will be rather different . even so , step 3 in the above procedure may very well be replaced by the version . reconstruction of one horizontal slice from generalized projections . the simplification is due to the perfectly balanced data capture in the present invention . we know a priori that there is one and only one source position that contributes to each detector position in the generalized projections as shown in fig1 . hence , there is no need to keep track of multiple exposure contributions , since there are neither missing nor redundant data in any projection . the situation is different in [ scha97 ] which is illustrated in fig3 showing a vertical section of the parallel scanning system . the real detector 125 is much higher than in fig9 so that the virtual detectors 121 , 122 , and 123 for neighboring half turns overlap vertically . therefore , in a vertical plane ( such as the plane of the sheet ) a horizontal slice of the object is partially illuminated not from one but from three source positions on the trajectory . this irregularly distributed redundancy in exposure is also reflected in fig4 which shows the virtual detector window in [ scha97 ] for the minimum sized detector . the upper and lower boundaries 131 and 132 , respectively , are the same as 81 , 82 in fig8 although mapped onto the virtual planar detector . in the most likely physical embodiment of the 2d - detector arrangement proposed in this invention , the detector elements are placed onto the source cylinder 41 . see fig2 . for moderate cone angles the detector elements are then facing the incoming rays rather straight on . for detectors made to cover high cone angles it might be more appropriate to mount the detector elements on the inside of a sphere centered in s . this would guarantee or at least make it more easy to secure that all detectors are facing the incoming rays correctly . fig1 shows again the detector window 11 on the helix cylinder rolled out on the plane of the sheet . however , this time it is overlaid with the same the detector window mapped onto the source cylinder arc 41 . when rolled out on the sheet , this latter detector appears in fig1 outlined as 141 . considering the geometry of fig4 it might be more optimal to place the detector on the source cylinder arc 43 having the smallest possible radius close up to the object cylinder 13 . however , since the geometry of such a detector would conform exactly with 141 , we may discuss the geometry of 141 without loss of generality . the detector 141 coincides with 11 in the middle but varies with γ so that the top - most and bottom - most point of the detector are found at z top = v ω   r  π + 2  γ cos   γ  and   z bottom = v ω   r  π - 2  γ cos   γ , ( 4 ) respectively . the height h is then varying as h  ( γ ) = z top + z bottom = v ω   r  2  π cos   γ = h cos   γ ( 5 ) where h is the pitch as before . thus , data which are captured on the source cylinder have to be resampled from the unevenly sloping detector area in fig1 to the grid of the detector ( also shown in fig1 ), defined by vertical lines and evenly sloping lines with rhombus shaped detector elements . when projection data are resampled once more into parallel projections on the planar virtual detector in fig5 the final grid pattern will be perfectly rectangular . an important special case for the present invention is when the detector 141 ( and the pitch ) of fig1 is reduced in height to a single row 150 of detector elements 151 , which is shown in fig1 . we note that also in this special case will the height of the detector element increase with increasing fan angle as predicted by the above formula ( 5 ). normally , the detector array in fig1 would no longer be considered as a two - dimensional detector but a one - dimensional array detector . one - dimensional array detectors are used in existing helical fan - beam tomographs for which the state - of - the - art is represented by [ king93 ]. the detector is normally placed on the surface of a source cylinder 41 although not designed as the one in fig1 . instead , the detector elements are of constant height and they are not placed in a slanted fashion but horizontally straight on the source cylinder surface . as a consequence , to secure sufficient data , either the height of the detector elements have to be increased , as in formula ( 3 ) which decreases the resolution in the z - direction , or the pitch of the helix has to be decreased with the same factor , which reduces the scanning efficiency and increases the dose compared to the present invention . the scanning will also acquire much redundant data so that the accompanying reconstruction procedure has to employ elaborate weighting factors to compensate for multiple exposure . using the present invention with a detector designed and arranged accordingly , for instance as in fig1 , the data capture will be complete and free of redundancy and the reconstruction procedure can be simplified to contain the three steps rebinning , one - dimensional ramp filtering , and backprojection with constant magnification factor . all references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes . [ dan97a ] p . e . danielsson , “ förfarande och anordning för tomografering ”, swedish patent application no 9700072 - 3 , filed jan . 14 , 1997 . [ dan97b ] p . e . danielsson , paul edholm , jan eriksson , maria magnusson seger , “ towards exact 3 d - reconstruction for helical scanning of long objects ” , conf . record from 1997 int . meeting on fully three - dimensional image reconstruction , nemacollin , p a , jun . 25 - 28 , 1997 . [ feld84 ] l . a . feldkamp , l . c . davis , j . w . kress , “ practical cone beam algorithms ” , journal of optical soc . am . vol . a6 , pp . 612 - 619 , 1984 . [ wang93 ] g . wang , t . h . lin , p . c . cheng , d . m . shinozaki , “ a general cone - beam reconstruction algorithm ” , ieee trans . on medical imaging , vol . 12 pp . 486 - 496 , 1993 . [ scha96 ] s . schaller , t . flohr , p . steffen , “ a new approximate algorithm for image reconstruction in cone - beam spiral ct at small cone angles ” , conference record , ieee medical imaging conference , pp . 1703 - 1709 , november 1996 , anaheim , calif . [ scha97 ] s . schaller , t . flohr , p . steffen , “ new efficient fourier - reconstruction method for approximate image reconstruction in spiral cone - beam ct at small cone angles ” , to be published in proc . spie med . imaging conf ., newport beach , calif ., feb . 22 - 28 , 1997 . [ tam95 ] k . c . tam , “ three - dim . computerized tomography scanning method and system for large objects with smaller area detectors ” , u . s . pat . no . 5 , 390 , 112 , feb . 14 , 1995 . [ eber95 ] j . w . eberhard ; k . c . tam , “ helical and circle scan region of interest computerized tomography ” , u . s . pat . no . 5 , 463 , 666 , oct . 31 , 1995 . [ gra87 ] p . grangeat , “ mathematical framework of cone - beam 3 d reconstruction via the first derivative of the radon transform ” , in “ mathematical methods in tomography ” , g . t . herman , a . k . luis , f . natterer ( eds ), lecture notes in mathematics , springer , 1991 . [ king93 ] k . f . king , a . h . lonn , c . r . crawford , “ computed tomographic image reconstruction method for helical scanning using interpolation of partial scans for image construction ” , u . s . pat . no . 5 , 270 , 923 , dec . 14 , 1993 .	0
in fig1 there is shown a front view illustration of a multipoint recorder embodying an example of the present invention and having an ink cartridge , or wheel , 2 arranged on an ink cartridge carriage 4 for movement across a recording medium ( not shown ) along a recording line . a recording head 6 is located on a recording head carriage 8 which is also arranged to be driven across the recording medium along the recording line . the recording head 6 with the recording head carriage 8 and the ink cartridge 2 with the ink cartridge carriage 4 are located on opposite sides of the recording medium , e . g ., the ink cartridge carriage 4 may be located on the side of the recording medium facing an operator while the recording head carriage 8 can be located on the hidden , or rear side , of the recording medium . the ink cartridge carriage 4 is slidably supported on a guide rail 10 to enable the ink cartridge carriage 4 to be moved across the recording medium . similarly , the recording head carriage 8 is slidably supported on a guide rail 12 whereby the recording head carriage 8 may be moved across the recording medium . the recording head 6 is connected by a multiconductor cable 14 to any suitable means ( not shown ) for selectively energizing the recording pins in the recording head 6 to produce a desired recording on the recording medium . such recording heads are well - known in the art , e . g ., the alpha - numeric recording head manufactured by hydra corp . of mountain view , ca ., and a further discussion thereof is believed to be unnecessary . the guide rails 10 and 12 are monted between a pair of parallel end plates 16 and 18 which define the width of the recorder and provide support for the various elements of the recorder , as hereinafter described . the recording carriage 8 is connected to a first drive cable 20 which is selectively driven to move the recording head carriage 8 along the guide rail 12 . the drive cable 20 is supported in a closed loop configuration by guide rollers 22 , 24 and 26 mounted on the end plates 16 and 18 . additionally , the ends of the drive cable 20 are attached to a drive drum 28 mounted on an output shaft of a motor 30 mounted on a shelf 31 located between the end plates 16 , 18 . the ends of the drive cable 20 are attached to the drive drum 28 after a sufficient number of turns of the drive cable 20 on the drum 28 to provide for a cable reserve adequate to drive the recording head carriage 8 from one side of the recording medium to the other . the ink cartridge carriage 4 is driven by a second cable system using a second drive cable 32 and a third drive cable 34 . a pair of pulleys 36 and 38 are coaxially mounted on the ink cartridge carriage 4 by means of a support shaft 40 and respective one - way clutches ( not shown ) located within each of the pulleys 36 , 38 to connect the pulleys 36 , 38 to one end of the shaft 40 . the shaft 40 is arranged to pass through the ink cartridge 4 to drive a first one of a pair of meshed bevel gears 42 , 44 . the bevel gears 42 , 44 change the drive direction from the axis of the shaft 40 connected to a first bevel gear 42 to the axis of a shaft 46 connected to a second bevel gear 44 and located at a 90 ° angle with respect to the axis of the shaft 40 . the ink cartridge 2 is attached to the shaft 46 and is arranged to rotate therewith . the ink cartridge 2 includes a plurality of ink supply layers containing respective ink colors separated by ink impervious separators as more fully described hereinafter with respect to fig5 . the cartridge 2 is arranged to contact the recording medium on the opposite side thereof from the recording head 6 whereby the selective energization of the recording head 6 is arranged to drive the recording medium into contact with a corresponding one of the ink containing layers previously aligned with the recording head 6 to produce a record mark on the recording medium . a first drive cable 32 is disposed around the pulley 38 and has one end attached to a second drive drum 50 coaxially located on the output shaft of the motor 30 adjacent to the first drive drum 28 . however , the diameter of the second drive drum 50 is arranged to be twice that of the first drive drum 28 as discussed hereinafter . the length of the drive cable 32 between the drive drum 50 and the pulley 38 is supported by a pair of guide rollers 52 and 54 mounted on the end plate 16 . the other end of the drive cable 32 is attached to a third drive drum 55 which is mounted on a shaft 56 . the length of the cable 32 between the pulley 38 and the drive drum 55 is supported by a pair of guide rollers 57 , 59 . the shaft 56 is driven by a coaxial gear 58 which , in turn , is driven by a worm gear 60 . the worm gear 60 is mounted on an output shaft of a second drive motor 62 . the second drive cable 34 is similarly connected at one end to the second drive drum 50 and is supported between the second drive drum 50 and the pulley 36 by a guide roller 64 mounted on the end plate 18 . the other end of the second drive cable 34 is connected to a fourth drive drum 66 coaxially arranged with the third drive drum 54 on the shaft 56 . a pair of guide rollers 68 and 70 mounted on the end plate 18 are arranged to support the cable 34 between the pulley 36 and the fourth drive drum 66 . such clutches are well - known in the art such as the roller clutch manufactured by the torrington co ., torrington , conn . a code wheel 72 for providing a representation of the position of the shaft 56 is also coaxially mounted above the drive drums 54 and 66 on the shaft 56 . a code wheel sensor 74 is arranged adjacent to the code wheel 72 to sense its operation . the code wheel 72 and sensor 74 may each be any suitable prior art device , such devices being well - known in the art . a plurality of recording medium support rollers , e . g ., rollers 76 and 78 , are also supported between the end plates 16 and 18 to define a recording medium path as shown in fig5 . a recording medium drive includes a drive motor 80 mounted on the end plate 16 and arranged to drive support roller 76 and paper supply and take - up reels 82 and 84 , as shown in fig3 by suitable flexible belts 86 , 88 and 90 which are driven from a drive pulley 92 . a roll of the recording medium 94 is shown in diagrammatic form in fig3 on reel 82 . the detailed showing of the path taken by the recording medium 94 is shown in diagrammatic form in fig4 and is provided for the purpose of illustrating the specific tape path between the tape reels 82 and 84 and the passage between the recording head 6 and the ink cartridge 2 . the motors 30 , 62 , and 80 and the code wheel sensor 74 are all connected to a drive control means 96 mounted on the shelf 31 as shown in illustrative form in fig1 and 2 . the drive control means 96 may be any suitable prior art electrical control for selectively energizing the recording medium drive motor 80 to drive the recording medium 94 , for selectively energizing the drive motor 34 to drive the combination of the recording head 6 and ink cartridge 2 across the recording medium in response to an input signal to position the recording head 6 at a point along the recording line on the recording medium at which a recording is desired , and for selectively energizing the recording head 6 when the recording point along the recording line is reached . additionally , the drive control means is used to selectively energize the drive motor 62 to effect a reorientation of the recording head 6 and a desired one of the ink carrying layers on the ink cartridge 2 to produce a color change of the recording . the details of the drive control 96 , are conventional , and a detailed discussion thereof is believed to be unnecessary in order to provide an understanding of the present invention . thus , the drive control 96 may include well - known circuits for comparing the position of the recording head 6 as determined by the position of the drive motor 30 with an input signal to be recorded applied on a input cable 97 whereby the amplitude if the input signal is recorded on the recording medium 94 at a point represented by an amplitude scale on the recording medium 94 . such a null - balance drive of a recording element along a recording medium is well - known in the art , e . g ., the recorder shown in u . s . pat . nos . 3 , 576 , 582 and 2 , 427 , 480 . further , the energization of the paper drive motor 80 to drive the recording medium either continuously or incrementally is also well - known in the art as shown in the aforesaid patents . finally , the selective drive of the color change motor and the sensing of the position of the code wheel by means of the sensor 74 during a color change operation involving a selectively reorienting of the ink cartridge 2 and recording head 6 by the illustrated example of the present invention is also performed by any suitable well - known electrical circuits in response to an input control signal indicative of the need for a color change . for example , a digitally coded control signal could be selectively applied to the input cable 97 to order a color change . the digital code sensed by the sensor 74 from the code wheel 72 is compared by the drive control 96 to the control signal by any suitable code comparator . a motor drive signal is produced in response to this comparison operation and is applied to the drive motor 62 until a code comparison indicates that the desired color position has been attained . at this time , the color change motor drive signal would be terminated until the next color change operation . the one - way drive relationship of the worm gear 60 and the gear 58 would mechanically maintain the desired recording color position . in fig5 there is shown a detailed representation of ink cartridge 2 which is mounted on the ink cartridge carriage 4 for linear movement therewith along guide rail 10 and for rotation on shaft 46 in response to the differential operation of the pulleys 36 , and 38 . the ink cartridge 2 includes a plurality of concentric ink filled layers 98 , 100 , 102 , 104 , 106 and 108 . these ink filled layers may each contain a respective color of recording ink . the ink layers 100 , etc . are separated from each other by ink impervious spacers , or washers , for example , the ink layer 98 is separated from ink layer 100 by spacer 110 . thus , the spacers are effective to prevent migration of ink from one layer to another . the spacers may be made of aluminum , while the ink layers may be any suitable ink - retaining material in a washer - shaped configuration , e . g ., the microporous material identified as day - flo # 175 manufactured by the dayco corp . of dayton , ohio . the spacers and ink layers are attached together by any suitable means , e . g ., rivets , and attached to the shaft 46 to be rotated therewith . thus , the rotation of the ink cartridge 2 by the shaft 46 is effective to spread the wear and ink utilization of the printing operation around the entire periphery of each of the ink layers . the shaft 46 is rotated by the bevel gears 42 , 44 which , in turn , are driven by the shaft 40 and pulleys 36 , 38 . since the pulleys 36 , 38 have one - way clutches therein arranged for opposite clutching operation , only one of the pulleys 36 , 38 is effective to drive the shaft 40 at any time since the pulleys 36 and 38 are always rotated in opposite directions by the drive cables 32 , 34 . however , the shaft 40 and ink cartridge 2 are always driven in the same direction since the one - way clutches convert the opposite motion of the pulleys 36 , 38 to a single direction of rotation of the shaft 40 . in operation , the recorder apparatus of the present invention is effective to concurrently drive the recording head 6 and the color cartridge 2 across a recording medium along a recording line to produce a recording thereon . additionally , the recording medium is driven between a supply reel and a take up reel by a recording medium drive system . further , the orientation of the recording head 6 with the ink layers in the color cartridge 2 is selectively alterable to change the color of the recorded mark on the recording medium . specifically , the recording medium drive motor 8 is energized by the drive control means 96 to drive the recording medium past the recording head 6 and the ink cartridge 2 as shown in fig4 . assuming that a single color is to be used for the recording , the recording head 6 is oriented with the desired ink layer in the ink cartridge 2 by a selective energization of the color change motor 62 . this energization of the motor 62 is continued until the detection of the code wheel 70 produces an indication to the drive control means 96 that the desired color orientation has been achieved . in other words , the motor 62 is energized in the desired direction to drive the worm gear 60 , which , in turn , drives the gear 58 and the pulleys 55 and 66 . since the one end of each of the drive cables 32 and 34 is attached to a respective one of the pulleys 55 and 66 , i . e ., one end of the drive cable 32 is attached to pulley 55 and one end of the drive cable 34 is attached to pulley 66 , this rotation of the pulleys 55 and 66 is effective to roll - up one of the drive cables on the corresponding one of the pulleys and pay - out the other of the drive cables from the corresponding one of the pulleys 55 , 66 . since the drive cables 32 and 34 pass around the pulleys 36 and 38 , this lengthening and shortening of the drive cables 32 , 34 is effective to move the ink cartridge carriage 4 on the guide rail 10 in the direction of the shortening cable . further , this movement is achieved without moving the recording head carriage 6 whereby a reorientation of the recording head with an ink layer on the ink cartridge 2 is achieved . when the desired ink layer on the ink cartridge 2 has been selected as sensed by a detection of the position of the code wheel 70 , the energization of the motor 62 is terminated . a selection of a position for the recording on the recording medium is achieved by an energization of the motor 30 which is effective to concurrently drive the recording head carriage 8 and the ink cartridge carriage 4 across the recording medium while maintaining a selected orientation of the recording head 6 and an ink layer in the ink cartridge 2 . in other words , since the worm gear drive of the pulleys 55 and 66 is effective to maintain the selected position thereof during a non - energized state of the motor 62 , the energization of the motor 30 is effective to roll - up and to pay - out the drive cables 32 and 34 therefrom inasmuch as these cables have their other ends attached to the drum 50 . this lengthening and shortening of the cables 32 and 34 is again effective to move the ink cartridge carriage 4 on the guide rails 10 . however , during this ink cartridge carriage motion induced by the drive motor 30 , the recording head carriage 8 is concurrently moved on guide rail 12 by the paying - out and rolling - up of the drive cable 20 on the drum 28 inasmuch as the ends of the drive cable are attached to the drum 28 . since the lengthening and shortening of these drive cables 32 and 34 has to achieve the same degree of motion as the drive induced by the cable 20 to maintain a selected recording head and print head orientation , the diameter of the drum 50 is arranged to be twice the diameter of the drum 28 to compensate for the two cable action producing the motion of the ink cartridge carriage 4 . it should be noted that during either the color selection operation or the recording operation , the rotation of the pulleys 36 and 38 is effective to rotate the ink cartridge 2 to distribute the recording wear on the ink layers , as previously discussed . such a rotation also allows an ink reflow to provide replenishment of the ink at the surface of each ink layer . it should also be noted that the layers may be of different widths to offset an unequal use of a particular color by spreading the recording wear across the respective layer width and periphery . further , the selection of an ink layer in the color cartridge 2 and the motion of the recording head 6 to a new recording position may be achieved concurrently by a concurrent energization of the drive motors 30 and 62 . additionally , since such a matrix recording head is capable of multi - symbol recording , the recorder may use a bi - directional recording medium drive for producing either real - time or historical displays of graphs , charts , block diagrams , etc . finally , while the illustrative example of the invention shown herein uses a null - balance recording technique , other recording techniques such as a scan , or on - the - fly , recording , wherein the recording head is simply driven across the recording medium and a recording effected at the appropriate place , may also be used without departing from the scope of the present invention . accordingly , it may be seen that there has been provided , in accordance with the present invention , a multipoint recorder having multicolor capabilities with a simplified recording head structure and drive system for the recorder .	6
referring to fig1 cylindrical wall 10 of single wall storage tank 12 is comprised of rolled metal sheet 14 and rolled metal sheet 16 . both rolled metal sheets 14 and 16 are formed by cutting a rectangular piece of metal and rolling the metal until two opposite butted ends 18 come together to form a ring . butted ends 18 are welded together by weld joint 20 . rolled metal sheet 14 has a joggle joint rolled end 22 and an outside end 28 . the formation of a joggle joint rolled end 22 is discussed below . rolled metal sheet 16 has an inside end 24 and an outside end 28 . when rolled metal sheets 14 and 16 are assembled , joggle jointed rolled end 22 is welded to inside end 24 , thus forming joggle joint 26 . attention is drawn to the non - alignment of butt - welded joints 20 of rolled metal sheets 14 and 16 . the purpose of non - alignment of butt - welded joint 20 is to increase the strength of single wall storage tank 12 . rolled metal sheets 14 and 16 are comprised of a special ferrous alloy which provides fire - resistant support to single wall storage tank 12 . the ferrous alloy has a maximum of approximately 0 . 15 % carbon and a maximum of approximately 0 . 8 % manganese . the maximum limits on carbon and manganese is to limit the brittleness of the alloy . a brittle alloy will not as effectively withstand the stresses placed on the tank when exposed to an elevated temperature . in the preferred embodiment , the ferrous alloy also has a maximum of approximately 0 . 04 % phosphorous , and a maximum of approximately 0 . 05 % sulfur . attention is drawn to the fact that this ferrous alloy composition is not a standard composition . the closest structural grade steel available to this composition is astm a 36 , which has a carbon percent maximum of approximately 0 . 25 %. referring now to fig2 and 3 , an assembled single wall storage tank 12 is comprised of cylindrical wall 10 and storage tank end panels 30 . storage tank end panels 30 are cut from the same metal as used for rolled metal sheets 14 and 16 . storage tank end panels are cut and flanged and attached to outside ends 28 forming joint 32 . in the preferred embodiment , joints 32 are joggle joints . the thickness of rolled metal sheets 14 and 16 and storage tank end panels 30 are based on the size of the tank . table i , plate thickness chart for single wall fire - resistant tanks , lists the plate thickness for various size tanks . the thickness of the steel is critical to the invention . when the tank is heated to over 1000 ° f ., the outside of the steel becomes porous forming a protective &# 34 ; skin .&# 34 ; as a result , the steel sheet must be thick enough and be of a consistent quality to allow the &# 34 ; skin &# 34 ; to form and have enough mass to support the skin and to provide maintain the integrity of single wall storage tank 12 . further , the thickness affects the performance of the assembly when exposed to high temperatures by allowing for increased expansion without fatal stresses that result in tank rupture . table i______________________________________single wall fire - resistant tanksplate thickness chartgallons size plate thickness______________________________________ 300 38 &# 34 ; × 5 &# 39 ; 10 ga . 550 48 &# 34 ; × 6 &# 39 ; 10 ga . 1 , 000 48 &# 34 ; × 12 &# 39 ; 10 ga . 1 , 000 64 &# 34 ; × 6 &# 39 ; 10 ga . 2 , 000 64 &# 34 ; × 12 &# 39 ; 7 ga . 3 , 000 64 &# 34 ; × 18 &# 39 ; 7 ga . 4 , 000 64 &# 34 ; × 24 &# 39 ; 7 ga . 5 , 000 8 &# 39 ; × 14 &# 39 ; 1 / 4 &# 34 ; 6 , 000 8 &# 39 ; × 16 &# 39 ; 1 / 4 &# 34 ; 8 , 000 8 &# 39 ; × 21 &# 39 ; 1 / 4 &# 34 ; 10 , 000 8 &# 39 ; × 27 &# 39 ; 1 / 4 &# 34 ; 10 , 000 9 &# 39 ; × 21 &# 39 ; 1 / 4 &# 34 ; 12 , 000 9 &# 39 ; × 25 &# 39 ; 1 / 4 &# 34 ; 15 , 000 9 &# 39 ; × 32 &# 39 ; 1 / 4 &# 34 ; 20 , 000 10 &# 39 ; × 34 &# 39 ; 1 / 4 &# 34 ; 30 , 000 10 &# 39 ; × 51 &# 39 ; 1 / 4 &# 34 ; ______________________________________ single wall storage tank 12 also comprises welded couplings 34 and tank skids 36 . fig2 and 3 depict couplings 34 on the top of single wall storage tank 12 . however , couplings can be placed where desired , depending on the application for which single wall storage tank 12 is used . tank 12 is supported by skids 36 . in the preferred embodiment , there are two skids 36 which run longitudinally on the bottom of single wall storage tank 12 . skids 36 on single wall storage tank 12 perform multiple functions . skids 36 stabilize the tank 12 during its normal use . skids 36 provide structural support to single wall storage tank 12 as the temperature of the tank increases and the &# 34 ; skin &# 34 ; develops . the structural strength of single wall storage tank 12 diminishes as the temperature of the tank increases beyond 1000 ° f . skids 36 help give structural support to the steel in this temperature range . in the preferred embodiment , skids 36 have a similar coefficient of expansion as tank 12 , thereby expanding at a similar rate as tank 12 when exposed to elevated temperatures , further reducing the chance of tank rupture . now referring to fig4 skid 36 has a generally u - shaped cross section comprising a base 38 , short vertical member 40 , and tall vertical member 42 . generally , skid 36 is designed such that single wall storage tank 12 rests on both short vertical member 40 and tall vertical member 42 , as is shown in fig3 . short vertical member 40 is at an angle 44 from base 38 . in the preferred embodiment , angle 44 is approximately 100 °. similarly , tall vertical member 42 , which is taller than short vertical member 40 , is at an angle 46 from base 38 . in the preferred embodiment , angle 46 is approximately 100 °. extending from the top of tall vertical member 42 is tank resting element 48 . tank resting element 48 is a band of metal which extends the entire length of tall vertical member 42 . tank resting element 48 makes angle 50 with the outside surface of tall vertical member 42 . in the preferred embodiment , angle 50 is approximately 142 °. tank resting element 48 has an upper surface 52 , which , along with edge 54 of short vertical member 40 , comprises the two points upon which single wall tank 12 rests . this configuration of skids 36 allows two parallel skids to be placed equally distant from the center of single wall tank 12 and supports single wall tank 12 . referring to fig5 double wall storage tank 60 is comprised of a secondary containment tank 62 and a product storage tank 64 . double wall storage tank 60 is fabricated in the same manner as single wall storage tank 12 , except that product storage tank 64 is nested inside secondary containment tank 62 . in the preferred embodiment , the diameter of secondary containment tank 62 is a half inch larger than the diameter of product storage tank 64 . additionally , secondary containment tank 62 has a length which is four inches longer than the length of product storage tank 64 . these differences in diameter and length allow for expansion and contraction without rupturing either secondary containment tank 62 or product storage tank 64 . additionally , the chance of tank rupture caused by thermal expansion is reduced by fabricating secondary containment tank 62 and product storage tank 64 from metal sheets having similar coefficients of expansion , so that both tanks expand at similar rates when exposed to elevated temperatures . in order to maintain structural integrity during elevated temperatures , the walls of both secondary containment tank 62 and product storage tank 64 , which are listed on table ii , plate thickness chart of double wall fire resistant tanks . table ii______________________________________double wall fire - resistant tanksplate thickness chart plate thickness secondary product containmentgallons size storage tank tank______________________________________ 300 38 &# 34 ; × 5 &# 39 ; 7 ga . 10 ga . 550 48 &# 34 ; × 6 &# 39 ; 7 ga . 10 ga . 1 , 000 48 &# 34 ; × 12 &# 39 ; 7 ga . 10 ga . 2 , 000 64 &# 34 ; × 6 &# 39 ; 7 ga . 10 ga . 3 , 000 64 &# 34 ; × 18 &# 39 ; 7 ga . 10 ga . 4 , 000 64 &# 34 ; × 24 &# 39 ; 7 ga . 10 ga . 5 , 000 8 &# 39 ; × 14 &# 39 ; 1 / 4 &# 34 ; 7 ga . 6 , 000 8 &# 39 ; × 16 &# 39 ; 1 / 4 &# 34 ; 7 ga . 8 , 000 8 &# 39 ; × 21 &# 39 ; 1 / 4 &# 34 ; 7 ga . 10 , 000 8 &# 39 ; × 27 &# 39 ; 1 / 4 &# 34 ; 7 ga . 10 , 000 9 &# 39 ; × 21 &# 39 ; 1 / 4 &# 34 ; 7 ga . 12 , 000 9 &# 39 ; × 25 &# 39 ; 1 / 4 &# 34 ; 7 ga . 15 , 000 9 &# 39 ; × 32 &# 39 ; 1 / 4 &# 34 ; 7 ga . 20 , 000 10 &# 39 ; × 34 &# 39 ; 1 / 4 &# 34 ; 7 ga . 30 , 000 10 &# 39 ; × 51 &# 39 ; 1 / 4 &# 34 ; 7 ga . ______________________________________ double wall storage tank 60 has couplings 66 mounted through secondary containment tank 62 to product storage tank 64 . as in single wall storage tank 12 , couplings 66 are found on the top of double wall storage tank 60 , but can be located anywhere depending on the use of the tank . double wall storage tank 60 also rests up and is supported by skid 70 . other embodiments of the invention include a double wall multiple product tank , with double bulk heads ( not shown ) welded inside the primary storage tank or multiple primary storage tanks nested inside a secondary containment tank ( not shown ). an additional embodiment of the invention includes a single wall multiple product tank with double bulk heads ( not shown ) welded inside the tank . now referring to fig6 skid 70 comprises belly bands 72 , vertical support members 74 , 45 ° support members 76 , horizontal members 78 , and angle member 80 . belly bands 72 are constructed of a curved band of steel that conforms to the underside of double wall storage tank 60 , thus stabilizing it . belly bands 72 have belly bands ends 82 which are supported by vertical support members 74 . vertical support members have an upper end 84 and a lower end 86 . upper end 84 is adjacent to the convex surface of belly band 72 near belly band end 82 , respectively . lower ends 86 are directly below upper ends 84 and are on the ends of horizontal member 78 at a 90 ° angle to horizontal member 78 . horizontal member 78 is a flat band of metal that extends between lower ends 86 of each belly band 72 and upon which the center of belly band 72 rests . belly bands 72 are also supported by 45 ° support members 76 . 45 ° support members 76 are flat bands of steel which extend at a 45 ° angle to horizontal member 78 and extend from lower end 86 to the convex surface of belly bands 72 , respectively . to further support belly bands 72 , the corner formed from vertical member 74 meeting horizontal member 78 rests in the inside angle 90 of angle support 80 . an angle support 80 runs along each side of secondary containment tank 62 , providing additional support to structures which support belly bands 72 . angle support 80 is illustrated with a gap to represent that angle 80 extends between belly bands 72 regardless of how far apart they are . further , skids of other embodiments of the invention may have more than two belly bands 72 to sufficiently support longer or heavier tanks . additionally , skid 70 performs the similar functions as skid 36 . the single wall storage tank 12 and double wall storage tank 60 are constructed per ul 142 -- standard for steel aboveground tanks for flammable and combustible liquids . all joints are either butt weld joints 94 or joggle joints 94 . butt weld joints 96 are so named because the weld 96 fuses edges of plates that &# 34 ; butt &# 34 ; up against each other . in the present invention , a weld is made by welding both sides with a hot gas metal arc welder to ensure complete and thorough fusion . when using the hot gas metal arc welder , the gas shield is carbon dioxide . additionally , the wire feed for the hot gas metal arc welder is an aws e71t - 1 class , titania type flux cored wire designed for use with 100 % carbon dioxide gas shielding , the wire in the preferred embodiment having a typical composition of approximately 0 . 05 % carbon and approximately 1 . 28 % manganese . however , the wire can have a maximum of approximately 0 . 15 % carbon and a maximum of approximately 1 . 4 % manganese , of which excess manganese will be burnt off due to excess heat used during welding . further , in the preferred embodiment , the wire has approximately 0 . 05 % carbon , 1 . 28 % manganese , 0 . 50 % silicon , 0 . 013 % phosphorus , and 0 . 009 % sulfur . further , the amperage used during welding is 180 to 220 amps . also of importance is the relative tensile strength , yield strength , coefficient of expansion , and composition of the steel alloy in relation to the weld metal . all the joints in tanks 12 and 60 which are not butt weld joints are joggle joints . unlike a butt weld joint , in joggle joint , an edge overlap portion one overlaps an edge portion of another plate 112 . further , weld 120 , which fuses joggle joint 94 together , is between edge 122 of plate 112 and plate 114 such that surface 124 , which is on the opposite side of plates 112 and 114 from edge overlap portion 116 , is substantially flat . a submerged arc welder is used to weld all joggle joints 94 . additionally , and l 61 wire is used with a 761 flux and the amperage used during welding is 225 to 280 amps . as per ul 142 , the tank is pressure tested by soaping all the welds , observing any leaks while the tank is under pressure , and rewelding when necessary . the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof , and accordingly , reference should be made to the appended claims , rather than to the foregoing specification , as indicating the scope of the invention .	1
the detection device in accordance with the invention includes a transmitter unit 11 which has a laser diode 25 serving as a radiation source and an optical transmission system 27 in the form of a lens or a lens arrangement disposed in front of the laser diode 25 . furthermore , a receiver unit 13 is provided which has an areal radiation receiver 29 which is formed , for example , by photodiodes arranged in a line and in front of which an optical reception device 31 , formed for example by a lens , is disposed . a prism 15 , which serves as a radiation deflection device and has a planar reflection surface 19 facing the transmission / reception plane , is rotatable continuously at a constant speed about an axis 23 extending perpendicular to the transmission / reception plane . for this purpose , the prism 15 is connected to a drive unit 33 . for certain vehicle applications , a scanning frequency of 10 hz , i . e . of 10 scans per second covering 360 ° in each case , and an angular resolution of at least 1 ° are required . here , the laser diode 25 must produce radiation pulses with a frequency of 3600 hz for an angular resolution of 1 °. the laser diode 25 of the scanner in accordance with the invention works with a pulse frequency of 14 , 400 hz , whereby an angular resolution of 0 . 25 ° is achieved . the optical transmission system 27 provides a fan - like widening or expansion of the radiation produced by the laser diode 25 such that the front 17 of the radiation propagating in the direction of the reflection surface 19 is of line shape and consequently , in the rotational position of the deflection device 15 in accordance with fig1 a and 1 b , a radiation line 17 ′ is transmitted into the monitored zone which stands perpendicular to the transmission / radiation plane . the orientation of the radiation front 17 ′ reflected into the monitored zone changes on rotation of the prism 15 relative to the transmitter unit 11 and to the receiver unit 13 , and thus relative to the elongated radiation front 17 propagating in the direction of the reflection surface 19 ; i . e . the light line 17 ′ rotates with the prism 15 . fig2 a and 2 b show the other extreme case with the deflection device 15 rotated by 90 ° with respect to the position of fig1 a and 1 b . the radiation front 17 still having the same orientation between the transmitter unit 11 and the reflection surface 19 is transmitted , as a result of the changed orientation of the reflection surface 19 extending in an inclined manner to the transmission / reception plane , as a radiation line 17 ′ into the monitored zone which lies in a plane extending parallel to the transmission / reception plane . the light line 17 ′ transmitted into the monitored zone has a more or less strongly inclined position in the intermediate rotational positions ( not shown ) of the prism 15 . the detection device in accordance with the invention is preferably used in connection with a vehicle for object recognition and object tracking . in this connection , the detection device is preferably attached in or on the vehicle such that the transmission / reception plane extends horizontally , i . e . perpendicular to the vertical axis of the vehicle , in normal driving operation , i . e . with a horizontally oriented vehicle , and the upright light line or streak 17 ′ in accordance with fig1 a and 1 b is transmitted to the front in the direction of travel of the vehicle . the division of the radiation receiver 29 of the receiver unit 13 into a plurality of individual receivers allows a separate evaluation of different regions of the light line or streak reflected onto the receiver 29 and thus the detection of contour profiles of the respectively scanned objects . with this application , the regions disposed to the side of the vehicle are scanned with a horizontally extending radiation front , i . e . with a lying light line , such that — in contrast to the scanning to the front in the direction of travel — no height information is gained . however , since information from regions disposed in front of the vehicle in the direction of travel is of very high relevance in most vehicle applications , this circumstance can be accepted without problem in practice , especially since a light line which is lying and extends parallel to a plane extending perpendicular to the axis of rotation 23 of the deflection device 15 provides the advantage of a multiple scan at least for specific vehicle applications . the light line , which is lying or is disposed in the scanning plane , moreover advantageously allows a reduction in the scanning frequency , since a plurality of measuring points disposed next to one another are measured with it at the same time . the scanning frequency can thus be reduced by a factor corresponding to the number of measuring points . the optoelectronic detection device shown in fig3 is likewise a laser scanner . it comprises a laser module 147 , which includes a laser chip , and has a connection 149 , the laser module serving as a linear radiation source , a projection lens 143 serving as a transmitting lens , a mirror 133 rotatable about an axis 139 by means of a motor 131 and a receiver unit which includes a receiver lens 145 surrounding the projection lens 143 and a receiver member having an areal radiation receiver in the form of a diode array which has a one - row arrangement of a plurality of photodiodes . the mirror sub - assembly is arranged in a glass tube 141 . the angular position of the mirror 133 is determined by means of an encoder disk 137 and an angular measuring device 135 . the radiation 155 transmitted by the transmitter unit , exiting the glass tube 141 after reflection at the mirror 133 and entering into the monitored zone , is again guided — after reflection in the monitored zone as incident radiation 153 — via the mirror 133 onto the receiver lens 145 and from this onto the diode array of the receiver member 151 . fig4 shows the diode array 121 of the receiver member 151 which consists in this example of eight avalanche photodiodes 113 arranged in a row and serving as an areal radiation receiver . the individual diode elements 113 are separated from one another by webs 119 at which the receiver 121 is “ blind ”. the diode array 121 protected by a glass window 111 is arranged in a housing 115 provided with connector pins 117 . a separate amplifier ( not shown ) is connected to each individual diode 113 so that a separate distance measurement can be carried out for each field of view corresponding to one of the individual diodes 113 . the amplifiers are connected to a common evaluation unit ( not shown ). fig5 schematically shows the laser chip 147 of the transmitter unit which has a p - n junction 123 serving as a linear radiation source . a projection lens 143 is disposed in front of the laser chip 147 . the transmitter unit of laser module 147 and transmitter lens 143 generates a radiation line or light streak 127 as a projected image of the linear radiation source 123 . the expanded radiation propagating as a radiation line , i . e . the elongated radiation front transmitted by the transmission unit 143 , 147 , strikes the inclined mirror 133 , which rotates with respect to the stationary transmitter / receiver unit , and is reflected out of the tube 141 into the monitored zone in an orientation dependent on the rotational position of the mirror 133 . fig6 shows the projected scanned image of the detection device in accordance with the invention for a complete revolution of the rotating mirror 133 including a horizontal angle of 360 °. the image 165 of the line - like laser source 123 is rotated once about itself with respect to the horizon 161 in a mirror rotation due to the rotating mirror 133 , whereby a sinusoidal expansion with an envelope 169 is created , with the sinusoidal curve defining the effective height of the light line . with a laser scanner installed on a vehicle , this is aligned such that the antinodes of the sinusoidal expansion are directed to the front in the direction of travel and in the backward direction such that , in these directions , an expansion of the radiation takes place in the vertical direction which is advantageous for at least most vehicle applications ; i . e . the vehicle environment is scanned to the front and rear with a large vertical angle . in fig6 the position of a region 167 of the projected line image 165 corresponding to one of the eight diode elements 113 is shown for different orientations of the line image 165 to illustrate the movement of this part of the overall line - shaped visual field during the scanning operation . the continuously changing orientation of the line - shaped image 165 of the linear radiation source 123 in the monitored zone is taken into account in the evaluation of the received radiation 153 by means of the evaluation unit connected to the receiver member 151 , with said image 165 always being imaged on the diode array 121 which is stationary and thus always having the same orientation in the scanner .	6
as illustrated in fig1 , and 6 , a door lever assembly 10 includes a lever handle 12 rotatably connected to a trim housing 16 . mounting studs 14 extending from the trim housing 16 are used to attach the trim housing 16 to a door 11 . the lever handle 12 and trim housing 16 are of conventional design and operation . in its unlocked position , turning the lever handle 12 of the door lever assembly 10 results retraction or extension of door latches 61 of a door latch assembly 60 . the door latch assembly 60 includes vertical rods 62 that are indirectly connected to the lever handle 12 so that rotation of the lever handle 12 causes vertical movement of the rods 62 , this vertical movement in turn causing retraction of the door latches 61 . a series of interlinked components provide the connection between the conventional lever handle 12 and the vertical rods 62 . the lever handle is permanently attached to a shaft 48 that extends through the trim housing 16 to engage a cam 42 . the cam 42 is attached to the shaft 48 by a shear pin 49 that projects outward from the shaft in one direction to fit into a channel defined in the cam 42 . when the cam 42 is prevented from moving , excessive torque forces greater than a predetermined maximum applied to the shear pin 49 will result in breakage of the shear pin 49 . the extension of the shear pin 49 in a single direction , as compared to extension from both sides of the shaft , results in improved breakage characteristics and more consistent breakage of the shear pin when the predetermined maximum torque force is applied . breakage of the shear pin 49 allows the shaft 48 and connected lever handle 12 to spin freely , preventing any further damage to internal components of the door lever assembly 10 . in ordinary operation under typical turning torque forces , however , the connection of the shear pin 49 to the cam 42 simply permits manual rotation of the cam 42 driven by rotation of the door lever handle 12 . the cam 42 is configured to present a pair of cam wings 43 that extend outward from the cam to engage a slider 30 . depending on the direction of rotation , one of the cam wings 43 slidably engages the slider 30 , linearly pushing it upward and away from cam 42 against the force of compressible lift springs 32 toward a plate 40 integrally formed to project from the trim housing 16 . since the slider 30 supports an attached lift arm 24 , linear movement of the slider also causes the lift arm 24 to upwardly move . the lift arm 24 is in turn attached to vertical rods 62 ( rods 62 are indicated in fig6 ) that control unlatching of latches 61 of the door latch assembly 60 . when the latches 61 are released , the door 11 opened , and the lever handle 12 released , the lift springs 32 , which are attached between the plate 40 and the slider 30 , force the slider 30 downward and away from the plate 40 . as the slider 30 moves downward , it forces the cam 42 to rotate , which in turn forces rotation of the shaft 48 and connected lever handle 12 . the lever handle 12 is therefore forced back into its initial substantially horizontal position upon its release . in its locked position , the door lever assembly 10 provides for interruption of the foregoing linkages between the door lever handle 12 and the door latch assembly 60 . as seen in an unlocked position in fig1 and 3 , and in a locked position in fig4 and 5 , the door lever assembly 10 includes a block arm assembly 70 connected to the trim housing 16 . the block arm assembly 70 has a generally u - shaped block arm 72 pivotally connected at one end to the trim housing 16 by a dowel pin 74 . as best seen in fig3 the dowel pin 74 is itself held to the trim housing 16 by a combination of washers 76 and machine screws 78 . at the end of the block arm 72 opposite the dowel pin 74 , the block arm 72 supports an integrally attached block head 88 . the block head 88 is dimensioned to fit in a gap between the plate 40 and the slider 30 , when the slider 30 is in its initial position . placement of the block head 88 in between the plate 40 and slider 30 locks the door lever assembly 10 by preventing movement of the slider 30 , which in turn prevents movement of the connected lift arm 24 as well as the linked cam 42 , shaft 48 , and door lever handle 12 . as seen in fig1 , and 3 , the block arm 72 is normally rotated so that the block head 88 is not positioned between the slider 30 and plate 40 to lock the door lever assembly 10 . this is accomplished by use of a compression spring 80 , attached between an aperture 81 defined in the trim housing and a tab 82 defined to project from the block arm 72 . however , the biasing force of spring 80 can be overcome by activation of a solenoid assembly 84 to lock the door lever assembly 10 . the solenoid assembly 84 is of conventional construction and includes a movable solenoid plunger 86 connected to the block arm 72 . when a remotely controlled electrical voltage ( typically 24 volts dc ) is applied across the solenoid assembly 84 , a strong magnetic field is created to draw the solenoid plunger 86 inward toward the trim housing 16 . movement of the solenoid plunger 86 overcomes the resistance of the spring 80 , and pulls the block head 88 into its locking position between the plate 40 and slider 30 ( as best seen in fig4 and 5 ). as long as the electrical connection is maintained , the block head will remain in its lock position . however , if the electrical connection is broken , either deliberately or accidentally , the force of the spring 80 is directed to push the block arm and attached block head out of the lock position . while the present invention has been described in connection with specific embodiments , it will be apparent to those skilled in the art that various changes may be made therein without departing from the spirit or scope of the invention .	8
referring now in specific detail to the drawings , in which identical reference numerals identify similar or identical elements throughout the several views , in fig2 a and 2b , there is shown a laser diode 20 which provides the divergent laser light to be focused by the present invention . the laser diode 20 is a typical structure of laser diodes available commercially . commercially available laser diodes structured in this manner include the non - contact l58300 / l56100 by sony or toshiba , or the non - contact l58500 by sony or toshiba . the dimensions given in the following description correspond to a particular representative embodiment of a focusing module , constructed according to the present invention , and are in no way to be considered as limiting . the dimensions given would enable the use of the focusing module with the above mentioned laser diodes . referring to fig1 a and 1b , the laser diode 20 is shown with the prior art embodiment of a focusing module 10 , having a threaded interface 11 between members 10a and 10b , which allows for focusing . the lens glass 18 is urged by a spring 19 to rest directly on the sloped seating portion 15 of member 10b , which is also provided with emission opening 17 , circular in shape and of considerably smaller diameter than lens glass 18 . focusing of prior art module 10 is accomplished by rotation of member 10b with respect to member 10a . fig3 - 8 show a particular embodiment of the focusing module of the present invention . as best shown in fig6 - 8 , the focusing module 100 of the present invention has a diode holder 30 , a lens holder 40 , and a lens assembly 60 which seats at the front end of the interior of lens holder 40 . referring to fig3 a , 3b , and 3c , the diode holder 30 of the focusing module 100 is shown . the diode holder 30 is preferably of thin - walled construction as seen in fig3 a and 3b , and has a first annular portion 35 and a second annular portion 31 of smaller radius than that of the first annual portion 35 . in the representative embodiment , first annular portion 35 is on the order of 355 mil in inner diameter , and second annular portion 31 is on the order of 326 mil in inner diameter , both having a tolerance of approximately 1 mil . the diode holder 30 and lens holder 40 are typically made of a light gauge metal , such as brass , and are preferably spin formed using standard spin forming and cutting techniques , but may also be formed by other known techniques such as drawing or stamping . these members 30 and 40 may also be molded of a light - weight rigid plastic material such as phenolic resins or other high impact plastics . fig3 a shows a front or radial view of the diode holder 30 and demonstrates that the tubular shape of the diode holder 30 is primarily hollow . the thickness of the walls of the first annular portion 35 may be on the order of 6 mil , for example , and is therefore relatively thin compared to the diameter of the first annular portion 35 . the cross - section shows the second annular portion 31 having a thickness likewise on the order of 6 mil and is therefore relatively thin compared to the diameter of the second annular portion 31 . the first annular portion 35 and the second annular portion 31 connect through the sloping washer - shaped surface 33 whose radial surface has a width on the order of 6 mil and extends axially on the order of 20 mil . referring to fig3 b , in the representative embodiment the first annular portion 35 extends axially on the order of 125 mil , for example . the entire length of the diode holder 30 which is the net length of the first annular portion 35 and the second annular portion 31 is on the order of 325 mil . spaced equidistantly around the first annular portion 35 are a series of indentations extending radially inward , shown in fig3 a , 3b , and 3c as a series of punches 34 , 36 , and 37 . the punches 34 , 36 , and 37 are formed using standard shear or stamping technology , in which the shear portions 34a , 36a , and 37a , extend circumferentially along the rearward portion of the punch , shown most clearly by punch 36 of fig3 b . these shear portions 34a , 36a , and 37a further act as a stop to define the limit of reception of the base 21 of the laser diode 20 in the focusing module 100 . to achieve proper axial orientation between the focusing module 100 and the laser diode 20 the distance between the shear portions 34a , 36a , and 37a and the rear axial end of the first annular portion 35 is uniform and is preferably equivalent to the axial length of base 21 of diode 20 , and generally is on the order of 46 mil with a tolerance of 1 mil , in the representative embodiment . the first annular portion 35 also has an inward indentation or groove 32 extending in the axial direction along the length of the first annular portion , as shown in fig3 a - 3c , and is best seen in fig3 c which clearly shows the groove 32 extending in the axial direction . the groove 32 extends radially inwardly so that its innermost extension has approximately the same radial distance as the inner radius of the second annular portion 31 , the latter on the order of 326 mil . the groove 32 interfaces with a notch 24 shown in fig2 a and 2b , extending in the axial direction of the length of base 21 of the laser diode 20 thereby preventing rotation of the diode 20 with respect to the center axis of the diode holder 30 when the diode 20 is received in the diode holder 30 . referring back to fig3 a , 3b , and 3c , the inward groove 32 is stamped into diode holder 30 or pressed into the holder by a pressing operation . referring to fig4 a , 4b and 4c , the lens holder 40 of the focusing module is shown , and as best seen in fig4 a and 4b , the lens holder 40 has a flange portion 41 , a rear annular portion 41a of radius smaller than the flange 41 , and a forward annular portion 43 of radius smaller than the rear annular portion . the radially positioned washer - like surface connecting the rear annular portion 41a and the forward annular portion 43 forms the seating surface 42 for the lens assembly 60 as shown in fig7 and described below . the front end of the lens holder 40 is a closed disk - like surface 44 with an opening 45 through which the laser light is emitted and which corresponds in shape to the cross - sectioned shape of the laser light beam . this shape is generally an oblong shape , such as but not limited to , an ellipsoidal shape . in fig4 a , three cuts 46 , 47 , and 48 in the flange 41 , are shown and their function will be described below . in the projection along the center axis of fig4 a , the linear midpoint of these cuts is tangent to the outer surface of the rear annular portion 41a . this is also shown in fig4 b , where the cut 46 conforms the cut portion of the flange 41 and rear annular portion at the particular cross - section of fig4 b . the flange 41 further has a radially extending notch 49 , which as seen in fig4 a , extends radially inwardly so that its innermost radial extension is approximately equivalent to the outer radius of the rear annular portion 41a . in a second embodiment of the lens holder 40 shown in fig4 c , the cuts 46 , 47 , and 48 , and notch 49 may approach the washer - like surface projection but are not tangential to it . the ellipsoidal opening 45 of lens holder 40 has its center point aligned with the central axis of the lens holder 40 . the semi - major axis of ellipsoidal opening 45 bisects fitting notch 49 and also bisects cut 46 of flange 41 in the two dimensional projection in fig4 a . the semi - major axis of the ellipsoidal opening 45 in the representative embodiment may be approximately 160 mil and the semi - minor axis may be approximately 35 - 50 mil , depending on the particular laser diode used . the lens holder 40 is received within the diode holder 30 as shown in fig6 . to achieve reception , the closed front end 44 of the lens holder 40 is moved coaxially into the radial opening of the diode holder 30 defined by the first annular portion 35 toward the radial opening at the opposite end of the diode holder 30 defined by the second annular portion 31 . the rear annular portion 41a of the lens holder 40 has an outer radius only marginally smaller than the second annular portion 31 of the diode holder 30 thereby having a frictional engagement and maintaining the coaxial positioning of the diode holder 30 and the lens holder 40 . the first annular portion 35 of the diode holder 30 receives the flange 41 ( not shown in fig6 ) of the lens holder 40 . the flange 41 has radius marginally smaller than the radius of the first annular portion 35 thereby allowing reception . however , the flange 41 has radius larger than the second annular portion 31 of the diode holder 30 thereby preventing further reception in the axial direction of the lens holder 40 by the diode holder 30 when the flange 41 comes in contact with the washer - like surface 33 of the diode holder 30 . the flange 41 freely travels in an axial direction past punches 34 , 36 , and 37 ( not shown in fig6 ) in the first annular portion 35 due to the cuts 46 , 47 , and 48 ( not shown in fig6 ) on the flange 41 . the received lens holder 40 is prevented from rotating about the center axis with respect to the diode holder 30 due to the notch 49 in the flange 41 of the lens holder 40 which interfaces with the groove 32 in the first annular portion 35 of the diode holder 30 . referring again to fig4 a , 4b , and 4c , the lens holder 40 has relative dimensions as defined above as well as the following for the representative embodiment : the thickness of the flange 41 rear annular portion 41a and forward annular portion 43 are on the order of 6 mil . the seating surface 42 has a surface width of approximately 37 mil , and a tolerance of approximetaly 1 mil . the seating surface 42 is normal to the central axis except for the bending at the point of contact with the annular portions 41a and 43 . the inner diameter of the forward annular portion 43 is on the order of 250 . 5 mil , with a tolerance on the order of 1 mil . the outer diameter of the rear annular portion 41a is on the order of 324 . 8 mil with tolerance on the order of 0 . 5 mil . the outer diameter of the flange 41 is on the order of 352 . 5 mil with tolerance of the order of 0 . 5 mil . the length of the rear annular portion 41a is approximately 262 mil with a tolerance of approximately 1 mil . the length of the forward annular portion 43 is approximately 66 mil with a tolerance on the order of 1 mil . referring to fig5 a and 5b , the positioning spring 28 of the focusing module 100 is shown interfacing with the base of the laser diode 20 . the positioning spring 28 receives the cylindrical extension 22 of the diode 20 . the positioning spring 28 has an unextended radius relatively smaller than the cylindrical extension 22 ; therefore the portion of the positioning spring 28 receiving the laser diode 20 provides an inward radial force on the base 21 of the diode 20 and the non - receiving portion of the positioning spring 28 tapers along its length . the positioning spring 28 receives the cylindrical extension 22 completely , so that one end of the positioning spring 28 rests on the ledge 23 of the base 21 of the laser diode 20 . fig7 shows the lens assembly 60 of the focusing module 100 positioned in the focusing module 100 . shown in fig7 is the lens holder 40 received in the diode holder 30 as described above with reference to fig6 . the focusing lens glass 63 is an integral part of lens assembly 60 and the central axis of the focusing lens 63 coaxially positioned with respect to the central axis of the lens assembly 60 . such lens assemblies are available commercially , and the model a - 365 manufactured by kodak is used in a preferred embodiment . the lens assembly 60 has an outer radius smaller than the rear annular portion 41a of the lens holder 40 but larger than the radius of the forward annular portion 43 ; the front face 64 of the lens assembly 60 rests upon the seating surface 42 providing an axial stop for the lens assembly 60 . a ring extension 62 of the lens assembly 60 has outer diameter only marginally smaller than forward annular portion 43 thereby preventing radial movement of the lens assembly 60 with respect to the lens holder 40 and achieving a coaxial positioning of the focusing lens assembly 60 , the diode holder 30 , and lens holder 40 . referring to fig8 as described above , the diode holder 30 cannot rotate with respect to the received diode 20 and the received lens holder 40 cannot rotate with respect to the diode holder 30 . accordingly , the ellipsoidal opening 45 cannot be rotated axially with respect to the laser diode 20 and the cross - section of the emitted laser light approximately matches opening 45 . when the laser diode 20 is received in the focusing module 100 , the positioning spring 28 is compressed against the lens assembly 60 forcing it in the axial direction against seating surface 42 . the forward force against the seating surface is transmitted to the diode holder 30 at the washer - like surface 33 of the diode holder 30 by the flange 41 of the lens holder 40 . this results in a forward axial force on the diode holder 30 with respect to the base 21 of the laser diode 20 ; therefore to receive the laser diode 20 in the diode holder 30 , a force ( shown as f1 and f2 ) is provided at the closed front end 44 to counteract this resulting force from the compressed positioning spring 28 . when the force enables maximum reception of the base 21 of the laser diode 20 as defined by the punches 34 , 36 and 37 on the first annular portion 35 of the diode holder 30 , an adherent is applied at points where the base 21 of the laser diode 20 is received and allowed to cure , thereby affixing the base 21 of the laser diode 20 to the diode holder 30 . with the laser diode 20 affixed , the compressed positioning spring 28 forces forward axial movement of the lens holder 40 until the flange 41 rests on the washer - like surface 33 of diode holder 30 . with the laser diode 20 energized , light emitted with an axial component passes through the lens assembly 60 and through the ellipsoidal opening 45 . the focusing is adjusted by reapplying a force ( shown in fig8 as f1 and f2 ) at the closed front end 44 of lens holder 40 , thereby sliding the lens holder 40 and lens assembly 60 in a rearward axial direction with respect to the diode holder 30 . when focusing is achieved , forces f1 and f2 may be adjusted slightly due to the tolerances in the cylindrical members , which causes the central axis of the lens to be concentrically aligned with the central axis of the light emission , thereby achieving a symmetric intensity pattern . once achieved , adherents such as described above are applied at points where the diode holder 30 and the lens holder 40 contact , and allowed to cure before the force is removed so that precise focusing is maintained .	8
as described above , the present invention may be employed in the measurement of both pacing and cardioversion lead and electrode impedances in single or dual chamber pacemakers as well as in pacemaker - cardioverter - defibrillators or in other body tissue stimulators . in the case of a cardiac pacemaker , the impedance testing routine may be entered into either periodically or by physician initiation with an external programmer by initiating a temporary asynchronous pacing mode of operation having a fixed escape interval wherein the output capacitor may be first discharged into a precision resistor load part way through the escape interval and the measurement of the time that it takes to discharge from vdd to vdd / 2 can be conducted without having any effect on the patient thereafter , at the end of the temporary escape interval ( which is preferably set at a lower than normal test pacing rate , such as 60 beats per minute ) the output capacitor may be discharged into the patient &# 39 ; s pacing lead and heart in order to measure the time that it takes for the output capacitor to again discharge from vdd to vdd2 . the two elapsed times may be stored in memory and processed to develop the current lead impedance value . however , when testing the impedance of a cardio version / defibrillation electrode system , it is undesirable to shock the patient just to obtain the impedance value . therefore , advantage is taken of the fact that periodically the function of the cardioverter / defibrillator output shock generating circuit is tested by the physician who initiates charging and discharging of the high voltage output capacitors into a test load in order to reform the capacitors which , by their nature , tend to lose their ability to charge if not charged and discharged periodically . in the course of that testing , the present invention may be practiced by measuring the time that it takes for the output capacitor voltage to decrease from a first reference value to a second reference value through the known impedance test load , where the first and second reference voltages are chosen to be at levels which are insufficient in and of themselves to cardiovert the patient . then , the same procedure may be repeated by recharging the output capacitor and causing it to discharge from the first reference voltage to the second reference voltage through the electrode system and measuring the elapsed time in order to compare the two elapsed times and measure the cardioversion / defibrillation lead impedance . alternatively , the physician may elect to conduct a test of the system &# 39 ; s ability to cardiovert the patient in an electrophysiologic study and , in the course of that procedure , the physician may first program the implanted device to charge up its high voltage output capacitors and discharge them into the test impedance , obtain the aforementioned elapsed time measurement , initiate stimulation to induce a tachyarrhythmia and program the device to both cardiovert or defibrillate the enduced tachyarrhythmia and to conduct the elapsed time measurement in accordance with the method of the present invention . turning now to fig1 the overall impedance of a pacing or cardioversion lead and electrode system in contact with a patient &# 39 ; s heart and as presented at the output circuit of either the pacemaker or the cardioverter / defibrillator shock generator is depicted as a series of resistances and capacitances . since the output circuit in either case is viewing the remainder of the system through a feedthrough terminal , connector block connection , lead conductor system and electrode - tissue interface , each of those components may possess a discrete electrical series resistance . it will be understood that the normal resistances of the feedthrough , connector block and connector pin connection , lead conductor and its connections with the connector pin and electrode should remain relatively low and stable . in pacing , employing relatively small pace / sense electrode surface areas , impedances at the electrode - tissue interface would be expected to range between 500 and 1000 ohms while total impedance of the remainder of the system , employing highly conductive alloys , would range between 10 and 20 ohms . similarly , with cardioversion lead systems , the impedance of the electrical components would be expected to fall between 10 and 20 ohms , whereas the electrode - tissue interface impedance may range between 20 and 200 ohms . a relatively large surface area of the typical cardioversion / defibrillation electrode contributes to a lower electrode - tissue interface impedance . fig1 illustrates the effective series and parallel connected impedances of the components listed above where r ft represents the feedthrough resistance : r cb represents the connector block impedance : r lc represents the lead conductor and connection joint impedances of the lead conductor and its connections with the proximal conductor pin and the distal electrode ; and wherein the electrode - tissue interface impedance which can be represented through an electrical impedance which comprises a series resistor r s in series electrically with a parallel combination of a faraday resistor r f and a helmholtz capacitor c h . the entire series resistance of r ft , r cb , r lc and r s has a nominal value of about 10 to 200 ohms , the capacitor c h has a nominal value of about 5 to 50 microfarads , and the resistor r f has a nominal value of 2k to 100k ohms . these values apply for the impedance measured in gross terms across the output terminals of the pulse generator . turning now to fig2 it depicts in simplified form a typical pulse generator output circuit for either a pacemaker or a cardioverter wherein the output capacitor 10 of either such device is typically adapted to be charged to a programmed battery voltage vdd through a charging switch 12 and the lead system which is shown diagrammatically as r lead representing the impedance depicted in fig1 . at the appropriate time following the charging of capacitor 10 , the switch 12 is opened and the switches 14 and 28 are closed in order to discharge capacitor 10 through r lead for the time duration or pulse width set by the closure of switch 14 . the remaining elements of fig2 may be incorporated into each embodiment and employed in the lead impedance measurement method and apparatus of the present invention . in the pacing context , the output circuit of fig2 may take the form of the circuit depicted , for example , in u . s . pat . no . 4 , 498 , 478 to bourgeois or u . s . pat . no . 4 , 476 , 868 to thompson , or u . s . pat . no . 4 , 406 , 286 to stein , all incorporated by reference herein in their entirety . the switches 28 and 30 may take the form of transistor switches in a fashion taught by the above - incorporated &# 39 ; 478 , &# 39 ; 868 and &# 39 ; 286 patents . additional elements to the prior art output circuits by which the method and apparatus of the present invention may be implemented to include the first differential amplifier 20 coupled across the capacitor 10 by conductor 22 , a second differential amplifier 24 , the counter 26 , the switches 28 , 30 , and the known precision resistor 32 all coupled as depicted in fig2 . the operation of the lead impedance measuring system is explained in conjunction with the waveform diagram of fig3 and the flowchart diagram of fig4 . very generally , the lead impedance method follows the steps of charging the capacitor 10 to vdd , discharging the capacitor 10 through r known resistance 32 , while at the same time enabling the counter 26 to start counting clock pulses , and to freeze the count in the counter 26 when the voltage across the capacitor 10 decreases to vdd / 2 , as determined by the first and second op amps 20 and 24 thereafter , the process is repeated through the lead impedance presented to the output terminal of the pulse generator at switch 28 , representing the discharge time of the capacitor 10 between the same starting and ending voltage . the first and second counts reflect the discharge time corresponding to a discrete number of clock pulse intervals denoted t cap and t lead , respectively . r known remains constant and vdd should be a repeatable constant voltage for the two successive discharges of capacitor 10 , the only variable in the time t cap from one pulse generator to another and over the life of the pulse generator in question should be the condition of the switches 14 and 30 and capacitor c . in practice , capacitor tolerances vary from one pulse generator to the next , and the repetitive cycling , particularly of high voltage electrolytic capacitors , causes the capacitance to change over time . therefore , since the rc time constant of the capacitor 10 and precision resistor 32 may vary , the first discharge time is denoted t cap , and it is measured and stored in memory at least on the first occasion that the lead impedance is calculated or , preferably , each time that it is calculated . the relationship between the capacitance c of the capacitor 10 and the resistances r known of the precision resistor 32 and r lead for the combined lead impedance are expressed as follows : since the resistance r known is known , it may be used as a constant , and the determination of the variable lead impedance r lead reduces to : ## equ1 ## and results in known switch impedances for switches 14 and 28 may be subtracted or ignored if insignificant . this approach eliminates the need to use natural log functions or approximations thereof . in the calculation of r lead , the two counts are compared to one another and the ratio of the t lead to the t cap multiplied by the r known resistance yields the current r lead value in a manner to be described in conjunction with fig4 . the above - described method may be employed also in the context of a cardioverter - defibrillator , where the capacitor 10 may take the form of the high voltage output capacitor and the voltage source vdd may take the form of the output of the dc - dc converter , as shown , for example in u . s . pat . nos . 4 , 595 , 009 and 4 , 548 , 209 , filed in the names of lebindors and wielders . in that context , the r lead impedance constitutes the same impedance elements as depicted in fig1 but in regard to a cardioversion / defibrillation lead system , rather than the pacing lead system previously described . moreover , the fixed r known impedance element may take the form of the internal discharge resistor which is usually provided at 1 - 3k ohms . the switches 12 , 14 , 28 and 30 may constitute the high voltage silicone controlled switches and power fets commonly employed in the output circuits of such devices . turning now to fig3 and 4 , they describe the practice of a method of the present invention implemented in pacing context wherein it will be understood that the pacemaker is normally operating to repetitively timeout escape intervals which may be fixed at a previously programmed value or vary between preset upper and lower escape intervals in relation to a pacing rate control signal established by physiologic sensor , as is well known in the pacing art . at some point , either upon receipt of an external programmed - in command , the occurrence of a particular event or upon an internally timed - out self test command , the pacing logic or software commences a subroutine to initiate the successive measurement of the t lead and t cap time intervals turning now to fig3 the successive discharge of the capacitor 10 into the r known and r lead impedances is depicted along the time line t and in relation to the starting voltage vdd and ending voltage vdd / 2 . once the impedance measurement algorithm is entered into , at start block 100 of fig4 the pacing mode is changed to a temporary fixed rate mode at a preset escape interval for at least one escape interval denoted t 2x . escape interval t 2x may be selected to be in the range of 1 , 000 ms to allow for the successive charge and discharge of the capacitor 10 through both the r known and r lead impedances and still allow adequate time for the capacitor 10 to recharge . fig3 illustrates the discharge of the capacitor 10 through the r known impedance at the end of the interval t x to develop the reference time period t cap and to subsequently allow the discharge of the capacitor 10 through the r lead impedance at the end of the escape interval t 2x to develop the pulse width interval t lead . turning now to fig4 the testing subroutine starts at start block 100 , which may precede the end of a current escape interval reflecting the receipt of a programmed - in command , for example . when the next pace or sensed event occurs , the escape interval is set to 2 × ms , switches 12 and 28 are closed and switches 14 and 30 are opened in block 104 to provide for the recharge of the capacitor 10 through the r lead impedance in the normal pacing fashion . during this time , the counter 26 is not enabled and as capacitor 10 charges up to vdd , its voltage is presented across the positive or negative input terminals of the unity gain differential to single - ended op amp 20 , which in turn presents that voltage to the positive input terminal of differential amplifier 24 . differential amplifier 24 compares the voltage at its positive input terminal against a reference voltage , in this case one - half the vdd voltage or vdd / 2 , and provides an output signal at its output terminal whenever the presented voltage across the capacitor 10 exceeds the reference voltage vdd / 2 less any offset voltages . the output of the differential amplifier 24 operates to freeze and transfer the contents of the counter 26 into memory when that presented voltage falls below the reference voltage vdd / 2 as described hereinafter . in block 108 , and in reference to fig3 at the end of the interval t x as timed out by decision block 108 , the counter 26 is enabled , the switches 12 and 28 are opened and the switches 14 and 30 are closed . at that instant , the voltage vdd across the capacitor 10 is presented to the positive input terminal of the differential amplifier 24 and also begins to discharge through the r known impedance 32 in a fashion depicted by the capacitive discharge pulse having a width t cap depicted in fig3 . as long as the voltage on capacitor 10 is greater than vdd / 2 , counter 26 continues to count clock pulses . as soon as the voltage on the capacitor 10 falls below vdd / 2 , the output from the differential amplifier 24 switches from high to low , and the counter 26 receives a command to freeze the count , transfer it to a memory location or a separate register , and to disable itself . at the same time , this accumulated count may be reset to zero . at the same time , the switches 14 and 30 are set open and switches 12 and 28 are set closed to terminate the discharge of the capacitor 10 and commence its recharge . the stored time interval t cap is held awaiting the measurement of the time t lead , whereupon the mathematical comparison and multiplication steps take place . thereafter , the fixed escape interval t 2x times out in block 116 , and the counter 26 is again enabled in block 118 . at the same time , the switches 12 and 30 are opened , and the switches 14 and 28 are closed . thus , the discharge of the capacitor 10 through the r lead impedance commences at the end of the escape interval . again , the voltage on the capacitor 10 is monitored by the differential amplifiers 20 and 24 and when it again falls below vdd / 2 , the contents of the counter 26 are frozen , transferred to a separate register and the counter cleared in blocks 122 and 124 . at the same time , the switches 14 and 30 are opened , and the switches 12 and 28 are closed to commence the recharge . once the count representing the time t lead is stored in block 124 , the subroutine is exited in block 126 , thus returning control of the pacing mode and rate to the normal operating pacing system . since the clock pulses have predetermined pulse widths , the accumulated counts transferred into memory at registers representing the time intervals t cap and t lead are fairly representative of the actual rc discharge times . moreover , since the ratio of the two times are employed in the calculation of the current lead impedance , any voltage reference drift or other component value or operating parameter drift cancel one another out . over the impedance range of 100 to 1000 ohms , the error tolerance is dependent upon the following factors : counter resolution vs . minimum decay time 30 . 5 us / 693 us ( 100 ohm , 10 uf ) 4 . 4 % counter resolution vs . nominal decay time 30 . 5 us / 3 . 53 ms ( 510 ohm , 10 uf ) 0 . 9 % known load decay time ± 2 . 7 % ( sum of errors in calculation of t cap ) in theory , the measurement accuracy meets the goal of ± 5 - 10 % in the specified load range . the comparator and op amp errors are consistent between the known impedance pulse and the unknown impedance pulse effectively eliminating them from the overall summation of error terms . in the cardioversion - defibrillation context , the method of fig4 may be modified by eliminating the decision block 102 and setting an overall time interval in block 104 that may encompass 30 to 60 seconds to assure adequate charging to full program voltage . although technically not an escape interval , the time - out of the set interval is necessary to assure that the output capacitor is fully charged . alternately , if the cardioverter - defibrillator is provided with a circuit for monitoring the achievement of full charge on the output capacitor or capacitors , then the initial discharge through the r known impedance 32 and then the subsequent discharge through the r lead impedance 16 may take place upon confirmation of the capacitor output voltage vdd . in either case , the excessive charging and discharging of the capacitor 10 to develop the time intervals t cap and t lead occurs in the same fashion as described above . in those instances where it is undesirable to discharge full output capacitor voltage through the r lead impedance on the patient , a smaller sub threshold voltage vdd may be selected or the reference voltage vdd / 2 ( i . e ., 0 . 5 vdd ) may be set at a higher value , such as 0 . 95 vdd . in either case , the method and appartus of the present invention finds particular utility in the pacemaker - cardioverter - defibrillator context , inasmuch as the condition of the capacitors may change over time by virtue of their being repetitively subjected to high voltage charge and discharge cycles . in accordance with the present invention , changes in the applied voltage vdd , the capacitor 10 and the various switches are all taken into account and offset one another in the calculation . other modifications of the embodiments of the method and apparatus of the present invention will become readily apparent to those skilled in the art in light of the foregoing disclosure . therefore the scope of the present invention should be interpreted from the following claims interpreted in light of the above - described preferred embodiments and other modifications and embodiments thereof .	0
the following description is a detailed description of the main embodiments of the invention with reference to the drawings in which the same number references identify the same elements in each of the different figures . the invention describes a method for automatically predicting at least one word of text while a text - based message is being inputted using a terminal 1 . according to fig1 , the terminal 1 is , for example , a mobile cell phone equipped with a keypad 2 and a display screen 3 . in an advantageous embodiment , the mobile terminal 1 can be a camera - phone , called a ‘ phonecam ’, equipped with an imaging sensor 2 ′. the terminal 1 can communicate with other similar terminals ( not illustrated in the figure ) via a wireless communication link 4 in a network , for example a umts ( universal mobile telecommunication system ) network . according to the embodiment illustrated in fig1 , the terminal 1 can communicate with a server 5 containing digital images that , for example , are stored in an image database 51 . the server 5 may also contain a word database 5 m . the server 5 may also serve as a gateway that provides terminal 1 with access to the internet . in another embodiment , the images and words can be saved to the internal memory of terminal 1 . the majority of mobile terminals are equipped with means of receiving , sending or capturing visual image or video data . however , the method that is the object of the invention has the advantage that it can be implemented with even the simplest of cell phones , i . e . cell phones without means of image capture , as long as the cell phone can receive and send image or sequence of images ( videos ) data . the method that is the object of the invention is a more effective and more contextually - adapted means of inputting a text - based message associated with an image than the t9 ® method or even the ‘ itap ’ method . in the description that follows , the word image is used to indicate either a single image or a sequence of images , i . e . a short film or a video , for example . the image can , for example , be an attachment to a multimedia message . the multimedia message can contain image , text and audio data . the text - based data can , for example , be derived and extracted from image metadata , i . e . data that , for example , is specific to the context in which the image was captured and that is stored in the exif fields associated with jpeg images . the file format supporting the digital data characterizing the image , text or audio data is advantageously an mms ( multimedia message service ) format . the mms can therefore be transferred between digital platforms , for example between mobile terminals or between a server such as server 5 and a terminal such as mobile terminal 1 . the image can also , for example , be attached to another means of communication such as a electronic mail ( e - mail ). the invention method can be applied directly , as soon as an image or video 6 has been selected . the image is advantageously selected using terminal 1 and then displayed on the display 3 of terminal 1 . image 6 can , for example , be saved or stored in the image database 5 i . otherwise , image 6 may just have been captured by terminal 1 , and it may be that the user of terminal 1 wants to instantaneously add textual comment related to the content of the image 6 or , for example , related to the context in which image 6 was captured . the invention method consists in taking advantage of the information contained in the image in order to facilitate the prediction of at least one word of text related to the content or context associated with image 6 . the at least one predicted word already exists and for example is contained in the word database 5 m . the word database 5 m is , compared to the dictionary used in the t9 ® protocol , advantageously a specially - designed dictionary able to adapt to the image content or the or context associated with the image . the dictionary is self - adapting because it is compiled from words derived from contextual and ( or ) semantic analysis specific to a given image . these words are then adapted to the text correlated with image 6 . the word dictionary 5 m is built from the moment where at least one image or at least one sequence of images has been selected via a messaging interface , for example an mms messaging interface , or by any other software able to associate a text message with an image or a sequence of images with the objective of sharing the text and the image or images . once the text - based message ( associated with the image ) and the image have been sent , or else once the text - based message and the image have been saved to the mobile terminal &# 39 ; s memory or to a remote memory that can be accessed via a means of communication compatible with the mobile terminal , then the dictionary 5 m associated with that specific image or images ( s ) or specific sequence ( s ) of images is destroyed . hence , the next time a new image or sequence of images is selected , a new dictionary 5 m will be compiled based on the semantic and ( or ) contextual data derived from the new multimedia data . in another embodiment of the method , the dictionary 5 m associated with an image or a specific sequence of images is saved to memory , ready to be used at a later time . in an alternative embodiment , the dictionary 5 m may be built for each set of multimedia data before the user has sent a message . in this latter scenario , the user does not see the dictionary 5 m being built . this involves saving a back - up of each dictionary 5 m associated with each set of image or image sequence - based multimedia data . if several images or sequences of images are selected for the same multimedia message , this involves building a new dictionary 5 m compiled from at least the words comprising the vocabulary of each of the various dictionaries 5 m associated with each selected image or sequence of images . the word database 5 m can automatically offer the user a word or a series of words as the user is writing a text - based message associated with image 6 via the keypad 2 . a series of several words will automatically be offered together from the outset , for example when the predictive text leads to an expression or a compound noun . the text - based message written can advantageously be displayed with the image 6 on display 3 of mobile terminal 1 , and the predicted word proposed can also be displayed automatically on the display 3 , for example as soon as the first letter of said word has been inputted using keypad 2 . the word proposed is advantageously displayed in a viewing window of display 3 that is positioned , for example , alongside the image 6 . the word can then be automatically inserted at the appropriate place in the text being written . when at least one new letter of the text being inputted using the terminal leads to several possible proposals , i . e . all of which have a meaning in relation to the semantic of the text being written , given the content of the image or , for example , the context in which the image was captured , the word predicted and proposed that was chosen from among the proposals can be selected by pressing , for example by touch , on the display 3 . the pressure is applied to the word that the person inputting the text with keypad 2 chooses as most closely matching what they want to say . in one variant of this embodiment , when several proposals have been predicted , the predicted and proposed word chosen can also be selected using one of the keys of the keypad 2 of terminal 1 . in an advantageous embodiment of the method according to the invention , the automatic prediction and proposal of at least one word is conducted in cooperation with the t9 ® protocol . this means that the words proposed can be derived from both the word database 5 m ( the specially - designed self - adapting dictionary ) specific to the present invention and from another database ( not illustrated in fig1 specific to the t9 ® protocol . the words derived from each of these dictionaries ( both the t9 ® dictionary and the dictionary according to the present invention ) can therefore be advantageously combined . the predicted and proposed word is produced based on a semantic analysis of the image or sequence of images selected using terminal 1 . the semantic analysis can be conducted inside the image via an image analysis algorithm which classifies pixels , or via a statistical analysis of pixel distribution , or else via a spatiotemporal analysis of pixel distribution over time . the semantic analysis can be conducted based on recognition of the outlines produced by sets of connected pixels in the selected image or sequence of images . the outlines detected and recognized are , for example , faces . the extraction of semantic information from within an image , i . e . information related to the characterization or meaning of an entity contained in the image , also makes it possible to build and enhance the content of the specially - designed self - adapting dictionary 5 m . if the image 6 features , for example , a couple running across a sandy beach with a dog , then the image analysis algorithm will segment the content of image 6 into semantic layers . in this particular scenario , specially - designed sensors recognize and outline in image 6 zones of white sand and zones of seawater and blue sky , based on , for example , the methods described in u . s . pat . no . 6 , 947 , 591 or u . s . pat . no . 6 , 504 , 951 filed by eastman kodak company . classification rules are used to characterize the scene in the image as being , for example , a ‘ beach ’ scene , based on the fact that the scene contains both blue sea zones and white sand zones . these classification rules can , for example , be based on the methods described in u . s . pat . no . 7 , 062 , 085 or u . s . pat . no . 7 , 035 , 461 filed by eastman kodak company . other semantic classes can stem from an image analysis , such as , for example , ‘ birthday ’, ‘ party ’, ‘ mountain ’, ‘ town ’, ‘ indoors ’, ‘ outdoors ’, portrait &# 39 ;, ‘ landscape ’, etc . the combined use of a visual cue and a sound cue attached , for example , to a video enables a more comprehensive analysis of the content . in the same way , the use of audio data , for example spoken notes ( lyrics ) attached to an image can be advantageously used to deduce words characterizing the content of the image . an example of how the system works is detailed in u . s . pat . no . 7 , 120 , 586 filed by eastman kodak company . some of these semantic descriptors , in addition to others , can also be deduced from the image capture mode selected that is widely known as ‘ scene ’. a nokia n90 mobile phone , for example , can be used to define a ‘ scene ’ mode at the time of image capture as : ‘ night ’, ‘ portrait ’, ‘ sport ’, ‘ landscape ’. one of these words can advantageously be added to the dictionary 5 m when the user has selected the respective mode . there are other widely - used ‘ scene ’ modes , particularly in kodak digital cameras . the kodak easyshare c875 model , for example , proposes the following scene modes : ‘ portrait ’, ‘ night portrait ’, ‘ landscape ’, ‘ night landscape ’, ‘ closeup ’, ‘ sport ’, ‘ snow ’, ‘ beach ’, ‘ text / document ’, ‘ backlight ’, ‘ manner / museum ’, ‘ fireworks ’, ‘ party ’, ‘ children ’, ‘ flower ’, ‘ self - portrait ’, ‘ sunset ’, ‘ candle ’, ‘ panning shot ’. here again , the wording used to describe each of these modes can be integrated into the dictionary 5 m as soon as the user selects one of these modes . there is also a ‘ scene ’ mode known as automatic , which is designed to automatically find the appropriate ‘ scene ’ mode , for example according to the light and movement conditions identified by the lens . the result of this analysis may , for example , be the automatic detection of the ‘ landscape ’ mode . this word can then be incorporated into the dictionary 5 m . let us suppose that this is the case in the example scenario described above . the image analysis algorithm detects the specific pixel zones presenting the same colour and texture characteristics , which are generally learnt beforehand through so - called ‘ supervised ’ learning processes implementing image databases manually indexed as being , for example , sand , grass , blue sky , cloudy sky , skin , text , a car , a face , a logo etc ., after which the scene in the image is characterized . if , as described in u . s . pat . no . 6 , 940 , 545 or u . s . pat . no . 6 , 690 , 822 filed by eastman kodak company , a face is detected and recognized as being the face of ‘ john ’, and if another face is detected but cannot be recognized since it is side - on , or blurred , or hidden behind hair , a group of two people is nevertheless detected and the algorithm used in the invention method leads to the proposal of , for example , the following words : ‘ john ’, ‘ friend ’, ‘ girlfriend ’, ‘ wife ’, ‘ husband ’, ‘ son ’, ‘ daughter ’, ‘ child ’, or combinations of these words , for example ‘ john and a friend ’, ‘ john and his wife ’, ‘ john and his son ’, plus a ‘ dog ’. all this information can therefore be advantageously used to build up a dedicated dictionary with semantic words and expressions describing the visual content of an image or sequence of images attached , for example , to a multimedia message . the list of corresponding words and expressions in the dedicated dictionary 5 m is therefore , for example : ‘ beach ’; ‘ sand ’; ‘ blue sky ’; ‘ sea ’; ‘ dog ’; ‘ outdoors ’; ‘ john ’; ‘ landscape ’; ‘ friend ’; ‘ girlfriend ’; ‘ wife ’; ‘ child ’; ‘ husband ’; ‘ son ’; ‘ daughter ’; ‘ john and a friend ’; ‘ john and his wife ’; ‘ john and his son ’. a more advanced embodiment of the invention consists taking each of the words and expressions in this list and deducing other related words or expressions , or order to propose a wider contextual vocabulary when inputting the text . the previously inputted words ‘ friend ’, ‘ girlfriend ’, ‘ wife ’, ‘ husband ’, ‘ son ’, ‘ daughter ’, ‘ child ’, or the combinations ‘ john and a friend ’, ‘ john and his wife ’, ‘ john and his son ’, are examples of this . in the same way , the system can go on to deduce , based on the words ‘ beach ’ and ‘ blue sky ’, the words ‘ sunny ’, ‘ sun ’, ‘ hot ’, ‘ heat ’, ‘ holiday ’, ‘ swimming ’, ‘ tan ’, etc . this new list of words is deduced empirically , i . e . without any real semantic analysis of the content of the image or video . furthermore , for each given class ( the number and nature of which are set by the image analysis algorithm ) or ‘ scene ’ mode ( the number and nature of which are set by the image capture device that generated the photo ), it is possible to associate a discrete list of associated keywords that will be attached to the dictionary 5 m . since these word sub - lists are deduced empirically , it is likely that some of the words will not be relevant . for example , the photograph may have been taken while it was raining . hence , detecting that the scene is a ‘ beach ’ scene is no guarantee that the words ‘ sunny ’ and ‘ heat ’, for example , can be reliably associated . the description that follows will show how the use of context associated with the image partially resolves this ambiguity . given the descriptions outlined above , these words and expressions present a hierarchy that can be integrated into the dictionary 5 m . more specifically , it was described above that certain of these words and expressions were derived from others . this represents the first level in the hierarchy . in the above - mentioned example , the words ‘ sunny ’, ‘ sun ’, ‘ hot ’, ‘ heat ’, holidays ’, ‘ swimming ’ and ‘ tan were all derived from the word ‘ beach ’, whereas the word beach had itself been deduced from the detection of features known as low - level semantic information , such as ‘ blue sky ’ or ‘ white sand ’. these so - called ‘ parent - child ’ type dependencies can be exploited when displaying the dictionary words while the user is in the process of inputting text associated with the content of a multimedia message . more precisely , if two words are likely to be written , for example ‘ blue sky ’ and ‘ beach ’, that both begin with the same letter , i . e . ‘ b ’, then the expression ‘ blue sky ’ will either be displayed first , or can be highlighted , for example using a protocol based on colour , font , size or position . the word ‘ beach ’, which derived from the expression ‘ blue sky ’, will be proposed later , or less explicitly than the expression ‘ blue sky ’. similarly , the method gives stronger ties , i . e . it establishes a hierarchy or an order system , between words and expressions derived from semantic analysis of the multimedia content on one hand , and on the other the ‘ scene ’ mode selected ( by the user ) to capture the image . the method preferentially chooses , or highlights , words and expressions that characterize the scene , for example ‘ landscape ’ or ‘ sport ’, when the scene has been selected manually at image capture , using , for example , a thumbwheel or a joystick built in to the mobile terminal . this word characterizing a mode intentionally selected by the user is presented in priority compared to other words obtained based on semantic analysis of the visual or audio content attached to the multimedia message . for example , the word ‘ landscape ’ deduced from the fact that the ‘ landscape ’ mode had been selected is chosen preferentially or highlighted over the word ‘ beach ’ obtained form the image analysis , since the results of the image analysis may later prove to have been incorrect . it is also possible to establish a hierarchy between words and expressions that in principle have the same level , i . e . they have been extracted or deduced using the same techniques . for example , the words ‘ beach ’ and ‘ john ’ are both deduced via an analysis of image contents . it is possible , for example , that the image classification process can give a 75 % probability that the image depicts a beach . similarly , the face recognition process may , for example , determine that there is an 80 % chance that the face is john &# 39 ; s face and a 65 % chance that the face is patrick &# 39 ; s face . the word ‘ beach ’ can therefore be chosen preferentially or highlighted over the word ‘ patrick ’, even though both words stemmed from the semantic analysis of the image , since the word ‘ beach ’ is probably a more reliable deduction than the word ‘ patrick ’. this word database 5 m can then be used to fully implement the method for predicting word input that is the object of the invention . a particular embodiment of the invention consists in implementing the method according to the invention using , for example , a mobile cellphone 1 . the image 6 is selected using keypad 2 on the mobile phone , for example by searching for and finding image 6 in the image database ( 5 i ). the image 6 can be selected , for example , using an messaging interface such as an mms messaging interface , or any other software application capable of associating text with an image or a sequence of images in order to share this association . the selection step of an image or sequence of images 6 launches the semantic and contextual image analysis process , as described above , in order to build the dedicated dictionary 5 m . the dictionary created by the analysis of image 6 representing , for example , a beach setting , as described above , would for example in this case contain the words : ‘ beach ’; ‘ sand ’; ‘ blue sky ’; ‘ sea ’; ‘ dog ’; ‘ outdoors ’; ‘ john ’; ‘ landscape ’; ‘ friend ’; ‘ girlfriend ’; ‘ wife ’; ‘ husband ’; ‘ son ’; ‘ daughter ’; ‘ john and a friend ’; ‘ john and his wife ’; ‘ john and his son ’; ‘ sunny ’; ‘ sun ’; ‘ hot ’; ‘ heat ’; ‘ holidays ’; ‘ swimming ’; ‘ tan ’. as depicted in fig2 , image 6 is displayed on display 3 of mobile phone 1 . the user of mobile phone 1 then writes additional comments to add to image 6 . the user therefore inputs text using keypad 2 . the text - based comment to be written is , for example : “ hi , sunny weather at the beach ”. the user starts writing the first part t o of the text : “ hi , sunny w ”. this text can be written either via a conventional input system ( whether predictive or not ), such as multi - tap , two - key , t9 ® or itap . t o is written , for example , in the part of display 3 beneath image 6 . at this point , i . e . at the moment the letter ‘ w ’ is entered , a single proposition made of one ( or several ) word ( s ) is , for example , displayed on the display . this proposition 9 is , for example , ‘ sunny ’. this word was derived from dictionary 5 m and was deduced from the semantic image analysis carried out as per the method according to the invention . this word therefore has a fairly good chance of being used by the user as they write the text associated with image 6 . this is why the message is not only displayed on the display as soon as the first letter has been entered but is also listed preferentially among any other propositions that may be offered after the keypress ‘ s ’ in the event that would be not one but , for example , three propositions 7 , 8 and 9 ( fig2 ). for example , in the scenario where the method according to the invention is used in combination with the itap protocol , it is possible that another word beginning with the letter ‘ s ’ is displayed at the same time as the word ‘ sunny ’ derived from the dictionary 5 m . however , in this scenario , it is the word ‘ sunny ’ that would be displayed first in the list of propositions displayed . the appropriate word , ‘ sunny ’, is confirmed by the user , for example by pressing a key in keypad 2 . the word 9 ‘ sunny ’ would then automatically be inserted into the text to create text t 1 : “ hi , sunny weather ”. if the word 9 does not suit the user , i . e . the user did not want the word ‘ sunny ’, then the user continues to input , for example , ‘ su ’ and then ‘ sun ’, et cetera , until the appropriate word is automatically written or proposed . the user goes on to input the last part of the text : “ hi , sunny weather at the b ”; at this point , i . e . as soon as the letter ‘ b ’ has been entered , a single word 10 is proposed on the display , i . e . ‘ beach ’. the word 10 ‘ beach ’ would then be automatically inserted into the text to create text t 2 : “ hi , sunny weather at the beach ”. in a more advanced embodiment of the invention , text can be inputted orally . the text is not entered by pressing keys on keypad 2 , but the user of mobile cellphone 1 would use , for example , their own voice to input the text data . in this embodiment of the invention , mobile phone 1 is equipped , for example , with a microphone that works with a voice recognition module . using the previous text - based comment as an example , the user would simply pronounce the letter ‘ s ’ and , in the same way as described in the illustrations above , either a single proposition or else three propositions would be displayed . the dictionary 5 m is advantageously kept to a limited , manageable size to avoid too many words being displayed . the predicted and proposed word can also be produced based on a contextual analysis of the image or sequence of images selected using terminal 1 . the contextual analysis can advantageously provide , for example , geolocation data specific to the image or sequence of images . this geolocation data is preferably the place where the image or sequence of images was captured . the contextual image analysis algorithm can also provide time - based data specific to the image or sequence of images , such as for example dating data on the precise moment the image or sequence of images was captured . in a preferred , more advanced embodiment of the invention , the predicted proposed word is produced based on a semantic analysis and based on a contextual analysis of the image . this means that a semantic analysis of the selected image or sequence of images and then a contextual analysis are performed either jointly or successively , in no particular order . as regards the contextual image analysis , one or several words characterizing relevant geolocation data for image 6 captured with the phonecam 1 can be extracted using a gps module built into the phonecam . this latitude / longitude data can , for example , be associated with a street name , a district , a town or a state , such as ‘ los angeles ’. this data is added instantaneously to dictionary 5 m . in an advantageous embodiment , other words or expressions can be automatically deduced automatically from the geolocation coordinates for ‘ los angeles ’ and included in the dedicated dictionary 5 m . these other deduced words are , for example : ‘ laguna beach ’; ‘ mulholland drive ’; ‘ california ’; ‘ united states ’. again , as regards the contextual image analysis , one or several words characterizing relevant time - based data for image 6 captured with the phonecam ( 1 ) can be added instantaneously to the dictionary , such as words like ‘ weekend ’, ‘ afternoon ’, ‘ summer ’, according to whether the image was captured at the weekend , or an afternoon , or in the summer . a contextual image analysis can also be performed based on other data compiled , such as for example in an address book that can be accessed using terminal 1 . in this case , we are dealing not with the context of image capture but the local context of the image . in this example , the address book may contain predefined groups of contacts that share a certain relationship with the person in image 6 . if ‘ john ’ features in the image and a group in the address book already contains the names ‘ john ’, ‘ christopher ’ and ‘ marie ’, then the word database 5 m can be enhanced with all three of these names ( and not only ‘ john ’). another advantageous embodiment of the invention also makes it possible to automatically propose words or expressions deduced from the contextual analysis , as described above for the semantic analysis . for example , using knowledge of the date , time and geolocation of the image gained at the moment the image was captured , it is possible to deduce a predefined set of words such as ‘ hot ’, ‘ heat ’, et cetera , based on the fact that the image was captured in full daylight , in summer , and at a latitude where traditionally the weather is hot in this season and at this time of the day . in the scenario where the mobile terminal is connected to a remote database , for example a meteorological database , it is possible to crosscheck the air temperature at the time the image was captured . this temperature information , for example ‘ 30 ° c .’, can be used to generate or validate the words ‘ hot ’ and ‘ heat ’ as well as be used in the dictionary 5 m . words or expressions derived from the semantic analysis can be confirmed with a much higher probability , or else be overruled by crosschecking these words or expressions against data derived from the contextual analysis . for example , we previously saw how the words ‘ hot ’ and ‘ sunny ’ had been deduced from the word ‘ beach ’. the image capture date and geolocation data may , however , demonstrate that the image was taken in winter and at night - time , in which case the words derived from semantic analysis would be eliminated form the dictionary 5 m . fig3 illustrates another embodiment of the method according to the invention . the user of mobile phone 1 wants to write additional comments to add to image 6 . the user therefore inputs text using keypad 2 . the text to be added as a comment is , for example , “ hi , sunny weather at the beach . john ”. the protocol for writing this text is exactly the same as the embodiment of the invention illustrated in fig2 , up to text stage t 1 : “ hi , sunny weather ”. the user goes on to input the rest of the text : “ hi , sunny weather at the b ”; at this point , i . e . as soon as the letter ‘ b ’ has been entered , two words 11 and 12 are proposed on the display 3 , for example ‘ beach ’ and ‘ laguna beach ’. the user , who initially had not thought about specifying the actual name of the beach depicted in image 6 , is thus given two propositions 11 and 12 , including the expression 12 ‘ laguna beach ’, which they end up selecting . this gives text t 3 : “ hi , sunny weather at laguna beach ”. the user then finishes entering their text : “ hi , sunny weather at the beach . j ”; at this point , i . e . as soon as the letter ‘ j ’ has been entered , two words 13 and 14 are proposed on the display 3 , for example ‘ john ’ and ‘ patrick ’. the user , whose first name is john , wishes to sign their text message , and therefore validates word 14 , ‘ john ’. the final , completed text t 4 associated with image 6 is therefore : “ hi , sunny weather at laguna beach . john ”. ‘ patrick ’ was also proposed since the semantic image analysis was able to recognize that patrick featured in image 6 . furthermore , the first name ‘ patrick ’ was proposed when the letter required was a t because the invention method works on the supposition that the user wanted to add a first name . indeed , since the dictionary 5 m contained a first name beginning with the letter ‘ j ’, the word ‘ john ’ is identified as such , since it is derived from a face recognition phase based on the image or sequence of images . however , the method according to the invention also proposes in second place the other first name ( s ) obtained and available through this recognition phase , i . e . ‘ patrick ’ in this example . while the invention has been described with reference to its preferred embodiments , these embodiments are not limiting or restrictive of the claimed protection .	6
the present invention provides a mechanism for real - time detection of all of the conditions described above . additionally , it serves as a valuable tool for diagnosing the root cause of problems responsible for screening malfunctions . all of the above mentioned problems can be readily identified with the use of this device : a ) entrapped air bubbles can be quickly identified and quantified by the amount of “ spring back ” of the nozzle plunger when the piston force is removed ( as shown in fig3 , 4 & amp ; 5 below ). b ) specifications can be placed on the paste dispense rate , both for too high and too low a dispense rate . any nozzles or screeners that violate the specifications can be identified and corrected . c ) any “ hiccups ” or non - linearities in paste dispense rate can be identified and corrected . d ) conditions that would normally lead to gross paste overusage can be identified and corrected in the first screening pass , avoiding the “ dumping ” of an entire paste reservoir and the resultant loss of both paste and manufacturing throughput . in order to carry out the purposes of the invention , a linear variable differential transformer ( lvdt ) may be attached to an extrusion screening nozzle piston , as shown in fig1 below . the large rectangle 5 represents schematically the instrument on which the paste dispensing system is mounted . it may include , for example , materials handling systems to place the workpiece , such as a carrier for an integrated circuit , in position to receive the paste . rectangle 50 represents schematically a conventional pressure source , such as compressed air or other gas that supplies pressure to piston shaft 42 , which travels downwards in the figure as paste is dispensed . horizontal strip 34 represents the piston that applies the pressure from piston shaft 42 to the paste . strip 34 represents a teflon ™ seal that is in close mechanical contact with the walls 35 of the paste reservoir . walls 35 confine paste 20 , shown as having a number of air bubbles 22 within it . illustratively , paste 20 is a conductive paste that will , after heating , form conductors within a ceramic structure that conduct signals to various contacts on an integrated circuit . at the bottom of the figure , rectangle 10 represents the nozzle from which the paste flows to pass through apertures in a mask ( not shown in the figure ). the apertures are located to deposit a pattern of paste that will , upon heating , form the conductors required by the particular design being fabricated . in operation , the workpiece travels past the nozzle ( or vice versa ) and paste is dispensed at a rate that depends on the portion of the pattern underneath the nozzle at the particular time . the nozzle covers only a fraction of the workpiece and the rate of descent of the piston will therefore vary , depending on the density of the pattern underneath the nozzle . on the upper right of rectangle 5 , a vertical shaft 105 is the core of a conventional commercially available linear variable differential transformer . the shaft is rigidly mounted to the piston 34 , so that the vertical position of core 105 depends directly on the vertical position of piston 34 . rectangle 110 represents the differential transformer . it is shown with two coils 112 and 114 . core 105 passes all the way through the lower coil 112 and only partly through upper coil 114 . the relative magnitude or amplification factor of the two coils will therefore produce a corresponding difference in output signals . for example , a common input is supplied through both coils 112 and 114 . the difference in the outputs of the two coils will therefore represent the position of core 105 . subtracting the signal from coil 112 from that from coil 114 will therefore produce a signal representing the position of core 105 and therefore of piston 34 . in this figure , transformer 110 is rigidly mounted to the paste dispenser by a conventional structure not shown . on the right , analyzer 150 represents conventional electronics , whether custom or a general purpose computer , that applies analytical processes to the output signals as described below . the lvdt provides constant feedback of piston position enabling real - time monitoring of piston movement during normal screening operation . monitoring and analysis of the piston movement can enable the detection and correction of all of the potential screening problems outlined above . alternatively , the lvdt can be permanently mounted to the screening tool in mechanical communication with the nozzle piston actuator assembly , thereby simplifying the implementation into the manufacturing line . fig2 shows a side view of the structure , with the alternative mounting . screener 5 supports the paste dispenser 20 and the variable differential transformer 110 . pressure cylinder 50 is also supported , by conventional means not shown . in this case , a clamping mechanism 45 clamps to piston shaft 42 and supports core 105 . fig3 shows the output of the lvdt charted versus time for real - time paste usage data from normal manufacturing screening operation . time is on the x - axis , piston displacement is on the y - axis . note the sharp piston displacement at beginning and end of each screening stroke , indicative of compliance ( entrapped air ) in the system . three segments 320 - 1 , 320 - 2 and 320 - 3 slant downward at the same slope , showing the change in piston position as the paste is dispensed . at the end of each segment , the pressure in cylinder 50 is dropped , to stop the flow of paste . when that happens , the piston retracts or “ springs back ” as the entrapped air in the paste , released from the pressure of the piston , forces the piston upward . the vertical height of the upward restoring deflection is a measure ( referred to as the compression signal ) of the amount of entrapped air in paste 20 . those skilled in the art will appreciate that the amount of entrapped air should generally be uniform through the paste and therefore that the amount of air will depend on the amount of paste remaining . analysis of the air will preferably comprise a measurement by conventional techniques of the magnitude of the piston retraction . a retraction above some limit indicates too much entrapped air and will trigger an alarm ( and initiate corrective action ). illustratively , the spring back may be tested with a full paste reservoir and with the nozzle closed at the start of a run . if desired , the spring back may be measured periodically during the run , with the alarm limit being adjusted in accordance with the remaining volume of paste . an amount of retraction that is acceptable with a full reservoir might indicate too much air when the reservoir is one quarter full . fig4 and 5 show the results of closed nozzle pressurization tests . fig4 shows results for a quarter - full nozzle . note the deflection and subsequent recovery of piston position , denoted with bracket 410 . in this test , normal pressure was applied to the piston 50 for two seconds and then released . distance 410 represents an acceptable and rather low amount of entrapped air . fig5 shows similar results for a half - full nozzle . note the increased deflection ( bracket 510 ) compared to the quarter - full nozzle . the increased deflection , which is close to twice the deflection 410 is indicative of the same ( acceptable ) concentration distributed air bubbles in the paste . increased deflection proportionate to increased reservoir volume . install a fresh nozzle on the screener and conduct a trapped air test by applying pressure to cylinder 50 and releasing the pressure while measuring the spring back . if the amount of entrapped air is acceptable , begin application screening while measuring the application rate ( indicated by the slope of the piston displacement ). if the application rate is too high or low , take corrective action . the tested value of piston displacement rate for application of the criteria may be summed or integrated over time to smooth out fluctuations . also , fluctuations in the rate of displacement above a reference threshold may be flagged to indicate friction or stiction in the system . in the case of a stiction “ hiccup ”, the lvdt output signal will be constant for the duration of the stiction ( short compared with the duration of the dispensing period ) and then quickly shift to the slanting line 320 - i ( similar in slope to the shifts 331 and 333 ). such fluctuations may easily be detected by differentiating the piston displacement signal and testing if a spike exceeds a threshold for a time less than a spike time limit ( an additional indication being that the differentiated signal will be substantially zero for the duration of the stiction ). the spike time limit is used to discriminate between a short event , indicative of stiction or friction in the nozzle , and an excessive dispense rate for a time greater than a threshold time limit , indicative of an incorrect nozzle opening . there will be a normal spike in the derivative signal at the start and end of a segment 320 ( in fig3 ) when the entrapped air is compressed and released . that may handled by ignoring spikes within a certain time of the start and end of a stroke . a linear variable differential transformer is the preferred unit to generate the output signals but other transducers that report piston displacement such as optical encoders , capacitive sensors , etc . may be used . while the invention has been described in terms of a single preferred embodiment , those skilled in the art will recognize that the invention can be practiced in various versions within the spirit and scope of the following claims .	6
the present disclosure describes magnetic coupling devices and associated methods . several specific details of the invention are set forth in the following description and in fig1 - 7g to provide a thorough understanding of certain embodiments of the invention . one skilled in the art , however , will understand that the present invention may have additional embodiments , and that other embodiments of the invention may be practiced without several of the specific features described below . for example , while selected dimensions may be provided on various figures , these dimensions are for illustrative purposes only . in other embodiments , the magnetic coupling device and associated components can have significantly different dimensions than are shown in the illustrated embodiment . the magnetic coupling system 100 , shown in fig1 - 7g , can include a magnet rotor assembly 110 and a conductor assembly 120 . the magnet rotor assembly 110 can be coupled to a first shaft 111 ( shown in fig2 ) and the conductor assembly 120 can be coupled to a second shaft 121 ( shown in fig2 ). the magnet rotor assembly 110 and / or the conductor assembly 121 can be coupled to the respective shaft ( s ) using various methods , for example , by using fasteners , a friction / interference fit , set screws , and / or shaft keys ( shown in fig2 ). when the magnet rotor assembly 110 and a conductor assembly 120 are coupled to the first and second shafts 111 and 121 , the magnetic coupling system 100 can be used to transfer rotational movement of one shaft to the other shaft ( e . g ., coupling the shafts ). for example , a motor can apply a rotational force ( e . g ., torque ) to the first shaft 111 and the magnetic coupling system 100 can transmit the rotational force to the second shaft 121 . in certain embodiments , the magnetic coupling system 100 can be used as a clutch - type system to allow engagement and disengagement ( e . g ., coupling and decoupling ) of the first shaft 111 and the second shaft 121 . in other embodiments , the magnetic coupling system 100 can be used to buffer movement between the first shaft 111 and the second shaft 121 by allowing one shaft to smoothly transition to another rotational speed in response to a sudden change in the rotation of the other shaft . the magnetic rotor assembly 110 can include a first shaft mount 112 , one or more magnet holders 113 , and one or more magnets 114 in each holder . the magnet holder 113 can be made of various materials , for example , a plastic , a metal , or a ceramic . in certain embodiments , the first shaft mount 112 and the magnet holder 113 can be an integral unit . in the illustrated embodiment , the magnet holder 113 is coupled to the first shaft mount 112 , which in turn can be coupled to the first shaft 111 ( shown in fig2 ). twelve magnets 114 are coupled to the magnet holder 113 . the twelve magnets are shown as a first magnet 114 a , a second magnet 114 b , a third magnet 114 c , a fourth magnet 114 d , a fifth magnet 114 e , a sixth magnet 114 f , a seventh magnet 114 g , an eighth magnet 114 h , a ninth magnet 114 i , a tenth magnet 114 j , an eleventh magnet 114 k , and a twelfth magnet 114 l . as shown in the illustrated embodiment , the magnets can be arranged symmetrically around the magnet holder 113 with adjacent magnets arranged so that they present opposite poles on each side of the magnet holder 113 . other embodiments can have more or fewer magnets 114 and / or other arrangements and geometry ( e . g ., magnets can be stacked end - to - end , positive pole opposite negative pole , in openings around a magnet holder having a different size and shape than the magnet holder 113 shown in the illustrated embodiment ). the conductor assembly can include a second shaft mount 122 and an electro - conductive material 123 . in the illustrated embodiment , the second shaft mount 122 includes two portions shown as a top portion 122 a and a bottom portion 122 b . other embodiments can have more or fewer portions and / or other arrangements ( e . g ., a left portion and a right portion ). in the illustrated embodiment , the top portion 122 a and the bottom portion 122 b are configured to be coupled around a shaft using fasteners . the second shaft mount 122 can carry one or more electro - conductive material sections 123 . four electro - conductive material sections are shown in the illustrated embodiment , as a first electro - conductive material section 123 a , a second electro - conductive material section 123 b , a third electro - conductive material section 123 c , and a fourth electro - conductive material section 123 d . the first and second electro - conductive material sections 123 a and 123 b are coupled to the top shaft mount section 122 a and the third and fourth electro - conductive material sections 123 c and 123 d are coupled to the bottom shaft mount portion 122 b . in other embodiments , the conductor assembly can include more or fewer electro - conductive material sections 123 and / or other arrangements ( e . g ., the electro - conductive material sections 123 can be integral with the second shaft mount 122 ). when the second shaft mount 122 is coupled to the second shaft 121 ( shown in fig2 ), the second shaft 121 , the second shaft mount 122 , and the electro - conductive material sections 123 can rotate as a unit . the split arrangement of the conductor assembly 120 , described above , can simplify handling , installation , and adjustment of the magnetic coupling system 100 . for example , the magnet rotor assembly 110 can be installed on to the first shaft 111 ( shown in fig2 ). the first shaft mount 112 can be positioned on the first shaft 111 so that the end of the first shaft 111 is flush with a face of the first shaft mount 112 . the first shaft mount 112 can then be coupled to the first shaft 111 so that the conductor assembly 120 and the first shaft 111 can turn as a unit . in the illustrated embodiment , one or more shaft keys and an interference fit ( e . g ., the first shaft mount 112 is pressed onto the first shaft 111 ) are used to couple the first shaft 111 to the magnet rotor assembly 110 . as discussed above , in other embodiments , other methods ( e . g ., fasteners and / or set screws ) can be used to couple the first shaft mount 112 to the first shaft 111 . the top portion 122 a and bottom portion 122 b of the second shaft mount 122 can then be positioned around the magnet holder 113 . the magnet rotor assembly 110 and the conductor assembly 120 can be configured so that when the second shaft mount 122 is positioned around the magnet holder 113 , the first shaft mount 112 and the second shaft mount 122 fit together to provide a selected amount of space between the magnet holder 113 , with the associated magnets 114 , and the electro - conductive material sections 123 . for example , a gapping tool or gauge can be inserted through the holes shown in the second shaft mount 122 to measure and / or adjust a gap between a portion of the second shaft mount 122 and the magnet holder 113 before the second shaft mount 122 is coupled to the second shaft 121 . in other embodiments , the magnetic coupling system 100 can use other methods for controlling / adjusting the gap between the magnets 114 / magnet holder 113 and the electro - conductive material sections 123 ( e . g ., a spacer element with a bushing centrally located between the magnet holder 113 or the first shaft mount 112 and the second shaft mount 122 ). once the conductor assembly 120 is positioned relative to the magnet holder 113 and first shaft mount 112 , the second shaft mount 122 can be coupled to the second shaft 121 so that the second shaft 121 and the conductor assembly can turn as a unit . in the illustrated embodiment , one or more shaft keys and fasteners ( e . g ., fasteners that cause the first and second portions 122 a and 122 b of the second shaft mount 122 to tighten around the second shaft 121 ) are used to couple the second shaft mount 122 to the second shaft 121 . as discussed above , in other embodiments , other methods ( e . g ., an interference fit and / or set screws ) can be used to couple the first shaft mount 112 to the first shaft 111 . as discussed above , with the magnet rotor assembly 110 coupled to the first shaft 111 and the conductor assembly 120 coupled to the second shaft 121 when a rotational force is imparted to one shaft the force can be transferred to the other shaft via the magnetic coupling system 100 . for example , if the first shaft 111 is rotated , the first shaft mount 112 , the magnet holder 113 , and the magnets 114 will rotate with the first shaft 111 . as the magnets rotate relative to the electro - conductive material sections 123 , magnetic friction will cause the electro - conductive material sections 123 to move . as the electro - conductive material section 123 moves the second shaft mount 122 will move , thereby moving the second shaft 121 . the position of the magnets 114 relative to the conductive material sections 123 can determine the strength of the magnetic friction and thereby the ability of the magnetic coupling system 100 to transfer rotational forces and / or motion between one shaft and the other . for example , increasing the space or gap between the magnets 114 and the electro - conductive material sections 123 , shown as a first gap 130 a and a second gap 130 b in fig3 b , can reduce the strength of the magnetic friction between the magnets 114 and the electro - conductive material sections 123 . in other embodiments , the magnets 114 can be positioned to rotate so that only a portion of each magnet 114 passes between electro - conductive material sections 123 instead of the entire magnet 114 passing between electro - conductive material sections 123 , thereby reducing the strength of the magnetic friction between the magnets 114 and the electro - conductive material sections 123 . other variables can also affect the strength of the magnetic friction between the magnets 114 and the electro - conductive material sections 123 . for example , the thickness of the electro - conductive material sections 123 , whether the electro - conductive material sections 123 are solid , laminated , or plated , and the number of magnets 114 can all affect the strength of the magnetic friction between the magnets 114 and the electro - conductive material sections 123 . additionally , the material placed behind the electro - conductive material sections 123 can affect the strength of the magnetic friction . for example , if the electro - conductive materials sections 123 are copper and are backed by a ferrous material ( e . g ., at least a portion of the second shaft mount 122 is made of steel ) the magnetic friction can be stronger than if the electro - conductive material sections 123 are backed by a non - ferrous material ( e . g ., aluminum and / or plastic ). the manner in which the electro - conductive material sections 123 are positioned relative to each other can also affect the strength of the magnetic friction and / or the consistency of the magnetic friction as the magnet rotor assembly 110 and the conductor assembly 120 rotate . for example , if the first electro - conductive material section 123 a and the third electro - conductive material section 123 c are positioned such that they form a continuous ring around the first shaft mount 112 , as the magnet holder 113 rotates , the magnetic friction will be more consistent than if there is a gap between the first electro - conductive material section 123 a and the third electro - conductive material section 123 c . the more consistent the magnetic friction is as the magnet rotor assembly 110 and the conductor assembly 120 rotate , the smoother the rotational force and / or motion can be transferred from one shaft to the other . various methods can be used to position the electro - conductive material sections 123 to avoid gaps and / or to make combined electro - conductive material sections 123 appear to be more like a single electro - conductive material section 123 ( e . g ., make the combined sections appear to be more nearly homogenous ) with respect to the magnetic friction created by the relative motion between the magnets 114 and the electro - conductive material sections 123 . for example , the edges 124 a and 124 b ( fig2 ) between the electro - conductive material sections 123 where the electra - conductive material sections 123 meet and / or are joined ( e . g ., between the first electro - conductive material section 123 a and the third electro - conductive material section 123 c ) can be configured to improve this characteristic . depending on the materials used and the selected configuration , edges 124 a and 124 b of adjoining electro - conductive material sections 123 can have various arrangements , including being straight cut , cut at corresponding angles to fit together , cut in saw tooth shapes that can interlock , cut to form a tongue and groove arrangement , and / or cut to have rounded shapes ( e . g ., one concave and one convex ). in other embodiments , there may not be an edge joint ( e . g ., a solid , continuous ring / disk can be used ). a feature of some of the embodiments described above is that the magnet rotor assembly and the conductor assembly of the magnetic coupling system can be handled as separate pieces , which makes handling and installation easier than with current systems . additionally , even though the conductor assembly and the magnetic rotor assembly can be handled separately they can be easily adjusted once installed and / or during the installation process . accordingly , an advantage of these features is that the easy handling , easy installation , and / or easy adjustment of the magnetic coupling system can save time and money during the installation and / or maintenance of these systems . embodiments of the invention described above can be applied to a very wide variety of systems using a magnetic coupling or drive . for example , features of embodiments described above can be used in conjunction with selected embodiments and / or features described in u . s . pat . nos . 5 , 477 , 093 ; 5 , 477 , 094 ; 5 , 668 , 424 ; 5 , 691 , 587 ; 5 , 712 , 519 ; 5 , 473 , 209 ; and 4 , 826 , 150 . the above - detailed embodiments of the invention are not intended to be exhaustive or to limit the invention to the precise form disclosed above . specific embodiments of , and examples for , the invention are described above for illustrative purposes , but those skilled in the relevant art will recognize that various equivalent modifications are possible within the scope of the invention . for example , whereas steps are presented in a given order , alternative embodiments may perform steps in a different order . the various aspects of embodiments described herein can be combined and / or eliminated to provide further embodiments . although advantages associated with certain embodiments of the invention have been described in the context of those embodiments , other embodiments may also exhibit such advantages . additionally , none of the foregoing embodiments need necessarily exhibit such advantages to fall within the scope of the invention . in general , the terms used in the following claims should not be construed to limit the invention to the specific embodiments disclosed in the specification unless the above - detailed description explicitly defines such terms . in addition , the inventors contemplate various aspects of the invention in any number of claim forms . accordingly , the inventors reserve the right to add claims after filing the application to pursue such additional claim forms for other aspects of the invention .	7
referring now to fig1 for an overview , therein is shown a conventional , commercially available sample and hold circuit 9 for inputting analog signals at controlled intervals . the sample and hold circuit 9 is connected to d / a converter circuitry 10 which outputs to a / d converter circuitry 12 . the a / d converter circuitry 12 is powered from a bootstrap power supply 14 . the d / a and a / d converter circuitry are controlled by control logic circuitry 16 directed by a conventional , commercially available microprocessor 15 which is connected to conventional calibration memory 17 . the d / a converter circuitry 10 uses reference voltages , or potentials , from precision voltage reference circuitry 18 . the d / a converter circuitry 10 includes a d / a amplifier 11 with a ladder resistor network 13 . the ladder resistor network 13 is made up of a plurality of ladder resistors , seven in the preferred embodiment , designated serially by the numbers 19 through 25 . each of the resistors has a value which is a multiple of the preceding resistor to make the resistors binary weighted . the ladder resistor network 13 at one end , is connected to the negative or inverting input of the d / a amplifier 11 . the other end of each of the ladder resistors in the network is connected to a pair of digital controlled ladder switches which are respectively , individually , designated by the numerals 26 through 37 . the ladder resistor 25 is connected to the positive voltage of the reference circuitry 18 to provide a permanent offset to the potential at the inverting input of the d / a amplifier 11 . of each pair of ladder switches , the odd numerals 27 , 29 , 31 , 33 , 35 , and 37 are connected to the negative voltage reference circuitry 18 while the even numerals 26 , 28 , 30 , 32 , 34 , and 36 are connected to an analog common ground designated by the numeral 8 . disposed across the d / a amplifier 11 is a d / a gain setting resistor 38 . the output of the d / a amplifier 11 is connected to the a / d converter circuitry 12 and in particular has an operative connection to an a / d amplifier 40 . the a / d comparator / amplifier 40 is bridged by an a / d gain setting resistor 44 connected to the output node 45 . the a / d gain setting resistor 44 is connected at one end to an a / d input resistor 42 , which is connected at its other end to the d / a amplifier 11 and to an autozero ( az ) storage capacitor 46 at the same end . the az storage capacitor 46 is further connected to the negative input of the a / d comparator / amplifier 40 . the negative input of the a / d comparator / amplifier 40 and the output of the a / d comparator / amplifier 40 is further bridged by a digitally controlled az switch 47 which is one of a group of switches which may be described as amplifier control switches . a store 1 or store 2 switch 48 is disposed between the output of the a / d comparator / amplifier 40 and the a / d gain setting resistor 44 . a digitally controlled &# 34 ; compare &# 34 ; switch 50 is connected to the junction between the store 1 or store 2 switch 48 and the a / d gain setting resistor 44 and connects the junction to the analog common 8 in its conductive condition . the positive input of the a / d comparator / amplifier 40 is connected to a digitally controlled &# 34 ; az &# 34 ; switch 49 . bridging the positive input and the output of the a / d comparator / amplifier 40 are two pairs of digitally controlled switches , &# 34 ; store 1 &# 34 ; switch 52 and &# 34 ; store 3 &# 34 ; switch 54 in parallel with &# 34 ; store 2 &# 34 ; switch 53 and &# 34 ; store 4 &# 34 ; switch 55 . connected between the store 1 switch 52 and store 3 switch 54 is a &# 34 ; a storage &# 34 ; capacitor 58 which is connected to the analog common 8 . between the store 2 switch 53 and the store 4 switch 55 is a connection to a &# 34 ; b storage &# 34 ; capacitor 60 which is further connected to the analog ground 8 . the main analog input over lead 64 is connected to the sample and hold circuit 9 and then via a digitally controlled &# 34 ; input &# 34 ; switch 62 to the positive input of the a / d comparator / amplifier 40 . the bootstrap ( bs ) power supply 14 is connected to the a / d converter circuitry 12 and includes a &# 34 ; bs follower &# 34 ; amplifier 66 which is bridged across its negative input and output by a bs follower resistor 68 . the negative input of the bs follower amplifier is connected by a bs input limit resistor 70 and a pair of opposed limiting zener diodes 72 and 73 to the output of the a / d amplifier 40 . the positive input of the bs follower amplifier 66 is connected to the positive input of the a / d comparator / amplifier 40 and the input switch 62 , store 3 switch 54 , store 4 switch 55 and autozero switch 49 . the output of the bs follower amplifier 66 is connected between two supply setting zener diodes 76 and 78 which at their opposite extremities are connected to plus and minus bias resistors 80 and 82 , respectively . the extreme ends of the bias setting resistors 80 and 82 are respectively connected to positive and negative source potentials . the junctions between the supply setting zener diodes 76 and 78 and the plus and minus bias resistors 80 and 82 are respectively connected to the bases of &# 34 ; supply follower &# 34 ; transistors 84 and 86 , respectively . the supply followers 84 and 86 are disposed between the plus and minus source potentials . disposed between the supply follower transistors 84 and 86 is a capacitor 87 . the supply follower transistor proximate leads 88 and 90 are connected as the power supply of the a / d comparator / amplifier 40 . referring now to the precision voltage reference circuitry 18 , therein is shown a positive temperature coefficient zener diode 92 with a setable , opposing temperature coefficient emitter base junction of transistor 94 . the transistor and zener are packaged in a single isotherminal package generally designated as reference amplifier 90 . the reference amplifier 90 has connected thereto a collector resistor 96 . zener current / source resistor 100 is connected from node 118 to cathode of zener node 90 and second zener current / source resistor 98 is connected between node 112 and cathode of zener 92 . the collector and base of the transistor 94 is bridged by a capacitor 101 and the base of the transistor 94 is further connected to a resistor 102 . the resistor 102 is connected by a node 103 to a resistor network made up of resistors 104 and 105 . the resistor 104 connects the resistor 102 to analog common 8 , 106 and the resistor 105 connects the resistor 102 to a node 107 which is connected to the diode 92 and to the emitter distant end of the second emitter resistor 98 . the operational amplifier 106 has its positive input connected to the ground 8 and its negative input connected between the reference amplifier 90 and the collector resistor 96 . the output of the operational amplifier 106 is connected to a diode 108 . the diode 108 in turn is the regulated negative voltage source by a resistor 110 to a negative voltage reference output node 112 . this negative output node 112 is further connected to the zener current source resistor 98 and the node 107 . the negative output node 112 is further connected to a resistor 114 which is connected in turn to the negative input of an operational amplifier 116 . the positive input of the operational amplifier 116 is connected to the ground 8 and the output is connected to a positive voltage reference output node 118 . the output node 118 is further connected by a gain setting resistor 120 to the negative input of the operational amplifier 116 . the negative output node 112 , outside the precision voltage reference circuitry 18 , is connected by lead 122 to the switches 35 and 37 ; by the lead 124 to the switches 31 and 33 ; by the lead 126 to the switch 29 ; and by the lead 128 to the switch 27 . the positive output node 118 is connected by the ladder resistor 25 to the ladder resistor network 13 in the d / a converter circuitry 10 . the initial phase of operation includes a calibration phase which will be described later because it is easier to understand after the operation of the remainder of the system is understood . the second phase of operation is the autozero phase during which the system is in a quiescent state with all the voltage levels fixed and no changes movement of any of the levels at any of the amplifier or resistor networks . during autozero , the autozero switches 47 and 49 are turned on . the autozero switch 49 connects the positive input of the a / d comparator / amplifier 40 to the analog common 8 and the autozero switch 47 connects the output thereof to the negative input proximate the a / z storage capacitor 46 . all the offsets from the d / a amplifier 11 , the ladder resistor network 13 , and the a / d amplifier / comparator 40 are imposed on the autozero storage capacitor 46 . all of the other switches in the a / d converter circuitry 12 are off . the d / a amplifier / comparator 11 output is set to zero by turning on switches 27 , 28 , 30 , 32 , 34 and 36 . switches 26 , 29 , 31 , 33 , 35 and 37 are turned off . the first operative phase of the analog to digital conversion begins when the microprocessor 15 provides directions to start the compare phase . during the compare phase , the analog input which is present at the sample and hold circuit 9 is applied to the positive input of the a / d comparator / amplifier 40 through input switch 62 which is turned on . further , the compare switch 50 is turned on . when the input signal is applied , the output of the d / a amplifier 11 will still be that of the analog common ground 8 and the analog input would cause the output of the a / d comparator / amplifier 40 to be at one extreme or the other depending upon the polarity of the analog input . it should be noted that the present invention is operative for the entire range of negative to positive polarity analog inputs without a need for sensing polarity . after a trigger from microprocessor 15 , the control logic circuit 16 will start opening and closing the digital switches 26 through 37 on and off to selectively connect the ladder resistors 19 through 24 into the connection between the input of the d / a amplifier 11 and the negative output node 112 or common 8 . the selective turn - on of the ladder switches 26 through 37 causes the output of the d / a amplifier 11 to start ramping in steps from minus full scale to plus full scale . at each step , the output of the a / d comparator / amplifier 40 operating in its comparator mode is checked for polarity . if polarity is positive , the particular ladder switch is left on and then the next switch is activated for the next resistor connection . if polarity is negative the particular switch is turned off , and the other switch of the pair is turned on to connect that resistor to the analog common ground 8 . in all cases , for both polarities of input , the current always flows through the ladder switches in the same direction . this is because it has been discovered that conventional bidirectional switches exhibit sufficient differences in resistance to current flow in different directions to cause noticable errors in high precision instruments of the type embodying the current invention . as each of the resistors in the ladder resistor network 13 is tried , the control logic circuit 16 remembers which of the ladder resistors is left connected to the negative output node 112 . since the ladder resistors are binary weighted , each of the resistors selected during the above process represents the closest digital equivalent of the analog input at the positive input of the a / d comparator / amplifier 40 . the output of the a / d comparator / amplifier 40 is thus below the next complete digit and may be termed a &# 34 ; remainder &# 34 ;. in this fashion , the first digit is determined and the portion of the input signal representative thereof is subtracted from the positive input to the a / d comparator / amplifier 40 . to store the remainder being outputted from the a / d comparator / amplifier 40 the compare switch 50 is turned off and the store 1 or store 2 switch 48 is turned on . the input switch 62 is left on and the store 1 switch 52 is turned on to connect the output of the a / d comparator / amplifier 40 to the a storage capacitor 58 . during this next phase , the a / d comparator / amplifier 40 is no longer used as a comparator and instead is used as an amplifier . in the amplifier mode , inputs to the positive input of the a / d comparator / amplifier 40 are multiplied by a predetermined factor . in the preferred embodiment , the predetermined factor that the remainder is multiplied by is 16 . the amplified output then charges the a storage capacitor and a time delay is provided to allow the a / d comparator / amplifier 40 to stabilize after charging the a storage capacitor 58 . then the store 1 switch 52 is turned off . finally , the input switch 62 is also turned off to complete this amplifier or remainder storage phase . in the next phase , the a / d comparator / amplifier 40 is then reconfigured into its comparator mode . the compare switch 50 is turned on and the store 1 or store 2 switch 48 is turned off . with the store 3 switch 54 turned on , the compare phase cycle is restarted . the charge that was stored on the a storage capacitor 58 now replaces the original analog signal as the input to the positive input of the a / d comparator / amplifier 40 . as before , the ladder switches are opened and closed by the control logic circuit 16 and the a / d amplifier / comparator 40 in its comparator mode is monitored for its output polarity . if a particular ladder switch causes the output polarity to be negative , that particular switch is removed from the connection to the negative output node 112 . after each of the six ladder switches have been tried , those resistors that remain connected to the precision voltage reference circuitry 18 represent the digital equivalent of the analog voltage which is the predetermined number of times the remainder from the previous compare phase . it is in this fashion that the first significant bits of the remainder are determined . the circuit is then switched so that the a / d comparator / amplifier 40 is changed into the amplifier mode . the compare switch 50 is turned off and the store 1 or store 2 switch 48 is turned on . the store 3 switch 54 is left on and the input from the d / a amplifier and the potential from the a storage capacitor 58 is applied to the positive input of the a / d comparator / amplifier 40 . the difference between the output of the d / a amplifier and the charge from the a storage capacitor 58 is multiplied by the predetermined factor and appears at the output node 45 . during this phase , the potential at the output node 45 is applied to the b storage capacitor 60 through the store 2 switch 53 . after a sufficient time delay for the a / d comparator / amplifier 40 to stabilize , the store 2 switch 53 is opened and the charge across b storage capacitor 60 represents the predetermined number times the difference between the d / a output and the charge previously on the a storage capacitor 58 . this time , however , the digital information representing the ladder bits which were called during the last compare phase are equal to one - sixteenth the values represented by the same bits when they were called during the first compare phase . now , the compare phase and the amplification phases are repeated ; the compare phase is repeated three times and the amplification phase twice . each time the compare and amplification phases are repeated , the role of the a and b storage capacitors 58 and 60 , respectively , are exchanged . during each compare mode when the last one or two ladder switches are tested , it is possible for the comparator mode connected a / d amplifier / comparator 40 to be not settled and to have its output polarity incorrectly interpreted by the control logic circuitry 16 . this situation will cause a ladder switch to be incorrectly selected and the final digital representation of the analog input to be in error . the point where comparator errors are most likely to appear is at the cardinal points or points where the input voltage level is very near the value where there are major changes of ladder switch patterns , such as 101111 to 110000 . in the original recirculation of the remainder system , if the ladder switch is selected incorrectly such that its corresponding analog level is slightly larger than the applied input , the final digital result will be in error by the difference and in most cases , the a / d converter will have some missing values or codes near cardinal points . generally a cardinal point is most noticable between two closely spaced readings which result in major changes of ladder switch patterns . in the past , any mismatch of ladder switches or resistors caused major discontinuities in th linearity curve . for example , for equally spaced increments of input voltage , successive digital readings might be : ______________________________________desired actual______________________________________09995 0999509996 0999609997 0999709998 09997 ( discontinuity ) 09999 09997 ( discontinuity ) 10000 1000010001 1000110002 10002______________________________________ in the present invention the cardinal point errors are eliminated because of a self correction scheme embeded in the topology of the circuit . in the preferred embodiment , the equivalent value of the ladder resistors 19 through 24 are weighted sixteen to one . there is also the ladder resistor 25 which has a negative sixteen weight to start the binary digits from a negative ( or offset ) value . this means switch 26 on will result in zero output from the d / a amplifier 11 . with six switches , the switch patterns of each recirculation overlap by two . thus , if an error is made during one of the recirculations of the remainder , the error is added to the remainder and affects the switch pattern in the next recirculation to be cancelled or substracted out . after all the phases are completed , a register in the control logic circuit 16 has a binary representation of the analog signal that was applied at the input 64 . this binary data is then shifted out six bits at a time serially onto an interface bus , to be later described , that is connected to the microprocessor 15 . the microprocessor 15 then rearranges the data and inserts the appropriate correction factors to correct for errors due to the ladder resistor network 13 , the various switches in the a / d converter circuitry 12 , and the voltages from the precision voltage reference circuitry 18 . while the data is being transferred form the control logic circuit 16 through the bus interface 70 , the a / d converter circuitry 12 is placed back in its autozero phase . the bs power supply 14 enhances the performance of the a / d amplifier / comparator 40 by generating a power supply which tracks the input to the a / d comparator / amplifier 40 . it also serves to limit the output excursion of the a / d comparator / amplifier 40 when it is used in the comparison mode . when the a / d comparator / amplifier 40 is in the autozero phase or in the amplifier phase , the bootstrap follower amplifier 66 is connected as a follower . the output of the bs follower amplifier 66 tracks the voltage at its positive input . th positive input of the bs follower amplifier 66 is connected to the positive input of the a / d comparator / amplifier 40 . the output of the bs follower amplifier 66 is connected at the junction of the two zener diodes 76 and 78 . these two zener diodes 76 and 78 set the operating points for the plus and minus supply follower transistors 84 and 86 , respectively . the transistors 84 and 86 are set up so as to provide a bootstrap power supply via leads 88 and 90 to the a / d comparator / amplifier 40 . thus , the bootstrap power supply 14 provides a power supply that bootstraps on tracks the a / d amplifier / comparator 40 inputs so it never sees a common mode input signal . this makes it feasible to use a lower grade amplifier than heretofore believed possible for the a / d comparator / amplifier 40 . when the a / d comparator / amplifier 40 is used in the comparator mode , its output is driven to supply extremes in either polarity depending on the input signal . when this occurs , the output devices in the amplifier become saturated and do not recover in time to perform as a linear amplifier when the circuit is changed into an amplifier . therefore , the bootstrap power supply 14 includes components so that it can limit supply voltages and thus limit the output excursions of the a / d comparator / amplifier 40 to make it recover more quickly after it has been overloaded during the compare phase . this is accomplished by resistor 70 and two zener diodes 72 and 73 , connected back to back which are connected between the negative input to the bs amplifier 66 and the output of the a / d comparator / amplifier 40 . when the output of the a / d comparator / amplifier 40 exceeds a predetermined level , the zener diodes break over and convert the configuration of the bootstrap follower amplifier 66 from a follower mode into an operational mode and thus it becomes an inverting amplifier . as an inverting amplifier , the bootstrap amplifier 66 limits the output of the a / d comparator / amplifier 40 by limiting its power supply . this limiting of the output level of the a / d amplifier / comparator 40 makes it possible for the amplifier to very quickly return to its linear mode of operation during the amplifier phase . the precision reference voltage circuitry 18 provides a positive and negative reference voltage source which has excellent long - term stability , small temperature coefficient , and is presettable to a desired output voltage without production manual adjustments . the reference amplifier 90 and the collector resistor 96 are selected to set the current through transistor 94 such that the temperature coefficient of the emitter base voltage of transistor 94 is exactly equal to the temperature coefficient of the zener diode 92 . the net temperature coefficient of the zener diode 92 and the base emitter voltage of the transistor 94 is zero for the voltage between the nodes 103 and 107 . the reference amplifier 90 provides the needed voltages to properly bias the operational amplifier 106 and to scale the stable voltage between nodes 103 and 107 to desired voltage levels between the analog common ground 8 and the negative output node 112 . the operational amplifier 106 is an active device that controls negative voltage levels at the negative output node 112 . the resistor network made up of the resistors 104 and 105 also set up the desired output voltage between the analog ground 8 and the negative output node 112 . the diode 108 and the resistor 110 ensure that the output at the negative output node 112 is always negative . the portion of the precision reference voltage circuitry 18 which outputs a positive precision reference voltage at the positive output node 118 consists of the operational amplifier 116 and two gain setting resistors 114 and 120 . this circuit provides the desired positive output and it is the stable source for setting the required zero temperature coefficient current for the reference amplifier 90 via the resistor 96 . the positive and negative output voltages provide the precise voltage levels needed to set the desired current for the reference zener diode 92 via resistors 98 and 100 . in effect , the reference amplifier 90 can be considered part of an operational amplifier . the base of the reference amplifier transistor 94 and the resistor 102 is the non - inverting input and the emitter of the reference amplifier transistor 94 is the inverting input . diode 108 and resistor 110 with amplifier 106 make up the output portion of the operational amplifier . essentially , the output voltage at the negative output node 112 would be more negative than the node 103 by the voltage across the zener diode 92 plus the offset voltage of the operational amplifier . the effective operational amplifier will have an input offset voltage that has an adjustable temperature coefficient set by the selection of the value of the collector resistor 96 . the zener diode 92 has a positive temperature coefficient and so the equivalent operational amplifier will have an adjustable negative temperature coefficient . thus , with proper selection of the collector resistor 96 during testing of the reference amplifier 90 , the voltage between the base of the transistor 94 and the negative output node 112 will be a temperature and time independent stable voltage . the voltage at the negative output node 112 with respect to the analog common ground 8 can be adjusted to any level larger than the voltage across the zener diode 92 plus the voltage across the base emitter junction of the reference transistor 94 . since the resistors 104 and 105 are in one precision network , the division can be made very stable . the positive reference voltage at the positive output node 118 is generated with an inverting amplifier using a gain of minus one . the gain is set up by the ratio of the two resistors 114 and 120 which are in one network and which can be made very stable . the voltage offset and the voltage temperature coefficient can cause some errors , but for this ( a / d ) application , the errors are negligible . in actual production , it has been found that the precision voltage reference circuitry 18 is unique for several reasons . first , the output voltage of the circuit can be very precisely set by laser trimming the resistor network consisting of the two resistors 104 and 105 during testing of the reference amplifier 90 . the collection of components then can be installed in a larger system without the requirement of manually selecting resistors or adjusting a control . second , the circuit places the reference amplifier 90 in an electrical environment that duplicates the environment in which the device was originally tested . the resistor 102 makes the resistance looking away from the base appear to be the same as that in a test environment . the resistors 98 and 100 make the source resistance for the zener current for the reference zener 92 to be the same as in the test environment , and third , the complete circuit can be built using only seven components . referring now to fig2 therein is shown the contents of the block designated as the control logic circuitry 16 . a prescaler 302 receives a set frequency input signal from the instrument ( not shown ) containing the a / d converter . the signal is provided to a main counter 304 . the main counter 304 is connected to a watchdog timer , 306 . the main counter 304 is further connected to a timing control 314 which provides signals ( according to the timing diagram to be hereafter described ) to a first - in first - out ( fifo ) register 312 which forwards signals to tristate buffers 310 . connected to the timing control 314 is an &# 34 ; and / or select &# 34 ; logic 316 . where not otherwise designated , these are all conventional components assembled in well - known configurations or would be obvious to those skilled in the art from the description . the timing control 314 further has output leads 318 , 320 , 322 , and 324 connected to a sample and hold circuit 9 ( shown in fig1 ). the main counter 304 is still further connected to watchdog timer 306 that is used to check to make sure that microprocessor 15 interogates the system periodically and , if it does not , it will be assumed that the microprocessor program counter has lost its place and will cause the microprocessor 15 to reset thus initializing the software and the a / d status to a known state . the watchdog timer 306 is connected to a reset gating circuit 325 ( for resetting the microprocessor 15 as described above ) and to a lead 326 to the bus interface 70 . the bus interface 70 is connected by a lead 328 to the watchdog timer 306 . the bus interface 70 is further connected by a lead 330 to the trigger control 308 and is connected by leads 332 , 334 , 336 , 338 , 340 , and 342 from the tristate buffers 310 . each of these leads is individually connected from the tristate buffers 310 to the and / or select logic 316 . a lead 344 connects the timing control 314 to the bus interface 70 and a lead 346 connects the timing control 314 to the output node 45 . the and / or select logic 316 is connected by leads 348 , 350 , 352 , 354 , 356 , and 358 to the ladder switches 26 , 28 , 30 , 32 , 34 , and 36 , respectively ( shown in fig1 ). the and / or select logic 316 is further connected by lead 360 to the compare switch 50 and by the lead 362 to the autozero switch 47 and 49 . the and / or select logic 316 is further connected by leads 364 , 365 , 366 , 370 and 372 respectively to the amplifier control switches 52 , 48 , 53 , 54 , and 55 . a lead 368 is connected to the input switch 62 . in order to understand the operation of the entire analog to digital converter , it is necessary to reference the flow chart in fig .&# 39 ; s 3 , 4 , and 5 , sequentially , and the wave form diagrams of fig .&# 39 ; s 6 and 7 simultaneously . initially , the a / d converter is in a standby state in which the output signals on leads 318 and 320 are on , the signals on leads 322 and 324 are off , and the autozero mode is in effect . in the autozero mode , there are signals on leads 348 for the ladder switch 26 and the lead 362 for the autozero switch 47 and 49 and no signals on : the leads 350 , 352 , 354 , 356 , and 358 for the other ladder switches ; the lead 360 to the compare switch 50 ; and the leads 364 , 366 , 368 , 370 , and 372 which are for the amplifier control switches . after the triggering input is provided as indicated by the decision block 402 , the output on lead 320 is turned off as shown at block 404 . next , a predetermined period of time passes as shown by delay block 406 before the signal on lead 318 is turned off and the signal on lead 322 is turned on by the timing control 314 . with reference to fig6 which is a timing diagram which depicts the various wave forms imposed on leads 318 , 320 , 322 , and 324 , it may be seen that the wave forms change at points 502 , 504 , and 506 . after the predetermined delay as indicated by block 410 , the autozero mode is turned off as indicated by block 412 . the wave forms involved are shown at points 522 and 508 in fig7 . as a point of reference , it should be noted that the points 508 and 510 are identical in fig .&# 39 ; s 6 and 7 . next , the input mode is turned on as indicated by block 414 as the input switch 62 remains closed between points 508 and 510 . while the input mode is turned on , the digit selection process ( process by which the bits which make up the digit are selected ) indicated by block 416 is implemented . this is a subroutine which is shown in fig5 and which will be discussed in greater detail later . when the digit selection process is completed , the input mode is turned off as indicated by block 418 and at point 510 in fig6 and 7 . next , the a capacitor mode is activated by turning on the switch 54 at the point 528 in fig7 . after the a capacitor switches are turned on , a pair of simultaneous processes occur . the first process is the digit selection process of block 438 , which is the subroutine shown in fig5 repeated . the second process which relates to the sample and hold circuit 9 begins with a predetermined time delay as indicated by block 422 after which the signal on the 322 is turned off as shown by block 424 and point 512 in fig6 . another predetermined delay occurs at block 426 and then the signal on lead 324 is turned on in block 428 as indicated at point 514 in fig6 . the signal remains on for a predetermined period as indicated by block 430 and then it is turned off at block 432 and point 516 . after a further time delay indicated by block 434 , the signals on leads 318 and 320 are turned on as indicated by block 436 and the points 518 and 520 which occur shortly thereafter . it should be noted from the dotted lines in fig .&# 39 ; s 6 and 7 that the signals are not turned on and off simultaneously but rather are generally staggered so that one signal will terminate before another begins . this &# 34 ; break before make &# 34 ; has contributed to system accuracy by eliminating error inducing transients . by the time the block 436 occurs , the digit selection process of 438 will be completed and the program will proceed to block 440 where the a capacitor switches will be turned off with switch 54 being turned off at point 532 . next , the b capacitor mode is activated as indicated by block 442 and point 536 . next , the digit selection process is repeated for the remaining remainder as indicated by block 444 . after completion of the digit selection process in block 444 , the b capacitor switches are turned off as indicated by the block 446 and the a capacitor switches are turned on as indicated by block 448 and then the digit selection process is repeated for the remaining remainder as indicated by block 450 . after completion of the bit selection process , the a capacitor switches are turned off as indicated by block 452 and the b capacitor switches are turned on as indicated by block 454 . next , the digit selection process is repeated as indicated by block 456 and then the b capacitor switches are turned off as indicated by block 458 . during the capacitor charging process the remainder value is being stored . this remainder value storage occurs four times between wave form points 524 to 526 , 533 to 534 , 538 to 540 , and 546 to 548 . at that point , the autozero is turned on as indicated by block 460 and point 558 . the digit selection process could continue to be repeated for additional digits ; however , at this point in the preferred embodiment the autozero is turned on as indicated by block 460 and point 558 . next , a &# 34 ; dataready &# 34 ; signal is sent to the microprocessor 15 as indicated in block 462 . when the &# 34 ; dataready &# 34 ; signal is received as indicated by the decision block 464 , the control 314 and logic circuit 16 sends 5 bytes of data from the fifo buffer 312 to the microprocessor 15 for processing 466 and the program returns to the decision block 402 in fig3 to recycle the system for the next analog to digital conversion . referring now to fig5 therein is shown the digit selection process subroutine which starts off at block 470 where switches 26 , 28 , 30 , 32 , 34 , or 36 are turned on , the corresponding paired switch 27 , 29 , 31 , 33 , 35 or 37 is turned off . after a predetermined time delay as indicated by block 472 the first ladder switch 27 is turned on at block 474 . the switch 27 is left on for a predetermined period as indicated by block 476 until the output of the d / a amplifier 11 output polarity is determined by block 478 . if the polarity has changed , the switch 27 will be turned off at block 480 and if it has not it will be left on . in either event , the program will proceed through a further time delay as indicated by the block 482 . next , the second ladder switch 29 will be turned on as indicated by block 484 and again after a predetermined time delay as indicated by block 486 a comparison will be made as indicated by decision block 490 to determine if there has been a polarity change of the a / d comparator / amplifier 40 output . this portion of the subroutine will be repeated for each of the ladder switches 31 , 33 , 35 and 37 until a polarity change occurs . if a polarity change occurs when a switch is turned on , that switch will be turned off and the program continued . with one final last time delay , the on or off condition of the ladder switches will be held in the fifo buffer 312 as indicated by the block 496 . next the a capacitor or b capacitor will be allowed to reach its final value according to the bit switch states as indicated by block 498 and then the subroutine will return back to the main program at block 416 , 438 , 444 , 450 or 456 . the memorization of the states in the fifo occur five times during the preferred embodiment program at wave form points 524 , 530 , 538 , 546 , and 554 . in the digit selection process the various ladder switches are turned on to impose the corresponding ladder resistors and thus voltages to the amplifier 11 between wave form points 508 to 524 ; 528 to 530 ; 536 to 538 ; 544 to 546 ; and 552 to 554 . the tristate buffers 310 and the bus interface 70 transfer the data to the microprocesser 15 . the data transfer is byte serial bit parallel and the bytes are transferred to the microprocessor 15 in the same order as they were generated : ( first in , first out ). in the preferred embodiment each byte contains six bits with each bit representing a ladder switch state . the data transferred from the bus interface 70 to the microprocessor 15 has the following significance as shown in the table below : ______________________________________data pattern vs ladder switch onsw27 sw29 sw31 sw33 sw35 sw37______________________________________byte 1 2 . sup . 1 2 . sup . 0 2 . sup .- 1 2 . sup .- 2 2 . sup .- 3 2 . sup .- 4byte 2 2 . sup .- 3 2 . sup .- 4 2 . sup .- 5 2 . sup .- 6 2 . sup .- 7 2 . sup .- 8byte 3 2 . sup .- 7 2 . sup .- 8 2 . sup .- 9 2 . sup .- 10 2 . sup .- 11 2 . sup .- 12byte 4 2 . sup .- 11 2 . sup .- 12 2 . sup .- 13 2 . sup .- 14 2 . sup .- 15 2 . sup .- 16byte 5 2 . sup .- 15 2 . sup .- 16 2 . sup .- 17 2 . sup .- 18 2 . sup .- 19 2 . sup .- 20______________________________________ for every bit that is logic one in the data pattern transferred to the microprocessor 15 , the microprocessor 15 adds a voltage multiplied by a power of 2 as shown in the above table , adjusted for known errors of the ladder resistors 19 through 25 and stored in the calibration memory 17 . the analog to digital conversion operations have been described above ; however , to initialize the system , the microprocessor 15 calibrates the a / d converter by heuristically solving an 8 variable equation which represents the a / d analog circuitry . the exact method will be evident to those skilled in the art from the following analysis : n 1 thru n 5 =&# 34 ; nibbles &# 34 ; or the closest approximation voltage which is subtracted at each iteration of the bit selection process ; r 1 thru r 4 = remainder stored after each bit selection process ; in the preferred embodiment , the last nibble n 5 is assumed equal to r 4 without sacrificing the accuracy necessary ( i . e . remainder is discarded ). then solving for v in : a . sub . r . sup . 4 v . sub . in = a . sub . r . sup . 4 n . sub . 1 + a . sub . r . sup . 3 n . sub . 2 + a . sub . r . sup . 2 n . sub . 3 + a . sub . r n . sub . 4 + n . sub . 5 if the gain a is not exactly right , the remainder stored and therefore the conversion result will be in error . thus : a / d result = n . sub . 1 + kn . sub . 2 / a + k . sup . 2 n . sub . 3 / a . sup . 2 + k . sup . 4 n . sub . 4 / a . sup . 3 + k . sup . 4 n . sub . 5 / a . sup . 4 if it assumed that e 2 , e 3 , and e 4 are much less than 1 ( since e is less than 1 ), then : a / d result =( n . sub . 1 + n . sub . 2 / a + n . sub . 3 / a . sup . 2 + n . sub . 4 / a . sup . 3 + n . sub . 5 / a . sup . 4 )+( en . sub . 2 / a + 2en . sub . 3 / a . sup . 2 + 3en . sub . 4 / a . sup . 3 + 4en . sub . 5 / a . sup . 4 ) in the above , the four terms in the second set of parenthesis are the total error . the following equation will provide the a / d reading or result in the preferred embodiment when all of the variables are substituted with the correct numerical values : ## equ1 ## where : a , b , c , . . . h , i , j ,= switch selection patterns are ( value 0 or 1 ) the values of l1 , l2 , l3 , l4 , l5 , l6 , e , and z are nominally known and therefore , in an implementation of the a / d converter , inputs can be chosen so that specific switch selection patterns can be selected as needed . during calibration , known values of input are applied to the a / d converter and the exact values for each of the variables l1 , l2 , l3 , l4 , l5 , l6 , e , and z can be empirically determined . in the preferred embodiment , the a / d result is dependent on all of the terms of the above equation , however in the process of determining the values of the variables only the first two terms are specifically considered in the iterative program to arrive at the exact values . in practice only the difference or &# 34 ; error &# 34 ; between the real value and the ideal value is stored in the calibration memory 17 . when the a / d converter is used to make a measurement , the switch selection patterns are determined by the hardware . these pattern values are then substituted in the equation with the actual ladder values combined with the correction factors ( errors ), the e value , and the z value to arrive at the final a / d result . from the above , it will be evident that whenever a system is to be calibrated either at the factory or in the field , known external calibration signals having specific levels are imposed on the system . with the external signals intended to exercise certain bits in the system , the difference between the calibration and outputted digital signals will provide the data for determining the constants in the multivariable equation . when the calibration device ( not shown ) is subject to computer control as to the signal levels it outputs and when , the microprocessor 15 can also be computer controlled to initiate its calibration cycle to allow remote automatic calibration of the system . as many possible embodiments may be made of the invention without departing from the scope thereof , it is to be understood that all matters set forth herein and shown in the accompanying drawings are to be interpreted in an illustrative and not a limiting sense .	7
for purposes herein , a “ video player ” shall be defined as any device capable of streaming video from a network connection , including , for example , via wifi , bluetooth , a cellular data connection such as lte , a hardwired connection or via any means of connecting to a server capable of serving video at mixed bitrates . such devices include , but are not limited to smart televisions , projectors , video streaming devices ( appletv , chromecast ®, amazon fire stick , roku ™, etc . ), video gaming systems , smart phones , tablets and software - based video players running on generic computing devices . for a user to perceive the client - side video player , many components are required , including a video display screen , a video display subsystem with buffering , a networking interface , a processor of some sort in order to perform the networking functions and http processing , and logic to perform the bitrate adaptation method described in detail following ( implemented in either an integrated circuit module and or in software on a general purpose processor ). a component model of the adaptive video player is illustrated in fig1 . video player 100 makes http requests 102 to an internet - based video server 101 , requesting video segments 104 at a specific bitrate r . as video segments 104 are received they are placed in playback buffer 106 . buffer occupancy is determined by the difference between the rate at which video segments 104 are downloaded in to playback buffer 106 and the rate at which video segments 104 are removed from playback buffer 106 for rendering on a video display screen . video can be modeled as a set of consecutive video segments or chunks , v ={ 1 , 2 , . . . , k }, 104 , each of which contains l seconds of video and encoded with different bitrates . thus , the total length of the video is k × l seconds . the video player can choose to download video segment k with bitrate r k ∈ r , where r is the set of all available bitrate levels . the amount of data in segment k is then l × r k . the higher bitrate is selected , the higher video quality is perceived by the user . let q ( 19 ): r → r + be the function which maps selected bitrate r k to video quality perceived by user q ( r k ). the assumption is that q (·) is increasing . the video segments are downloaded into a playback buffer , 106 as shown in fig1 , which contains downloaded but as yet unviewed video . let b ( t ) ∈[ 0 , b max ] be the buffer occupancy 108 at time t , i . e ., the play time of the video remained in the buffer . the buffer size b max depends on the policy of the service provider , as well as storage limitations . fig2 helps illustrate the operation of the video player . at time t k , the video player starts to download segment k . the downloading time depends on the selected bitrate r k as well as average download speed c k . at time t k + 1 , when segment k is completely downloaded , the video player immediately starts to download the next segment k + 1 . if c t denotes the bandwidth at time t , then : the buffer occupancy b ( t ) evolves as the chunks are being downloaded and the video is being played . specifically , the buffer occupancy increases by l seconds after chunk k is downloaded and decreases as the user watches the video . let b k = b ( t k ) denote the buffer occupancy when the player starts to download chunk k . the buffer dynamics can then be formulated as : an example of buffer dynamics is shown in fig3 , the determination of waiting time δt k , also referred as chunk scheduling problem , is an equally interesting and important problem in improving fairness of multi - player video streaming . it is assumed that the player immediately starts to download chunk k + 1 as soon as chunk k is downloaded . the one exception is when the buffer is full , at which time the player waits for the buffer to reduce to a level which allows chunk k to be appended . formally , the ultimate goal of bitrate adaptation is to improve the qoe of users to achieve higher long - term user engagement . a flexible qoe model , as opposed to a fixed notion of qoe is therefore used . while users may differ in their specific qoe functions , the key elements of video qoe are enumerated as : average quality variations — this tracks the magnitude of the changes in the quality from one chunk to another : total rebuffer time — for each chunk k rebuffering occurs if the download time d k ( r k )/ c k is higher than the playback buffer level when the chunk download started ( i . e ., b k ). thus the total rebuffer time is : alternatively , the number of rebufferings could be used in lieu of total rebuffer time : as users may have different preferences on which of four components is more important to them , the qoe of video segment 1 through k is defined by a weighted sum of the aforementioned components : here λ , μ and μ s are non - negative weighing parameters corresponding to video quality variations and rebuffering time , respectively . a relatively small λ indicates that the user is not particularly concerned about video quality variability ; the large λ is , the more effort is made to achieve smoother changes of bitrates . a large μ , relative to the other parameters , indicates that a user is deeply concerned about rebuffering . in cases where users prefer low startup delay , a large μ s is employed this definition of qoe is very general and allows customization so it can easily take into account user &# 39 ; s preference , and could be extended as needed to incorporate other factors . as can be seen if fig1 , the qoe preferences 120 of the user is one of the factors used by bitrate controller 116 to determine the bitrate 118 of subsequent requests 102 for video chunks . the problem of bitrate adaptation for qoe maximization can therefore be formulated in the following way : the bandwidth trace c t , t ∈[ t 1 , t k + 1 ] serves as input to the problem . the outputs of qoe_max 1 k are bitrate decisions bitrate decisions r 1 , . . . , r k , and startup time t s . note that the problem qoe_max 1 k is formulated assuming the video playback has not started at the time of this optimization so the start - up delay t s is a decision variable . however , this qoe maximization can also take place during video playback at time t k 0 when the next chunk to download is k 0 and the current buffer occupancy is b k 0 . in this case , the variable t s can be dropped and the corresponding steady state problem denoted as qoe_max_steady k k 0 . a source of randomness is the bandwidth c t : at time t k when the video player chooses bitrate r k , only the past bandwidth { c t , t ≦ tk } is available while the future values { c t , t & gt ; t k } are not known . however a throughput predictor 110 can be used to obtain predictions for future available bandwidth 114 based on past throughput 112 , defined as { ĉ t , t & gt ; t k }. based on such predictions 114 , and on buffer occupancy information 108 ( which is instead known precisely ) and the qoe preferences 120 of the user , the bitrate controller 116 selects bitrate 118 of the next segment k : r k = f ( b k , { ĉ t , t & gt ; t k }, { r i , i & lt ; k } ). ( 12 ) note that the basic mpc algorithms assume the existence of an accurate throughput predictor . however , in certain severe net work conditions , e . g ., in cellular networks or in prime time when the internet is congested , such accurate predictors may not be available . for example , if the predictor consistently overestimates the throughput , it may induce high rebuffering . to counteract the prediction error , a robust mpg algorithm is presented . robust mpc optimizes the worst - case qoe assuming that the actual throughput can take any value in a range [̂ ct , ̂ ct ] in contrast to a point estimate ̂ ct . robust mpc entails solving the following optimization problem at time t k to get bitrate r k : in general , it may be non - trivial to solve such a max - min robust optimization problem . in this case , however , the worst case scenario takes place when the throughput is at its lower bound ct = ̂ ct . thus , the implementation of robust mpc is straightforward . instead of ̂ ct , the lowest possible ̂ ct is used as the input to the mpc qoe maximization problem . to verify the inventions improved qoe over current methods , a normalized qoe metric was defined to compare performance of available video playback systems . these systems , along with the invention , were compared to the optimal possible performance , that which could be achieved if the future bandwidth of the network was known . for a given bandwidth trace { c , t ∈[ t , t k + 1 ]}, the offline optimal qoe , denoted by qoe ( opt ), is the maximum qoe that can be achieved with perfect knowledge of future bandwidth over the entire time horizon . technically , it is calculated by solving problem qoe_max 1 k . while the assumption of knowing the entire future is not true in reality , the offline solution provides a theoretical upper bound for all systems for a particular bandwidth trace . on the other hand , online qoe with bitrate selection system a is calculated under the assumption that at time t k , the bitrate controller only knows the past bandwidth { ct , t ∈[ t 1 , t k ]. based on this , r k ( i . e ., the bitrate 118 for the next video segment ) is selected . the online qoe achieved by algorithm a can be denoted by qoe ( a ). because offline optimal solution assumes perfect knowledge about the future , for any video playback system the online qoe is always less than the offline optimal qoe . in other words , qoe ( opt ) is an upper bound of online qoe achieved by any video playback system . to this end , qoe of a ( n - qoe ( a )) is defined as the performance metric for an system a : fig2 shows a high - level overview of the workflow of the mpc algorithm for bitrate adaptation . the algorithm essentially chooses bitrate r k by looking n steps ahead ( i . e ., the moving horizon ), and solves a specific qoe maximization problem ( this depends on whether the player is in steady or startup phase ) with throughput predictions { c ̂ t , t ∈[ t k , t k + n ]}, or c ̂ [ t k , t k + n ] . the first bitrate r k is applied by using feedback information and the optimization process is iterated at each step k . at iteration k , the player maintains a moving horizon from chunk k to k + n − 1 and carries out the following three key steps , as shown in algorithm 1 . 1 . predict : predict throughput c ̂ [ t k , t k + n ] for the next n chunks using some throughput predictor . the actual prediction mechanism relies on existing approaches . improving the accuracy of this prediction will improve the gains achieved via mpc . that said , mpc can be extended to be robust to errors as we discuss below . 2 . optimize : this is the core of the mpc algorithm : given the current buffer occupancy b k , previous bitrate r k − 1 and throughput prediction c ̂ [ t k , t k + n ] , find optimal bitrate r k . in steadystate , r k = f mpc r k − 1 , b k , c [ t k , t k + n ] , implemented by solving in the start - up phase , it also optimizes start - up time t s as : [ r k , t s ]= f mpc st ( r k − 1 , b k , ĉ [ t k , t k + n ] ) if practical details about computational overhead , are ignored , off - the - shelf solvers such as cplex can be used to solve these discrete optimization problems . 3 . apply : start to download chunk k with r k and move the horizon forward . if the player is in start - up phase , wait for t s before starting playback . this workflow has several qualitative advantages compared with buffer - based ( bb ), rate - based ( rb ). first , the mpc algorithm uses both throughput prediction and buffer information in a principled way . second , compared to pure rb approaches , mpc smooths out prediction error at each step and is more robust to prediction errors . specifically , by optimizing several chunks over a moving horizon , large prediction errors for one particular chunk will have lower impact on the performance . third , mpc directly optimizes a formally defined qoe objective , while in rb and bb the tradeoff between different qoe factors is not clearly defined and therefore can only be addressed in an ad hoc qualitative manner . experimentation using this invention over a wide variety of network conditions have shown a higher normalized qoe compared to existing video playback systems . lastly , as opposed to rate - based and buffer - based algorithms , which need relatively minor computations , the challenge with mpc is that a discrete optimization problem needs to be solved at each time step . there are two practical concerns here . ( 1 ) computational overhead : the high computational overhead of mpc is especially problematic for low - end mobile devices , which are projected to be the dominant video consumers going forward . since the bitrate adaptation decision logic is called before the player starts to download each chunk , excessive delay in the bitrate adaptation logic will negatively affect the qoe of the player . ( 2 ) deployment : because there is no closed - form or combinatorial solution for the qoe maximization problem , a solver ( e . g ., cplex or gurobi ) will need to be used . however , it may not be possible for video players to be bundled with such solver capabilities ; e . g ., licensing issues may preclude distributing such software or it may require additional plugin or software installations which poses significant barriers to adoption . therefore , it is evident that the solution should be lightweight and combinatorial ( i . e ., not solving a lp or ilp online ). as such , also presented herein is a fast and low - overhead fastmpc design that does not require any explicit solver capabilities in the video player . at a high level , fastmpc algorithms essentially follow a table enumeration approach . here , an offline step of enumerating the state - space and solving each specific instance is performed . then , in the online step , these stored optimal control decisions mapped to the current operation conditions are used . that is , the algorithm will be reduced to a simple table lookup indexed by the key value closest to the current state and the output of the lookup is the optimal solution for the selected configuration . as shown in fig4 , the state - space is determined by the following dimensions : ( 1 ) current buffer level , ( 2 ) previous bitrates chosen , and ( 3 ) the predicted throughput for the next n chunks ( i . e ., the planning horizon ). thus , fastmpc will entail enumerating potential scenarios capturing different values for each dimension and solving the optimization problems offline . unfortunately , directly using this idea will be very inefficient because of the high dimensional state space . for instance , if there are 100 possible values for the buffer level , 10 possible bitrates , a horizon of size 5 , and 1000 possible throughput values , there will be 10 18 rows in the table . there are two obvious consequences of this large state space . first , it may not be practical to explicitly store the full table in the memory , causing any implementation to have a very high memory footprint along with a large startup delay , as the table will need to be downloaded to the player module . second , it will incur a non - trivial offline computation cost that may need to be rerun as the operating conditions change . compaction via binning : to address the offline exploration cost , it should be realized that very fine - grained values for the buffer and the throughput levels may not be needed . as a consequence , these values may be suitably coarsened into aggregate bins . moreover , with binning , row keys do not need to be explicitly stored the as these are directly computed from the bin row indices . the challenge is to balance the granularity of binning and the loss of optimality in practice . in practice , using approximately 100 bins for buffer level and 100 bins for throughput predictions works well and yields near - optimal performance . table compression : the decision table learned by the offline computation has significant structure . specifically , the optimal solutions for several similar scenarios will likely be the same . thus , this can be exploited this structure in conjunction with the binning strategy to explore a simple lossless compression strategy using a run - length encoding to store the decision vector . the optimal decision can then be retrieved online using binary search . in practice , with compression , the table occupies less than 60 kb with 100 bins for buffer levels , 100 bins for throughput predictions and 5 bitrate levels . the invention may be implemented in any video player 100 , as defined herein , as , for example , a built - in feature , an add - on , a downloadable app , a piece of software , etc ., or in any other way of implementation , currently known or yet to be developed . although the invention is illustrated and described herein with reference to specific embodiments , the invention is not intended to be limiting to the details shown . rather , various modifications may be made in the details without departing from the invention .	7
for conciseness , the process and product of the invention will be described in details hereinafter by an example of plated matte tin deposit layer . however , this does not mean to any limit on the application of the invention . for one skilled in the art , it is easy to be understood that the invention could not only be applied in the matte tin deposit layer , but also could be applied in other sn rich deposit layers , such as sncu , snbi , snag deposit layer . the preferred and comparative examples of the present invention are prepared by an auto strip plating line or a conventional hull cell . the auto strip plating line is available in the market and a schematic view of its construction is shown in fig2 . specially , fig2 shows a schematic view of an auto strip plating line 200 used in the plating process according to one embodiment of the present invention . the auto strip plating line 200 comprises tanks 11 - 15 , rectifiers 21 - 25 for transforming an alternative current into a direct current and supplying the same to each tank , baths 51 , 52 and a steel belt 4 for conveying a substrate . the auto strip plating line 200 further comprises some nozzles 31 - 35 for ejecting plating solution from the bottom . according to the invention , in the tanks filled with plating solution , the metal tin serves as an anode , and the product to be plated serves as a cathode . according to a typical example , the product to be plated is sdip ( shrink dual in line package ) 64 / 24 , and the lead frame ( l / f ) of the sdip 64 / 24 is alloy 194 ( one kind of copper l / f , comprising 2 . 4 % fe , 0 . 03 % p , 0 . 1 % zn , and cu remain ). the two electrodes are electrically connected to the corresponding anode and cathode of a direct current power supply respectively . the plating solution can be a methyl sulfonic acid based tin plating solution available in the market , it comprises of tin methyl sulfonic acid in the amount of 40 g / l and methyl sulfonic acid in the amount of 150 g / l , and some starter additive with a concentration of 40 - 100 g / l ( preferably , 40 g / l ) and some brighter additive with a dose of 3 - 9 ml / l ( preferably , 4 ml / l ) are added . the starter additive can use aqueous solution of nonionic wetting agents , the brighter additive can be selected from ethoxylated naphthol sulphonic acid , α - naphthol or α - naphthol sulphonic acid , and the solvent can be isopropyl glycol based solvent or other suitable solvent known in the art . of course , some other additive or composition can be added into the plating solution based on the specific or practical need , which will not be described in detail here since they are common knowledge in the art . the controllable factors or parameters for the plating condition are listed as follows : of course , these factors or parameters can be adjusted depend on the different plating product ( such as different plating area ). it can be seen from table 1 , by adjusting the plating condition , sn deposit layers with three different types of grain structure as shown in fig3 can be obtained . specially , fig3 shows the surface topography and the morphology of a cut ( formed by focused ion beam technology ) with three different types of grain structure , i . e ., regular modified matte tin ( regular mmt ) a , irregular modified matte tin ( irregular mmt ) b and regular matte tin ( regular mt ) c . as shown in fig3 , regular modified matte tin a and regular matte tin c generally have the similar grain structure , i . e ., columnar grain structure , which has a much larger size in the direction perpendicular to the deposit surface than in other directions . in contrast , irregular modified matte tin b has another kind of grain structure ( so called as non - columnar grain structure ), which is completely different from the columnar grain structure as mentioned above . it can be known from the description hereinafter in combination with what shown in fig3 , both the regular modified matte tin a and the regular matte tin c are predominated by the grains perpendicular to a substrate , and whisker growth can be observed regardless the size of grains . on the other hand , the irregular modified matte tin b is predominated by the grains parallel to a substrate , in this case , since the copper atoms mainly diffuse from the substrate to the deposit layer along the grain boundaries and most of the grain boundaries in the irregular modified matte tin b are parallel to the substrate , the intermetallic compound will grow as a sort of semi - bulk diffusion , so that the wedge typed growth of intermetallic compound is inhibited . it can be known from table 1 and fig3 , by properly adjusting the plating condition , the sn deposit layer with different types of grain structure can be obtained . it is apparent from fig4 a to fig1 b , in the grain structure of irregular modified matte tin b of the invention , the size of the grains in the direction perpendicular to the deposit surface ( i . e ., direction z ) is much smaller than in the directions parallel to the deposit surface ( i . e ., direction x or y ), which will be described in details hereinafter . it has been proved that under the plating condition as mentioned above , only the regular matte tin c can be obtained if there is no starter additive and brighter additive in the plating solution . the regular modified matte tin a can be obtained in the case that starter additive and brighter additive are added in the plating solution , the current density is lower and the bath temperature is higher . the irregular modified matte tin b1 ( when the bath temperature is higher ) and b2 ( when the bath temperature is lower ) can be obtained in the case that starter additive and brighter additive are added in the plating solution and the current density is higher . by controlling the plating condition so as to obtain form three different types of grain structure and limiting the total thickness of the deposit layer ( s ) in a range of 2 - 10 μm , the examples c1 - c34 with sn deposit layer ( s ) on sdip 64 / 24 ( see table 2 ) and the examples r1 - r11 with sn deposit layer ( s ) on sdip 32 ( see table 3 ) are prepared . fig4 a to 9a show the photography of the grain structure in examples c28 , c33 , c21 , c15 , c1 , and c32 respectively , fig4 b to 9b show the schematic views corresponding to fig4 a to 9a . in these figures , the reference number 50 represents a substrate ( e . g ., cu l / f ), the reference number 60 represents a deposit layer , the reference number 70 represents a sn grain , and the reference number 80 represents an intermetallic compound . the samples obtained from these examples are placed in an environment of 55 ° c ., 85 % rh ( high temperature and humidity , hth test ) for 2000 hours ( see table 2 ) and placed at the room temperature for 15 months ( see table 3 ), so that hth whisker test is carried out , so as to compare the behavior of whisker growth and analyze the effect of grain structure and plating condition on the whisker growth . i ) structure types a and b are produced by auto strip plating line , structure type c is produced by hull cell , structure type c ′ is produced by auto strip plating line as shown in the examples c1 - c20 of table 2 , if the grain structure of the bottom layer exhibits an irregular structure type b ( irregular modified matte tin b ), none whisker grows in the hth test till 2000 hours . in contrast , as shown in the examples c21 - c22 , c29 - c34 , m1 - m4 of table 2 and the comparative examples r1 - r5 of table 3 , if the grain structure of the bottom layer exhibits a regular structure type , i . e ., regular matte tin c or regular modified matte tin a , whisker appears in all the cases . accordingly , as shown in fig4 a - 9b , none whisker presents in finished product even after the hth whisker test since the same bottom structure b is selected . in contrast , in both the examples c21 and c33 in which a bottom structure c or a is sleeted , whisker is observed . it can be further known from the examples c28 , c15 and c1 as shown in fig4 a , 4 b , 7 a , 7 b , 8 a and 8 b , in the solution of the invention , a fine grained deposit layer is directly deposited on a substrate , and the grains in the fine grained deposit layer are formed in a specific structure type , that is , these grains have a smaller ( preferably , much smaller ) size in the direction perpendicular to the deposit surface than in the direction parallel to the deposit surface . in this condition , the intermetallic compound between sn and the substrate will grow along the grain boundaries , which are closer together than in the normal deposit and be evenly distributed over the deposit layer ( e . g ., sn layer ), causing a more lateral growth of the intermetallic compound , resulting in a better distribution of stress and thus no whisker growth . it can be clearly seen this kind of growth of the intermetallic compound from two preferred embodiments of the invention , which is best shown in fig1 a , 10 b , 11 a and 11 b . specially , as compared with the “ bulk diffusion ” appearing at higher temperature , the intermetallic compound in the invention grows as a sort of “ semi - bulk diffusion ”. in contrast , as shown in fig1 a , 1 b , 5 a , 5 b , 6 a , 6 b , 9 a and 9 b , the normal sn deposit layer in the art has a columnar grain structure , which allows a wedge typed growth of the intermetallic compound ( e . g ., cu 6 sn 5 ) in the vertical direction along the grain boundaries , and thus results in whisker growth . furthermore , it has been found that in the invention , the size of grains in the direction perpendicular to the deposit surface is preferably not more than 2 μm . more preferably , the size of grains in the direction perpendicular to the deposit surface ( i . e ., direction z ) is 0 . 05 - 2 μm , and the size of grains in the direction parallel to the deposit surface ( i . e ., direction x or y ) is 0 . 2 - 10 μm . for example , when the size in the direction x or y is 2 μm or more , the size in the direction z is preferably set to about 1 μm ; when the size in the direction x or y is 0 . 2 μm or more , the size in the direction z is preferably set to about 0 . 05 μm . besides , it is preferred that the sizes in the direction x and y are different , and an example is : x = 0 . 5 μm , y = 0 . 2 μm . further , it is preferred that all the grains in the deposit layer tend to be arranged in the same orientation parallel to the deposit surface , so that the whisker growth will be more effectively inhibited . the total thickness of the deposit layer is well known in the art . in the examples of c1 - c20 , the total thickness is set as 2 - 10 μm . it can be seen from the examples c1 - c20 and c23 - c28 as shown in table 2 , when the same bottom structure type b ( i . e ., irregular modified matte tin b ) is exhibited in the bottom layer , none whisker grows in the hth whisker test till 2000 hours regardless the thickness and structure of the top layer , even only 2 μm thickness of the bottom layer . there is clear conclusion that if the bottom layer dominates imc self - bulk diffusion not to induce whisker growth , the whisker will be inhibited regardless the thickness and structure of the top layer . to compare the thickness of irregular grain structure on the bottom layer - 2 μm and 4 μm , the thinner has the same effect with the thicker . in this evaluation , the thickness , 2 μm , is enough to retard whisker growth . it can be seen from table 1 that the irregular ( non - columnar ) grain structure can be obtained both in a higher bath temperature and in a lower bath temperature . that is , the bath temperature is not the crucial factor of the invention . referring to fig1 a and 11b , if necessary ( e . g ., in order to obtain an excellent surface roughness ), one or more additional sn rich deposit layers can be added on the fine grained sn rich deposit layer of the present invention . the additional sn rich deposit layer can be formed by any suitable technology well known in the art . in summary , in the solution of the invention , a fine grained sn rich deposit layer with a specific irregular grain structure is directly deposited on a substrate , so that the intermetallic compound is induced to grow as a sort of semi - bulk diffusion and thus whisker growth is effectively inhibited . furthermore , in the case that the deposit layer in constituted by two layers , that is , a top layer and a bottom layer , if the bottom layer dominates imc self - bulk diffusion not to induce whisker growth , the whisker will be inhibited regardless the thickness and structure of the top layer . besides , it can be concluded that the self - bulk diffusion of imc has more influence on whisker growth than plating thickness . it has been proved that the intermetallic compound in the fine grained sn deposit layer of the invention will grow as a sort of semi - bulk diffusion in any case , regardless the storage temperature . obviously , the invention is not limited to be applied to sdip 64 / 32 / 24 . instead , it can also be applied to lead of integrate circuit package and discrete element ( e . g ., transistor / diode and passive component of chip resistor / capacitor ), electrical connector , substrate ( printed circuit board or tape ) or any other electrical component known in the art . preferably , the invention is applied to copper base material that needs sn rich deposit lay and sensitive for whisker issue . although particular embodiments of the invention have been described in detail herein with reference to the accompanying drawings , it is to be understood that these embodiments are only given for the purpose of illustration , and the invention is not limited to those particular embodiments . as a matter of fact , various changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the invention .	8
this invention relates to an electronic signal - seeking radio receiver which includes means for digitally programming and scanning the specific frequencies to be monitored and broadcast . the reception of one of these frequencies will inhibit the signal - seeking process until such frequency no longer contains a broadcast signal . a single antenna is used in the receiver to receive frequency signals in the high frequency band , i . e ., 30 to 50 megahertz , the vhf band , i . e ., 150 to 170 megahertz , and in the uhf band which is in the range of 450 to 470 megahertz . the specific frequencies which will cause the scanning process to stop if they have a broadcast signal imposed thereon , are predeterminably programmed by a matrix method . more specifically , and with reference to the drawings , fig1 shows a block diagram of frequency synthesizer which is programmable to preselect the particular plurality of frequencies which are monitored for incoming , broadcast signals . the synthesizer 10 has a capability of scanning all of the 12 , 000 channels contained in the hf , vhf and uhf bands . the plurality of preselected and programmed frequencies are taken from these 12 , 000 possible channels . the synthesizer relies on a 75 mhz oscillator 12 for providing a reference signal of very stable frequency to serve as the basis for the scanning of the particular frequencies that have been programmed and the monitoring of incoming signals for broadcasts on those frequencies . in general terms , and with reference to fig1 the frequency of the 75 mhz signal is first divided in half by a divider 14 , then by ten in a ten &# 39 ; s divider 16 , and subsequently by a five &# 39 ; s divider 18 , by a second five &# 39 ; s divider 20 , by a three &# 39 ; s divider 22 , and finally by a second ten &# 39 ; s divider 24 . the net result is a precise 5 kilohertz signal that is available at the output of the last ten &# 39 ; s divider 24 . this 5 khz signal is then passed through a monostable multivibrator device such as a one - shot 26 to shape the wave form such that the positive pulses have a duration of approximately 50 nanoseconds . the 5 khz signals , each positive pulse of which is 50 nanoseconds in duration , is then supplied to a phase and frequency detector 28 as the reference frequency signal . the phase and frequency detector 28 is included in , and forms part of , a feedback circuit 30 , which is responsible for generating frequencies that are indicative of the programmed frequencies . a voltage controlled oscillator 32 is , at any given time , supplying an output line with signals having a frequency between about 15 and 35 mhz . this oscillatory signal passes through a translator 36 before being applied to a series of programmable counters 38 to clock these counters . these counters 38 are programmed in a fashion which will be fully described hereinafter , but for the moment , it is sufficient to say that they are programmed . the output of the programmable counters 38 is passed through a decoder 42 which decodes a predetermined count from the decoders . the output of the decoder 42 is applied to a flip - flop ( ff ) 44 to generate a signal at the output of the ff 44 having frequency that is representative of the vco frequency divided by the number of counts which the programmable counters had to count to reach the predetermined count . the frequency signal from the ff 44 is applied to the phase and frequency detector 28 where it is compared with the 5 khz reference frequency . if the frequency of the signal from the control ff 44 is greater than 5 khz , the dc output voltage 46 of the phase and frequency detector 28 goes down in amplitude . on the other hand , if the frequency of the signal from the control ff 44 is less than 5 khz the dc voltage output of the phase and frequency detector 28 goes up . the respective dc output from the phase and frequency detector 28 is applied , through a notch filter 48 , to the voltage controlled oscillator ( vco ) 32 . the notch filter blocks any 5 khz signals that are possibly imposed on the dc voltage to prevent any deviations in the subsequently generated signals . the vco 32 is responsive to the proportionate dc voltage from the phase and frequency detector 28 to alter its output frequency , which again is between 15 and 35 mhz , to bring the output of the control ff 44 into congruence with the 5 khz reference frequency . the repetitive change of the programmed number in the programmable counters 38 is effective to change the output frequency of the vco in the above described manner , with only an infinitesimal amount of time being required for the stabilization of the vco frequency each time it is changed . with reference to fig2 the output of the vco 32 , which is now somewhere between 15 and 35 mhz , depending upon the number programmed in the programmable counters 38 , is supplied to a rf mixer 60 along with a 75 mhz signal coming directly from the 75 mhz reference oscillator 12 . this first mixer 60 is effective to mix the two frequencies together thereby placing a signal on its output 62 which has a frequency content between 90 and 110 mhz . this 90 to 110 mhz signal is used as the local oscillator frequency and is passed through a tuned , linear amplifier 64 for amplification of the signal . when the programmed frequency is programmed to be in the vhf band , in a manner to be described , the output of the 90 - 110 mhz amplifier is applied to a second mixer 66 . the other input 68 to the second mixer 66 is obtained , by means of two radio frequency amplifiers 70 and 72 , from the only antenna 74 which is utilized in the receiver . the second mixer 66 is effective to mix the 150 to 170 mhz signals received from the antenna 74 and the 90 to 110 mhz signals received from the first mixer 60 to generate a 60 mhz signal . it should be understood that the required 60 mhz signal will only be generated by the second mixer 66 when the programmed local oscillator frequency which is the 90 to 110 mhz signal coming from the first mixer 60 is in the proper relationship with the signal being received by the antenna 74 . the 60 mhz signal from the second mixer 66 is passed through a tuned amplifier 76 and is applied to a third mixer 78 . the other input to the third mixer 78 is received from a 55 . 5 mhz crystal controlled oscillator 80 . these two signals , when presented to the third mixer 78 , are effective to generate a 4 . 5 mhz signal on the ouput of the mixer 82 . the output of the third mixer is coupled , by a crystal filter 84 , to an fm quadrature detector 86 . the crystal filter 84 has a band width of 7 khz and is effective to eliminate problems with adjacent channels to insure that the signal is entirely that of the programmed frequency . the fm detector 86 is responsible for controlling and generating a plurality of parameter signals . the fm detector 86 contains a saturation detector which , when the incoming signal from the antenna 74 is substantially large in amplitude , places a signal on an automatic gain control ( agc ) line 88 which proportionately reduces the gain of the first and second rf amplifiers 70 and 72 . the fm detector is also coupled through low pass preamps 90 to an audio amplifier 92 for presentation of the desired signal via the speaker 93 . thirdly , the fm detector 86 is also used as a squelch detector and originates a signal when only noise or static is present on the incoming programmed frequency channels to turn off the low pass amplifier 90 so that such noise is not broadcast through the speaker 93 . on the other hand , when a desired signal is present and is available to the detector 86 , the squelch output line 94 from the fm detector 86 causes a scanning oscillator 120 to which it is coupled to stop its scanning process . the signal path and processing from the antenna 74 to the audio amplifier 92 , as above descrived , is that used for the reception of the vhf band . as previously mentioned , the inventive receiver utilizes only a single antenna for reception of the three radio frequency bands , i . e ., hf , uhf and vhf . turning now to the uhf band which contains frequencies between 450 and 470 mhz , the programming of the programmable counters ( fig1 ) to receive a frequency in the uhf band is effective , when monitoring for a signal having that frequency , and as shall be made more clear hereinafter , to operate a gate 98 which eliminates the incoming antenna signal from the vhf first stage rf amplifier 70 , but which provides such signal to a tuned rf amplifier 100 in the vhf section 101 for amplification . the amplified signal is thereafter supplied to a uhf mixer 102 for mixing the 450 to 470 mhz signal with a 300 mhz signal that is used as the other input 104 to the mixer 102 . the 300 mhz signal is obtained by twice doubling , by means of doublers 106 and 107 , the 75 mhz reference signal from the 75 mhz crystal oscillator shown in fig1 . as thus far described , only one amplifier 100 is used to amplify the incoming uhf signal . the reason for this is that the output of the uhf mixer 102 is coupled to the first rf amplifier 70 in what has previously been described as the vhf section . since the gate 98 is open , the signal from the uhf mixer is all that is received by the first rf amplifier 70 . the subsequent coupling through the second rf amplifier 72 , the second mixer 66 and the above described mixing with the incoming local oscillator frequency , again having a specific frequency somewhere in the range of 15 to 35 mhz according to the programmed frequency , is identical to the processing of the first described vhf signal . the third case is , of course , when a specific frequency in the high band , i . e ., 30 to 50 mhz , is programmed . in this instance , the antenna gate 98 is again opened , and , due to the additional opening of a second gate 108 , the first two rf amplifiers 70 and 72 are turned off . more specifically , the second gate 108 , when open , is effective to remove the necessary bias voltage from the two amplifier stages 70 and 72 thereby eliminating , or blocking , any vhf or uhf signals from the remaining portions of the signal processing circuit . assuming that a high band frequency ( hf ) is programmed and that such a frequency is available at the antenna 74 , such signal is supplied to a linear amplifier 110 for amplification and is thereafter available to a hf mixer 112 . the other input to this mixer 112 is from the tuned linear amplifier 64 which , as above described , amplifies the 90 to 110 mhz local oscillator frequency . the output of the low band mixer 112 is a 60 mhz signal which is then applied to the input of the 60 mhz amplifier 76 . again , the subsequent processing of this signal to provide an audio output from the audio amplifier 92 is identical to that for the two bands previously described . the description thus far has been limited to the monitoring and processing of frequencies to provide an audio output when a plurality of programmed frequencies contain a broadcasted signal . the actual programming and selection of the plurality of predetermined frequency signals which will cause an audio output is shown by the block diagram in fig3 . it should be understood that although a specific plurality of signals are programmed as the desired signals , these signals can be selected from any of the 12 , 000 channels in the entire hf , uhf and vhf bands which are monitored for reception . in other words , the inventive receiver has the capability , by changing the programmed frequencies , to select any channel , of 5 khz band width , in any of the three frequency bands . turning to fig3 the basis for the scanning operation is an 80 hz scanning oscillator 120 which is normally a free running clock . the 80 hz signal from the scanning oscillator 120 is applied to a frequency divider 122 which , in the preferred embodiment , divides the 80 hz signal into a 10 hz signal . the 10 hz signal is decoded by a decoder block 124 to sequentially apply pulses to the 10 output lines 126 of the decoder which are coupled to an 8 × 14 matrix switch 128 . again in the preferred embodiment , this 8 × 14 matrix switch is a so - called diode matrix which , when the respective diodes are appropriately connected , and a ground pulse is available on the appropriate one of the input lines 126 , provides a combination of positive and negative signals , speaking in the binary sense , which are coupled in parallel to the programmable counters 38 , first shown in fig1 and repeated in fig3 for clarity . the specific plurality of combinations of the diodes that are coupled to each of the input lines 126 from the decoder 124 by a conductive paint or the like , determine the number to which the respective stages of the programmable counters 38 will be programmed . the diode matrix 128 is also used for selecting the particular band which the programmed frequency will be found in . in short , the diode matrix 128 is also coupled to the previously mentioned gates 98 and 108 which operatively select the frequency band which a particular signal is to be found in . the output of the fm detector 86 ( fig2 ) which bears the squelch signal is coupled through an amplifier and delay circuit 130 to the scanning oscillator 120 . the presence of a broadcast signal , as determined by the fm detector 86 , causes the squelch line 94 to have a substantially ground signal imposed thereon . this signal is coupled to the squelch amplifier 130 and , due to the coupling of the amplifier to the scanning oscillator 120 , inhibits the scanning oscillator . in other words , the scanning oscillator is free running until a broadcast signal is detected on one of the programmed frequencies and is immediately inhibited for the duration of that broadcast signal . after the termination of the broadcast signal , a delay inhibits the scanning oscillator for an additional period of time , so that in the event that there was only a momentary break in the broadcast , the receiver would not progress on to the next and subsequent programmed frequencies . with reference to the block diagram of fig1 the specific circuitry for the elements in the block diagram is shown in fig4 . the 75 mhz oscillator 12 is comprised of a crystal 200 which is connected in a parallel resonant mode with the gate terminal of a junction field effect transistor 202 . the output of the fet 202 is taken from its source terminal which is tuned by a filter 206 and which is coupled to one gate 208 of a mosfet 210 . the mosfet is utilized to electronically isolate the oscillators from subsequent components to prevent de - tuning of the oscillator . the output of the mosfet 210 is coupled by a capacitor 212 to a linear amplifier 214 which provides the desired three to four volt swing in the 75 mhz reference signal . the output of the 75 mhz oscillator is taken , by means of a conductor 216 , from the linear amplifier 214 and is applied to a jk flip - flop 14 which comprises the divide by two element 14 . the output of the jk ff 14 is a 37 . 5 mhz signal and is coupled to a counter 16 which provides the divide by ten element 16 . in essence , this counter is a sixteen bit counter which is used only to divide by ten . the resulting 3 . 75 mhz output from the divide by ten counter 16 is subsequently divided by five in a second counter 18 and is divided again by five in a third counter 20 to yield a 150 khz signal . the 150 khz signal is then divided by three by a pair of jk ff &# 39 ; s 218 and 220 which are connected in a dividing mode to provide the three &# 39 ; s divider 22 . the 50 khz signal from the three &# 39 ; s divider 22 is once again divided , this time by the tens divider counter 24 to provide the 5 khz signal which , as will be recalled , is used as a reference frequency signal . the 5 khz reference signal is applied to the monostable multi - vibrator 26 which is comprised of a one - shot 224 for altering the duration of 5 khz pulses to approximately 50 nsec . the one - shot 224 is coupled to the phase and frequency detector 28 for providing the basic reference signal frequency to the phase and frequency detector . the voltage controlled oscillator 32 provides a signal frequency somewhere between 15 and 35 mhz . the particular output frequency in this range , as explained in conjunction with fig2 defines the particular frequency which will be received , processed , and broadcast by the receiver at any given instant of time . the specific frequency in the 15 to 35 mhz range which is generated by the vco is controlled by an output from the phase and frequency detector 28 in a manner now to be described . the output of the vco 32 is coupled by a conductor 226 to a linear amplifier which serves as the translator 36 . the translator 36 , i . e ., the linear amplifier , is effective to translate the 0 . 75 volt amplitude signal from the vco 32 to the amplitude of 2 . 5 volts that is necessary to clock the programmable counters 38 and the control ff 44 . in accordance with the above description , the output signal from the translator 36 is , when the receiver is first turned on , somewhere between 15 and 35 mhz . this signal is coupled to the clocking input 230 of the first stage 232 of the three - stage programmable counter 38 . in effect , each of these stages 232 , 234 and 236 are programmable 4 bit counters . a flip - flop 244 forms the most significant bit of the binary count that is decoded by the decoders 42 but operates according to a so - called fixed or hard - wired program . the programming inputs to the counter stages 232 , 234 and 236 have been labeled a through l and come from outputs of the diode matrix switch 128 . the output of the vco 32 is also coupled to the clock input of the control ff 44 . the output of the vco is thereby effective to clock the three programmable counter 38 stages 232 , 234 and 236 , as well as the control ff 44 . the programming lines a - l for the three counter stages 232 , 234 and 236 are , in actuality , the preset lines for these respective counter stages . the particular combination at any given time , of ones , i . e ., 12 volts , and of zeros , i . e ., ground level , which are available on these preset lines a - l determine the count which is preset into the counter stages and from which point the counters will begin counting when clocked by the vco signal frequency . outputs of the three counter stages 232 , 234 and 236 are coupled , as shown , to three and gates 238 , 240 and 242 which decode the number 7057 each time the aggregation of the counter stages reaches this count . the hard - wired ff 244 is coupled to the last counter stage and to one of the and gates 242 and is responsible for the most significant bit in the binarily represented 7057 that is presented to the decoding and gates 238 , 240 and 242 . in operation , then , each time the counters binarily count to 7057 . the three and gates 238 , 240 and 242 detect this count and apply a positive signal to the control ff 44 . since the counter stages 232 , 234 and 236 are being clocked by the output frequency of the vco 32 , and if it is assumed that all of the preset lines a - l have binary zeros imposed thereon by the diode matrix card 128 , the output conductor of the control ff 44 should have approximately a 5 khz signal thereon . this can be computed , as with all zeros programmed on the present lines a - l , the counter stages must begin their count at zero and receive 7057 clock pulses from the vco before the control ff 44 is pulsed once . in effect , then , the vco output frequency is being divided by 7057 to obtain the 5 khz output from the ff 44 . five khz times 7057 equals 35 . 2 mhz which is the highest frequency to be obtained from the vco 32 . with all binary ones programmed on the preset lines a - l , the number 4096 is preset into the programmable counter 38 . when clocked by the vco , the counter begins its count at 4096 and is reset when it reaches 7057 , as before . in this case , the vco output frequency is divided by the difference between 4096 and 7057 , which is equal to the lowest vco frequency of 14 . 8 mhz or approximately 15 mhz . the resetting of the programmable counter stages 232 , 234 and 236 to zero or to the preset number is performed by a second output of the control ff 44 each time the ff 44 is pulsed thereby signifying that the count of 7057 has been reached . assume for the sake of description that the overall receiver has just been turned on . at that time , it would be unknown as to what frequency was coming from the vco 32 . assume further that all 1 &# 39 ; s are programmed on the program lines a - l . if the signal from the vco does not have a frequency of 15 mhz , the output of the control ff 44 will either be greater or less than 5 khz . the phase and frequency detector 28 , which has the reference 5 khz signal applied to it , also receives the output of the control ff 44 . in the event that the output of the control ff is greater than 5 khz , an output conductor 250 from the phase and frequency detector 28 would have a positive dc voltage imposed thereon . the magnitude of this voltage is directly proportional to the difference in frequency between the 5 khz reference signal and the signal coming from the control ff 44 . this dc voltage now becomes the control voltage for the vco 32 . more specifically , the output conductor 250 from the phase and frequency detector 28 is coupled to a varactor 252 by means of a notch filter 254 . this notch filter eliminates any 5 khz signal on the dc signal from the detector 28 so that the voltage applied to the varactor 252 is substantially a pure dc . the varactor 252 forms part of a parallel resonant circuit 256 which determines the frequency at which the vco will oscillate . a change in the voltage that is applied to the varactor 252 changes the capacitance of the varactor to thereby effect the change in the frequency to which the vco is tuned . the resulting change in the frequency of the vco &# 39 ; s output will , if it has been reduced , cause the programmable counters 38 and the control ff 44 to be clocked at a slower rate which continues to rapidly home in on and stabilize at 5 khz . the output of the vco 32 is thereby regulated , via the phase and frequency detector 28 , by the particular combination of 1 &# 39 ; s and 0 &# 39 ; s which are preset into the programmable counters 38 . as will be seen , these programmed numbers also constantly change , on the order of ten times a second . the output of the vco is , according to the above description , somewhere between 15 and 35 mhz . the specific frequency has now been determined and has been set by the programmable counters 38 and the phase and frequency detector 28 . furthermore , the specific frequency from the vco , as will now be seen , establishes the frequency to which the radio receiver is tuned in an effort to detect a broadcast signal on that frequency . with reference to fig5 the output conductor 230 from the linear amplifier and translator 36 is applied to the first mixer 60 , as well as to the counter 38 and the control ff 44 . the other input of this mixer 60 is from the 75 mhz oscillator 12 by conductor 216 . a mosfet 270 forms the basis for the mixer 60 , and has a tuned output with a center frequency of 100 mhz . the frequency output of the first mixer 60 is thereby in the range of 90 to 110 mhz . the 90 to 110 mhz signal is coupled by a tuned tank circuit 272 to a linear amplifier 274 . the amplifier 274 has a tuned output that is again 90 to 110 mhz with a now substantially increased amplitude . this 90 to 110 mhz signal will hereinafter be referred to as the local oscillator frequency . its specific frequency within the 90 to 110 mhz range establishes the particular channel or frequency to which the receiver will be tuned to receive from the antenna 74 . again , there are 4 , 000 possible channels in each of the three bands , thereby making a total of 12 , 000 possible channels or frequencies which can be programmably received . the local oscillator frequency is coupled by a capacitor 276 to the second gate 278 of a dual gate mosfet 280 which forms the basis of the second mixer 66 . the circuitry and processing for a signal in the vhf band will first be described assuming , of course , that the vhf band has been programmed , in a manner still to be described . in the vhf mode , the input to the first gate 282 of the mosfet 280 in the second mixer 66 is received , after substantial amplification , from the antenna 74 . more specifically , the antenna 74 is coupled through a parallel tuned filter 284 to the first gate 354 of a dual gate mosfet 286 which comprises , along with its associated filters and circuitry , the first rf amplifier stage 70 . the first and second rf amplifier stages 70 and 72 are stagger tuned and both are comprised of mosfets connected within their respective stages in an enhancement mode . the output of the first rf amplifier 70 is coupled by a capacitor 288 to the second rf amplifier 72 . the output of the second rf amplifier 72 is likewise coupled by a capacitor 290 and a parallel resonant circuit 292 to the first gate 282 of the mosfet 280 in the second mixer 66 . the vhf band has a frequency range of between 150 and 170 mhz . the mixing of this signal , when received by the antenna 74 , with the local oscillator frequency in the second mixer , is effective to generate a 60 mhz signal which passes through a single tuned resonant circuit 294 before being applied to the 60 mhz amplifier 76 . the 60 mhz signal will only be generated when a vhf signal of the proper frequency is received that is in the proper proportion to the local oscillator frequency . the programmed local oscillator frequency is thereby controlling the frequency to be monitored for a broadcast signal . the output of the 60 mhz amplifier is coupled to the third mixer 78 which receives its other input from the 55 . 5 mhz oscillator 80 . the 55 . 5 mhz oscillator is comprised of a parallel resonant crystal 296 and a junction type fet 297 which provides the wave shaping required . the output of the third mixer has a frequency of 4 . 5 mhz and is applied by the 4 . 5 mhz crystal filter 84 to the input of the fm detector 86 . to reiterate , the 4 . 5 mhz crystal filter 84 is used to eliminate adjacent channel problems and has been found to be very important since the 4 , 000 possible channels in each band are only separated in increments of 5 khz . the first portion of the fm detector 86 , which is included in the integrated circuit making up the fm indicator , is an amplifier stage which provides on the order of 80 db of gain . the fm detector detects the presence of the broadcast information that is modulated on the 4 . 5 mhz signal and makes an audio signal in the frequency range of 60 hz to 5 khz available on an output conductor 300 . the subsequent audio processing and presentation of this signal will be later described in conjunction with fig6 . the fm detector 86 also provides an automatic gain control ( agc ) signal on second output conductor 302 . this agc signal is a dc voltage which is amplified by two dc amplifiers 304 and 306 before being applied to the second gates 308 and 310 of the dual gate mosfets 312 and 286 contained in the first and second rf amplifiers 70 and 72 . the agc voltage level is increased as the point of saturation of the fm detector increases . the net effect of the agc signal is to proportionately reduce the gain of the first and second rf amplifiers 70 and 72 . the selection of the specific frequency band , i . e ., hf , vhf or uhf , which will be monitored for a specific signal frequency , is selected by programming the diode matrix 128 . the selection of the vhf band is made by the application of a zero voltage by the matrix 128 to the base conductor 320 of a transistor switch 322 to turn that switch 322 on . at the same time , a second transistor switch 324 is turned off by the application of a one , i . e ., a positive voltage , to its base conductor 326 which turns off the bias voltage for the doublers 106 , the mixer 102 and the amplifier 100 in the uhf portion of the receiver . turning the second transistor switch off also , by means of a direct coupling , causes a third transistor switch 328 to also be turned off , thereby also eliminating the bias voltage from the hf portion of the receiver . assume for the sake of description , that a frequency is programmed and , furthermore , that the desired frequency is to be found in the uhf band and that the uhf band is accordingly programmed . the first transistor switch 322 would remain on and the second and third transistor switches would be turned on . the now conductive second transistor switch 324 removes the bias voltage from a fourth transistor switch 330 to render that switch non - conductive , which in turn opens a diode 332 in the parallel resonant circuit 284 which couples the antenna 74 to the first rf amplifier 70 in the vhf section . the incoming signal from the antenna 74 is now available to the uhf amplifier 100 through a now conductive diode 334 . the actual input to the uhf amplifier 100 is through a tuned filter 335 having an approximate center frequency of 460 mhz which is sufficient to accept the incoming signal having a range of 450 to 470 mhz . again , the uhf amplifier 100 is a dual gate mosfet . the drain 336 of this mosfet 338 is coupled by tuned tank circuits 340 to the first gate 342 of a mosfet 344 in the uhf mixer 102 . the other gate of the mosfet 344 is supplied with an incoming signal of 300 mhz from the two doubler circuits 106 and 107 . as previously mentioned , the input to the first 107 of these doubler circuits is obtained directly from the 75 mhz oscillator 12 . the first doubler 107 is effective to double the 75 mhz frequency to 150 mhz , which then passes through the second doubler 106 to obtain the 300 mhz signal that is supplied to the second gate 346 in the uhf mixer mosfet 344 . the output conductor 348 from the uhf mixer 102 is coupled by a capacitor 350 to a tuned circuit 353 which serves as the input device for the first gate 354 in the mosfet 312 of the first rf amplifier 70 in what has heretofore been the vhf processing amplifiers . the output signal from the uhf mixer 102 is , by virtue of the inputs to the uhf mixer , in a frequency range of 150 to 170 mhz . thus , a pseudo vhf signal has been generated which represents a uhf frequency . the subsequent processing , i . e ., amplification , mixing and filtering are identical for the uhf signal to that previously described for the vhf band . the programming of the high frequency ( hf ) band , i . e ., 30 to 50 mhz is effective to permit the second and third transistor switches 324 and 328 to remain on and is further effective to turn the first transistor switch 322 to its non - conductive state . the latter action removes the dc bias voltage from the first and second rf amplifiers 70 and 72 , thereby rendering them inoperative and , in accordance with the previous description , inhibits the reception of a vhf or a uhf signal . the reception of a hf signal by the antenna 74 , when a high frequency signal is programmed , is amplified by two stagger tuned linear operational amplifiers 360 and 362 which comprise the linear amplifier 110 whose output is coupled to the hf band mixer 112 . the local oscillator frequency coming from the first mixer 60 , and thereafter the linear amplifier 64 , is used as the other input to the hf mixer 112 . as the first input is always 30 to 50 mhz and the second , i . e ., the local oscillator frequency is always 90 to 110 mhz , the output conductor 364 from the hf mixer 112 is always , when a hf signal is programmed and present , 60 mhz . the hf mixer 112 is coupled by its output conductor 364 to the input of the tuned 60 mhz amplifier 76 . the subsequent processing of the so - called hf signal is indentical to that performed on the vhf and uhf signals from the 60 mhz amplifier 76 through the audio amplifier 92 . the squelching of unwanted noise signals and the actual programming circuitry used to program the programmable counters 38 will now be described in conjuction with fig6 and with reference to fig3 . when a broadcast is being received at a programmed frequency and in a programmed band , the output conductor 300 from the fm detector 86 of fig5 will have a 60 hz to 5 khz signal imposed thereon . the audio output conductor 300 is coupled by a capacitor 370 to a notch filter 372 which removes frequencies in the range of 300 to 350 hz from the audio signal . this notch filter 372 has been found necessary due to the generation of signals of this frequency , which it appears occurs due to the constantly changing output frequency of the vco 32 . the output of the notch filter passes through a first - stage pre - amplifier 374 in the pre - amp 90 to compensate for the insertion losses in the audio signal which are incurred by the notch filter 372 . the output of the first - stage pre - amp 374 then passes to a second stage pre - amp 376 which is tuned to pass low frequencies . the output conductor 378 of the second pre - amp 376 is coupled to the audio frequency amplifier 130 by a volume control potentiometer 380 . the audio amplifier 130 is in turn coupled by a capacitor 382 to the speaker 131 . in the event that only noise is present on the programmed frequency band and , more specifically , on the programmed frequency within that band , another output conductor 390 receives a positive voltage from the fm detector 86 which passes through a squelch level potentiometer 392 before being coupled to a first squelch transistor switch 394 as shown in fig6 . the presence of the squelch signal , i . e ., a positive voltage on fm detector output conductor 390 , is effective to turn the first transistor switch 394 in the squelch circuit to its on state . the collector 396 of the first squelch transistor switch 394 then goes to a ground level potential which is coupled to turn a second transistor switch 398 to its off state . the collector 400 of the second squelch switch 398 then goes to a positive voltage , such voltage then passing through a squelch amplifier 402 where the signal is amplified and is used as the input to the scanning oscillator 120 . this oscillator 120 is , as previously mentioned in conjunction with fig3 outputting an 80 hz signal which is used to clock the frequency divider 122 . in operation then , the scanning oscillator 120 clocks the frequency divider 122 when there is no broadcast signal being received in a programmed band frequency . it has been found desirable to eliminate the audio output to the speaker 131 during the absence of a programmed broadcast signal . accordingly , the collector 396 of the first squelch transistor switch 394 is coupled to the base 404 of a third transistor 406 in the squelch circuit . the latter transistor 406 thereby is turned on and is saturated when there is no broadcast signal , i . e ., when there is a positive squelch signal coming from the fm detector 86 . the collector of this squelch activated transistor 406 is coupled to the input of the second pre - amp 376 in the audio circuit and renders this pre - amp and thereby the audio amplifier 130 inoperative when the transistor 406 is conductive . when the fm detector 86 detects a broadcast signal on a programmed frequency band , the squelch signal on output conductor 390 is removed , thereby causing the first squelch transistor switch 394 to go off , the second squelch transistor switch 398 to go on and the output of the squelch amplifier 402 to go low . this removes the voltage source to the scanning oscillator 120 . the result is that the scanning oscillator stops the scanning process thereby enabling the broadcast of the signal which has been received by the fm detector for the duration of that signal . it should also be mentioned that turning the first squelch transistor switch 394 to its non - conductive state removes the inhibit from the second audio pre - amp 376 which then permits the broadcast signal to be heard via the speaker 131 . a delay capacitor 410 is connected in parallel with the base 412 of the second squelch transistor 398 . this capacitor is rapidly charged when the collector 396 of the first squelch transistor 394 goes high to indicate that no squelch signal is present and a broadcast signal is being received . at the conclusion of the broadcast signal , and as above explained , the collector 396 of the first squelch transistor 394 goes low which , in theory , should permit the scanning oscillator 120 to continue scanning . however , there is the possibility that the broadcast signal was only being interrupted momentarily , and , to permit instantaneous scanning at the conclusion of a signal could possibly cause the remainder of a broadcast signal , which was being subjected to momentary interruptions , to go unheard . the delay capacitor 410 obviates this problem , as it slowly discharges through the base 412 of the second transistor 398 after a squelch signal has been generated by the fm detector 86 . the relatively slow decay time of this capacitor 410 is sufficient to permit the collector 400 of the second squelch transistor 398 to remain low for , say 11 / 2 seconds , before the second transistor 398 is turned off . turning now to the scanning oscillator 120 , the output of the oscillator 120 is coupled to the base 420 of a transistor limiter 422 which provides the necessary 0 - 5 volt swing in the 80 hz signal to clock the frequency divider 122 . the frequency divider 122 is comprised of three ff &# 39 ; s 424 , 426 and 428 which are coupled together to divide the 80 hz frequency down to 10 hz . the outputs of the three divider ff &# 39 ; s 424 , 426 and 428 are appropriately coupled to four nor gates 430 - 433 and to eight nand gates 436 - 444 for decoding the 10 hz signal into repetitive sequential signals each having a duration of 0 . 1 of a second . the outputs of the eight nand gates 436 - 444 , when the scanning oscillator 120 is running , are sequentially turned off , i . e ., taken to ground level , once each 0 . 8 seconds . the outputs of these nand gates 436 - 444 are coupled by a tandem switch 446 to the input lines 448 - 455 of the diode matrix card 128 . the input lines 448 - 455 of the diode matrix card 128 are also coupled by means of individual light - emitting diodes 456 to a positive voltage supply . as their respective input lines 448 - 455 sequentially go to ground the light - emitting diodes sequentially conduct , thereby signifying that the associated input line has been turned off by the scanning process . the diode matrix 128 is comprised of a plurality of diodes 460 which are connected to form the 8 × 14 matrix 128 that is utilized in the preferred embodiment . for purposes of clarity and dexcription , only six of the diodes are illustrated in fig6 but it is to be understood that the remainder of the diodes are present and are connected in identical fashion with those that are shown . the specific diodes are programmed , i . e ., coupled to the respective matrix input lines 448 - 455 by closing normally open contacts 464 leading from the cathode of each diode to the respective input lines 448 - 455 . in practicing the invention , these normally open contacts 464 are typically bridged by conductive silver ink or the like . the three diodes 466 , 468 and 470 associated with the first input line 448 are shown as being bridged , while the three diodes that are illustrated , two being associated with the second input line 449 and one being associated with the third input line 450 are shown as being unbridged . in operation , and assuming as indicated above that the first three diodes 466 , 468 and 470 associated with the first input line 448 are connected to such input line and , further , that the remaining diodes associated with the first input line 448 remain unconnected , only the first three outputs a - c to the programmable counters 38 will be grounded , and the remaining lines d - l will remain at a high voltage level when the first input line is grounded . it should be seen , now , that this establishes a binary code consisting of three zeros and nine ones . more specifically , and to further explain the operation of the diode matrix 128 , when the first input line 448 is grounded , the first three diodes 466 , 468 and 470 , to continue the example , are rendered conductive thereby pulling the anodes of the diodes to a ground level . this removes the forward bias voltage for three other diodes 474 , 476 and 478 which are coupled between the programmable counter preset lines and the above mentioned anodes . the above output of the diode matrix card 128 and which according to the example consists of three zeros and nine ones , is present for only the one - tenth of a second that the first input line 448 is grounded . the scanning oscillator 120 , as previously explained , causes , after a frequency division and decoding , the sequencing of the voltages that are applied to the input lines 448 - 455 of the diode matrix 128 . assuming a base time of 0 , at 0 . 1 seconds , the first input line 448 goes to ground and the other lines 449 - 455 remain at a high voltage . at 0 . 2 seconds the second input line 449 then goes to ground and all the others ( 448 , 450 - 455 ) remain high . at this time , all diodes which have their cathodes bridged to the second input line 449 cause the associated output lines a - l to operatively go to ground . this establishes a second binary code on the output lines a - l which is indicative of a second programmed frequency . it should now be understood that the sequencing of the input lines 448 - 455 to the diode matrix 128 causes a different binary combination to be present on the output lines a - l as each of the input lines are respectively grounded by the scanning oscillator 120 . the thirteenth and fourteenth output lines m and n of the diode matrix are used to generate a two bit code which controls the first and second transistor switches 322 and 324 used in the circuit of fig5 for alternatively determining the particular band in which the programmed frequency , indicated by the binary combination on output lines a - l , is to be found . more specifically , the bridging of the diode contacts 464 that are associated with the m and n output lines to any of the input lines 448 - 455 , causes the respective output line m and / or n to be grounded when the input line associated therewith is grounded . in accordance with the description of fig5 the grounding of only the m output causes the first transistor switch 322 to be turned on and thereby supplies bias voltage to the first two rf amplifiers 70 and 72 . as the n output line remains ungrounded , the second switch 324 remains non - conductive thereby removing the bias voltage from the uhf and the hf circuits . in operation , then , predetermined ones of the diode matrix diodes 460 have their cathodes coupled by conductive paint or the like to a respective matrix input line 448 - 455 . the receiver is turned on , and the scanning oscillator 120 begins generating its 80 hz signal . this frequency is divided and decoded by the frequency divider 122 and the decoder 124 to sequentially ground each of the diode matrix input lines 448 - 455 in repetitive fashion . each of the input lines is thereby grounded for 0 . 1 of a second . during the time when each of the input lines 448 - 455 is grounded , a predetermined combination of binary significant ones and zeros is available on the output lines a - l leading to the preset lines a - l of the programmable counter stages 232 , 234 and 236 ( fig4 ). thus , a different combination of ones and zeros , representing a different binary number , can be presented and preset into the programmable counter stages 232 , 234 and 236 of fig4 each time a different diode matrix input 448 - 455 goes to ground . in effect , each binary combination available to the preset lines a - l of the programmable counter , presets a different number into such counter stages . it should now be seen that during each 0 . 1 second time period , a different output frequency from the vco 32 is established and generated . for the sake of description , it is assumed that each of the eight input lines to the diode matrix switch contain a different combination of bridged diodes , although two or more of them could be identical . again , during each 0 . 1 second time period , the vco 32 is caused by the programmable counters 38 , acting in conjunction with the phase and frequency detector 28 , to have a different output frequency . this output frequency , somewhere in the range of between 15 and 35 mhz , is then mixed with the 75 mhz oscillator output to form the 90 to 110 mhz local oscillator frequency . if the desired frequency is in the vhf band , the diode 460 on the diode matrix card 128 that is associated with the respective grounded input line 448 - 455 and that is also associated with the m output line is placed or programmed into circuit so that the m output line goes to ground . the grounding of the m output line causes the first transistor switch 322 to go on thereby supplying bias voltage to the first and second rf amplifiers 70 and 72 . this enables an incoming vhf signal to be amplified and , if such signal is at the desired frequency , the second mixer 66 will have the required 60 mhz signal output to enable the subsequent processing of the signal and its broadcast from the speaker 131 . if a vhf signal is received by the antenna 74 but is not at the proper frequency , no broadcast will be made . if the desired frequency is in the uhf band , both the m and n diodes are bridged to the matrix input line where the desired frequency is programmed to turn on both the switches ( fig5 ) 322 and 324 . programming of the hf band is accomplished by bridging only the n diode to the appropriate input line 448 - 455 . all of the above counter - programming , selection of hf , vhf or uhf bands and vco frequency output takes place each 0 . 1 of a second . in the event that a signal , at the programmed frequency , is indeed present at the antenna 74 and contains a broadcast , the described squelch circuitry will halt or inhibit the scanning oscillator 120 until 1 . 5 seconds after the termination of such broadcast so that it can be heard from the speaker 131 . at that time , the scanning will continue to progressively step through each of the programmed frequencies designated by the diode matrix card 128 to look , for a period of 0 . 1 of a second , for an incoming signal from the antenna 74 having the respective programmed frequency , in the programmed band and containing a broadcast . the above description , taken in its entirety , describes an automatically scanning and seeking radio frequency receiver which can synthesize all of the frequencies in the hf , vhf and uhf frequency bands and which has the ability to stop the scanning process when any one of a plurality of predetermined frequencies is obtained and which carries a broadcast signal . furthermore , the described receiver utilizes a singular antenna to effectively receive signals in any one or all of the three radio bands .	7
a . method utilizing a decrease in fluorescence caused by formation of a base pair of an artificial fluorescent base and an artificial quenching base of the invention the method according to an embodiment of the present invention detects the formation of an artificial base pair by observing a decrease in fluorescence of an artificial fluorescent base caused by the formation of the base pair of an artificial fluorescent base and an artificial quenching base represented by formula ii : ( in formula ii , r 2 is a group selected from the group consisting of : substituted or unsubstituted alkyl , alkenyl , and alkynyl groups each having 2 to 10 carbon atoms ; one or more five - membered heterocyclic rings , one or more six - membered heterocyclic rings , and one or more fused heterocyclic rings , these heterocylic rings containing nitrogen or sulfur , and one or more aromatic rings ; the artificial fluorescent base is preferably selected from the group consisting of : ( i ) a 7 -( 2 , 2 ′- bithien - 5 - yl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( dss ); ( ii ) a 7 -( 2 , 2 ′, 5 ′, 2 ″- terthien - 5 - yl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( dsss ); ( iii ) a 2 - amino - 6 -( 2 , 2 ′- bithien - 5 - yl ) purin - 9 - yl group ( ss ); ( iv ) a 2 - amino - 6 -( 2 , 2 ′, 5 ′, 2 ″- terthien - 5 - yl ) purin - 9 - yl group ( sss ); ( v ) a 4 -( 2 , 2 ′- bithien - 5 - yl )- pyrrolo [ 2 , 3 - b ] pyridin - 1 - yl group ( dsas ); ( vi ) a 4 -[ 2 -( 2 - thiazolyl ) thien - 5 - yl ] pyrrolo [ 2 , 3 - b ] pyridin - 1 - yl group ( dsav ); and ( vii ) a 4 -[ 5 -( 2 - thienyl ) thiazol - 2 - yl ] pyrrolo [ 2 , 3 - b ] pyridin - 1 - yl group ( dvas ). these compounds are known to form a base pair with the base represented by formula ii . in addition to the above - mentioned artificial fluorescent bases , for example , 2 - amino purine and ethenoadenosine can also be used . preferably , the artificial quenching base of the present invention is represented by the following formula iii or iv : ( in formula iii , r 3 is selected from — h , iodine , — ch 3 , and : ( in formula iv , r 4 is selected from — ch 3 , — ch 2 — nh 2 , and : in formula iv , n is preferably an integer of 3 to 7 , more preferably 5 . the present invention also provides a kit used in a method of detecting the formation of a base pair of artificial bases on the basis of a decrease in fluorescence of an artificial fluorescent base . the kit includes : a nucleic acid primer comprising a polynucleotide having a 7 -( 2 , 2 ′- bithien - 5 - yl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( dss ) as a base ; and a polynucleotide having a quenching base represented by formula iii or iv as a base . b . method utilizing a change in fluorescence intensity of a fluorescent molecule linked to an artificial quenching base of the invention caused by formation of an artificial base pair the method according to another embodiment of the present invention detects the formation of an artificial base pair of an artificial quenching base represented by : ( in formula v , r 5 is a fluorescent molecule linked with a linker ) on the basis of a change in fluorescence intensity of the fluorescent molecule in the artificial quenching base caused by formation of the base pair of the artificial base represented by formula v . the complementary base to form a base pair with the artificial base of formula v may be any base such as the above - mentioned ds , dss , dsss , s , ss , sss , ddsa , dsas , dsav , ddva , dvas , or ddia . the complementary base is preferably ds , s , ss , sss , ddsa , ddva , or ddia , more preferably a 7 -( 2 - thienyl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( ds ). the artificial quenching base is preferably a base represented by formula vi : ( in formula vi , r 6 is a fluorescent molecule linked directly or via a linker ). as the linker , those described in the quencher represented by formula i can be used . as the fluorescent molecule , those described in the quencher represented by formula i can be used . the present invention also provides a kit used in a method of detecting the formation of a base pair of an artificial base on the basis of a change in fluorescence intensity . the kit includes : a nucleic acid primer comprising a polynucleoside having a 7 -( 2 - thienyl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( ds ) as a base ; and c . method of detecting a nucleic acid utilizing a nucleic acid including a polynucleoside having a modified natural base , artificial base , or base analog having a self - quenching activity that can function as a donor in , for example , fluorescence resonance energy transfer ( fret ) or static quenching an embodiment of the present invention provides a method of detecting the formation of an artificial base pair . the method utilizes a nucleic acid comprising a polynucleoside having a modified natural base , artificial base , or base analog having a self - quenching activity that can function as a donor in , for example , fluorescence resonance energy transfer ( fret ) or static quenching . formation of an artificial base pair of an artificial base ( a first artificial base ) and an artificial base having a fluorescent molecule ( a second artificial base ) in the nucleic acid causes a change in fluorescence spectrum caused by fluorescence resonance energy transfer from the polynucleotide including the modified natural base , artificial base , or base analog to the fluorescent molecule of the second artificial base or static quenching to allow detection of the formation of the artificial base pair . the nucleic acid having the artificial base pair of an artificial base ( a first artificial base ) and an artificial base having a fluorescent molecule ( a second artificial base ) preferably has an artificial quenching base represented by formula ii of the present invention as the second artificial base , but the nucleic acid is not necessarily limited thereto . a nucleic acid including a polynucleoside having a modified natural base , artificial base , or base analog having a self - quenching activity that can function as a donor in , for example , fluorescence resonance energy transfer ( fret ) and / or static quenching in a known artificial base pair can be used . the present invention provides the following embodiment as a variation of method c . in the method of the present invention of detecting the formation of a base pair of artificial bases on the basis of a change in fluorescence spectrum caused by , for example , fluorescence resonance energy transfer or static quenching , the formation of a base pair of a 7 -( 2 , 2 ′- bithien - 5 - yl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( dss ) and a base represented by the following formula vi : ( in formula vi , r 6 is a fluorescent molecule linked directly or via a linker ) causes fluorescence resonance energy transfer from dss to the fluorescent molecule in the base of formula vi or static quenching by excitation with ultraviolet light having a wavelength of 240 to 410 nm . this causes a change in fluorescence spectrum , and the method detects the formation of the artificial base pair on the base of the change . dss is excited with ultraviolet light having a wavelength of 240 to 410 nm it is desirable that the fluorescent molecule in the base of formula vi does not produce fluorescence at this wavelength , but do produce fluorescence only when fret has occurred . in embodiments of c - 2 to c - 4 , the formation of an artificial base pair of a 7 -( 2 - thienyl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( ds ) and a base formula vi is detected . the present invention provides the following embodiment as a variation of method c . in the method of the present invention of detecting the formation of a base pair of artificial bases on the basis of a change in fluorescence spectrum caused by , for example , fluorescence resonance energy transfer or static quenching , the formation of a base pair of a 7 -( 2 - thienyl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( ds ) and a base represented by formula vi causes , for example , fluorescence resonance energy transfer from at least one 2 - amino - 6 -( 2 - thienyl ) purin - 9 - yl group ( s ) to the fluorescent molecule in the base of formula vi or static quenching by excitation with ultraviolet light having a wavelength of 240 to 390 nm . this causes a change in fluorescence spectrum , and the method detects the formation of the artificial base pair on the basis of the change , wherein at least one polynucleotide having a 2 - amino - 6 -( 2 - thienyl ) purin - 9 - yl group ( s ) as a base is present in the same nucleic acid strand comprising a polynucleoside having ds as a base . the number of “ s ”&# 39 ; s present in the same nucleic acid strand comprising the nucleoside having ds as a base is not limited , but is preferably one to three , more preferably one or two , and most preferably two . as shown in lane 3 of fig2 , when the number of “ s ”&# 39 ; s is two , the fluorescence intensity of s &# 39 ; s is decreased or quenched by the self - quenching activity of “ s ”&# 39 ; s ( self quenching ), and a change in fluorescence spectrum caused by fret is clearly observed ( lane 7 of fig2 ). when the number of s is one , the fluorescence of s is observed ( lane 2 of fig2 ). in this case , fret allows the observation of fluorescence of the fluorescent molecule instead of the fluorescence of s ( lanes 5 and 6 of fig2 ). in addition to the embodiment where two or more artificial bases are present in an identical nucleic acid such as the case of having two “ s ”&# 39 ; s adjacent to each other , cases of a natural base to which a base having self - quenching activity is linked and of one artificial base having two or more quenching base ( s ) moieties , such as dss , can also be used in the method of the present invention utilizing fret and / or static quenching . the present invention provides the following embodiment as a variation of method c . in the method of the present invention of detecting the formation of a base pair of artificial bases on the basis of a change in fluorescence spectrum caused by , for example , fluorescence resonance energy transfer or static quenching , the formation of a base pair of ds and a base represented by formula vi causes , for example , fluorescence resonance energy transfer from at least one 2 - amino - 6 -( 2 - thienyl ) purin - 9 - yl group ( s ) to the fluorescent molecule in the base of formula vi or static quenching by excitation with ultraviolet light having a wavelength of 350 to 390 nm this causes a change in fluorescence spectrum , and the method detects the formation of the artificial base pair on the basis of the change , wherein at least one polynucleotide having at least one natural base to which at least one 2 - amino - 6 -( 2 - thienyl ) purin - 9 - yl group ( s ) linked is present in the same nucleic acid strand comprising a polynucleoside having ds as a base . the type of the natural base to which s is linked is not limited and can be any of a , t , g , c , and u . when two or more s - linked natural bases are present to be adjacent to each other , the natural bases may be the same or different , preferably the same . the number of the s - linked natural bases adjacent to each in a nucleic acid is not particularly limited as in the embodiment of c - 2 where s is present in an identical nucleic acid , and is preferably one to three , more preferably one or two , and most preferably two . the embodiment of c - 3 encompasses an embodiment where two or more “ s ”&# 39 ; s are linked to one natural base ( fig3 ). the number of “ s ”&# 39 ; s is not particularly limited , but is preferably two or three , more preferably two . the present invention provides the following embodiment as a variation of method c . in the method of the present invention of detecting the formation of a base pair of artificial bases on the basis of a change in fluorescence spectrum caused by , for example , fluorescence resonance energy transfer or static quenching , the formation of a base pair of ds and a base represented by formula vi causes , for example , fluorescence resonance energy transfer from a 7 -( 2 , 2 ′- bithien - 5 - yl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( dss ) to the fluorescent molecule in the base of formula vi or static quenching by excitation with ultraviolet light having a wavelength of 240 to 410 nm . this causes a change in fluorescence spectrum , and the method detects the formation of the artificial base pair on the basis of the change , wherein a polynucleotide having a natural base to which at least one 7 -( 2 , 2 ′- bithien - 5 - yl ) imidazo [ 4 , 5 - b ] pyridin - 3 - yl group ( dss ) linked is present in the same nucleic acid strand comprising a polynucleoside having ds as a base . in the embodiments of method c including c - 1 to c - 4 of the present invention , any fluorescent molecule can be used without limitation . preferred are those described in the quencher represented by formula i , more preferably indocarbocyanine ( cy3 ). the substituent r 6 in the base represented by formula vi preferably has the following structure : the present invention further provides a kit used in a method of detecting the formation of a base pair of artificial bases on the basis of a change in fluorescence spectrum caused by , for example , fluorescence resonance energy transfer or static quenching . the kit includes one nucleic acid primer selected from the group consisting of the following i ) to iii ): i ) a nucleic acid primer comprising a polynucleotide having dss as a base ; ii ) a nucleic acid primer comprising a polynucleoside having ds as a base and a polynucleotide having at least one s as a base ; iii ) a nucleic acid primer comprising a polynucleoside having ds as a base and a polynucleotide having at least one natural base to which at least one s is linked ; and iv ) a nucleic acid primer comprising a polynucleoside having ds as a base and a polynucleotide having a natural base to which dss is linked , and the kit includes a polynucleotide having a base represented by formula vi . the dss - pn and dss - px base pairs efficiently function also in pcr . in the present invention , the base pairs of nucleic acid may be formed in any process of transcription , reverse transcription , replication , and translation . the method of detection of the present invention utilizing fret and / or static quenching ( embodiment c ) is characterized in that a change in detection spectrum can be observed with the naked eye . prior to the present invention , no method could simply detect the formation of an artificial base pair or target nucleic acid in a visible form . the method of detection of the present invention can be applied to visualization of real - time pcr . accordingly , no complicated and expensive pcr machine is necessary . furthermore , in amplification of nucleic acid by the method of the present invention of detecting an artificial base pair , the amplified nucleic acid can be simply detected by directly performing electrophoresis ( e . g ., fig2 ). in addition , it enables quantification of the nucleic acid on the basis of the density of the band in the electrophoresis . the present invention will be more specifically described by the following examples , which are not intended to limit the technical scope of the present invention . those skilled in the art can easily add modifications or changes to the present invention on the basis of the description of this specification , and such modifications and changes are included in the technical scope of the present invention . reagents and solvents were purchased from typical suppliers and were used without further purification . 1 h - nmr ( 300 mhz ) and 31 p - nmr ( 121 mhz ) spectra were recorded on a bruker av300 nuclear magnetic resonance spectrometer . synthesized nucleoside 5 ′- triphosphate was subjected final purification with a gilson hplc system . electrospray - ionization mass spectra ( esi - ms ) were recorded on a waters zmd 4000 mass system equipped with a waters 2690 lc system . a solution of cy3 n - hydroxysuccinimidyl ester ( cy3 - se , 6 . 0 mg , 7 . 63 μmol ) in dmf ( 300 μl ) was added to a 100 mm nahco 3 — na 2 co 3 buffer solution ( ph 8 . 6 , 500 μl ) containing 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 -[ 3 -( 6 - aminohexanamide )- 1 - propynyl ]- 2 - nitropyrrole 5 ′- triphosphate ( nh 2 - hx - dpxtp ) ( 8 . 4 μmol ), and the mixture was left to stand at room temperature for 12 hours . a 50 mm teaa ( 3 . 0 ml ) solution was added to the reaction solution , and cy3 - hx - dpxtp ( 2 . 7 μmol , 35 %) was yielded through purification by deae sephadex a - 25 and hplc . 1 h nmr ( 300 mhz , d 2 o ) δ 8 . 55 ( t , 1h , j = 13 . 6 hz ), 7 . 90 ( t , 2h , j = 1 . 7 hz ), 7 . 85 ( dd , 2h , j = 1 . 2 , 8 . 4 hz ), 7 . 78 ( d , 1h , j = 2 . 1 hz ), 7 . 39 ( dd , 2h , j = 1 . 9 , 8 . 5 hz ), 7 . 19 ( d , 1h , j = 2 . 1 hz ), 6 . 64 ( t , 1h , j = 5 . 9 hz ), 6 . 39 ( dd , 2h , j = 2 . 8 , 13 . 5 hz ), 4 . 59 ( m , 1h ), 4 . 22 - 4 . 08 ( m , 9h ), 3 . 20 ( q , 32h , j = 7 . 3 hz ), 3 . 07 ( t , 2h , j = 6 . 5 hz ), 2 . 59 ( dt , 1h , j = 6 . 1 , 13 . 3 hz ), 2 . 38 ( dt , 1h , j = 6 . 2 , 13 . 8 hz ), 2 . 27 - 2 . 17 ( m , 2h ), 1 . 86 ( m , 2h ), 1 . 77 ( s , 12h ), 1 . 67 - 1 . 54 ( m , 4h ), 1 . 42 - 1 . 25 ( m , 56h ). 31 p nmr ( 121 mhz , d 2 o ) δ − 8 . 65 ( bs , 1p ), − 10 . 72 ( d , 1p , j = 19 . 7 hz ), − 22 . 32 ( t , 1p , j = 20 . 4 hz ). ms ( esi ) for c 49 h 65 n 6 o 22 p 3 s 2 , calculated value : 1247 . 28 ( m + h ) + , observed value : 1247 . 43 ( m + h ) + , calculated value : 1245 . 28 ( m − h ) − , observed value : 1244 . 91 ( m − h ) − . quenching of artificial fluorescent base dss by artificial base pn in complementary strand ( fig7 ) in order to investigate a change in fluorescence in a single - stranded dna fragment including an artificial fluorescent base dss ( 12 - mer , 5 ′- ggtaacn 1 atgcg - 3 ′, n 1 = dss ) ( seq id no : 1 ) or in a double - stranded dna formed with a complementary dna fragment ( 12 - mer , 5 ′- cgcatn 2 gttacc - 3 ′, n 2 = pn , dss , ds , or t ) ( seq id no : 2 ), a solution containing 5 μm of a single - stranded dna ( ssdna ) or a double - stranded dna ( dsdna ), 10 mm sodium phosphate ( ph 7 . 0 ), 100 mm nacl , and 0 . 1 mm edta was prepared . after annealing , the fluorescence was photographed by irradiation with light of 365 nm using an uv transilluminator . the results are shown in fig7 . fig8 shows fluorescence spectra of dna fragments measured with a jasco fp - 6500 spectrometer equipped with an etc - 273t temperature controller . a solution containing 5 μm of a single - stranded dna fragment including dss ( 12 - mer , 5 ′- ggtaacn 1 atgcg - 3 ′, n 1 = dss ) ( seq id no : 1 ) or its double - stranded dna with a complementary strand ( 12 - mer , 5 ′- cgcatn 2 gttacc - 3 ′, n 2 = pn , dss , ds , or t ) ( seq id no : 2 ) in a 10 mm sodium phosphate buffer ( ph 7 . 0 ), 100 mm nacl , and 0 . 1 mm edta was prepared . after annealing , a fluorescence spectrum caused by excitation with light of 385 nm was measured at 25 ° c . for comparison , the fluorescence spectrum of a single - stranded dna fragment including ds ( 12 - mer , 5 ′- ggtaacn 1 atgcg - 3 ′, n 1 = ds , 5 μm ) ( seq id no : 3 ) excited with light of 310 nm at 25 ° c . was measured . a . change in fluorescence intensity of deoxyribonucleoside triphosphate of an artificial fluorescent base dss ( ddsstp , 5 μm ) dependent on the concentration of deoxyribonucleoside triphosphate of pn ( dpntp ) solutions were prepared by adding 5 μl of deoxyribonucleoside triphosphate ( ddsstp , 105 μm ) to solutions ( 100 μl ) of 10 mm sodium phosphate ( ph 7 . 0 ), 100 mm nacl , and 0 . 1 mm edta containing 2 , 1 , 0 . 5 , 0 . 2 , 0 . 1 , or 0 . 05 mm deoxyribonucleoside triphosphate ( dpntp ). the emission spectrum of ddsstp by excitation with light of 370 nm was measured with a jasco fp - 6500 spectrometer equipped with an etc - 273t temperature controller at 20 ° c . similarly , in order to investigate the fluorescence - quenching effect of ddsstp in the presence of deoxyribonucleoside triphosphate of a natural base , solutions were prepared by adding 5 μl of deoxyribonucleoside triphosphate ( ddsstp , 105 μm ) to solutions ( 100 μl ) of 10 mm sodium phosphate ( ph 7 . 0 ), 100 mm nacl , and 0 . 1 mm edta containing 15 , 12 , 9 , 6 , 3 , or 1 mm deoxyriboadenosine triphosphate ( datp ), deoxyriboguanosine triphosphate ( dgtp ), deoxyribothymidine triphosphate ( dttp ), or deoxyribocytidine triphosphate ( dctp ). the emission spectrum of ddsstp by excitation with light of 370 nm was measured at 20 ° c . b . comparison of quenching activity of dpntp and triphosphate of a natural base against dss quenching of nucleoside triphosphate of an artificial fluorescent base ddsstp ( 5 μm ) by deoxyribonucleoside triphosphate of pn and deoxyribonucleoside triphosphate of a natural base was analyzed by steady - state stern - volmer plot . specifically , emission spectra ( 370 nm excitation ) were measured in a 10 mm sodium phosphate buffer ( ph 7 . 0 ) solution containing 100 mm nacl and 0 . 1 mm edta at 20 ° c . the decrease in fluorescence intensity with the concentration of a quencher ( dpntp , datp , dgtp , dctp , or dttp ) present in the system was substituted for the following stern - volmer expression to calculate the stern - volmer constant ( k sv ): f 0 / f 1 = 1 + k sv [ q ]. stern - volmer expression : here , f 0 represents the fluorescence intensity when no quencher is present ; f 1 represents the fluorescence intensity when a quencher is present ; and [ q ] represents the concentration of the quencher . specifically , the k sv was determined from the straight line obtained by a least - squares method from plots of the f 0 / f 1 values on the vertical axis for the quencher concentrations [ q ] on the horizontal axis . a larger k sv value indicates a higher quenching activity of a quencher . it was revealed that the quenching activity of pn is higher than that of a guanine base , which is known to have a quenching activity . quenching of the fluorescence of ddss by dpn and derivatives thereof ( fig1 ) fig1 shows the results of fluorescence measurement of ddss in the final concentration of 5 μm in the presence of 2 . 5 mm or 5 mm dpn or each derivative thereof at an excitation wavelength of 385 nm and a measurement temperature of 25 ° c . specifically , nucleoside solutions ( 20 μm ddss and 20 mm dpn or each derivative thereof ) were prepared by the following procedure . about 5 mg of ddss , dpn , or a derivative of dpn was dried at 55 to 60 ° c . for 6 hours and was then weighed . an aqueous 20 % acetonitrile solution was added to ddss , dpn , or a derivative of dpn such that the concentration of ddss was 2 mm and the concentration of dpn or a derivative thereof was 20 mm . the ddss solution was further diluted to 20 μm . in order to prepare samples for measuring fluorescence spectra , for a final concentration of dpn or its derivative of 2 . 5 mm ( fig1 a ), 50 μl of a 20 μm ddss solution , 25 μl of a solution of 20 mm dpn or its derivative , 25 μl of a 20 % acetonitrile solution , and 100 μl of ethanol were mixed into a total volume of 200 μl . for a final concentration of dpn or its derivative of 5 mm ( fig1 b ), 50 μl of a 20 μm ddss solution , 50 μl of a solution of 20 mm dpn or its derivative , and 100 μl of ethanol were mixed into a total volume of 200 μl . experiment of single - base incorporation into dna of a dss - pn base pair using a klenow fragment ( table 1 ) an experiment of single - base incorporation by a klenow fragment was performed with reference to documents ( kimoto , m ., yokoyama , s ., hirao , i ., biotechnol . lett ., 2004 , 26 , 999 - 1005 ; petruska , j ., goodman , m . f ., boosalis , m . s ., sowers , l . c ., cheong , c ., tinoco , i ., proc . natl . acad . sci . usa , 1988 , 85 , 6252 - 6256 ; goodman , m . f ., creighton , s ., bloom , l . b ., petruska , j ., crit . rev . biochem . mol . biol ., 1993 , 28 , 83 - 126 ; morales , j . c ., kool , e . t ., nat . struct . biol ., 1998 , 5 , 950 - 954 ). specifically , a primer ( 20 - mer , 5 ′- actcactatagggaggaaga - 3 ′ ( seq id no : 4 ) or 5 ′- actcactatagggagcttct - 3 ′ ( seq id no : 5 )) labeled with 6 - carboxyfluorescein at the 5 ′ end and a template dna ( 35 - mer , 5 ′- agctctdsstcttcctccctatagtgagtcgtattat - 3 ′ ( seq id no : 6 ) or 5 ′- tcgaganagaagctccctatagtgagtcgtattat - 3 ′ ( n = pn , a , g , c , or t ) ( seq id no : 7 )) were heated in a 100 mm tris - hcl buffer ( ph 7 . 5 ) containing 20 mm mgcl 2 , 2 mm dtt , and 100 μg / ml bovine serum albumin ( bsa ) at 95 ° c . and were then gradually cooled to 4 ° c . for annealing to form a double strand of the template and the primer . an enzyme solution ( 2 μl ) of a klenow fragment not having exonuclease activity ( kf exo −, amersham usb ) was added to 5 μl of each primer - template double - stranded dna solution ( 10 μm ). the mixture was incubated at 37 ° c . for 2 minutes to form a dna / enzyme complex . to this solution , 3 μl of each substrate solution , i . e ., nucleoside triphosphate solution ( dss , pn , or one of a , g , c , and t , 1 μm to 5 mm ) was added , followed by an enzyme reaction at 37 ° c . ( for 1 to 35 minutes ). the reaction was terminated by adding 10 μl of a 20 mm edta solution in 95 % formamide ( stop solution ) to the reaction solution and heating the solution at 75 ° c . for 3 minutes . the reaction conditions are summarized as follows . for each solution ( 10 μl ), 5 μm primer - template double strand , 5 to 50 nm enzyme , and 0 . 3 to 1500 μm substrate are used . the solution ( 10 μl ) contains 50 mm tris - hcl ( ph 7 . 5 ), 10 mm mgcl 2 , 1 mm dtt , and 0 . 05 mg / ml bsa . the reaction is performed at 37 ° c . for 1 to 35 minutes . a part of the reaction solution was diluted with the stop solution , and 0 . 5 μl of the diluted reaction solution was mixed with 3 μl of a loading solution ( deionized formamide : 50 mg / ml blue dextran solution containing 25 mm edta = 5 : 1 ). the solution mixture was heated at 90 ° c . for 2 minutes and then was rapidly cooled on ice . about 0 . 5 μl of the solution was loaded on every other lane of a sequencing gel for electrophoresis . the sequencing gel ( 36 cm wtr ) was composed of 6 m urea , 10 % polyacrylamide ( acrylamide : bisacrylamide = 19 : 1 ), and 0 . 5 × tbe . the buffer used for the electrophoresis was 0 . 5 × tbe . the run module was gs run 36c - 2400 . the time for electrophoresis was about 1 hour , and the peak patterns of the reaction products were analyzed and quantitatively measured by an automated abi377 dna sequencer equipped with genescan software ( version 3 . 0 ). the proportion of the primer extended by one nucleotide was determined from the peak area of the unreacted primer fragment and the peak area of the dna fragment extended by single - base incorporation , and enzymatic parameters v max and k m were calculated by hanes - woolf plot ( goodman , m . f ., creighton , s ., bloom , l . b ., petruska , j ., crit . rev . biochem . mol . biol ., 1993 , 28 , 83 - 126 ). the v max value was standardized to 20 nm enzyme concentration and 5 μm double strand concentration for various enzyme and double - strand concentrations used . a : assays were carried out at 37 ° c . for 1 to 35 mm using 5 μm template - primer duplex , 5 to 50 nm enzyme , and 0 . 3 to 1500 μm nucleoside triphosphate in a solution ( 10 μl ) containing 50 mm tris - hcl ( ph 7 . 5 ), 10 mm mgcl 2 , 1 mm dtt , and 0 . 05 mg / ml bovine serum albumin . each parameter was an averaged value of three to eight data sets . c not determined . minimal inserted products (& lt ; 2 %) were detected after an incubation for 20 mm with 1500 μm nucleoside triphosphate and 50 nm enzyme . d the units of this term are % min − 1 m − 1 . primer extension reaction by template dna containing pn and ddsstp using a klenow fragment of dna polymerase i derived from escherichia coli ( fig1 ) a primer ( 23 - mer ) ( seq id no : 8 ) labeled with 32 p at the 5 ′ end and a template dna containing pn or pa ( 35 - mer ) ( seq id no : 9 ) were heated at 95 ° c . in a 20 mm tris - hcl ( ph 7 . 5 ) buffer containing 14 mm mgcl 2 and 0 . 2 mm dtt and were then gradually cooled to 4 ° c . for annealing to form a double strand of the template and the primer . a substrate solution ( 2 . 5 μl ), i . e ., a nucleoside triphosphate solution ( 40 μm dctp , 40 μm dttp , and 0 to 40 μm ddsstp ) was added to 5 μl of each primer - template double - stranded dna solution ( 400 nm ) on ice . to the solution added was an enzyme solution ( 2 . 5 μl , one unit ) of a klenow fragment having exonuclease activity ( kf exo +, takara ) diluted with sterilized water for starting a reaction . after incubation at 37 ° c . for 3 minutes , the reaction was terminated by adding 10 μl of 1 × tbe solution ( stop solution ) containing 10 m urea and heating at 75 ° c . for 3 minutes . the reaction products were electrophoresed on a 15 % polyacrylamide / 7 m urea gel , and the band pattern was analyzed by autoradiography with a bioimaging analyzer ( fla7000 , fujifilm ). pcr amplification of dna including ds using a dss - px base pair ( fig1 ) pcr was performed using a template dna including ds ( s2 , 55 - mer ) or a dna composed of only natural bases ( control , 55 - mer ) in the presence of predetermined concentrations of artificial base substrates , nh 2 - hx - dpxtp and ddsstp . the products were analyzed by electrophoresis . the results are shown in fig1 . the sequences of the template dnas and primers used are as follows . pcr ( reaction scale : 40 μl ) was performed with a dna fragment at a final concentration of 0 . 4 nm as a template by 20 cycles of 94 ° c . for 30 sec , 45 ° c . for 30 sec , and 65 ° c . for 4 min . the final reaction solution was composed of 20 mm tris - hcl ( ph 8 . 8 ), 10 mm kcl , 10 mm ( nh 4 ) 2 so 4 , 2 mm mgso 4 , 0 . 1 % triton x - 100 , deepvent dna polymerase ( 0 . 02 units / μl , neb ), 1 μm of the 5 ′ primer , 1 μm of the 3 ′ primer , 0 . 3 mm each natural base substrate dntp , 10 to 25 μm ddsstp , and 25 μm nh 2 - hx - dpxtp . the pcr products after 20 cycles were electrophoresed on a 15 % polyacrylamide / 7 m urea gel . the gel was stained with sybr green ii ( lonza ), and the band of amplified dna was detected with a bioimager las4000 ( fujifilm ) at the sybr mode . sequencing of dna after pcr amplification using dss - px base pair ( fig1 ) pcr was performed using a template dna including ds ( s2 , 55 - mer ) in the presence of predetermined concentrations of artificial base substrates , nh 2 - hx - dpxtp and ddsstp . whether the artificial base dss was maintained in the products was analyzed by dna sequencing using an artificial base substrate dpa &# 39 ; tp or ddpa &# 39 ; tp . the results are shown in fig1 . the sequences of the template dnas and primers used are as follows . pcr ( reaction scale : 25 μl ) was performed with a dna fragment at a final concentration of 0 . 6 nm as a template by 15 cycles of 94 ° c . for 30 sec , 45 ° c . for 30 sec , and 65 ° c . for 4 min . the final reaction solution was composed of 20 mm tris - hcl ( ph 8 . 8 ), 10 mm kcl , 10 mm ( nh 4 ) 2 so 4 , 2 mm mgso 4 , 0 . 1 % triton x - 100 , deepvent dna polymerase ( 0 . 02 units / μl , neb ), 1 μm of the 5 ′ primer , 1 μm of the 3 ′ primer , 0 . 3 mm each natural base substrate dntp , 2 to 10 μm ddsstp , and 2 to 50 μm nh 2 - hx - dpxtp . the full - length pcr product after 15 cycles was purified with a denatured gel , and the purified product was subjected to sequence analysis as a template for dna sequencing . the sequencing reaction of dna was performed using a mixture ( total volume of 20 μl ) of 8 μl of cycle sequencing mix of a commercially available bigdye terminator v1 . 1 cycle sequencing kit ( applied biosystems ), a primer ( 4 pmol ), and the pcr - amplified dna fragment ( about 0 . 3 pmol ) by 25 cycles of pcr ( 96 ° c . for 10 sec , 50 ° c . for 5 sec , and 60 ° c . for 4 min ) in the presence of 40 pmol of dpa &# 39 ; tp or 1 nmol of ddpa &# 39 ; tp . the unreacted dye terminator was removed from the reaction solution with a centri - sep spin column ( applied biosystems ). the resulting solution was dried by suction under reduced pressure . the residue was suspended in 4 μl of a blue dextran solution in formamide , and a part of the suspension was analyzed with an abi377 dna sequencer . the gel used for the analysis was composed of 7 % polyacrylamide / 6 m urea gel , and the sequence peak pattern was analyzed with applied biosystems prism sequencing analysis v3 . 2 software . fig1 shows the principle of a real - time pcr using a primer including an artificial base dss in the presence of a substrate dpxtp . incorporation of px into a complementary strand of dss allows the px to function as a quencher of the dss . accordingly , double - stranded dna amplified by pcr can be detected from a decrease in fluorescence intensity of dss . fig1 shows the results of real - time pcr when the following dna fragments were actually used . the results show quantitative amplification plots that indicate only three copies of dna in the reaction solution ( 25 μl ) can be detected . specifically , pcr was performed with a real - time pcr machine ( stratagene mx3005p ) in the presence of 1 μm of each primer , 0 . 2 mm of each natural base substrate dntp , and 2 μm of an artificial base substrate dpxtp at 94 ° c . for 2 min and then through 55 cycles each of consisting of two steps of 94 ° c . for 5 sec and 68 ° c . for 40 sec . the reaction scale of the pcr was 25 μl , and the reaction solution was composed of 40 mm tricine - koh ( ph 8 . 0 ), 16 mm kcl , 3 . 5 mm mgso 4 , 3 . 75 μg / ml bsa , and 1 × titanium taq dna polymerase . the dna fragment used as the template was diluted such that the reaction solution contained 0 , 3 , 15 , 30 , 150 , 300 , 1500 , 3000 , 15000 , or 30000 copies , and pcr was performed at each concentration . the filter set used for the detection was for an excitation wavelength of 350 nm and a fluorescence wavelength of 440 nm ( for alexa ). data was analyzed with plexor ( registered trademark ) analysis software ( v1 . 5 . 4 . 18 , promega & amp ; eragen biosciences ). the results are shown in fig1 . fluorescent characteristics dna hairpin including dss - pn base pair ( fig1 ) a 1 × ex taq buffer ( takara , containing 2 mm mgcl 2 ) containing 1 μm dna including dss , i . e ., hairpin ssdna ( 34 - mer ) ( seq id no : 18 ) or ssdna ( 12 - mer ) ( seq id no : 19 ) was prepared . changes in fluorescence intensity due to variable temperature were detected in the presence of a reference dye rox ( invitrogen ) ( final concentration : 1000 fold dilution ) with mx3005p at the dissociation mode . fig1 is a graph showing fluorescence intensities after correction with a signal intensity of rox and normalization with the value at 35 ° c . the profile of ssdna ( 12 - mer ) in a linear strand without a hairpin structure shows gradually decreasing fluorescence as in the case of single use of the buffer ( background ) not containing dna . in contrast , the profile of hairpin ssdna ( 34 - mer ) forming a hairpin structure containing a dss - pn base pair shows an increase in fluorescence with temperature . this suggests that pn having a quenching activity forms a base pair with dss in the hairpin structure at low temperature to quench the fluorescence of dss to reduce the fluorescence intensity and that the hairpin structure is broken at elevated temperature to lose the quenching activity to allow the detection of the fluorescence of dss . visualization of molecular beacon using dss - pn base pair ( fig1 ) a solution of 2 μm of a dna fragment molecular beacon ( mb - c , 26 - mer ) ( seq id no : 20 ) and a solution of 2 μm of a dna fragment target dna ( 71g , 71 - mer ) ( seq id no : 21 ) were prepared and mixed in equal volumes ( each 50 μl ). as a negative control , a solution not containing the target dna was mixed with the mb - c solution . the final solution was composed of 1 μm each dna , 10 mm sodium phosphate buffer ( ph 7 . 0 ), 100 mm nacl , and 0 . 1 mm edta . this solution was heated at 90 ° c . for 10 seconds with a pcr machine and was then slowly cooled to 25 ° c . the solution was photographed with a digital camera under irradiation with a uv - led lamp at an excitation wavelength of 375 nm or natural light . the photographs are shown on the right in fig1 . in the absence of the target dna , the molecular beacon forms a loop - stem structure to quench the fluorescence of dss by formation of the dss - pn base pair . in contrast , in the presence of the target dna , the loop region of the molecular beacon forms a double strand with the target dna by hybridization to break the stem structure to lose the dss - pn base pair . as a result , the fluorescence of dss was detected by visual observation . detection of single - nucleotide mutation with a molecular beacon using a dss - pn base pair ( fig1 ) a molecular beacon ( 26 - mer , mb - c ( seq id no : 20 ) or mb - t ( seq id no : 23 )) solution ( 50 μl ) diluted to 500 nm was mixed with a target dna fragment ( 71 - mer , 71g ( seq id no : 21 ) or 71a ( seq id no : 22 ), 12 . 5 μl ) in a concentration of five times the final solution to prepare a sample . the sample was warmed at 45 ° c . for 5 minutes or more in an incubator to obtain an equilibrium state . fluorescence was measured with a jasco fp - 6500 spectrometer . the solution was transferred to a cell and was left in the apparatus ( at 45 ° c .) for 2 minutes , and fluorescence spectrum of 430 to 470 nm was measured by exciting with light of 390 nm by automated shutter control . the final solution was composed of 400 nm molecular beacon , 0 to 3200 nm target dna , 10 mm sodium phosphate buffer ( ph 7 . 0 ), 100 mm nacl , and 0 . 1 mm edta . fig1 is a graph plotting the fluorescence intensity at 454 nm normalized by the fluorescence intensity in the absence of the target dna fragment . the results show that single - nucleotide mutation can be detected with a molecular beacon using a dss - pn base pair on the basis of that single - base mismatch significantly decreases fluorescence intensity compared with that in a completely complementary strand . visualization of pcr using cy3 - px / dss base pair ( fig2 ) fig1 shows the principle of real - time pcr using a primer including an artificial base dss in the presence of a substrate cy3 - hx - dpxtp . cy3 - hx - dpx is incorporated into a complementary strand of dss to cause fret between dss and cy3 by irradiation with light of approximately 350 nm , resulting in specific emission of double - stranded dna amplified by pcr . the fluorescence by the fret was visually detected ( fig2 ). the sequences of strands used in this experiment are the same as those shown in fig1 . specifically , pcr was performed with a real - time pcr machine ( stratagene mx3005p ) in the presence of 1 μm of each primer , 0 . 2 mm of each natural base substrate dntp , and 2 μm of an artificial base substrate cy3 - hx - dpxtp at 94 ° c . for 2 mm and then through 55 cycles each consisting of two steps of 94 ° c . for 5 sec and 68 ° c . for 40 sec . the reaction scale of the pcr was 25 μl , and the reaction solution was composed of 40 mm tricine - koh ( ph 8 . 0 ), 16 mm kcl , 3 . 5 mm mgso 4 , 3 . 75 μg / ml bsa , and 1 × titanium taq dna polymerase . the dna fragment used as the template was diluted such that the reaction solution contained 0 , 3 , 30 , 300 , 3000 , 30000 , 300000 , or 3000000 copies , and pcr was performed at each concentration . the reaction tube was directly irradiated with uv light of 365 nm , and fluorescence was visually detected through an orange filter . real - time pcr by fluorescent molecule cy3 - linked px base with quenching activity ( fig2 ) fig2 shows the principle of real - time pcr using a primer including an artificial base ds in the presence of a substrate dpxtp derivative including fluorescent molecule ( e . g ., cy3 ). linking of a fluorescent molecule to a px base having a quenching activity quenches the fluorescence intensity of the fluorescent molecule by about 30 %. when a substrate ( cy3 - hx - dpxtp ) is used in pcr using a primer including a ds base , cy3 - hx - dpx is incorporated in a dna to increase the fluorescence intensity of the cy3 . fig2 shows the results of real - time pcr when the following dna fragments were actually used . the results show quantitative amplification plots that indicate only three copies of dna in the reaction solution ( 25 μl ) can be detected . specifically , pcr was performed with a real - time pcr machine ( stratagene mx3005p ) in the presence of 1 μm of each primer , 0 . 2 mm of each natural base substrate dntp , and 2 μm of an artificial base substrate cy3 - hx - dpxtp at 94 ° c . for 2 min and then through 55 cycles each consisting of two steps of 94 ° c . for 5 sec and 68 ° c . for 40 sec . the reaction scale of the pcr was 25 μl , and the reaction solution was composed of 40 mm tricine - koh ( ph 8 . 0 ), 16 mm kcl , 3 . 5 mm mgso 4 , 3 . 75 mg / ml bsa , and 1 × titanium taq dna polymerase . the dna fragment used as the template was diluted such that the reaction solution contained 0 , 3 , 30 , 300 , 3000 , 30000 , 300000 , or 3000000 copies , and pcr was performed at each concentration . the filter set used for the detection was for an excitation wavelength of 545 nm and a fluorescence wavelength of 568 nm ( for cy3 ). data was analyzed with the attached analysis software mxpro version 4 . 10 . detection of real - time pcr products by fluorescent molecule cy3 - linked px with quenching activity on electrophoretic gel ( fig2 ) since cy3 is incorporated in the pcr product shown in fig2 , the pcr product can be detected by agarose gel electrophoresis with the fluorescence of cy3 on the gel without conventional dna staining with , for example , etbr or sybr green . fig2 shows the results of detecting band patterns in 4 % agarose gel electrophoresis of 12 μl of the pcr product shown in fig2 with a bioimaging analyzer , fla7000 ( fujifilm ) at a cy3 detection mode ( excitation laser : 532 nm , detection filter : 0580 ). fluorescent characteristics of dna including fluorescent molecule cy3 and artificial fluorescent base s ( fig2 ) the concentrations of dna fragments chemically synthesized and purified by hplc were each adjusted to a final concentration of 5 μm with a 10 mm sodium phosphate buffer ( ph 7 ) containing 100 mm nacl and 0 . 1 mm edta . fig2 shows the results of investigation on fluorescent characteristics of these solutions by visual observation and fluorescence spectra . uv irradiation was performed from below with an uv transilluminator . the dna fragment containing one artificial fluorescent base s emitted light by irradiation with light of 254 nm , 302 nm , and 365 nm ( photograph of lane 2 ), and the fluorescence was quenched by introducing two adjacent “ s ”&# 39 ; s to the dna ( photograph of lane 3 ). the dna containing cy3 slightly emitted fluorescent light by irradiation with light of 254 nm and 302 nm , but hardly emitted fluorescent light by irradiation with light of 365 nm ( photograph of lane 4 ). the fluorescence of cy3 was observed by introducing one or two “ s ”&# 39 ; s near cy3 in the dna to confirm the occurrence of fret ( photographs of lanes 5 to 7 ). the graph shows the fluorescence spectra when the solutions were excited with light of 365 nm visualization of pcr by a combination of fluorescent molecule cy3 - linked px base with quenching activity and artificial fluorescent base s ( fig2 to 28 ) fig2 shows the principle of real - time pcr using a primer including an artificial base ds and two adjacent artificial fluorescent bases “ s ”&# 39 ; s in the presence of a substrate cy3 - hx - dpxtp . the fluorescence of “ s ”&# 39 ; s is completely quenched by introducing them so as to be adjacent to each other ; however , combination of arrangement of ds near the “ s ”&# 39 ; s and specific incorporation of cy3 - hx into the double - stranded dna by complementation to the ds causes fret between the s &# 39 ; s and the cy3 by irradiation with light of approximately 365 nm , which allows only the double - stranded dna amplified by pcr to specifically emit light . fig2 shows the results of visual observation of the product by 25 cycles of pcr actually using the following dna fragments . in the system using ss - cy3 shown in fig2 , pcr was performed with a pcr machine ( mj research , ptc - 100 ) in the presence of 1 μm of each primer , 0 . 2 mm of each natural base substrate dntp , and 2 μm of an artificial base substrate cy3 - hx - dpxtp at 94 ° c . for 2 min and then through 25 cycles each consisting of two steps of 94 ° c . for 5 sec and 68 ° c . for 40 sec . the reaction scale of the pcr was 25 μl , and the reaction solution was composed of 40 mm tricine - koh ( ph 8 . 0 ), 16 mm kcl , 3 . 5 mm mgso 4 , 3 . 75 μg / ml bsa , and 1 × titanium taq dna polymerase . the concentration of the dna fragment used as the template was 0 . 5 nm . in the conventional pcr performed in the presence of sybr green i , sybr green i ( final concentration : 1 / 30000 ), instead of the 2 μm artificial base substrate cy3 - hx - dpxtp , and rox ( final concentration : 1 / 500 ), as a reference dye , were used . real - time pcr detection in the presence of sybr green i is one of the methods that have been most widely employed , but , as shown in the photographs on the two lanes on the right side in fig2 , the change in fluorescence between the presence and the absence of dna is not noticeable and therefore cannot be visually detected . in contrast , in the method of the present invention , pcr can be visually detected , as shown in the two lanes on the left side in fig2 . in the real - time pcr shown in fig2 a , pcr was performed with a real - time pcr machine ( stratagene mx3005p ) in the presence of 1 μm of each primer , 0 . 2 mm of each natural base substrate dntp , and 2 μm of an artificial base substrate cy3 - hx - dpxtp at 94 ° c . for 2 min and then through 55 cycles each consisting of two steps of 94 ° c . for 5 sec and 68 ° c . for 40 sec . the reaction scale of the pcr was 25 μl , and the reaction solution was composed of 40 mm tricine - koh ( ph 8 . 0 ), 16 mm kcl , 3 . 5 mm mgso 4 , 3 . 75 μg / ml bsa , and 1 × titanium taq dna polymerase . the dna fragment used as the template was diluted such that the reaction solution contained 0 , 3 , 30 , 300 , 3000 , 30000 , 300000 , or 3000000 copies , and pcr was performed at each concentration . furthermore , as shown in fig2 a , it was revealed that pcr products from only three copies of dna in a reaction solution ( 25 μl ) can be visually detected by irradiation with light of 365 nm furthermore , fig2 shows the results of agarose gel electrophoresis of visualized pcr products shown in fig2 a . the results show that a product can be detected through fret from s to cy3 caused by irradiation with light of 312 nm and that a product can be detected through fluorescence of cy3 directly incorporated into dna by irradiation with light of 532 nm fig2 shows the electrophoretic results of 12 μl of the pcr product shown in fig2 a on a 4 % agarose gel when the product was detected through fret between s and cy3 with a bioimaging analyzer , las4000 ( fujifilm ), at an etbr detection mode ( excitation : 312 nm , transparent uv detection filter : 605df40 ) and when the product was directly detected by fluorescence of cy3 with fla7000 ( fujifilm ) at a cy3 detection mode ( excitation laser : 532 nm , detection filter : o580 ). visualization of pcr using a combination of fluorescent molecule cy3 - linked px base with quenching activity : quantitative determination of fluorescence intensity at respective pcr cycles ( fig2 b to 27 d ) this example is a supplementary experiment of the experiment shown in fig2 a . pcr using a primer including an artificial base ds and two adjacent artificial fluorescent bases “ s ”&# 39 ; s in the presence of a cy3 - hx - dpxtp substrate can be utilized in real - time pcr ( fig2 b ) by measuring an increase in fluorescence intensity of cy3 in the amplified dna . in addition , a difference in initial concentrations of dna can be visually detected by pcr amplification of the dna ( fig2 c ). furthermore , amplification of dna can be quantified by processing photographed images of tubes in the amplification process of respective pcr cycles ( fig2 d ). pcr was performed with a real - time pcr machine ( stratagene mx3005p ) in the presence of 1 μm of each primer , 0 . 2 mm of each natural base substrate dntp , and 2 μm of an artificial base substrate cy3 - hx - dpxtp at 94 ° c . for 2 min and then through 30 , 35 , 40 , 45 , or 55 cycles each consisting of two steps of 94 ° c . for 5 sec and 68 ° c . for 40 sec . the reaction scale of the pcr was 25 μl , and the reaction solution was composed of 40 mm tricine - koh ( ph 8 . 0 ), 16 mm kcl , 3 . 5 mm mgso 4 , 3 . 75 lag / ml bsa , and 1 × titanium taq dna polymerase . the dna fragment used as the template was diluted such that the reaction solution contained 0 , 3 , 30 , 300 , 3000 , 30000 , 300000 , or 3000000 copies , and pcr was performed at each concentration . for quantitative analysis , images of a tube after completion of the reaction was processed by the following procedure : the tube was photographed with a digital camera through an uv cut filter and an orange filter under irradiation with uv of 365 nm from below with a uv transilluminator , and the resulting file ( jpeg format ) was converted to a tiff format file with adobe photoshop ver . 6 . 0 so that the image mode is a gray scale and the resolution is 72 pixel / inch . this file was read with science lab 2005 multi gauge software for quantitative analysis . specifically , the background value ( average of seven points in the area between tubes ) was subtracted from the quantum level ( ql value ) at portion [ 1015 ( pixel ) 2 ] of the reaction solution of the tube , and the resulting value per unit area was plotted for the pcr cycles or the number of copies used as the template to show the results as a graph . detection of pcr product using nucleoside derivative ( s - hx - du ), a natural base to which a fluorescent molecule ( s base ) is linked via a linker , and ds - px base pair ( fig2 b to 29 d ) this example is supplementary experiment of the experiment shown in fig2 a . fig2 a shows the principle of real - time pcr using a primer including two adjacent modified bases ( s - hx - du ) s , each being a natural base u to which an artificial fluorescent base is linked via a linker , in the presence of a substrate cy3 - hx - dpxtp . the fluorescence of s is quenched when two ( s - hx - du ) s are adjacent to each other ; however , combination of arrangement of ds near the ( s - hx - du ) s and specific incorporation of cy3 - hv - dpx into the double - stranded dna by the complementation to the ds causes fret between the s of the s - hx - du and the cy3 by irradiation with light of approximately 365 nm , which allows only the double - stranded dna amplified by pcr to specifically emit light , as in the case of two adjacent “ s ”&# 39 ; s ( fig2 ). in the case shown in fig2 , since the primer includes two s bases , the synthesis of a complementary strand by pcr may stop at this site . in this method , however , since s is linked to a natural base via a linker , the synthesis of a complementary strand by pcr proceeds . accordingly , a portion containing an artificial dye for color development can be introduced to any site of a primer , and the method can be used in pcr such as lamp or smap . in addition , the method can be applied to a strand other than primer regions , such as padlock pcr . fig2 b shows the dna sequences used and conditions for pcr . fig2 c shows the results of real - time pcr by 55 cycles , and fig2 d shows the results of visual observation of amplified products after pcr by 55 cycles . the pcr amplification was performed using the dna as a target ( target dna ) in an amount ranging from 0 to 3000000 copies to confirm that dna was visually observed from three or more copies of dna . sequences used in the experiment ( primer annealing sites are underlined ; us = s - hx - du ): specifically , pcr was performed with a real - time pcr machine ( stratagene mx3005p ) in the presence of 1 μm of each primer , 0 . 2 mm of each natural base substrate dntp , and 2 μm of an artificial base substrate cy3 - hx - dpxtp at 94 ° c . for 2 min and then through 55 cycles each consisting of two steps of 94 ° c . for 5 sec and 68 ° c . for 40 sec . the reaction scale of the pcr was 25 μl , and the reaction solution was composed of 40 mm tricine - koh ( ph 8 . 0 ), 16 mm kcl , 3 . 5 mm mgso 4 , 3 . 75 μg / ml bsa , and 1 × titanium taq dna polymerase . the dna fragment used as the template was diluted such that the reaction solution contained 0 , 3 , 30 , 300 , 3000 , 30000 , 300000 , or 3000000 copies , and pcr was performed at each concentration . the reaction tube was directly irradiated with uv light of 365 nm , and fluorescence was visually detected through an orange filter . chemical synthesis of s - hx - du amidite reagent ( compound shown in fig6 ) ( fig3 ) dehydrated dichloromethane ( 20 ml ) and triphenylphosphine ( 5 . 91 g , 22 . 5 mmol ) were added to 8 - hydroxy - 1 - octyne ( 1 . 95 g , 15 mmol ). the mixture was cooled to 0 ° c . and was then dropwise added to dehydrated dichloromethane ( 10 ml ) containing carbon tetrabromide ( 7 . 46 g , 22 . 5 mmol ), followed by stirring at room temperature for 2 hours . after separation between dichloromethane ( 100 ml ) and 5 % sodium bicarbonate ( 150 ml ), the organic layer was washed with saturated brine ( 150 ml ). the organic layer was dried over sodium sulfate and then concentrated . the concentrated product was purified by silica gel column chromatography ( dichloromethane : methanol = from 100 : 0 to 99 : 1 ) to yield 8 - bromo - 1 - octyne ( crude ). 1 h nmr ( 300 mhz , dmso - d6 ) δ 3 . 51 ( t , 2h , j = 6 . 7 hz ), 2 . 71 ( t , 1h , j = 2 . 7 hz ), 2 . 12 - 2 . 17 ( m , 2h ), 1 . 75 - 1 . 84 ( m , 2h ), 1 . 24 - 1 . 54 ( m , 6h ). 2 ) synthesis of 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - amino purine ( step ( b ) in fig3 ) 8 - bromo - 1 - octyne ( 2 . 0 g , 10 . 6 mmol ) prepared in step 1 ) was added to a dehydrated dimethylformamide ( 25 ml ) solution containing 6 -( thien - 2 - yl )- 2 - amino purine ( 1 . 2 g , 5 . 5 mmol ) and potassium carbonate ( 2 . 3 g , 16 . 5 mmol ), followed by stirring at room temperature for 15 hours . the reaction solution was concentrated and was separated between ethyl acetate and water . the organic layer was washed with saturated brine , was dried over anhydrous sodium sulfate , and was purified by medium - pressure preparative column chromatography to yield 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - amino purine ( 1 . 6 g , 4 . 9 mmol , 87 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 8 . 53 ( dd , 1h , j = 1 . 2 , 3 . 7 hz ), 8 . 14 ( s , 1h ), 7 . 79 ( dd , 1h , j = 1 . 2 , 5 . 0 hz ), 7 . 26 ( dd , 1h , j = 3 . 7 , 5 . 0 hz ), 6 . 48 ( brs , 2h ), 4 . 05 ( t , 2h , j = 7 . 2 hz ), 2 . 72 ( t , 1h , j = 2 . 6 hz ), 2 . 12 ( m , 2h ), 1 . 78 ( m , 2h ), 1 . 23 - 1 . 46 ( m , 6h ). 3 ) synthesis of 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ( step ( c ) in fig3 ) 1 - hydroxybenzotriazole ( 1 . 19 g , 8 . 84 mmol ) was azeotropically dried with dehydrated pyridine three times . dehydrated pyridine ( 2 . 5 ml ), dehydrated acetonitrile ( 2 . 5 ml ), and phenoxyacetyl chloride ( 1 . 08 ml , 7 . 85 mmol ) were added to the 1 - hydroxybenzotriazole . the mixture was stirred at room temperature for 5 minutes , then cooled to 0 ° c ., and dissolved in dehydrated pyridine ( 25 ml ). 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - amino purine ( 1 . 60 g , 4 . 91 mmol ) prepared in step 2 ) was added thereto . the mixture was stirred at room temperature overnight and was separated between ethyl acetate ( 150 ml ) and saturated brine ( 150 ml ) twice . the organic layer was dried over sodium sulfate and then concentrated . the concentrated product was purified by silica gel column chromatography ( dichloromethane : methanol = from 100 : 0 to 99 : 1 ) to yield 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ( 1 . 44 g , 3 . 13 mmol , 64 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 10 . 71 ( s , 1h ), 8 . 62 ( d , 1h , j = 2 . 6 hz ), 8 . 54 ( s , 1h ), 7 . 92 ( dd , 1h , j = 1 . 1 , 5 . 0 hz ), 7 . 31 ( m , 3h ), 6 . 92 - 6 . 93 ( m , 3h ), 5 . 15 ( brs , 2h ), 4 . 20 ( t , 2h , j = 7 . 1 hz ), 2 . 71 ( t , 1h , j = 2 . 6 hz ), 2 . 09 - 2 . 13 ( m , 2h ), 1 . 82 - 1 . 92 ( m , 2h ), 1 . 27 - 1 . 41 ( m , 6h ). 4 ) synthesis of 5 -[ 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ]- 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 2 ′- deoxyuridine ( step ( d ) in fig3 ) 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 5 - iodo - 2 ′- deoxyuridine ( 1 . 64 g , 2 . 5 mmol ), tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 145 mg , 0 . 125 mmol ), copper iodide ( 76 mg , 0 . 4 mmol ), and dehydrated dimethylformamide ( 7 . 5 ml ) were added to a microwave machine . after the system was purged with argon gas , dehydrated triethylamine ( 523 μl , 3 . 75 mmol ) was added , and then dehydrated dimethylformamide ( 5 ml ) and dehydrated pyridine ( 10 ml ) containing 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ( 1 . 38 g , 3 . 00 mmol ) prepared in step 3 ) were added thereto . the mixture was stirred at 60 ° c . for 3 hours with the microwave machine ( standard mode ) and was separated between ethyl acetate ( 100 ml ) and water ( 100 ml ). the organic layer was washed with saturated brine ( 100 ml ), was dried over sodium sulfate , and then was concentrated . the concentrated product was purified by silica gel column chromatography ( dichloromethane : methanol = from 100 : 0 to 97 : 3 ) to yield 5 -[ 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ]- 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 2 ′- deoxyuridine ( 931 mg , 0 . 94 mmol , 38 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 11 . 59 ( brs , 1h ), 10 . 70 ( brs , 1h ), 8 . 61 ( dd , 1h , j = 0 . 9 , 3 . 8 hz ), 8 . 51 ( s , 1h ), 7 . 92 ( dd , 1h , j = 0 . 9 , 5 . 0 hz ), 7 . 87 ( s , 1h ), 7 . 17 - 7 . 37 ( m , 12h ), 6 . 82 - 6 . 96 ( m , 7h ), 6 . 11 ( t , 1h , j = 6 . 6 hz ), 5 . 31 ( d , 1h , j = 4 . 4 hz ), 5 . 14 ( brs , 2h ), 4 . 02 - 4 . 28 ( m , 3h ), 3 . 70 - 3 . 91 ( m , 1h ), 3 . 12 - 3 . 16 ( m , 2h ), 2 . 04 - 2 . 24 ( m , 4h ), 1 . 76 - 1 . 99 ( m , 2h ), 1 . 15 - 1 . 20 ( m , 6h ). 5 ) synthesis of 5 -[ 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ]- 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 2 ′- deoxyuridine - 3 ′- o -( 2 - cyanoethyl - n , n - diisopropyl ) phosphoramidite ( step ( e ) in fig3 ) 5 -[ 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ]- 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 2 ′- deoxyuridine ( 890 mg , 0 . 9 mmol ) prepared in step 4 ) was azeotropically dried with dehydrated pyridine three times and with dehydrated tetrahydrofuran three times . subsequently , dehydrated tetrahydrofuran ( 4 . 5 ml ), dehydrated diisopropylethylamine ( 235 μl , 1 . 35 mmol ), and 2 - cyanoethyl - n , n ′- diisopropylchlorophosphoramidite ( 241 μl , 1 . 08 mmol ) were added thereto , followed by stirring at room temperature for 1 hour . dehydrated methanol ( 50 μl ) was added to the mixture , and the resulting mixture was separated between ethyl acetate : triethylamine ( 20 : 1 , 50 ml ) and 5 % sodium bicarbonate ( 50 ml ). the organic layer was washed with saturated brine ( 100 ml ), was dried over sodium sulfate , and was concentrated . the concentrated product was purified by silica gel column chromatography ( hexane : ethyl acetate : triethylamine = from 98 : 0 : 2 to 78 : 20 : 2 ) to yield 5 -[ 6 -( thien - 2 - yl )- 9 -( 7 - octynyl )- 2 - phenoxyacetamide purine ]- 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 2 ′- deoxyuridine - 3 ′- o -( 2 - cyanoethyl - n , n - diisopropyl ) phosphoramidite ( 867 mg , 0 . 73 mmol , 81 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 11 . 57 ( brs , 1h ), 10 . 70 ( brs , 1h ), 8 . 60 ( dd , 1h , j = 1 . 1 , 3 . 7 hz ), 8 . 50 ( s , 1h ), 7 . 89 - 7 . 92 ( m , 2h ), 7 . 14 - 7 . 36 ( m , 12h ), 6 . 79 - 6 . 95 ( m , 7h ), 6 . 10 ( dt , 1h , j = 6 . 2 , 6 . 3 hz ), 5 . 13 ( brs , 2h ), 4 . 50 - 4 . 60 ( m , 1h ), 4 . 16 ( t , 2h , j = 6 . 7 hz ), 3 . 99 - 4 . 06 ( m , 1h ), 3 . 17 - 3 . 71 ( m , 12h ), 2 . 26 - 2 . 76 ( m , 4h ), 2 . 05 - 2 . 10 ( m , 2h ), 1 . 74 - 1 . 77 ( m , 2h ), 0 . 82 - 1 . 39 ( m , 18h ). chemical synthesis of dss - hx - du amidite reagent ( compound shown in fig6 ) ( fig3 ) 1 ) synthesis of 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ( step ( a ) in fig3 ) a dmf solution ( 15 ml ) containing 7 -( 2 , 2 ′- bithien - 5 - yl ) imidazo [ 4 , 5 - b ] pyridine ( 850 mg , 3 . 0 mmol ) and potassium carbonate ( 1 . 3 g , 9 . 0 mmol ) was stirred at 60 ° c . for 1 hour . subsequently , 8 - bromo - 1 - octyne ( 850 mg , 4 . 5 mmol ) was added to the dmf solution , followed by stirring at 60 ° c . for 6 hours . the reaction solution was separated between ethyl acetate and water . the organic layer was washed with saturated brine , was dried over anhydrous sodium sulfate , and was purified by medium - pressure preparative column chromatography to yield 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ( 520 mg , 1 . 3 mmol , 44 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 8 . 56 ( s , 1h ), 8 . 34 ( d , 1h , j = 5 . 2 hz ), 8 . 21 ( d , 1h , j = 3 . 9 hz ), 7 . 63 ( d , 1h , j = 5 . 2 hz ), 7 . 58 ( dd , 1h , j = 1 . 1 , 5 . 1 hz ), 7 . 46 ( dd , 1h , j = 1 . 1 , 3 . 6 hz ), 7 . 44 ( d , 1h , j = 4 . 0 hz ), 7 . 14 ( dd , 1h , j = 3 . 6 , 5 . 1 hz ), 4 . 29 ( t , 2h , j = 7 . 4 hz ), 2 . 72 ( t , 1h , j = 2 . 7 hz ), 2 . 12 ( m , 2h ), 1 . 87 ( m , 2h ), 1 . 43 - 1 . 31 ( m , 6h ). 2 ) synthesis of 5 -[ 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 2 ′- deoxyuridine ( step ( b ) in fig3 ) a dmf ( 4 . 2 ml ) solution containing 5 - iodo - 2 ′- deoxyuridine ( 294 mg , 0 . 83 mmol ), 7 -( 2 , 2 ′- bithienyl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ( 270 mg , 0 . 69 mmol ), cui ( 25 mg ), tetrakistriphenylphosphine ( 48 mg ), and triethylamine ( 173 μl ) was stirred at room temperature for 17 hours . the reaction solution was separated between ethyl acetate and water . the organic layer was washed with saturated brine , was dried over anhydrous sodium sulfate , and was purified by column chromatography ( eluted with a 3 % methanol solution in methylene chloride ) to yield 5 -[ 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 2 ′- deoxyuridine ( 155 mg , 0 . 25 mmol , 36 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 11 . 54 ( s , 1h ), 8 . 56 ( s , 1h ), 8 . 34 ( d , 1h , j = 5 . 2 hz ), 8 . 21 ( d , 1h , j = 3 . 9 hz ), 8 . 09 ( s , 1h ), 7 . 63 ( d , 1h , j = 5 . 2 hz ), 7 . 58 ( dd , 1h , j = 1 . 1 , 5 . 1 hz ), 7 . 46 ( dd , 1h , j = 1 . 1 , 3 . 6 hz ), 7 . 44 ( d , 1h , j = 4 . 1 hz ), 7 . 14 ( dd , 1h , j = 3 . 6 , 5 . 1 hz ), 6 . 10 ( t , 1h , j = 6 . 9 hz ), 5 . 21 ( d , 1h , j = 4 . 3 hz ), 5 . 06 ( t , 1h , j = 5 . 0 hz ), 4 . 30 ( t , 2h , j = 7 . 2 hz ), 4 . 21 ( m , 1h ), 3 . 77 ( m , 1h ), 3 . 56 ( m , 2h ), 2 . 33 ( m , 2h ), 2 . 09 ( m , 2h ), 1 . 88 ( m , 2h ), 1 . 45 ( m , 4h ), 1 . 29 ( m , 2h ). 3 ) synthesis of 5 -[ 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 5 ′- o -( 4 , 4 - dimethoxytrityl )- 2 ′- deoxyuridine ( step ( c ) in fig3 ) a pyridine ( 2 . 4 ml ) solution containing 5 -[ 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 2 ′- deoxyuridine ( 150 mg , 0 . 24 mmol ) and 4 , 4 ′- dimethoxytrityl chloride ( 91 mg , 0 . 27 mmol ) was stirred at room temperature for 1 hour . the reaction solution was separated between ethyl acetate and an aqueous 5 % sodium bicarbonate solution . the organic layer was washed with saturated brine , was dried over anhydrous sodium sulfate , and was purified by column chromatography ( eluted with a 2 % methanol solution in methylene chloride ) to yield 5 -[ 7 -( 2 , 2 ′- bithienyl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 5 ′- o -( 4 , 4 - dimethoxytrityl )- 2 ′- deoxyuridine ( 183 mg , 0 . 2 mmol , 82 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 11 . 58 ( s , 1h ), 8 . 53 ( s , 1h ), 8 . 32 ( d , 1h , j = 5 . 2 hz ), 8 . 20 ( d , 1h , j = 3 . 9 hz ), 7 . 87 ( s , 1h ), 7 . 60 - 7 . 57 ( m , 2h ), 7 . 46 - 7 . 43 ( m , 2h ), 7 . 35 - 7 . 32 ( m , 2h ), 7 . 26 - 7 . 13 ( m , 8h ), 6 . 81 ( d , 4h , j = 9 . 0 hz ), 6 . 10 ( t , 1h , j = 7 . 0 hz ), 5 . 30 ( d , 1h , j = 4 . 4 hz ), 4 . 26 ( m , 3h ), 3 . 89 ( m , 1h ), 3 . 69 ( s , 6h ), 3 . 15 ( m , 2h ), 2 . 18 ( m , 2h ), 2 . 05 ( m , 2h ), 1 . 78 ( m , 2h ), 1 . 22 - 1 . 13 ( m , 6h ). 4 ) synthesis of 5 -[ 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 2 ′- deoxyuridine - 3 ′- o -( 2 - cyanoethyl - n , n - diisopropyl ) phosphoramidite ( step ( d ) in fig3 ) 5 -[ 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 5 ′- o -( 4 , 4 - dimethoxytrityl )- 2 ′- deoxyuridine ( 180 mg , 0 . 2 mmol ) was azeotropically dried with pyridine three times and with thf three times . subsequently , thf ( 1 . 0 ml ) and diisopropylethylamine ( 52 μl ) were added thereto , and the mixture was stirred . 2 - cyanoethyl - n , n - diisopropylchlorophosphoramidite ( 54 μl , 0 . 24 mmol ) was added to this solution , followed by stirring at room temperature for 1 hour . dehydrated methanol ( 50 μl ) was added to the reaction solution , and the resulting mixture was separated between a mixture of ethyl acetate : triethylamine ( 20 : 1 , v / v ) and an aqueous 5 % sodium bicarbonate solution . the organic layer was washed with saturated brine , was dried over anhydrous sodium sulfate , and was concentrated . the residue was purified by silica gel column chromatography ( eluted with ethyl acetate : methylene chloride : triethylamine = 45 : 45 : 10 , v / v / v ) to yield 5 -[ 7 -( 2 , 2 ′- bithien - 5 - yl )- 3 -( 7 - octynyl )- imidazo [ 4 , 5 - b ] pyridine ]- 5 ′- o -( 4 , 4 ′- dimethoxytrityl )- 2 ′- deoxyuridine - 3 ′- o -( 2 - cyanoethyl - n , n - diisopropyl ) phosphoramidite ( 220 mg , 99 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 11 . 59 ( s , 1h ), 8 . 53 ( s , s , 1h , 1h ), 8 . 32 ( d , 1h , j = 5 . 2 hz ), 8 . 20 ( d , 1h , j = 3 . 9 hz ), 7 . 89 ( d , 1h , j = 2 . 1 hz ), 7 . 60 - 7 . 57 ( m , 2h ), 7 . 46 - 7 . 43 ( m , 2h ), 7 . 34 ( m , 2h ), 7 . 26 - 7 . 13 ( m , 8h ), 6 . 81 ( m , 4h ), 6 . 98 ( dt , 1h , j = 6 . 3 , 6 . 5 hz ), 4 . 47 ( m , 1h ), 4 . 25 ( t , 2h , j = 6 . 9 hz ), 4 . 05 - 3 . 98 ( m , 1h ), 3 . 71 ( m , 1h ), 3 . 69 ( s , 6h ), 3 . 60 - 3 . 42 ( m , 2h ), 3 . 20 ( m , 2h ), 2 . 73 ( t , 1h , j = 5 . 9 hz ), 2 . 61 ( t , 1h , j = 5 . 9 hz ), 2 . 44 - 2 . 25 ( m , 2h ), 2 . 07 ( m , 2h ), 1 . 77 ( m , 2h ), 1 . 09 ( m , 18h ). n - iodosuccinimide ( 900 mg , 4 mmol ) was added to a 1 -( 2 - deoxy -( 3 - d - ribofuranosyl )- 2 - nitropyrrole ( 456 mg , 2 mmol ) solution in acetonitrile ( 8 ml ). the mixture was stirred at room temperature overnight and then separated between ethyl acetate ( 200 ml ) and water ( 200 ml ). the organic layer was concentrated and purified by silica gel column chromatography and hplc to yield 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - iodo - 2 - nitropyrrole ( 587 mg , 1 . 66 mmol , 83 %). 1 h nmr ( 270 mhz , dmso - d6 ) δ 7 . 90 ( d , 1h , j = 2 . 0 hz ), 7 . 40 ( d , 1h , j = 2 . 0 hz ), 6 . 54 ( t , 1h , j = 5 . 6 hz ), 5 . 27 ( d , 1h , j = 4 . 3 hz ), 5 . 10 ( t , 1h , j = 4 . 9 hz ), 4 . 23 ( m , 1h ), 3 . 83 ( m , 1h ), 3 . 53 - 3 . 85 ( m , 2h ), 2 . 18 - 2 . 45 ( m , 2h ). 2 -( tributylstannyl ) thiophene ( 476 μl , 1 . 5 mmol ) was added to a dmf ( 2 . 5 ml ) solution containing 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - iodo - 2 - nitropyrrole ( 177 mg , 0 . 5 mmol ) and bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 18 mg , 0 . 025 mmol ). the mixture was reacted at 100 ° c . for 30 minutes in a microwave machine ( standard mode ). the reaction solution was separated between ethyl acetate ( 50 ml ) and water ( 50 ml ). the organic layer was concentrated and purified by hplc to yield 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 -( thien - 2 - yl )- 2 - nitropyrrole ( 97 mg , 0 . 32 mmol , 63 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 8 . 13 ( d , 1h , j = 2 . 3 hz ), 7 . 52 ( d , 1h , j = 2 . 3 hz ), 7 . 42 ( dd , 1h , j = 1 . 1 , 5 . 1 hz ), 7 . 33 ( dd , 1h , j = 1 . 1 , 3 . 5 hz ), 7 . 06 ( dd , 1h , j = 3 . 6 , 5 . 1 hz ), 6 . 59 ( t , 1h , j = 5 . 7 hz ), 5 . 30 ( d , 1h , j = 4 . 6 hz ), 5 . 17 ( t , 1h , j = 5 . 1 hz ), 4 . 28 ( m , h ), 3 . 86 ( m , 1h ), 3 . 70 - 3 . 74 ( m , 1h ), 3 . 58 - 3 . 69 ( m , 1h ), 2 . 41 - 2 . 45 ( m , 1h ), 2 . 25 - 2 . 33 ( m , 1h ). 2 -( tributylstannyl ) furan ( 472 μl , 1 . 5 mmol ) was added to a dmf ( 2 . 5 ml ) solution containing 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - iodo - 2 - nitropyrrole ( 177 mg , 0 . 5 mmol ) and bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 18 mg , 0 . 025 mmol ). the mixture was reacted at 100 ° c . for 30 minutes in a microwave machine ( standard mode ). the reaction solution was separated between ethyl acetate ( 50 ml ) and water ( 50 ml ). the organic layer was concentrated and purified by hplc to yield 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 -( furan - 2 - yl )- 2 - nitropyrrole ( 111 mg , 0 . 38 mmol , 76 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 8 . 08 ( d , 1h , j = 2 . 3 hz ), 7 . 63 ( dd , 1h , j = 0 . 7 , 1 . 8 hz ), 7 . 50 ( d , 1h , j = 2 . 3 hz ), 6 . 69 ( dd , 1h , j = 0 . 7 , 3 . 3 hz ), 6 . 61 ( t , 1h , j = 5 . 7 hz ), 6 . 53 ( dd , 1h , j = 1 . 8 , 3 . 3 hz ), 5 . 29 ( d , 1h , j = 4 . 4 hz ), 5 . 12 ( t , 1h , j = 5 . 1 hz ), 4 . 27 ( m , 1h ), 3 . 87 ( m , 1h ), 3 . 65 - 3 . 72 ( m , 1h ), 3 . 56 - 3 . 63 ( m , 1h ), 2 . 41 - 2 . 46 ( m , 1h ), 2 . 23 - 2 . 31 ( m , 1h ). 2 -( tributylstannyl ) dithiophene ( 341 mg , 0 . 75 mmol ) was added to a dmf ( 2 . 5 ml ) solution containing 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - iodo - 2 - nitropyrrole ( 177 mg , 0 . 5 mmol ) and bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 18 mg , 0 . 025 mmol ). the mixture was reacted at 100 ° c . for 30 minutes in a microwave machine ( standard mode ). the reaction solution was separated between ethyl acetate ( 50 ml ) and water ( 50 ml ). the organic layer was concentrated and purified by hplc to yield 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 -( 2 , 2 ′- bithien - 5 - yl )- 2 - nitropyrrole ( 90 mg , 0 . 23 mmol , 46 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 8 . 15 ( d , 1h , j = 2 . 3 hz ), 7 . 57 ( d , 1h , j = 2 . 3 hz ), 7 . 50 ( dd , 1h , j = 1 . 1 , 5 . 1 hz ), 7 . 24 - 7 . 31 ( m , 3h ), 7 . 08 ( dd , 1h , j = 3 . 6 , 5 . 1 hz ), 6 . 60 ( t , 1h , j = 5 . 7 hz ), 5 . 28 ( d , 1h , j = 3 . 6 hz ), 5 . 17 ( t , 1h , j = 5 . 2 hz ), 4 . 29 ( m , 1h ), 3 . 87 ( m , 1h ), 3 . 68 - 3 . 75 ( m , 1h ), 3 . 57 - 3 . 65 ( m , 1h ), 2 . 41 - 2 . 46 ( m , 1h ), 2 . 26 - 2 . 34 ( m , 1h ). tetramethyltin ( 287 μl , 2 mmol ) was added to a dmf ( 2 ml ) solution containing 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - iodo - 2 - nitropyrrole ( 142 mg , 0 . 4 mmol ), bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 14 mg , 0 . 02 mmol ), and triphenylarsine ( 12 mg , 0 . 04 mmol ), followed by reaction at 60 ° c . for 2 days . the reaction solution was separated between ethyl acetate ( 50 ml ) and water ( 50 ml ). the organic layer was concentrated and purified by hplc to yield 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - methyl - 2 - nitropyrrole ( 15 mg , 0 . 06 mmol , 15 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 7 . 55 ( d , 1h , j = 2 . 8 hz ), 7 . 09 ( d , 1h , j = 2 . 2 hz ), 6 . 55 ( t , 1h , j = 5 . 9 hz ), 5 . 27 ( d , 1h , j = 4 . 3 hz ), 5 . 00 ( t , 1h , j = 5 . 3 hz ), 4 . 22 ( m , 1h ), 3 . 82 ( m , 1h ), 3 . 52 - 3 . 64 ( m , 2h ), 2 . 34 - 2 . 42 ( m , 1h ), 2 . 11 - 2 . 19 ( m , 1h ), 2 . 02 ( s , 3h ). tributyl ( 1 - propynyl ) tin ( 327 μl , 1 mmol ) was added to a dmf ( 5 ml ) solution containing 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - iodo - 2 - nitropyrrole ( 180 mg , 0 . 5 mmol ) and bis ( triphenylphosphine ) palladium ( ii ) dichloride ( 38 mg , 0 . 05 mmol ), followed by reaction at 100 ° c . for 90 minutes . the reaction solution was concentrated and purified by silica gel column chromatography and hplc to yield 1 -( 2 - deoxy - β - d - ribofuranosyl )- 4 - propynyl - 2 - nitropyrrole ( 76 mg , 0 . 28 mmol , 57 %). 1 h nmr ( 300 mhz , dmso - d6 ) δ 7 . 92 ( d , 1h , j = 2 . 2 hz ), 7 . 27 ( d , 1h , j = 2 . 2 hz ), 6 . 55 ( t , 1h , j = 5 . 7 hz ), 5 . 28 ( d , 1h , j = 4 . 5 hz ), 5 . 11 ( t , 1h , j = 5 . 2 hz ), 4 . 24 ( m , 1h ), 3 . 85 ( m , 1h ), 3 . 53 - 3 . 70 ( m , 2h ), 2 . 45 ( m , 1h ), 2 . 22 ( m , 1h ), 1 . 99 ( s , 3h ).	2
fig1 to 3 illustrate a simple embodiment of the invention in which there are two corresponding memory locations in separate memory banks , a and b . these may be collectively referred to as a &# 34 ; stable location &# 34 ;. briefly , the location from which data is currently being read is designated the &# 34 ; active location &# 34 ;, while that to be used in the event of rollback is designated as the &# 34 ; backup location &# 34 ;. at a checkpoint , copying . of the contents of the active location is avoided by simply designating the active location as being both the active and the backup location . the other of the two locations is non - designated at the checkpoint ; reads are then satisfied from the location designated as active and backup . at the first write operation ( if any ) after the checkpoint , the non - designated location is designated as the active location and reads and writes then take place to this location , the other remaining as the backup location . at the next checkpoint , the active location is designated as being both active and backup , the previous backup location becoming non - designated . if , however , there are no writes between the two above - mentioned checkpoints , the designations are not changed . in fig1 the memory locations are indicated generally by the numeral 1 . in addition , there is a modification status indicator bit m , and a role or mode indicator bit r . these two bits together provide the necessary information for implementing the checkpoint . if m = 0 ( unmodified , no write since last checkpoint ), and r = 0 , this m value indicates that a single location is both active and backup , and this r value indicates that this location is location a . this is indicated by step 2 of fig1 reads are then satisfied from location a , and if rollback is required , this also refers to location a . however , location a could not function as a backup location if it were then written to , and accordingly if there is then a write request the m bit is changed to 1 to indicate modification since the previous checkpoint and the r bit is changed to 1 to indicate that location b is now the active location . this is step 3 of fig1 . the write then takes place to location b , as do subsequent reads and writes until the next checkpoint . the next checkpoint is indicated by 4 , and this involves resetting the m bit to 0 . the subsequent combined mr value of 01 indicates to the processor that b is both active and backup and reads and writes take place mirroring those described above . accordingly , after a write ( to location a ) the m bit is changed to 1 to indicate modification since the previous checkpoint and the r bit is changed to 0 to indicate that a is now active . at the next checkpoint 5 , m is reset to 0 and the initial state described above is arrived at . of course , as shown in fig2 and 3 , if there is no write between checkpoints the m and r bits are not changed and the single location designated as active and backup remains so . the drawings also demonstrate clearly that second and subsequent writes after a checkpoint do not result in any change of designation . it will thus be appreciated that checkpointing according to the method of the invention does not involve copying and may therefore be carried out almost instantaneously . it is only required to reset the m bit . this may be done extremely quickly if the m bits are stored on a single , resettable memory circuit such as a resettable static random access memory ( sram ). such an operation takes less than 50 ns . this is a very important aspect of the invention because of the major advantages achieved . in modern cache - coherent systems , there still will be no copying even if the m and r bits refer to an amount of data which has a granularity up to that of the cache - to - main memory write operation ( a cache line or sub - line ). if the bits m and r refer to an amount of data ( for example , a memory page ) which has a larger granularity than that of a write operation , then a copy - on - write operation is needed before the write is performed ( as described in brackets in the table of fig2 ). such copying may , however , be carried out very quickly if a multi - ported memory device such as a video ram ( vram ) is used . with a vram , transfer cycles may be used for fast copying . with a large granularity , the number of m and r bits required is substantially reduced , thus saving on expense of resettable memory circuits . rollback ( which is hopefully a much less frequent event than checkpointing ) requires the location status array to be scanned and selectively updated ( unless the necessary state transformations of the m and r bats cannot be accomplished in parallel by the device in which they are stored ). not all locations may need to be checkpointed . those locations that are devoted to program code need only be checkpointed in special systems , such as real - time systems which cannot tolerate the delay of reloading the program code from secondary storage into memory . only those locations that are stable must be checkpointed . if the memory includes stability flags for each location , then only writes to those locations which are marked as stable are allowed to cause state changes in the m and r bits , and hence only those locations are checkpointed . checkpointing is useful as a mechanism for providing fault tolerance and atomicity to software . it is also a useful mechanism for providing tolerance to hardware faults . in a memory system which incorporates error detection and correction circuits checkpointing can be used to provide tolerance to faults that cause incorrectable errors . if further tolerance to hardware faults is required , any of the well known methods for providing this , such as duplexing , triple or n modular redundancy , or distributed architectures may be utilised . for example , three memory boards may work in a triple modular redundancy arrangement . the host processors would broadcast data and commands to all replicas , and would read data from all replicas . if a board detects a difference between the data on the host bus and the data at the input to its output buffers , it would invoke an error handling mechanism . the faulty board would isolate itself from the bus and indicate that it needs repair . in this case , the hardware fault is masked and the checkpointing method is not involved . other methods might utilize checkpointing . in the above description , it has been assumed that a switchmode checkpoint has a &# 34 ; global &# 34 ; effect , i . e . in affects all of the memory , or more precisely all checkpointable items in memory . in many circumstances , this is not convenient , particularly where it is desirable to checkpoint different sets of items at different times and frequencies . this can be accommodated by allowing a checkpointable item to exist in one or more checkpointable regions , where each region can be independently checkpointed . one such embodiment is shown in fig4 in which a memory device 10 having an address decoder 11 and data storage locations 12 is illustrated . each checkpointable item &# 39 ; s m bit can be tagged with a region identifier . when the m bits for a particular region are to be reset ( typically at a checkpoint ), only those m bits that have the correct tag value are selectively reset . in fig4 the region identifier is indicated by the numeral 13 . another embodiment is shown in fig5 in which each region can have a separate m bit per checkpointable item . in this embodiment the m bits for a particular region are reset by resetting a single memory device specific to that region . such memory devices are indicated by the numeral 15 in fig5 and are selected via a decoder 16 which is fed with the region identifier from a region identifier memory device 17 . in some circumstances , it is convenient to maintain not just one checkpoint to return to if so desired but a chain of n checkpoints . this is useful when nesting checkpoints , for example . this can be done by increasing the width of the r field -- an n bit r field allows a chain of ( 2 n - 1 ) checkpoints . for example , 2 r bits allows a chain of 3 checkpoints , plus the active bank . the r field is operated like an n bit wrap - around counter , where the current count indicates the active bank , and counts further back in time indicate checkpoints further back in time . an example for 2 r bits is shown in fig6 . this of course requires that there by 2 n logical banks of memory , where memory accesses are diverted to a particular bank as determined by the current value of the r field . the logical banks can be distributed amongst the same number or fewer physical banks . usually two physical banks are sufficient , and even just one will suffice for many applications . in fig6 there are just two physical banks , where each checkpointable location takes up two locations in each physical bank , the four locations representing just one location in four logical banks . it will be noted that the number of checkpointing regions does not affect the r field , since in the absence of rollback the r field is changed only on memory write accesses , whereas the m bit is only changed at checkpoints . the exception to this is for rollback after faults , but in this case the m and r fields must be adjusted individually for each checkpointable item . hence only a single r field is needed per checkpointable item . between checkpoints , it may be useful to record in a status field whether each checkpointable item has been read or modified . this field must be initialized at the very beginning of each checkpoint interval -- in practice it is convenient to clear the field when the m bit cleared . typically , the status field will consist of more than one bit , with some bits dedicated to optimizing the checkpointing process . for example , the status field might consist of a single bit , s , encoded with the m bit as : &# 34 ; clean &# 34 ; is the initial status , &# 34 ; referenced &# 34 ; indicates the item has been read , and &# 34 ; modified &# 34 ; means that the item has been altered . &# 34 ; marked &# 34 ; in this case implies that some special action must be taken for the relevant item . for each checkpointable item , the status field must be associated with the item &# 39 ; s checkpoint region , and the status must be reset whenever the m bit is reset . in the case where the m bits are tagged with the region identifier , the status field can be stored alongside the m bit . if separate resettable memory devices are used to store the m bit for each region , then the status can be restored in the relevant resettable memory device . this is shown in fig4 and 5 . referring now to fig7 there is shown a memory circuit of the invention which can perform the checkpointing method very efficiently . this memory stores information in cells -- one cell per checkpointable item . each cell holds its information in four fields : as indicated above , each checkpointable item &# 39 ; s m bit is tagged with a region identifier . when the item is being allocated to a particular region , the cell for that item is selected by decoding the address input pins , then the region number is written from the region pins into that cell &# 39 ; s region identifier . at the same time , initial values for that cell &# 39 ; s r , m and status fields are written from the r , m and status pins into that cell . as is conventional for memory devices , the write is performed by activating the write pin , qualified by the cs ( chip select ) pin . subsequent read or write accesses to that item update the r and status fields . again conventionally , the write is performed by selecting the cell for that item by decoding the address input pins , and activating the write pin , qualified by the cs pin . a read is performed in the same way , but by activating the read pin rather than the write pin . when the m bits for a particular region are to be reset ( typically at a checkpoint ) the region number is fed from the region pins into the memory as indicated in fig7 and the reset input is activated . all cells simultaneously . compare the region number to the value in their region identifier . any cell where the two values are equal resets its m and status fields . thus , only those m bits that have the correct tag value are reset and the status field is reset in unison . if a rollback input is available , the necessary state transformations could be performed by all cells simultaneously . in the case of one m bit and one r bit : ______________________________________if m , r = 00 do nothingif m , r = 11 change m , r to 00if m , r = 01 do nothingif m , r = 10 change m , r to 01 . ______________________________________ extension of the case of more than one m bit and / or more than one r bit will be immediately apparent . the invention may be applied to systems which incorporate caches either locally or remotely . for example , if a checkpoint of a region is invoked by a host processor writing the region identifier to a well known memory address , the processors , caches may use the identifier to checkpoint any cached subsets of that region . at the same time , the memory can use the identifier to checkpoint its copy of the region , and any other host processor caches can similarly checkpoint their cached subsets of the region . the invention is not limited to the embodiments hereinbefore described , but may be varied in construction and detail .	6
the present invention will now be described more fully with reference to various preferred embodiments of the invention as shown in the accompanying drawings . it should be noted , however , that the principles of the present invention may be embodied in many different forms and should not be construed as being limited to the particular embodiments set forth herein . rather , these embodiments are provided simply by way of example , and not of limitation . accordingly , various changes in form and details may be made to the described embodiments without departing from the spirit and scope of the invention as defined by the appended claims . among others , the principles of the invention apply to many types of semiconductor devices and are not limited to any particular type of device , such as a dram . the present invention can , for instance , be applied to a ferroelectric random access memory ( fram ), a static random access memory ( sram ), and a non - volatile memory ( nvm ), as well as a dram . in addition , although a solder ball can be used to provide an external connection terminal , other suitable external connection could also be used . fig3 illustrates a semiconductor device 100 having a fuse circuit 116 formed therein according to an embodiment of the present invention . referring to fig3 , unlike in the prior art in which a fuse circuit is formed in a peripheral region , a fuse circuit 116 according to this embodiment is formed in a cell region 122 . a pad redistribution pattern 110 can also be primarily located in the cell region 122 . fig4 includes a cross - sectional view of a conventional semiconductor device 10 , taken along line a - a ′ of fig1 , and a cross - sectional view of a semiconductor device 100 embodying principles of the present invention , taken along line b - b ′ of fig3 . these cross - sectional views provide a comparison between the integration densities of the two devices . as can be seen from fig4 , by moving the fuse circuit 116 from the peripheral region 124 to the cell region 122 , the area of a semiconductor device can be reduced by an amount d . the distance d corresponds to a reduced amount of area on the surface of the semiconductor device , and results in an increase in the number of chips that can be arranged on one wafer . referring to fig3 and 4 , the semiconductor device 100 having a redundant circuit and a fuse circuit 116 according to an embodiment of the present invention includes a semiconductor substrate 101 having a cell region 122 and a peripheral region 124 formed on predetermined areas thereof . a fuse circuit 116 is formed in the cell region 122 . fig5 through 8 are cross - sectional views illustrating a method of fabricating a semiconductor device 100 having a fuse circuit 116 formed in a cell region 122 thereof , according to one embodiment of the present invention . in addition , as shown in fig5 through 8 , a pad redistribution pattern 110 can convert a center - type bond pad into a peripheral bond pad . referring to fig5 , a lower structure 102 , for example , a dram circuit unit , which includes a field oxide layer , a gate electrode , a bit line , a capacitor , and a metal wiring layer , ( not shown for simplicity ) is formed in a peripheral region and a cell region of a semiconductor substrate 101 . next , a passivation layer 106 is deposited on the lower structure 102 and is patterned to expose a pad 104 . referring to fig6 , a conductive layer , used to form a pad redistribution pattern 110 , is formed on the passivation layer 106 . the conductive layer can be chrome ( cr ), copper ( cu ), nickel ( ni ), gold ( au ), aluminium ( al ), titanium ( ti ), and / or titanium nitride ( tin ). next , the conductive layer is patterned to form the pad redistribution pattern 110 and a fuse pattern 116 a . the pad redistribution pattern 110 and the fuse pattern 116 a can be formed on substantially the same plane but preferably do not overlap with each other . in this embodiment , the pad redistribution pattern 110 converts a center - type bond pad into a peripheral bond pad . the fuse pattern 116 is preferably formed in the cell region , not in the peripheral region . another passivation layer 107 is preferably formed on the semiconductor substrate 101 , after the pad redistribution pattern 110 has been formed . this passivation layer 107 can be patterned to expose a peripheral bond pad 126 . fig7 illustrates the conversion of the center - type bond pads to the peripheral bond pads . referring to fig7 , the semiconductor device 100 a having center - type bond pads 104 is converted to a device 100 b having peripheral bond pads 126 , using the pad redistribution pattern . in other words , the semiconductor device 100 a does not include the pad redistribution pattern 110 , while the device 100 b has been converted into a peripheral bond pad device from the center - type bond pad device 100 a by forming a pad redistribution pattern . referring to fig8 , a ball bond 128 is formed using wires , for example , gold wires , on the exposed peripheral bond pad 126 to permit external electrical connection of the semiconductor device 100 . the passivation layers 106 and 107 may be formed as a single layer or a multi - layer and may also be embodied in different forms . fig9 through 12 are cross - sectional views of a semiconductor device 100 c having a fuse circuit formed in cell region at various steps during its fabrication . these figures illustrate a method of fabricating a semiconductor device according to another embodiment of the present invention . in this embodiment , a pad redistribution pattern is introduced to form a solder ball pad . referring to fig9 , a lower structure 102 , for example , a dram circuit unit , is formed in a peripheral region and a cell region of the semiconductor device 100 c on a substrate 101 . the lower structure 102 preferably includes a field oxide layer , a gate electrode , a bit line , a capacitor , and a metal wiring layer . next , a passivation layer 106 is deposited on the semiconductor substrate 101 over the lower structure 102 and is patterned to expose a pad 104 . referring to fig1 , a first insulating layer 108 is formed on the passivation layer 106 . the first insulating layer 108 may be a single layer or a multi - layer made of a high - density plasma ( hdp ) oxide layer , a benzicyclobutene ( bcb ) layer , a polybenzoxazole ( pbo ) layer , and / or a polyimide layer , for example . next , a patterned photoresist layer is formed on the first insulating layer 108 . the first insulating layer 108 and the passivation layer 106 are patterned by photolithography and etching to form a via hole therethrough to be connected to a bit line or word line . the via hole is then filled with a conductive material , thereby forming a plug 112 . a conductive layer is formed on the resulting structure . the conductive layer is patterned to form the pad redistribution pattern 110 and the fuse pattern 116 a simultaneously in the same process . the conductive layer may be a single layer or a multi - layer containing tungsten ( w ), chrome ( cr ), titanium ( ti ), and / or titanium tungsten ( tiw ). in the prior art , a fuse circuit , including the fuse pattern 116 a , is formed by extending bit line / word line wiring layers of the lower structure 102 to a peripheral region . in the foregoing embodiments of the present invention , however , the fuse pattern 116 a is formed in a cell region . referring to fig1 , a second insulating layer 114 is formed on the first insulating layer 108 . the second insulating layer 114 may be a single layer or a multi - layer containing a polyimide , for example . a patterned photoresist layer is then formed on the second insulating layer 114 . the second insulating layer is then patterned by photolithography and etching to form a solder ball pad 118 , through which a predetermined portion of the pad redistribution pattern 110 is exposed . referring to fig1 , a laser repair process can then be performed on the resulting structure , including the semiconductor substrate 101 , on which the solder ball pad 118 has been formed , in which a fuse pattern 116 b is selectively cut . in this process , cells in a cell region that are identified as defective cells through an electrical test can be replaced by redundant memory cells in a redundancy circuit . an external connection terminal , for example , a conductive bump , e . g ., a solder ball 120 , can then be attached to the resulting structure after the laser repair process is completed . other external connections can be used instead of the solder ball 120 . in the prior art , since the fuse pattern is arranged under the passivation layer 106 , it is difficult to selectively cut the fuse pattern by irridating laser beams to the fuse pattern through the passivation layer 106 . this is because the laser beams may be out of focus . thus , the width of the fuse pattern 116 b needs to be increased . according to principles of the present invention , however , because the fuse pattern 116 b is formed close to the top surface of a semiconductor device , the distance traveled by the laser beams to reach the fuse pattern 116 b can be reduced . thus , the problem of the prior art , in which laser beams are out of focus , can be solved . in addition , since the fuse pattern 116 b is formed not in a peripheral region but rather in a cell region , the integration density of a semiconductor device can be increased . fig1 and 14 are cross - sectional views illustrating alternative embodiments of a fuse pattern of a fuse circuit according to another aspect of the present invention . in the previously described embodiments , the fuse pattern 116 b is formed having almost the same thickness as the pad redistribution pattern 110 . in this alternative embodiment , however , a pad redistribution pattern 210 is formed of chrome ( cr ), copper ( cu ), nickel ( ni ), gold ( au ), aluminium ( al ), titanium ( ti ), and / or titanium nitride ( tin ) as a multi - layer on a first insulating layer 208 . a fuse pattern 216 a is then etched so that the thickness of the fuse pattern 216 a is substantially less than the thickness of the pad redistribution pattern 210 . accordingly , it becomes easier to cut the fuse pattern 216 a using laser beams . it is thereby possible to increase the yield of a semiconductor device in a laser repair process . the fuse pattern 216 a having a smaller thickness than the pad redistribution pattern 210 may be formed of chrome ( cr ), copper ( cu ), nickel ( ni ), gold ( au ), aluminium ( al ), titanium ( ti ), and / or titanium nitride ( tin ) in a single layer or a multi - layer . a second insulating layer 214 can also be provided . as described above , according to various embodiments of the present invention , a chip is designed so that a fuse circuit can be located in a cell region , not a peripheral region , to increase the integration density of a semiconductor memory chip . in addition , by forming the fuse circuit on a passivation layer , the problem of the prior art , in which laser beams applied in a laser repair process to cut a fuse pattern are out of focus , can be solved . furthermore , because the fuse pattern is formed to have a smaller thickness than a pad redistribution pattern through etching , it is possible to easily perform a fusing process . while this invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .	7
a lightweight expanded silicate aggregate is prepared according to the present invention from dry rice hull ash . rice hulls are a waste product from rice mills and are normally considered to be of little value . the rice hulls are normally burned at or near the mill and the ash is disposed of . it has been found that by the process of the present invention , rice hull ash can be made into a lightweight expanded silicate aggregate for less than half the cost , on a raw material basis , than that of a lightweight expanded silicate aggregate prepared from anhydrous sodium silicate glass . dry rice hulls are known to contain about 20 % sio 2 , with the remaining composition being primarily cellulose and minor amounts of other combustible materials . when the rice hulls are incinerated , however , to burn the combustible material , the remaining rice hull ash contains in excess of 95 % sio 2 . it has been found that the rice hull ash used in the process of the present invention should be well burned and should contain less than about 4 % by weight of carbon . it has been found that if the carbon content of the ash is higher than about 4 %, then the aggregate will not expand satisfactorily . in the broadest aspect of the invention , the rice hull ash is mixed with an alkali metal hydroxide , boric acid , and water to form a slightly damp powdery composition . more particularly , the dry rice hull ash is mixed in the range of 45 % to 70 % by weight with 10 % to 25 % by weight of an alkali metal hydroxide , preferably selected from the group consisting of sodium hydroxide and potassium hydroxide , 10 % to 25 % by weight of water , and 2 % to 4 % by weight of boric acid . more preferably , the dry rice hull ash is mixed in the range of 56 %- 60 % by weight with 15 %- 20 % sodium hydroxide , 15 %- 20 % water , and 2 %- 3 % boric acid . in the most preferred embodiment , 62 . 1 % dry rice hull ash and 2 . 5 % boric acid are mixed together with 35 . 2 % by weight of a 50 % sodium hydroxide solution . preferably , the dry rice hull ash and boric acid are mixed together in dry form in a mixer to which is added a solution formed from the water and the alkali metal hydroxide . the solution of water and alkali metal hydroxide may either be commercially obtained aqueous solution or may be prepared by mixing the dry alkali metal hydroxide with water on site . the temperature necessary to initiate reaction is about 160 ° f . the necessary reaction temperature may be achieved either by mixing the dry rice hull ash , boric acid , and alkali metal hydroxide solution all at room temperature and then heating in , for example , an oven until the necessary reaction temperature of 160 ° f . is reached . alternatively , the alkali metal hydroxide solution may be heated to a temperature in excess of 160 ° f . prior to addition to the dry rice hull ash and boric acid . when the heated alkali metal hydroxide solution is added , the reaction proceeds substantially spontaneously . additionally , when the alkali metal hydroxide solution is prepared on site , the heat of solution when the alkali metal hydroxide and water are mixed is sufficient to elevate the temperature of the solution above 160 ° f . when the freshly mixed alkali metal hydroxide and water solution is added to the dry rice hull ash and boric acid components the reaction proceeds spontaneously . a minor amount of a silicone fluid emulsion may be added to the mixture prior to reaction . it has been found that the silicone causes the finished material not to absorb water from the air , which is a useful characteristic of the product when used as an insulation . after the reaction has initiated , the composition is cured until the reaction is complete . the curing may take place either in room temperature or in an elevated temperature oven having a temperature less than the boiling temperature of water . the reaction is in most cases substantially complete in between 30 minutes and 2 hours ; however , it has been found that the composition is completely cured in about 24 hours when cured in an oven at 160 ° f . or in about 48 hours when cured at room temperature . after the composition has been cured , it forms a solid brittle friable mass . the mass may be broken up by crushing or grinding to form suitably sized discrete particles . preferably , the particle size is between 8 and 20 mesh . after the particles have been formed , they are expanded in a furnace , or a like , at a temperature of , preferably , between 800 ° f . and 1000 ° f . the resulting product is a lightweight material that is insoluble in water , acids , and bases . the cured composition may be shipped in its unexpanded form to save shipping costs due to the high volume of the expanded material . the cured composition may also be stored in the unexpanded form saving warehouse space until it is needed for current production . after expansion , the composition has a wide range of uses . many of the uses fall within the category of thermal or acoustic insulation . another category of uses is as a sorbent for various materials . yet another category of uses is as an aggregate in an aggregate - binder system for building panels . the composition may also be used as a refractory , a filler for other materials , an energy attenuator , soil conditioner or filter medium . it will be apparent that the composition will have many other uses as well . the composition has high thermal and acoustic energy insulation properties . the composition can be used as a loose fill insulation material or it may be combined with a binder system in a sprayable system . the composition has been found to be particularly useful as a sorbent for a wide variety of liquids . the composition will sorb acids , agricultural chemicals , alcohols and ethers , alkalies , amines , aromatic compounds , chlorinated hydrocarbons , chlorinated solvents , hydrocarbons , ketones , aldehydes and esters , salts , silicates , surfactants , vegetable oils and many other liquids . the following are exemplary of the liquids that can be sorbed by the compositions of this invention : ______________________________________acids agricultural chemicalsacetic acid ( glacial ) bueno ® 6 ( monosodiumboric acid 6 % @ 90 ° f . acid methanearsenate ) boric acid 12 % @ 140 ° f . dacamine ® ( n -- oleyl 1 , 3 - chlorosulfonic acid propylenediamine salt ofchromic acid , 20 % 2 , 4 - dichlorophenoxyaceticchromic acid , 60 % acid , 2 lbs ./ gal . ) formic acid dacamine 4d ( n -- oleyl 1 , 3 - hydrochloric acid , 38 % propylenediamine salt ofnitric acid , 71 % 2 , 4 - dichlorophenoxyaceticnitric acid , fuming acid , 4 lbs ./ gal . ) oleum , fuming sulfuric daconate ® 6 ( monosodiumphosphoric acid , 83 % methylarsenate ) sulfuric acid , 98 % dsma ( disodiumalcohols & amp ; ethers methanearsenate ) allyl alcohol chlorinated hydrocarbonsdiethyl ether chlorowax lv ® ethanol chlorowax 40 ® ethylene glycol chlorowax 42 - 170glycerin chlorowax 50 ® isopropanol chlorowax 100methanol chlorowax 500 - calkalies pcb ( polychlorinatedammonium hydroxide , 30 % biphenyl ) caustic potash , 45 % chlorinated solventscaustic potash , 10 % carbon tetrachloridecaustic soda , 50 % chloroformcaustic soda , 10 % ethylene dichloridesodium methoxide in methylene chloridemethanol , 25 % liquid perclene ® damines ( perchloroethylene ) aniline triclene ® dn - butylamine ( trichloroethylene ) diethylamine hydrocarbonsethylenediamine cyclohexanetriethanolamine gasolinetriethylamine fuel oil , # 2aromatics n - hexanebenzene mineral spiritsbenzonitrile motor oil , sae # 40benzoyl chloride ketones , aldehydes & amp ; estersbtx ( benzene / toluene / acetaldehydexylene ) acetonechlorobenzene amyl acetatecresol n - butyl acetateo - dichlorobenzene dioctyl phthalate ( dop ) ethyl benzene formaldehyde , 37 % nitrobenzene methyl ethyl ketonephenol , 84 % methyl methacrylatetoluene vinyl acetatexylene miscellaneoussalts acetic anhydridealum , 50 % liquid acrylonitrileferric chloride , 40 % allyl chloridepotassium carbonate , 47 % brominesodium bichromate , 70 % carbon disulfidesodium sulfate , ( 18 %) epichlorohydrinsilicates heat transfer liquidsodium silicate , dowtherm a , dow chem . co . gr 40 liq . hydrazine hydratesodium silicate , ( 85 % sol . ) gr 52 liq . hydrogen peroxide , 30 % surfactants isophoronebional ® a - 50 , cationtic mek peroxide in ( gaf ) dimethyl phthalate , 60 % monawet ® sno - 35 , anionic , methyl isocyanate ( mona industries ) oil / water emulsion , 75 % tergitol ® 15 - s - 12 , nonionic , petroleum lubricating oil ( union carbide ) phosphatizing solutionvegetable oils phosphorus trichloridecorn oil pvc latex ( 40 %) solidspeanut oil scintillation liquidsafflower oil so - x - 1 scintiverse ™ soybean oil ( fisher scientific co .) scintillation liquid ( ppo , popop , xylene , napthalene , dioxane , ethoxyethanol ) silane coupling agent silicone emulsion sm 2085 general electric company silicone transformer liquid dow corning 561 styrene tetrahydrofuran titanium tetrachloride toluene diisocyanate water / oil emulsion , 5 % petroleum lubricating oil water repellent # 772 , dow corning______________________________________ the sorbents of the present invention sorb many times their own weight of liquid . generally , they will sorb from about 2 to 10 times their own weight , or more , depending on the specific liquid being sorbed . once sorbed , the liquids will be retained by the sorbant allowing easy handling and disposal . the sorbents of this invention are particularly suitable for use in sorbing and disposing of hazardous liquids . one particularly useful embodiment of this invention is the use of these sorbents to separate hydrophobic / hydrophilic liquid mixtures . the sorbents are treated with a silicone fluid either at the stage of raw material mixing during preparation of the unexpanded particles or in a post treatment of the expanded particles prior to contacting the liquids to be sorbed / separated . the addition is by simple mixing . the silicone treated sorbent will sorb the hydrophobic and hydrophilic components of the liquid at different rates , removing the hydrophobic component more quickly and making the sorbent highly useful in , for example , the cleanup of oil spills on water . the term &# 34 ; silicone fluid &# 34 ; as used in this application means a synthetic polymer of the general formula where n = 1 - 3 and m ≧ 2 . the silicone contains a repeating silicon - oxygen backbone and has organic groups r attached to a significant proportion of the silicon atoms by silicon - carbon bonds . the r group is preferably methyl ; it may be other alkyl or other group . these polymers are commonly combined with additives and / or solvents . in general , any of the commercially available silicone fluids may be used in this invention . desirable silicone fluids are emulsified siloxane fluids . preferred are polydimethyl siloxane fluid based emulsions . general electric silicone emulsion sm 2140 formulated with a 10 , 000 centistoke polydimethyl siloxane fluid is most desirable . this product can be diluted with water and presents no known fire hazard . it has low toxicity and has no objectionable odors . the silicone fluid is used in an amount effective to modify the differential hydrophobic liquis sorbing / hydrophilic liquid sorbing characteristics of the sorbent . in general , it is present in an amount in the range of about 0 . 25 %- 5 %, preferably 0 . 5 %- 1 . 5 %, most preferably 0 . 75 %- 1 . 25 % by weight of the sorbent . another particularly useful embodiment of this invention is the use of the compositions of this invention as sorbents for animal wastes . it is particularly useful in litterboxes for domestic pets , in particular dogs , cats and rodents . its usefulness may be enhanced in these applications by the addition of odor - covering or odor - reducing additives . odor - covering additives include any fragrance or perfume which masks the odor of the animal waste . any of the commonly used odor - covering additives may be used . the quantity of additive used depends on the amount of animal waste deposited in the sorbent , the duration of use , the location of use and the particular additive used . odor - reducing additives are additives which react with the odor causing components and modify them into non - odor causing forms or which prevent odor causing compounds from being formed . bactericidal enzymes are especially useful in preventing odors caused by bacterial degradation of components of sorbed liquids . a particularly desirable bactericidal enzyme additive is that sold by the branton company under the trademark outright ®. the amount of odor - reducing additive used depends on the particular additive , the specific odorant and the duration of use of the sorbant . generally , from about 1 to 15 %, preferably about 1 . 5 to 10 % and most desirably about 2 to 5 % by weight of odor - reducing additive is used . 79 parts by weight of dry rice hull ash and 4 parts by weight of boric acid were mixed in a dry mixer . 56 parts by weight of a commercially obtained 50 % by weight solution of sodium hydroxide to which 2 % by weight of the sodium hydroxide solution of a 50 % silicone emulsion were added were heated to 180 ° f . the heated solution was added to the dry rice hull ash the boric acid mixture and mixed together to form a damp powdery composition . the damp powdery composition was placed in a tub on the floor at room temperature and allowed to cure for 48 hours . after curing , the composition formed a brittle mass which was broken up into particles between 8 and 20 mesh in size . the particles were expanded in a furnace at about 1000 ° f . the product obtained had a bulk density of 5 . 804 pounds per cubic foot . the material was insoluble in water , mineral acid , and base and had a ph of 10 . 4 . the material was placed in boiling water and showed no signs of disintegration . thus , the product of example 1 was deemed acceptable . the procedure of example 1 was generally repeated except that the 56 parts of the 50 % sodium hydroxide solution was added to the mixture of 79 parts dry rice hull ash and 4 parts boric acid at room temperature and the resulting composition was placed in a drying oven at 160 ° f . for 24 hours during which reaction and curing occurred . the cured composition again was comminuted and expanded . the bulk density of the expanded product of example 2 was 5 . 736 pounds per cubic foot . again , the product was insoluble in water , mineral acids , and bases , and passed the boil test . in this example , 1 . 0 parts of dry rice hull ash , 0 . 035 parts of cao , and 0 . 035 parts of boric acid were mixed together in dry form in a mixer . a sodium hydroxide solution was formed by combining 0 . 376 parts of anhydrous sodium hydroxide with 0 . 215 parts of water , with the addition of 2 percent by weight of the sodium hydroxide and water of the silicone fluid . the heat of solution of the sodium hydroxide in the water caused the solution to attain a temperature of 190 ° f . the hot solution was added to the dry mixture of rice hull ash , calcium oxide , and boric acid and was placed in a drying oven at 160 ° f . for 24 hours to cure . the cured composition was comminuted and expanded to achieve a bulk density of 6 . 276 pounds per cubic foot . the expanded product was insoluble in water , mineral acid , and base , and was not subject to disintegration during boiling . in this example , the procedure of example 3 was generally repeated except that the composition formed by mixing the dry rice hull ash , calcium oxide , and boric acid , with the solution formed from anhydrous sodium hydroxide , water , and silicone fluid , was allowed to cure at room temperature for 24 hours , whereupon the cured material was comminuted and expanded . the expanded product had a bulk density of 10 . 6 pounds per cubic foot , which indicated that the product was not completely cured . however , the expanded product was insoluble in water , mineral acid , and bases , and did not disintegrate when boiled . in this example , the process of example 2 was generally repeated except that the amount of dry rice hull ash was increased by 25 %. more specifically , 98 . 75 parts of dry rice hull ash were mixed with 4 parts of boric acid in a dry mixer . to the dry rice hull ash and boric acid was added 56 parts of 50 % sodium hydroxide solution with 3 % silicone fluid at room temperature . the resulting composition was placed in an oven at 160 ° f . for 24 hours , during which time the composition reacted and cured . after curing , the composition was comminuted and expanded . the expanded material had a bulk density of 2 . 838 pounds per cubic foot , was insoluble , and did not disintegrate when boiled in water . in this example , the product was prepared according to the process set forth in example 5 except that the boric acid was omitted and 3 parts by weight of calcium oxide were included . thus , in this example , 98 . 75 parts by weight of dry rice hull ash were mixed with 3 parts by weight of calcium oxide . 56 parts by weight of the 50 % sodium hydroxide solution with 3 % by weight thereof of silicone fluid were added to the dry rice hull ash and lime at room temperature . the resulting mixture was cured in an oven at 160 ° f . for 24 hours . the product was then comminuted and expanded . the expanded product had a satisfactory bulk density of 6 . 000 pounds per cubic foot but disintegrated when boiled in water . accordingly , the product prepared without boric acid was deemed to be unacceptable . in this example , the product was prepared according to the method of example 6 except that the calcium oxide was omitted . thus , 98 . 75 parts by weight of dry rice hull ash were mixed with 56 parts by weight of a 50 % sodium hydroxide solution with 3 % silicone at room temperature . the mixture was cured in an oven at 160 ° f . for 24 hours and comminuted and expanded . the expanded product had a very low bulk density of 3 . 324 pounds per cubic foot but , again disintegrated when boiled in water . thus , while an expanded product may be obtained without boric acid , such product is not acceptable . in this example , 98 . 75 parts by weight of dry rice hull ash were mixed in a dry mixer with 3 parts by weight of calcium oxide and 4 parts by weight of boric acid . to the dry mixture was added 56 parts by weight of 50 % sodium hydroxide solution with 2 % silicone fluid at room temperature . the resulting mixture was placed in an oven for 24 hours at 160 ° f ., during which time reaction and curing occurred . after curing , the product was comminuted and expanded . the expanded product had a bulk density of 7 . 008 pounds per cubic foot , was insoluble , and did not disintegrate when boiled . in this example , the process of example 2 was generally repeated , except that the amount of dry rice hull ash was increased by 50 %. thus , 118 . 5 parts of dry rice hull ash were mixed in a dry mixer with 3 parts by weight of lime and 4 parts by weight of boric acid . to the dry mixture was added 56 parts by weight of 50 % sodium hydroxide solution with 2 % silicone fluid at room temperature . the resulting composition was then placed in an oven at 160 ° f . for 24 hours , during which time reaction and curing occurred . the cured product was comminuted and expanded . the expanded material had a bulk density of 9 . 300 pounds per cubic foot and did not disintegrate when boiled . in this example , the amounts of dry rice hull ash was increased by 75 % over that of example 2 . more specifically , 138 . 25 parts by weight of dry rice hull ash were mixed in a dry mixer with 3 parts by weight of lime and 4 parts by weight boric acid . to the dry mixture was added 56 parts by weight of 50 % sodium hydroxide solution with 2 % silicone fluid . again , the resulting mixture was placed in an oven at 160 ° f . for 24 hours for reaction and curing . the cured product was comminuted and expanded . the expanded product had a bulk density of 12 . 972 pounds per cubic foot and did not disintegrate when boiled . in this example , the amount of dry rice hull ash was decreased by 25 % compared to example 2 . thus , 59 . 25 parts by weight of dry rice hull ash were mixed in a dry mixer with 3 parts by weight of lime and 4 parts by weight of boric acid . 56 parts by weight of 50 % sodium hydroxide solution with 2 % silicone fluid were added at room temperature . the resulting mixture was placed in an oven at 160 ° f . for 24 hours for curing and drying . the cured product was comminuted and expanded . the expanded product had a bulk density of 12 . 14 per cubic foot and did not disintegrate when boiled . however , the expansion was deemed to be poor due to the wetness of the cured product . in this example , urea was added to the sodium hydroxide solution prior to mixing with the dry components . thus , 79 parts by weight of dry rice hull ash were mixed with 3 parts by weight of lime and 4 parts by weight of boric acid . 4 parts by weight of urea was added to 56 parts by weight of 50 % sodium hydroxide solution with 2 % silicone fluid and mixed with the dry ingredients . the resulting composition was placed in an oven at 160 ° f . for 24 hours for reaction and curing . the cured material was comminuted and expanded to achieve a bulk density of 7 . 581 pounds per cubic foot which did not disintegrate when boiled . in this example , the sodium hydroxide solution was prepared by mixing water with anhydrous sodium hydroxide , urea , and the silicone fluid . thus , 1 part by weight dry rice hull ash was mixed with 0 . 035 parts by weight of lime and 0 . 035 parts by weight of boric acid . the sodium hydroxide solution was formed by mixing 0 . 376 parts by weight of sodium hydroxide with 0 . 215 parts by weight of water and 0 . 035 parts by weight of urea , which in turn was mixed with 2 % by weight of the solution of the silicone fluid . the heat of solution caused the solution to attain a temperature of 190 ° f . the sodium hydroxide solution was mixed with the dry components and the reaction was immediate . the composition was then cured for 24 hours in an oven at 160 ° f . the cured material was comminuted and expanded to attain a bulk density of 6 . 476 pounds per cubic foot and the expanded product did not disintegrate when boiled . in this example , a product was prepared generally according to the method of example 3 , except , that potassium hydroxide was substitute for sodium hydroxide . thus , 1 parts of dry rice hull ash was mixed in a dry mixer with 0 . 035 parts boric acid and 0 . 035 parts lime . a solution was formed by mixing 0 . 376 parts by weight of potassium hydroxide with 0 . 215 parts by weight of water with the addition of 2 % by weight of the solution of the silicone fluid . the heat of solution caused the solution to attain a temperature of 190 ° f . the hot solution was mixed with the dry components , which initiated an immediate reaction . the resulting mixture was cured for 24 hours in an oven at 160 ° f . the cured product was comminuted and expanded with a bulk density of 12 . 0 pounds per cubic foot . the expanded material did not disintegrate when boiled . in this example , the product was prepared according to the process in example 14 , except that the silicone fluid was omitted . the expanded product had a bulk density of 15 pounds per cubic foot and did not disintegrate when boiled . ten ( 10 ) grams of the material prepared in example 1 is placed in a container and two hundred fifty ( 250 ) grams of water is added . the mixture is allowed to stand for fifteen ( 15 ) minutes , after which the excess water is drained by inverting the container onto an 80 mesh screen . the retained aggregate is allowed to drain for five ( 5 ) minutes . the aggregate is then weighed , showing a weight gain of one hundred twenty ( 120 ) grams , or a water : aggregate ratio of 12 : 1 . the procedure of example 16 is repeated using animal urine instead of water . the weight gain is one hundred twenty five ( 125 ) grams , or a ratio of 12 . 5 : 1 . 1 / 4 cubic foot of the material prepared in example 1 is mixed with one ( 1 ) ounce of a bactericidal enzyme (&# 34 ; outright &# 34 ;) and placed in a litter box for use by an eight and one half ( 81 / 2 ) pound indoor cat . after ten ( 10 ) days no odor is noticeable . a hydrophobic - oleophilic sorbent is prepared by mixing one hundred ( 100 ) grams of the material prepared in example 1 with one ( 1 ) gram of a methyl siliconate emulsion ( general electric sm 2085 ). the sorbent is placed in a container with an excess of a 50 % water -# 2 fuel oil mixture and allowed to stand for fifteen ( 15 ) minutes , after which the excess liquid is drained as in example 16 . the excess liquid is separated into water and oil phases and each phase weighed . the result is an absorbtion ratio of 6 : 1 for the fuel oil and a negligible absorbtion of water . in this example an easy and convenient means for cleaning up hazardous liquid spills is devised by packaging the material prepared as in example 1 in a 1 . 5 ounce spun bonded polyethylene tube . the material ( 1 / 4 cubic foot ) is placed in the fabric tube ( dimensions : 3 &# 34 ; diameter × 15 &# 34 ; long ). the sorbent thus sealed in the fabric container is placed into a pan containing an excess of 38 % hydrochloric acid . after soaking for fifteen ( 15 ) minutes , the sorbent tube is removed , drained for five ( 5 ) minutes and weighed for liquid pick up . a ratio of ten ( 10 ) pounds of acid is absorbed per pound of sorbent .	1
fig1 illustrates a schematic posterior view of a spine 2 of a subject 1 and fig2 a - b illustrate a schematic side view and posterior view of the spine 2 , respectively . the normal anatomy of the spine of a human 1 is usually described by dividing up the spine 2 into three major sections : the cervical vertebrae 3 , the thoracic vertebrae 5 , and the lumbar vertebrae 7 . below the lumbar vertebrae 7 is a bone called the sacrum 9 and the coccyx 11 , which is part of the pelvis . each section is made up of individual bones called vertebrae 13 . there are seven cervical vertebrae , twelve thoracic vertebrae , and five lumbar vertebrae . fig3 a - b illustrate a schematic plan view ( axial overhead view ) and side ( lateral or elevation view ) of a vertebra 13 , respectively . fig4 illustrates a schematic plan view ( axial overhead view ) of a vertebra 13 . an individual vertebra 13 is made up of several parts . the vertabra consists of two stout rounded pedicles 15 , one on each side which spring from the body 17 and which are united posteriorly by two flat plates or laminae 19 . a small notch is located above ( not shown ) and a small notch 21 is located below the pedicle 15 ( called the superior and inferior vertebral notches , respectively ). the vertebral foramen 23 ( section of the spinal canal ) is small , and of a circular form that accommodates the spinal cord ( not shown ) that vertically ( axially ) transverse through it . the spinous process 25 is long , triangular on coronal section , directed obliquely downward . the superior articular processes 27 are thin plates of bone projecting upward from the junctions of the pedicles and laminae 19 . the transverse processes 29 arise from the arch behind the superior articular processes 27 and pedicles 15 ; they are thick , strong , and of considerable length , directed obliquely backward and lateralward , and each ends in a clubbed extremity , on the front of which is a small , concave surface , for articulation with the tubercle of a rib ( not shown ). the vertebral body 17 is a thin ring of dense cortical bone . the vertebral body is generally shaped like an hourglass , thinner in the center with thicker ends . outer cortical bone extends above and below the superior and inferior ends of the vertebrae 13 to form rims or cortical rims 31 . the superior and inferior endplates are contained within these rims of bone . the body 17 is composed of cancellous tissue , covered by a thin coating of compact bone ; the latter is perforated by numerous orifices , some of large size for the passage of vessels ; the interior of the bone is traversed by one or two large canals , for the reception of veins , which converge toward a single large , irregular aperture , or several small apertures , at the posterior part of the body . fig5 is a schematic cross section of the human torso through the first lumbar vertebra showing the spinal cord 33 along with related anatomy such as 43 vasculature , 41 epidural space , 39 dura matter , vertebral muscles 37 , spinal nerves 35 , transverse process 29 , spinous process 25 , vertebral foramen 23 , and body 17 of the vertebra 13 . referring generally to fig5 , the spinal cord 33 is part of the central nervous system of the human body . it is a vital pathway that conducts electrical signals from the brain to the rest of the body through individual nerve fibers 35 . the spinal cord 33 is a very delicate structure that is derived from the ectodermal neural groove , which eventually closes to form a tube during fetal development . from this neural tube , the entire central nervous system , our brain and spinal cord , eventually develops . up to the third month of fetal life , the spinal cord is about the same length as the canal . after the third month of development , the growth of the canal outpaces that of the cord . in an adult the lower end of the spinal cord usually ends at approximately the first lumbar vertebra , where it divides into many individual nerve roots ( l 1 ). still referring generally to fig5 , the spinal canal or vertebral foramina 23 is the anatomic casing for the spinal cord . the bones and ligaments of the spinal column or spine 2 are aligned in such a way to create a canal or vertebral foramina 23 that provides protection and support for the spinal cord . several different membranes enclose and nourish the spinal cord and surround the spinal cord itself . the outermost layer is called the “ dura mater ” or “ dura sac ” 39 . the dura is a thin membrane that encloses the brain and spinal cord and prevents cerebrospinal fluid from leaking out from the central nervous system . the space between the dura and the spinal canal is called the “ epidural space ” 41 . this space is filled with tissue , vessels and large veins ( various vasculature 43 ). the epidural space is important in the treatment of low - back pain , because it is into this space that medications such as anesthetics and steroids are injected in order to alleviate pain and inflammation of the nerve roots . fig6 is a schematic side view of illustrating that the spinal canal or vertebral foramen of the vertebra 13 is generally circular and smaller than a ring finger , and becoming triangular toward the cervical and lumbar ends . fig7 illustrates a schematic side view of a portion of the spine 2 or spinal column with a portion removed there from . for instance , as illustrated , most of the vertebral body has been removed from the vertebra second from the top as illustrated , except for the anterior cortical rims 31 . for instance , in an approach when the vertebral body is removed from the back prior to placement of the expandable cage , the superior and inferior end plate of the vertebral body may be removed as well . for example , the anterior part of the endplate can be left in place . however most of the superior and inferior part of the endplate of the vertebral body ( e . g ., involved with the tumor has to be removed ) so the cage can expand to the superior endplate of the adjacent inferior vertebra , and to the inferior endplate of the adjacent superior vertebra . next , in accordance with the present invention device and related method an expandable cage 51 is inserted as desired and required ( arrow “ i ”) into the space or area of the vacated by the removed vertebra or portion thereof and ultimately into the proper location , position and alignment with the vertebrae without damaging or severing the spinal cord ( not shown ). referring to fig8 a - c , the cage body 57 of the cage 51 is schematically captured in its collapsed or non - deployed state having a non - deployed vertical height ( nvh ) and a transverse width ( tw ) and transverse length ( tl ), in the elevation , plan ( overhead ), and perspective views , respectively . referring to fig8 d , the cage body 57 of the cage 51 is shown in its expanded or deployed state having a deployed vertical height ( dvh ) and a transverse width ( tw ) and transverse length ( tl ). the non - deployed vertical height ( nvh ) is less than either the transverse width ( tw ) or transverse length ( tl ). alternatively , the non - deployed vertical height ( nvh ) is less than each of the transverse width ( tw ) and transverse length ( tl ). some typical cross - section shapes used would be circular , kidney shaped , or any geometrical shape as desired or required for fit to anatomy or surgical procedure . in an embodiment , for the cage 51 to be inserted safely from the back without touching or retracting the spinal cord the cage 51 must be in its collapsed stage ( non - deployed state ) not any taller ( vertically ) than about 15 - 20 mm maximum ( i . e ., non - deployed vertical height ( nvh )), or as desired or required . its cross section in the lateral or horizontal direction ( i . e ., the transverse width ( tw ) and transverse length ( tl ) may vary depending of the location to be inserted as the cross section of the vertebral bodies varies from the thoracic or lumbar spine . a lateral or horizontal cross section between about 25 - 30 mm may be used depending of the level , or as desired or required . it is essential to understand that such low profile expandable cage make their insertion safer as there is no need to retract the spinal cord and rotation and expansion of the cage will then allow its perfect placement . a driver element 71 is in communication with the cage . the driver element 71 may be adapted to position and orient the cage and / or fill the cage with a filler material such as cement or the like . other filler materials may also include biologic resin that hardens after time or at body temperature , a synthetic bioactive paste that hardens with time or at body temperature . the cage 51 in its expanded or deployed state may have a deployed vertical height ( dvh ) of about 45 - 60 mm , or as desired or required . it should be appreciated that various sizes , dimensions , contours , rigidity , shapes , flexibility and materials of any of the embodiments discussed throughout may be varied and utilized as desired or required . it should be appreciated that while the expansion illustrated in the various embodiments discussed through out focuses on vertical or axial expansion , it should be appreciated that expansion may also be implemented in the lateral or horizontal ( e . g ., transverse ) direction . in an exemplary embodiment , the driver 71 may be connected to the end plate ( not shown ) of the cage 51 so it locks , as opposed to a non - lock in screw in mechanism that would allow it to loosen up during the rotation , for instance of the cage counterclockwise . the cage end plate ( not shown ) where the driver is connected may be thicker than the opposite end plate ( not shown ) to allow fitting of the valve ( not shown ) and locking mechanism ( not shown ) and cement insertion mechanism under pressure . in an exemplary embodiment , the cage 51 itself may have a flexible cage body 57 that is a flexible , malleable and expandable chamber . a flexible and expandable chamber may comprise , but not limited thereto , the following structures : tube , balloon , hose , cylinder , accordion like - structure , bellows , case , shell , enclosure , sleeve , or repository . in an approach , the flexible cage body in its collapsed stage ( non - deployed stage ), may be under negative pressure . the negative pressure will allow the cement to have a uniform filling of the cage body avoiding air to be trapped inside the cage ( e . g ., bubble in cement or filing ) that could cause less biomechanic resistance . as the cage is expanded a positive pressure of filler material enters and expands the cage body . the expansion of the cage is driven by the filler material . in accordance with the present invention device and related method an expandable cage 51 is inserted the space or area of the vacated by the removed vertebra or portion thereof ( i . e ., between adjacent vertebrae ) and ultimately into the proper location , position and alignment with the adjacent vertebrae without damaging or severing the spinal cord ( not shown ). the cage body may be expanded in accordance with the present invention and , for example , restore the carpectomy defect . it should be appreciated that any pressure or regulation of pressure of air or filler material may vary as desired or required . regulation may entail , for example , at least one of the following : prevention , adjustment , reduction , amplification , or control for the flow of or quantity of air , filler material or any medium as desired or required . it should be appreciated that the cage body 57 and related cage components discussed herein may take on all shapes along the entire continual geometric spectrum of manipulation of x , y and z planes to provide and meet the anatomical , maneuverability , safety and structural demands and requirements . size and shape of the cage body 57 during the various stages of deployment ( non - deployed , partially deployed , and fully deployed , for example ) could also be manipulated by varying the compliance of the cage body walls , cage and cage body structure and inflation / expansion pressure . alternatively , referring to the cage body 57 , the flexible and expandable chamber may comprise a structure comprising a series of cylinders in telescopic arrangement . fig9 a is a schematic transverse cross section of the human torso through the second thoracic vertebra 13 showing the spinal cord 33 and vertebral foramen 23 along with related anatomy . fig9 b is an enlarged partial view of the human torso and vertebra 13 as illustrated in fig9 a . fig1 a - d are schematic views of the vertebra or area vacated by all or part of the vertebra as shown in fig9 b illustrating progressive stages of the cage 51 being inserted , rotated and located in place by the driver element 71 into the spine of the subject as desired or required using the low profile and reduced invasiveness posterior approach of the present invention device and method . in an approach , the cage 51 has a body 57 in communication with a lower endplate 53 and upper endplate 55 . as shown in fig1 a , the cage 51 has been at least partially inserted and manipulated with the driver element 71 from the posterior . as shown in fig1 b , the cage 51 has been further advanced by the driver element 71 from the posterior . as shown in fig1 c , the cage 51 is capable for rotation as indicated by arrow “ r ”. as shown in fig1 d , the cage 51 has been rotated and positioned into the area vacated by the vertebra . it should be appreciated that the lower endplate and upper endplate may be interchangeable and are described as upper and lower for illustration purposes only . it should be appreciated that the driver element may comprise more than one instrument or component as desired or required for the procedure . it should be appreciated that the lower endplate and upper end plate may be a variety of structures such as , but not limited thereto , the following ; housing , plate , substrate , seat , platform , pedestal , chamber , holder , case , box , base , flange , collar , panel , partition , wall or the like , or any combination thereof . fig1 a - b illustrate schematic side views of a portion of the spine 2 or spinal column with a portion removed there from . for instance , as illustrated , all of a vertebral body may be removed ( or a portion of a vertebral body ). an individual vertebra 13 is made up of several parts , such as the spinous process 25 , superior articular processes 27 , and transverse processes 29 . fig1 a illustrates the cage 51 placed and rotated accordingly by the driver element 71 into the spine 2 having utilized the present invention posterior approach while in a collapsed or non - deployed state . fig1 b illustrates the cage 51 expanded or deployed state using the driver element 71 and its related components . some related components may be the driver mechanism 73 that is adapted to deliver the cement 81 or filler material into the cage body 57 of the cage 51 . in an approach , the driver 71 is adapted to deliver the cement or filler material under negative pressure . the driver mechanism 73 of the driver element 71 may comprise an actuator 75 such as a valve or piston to advance the cement or filler . fig1 a - c illustrate schematic side views of a portion of the spine 2 or spinal column with a portion removed there from . for instance , as illustrated , all of a vertebral body may be removed ( or a portion of a vertebral body ) providing two adjacent vertebrae 13 . fig1 a illustrates the cage 51 placed and rotated accordingly by the driver element 71 into the spine 2 having utilized the present invention posterior approach while in a collapsed or non - deployed state . fig1 b illustrates the cage 51 in a partially expanded or deployed state using the driver element 71 and its related components . some related components may be the driver mechanism 73 that is adapted to deliver the cement 81 or filler material into the cage 51 . in an approach , the driver is adapted to deliver the cement or filler material under negative pressure . the driver mechanism 73 of the driver element 71 may comprise an actuator 75 such as a valve , regulator , manifold , syringe , flow - driver , pump , or piston , or any combination thereof , etc . to advance the cement or filler . for example , in an embodiment , the driver element comprises a tube that is connected to the cage and allows its placement . the driver may be locked or secured to the cage and a valve mechanism ( s ) is provided that prevents air from entering the cage to prevent air bubbles from forming in the cage body . yet the valve mechanism ( s ) or the like also allows filler material to enter the cage under positive pressure . the driver element is 71 is in communication with the cage 51 ( at the lower plate 53 in this instance ) at a cage aperture 58 . fig1 c illustrates the cage 51 in a fully expanded or deployed state using the driver element 71 and its related components . sill referring to fig1 a - c ( and any of the embodiments discussed throughout ), the driver element 71 can be locked or secured using the cage aperture 58 as the locking mechanism . alternatively , a separate locking or securing device , such as a driver lock 61 , may also be utilized . it should be appreciated that the driver lock or securing means of the aperture may be a variety of locking means such as , but not limited thereto , a lock , pin , stop , stay , brace , latch , catch or latch , threading , etc . indifferent if it &# 39 ; s the aperture 58 or lock 61 , by locking or securing of the driver element 71 the driver element 71 can manipulate the cage 51 during insertion , rotation and placement ( i . e ., orientation ) without losing grip or control of the cage 51 as desired or required . although not illustrated , it should be appreciated that the functions of the driver element 71 ( filling the filler into the cage and orienting the cage ) may be accomplished with separated members or instruments , rather than a single member or instrument as illustrated . fig1 a schematically illustrates the cage 51 placed and rotated accordingly by the driver element 71 into the spine 2 that is diagnosed with kyphosis , and which the cage 51 is in a partially expanded or deployed state . fig1 b illustrates the cage 51 in a fully expanded or deployed state using the driver element 71 and its related components whereby the cage conforms to the contours or curvature of the spine diagnosed with kyphosis . it should be appreciated that because of the flexible nature of the cage , the cage and / or plates will match the local kyphosis lordosis of the spine segment to be reconstructed . fig1 schematically illustrates the cage 51 ( without upper or lower plates ) in a fully expanded or deployed state using the driver element 71 and its related components , and whereby the driver element is in communication with the cage body 57 , rather than one or both of the upper or lower plates . fig1 schematically illustrates the cage 51 in a fully expanded or deployed state using the driver element 71 and its related components , and whereby cage rods 59 ( such as titanium rods or other materials as desired or required ) and pedicle screws 62 are implemented as part of the cage construction . fig1 a schematically illustrates the cage 51 having a cage body 57 of the accordion type in the collapsed or non - deployed state . fig1 b illustrates the cage 51 of fig1 a while in the partially expanded or deployed state . fig1 c illustrates the cage 51 of fig1 a while in the fully expanded or deployed state . the number of the pleats / folds of the accordion / bellows , as well as the height / thickness of the pleats / folds of the accordion / bellows may be increased or decreased as desired or required . fig1 a schematically illustrates the cage 51 having a cage body 57 of the telescopic type ( wedding cake ) in the collapsed or non - deployed state . fig1 b illustrates the cage 51 of fig1 a in the partially expanded or deployed state . fig1 c illustrates the cage 51 of fig1 a in the fully expanded or deployed state . an aspect of an embodiment of the present invention device and related method provides a cage to be inserted through a posterior approach . to accomplish such an objective , an expandable plastic tubing or an expandable series of cylinders may be implemented . for instance , a type of flexible tubing is an accordion or bellows type of tubing . the expandable cage have an extremely low profile structure to be inserted from the back . the present invention method and related method provides for introducing the cage from the back adjacent to the neural structures ( i . e ., spinal cord ) and then rotate it 90 degrees , or as desired or required , to be able to expand it . in an exemplary embodiment the cage had to about the lateral cross section of the size of a face of a u . s . quarter coin and as little profile vertically ( axially ) as possible so it can be inserted from the back . regarding the design of the present invention cage filled with cement , a plastic cage or compatible biomaterial that will be filled with cement to expand the cage once its in its desired location , position and / or alignment . it should be appreciated that in the case of an anterior approach or wide costotransveresectomy the cage can be inserted in a manner consistent with a mechanical cage without the need to rotate it in place , as the larger access allows its insertion without risk to the spinal cord . however , the present invention low profile cage with high expansion capabilities is adapted for a posterior and less invasive approach and is only feasible by rotating a low profile cage into the vertebrectomy defect . it should be appreciated that various aspects of embodiments of the present device , method , system and materials may be implemented with the following devices , methods , systems and materials disclosed in the following u . s . patent applications , u . s . patents , and pct international patent applications that are hereby incorporated by reference herein : 1 . u . s . pat . no . 6 , 436 , 140 , b1 , liu , et . al ., “ expandable interbody fusion cage and method for insertion ”, aug . 20 , 2002 . 2 . u . s . pat . no . 7 , 014 , 659 , b2 , boyer , et . al ., “ skeletal reconstruction cages ”, mar . 21 , 2006 . 3 . u . s . pat . no . 6 , 443 , 990 , b1 , aebi , et . al ., “ adjustable intervertebral implant ”, sep . 3 , 2002 . 4 . u . s . pat . no . 6 , 893 , 464 , b2 , kiester , “ method and apparatus for providing an expandable spinal fusion cage ”, may 17 , 2005 . 5 . u . s . pat . no . 5 , 665 , 122 , kambin , “ expandable intervertebral cage and surgical method ”, sep . 9 , 1997 . 6 . u . s . pat . no . 6 , 488 , 710 , b2 , besselnik , “ reinforced expandable cage ad method of deploying ”, dec . 3 , 2002 . 7 . u . s . pat . no . 6 , 491 , 724 , b1 , ferree , “ spinal fusion cage with lordosis correction ”, dec . 10 , 2002 . 8 . u . s . pat . no . 6 , 695 , 760 , b1 , winkler , “ treatment of spinal metastases ”, feb . 24 , 2004 . 9 . u . s . pat . no . 5 , 236 , 460 , barber , “ vertebral body prosthesis ”, aug . 17 , 1993 . 10 . u . s . pat . no . 5 , 480 , 442 , bertagnoli , “ fixedly adjustable intervertebral prosthesis ”, jan . 2 , 1996 . 11 . u . s . pat . no . 4 , 932 , 975 , main , et . al ., “ vertebral prosthesis ”, jun . 12 , 1990 . 12 . u . s . patent application publication no . us2005 / 0222681 b1 , richley , et . al ., “ devices and methods for minimally invasive treatment of degenerated spinal discs ”, oct . 6 , 2005 . 13 . u . s . patent application publication no . us2005 / 0283247 a1 , gordon , et . al ., “ expandable articulating intervertebral implant with limited articulation ”, dec . 22 , 2005 . 14 . u . s . patent application publication no . us2005 / 0283248 a1 , gordon , et . al ., “ expandable intervertebral implant with spacer ”, dec . 22 , 2005 . 15 . u . s . patent application publication no . us2006 / 0116767 , a1 , magerl , et . al ., “ implant used in procedures for stiffening the vertebral column ”, jun . 1 , 2006 . 16 . u . s . patent application publication no . us2006 / 0129241 , a1 , boyer , et . al ., “ skeletal reconstruction cages ”, jun . 15 , 2006 . 17 . u . s . patent application publication no . us2006 / 0142858 , a1 , colleran , et . al ., “ expandable implants for spinal disc replacement ”, jun . 29 , 2006 . 18 . u . s . patent application publication no . us2002 / 0128716 a1 , cohen , et . al ., “ spinal surgical prosthesis ”, sep . 12 , 2002 . it should be appreciated that as discussed herein , a subject may be a human or any animal . it should be appreciated that an animal may be a variety of any applicable type , including , but not limited thereto , mammal , veterinarian animal , livestock animal or pet type animal , etc . as an example , the animal may be a laboratory animal specifically selected to have certain characteristics similar to human ( e . g . rat , dog , pig , monkey ), etc . it should be appreciated that the subject may be any applicable human patient , for example . in summary , while the present invention has been described with respect to specific embodiments , many modifications , variations , alterations , substitutions , and equivalents will be apparent to those skilled in the art . the present invention is not to be limited in scope by the specific embodiment described herein . indeed , various modifications of the present invention , in addition to those described herein , will be apparent to those of skill in the art from the foregoing description and accompanying drawings . accordingly , the invention is to be considered as limited only by the spirit and scope of the following claims , including all modifications and equivalents . still other embodiments will become readily apparent to those skilled in this art from reading the above - recited detailed description and drawings of certain exemplary embodiments . it should be understood that numerous variations , modifications , and additional embodiments are possible , and accordingly , all such variations , modifications , and embodiments are to be regarded as being within the spirit and scope of this application . for example , regardless of the content of any portion ( e . g ., title , field , background , summary , abstract , drawing figure , etc .) of this application , unless clearly specified to the contrary , there is no requirement for the inclusion in any claim herein or of any application claiming priority hereto of any particular described or illustrated activity or element , any particular sequence of such activities , or any particular interrelationship of such elements . moreover , any activity can be repeated , any activity can be performed by multiple entities , and / or any element can be duplicated . further , any activity or element can be excluded , the sequence of activities can vary , and / or the interrelationship of elements can vary . unless clearly specified to the contrary , there is no requirement for any particular described or illustrated activity or element , any particular sequence or such activities , any particular size , speed , material , dimension or frequency , or any particularly interrelationship of such elements . accordingly , the descriptions and drawings are to be regarded as illustrative in nature , and not as restrictive . moreover , when any number or range is described herein , unless clearly stated otherwise , that number or range is approximate . when any range is described herein , unless clearly stated otherwise , that range includes all values therein and all sub ranges therein . any information in any material ( e . g ., a united states / foreign patent , united states / foreign patent application , book , article , etc .) that has been incorporated by reference herein , is only incorporated by reference to the extent that no conflict exists between such information and the other statements and drawings set forth herein . in the event of such conflict , including a conflict that would render invalid any claim herein or seeking priority hereto , then any such conflicting information in such incorporated by reference material is specifically not incorporated by reference herein .	0
in accordance with the instant invention there is provided a process for concentrating kcl in a flotation system . the process comprises adding to the flotation system a synthetic depressant during the flotation stage . the synthetic depressant employed in this process is a low molecular weight copolymer of general structure i . the molecular weight of the synthetic depressant should be within the range from about 500 to 85 , 000 and preferably within the range from about 7 , 000 to 85 , 000 . the degree of hydrolysis of the synethetic depressant should be from about 5 % to 66 %, preferably from about 20 % to 55 %, and more preferably , from about 40 % to 45 %. the hydrolyzed polyacrylamide can be prepared by first polymerizing acrylamide and then hydrolyzing some of the amide groups , or concurrent polymerization and hydrolysis or it may be made by other means , including copolymerization of acrylic acid or methacrylic acid and acrylamide , or hydrolysis of polyacrylonitrile , etc . in any event , there are the proper proportions of amide groups and the remainder being carboxyl groups , usually in the form of an alkali metal salt . the term hydrolyzed polyacrylamide is used as convenient understandable terminology rather than to limit the process of manufacture . reagents which have been found particularly useful for hydrolysis include naoh , koh and nh 4 oh . the resulting low - molecular weight copolymer when employed as a depressant in the flotation system has exhibited improved selectivity and recovery over conventional depressants at substantially lower dosages of depressant . the synthetic depressant is easily diluted with water to provide a reagent solution that , due to its non - susceptibility to bacterial decomposition , can be stored almost indefinitely . the synthetic depressants should be added in an effective amount to obtain the desired degree of depression . although this amount will vary depending upon the ore being processed , the flotation collector being employed , and other variables , it is generally on the order of about 0 . 01 to 0 . 20 pound of depressant calculated on active ingredient per long ton of ore . additionally , the instant process is capable of employing a combination of synthetic depressant with a conventional , naturally derived depressant , such as starch , modified starch derivatives and guar gums to arrive at substantially equivalent or improved performance to that obtained when employing the conventional depressant alone . the following specific examples illustrate certain aspects of the present invention and , more particularly , point out methods of evaluating the process for concentrating sylvite values in a flotation system . however , the examples are set forth for illustration only and are not to be construed as limitations on the present invention except as set forth in the appended claims . all parts and percentages are by weight unless otherwise specified . examples 1 to 23 illustrate the efficacy of the synthetic depressant at one - sixth to one - fourth dosage normally required for starch or guar to obtain equivalent or better grade , insolubles and recovery ( procedures i and ii ). the test results of examples 24 and 25 following the procedure iii show that synthetic depressant at lower dose than carboxymethyl cellulose give equivalent and higher minerological performance . scrub two separate samples each of 800 parts of sylvinite ore in 370 parts of a saturated brine solution for two minutes at 800 r . p . m . and thereafter combine the two samples into one containing at least 1600 parts of sylvinite ore . condition the sample of step 1 in a flotation cell at 1400 r . p . m . with 20 parts of a 1 . 4 % solution of nonionic polyacrylamide flocculant for 15 seconds and 2 parts of a 0 . 2 % solution of cationic surfactant collector for 15 additional seconds . transfer the sample of step 2 to a flotation bowl . flotation is then conducted for two minutes at 1600 r . p . m . which results in a slime froth and underflow . the underflow portion is screened on a 20 mesh screen resulting in + 20 mesh and - 20 mesh fractions . the + 20 mesh portion of step 3 is conditioned at 800 r . p . m . with 8 parts of a 4 % starch solution for 15 seconds followed by 10 parts of a 2 % solution of amine for 15 seconds and 4 drops of a hydrocarbon oil for 15 more seconds . the - 20 mesh portion of step 3 is conditioned at 1100 r . p . m . with 8 parts of a 4 % starch solution for 30 seconds followed by 5 parts of a 2 % solution of amine for 30 seconds . the + 20 and - 20 mesh portions are recombined in a flotation cell and conditioned at 1100 r . p . m . with 2 drops of a frother for 15 seconds . flotation is conducted at 1400 r . p . m . for two minutes resulting in a concentrate and a tail . the experimental procedure set forth above is followed in every material detail employing as the depressant 0 . 52 pound of dry starch per long ton of sylvinite in the flotation steps . test results are set forth in table i . the experimental procedure set forth above is followed in every material detail employing as the depressant 0 . 064 pound of a 45 % hydrolyzed polyacrylamide having a molecular weight of 30 , 000 per long ton of sylvinite in place of the starch used during the flotation steps . test results are set forth in table i . the experimental procedure set forth above is followed in every material detail employing 0 . 239 to 0 . 287 pound of dry copolymer depressant per long ton of sylvinite in place of the starch used during the flotation steps . test results and details are set forth in table i . table i______________________________________evaluation of synthetic depressantsreagents dose distribution % dry assays conc . conc . example cooh mwt . lb / lt kcl insol . kcl______________________________________comp . a none starch 0 . 520 87 . 6 2 . 8 72 . 71 45 30 , 000 0 . 064 87 . 8 2 . 7 70 . 72 43 7 , 000 0 . 287 91 . 4 2 . 2 68 . 43 66 7 , 000 0 . 287 88 . 3 3 . 2 68 . 54 45 2 , 500 0 . 239 89 . 0 4 . 4 54 . 95 23 7 , 000 0 . 285 86 . 4 3 . 0 71 . 7______________________________________ the experimental procedure set forth above is followed in every material detail employing as the depressant those materials detailed in table ii . the dosage listed in table ii is calculated on solid synthetic depressant and on solid starch . test results are set forth in table ii as well . table ii__________________________________________________________________________reagents dose assays conc . distribution conc . example % cooh mwt . lb . solid reagent / lt kcl insol . kcl__________________________________________________________________________comp . bnone starch 0 . 396 91 . 7 1 . 2 74 . 70 6 45 32 , 000 0 . 052 93 . 5 0 . 8 78 . 48comp . cnone starch 0 . 242 86 . 2 1 . 8 68 . 92comp . dnone starch 0 . 363 88 . 0 1 . 7 73 . 62 7 45 32 , 000 0 . 048 88 . 0 2 . 0 71 . 44 8 45 68 , 000 0 . 047 85 . 6 1 . 8 73 . 68comp . e45 200 , 000 0 . 041 85 . 3 1 . 7 71 . 38 9 45 32 , 000 0 . 024 90 . 2 2 . 1 64 . 2210 25 68 , 000 0 . 045 87 . 8 3 . 6 71 . 5511 45 68 , 000 0 . 047 88 . 4 4 . 7 76 . 4012 66 68 , 000 0 . 045 87 . 3 4 . 8 62 . 2813 25 32 , 000 0 . 048 89 . 2 5 . 5 73 . 214 66 32 , 000 0 . 050 90 . 6 4 . 0 67 . 58comp . fnone starch 0 . 330 90 . 5 2 . 6 70 . 9615 45 68 , 000 0 . 043 83 . 8 3 . 6 67 . 7516 45 68 , 000 0 . 029 85 . 1 3 . 6 69 . 1517 45 68 , 000 0 . 014 89 . 0 3 . 7 66 . 9518 45 32 , 000 0 . 044 86 . 5 2 . 8 80 . 6519 45 32 , 000 0 . 030 85 . 2 3 . 6 69 . 92__________________________________________________________________________ eight hundred parts of sylvinite ore are placed in a flotation cell which is then filled to the lip with a brine solution . the sylvinite is scrubbed for 5 minutes and thereafter transferred to a 5 liter cylinder where it is stirred for 1 minute and allowed to settle for an additional minute . the slimes are decanted to within 1 / 2 inch of the settled sylvinite . the settled sylvinite is combined with 300 parts of saturated brine solution and 0 . 34 pound per ton of guar is mixed in and then agitated for 10 - 20 seconds . next 0 . 10 pound per ton of an amine collector is mixed in and thereafter agitated for 10 seconds . to this is then added 4 drops of a hydrocarbon oil followed by 5 seconds of agitation and finally 4 drops of methyl isobutyl carbinol followed by 5 seconds of agitation . the mixture is transferred to a flotation cell and filled to the lip with a brine solution . a two minute float follows . the concentrate and tail are dried and weighed . the experimental procedure ii set forth above is followed in every material detail employing a copolymer depressant in the flotation step in place of guar . the dosage listed in table iii is calculated on solid synthetic depressant and on solid guar . test results are detailed in table iii . table iii______________________________________ dosereagents lb . solid concentrate % reagent / % % kclexample cooh mwt . lt kcl insol . recovery______________________________________20 45 7 , 000 0 . 105 88 . 50 1 . 22 41 . 021 45 32 , 000 0 . 047 86 . 97 1 . 38 57 . 922 45 68 , 000 0 . 046 86 . 24 1 . 59 58 . 723 45 68 , 000 0 . 023 84 . 08 1 . 76 54 . 7comp . g guar 0 . 34 84 . 89 1 . 21 59 . 0______________________________________ the flotation feed consists of 400 parts of coarse and 400 parts of fine sylvinite particles , which have been deslimed . the fine particles slurry is stirred for 10 seconds , followed by the addition of commercial grade of carboxy methyl cellulose ( 0 . 056 lb / ton ). a slurry of coarse particle is stirred for 10 seconds , followed by the addition of commercial grade of carboxy methyl cellulose ( 0 . 084 lb / ton ). after 30 seconds conditioning time , commercial amine ( 0 . 275 lb / ton ) is added . after stirring for 30 seconds , process oil ( 0 . 15 lb / ton ) is added and is stirred for 15 seconds at slow speed , followed by 15 seconds high speed stirring . the fine and coarse fractions are transferred into the flotation bowl and 0 . 04 lb / ton m . i . b . c . and saturated brine solution are added . the concentrate and tail are filtered and dried ( example h ). the experimental procedure set forth above is followed in every material detail employing a 45 % hydrolyzed polyacrylamide ( molecular weight 45 , 000 ) in the flotation step in place of commercial carboxy methyl cellulose . the dosage listed in table iv is calculated as solid synthetic depressant and solid carboxymethyl cellulose and is based on the total charge of coarse and fine combined . table iv__________________________________________________________________________reagent lb / ton based on total charge of coarse & amp ; finecoarse particles fine particles assay conc . distrib . conc . exampledepressant dose amine oil mibc depressant dose kcl insol . kcl__________________________________________________________________________comp . hcarboxy methyl 0 . 084 0 . 275 0 . 15 0 . 04 carboxy methyl 0 . 056 89 . 5 1 . 1 86 . 7cellulose cellulose24 synthetic depressant 0 . 063 0 . 275 0 . 15 0 . 04 synthetic depressant 0 . 042 91 . 0 1 . 2 85 . 7m . w . 45 k 45 % cooh m . w . 45 k 45 % cooh25 synthetic depressant 0 . 078 0 . 275 0 . 15 0 . 04 synthetic depressant 0 . 052 91 . 6 1 . 3 87 . 4m . w . 45 k 45 % cooh m . w . 45 k 45 % cooh__________________________________________________________________________	1
one preferred embodiment of a lamp unit mounting structure of the present invention will now be described in detail with reference to the accompanying drawings . fig1 is an exploded , perspective view of a room lamp to which one preferred embodiment of the lamp unit mounting structure of the invention is applied , fig2 a is an enlarged perspective view of an important portion of a fixing member shown in fig1 , fig2 b is a cross - sectional view thereof , fig3 is a front - elevational view as seen from a direction iii of fig2 a , fig4 a is an enlarged perspective view of an important portion of a modified example of the fixing member shown in fig2 a , fig4 b is a cross - sectional view thereof , and fig5 to 7 are cross - sectional views explanatory of a process of mounting the lamp unit of fig1 on a car body panel . the room lamp 20 according to the embodiment , shown in fig1 , is a lamp unit which is adapted to be mounted at a lamp - mounting window 31 formed on a roof trim 30 ( serving as an interior wall member ) covering a body roof ( car body panel ). the room lamp 20 includes a lamp function portion a for mounting on that side ( upper side in the drawings ) of the roof trim 30 facing the body roof , and a design portion b for mounting on that side ( lower side in the drawings ) of the roof trim 30 facing the room , the lamp function portion a including a bulb 24 mounted in a housing 21 , a switch portion ( not shown ) and so on , while the design portion b includes a cover lens 51 , and a holder 41 . an ffc 22 ( which is a cable forming a roof harness ) is connected via the switch portion ( not shown ) to the bulb 24 mounted in the housing 21 of the lamp function portion a . namely , a connection portion of the ffc 22 ( which is the roof harness beforehand installed on the roof trim 30 ) is electrically connected to a wire connection portion of the lamp function portion a , and at this time the operator can effect this connecting operation with his face directed downward while confirming this connected condition with the eyes . the cover lens 51 of the design portion b is integrally attached to the holder 41 by engaging retaining projections 51 a respectively with engagement portions ( not shown ) of the holder 41 . the holder 41 includes engagement claws 42 for engagement respectively in engagement holes 32 ( formed through the roof trim 30 ) to fix the holder 41 and the roof trim 30 to each other , a housing fitting hole 46 for fittingly receiving the housing 21 , a fixing member 43 for fixing the room lamp 20 and a reinforcing member 60 of the body roof to each other , and shake - prevention piece portions 48 for being brought into resilient abutting engagement with the reinforcing member 60 after the mounting of the room lamp on the car body so as to prevent the shaking of the room lamp . the pair of engagement claws 42 are provided on a diagonal line of the holder 41 having a generally rectangular shape when viewed from the top , and also the pair of fixing member 43 are provided on another diagonal line of the holder 41 . two pairs of shake - prevention piece portions 48 are formed integrally on the holder 41 , and each pair of shake - prevention piece portions 48 are provided along a corresponding short side of the holder 41 , and extend obliquely upwardly . as shown in fig2 a , each fixing member 43 is formed on and projects perpendicularly from that side ( upper side in the drawings ) of the holder 41 ( of the room lamp 20 ) facing the reinforcing member 60 . this fixing member 43 includes an elastic arm 44 for retaining engagement at its distal end portion 44 c with a mounting portion 61 of the reinforcing member 60 , and a pair of elastic arm restriction portions 47 provided respectively on opposite ( right and left ) sides of the elastic arm 44 . the mounting portion 61 is formed by an edge portion of a notch 62 formed in the reinforcing member 60 . the elastic arm 44 includes a vertical portion 44 a formed integrally at its proximal end with the holder 41 , an elastic portion 44 b which extends from the vertical portion 44 a , and is bent into a generally inverted u - shape to extend obliquely downwardly , and a support piece portion 45 extending vertically downwardly from a lower surface of the elastic portion 44 b . the distal end portion 44 c of the elastic portion 44 b is adapted to be retainingly engaged with the mounting portion 61 of the reinforcing member 60 . a distal end portion ( lower end portion ) of the support piece portion 45 extends through a notch portion 41 a formed on the holder 41 , and is not fixed , and therefore is in a free condition . a pair of upper and lower engagement projections 45 a and 45 b are formed on and project outwardly from each of opposite side edges of the support piece portion 45 , these upper and lower engagement projections serving as the engagement portions of the elastic arm 44 . as shown in fig3 , the amount la of projecting of each upper engagement projection 45 a is smaller than the amount lb of projecting of each lower engagement projection 45 b . each elastic arm restriction portion 47 , formed ( molded ) integrally on the holder 41 , includes a retaining wall 47 a , and a slanting portion 47 b . as shown in fig2 a and 2b , a notch 47 c ( serving as an escape portion ) is formed in the retaining wall 47 a , and each lower engagement projection 45 b extends laterally beyond the notch 47 c to a position beneath the corresponding retaining wall 47 a since the amount lb of projecting of the lower engagement projection 45 b is large . the amount la of projecting of each upper engagement projection 45 a is small , and therefore the upper engagement projection 45 a is within the range of the notch 47 c . therefore , in a non - deformed condition of the elastic arm 44 , that is , before the room lamp 20 is mounted or after the room lamp is properly mounted , the lower engagement projections 45 b of the elastic arm 44 abut respectively against the lower surfaces of the retaining walls 47 a , and therefore the elastic arm 44 is prevented from being deformed upwardly . on the other hand , each upper engagement projection 45 a is within the range of the corresponding notch 47 c , and therefore the upper engagement projection 45 a will not interfere with the retaining wall 47 c upon downward deformation of the elastic arm , thereby allowing the downward deformation of the elastic arm . further , each pair of upper and lower engagement projections 45 a and 45 b are disposed respectively at upper and lower sides of the corresponding slanting portion 47 b , and therefore can slide along the slanting portion 47 b , but are prevented from movement in a direction perpendicular to the slanting portion 47 b . therefore , during the mounting of the room lamp on the car body , the distal end portion 44 c is prevented from being displaced in a direction ( upward - downward direction in the drawings ) of mounting and dismounting of the room lamp 20 relative to the car body , but can slide along the slanting portions 47 b . therefore , the elastic arm 44 can be deformed along the slanting portions 47 b , and therefore the room lamp 20 can be mounted on and removed from the car body . although a starting end of each slanting portion 47 b is cut vertically as shown in fig2 a and 2b , a tapering portion 47 d may be formed at this portion as shown in fig4 a and 4b . in this case , the engagement projections 45 a and 45 b , disposed in registry with the notch 47 c , can smoothly move to the slating portion 47 b . and besides , even if the support piece portion 45 is slightly engaged with the slanting portion 47 b of each elastic arm restriction portion 47 after the mounting operation is completed , each engagement projection 45 a slides over the tapering portion 47 d to move to the notch 47 c when an apex portion 44 d of the elastic arm 44 abuts against the body roof upon application of an upward force to the room lamp 20 . thus , the engagement projection 45 a is disengaged from the slanting portion 47 b , and therefore the upward force is prevented from acting on the body roof . in fig4 a and 4b , the same portions as described above are designated by identical reference numerals , respectively , and repeated description will be omitted . when the room lamp 20 of this embodiment is to be mounted on the roof trim 30 , first , the holder 41 is attached to the roof trim 30 to cover the lamp - mounting window 31 in the roof trim 30 , and the engagement claws 42 on the holder 41 are engaged respectively in the engagement holes 32 in the roof trim 30 , thereby fixing the holder 41 and the roof trim 30 to each other . at this time , the fixing member 43 and the shake - prevention piece portions 48 will not interfere with the roof trim 30 thanks to the provision of openings 33 in the roof trim 30 ( see fig5 ). the cover lens 51 is attached to the holder 41 from the inside of the car room ( that is , from the lower side in fig1 ), so that the design portion b is beforehand attached to the roof trim 30 . then , the housing 21 , forming the lamp function portion a of the room lamp 20 connected to the connection portion of the ffc 22 , is fitted into the housing fitting hole 46 in the holder 41 from that side ( upper side in the drawings ) of the roof trim 30 facing the reinforcing member 60 , and trim mounting portions 23 are retainingly engaged with a peripheral edge portion of the lamp - mounting window 31 , so that the lamp function portion a is directly mounted on the roof trim 30 as shown in fig5 . the cover lens 51 may be attached to the holder 41 after the housing 21 is fitted into the housing fitting hole 46 in the holder 41 . then , the ffc 22 is installed on that side of the roof trim 30 facing the reinforcing member 60 , and roof accessories ( not shown ) such as a back mirror and a sun visor are beforehand attached to the roof trim 30 , thereby forming a roof module in which the room lamp 20 and the roof trim 30 with the roof accessories are integrally combined together as shown in fig5 . then , the roof module , having the room lamp 20 and the roof trim 30 integrally combined together , is mounted on the body roof as shown in fig6 and 7 . at this time , the distal end portions 44 c of the elastic arms 44 , disposed at that side where the room lamp 20 is provided , are retainingly engaged respectively with the mounting portions 61 of the reinforcing member 60 , and by doing so , the room lamp 20 and the roof trim 30 are fixed to the reinforcing member 60 by the fixing member 43 . in the lamp unit mounting structure of this embodiment , the mounting operation is thus completed merely by mounting the roof module ( having the room lamp 20 and the roof trim 30 integrally combined together ) on the reinforcing member 60 of the body roof , and the operation for mounting the roof accessories can be omitted when mounting the roof trim , and therefore the mounting operation is easy . particularly , the fixing member 43 enable the room lamp 20 and the roof trim 30 to be easily and positively mounted simultaneously on the reinforcing member 60 of the body roof by their elastic arms 44 and elastic arm restriction portions 47 . namely , in the fixing member 43 of this embodiment , the pair of engagement projections 45 a and 45 b , formed at each of the opposite side edges of the support piece portion 45 of the elastic arm 44 , are disposed in registry with the notch 47 c ( formed in the retaining wall 47 a of the elastic arm restriction portion 47 formed integrally with the holder 41 ) as shown in fig2 b before the room lamp is mounted . when the elastic portion 44 b of the elastic arm 44 abuts against an edge 61 a of the mounting portion 61 as shown in fig8 a during the mounting of the roof module on the reinforcing member 60 , the elastic portion 44 b is pressed downward , so that the support piece portion 45 is pressed down rearwardly ( in a right - hand direction in fig8 a ). as a result , the slanting portion 47 b of each elastic arm restriction portion 47 is fitted between the corresponding pair of upper and lower engagement projections 45 a and 45 b formed on the support piece portion 45 . therefore , the elastic arm 44 is prevented from being deformed downwardly , and moves rearward . when the roof module is further pushed up , the support piece portion 45 moves rearward , and the distal end of the elastic arm 44 also moves rearward , and therefore the distal end portion 44 c of the elastic arm 44 slides past the edge 61 a , and is retainingly engaged with the mounting portion 61 , so that the roof module is mounted on the reinforcing member 60 . therefore , when mounting the room lamp 20 and the roof trim 30 ( combined together to form the module ) simultaneously on the reinforcing member 60 , the distal end portion 44 c of the elastic arm 44 will not escape toward the car room ( that is , downward ) in the direction of mounting and dismounting of the room lamp 20 relative to the car body before this distal end portion 44 c is retainingly engaged with the mounting portion 61 of the reinforcing member 60 . therefore , in the fixing member 43 , the distal end portion 44 c of the elastic arm 44 will not fail to be retainingly engaged with the mounting portion 61 of the reinforcing member , and hence is prevented from being held in a half - fixed condition , so that the module can be positively mounted on the reinforcing member 60 . and besides , when mounting the module on the car body , the distal end portion 44 c of the elastic arm 44 will not escape toward the car room in the direction of mounting and dismounting of the room lamp 20 relative to the car body as described above , and therefore an excessive clearance for allowing for this escape does not need to be formed between the distal end portion 44 c and the mounting portion 61 of the reinforcing member 60 . furthermore , at the time of mounting the module on the reinforcing member 60 of the body roof , the elastic portion 44 b is elastically deformed such that its distal end portion 44 c is moved toward the vertical portion 44 a , and hence is displaced so as to be releasably engaged with the mounting portion 61 , and at the same time this distal end portion 44 c is also displaced toward the reinforcing member 60 ( that is , upward ). therefore , the distal end portion 44 c can be displaced upwardly beyond its normal position , and therefore can positively slide past the edge 61 a of the mounting portion 61 . therefore , the distal end portion 44 c can be positively engaged with the mounting portion 61 without the need for providing a clearance ( as described above for the related room lamp - fixing structure of fig1 b in which the clearance t is needed ) between this distal end portion 44 c and the mounting portion 61 after the module is completely mounted on the car body . when the distal end portion 44 c slides past the edge 61 a as shown in fig6 , the slanting portions 47 b cease to urge the elastic portion 44 b upward , so that the distal end portion 44 c tends to be restored into its normal condition . therefore , a resilient force is produced in the elastic portion 44 b when the module is completely mounted on the car body , and the elastic portion 44 b resiliently abuts against the mounting portion 61 , so that the module is prevented from shaking relative to the reinforcing member 60 . in this embodiment , the shake - prevention piece portions 48 are provided at the holder 41 of the room lamp 20 , and are resiliently abut against the reinforcing member 60 after the module is mounted on the car body as shown in fig5 and 6 . therefore , for example , even when a clearance due to a molding error of the elastic arm 44 and an assembling tolerance is formed between the distal end portion 44 c and the mounting portion 61 , the shake - prevention piece portions 48 positively prevent the shaking of the module relative to the reinforcing member 60 . therefore , the module will not be shaken by vibrations or others during the travel of the car , and therefore will not produce abnormal sounds . when an excessive upward force acts on the room lamp 20 after the mounting operation is completed , there is a fear that the apex portion 44 d of each elastic arm 44 strikes against the body roof . however , the support piece portion 45 is located in the notches 47 c formed respectively in the elastic arm restriction portions 47 , and each engagement projection 45 a will not interfere with the retaining wall 47 a , so that the elastic arm 44 is allowed to be deformed downward as shown in fig8 b . therefore , the upward force is absorbed , thereby avoiding a situation in which the body roof is recessed . in the case where the tapering portion 47 d is formed at that end portion of the retaining wall 47 a disposed adjacent to the notch 47 c as shown in fig4 a and 4b , the engagement projections 45 a and 45 b , disposed in registry with the notch 47 c , can smoothly move to the slanting portion 47 b as shown in fig9 a . and besides , even if the support piece portion 45 is slightly engaged with the slanting portion 47 b of each elastic arm restriction portion 47 after the mounting operation is completed , each engagement projection 45 a slides over the tapering portion 47 d to move to the notch 47 c when the apex portion 44 d of the elastic arm 44 abuts against the body roof upon application of an upward force to the room lamp 20 , as shown in fig9 b . even when there is applied a large external force tending to displace the module ( fixed to the reinforcing member 60 of the body roof as shown in fig5 and 6 ) toward the room ( downward in the drawings ) relative to the roof reinforcing member 60 , the lower wide engagement projections 45 b ( formed on and projecting from the support piece portion 45 of the elastic arm 44 ), each laterally extending beyond the corresponding notch 47 c , abut respectively against the lower surfaces of the retaining walls 47 a of the elastic arm restriction portions 47 , and therefore the distal end portion 44 c can hardly be displaced upward in the direction ( upward - downward direction in the drawings ) of mounting and dismounting of the room lamp 20 relative to the car body . therefore , the distal end portion 44 c of the elastic arm 44 is prevented from being turned up , and the retaining force is enhanced , so that the fixed condition will not be canceled . the car body panel , interior wall member , lamp unit , wire connection portion , wires , etc ., of the lamp unit mounting structure of the invention are not limited to their respective constructions shown in the above embodiment , and each of these can take any other suitable form on the basis of the subject matter of the invention . for example , in the above embodiment , although the room lamp , serving as the lamp unit , is attached to the roof trim serving as the interior wall member , the invention can be applied also to the cases where a map lamp is attached to a roof trim and where a lamp unit such as a courtesy lamp is attached to a door trim serving as an interior wall member covering a car body panel such as a door panel . the cable ( wires ) to be installed on the interior wall member is not limited to the ffc described in the above embodiment , and a flat circuit member , such as an fpc ( flexible printed circuit board ) and a ribbon cable , and a wire harness can be used . although the present invention has been shown and described with reference to specific preferred embodiments , various changes and modifications will be apparent to those skilled in the art from the teachings herein . such changes and modifications as are obvious are deemed to come within the spirit , scope and contemplation of the invention as defined in the appended claims .	1
in fig2 , reference numeral 30 generally indicates a nozzle arrangement of a first embodiment of an ink jet printhead chip , in accordance with the invention , for an inkjet printhead . the nozzle arrangement 30 is one of a plurality of such nozzle arrangements formed on a silicon wafer substrate 32 to define the printhead chip of the invention . as set out in the background of this specification , a single printhead can contain up to 84 000 such nozzle arrangements . for the purposes of clarity and ease of description , only one nozzle arrangement is described . it is to be appreciated that a person of ordinary skill in the field can readily obtain the printhead chip by simply replicating the nozzle arrangement 30 on the wafer substrate 32 . the printhead chip is the product of an integrated circuit fabrication technique . in particular , each nozzle arrangement 30 is the product of a mems - based fabrication technique . as is known , such a fabrication technique involves the deposition of functional layers and sacrificial layers of integrated circuit materials . the functional layers are etched to define various moving components and the sacrificial layers are etched away to release the components . as is known , such fabrication techniques generally involve the replication of a large number of similar components on a single wafer that is subsequently diced to separate the various components from each other . this reinforces the submission that a person of ordinary skill in the field can readily obtain the printhead chip of this invention by replicating the nozzle arrangement 30 . an electrical drive circuitry layer 34 is positioned on the silicon wafer substrate 32 . the electrical drive circuitry layer 34 includes cmos drive circuitry . the particular configuration of the cmos drive circuitry is not important to this description and has therefore been shown schematically in the drawings . suffice to say that it is connected to a suitable microprocessor and provides electrical current to the nozzle arrangement 30 upon receipt of an enabling signal from said suitable microprocessor . an example of a suitable microprocessor is described in the above referenced patents / patent applications . it follows that this level of detail will not be set out in this specification . an ink passivation layer 36 is positioned on the drive circuitry layer 34 . the ink passivation layer 36 can be of any suitable material , such as silicon nitride . the nozzle arrangement 30 includes a nozzle chamber structure 38 . the nozzle chamber structure 38 defines a nozzle chamber 40 and has a roof 42 that defines an ink ejection port 44 . the nozzle chamber structure 38 includes a pair of opposed sidewalls 46 , a distal end wall 48 and a proximal end wall 50 so that the nozzle chamber 40 is generally rectangular in plan . a plurality of ink inlet channels 52 are defined through the silicon wafer substrate 32 , the drive circuitry layer 34 and the ink passivation layer 36 . one ink inlet channel 52 is in fluid communication with each respective nozzle chamber 40 . further , each ink inlet channel 52 is aligned with each respective ink ejection port 44 . the nozzle arrangement 30 includes an ink - ejecting member in the form of a paddle 54 . the paddle 54 is dimensioned to correspond generally with the nozzle chamber 40 . further , the paddle 54 has a distal end portion 56 that is interposed between an opening 58 of the ink inlet channel 52 and the ink ejection port 44 . the paddle 54 is angularly displaceable within the nozzle chamber 40 so that the distal end portion 56 can move towards and away from the ink ejection port 44 . thus , when the nozzle chamber 40 is filled with ink 60 , such movement of the paddle 54 results in a fluctuation of ink pressure within the nozzle chamber 40 so that an ink drop 62 is ejected from the ink ejection port 44 . the mechanism of ink drop ejection is fully set out in the above referenced applications and patents . it follows that this detail is not set out in this specification . the nozzle arrangement 30 includes an actuator in the form of a thermal bend actuator 64 . this form of actuator is also described in the above referenced applications and patents and is therefore not described in further detail in this specification . briefly , however , the thermal bend actuator 64 includes an actuator arm 66 that has a fixed end 68 that is fixed to an anchor 70 and a working end 72 that is displaceable towards and away from the substrate 32 upon receipt of a drive signal in the form of a current pulse emanating from the drive circuitry layer 34 . the nozzle arrangement 30 includes a sealing structure 78 that is interposed between the working end 72 of the actuator arm 66 and a proximal end portion 76 of the paddle 54 . the actuator arm 66 , the sealing structure 78 and the paddle 54 are the product of a deposition and etching process carried out with a single material . however , the arm 66 , the sealing structure 78 and the paddle 54 are discrete components . this facilitates fabrication of the nozzle arrangement 30 . the material can be any of a number of materials used in integrated circuit fabrication processes . however , it is a requirement that the material have a coefficient of thermal expansion that is such that the material is capable of expansion and contraction when heated and subsequently cooled to an extent sufficient to perform work on a mems scale . further , it is preferable that the material be resiliently flexible . the applicant has found that titanium aluminum nitride ( tialn ) is particularly suited for the task . the nozzle arrangement 30 includes a motion - transmitting structure 74 that interconnects the working end 72 of the actuator arm 66 and the proximal end portion 76 of the paddle 54 . the motion - transmitting structure 74 bridges the sealing structure 78 so that the sealing structure 78 is interposed between at least a portion of the motion - transmitting structure 74 and the sealing structure 78 . the motion - transmitting structure 74 includes an effort formation 80 that extends from the working end 72 of the actuator arm 66 . the motion - transmitting structure 74 also includes a load formation 82 that extends from the proximal end portion 76 of the paddle 54 . a lever arm formation 84 interconnects the effort and load formations 80 , 82 . the lever arm formation 84 is pivotally connected between the sidewalls 46 with connectors in the form of opposed flexural connectors 85 . the flexural connectors 85 are configured to experience torsional distortion upon pivotal movement of the lever arm formation 84 . it will therefore be appreciated that , upon reciprocal movement of the working end 72 of the actuator arm 66 , the lever arm formation 84 pivots . this pivotal movement results in the angular displacement of the paddle 54 , as described above , via the load formation 82 . the motion - transmitting structure 74 and the roof 42 define a slotted opening 86 that accommodates relative movement of the structure 74 and the roof 42 . the slotted opening 86 is interposed between a pair of ridges 88 that extend from the structure 74 and the roof 42 . the ridges 88 are dimensioned so that , when the nozzle chamber 40 is filled with the ink 60 , a fluidic seal 90 is defined between the ridges 88 . similarly , the sealing structure 78 and the proximal end portion 76 of the paddle 54 are configured so that a fluidic seal 92 is defined between the proximal end portion 76 and the sealing structure 78 . in fig3 and 4 , reference numeral 100 generally indicates a nozzle arrangement of an inkjet printhead chip , in accordance with the invention , for an inkjet printhead . with reference to fig2 , like reference numerals refer to like parts , unless otherwise specified . the nozzle arrangement 100 includes nozzle chamber walls 102 positioned on the ink passivation layer 36 . a roof 104 is positioned on the nozzle chamber walls 102 so that the roof 104 and the nozzle chamber walls 102 define a nozzle chamber 106 . the nozzle chamber walls 102 include a distal end wall 108 , a proximal end wall 110 and a pair of opposed sidewalls 112 . an ink ejection port 114 is defined in the roof 104 to be in fluid communication with the nozzle chamber 106 . the roof 104 defines a nozzle rim 116 and a recess 118 positioned about the rim 116 to inhibit ink spread . the walls 102 and the roof 104 are configured so that the nozzle chamber 106 is rectangular in plan . a plurality of ink inlet channels 120 , one of which is shown in the drawings , are defined through the substrate 32 , the drive circuitry layer 34 and the ink passivation layer 36 . the ink inlet channel 120 is in fluid communication with the nozzle chamber 106 so that ink can be supplied to the nozzle chamber 106 . the nozzle arrangement 100 includes a motion - transmitting structure 122 . the motion - transmitting structure 122 includes an effort formation 124 , a lever arm formation 126 and a load formation 128 . the lever arm formation 126 is interposed between the effort formation 124 and the load formation 128 . the nozzle arrangement 100 includes a sealing structure 130 that is fast with the ink passivation layer 36 . in particular , the sealing structure 130 is composite with a primary layer 132 and a secondary layer 134 . the layers 132 , 134 are configured so that the sealing structure 130 is resiliently deformable to permit pivotal movement of the lever arm formation 126 with respect to the substrate 32 . the layers 132 , 134 can be of a number of materials that are used in integrated circuit fabrication . the applicant has found that titanium aluminum nitride ( tialn ) is a suitable material for the layer 132 and that titanium is a suitable material for the layer 134 . the load formation 128 defines part of the proximal end wall 110 . the load formation 128 is composite with a primary layer 136 and a secondary layer 138 . as with the sealing structure 130 , the layers 136 , 138 can be of any of a number of materials that are used in integrated circuit fabrication . however , as set out above , successive deposition and etching steps are used to fabricate the nozzle arrangement 100 . it follows that it is convenient for the layers 136 , 138 to be of the same material as the layers 132 , 134 . thus , the layers 136 , 138 can be of tialn and titanium , respectively . the nozzle arrangement 100 includes an ink - ejecting member in the form of an elongate rectangular paddle 140 . the paddle 140 is fixed to the load formation 128 and extends towards the distal end wall 108 . further , the paddle 140 is dimensioned to correspond generally with the nozzle chamber 106 . it follows that displacement of the paddle 140 towards and away from the ink ejection port 114 with sufficient energy results in the ejection of an ink drop from the ink ejection port . the manner in which drop ejection is achieved is described in detail in the above referenced patents / applications and is therefore not discussed in any detail here . to facilitate fabrication , the paddle 140 is of tialn . in particular , the paddle 140 is an extension of the layer 136 of the load formation 128 of the motion - transmitting structure 122 . the paddle 140 has corrugations 142 to strengthen the paddle 140 against flexure during operation . the effort formation 124 is also composite with a primary layer 144 and a secondary layer 146 . the layers 144 , 146 can be of any of a number of materials that are used in integrated circuit fabrication . however , as set out above , successive deposition and etching steps are used to fabricate the nozzle arrangement 100 . it follows that it is convenient for the layers 144 , 146 to be of the same material as the layers 132 , 134 . thus , the layers 144 , 146 can be of tialn and titanium , respectively . the nozzle arrangement 100 includes an actuator in the form of a thermal bend actuator 148 . the thermal bend actuator 148 is of a conductive material that is capable of being resistively heated . the conductive material has a coefficient of thermal expansion that is such that , when heated and subsequently cooled , the material is capable of expansion and contraction to an extent sufficient to perform work on a mems scale . the thermal bend actuator 148 can be any of a number of thermal bend actuators described in the above patents / patent applications . in one example , the thermal bend actuator 148 includes an actuator arm 150 that has an active portion 152 and a passive portion . the active portion 152 has a pair of inner legs 154 and the passive portion is defined by a leg positioned on each side of the pair of inner legs 154 . a bridge portion 156 interconnects the active inner legs 154 and the passive legs . each leg 154 is fixed to one of a pair of anchor formations in the form of active anchors 158 that extend from the ink passivation layer 36 . each active anchor 158 is configured so that the legs 154 are electrically connected to the drive circuitry layer 34 . each passive leg is fixed to one of a pair of anchor formations in the form of passive anchors 160 that are electrically isolated from the drive circuitry layer 34 . thus , the legs 154 and the bridge portion 156 are configured so that when a current from the drive circuitry layer 34 is set up in the legs 154 , the actuator arm 150 is subjected to differential heating . in particular , the actuator arm 150 is shaped so that the passive legs are interposed between at least a portion of the legs 154 and the substrate 32 . it will be appreciated that this causes the actuator arm 150 to bend towards the substrate 32 . the bridge portion 156 therefore defines a working end of the actuator 148 . in particular , the bridge portion 156 defines the primary layer 144 of the effort formation 124 . thus , the actuator 148 is of tialn . the applicant has found this material to be well suited for the actuator 148 . the lever arm formation 126 is positioned on , and fast with , the secondary layers 134 , 138 , 146 of the sealing structure 130 , the load formation 128 and the effort formation 124 , respectively . thus , reciprocal movement of the actuator 148 towards and away from the substrate 32 is converted into reciprocal angular displacement of the paddle 140 via the motion - transmitting structure 122 to eject ink drops from the ink ejection port 114 . each active anchor 158 and passive anchor is also composite with a primary layer 160 and a secondary layer 162 . the layers 160 , 162 can be of any of a number of materials that are used in integrated circuit fabrication . however , in order to facilitate fabrication , the layer 160 is of tialn and the layer 162 is of titanium . a cover formation 164 is positioned on the anchors to extend over and to cover the actuator 148 . air chamber walls 166 extend between the ink passivation layer 36 and the cover formation 164 so that the cover formation 164 and the air chamber walls 166 define an air chamber 168 . thus , the actuator 148 and the anchors are positioned in the air chamber 168 . the cover formation 164 , the lever arm formation 126 and the roof 104 are in the form of a unitary protective structure 170 to inhibit damage to the nozzle arrangement 100 . the protective structure 170 can be one of a number of materials that are used in integrated circuit fabrication . the applicant has found that silicon dioxide is particularly useful for this task . it will be appreciated that it is necessary for the lever arm formation 126 to be displaced relative to the cover formation 164 and the roof 104 . it follows that the cover formation 164 and the lever arm formation 126 are demarcated by a slotted opening 172 in fluid communication with the air chamber 168 . the roof 104 and the lever arm formation 126 are demarcated by a slotted opening 174 in fluid communication with the nozzle chamber 106 . the lever arm formation 126 and the roof 104 together define ridges 176 that bound the slotted opening 172 . thus , when the nozzle chamber 106 is filled with ink , the ridges 176 define a fluidic seal during ink ejection . the ridges 176 serve to inhibit ink spreading by providing suitable adhesion surfaces for a meniscus formed by the ink . the slotted openings 172 , 174 demarcate resiliently flexible connectors in the form of a pair of opposed flexural connectors 178 defined by the protective structure 170 . the flexural connectors 178 are configured to experience torsional deformation in order to accommodate pivotal movement of the lever arm formation 126 during operation of the nozzle arrangement 100 . the silicon dioxide of the protective structure 170 is resiliently flexible on a mems scale and is thus suitable for such repetitive distortion . it should be noted that the paddle 140 , the sealing structure 130 and the actuator arm 150 are discrete components . this facilitates fabrication of the nozzle arrangement 100 while still retaining the advantages of efficient motion transfer and sealing .	1
the invention accordingly relates to new formulations for “ hemp ” concretes and mortars , that is , ones including at least one “ component ” ( in the broad sense indicated in the foregoing ) of hemp and / or flax and / or straw such as rinds of oats or rice and / or generally speaking any comparable hydrophilic substance , including optionally a synthetic substance , individually or in a mixture or mixtures , for the sake of simplification referred to in what follows , including the claims , as “ hemp ” concretes or mortars . hence the invention relates to new formulations for “ hemp ” concretes and mortars , that is , ones including at least one component of hemp as specified in the foregoing and technically equivalent components which comprise the conventional ingredients of mortars and concretes except in the respect that the binder is made up , in whole or in part , of rich lime optionally in various combinations of types and forms of lime as indicated in the foregoing , and in that they also comprise ( a ) at least one additive for formation of very fine pores and capillaries the term “ matrix water repellency ” is to be understood here to mean that the mass which encloses the fibers , particles , etc of hemp is subjected to the water repellent action of the additive . it is to be noted that the hemp itself is subject to this action , but without exerting an effect , since the hemp absorbs the water and is not made water - repellent because it contains water ; on the contrary , after elimination of the water , the water repellency exerts its effect and the hemp no longer absorbs water , for example , it absorbs neither moisture nor rain water , etc . this is one of the major advantages of the invention . the term “ formation of very fine pores and capillaries ” is used here to designate formation of a highly complex array whose structure may vary from one formulation to the other but which comprises open and / or closed tubular capillaries , as well as closed microbubbles or microspaces and / or closed microcavities , closed tubes among others , arranged , proportioned , and distributed so that the final concrete or mortar exhibits uniform or more or less uniform characteristics and has no setting or drying defects or uncertain properties , that is , properties of arrangement , proportioning , and distribution such that the matrix water may be evacuated toward the surface during setting and then drying , while after drying external water ( rain ) cannot penetrate the network of capillaries . for the sake of simplification of reading this complex array will be designated in what follows , including the claims , as a “ microcapillary system ”. the expert , who is thoroughly familiar with the problems of setting and drying of hydraulic concretes and mortars and with the characteristics which he must produce in order to formulate a “ good ” concrete or mortar , and who also is familiar with the difficulties and disadvantages of hemp mortars and concretes , will encounter no difficulty in controlling the microcapillary system claimed for the invention , especially on the basis of the percentage of rich lime , in the light of the following description and examples , and in relying on his personal general knowledge , and if necessary on a few routine tests , for the purpose of adaptation to the specific application considered . in one preferred embodiment the additive for formation of the microcapillary system comprises one or more plant and / or mineral colloid . in another preferred embodiment the additive for formation of the microcapillary system is suitable for arriving at a capillarity of the order of 5 to 15 ångströms , preferably 8 to 10 ångströms . in comparison , hemp or flax exhibits a capillarity which is 3 to 5 times greater , while a hydraulic binder yields a capillarity of the order of as much as 10 to 20 times greater . in another preferred embodiment this additive for formation of the microcapillary system is suitable for provision of the microcapillary system in question with closed tubes and / or masses and / or spaces and / or microbubbles and / or microcavities , closed tubes in particular . while not wishing to be bound to any theory , the applicant believes that such closed spaces , closed tubes in particular , are capable ( optionally when combined with open microcapillaries ) of extracting the water contained in the hemp and enabling it to migrate toward the surface in the form of water as liquid and then water vapor , which ultimately is propagated to the exterior . in another , non - restrictive , preferred embodiment the colloids selected are among the plant colloids such as alginates and / or polysaccharides and all derivatives of natural or synthetic starches and / or carragheenates . mention may be made in particular of guar hydroxypropyl ( polysaccharide family ), which has yielded the best results . good results have also been obtained with the carragheenates ( which are products similar to alginates ) and with calcium alginate . on the contrary , the alginates of sodium and magnesium have a tendency to precipitate and are not recommended . other microcapillary system formation additives are to be selected from among the following : in one preferred embodiment such water repellency additive comprises at least one water - repellent agent and one surfactant agent . while not wishing to be bound to any theory , the applicant believes that the surfactant contributes a “ netting ” or “ mesh ” structure which contributes greatly to uniformity of the final product and its properties . in one alternative embodiment use is to be made of a surfactant for a neutral or basic medium and / or a surfactant for an acid medium , and / or appropriate mixtures of these substances , as a function of the anticipated evolution of the ph ( which any expert is familiar with and can evaluate ). in one preferred , non - restrictive , embodiment the surfactant or surfactants selected are among the polysulfonates of calcium , sodium , or magnesium and in particular among the lignosulfonates . in another preferred , non - restrictive , embodiment another surfactant or other surfactants to be selected is / are among the following : in one preferred embodiment the water - repellent agents selected preferably are among the metallic soaps , the maleates , oleates , stearates , and the like of aluminum , magnesium , sodium , lithium , and similar salts , and / or siliconates of sodium and mixtures of such siliconates . in one preferred , non - restrictive , embodiment the water - repellent agent ( s ) selected is / are among the following : in one preferred , non - restrictive , embodiment the additives and agents employed in accordance with the invention are to be employed in the following proportions . a new industrial product is thereby obtained which is characterized in that it consists of mortars and concretes with a hemp binder component comprising rich lime , comprising ( a ) at least one additive for formation of very fine pores and capillaries the setting , mechanical properties , and drying of which are not marked by uncertain behavior . the invention also relates to a new industrial product of the mortar and concrete type with a hemp binder component of rich lime , characterized in that it includes in its mass a microcapillary system which itself comprises tubes and / or masses and / or spaces and / or microcavities , in particular closed tubes capable , especially closed tubes ( optionally combined with open microcapillaries ), of extracting water previously absorbed and contained in the hemp and of enabling it to migrate toward the surface in the form progressively of water and then of water vapor which ultimately spreads outward to the point of drying . this product is also characterized in that its water - repellent matrix renders the dry fibers of the hemp component water repellent , thereby preventing reabsorption of the water by the hemp component . in another alternative this product is characterized in that its global or “ residual ” thermal conductivity coefficient lambda is of the order of 0 . 8 to 0 . 12 , preferably around 0 . 1 . it is to be noted by way of comparison that the thermal conductivity coefficient of a hydraulic concrete or mortar is of the order of 0 . 6 to 1 . 15 , that is , around five to eleven times higher . such products would be products used in the btp ( construction and public works ), ones such as perpends , cutting blocks and blocks of various shapes , bricks , and the like well known to the expert , for the sake of simplification hereinafter referred to as “ perpends ” as well as slabs , wall linings , floors , ceilings , etc , and the like well known to the expert . other characteristics and advantages of the invention will be better understood by reading the following description in conjunction with the attached drawing , in which fig1 , which consists of fig1 a ( left ) and 1 b ( right ) represents a photograph of two samples ( 20 × 30 × 60 cm ) of hemp concrete ; in the figure on the left ( 1 a ): concrete not based on the invention ( comparative test ), made with a mixture of plaster and rich lime ( white area : excessively long drying time and development of mold fungus ) in the figure on the right ( 1 b ): concrete made with a mixture as specified for the invention fig2 presents a scanning electron microscope photograph of a lime mortar on a hemp granulate (× 1 , 000 ). the relationship between hemp ( a ) and hemp ( b ) is clearly shown . the grains of lime are lodged as far as in the interior of the fiber channels of the plant . fig3 presents a scanning electron microscope photograph showing bubbles and microbubbles of air and openings of tubular channels in the lime paste (× 111 ). the porosity of the lime paste is represented by air bubbles and tubular channels which have formed after evaporation of the mixing water . fig4 presents a scanning electron microscope photograph showing a network of air bubbles and tubular channels (× 17 ). the photograph shows with great clarity the complete envelopment achieved in accordance with the invention , an amalgam of tubes , closed tubes ( some of which are visible because they are cut off outside the cut ), spaces or masses , capillaries , and the hemp cuttings . fig5 presents a comparable hemp structure without the lime component . microscopic examination of fig2 to 5 reveals the presence , as claimed for the invention , of a significant capillary network made up of air bubbles and tubular channels . the invention relates to formulations of “ hemp ” concretes and mortars with a binder including lime , as well as to new industrial products consisting of such mortars and concretes , and also to use as additives for “ hemp ” mortars and concretes of the additive for formation of the microcapillary system and / or the water repellency additive , as well as products made by means of such mortars and concretes or formulation or by means of the additive for formation of the microcapillary system and / or the water repellency additive , such as bricks , blocks , perpends , various “ hemp ” elements , and also products for building and public works or individual structures erected by means of such mortars or concretes , additives or products , such as walls , slabs , covers , linings and coatings of floors , ceilings , walls , partitions , and similar structures . the invention also covers all embodiments and all applications which will be immediately comprehensible to the expert upon reading this application , on the basis of his own knowledge and optionally simple routine tests .	8
the static decoder circuit of the present invention shown in fig3 is illustrated below . referring to fig3 symbol t 1 represents a load misfet , and symbols t 2 to t 7 represent driver misfet &# 39 ; s of the n - channel type constituting a nor logic gate circuit . symbol t 9 denotes a load misfet of the n - channel type , and t 10 a driver misfet of the n - channel type ; these two misfet &# 39 ; s constitute a single inverter circuit . symbol t 12 denotes a misfet of the n - channel type to whose gate electrode will be fed output signals , i . e ., address decode signals of the nor logic gate circuit , t 13 an n - channel misfet to whose gate electrode will be fed output signals of the inverter circuit , and t 8 and t 11 designate switching misfet &# 39 ; s each consisting of an n - channel misfet , of which the gate electrodes are connected to a control signal terminal φ such that control signals ( clock pulse signals ) are fed thereto . the control signals will acquire the &# 34 ; h &# 34 ; level ( 5 volts ) and the &# 34 ; l &# 34 ; level ( zero volt ) alternatingly and periodically . during the operating periods , the control signal acquires the &# 34 ; h &# 34 ; level and turns on the power switches t 8 and t 11 . during the stand - by periods , on the other hand , the control signal acquires the &# 34 ; l &# 34 ; level to turn off the power switches t 8 and t 11 . symbol vcc represents a voltage source terminal to which is supplied a voltage source potential of 5 volts . further , symbols a 0 , a 1 , a 2 , a 3 , a 4 and a 5 denote address input terminals to which are supplied address input signals at the &# 34 ; h &# 34 ; level and &# 34 ; l &# 34 ; level . symbol xn represents an output terminal of the static decoder circuit . ( 1 ) stand - by period when the address decoder circuit is selected , i . e ., when the address decode signal at the &# 34 ; h &# 34 ; level is produced at the output terminal xn : the address signals fed to the address input terminals a 0 to a 5 are all at the &# 34 ; l &# 34 ; level . therefore , misfet &# 39 ; s t 2 to t 7 of the nor logic gate circuit are all turned off . on the other hand , the control signal fed to the control signal terminal φ is at the &# 34 ; l &# 34 ; level , whereby the switching misfet &# 39 ; s t 8 and t 11 are turned off . hence , the output point a in the nor logic gate circuit acquires the &# 34 ; h &# 34 ; level through the load misfet t 1 . although the misfet 10 is turned on , the switching misfet t 8 remains in an off state , whereby an output point b in the inverter circuit acquires the &# 34 ; h &# 34 ; level through the load misfet t 9 . consequently , the misfet t 13 is turned on . since the switching misfet t 11 is turned off as mentioned above , a signal at the &# 34 ; l &# 34 ; level is drawn to the output terminal xn . even if the driver misfet t 10 of the inverter circuit is turned on , the switching misfet t 8 remains turned off , and further even if misfet &# 39 ; s t 12 and t 13 are turned on , the switching misfet t 11 remains in an off state , such that no current pass is created between the power supply and ground . the control signal acquires the &# 34 ; h &# 34 ; level , and the switching misfet &# 39 ; s t 8 and t 11 are turned on . therefore , the output point b of the inverter circuit acqures the &# 34 ; l &# 34 ; level , turning off the misfet t 13 . as a result , a signal at the &# 34 ; h &# 34 ; level is drawn to the output terminal xn through the switching misfet t 11 and misfet t 12 . ( 3 ) stand - by period when the address decoder circuit is not selected , i . e ., when an address decode signal at the &# 34 ; l &# 34 ; level is drawn to the output terminal xn : an address signal at the &# 34 ; h &# 34 ; level is fed to at least one address input terminal among the address input terminals a 0 to a 5 . for instance , an address signal at the &# 34 ; h &# 34 ; level is fed to the address input terminal a 3 , and address signals at the &# 34 ; l &# 34 ; level are fed to other address input terminals a 0 , a 1 , a 2 , a 4 and a 5 . therefore , the misfet t 5 is turned on , and misfet &# 39 ; s t 2 , t 3 , t 6 and t 7 are turned off . on the other hand , since a control signal fed to the control signal terminal φ is at the &# 34 ; l &# 34 ; level , the switching misfet &# 39 ; s t 8 and t 11 are turned off . accordingly , the output point a of the nor logic gate circuit acquires the &# 34 ; h &# 34 ; level through the load misfet t 1 . as a result , the misfet t 10 is turned off because the source potential is at the &# 34 ; h &# 34 ; level . misfet &# 39 ; s t 12 and t 13 are turned on . therefore , a signal at the &# 34 ; l &# 34 ; level is drawn to the output terminal xn . it will therefore be understood that even when at least one misfet t 5 is turned on among the misfet &# 39 ; s of the nor logic circuit , the switching misfet t 8 remains off , whereby no current pass is developed between the power supply and ground . it will further be understood that no current pass develops in the inverter stage ( t 9 , t 10 ) and the output stage ( t 11 , t 12 ) because of the same reasons as mentioned in item ( 1 ) above . ( 4 ) operating period when the address decoder circuit is not selected : the control signal acquires the &# 34 ; h &# 34 ; level , turning the switching misfet &# 39 ; s t 8 and t 11 on . therefore , since the misfet t 5 is in a conductive state , a current pass is created for the first time . the output level at the output point a of the nor logic gate circuit is determined by the ratio of the resistance of the load misfet t 1 to the resultant resistance of misfet &# 39 ; s t 5 and t 8 . according to this embodiment , the resistance ratio is so selected that solely misfet &# 39 ; s t 10 and t 12 are rendered on , i . e ., the output level is smaller than a threshold voltage level vth of the misfet &# 39 ; s t 10 and t 12 . consequently , the output at the output point a is at the &# 34 ; l &# 34 ; level . therefore , the misfet &# 39 ; s t 10 and t 12 are turned off . further , the output point b acquires the &# 34 ; h &# 34 ; level through the load misfet t 9 , causing the misfet t 13 to be turned on . as a result , the output at the output terminal xn acquires the &# 34 ; l &# 34 ; level . as will be obvious from the foregoing description , the switching misfet &# 39 ; s t 8 and t 11 in the static decoder circuit of the present invention are turned off during the stand - by periods , thereby to completely interrupt the following current passes : further , the outputs at the output points a and b acquire the &# 34 ; h &# 34 ; level irrespective of the address input signals fed to the address input terminals a 0 to a 5 rendering the misfet t 13 conductive , so that the output terminal xn is always at the &# 34 ; l &# 34 ; level . it is therefore possible to interrupt the current pass through the load misfet &# 39 ; s in the memory array . this will be discussed later in further detail after the memory cell including a portion of the peripheral circuit shown in fig4 used in combination with the decoder circuit of fig3 is illustrated below . referring to fig4 the memory cell ms is composed of resistors r 1 and r 2 , and misfet &# 39 ; s t 1 , t 2 , t 3 and t 4 of the n - channel type . here , polysilicon resistors may be used as resistors r 1 and r 2 . further , misfet &# 39 ; s may be used instead of such resistors . symbols t 5 and t 6 denote load misfet &# 39 ; s , the output terminal xn is an output terminal of the decoder circuit shown in fig3 and dl and dl designate digit wires . in the memory cell ms , either one of the misfet t 3 or t 4 is necessarily turned on and another one is turned off . according to the decoder circuit of the present invention , the output signal at the output terminal xn is always at the &# 34 ; l &# 34 ; level during the stand - by periods , as mentioned earlier . hence , no current pass as indicated by arrow i 1 or i 2 is established in the memory cell . fig5 shows a 4096 - word by 1 bit static memory array made up of the static memory cells ms shown in fig4 . symbols x 0 , x 1 ,- x 63 denote output terminals of a plurality of x - decoder circuits each being made up of the decoder circuit of fig3 and symbols y 0 , y 1 ,- y 63 denote output terminals of a plurality of y - decoder circuits . symbols t 00 , t 01 ,- t 631 represent load misfet &# 39 ; s which are the same as the load misfet &# 39 ; s t 5 and t 6 of fig4 and which are inserted between the digit wires dl0 , dl0 ,- dl63 , dl63 and the power source terminal . ms0000 to ms6363 are each composed of the memory cell ms shown in fig4 . symbols t &# 39 ; 00 , t &# 39 ; 01 ,- t &# 39 ; 631 represent transfer misfet &# 39 ; s connected to their respective digit wires , which receive the outputs of the y - decoder circuits through their gates . in the y - decoder circuits in which no current pass is established in the memory cells , there is no need to employ a decoder circuit shown in fig3 of the present invention . accordingly , the decoder circuit shown in fig1 is used . with the above memory cell array , when the output terminal x 0 selected from the output terminals x 0 to x 63 produces an output signal at the &# 34 ; h &# 34 ; level during the standby period , a current pass develops between the power supply and ground through 64 units of load misfet &# 39 ; s . however , using the decoder circuit of the present invention , the output signal from the output terminal x 0 acquires the &# 34 ; l &# 34 ; level during the stand - by periods , whereby no current pass develops between the power supply and ground through load misfet &# 39 ; s t 00 to t 631 . it will therefore be obvious that the consumption of electric power is remarkably reduced . fig6 shows a layout of the 4096 - word by 1 bit static memory circuit composed of the static memory cell array shown in fig5 and the y - decoder circuits . as mentioned above , according to the present invention , it is possible to completely interrupt the current pass in the decoder circuits and in the static memory cells during the stand - by periods , enabling the consumption of electric power to be reduced . further , comparing the decoder circuit of the present invention shown in fig3 with the conventional decoder circuit shown in fig2 both of which have the same number of elements , it will be understood that the switching misfet t 3 of the present invention can be commonly used when the 4096 - word by 1 bit static memory circuit is constructed . the misfet t 12 for compensating the level of the conventional decoder circuit , however , is not commonly usable because an address decode signal is fed to the gate . consequently , when the decoder circuit of the present invention is applied to the static memory circuit , the number of elements can be greatly reduced as compared with when the conventional decoder circuit shown in fig2 is applied to the static memory circuit . although an embodiment of the present invention was described in the foregoing in conjunction with the drawings , it should be noted that the below - mentioned modifications are also allowable . ( 1 ) when the x - decoder circuits of the 4096 - word by 1 bit static memory array are constructed using the static decoder circuits shown in fig3 the switching transistors t 8 and t 11 shown in fig3 need not be connected to their respective decoder circuits . that is , the switching misfet &# 39 ; s t 8 and t 11 may be used as common switching misfet &# 39 ; s of the x - decoder circuits . here , however , it is desirable to connect the switching misfet t 8 to each of the decoder circuits . this is because , in the x - decoder circuits during operation , 63 units of the decoder circuits are not selected . on the other hand , as mentioned earlier , the level of the output signal of the nor logic gate circuit in the decoder circuit when it is not selected , is determined by the ratio of the resistance of the load misfet t 1 to the resultant resistance of the misfet in the nor logic gate circuit and the switching transistor t 8 . therefore , when the switching misfet t 8 is to be commonly used for a plurality of x - decoder circuits , the resistance of the switching misfet t 8 must be decreased to as great an extent as possible . for this purpose , it is necessary to increase the area of the switching misfet t 8 . this , however , is not desirable because the switching misfet t 8 occupies increased area when it is incorporated in a semiconductor chip . a difficulty in laying out the wiring also arises . the switching misfet t 11 , on the other hand , produces an &# 34 ; h &# 34 ; level signal at the output terminal of a selected decoder circuit only , and is turned on . the switching misfet t 11 can therefore be used as a common switching fet for the decoder circuits . ( 2 ) referring to the static decoder circuit shown in fig3 the switching misfet t 8 commonly utilizes the nor logic gate circuit and the inverter circuit to reduce the number of misfet &# 39 ; s to as great an extent as possible . if necessary , however , another switching misfet may be provided between a terminal of the misfet t 10 and ground . ( 3 ) referring to fig3 further , it is possible to use resistor loads instead of the load misfet &# 39 ; s t 1 and t 9 . while the present invention has been shown in connection with certain specific examples , it will be readily apparent to those skilled in the art that various changes in form and arrangement of parts may be made to suit the specific requirements without departing from the spirit and scope of the present invention .	6
the compounds of the formula i may be prepared as described in the following reaction schemes and discussion . unless otherwise indicated , r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 and r 9 and structural formula i in the reaction schemes and discussion that follow are defined as above . the starting materials used in the procedures of schemes 1 - 5 are either commercially available , known in the art or readily obtainable from known compounds using methods that will be apparent to those skilled in the art . referring to scheme 1 , compound ii is prepared by reaction of 1 , 4 - dibromobenzene with an organolithium reagent , preferably butyl lithium , at a temperature from − 100 ° c . to about 0 ° c ., followed by addition to 2 -( 2 , 5 - dimethylpyrrolyl )- pyridine at a temperature from about about 0 ° c . to about 50 ° c . in an ethereal solvent , preferably diethyl ether , for about 1 to 24 hours . compound iii is prepared by reacting ii with a boronic acid derivative of the formula p - ohc ( ch 2 ) m - 2 ( c 6 h 3 r 1 r 2 ) b ( oh ) 2 in a solvent consisting of an alcohol , preferably ethanol , optionally mixed with water and a halogenated hydrocarbon , at a temperature from about 25 ° c . to about 150 ° c ., for about 1 to 24 hours , using a palladium - based catalyst , either palladium - zero or palladium - two oxidation state , typically with phosphine ligands , preferably tetrakis - triphenylphosphine palladium . compound iv is prepared by reacting iii with tosylmethylisocyanide in the presence of potassium t - butoxide and ethanol , in an ethereal solvent such as 1 , 2 - dimethoxyethane , at a temperature from about − 100 ° c . to about 100 ° c ., for about 1 to 24 hours . compound v is prepared from iv by basic hydrolysis of the nitrile using an alkali metal hydroxide in an aqueous alcohol - based solvent , such as aqueous ethanol , at a temperature from about 25 ° c . to about 125 ° c ., for about 30 minutes to 48 hours . compound vi is prepared from v by dehydrative coupling with ammonia , a primary or secondary amine of the formula r 3 r 4 nh effected by a dehydrating agent such as a carbodiimide , for example , n - ethyl - n -( dimethylaminopropy )- carbodiimide , in a solvent that is a halogenated hydrocarbon or a n , n - dialkylamide , such as dimethylformamide , at a temperature from about 0 ° c . to about 100 ° c ., for about 1 to 48 hours . compound vii is prepared from vi by deblocking using hydroxylamine hydrochloride in an aqueous or alcoholic solvent , preferably aqueous ethanol , at a temperature from about 25 ° c . to about 100 ° c ., for about 1 to 48 hours , and may include deblocking a protecting group such a the t - butoxycarbonyl group by reaction with trifluoroacetic acid or a related polyhalogenated acetic acid or a gaseous hydrogen halide such as hcl , in a halogenated hydrocarbon , ethereal solvent or ethyl acetate , at a temperature from about − 70 ° c . to about 100 ° c ., for about 10 minutes to 24 hours . the final compound in scheme 1 , ib , wherein g = b , is prepared by reduction of vii with borane , a trialkyl borane , alane , or lithium aluminum hydride in an ethereal solvent , such as ethyl ether or tetrahydrofuran , at a temperature from about − 100 ° c . to about 100 ° c ., for about 30 minutes to 24 hours , and optionally using cesium fluoride and an alkali metal or alkaline earth carbonate in an aqueous alcoholic solvent , at a temperature from about 25 ° c . to about 125 ° c . for 1 to 72 hours . referring to scheme 2 , compound viii is prepared from ii by reaction with 3 - pyridyl boronic acid and a palladium catalyst , in either the palladium - zero or palladium - two oxidation state , with ligands typically comprised of trialkyl or triaryl phosphines , such as tetrakis - triphenylphosphine palladium , in an aqueous alcoholic solvent at a temperature from about 25 ° c . to about 125 ° c . for about 1 to 48 hours . compound ix is prepared from viii by alkylation with an alkyl or aralkyl halide or sulfonate , in an ethereal , alcoholic , aqueous alcoholic , or dialkylamine - based solvent , such as dimethylformamide , at a temperature from about 0 ° c . to about 125 ° c . for about 30 minutes to 72 hours , followed by reduction with a borohydride - or aluminum hydride - based reagent , such as sodium borohydride , in an ethereal , alcoholic , or aqueous - alcoholic solvent , typically methanol , at a temperature from about 0 ° c . to about 125 ° c . for about 1 to 72 hours . the final compound in scheme 2 , compound ia - a , where g = a , n = 1 , and q = 0 , is prepared from ix by deblocking with hydroxylamine hydrochloride in an alcoholic or aqueous - alcoholic solvent , typically aqueous ethanol , at a temperature from about 25 ° c . to about 125 ° c . for about 1 to 72 hours . in the process of scheme 2 , the preferred value of y in formulas ix and ia - a is benzyl . compounds of the formula ia - a wherein y is benzyl can be converted into the corresponding compounds wherein y is other than benzyl by debenzylation using hydrogen or ammonium formate in the presence of a noble metal catalyst , such as palladium , in an ethereal , halogenated hydrocarbon , alcoholic , or aqueous alcoholic solvent , at a temperature from 0 ° c . to 100 ° c . for a time from 30 minutes to 24 hours , followed by reductive amination with with an alkyl or aralkyl aldehyde in the presence of a borohydride - based reagent such as sodium cyanoborohydride or sodium triacetoxyborohydride , in an ethereal , halogenated hydrocarbon , alcoholic , or aqueous - alcoholic solvent , at a temperature from 0 ° c . to 100 ° c . for a time from 1 to 72 hours . referring to scheme 3 , compound x is prepared by reductive amination of 2 -( 4 - bromophenylmethyl )- piperidine with benzaldehyde and a borohydride - based reagent such as sodium cyanoborohydride or sodium triacetoxyborohydride , in an ethereal , halogenated hydrocarbon , alcoholic , or aqueous - alcoholic solvent , at a temperature from about 0 ° c . to about 100 ° c . for about 1 to 72 hours . compound xi is prepared from compound x by reaction of compound x with an organolithium reagent , typically butyl lithium , followed by addition of the resulting organolithium reagent to 2 -( 2 , 5 - dimethylpyrrolyl )- pyridine , in an ethereal solvent such as ethyl ether , at a temperature from about − 70 ° c . to about 100 ° c . for about 30 minutes to 48 hours . the final compound in scheme 3 , ia - b , wherein g = a , n = 1 , q = 1 and y is benzyl , is prepared from compound xi by deblocking with hydroxylamine hydrochloride in an alcoholic or aqueous - alcoholic solvent , typically aqueous ethanol , at a temperature from about 25 ° c . to about 125 ° c . for about 1 to 72 hours . compounds of the formula ia - b can be converted into the corresponding compounds wherein y is other than benzyl using the procedure described above for converting compounds of the formula ia - a into the analogous compounds wherein y is other than benzyl . referring to scheme 4 , compound xii is prepared from 6 - bromo - 2 -( 2 , 5 - dimethylpyrrolyl )- pyridine and 4 - formylphenylboronic acid in the presence of a palladium catalyst , in either the palladium - zero or palladium - two oxidation state , with ligands typically comprised of trialkyl or triaryl phosphines , such as tetrakis - triphenylphosphine palladium , in an aqueous alcoholic solvent , at a temperature from about 25 ° c . to about 125 ° c . for about 1 to 48 hours . compound xiii is then prepared from xii by reaction of xii with the enamine of a ketone or aldehyde , typically the morpholine or pyrrolidine enamine , in a aromatic hydrocarbon , hydrocarbon , or halogenated hydrocarbon solvent , preferably toluene , at a temperature from about 25 ° c . to about 150 ° c . for about 1 to 72 hours , followed by an aqueous hydrolysis step , typically with aqueous hydrochloric acid , and then reduction with hydrogen or ammonium formate in the presence of a noble metal catalyst , such as palladium , in an ethereal , halogenated hydrocarbon , alcoholic , or aqueous alcoholic solvent , at a temperature from about 0 ° c . to about 100 ° c . for about 30 minutes to 24 hours . the final compound in scheme 4 , ia , where g = a , q = 1 , x ═ ch , and y ═ nr 3 r 4 , is prepared by reductive amination of compound xiii with ammonia , a primary amine , or a secondary amine in the presence of a borohydride - based reagent such as sodium cyanoborohydride or sodium triacetoxyborohydride , in an ethereal , halogenated hydrocarbon , alcoholic , or aqueous - alcoholic solvent , at a temperature from about 0 ° c . to about 100 ° c . for about 1 to 72 hours , followed by deblocking with hydroxylamine hydrochloride in an alcoholic or aqueous - alcoholic solvent , typically aqueous ethanol , at a temperature from about 25 ° c . to about 125 ° c . for about 1 to 72 hours . referring to scheme 5 , compound xiv is prepared from 3 -( 4 - bromophenyl )- glutaric acid by dehydration with acetic anhydride or a similar dehydrating reagent , followed by reaction with benzylamine in a hydrocarbon , aromatic hydrocarbon , or halogenated hydrocarbon solvent , at a temperature from about 25 ° c . to about 180 ° c . for about 1 to 48 hours , followed by dehydration with acetic anhydride , or a similar dehydrating reagent , at a temperature from about 25 ° c . to about reflux for about 1 to 48 hours . compound xv is prepared by reduction of xiv with borane , borane methyl sulfide , alane , or lithium aluminum hydride in an ethereal or hydrocarbon solvent , at a temperature from about 0 ° c . to about 100 ° c . for about 30 minutes to 48 hours . compound xvi is prepared from compound xv by reaction of compound xv with an organolithium reagent , typically but lithium , followed by addition of the resulting organolithium reagent to 2 -( 2 , 5 - dimethylpyrrolyl )- pyridine , in an ethereal solvent , such as ethyl ether , at a temperature from about − 70 ° c . to about 100 ° c . for about 30 minutes to 48 hours . the final compound in scheme 5 , ia - d , where g = a , y ═ h , q = 0 , and x ═ n , is prepared by debenzylation of compound xvi using hydrogen or ammonium formate in the presence of a noble metal catalyst , such as palladium , in an ethereal , halogenated hydrocarbon , alcoholic , or aqueous alcoholic solvent , at a temperature from 0 ° c . to 100 ° c . for a time from 30 minutes to 24 hours , followed by deblocking with hydroxylamine hydrochloride in an alcoholic or aqueous - alcoholic solvent , typically aqueous ethanol , at a temperature from about 25 ° c . to about 125 ° c . for about 1 to 72 hours . compounds of the formula ia - d , which are prepared using the procedures of scheme 5 , can be converted into the analogous compounds wherein y is alkyl or aralkyl , by reductive amination with an alkyl or aralkyl aldehyde in the presence of a borohydride - based reagent such as sodium cyanoborohydride or sodium triacetoxyborohydride , in an ethereal , halogenated hydrocarbon , alcoholic , or aqueous - alcoholic solvent , at a temperature from 0 ° c . to 100 ° c . for a time from 1 to 72 hours . the preparation of other compounds of the formula i not specifically described in the foregoing experimental section can be accomplished using combinations of the reactions described above that will be apparent to those skilled in the art . in each of the reactions discussed or illustrated above , pressure is not critical unless otherwise indicated . pressures from about 0 . 5 atmospheres to about 5 atmospheres are generally acceptable , and ambient pressure , i . e ., about 1 atmosphere , is preferred as a matter of convenience . the compounds of formulae i (“ the active compounds of this invention ”) which are basic in nature are capable of forming a wide variety of different salts with various inorganic and organic acids . although such salts must be pharmaceutically acceptable for administration to animals , it is often desirable in practice to initially isolate a compound of the formula i from the reaction mixture as a pharmaceutically unacceptable salt and then simply convert the latter back to the free base compound by treatment with an alkaline reagent and subsequently convert the latter free base to a pharmaceutically acceptable acid addition salt . the acid addition salts of the active base compounds of this invention are readily prepared by treating the base compound with a substantially equivalent amount of the chosen mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent , such as methanol or ethanol . upon careful evaporation of the solvent , the desired solid salt is readily obtained . the active compounds of this invention and their pharmaceutically acceptable salts are useful as nos inhibitors i . e ., they possess the ability to inhibit the nos enzyme in mammals , and therefore they are able to function as therapeutic agents in the treatment of the aforementioned disorders and diseases in an afflicted mammal . the active compounds of this invention and their pharmaceutically acceptable salts can be administered via either the oral , parenteral or topical routes . in general , these compounds are most desirably administered in dosages ranging from about 0 . 01 to about 250 mg per day , in single or divided doses ( i , from 1 to 4 doses per day ), although variations will necessarily occur depending upon the species , weight and condition of the subject being treated and the particular route of administration chosen . however , a dosage level that is in the range of about 0 . 07 mg to about 21 mg per kg of body weight per day is most desirably employed . variations may nevertheless occur depending upon the species of animal being treated and its individual response to said medicament , as well as on the type of pharmaceutical formulation chosen and the time period and interval at which such administration is carried out . in some instances , dosage levels below the lower limit of the aforesaid range may be more than adequate , while in other cases still larger doses may be employed without causing any harmful side effect , provided that such larger doses are first divided into several small doses for administration throughout the day . the active compounds of the invention may be administered alone or in combination with pharmaceutically acceptable carriers or diluents by either of the three routes previously indicated , and such administration may be carried out in single or multiple doses . more particularly , the novel therapeutic agents of this invention can be administered in a wide variety of different dosage forms , i . e ., they may be combined with various pharmaceutically acceptable inert carriers in the form of tablets , capsules , lozenges , troches , hard candies , powders , sprays , creams , salves , suppositories , jellies , gels , pastes , lotions , ointments , aqueous suspensions , injectable solutions , elixirs , syrups , and the like . such carriers include solid diluents or fillers , sterile aqueous media and various non - toxic organic solvents , etc . moreover , oral pharmaceutical compositions can be suitably sweetened and / or flavored . in general , the therapeutically - effective compounds of this invention are present in such dosage forms at concentration levels ranging from about 5 . 0 % to about 70 % by weight . for oral administration , tablets containing various excipients such as microcrystallirie cellulose , sodium citrate , calcium carbonate , dicalcium phosphate and glycine may be employed along with various disintegrants such as starch ( and preferably corn , potato or tapioca starch ), alginic acid and certain complex silicates , together with granulation binders like polyvinylpyrrolidone , sucrose , gelatin and acacia . additionally , lubricating agents such as , magnesium stearate , sodium lauryl sulfate and talc are often very useful for tabletting purposes . solid compositions of a similar type may also be employed as fillers in gelatin capsules ; preferred materials in this connection also include lactose or milk sugar as well as high molecular weight polyethylene glycols . when aqueous suspensions and / or elixirs are desired for oral administration , the active ingredient may be combined with various sweetening or flavoring agents , coloring matter or dyes , and , if so desired , emulsifying and / or suspending agents as well , together with such diluents as water , ethanol , propylene glycol , glycerin and various like combinations thereof . for parenteral administration , solutions of an active compound of the present invention in either sesame or peanut oil or in aqueous propylene glycol may be employed . the aqueous solutions should be suitably buffered ( preferably ph greater than 8 ) if necessary and the liquid diluent first rendered isotonic . these aqueous solutions are suitable for intravenous injection purposes . the oily solutions are suitable for intraarticular , intramuscular and subcutaneous injection purposes . the preparation of all these solutions under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art . additionally , it is also possible to administer the active compounds of the present invention topically when treating inflammatory conditions of the skin and this may be done by way of creams , jellies , gels , pastes , patches , ointments and the like , in accordance with standard pharmaceutical practice . the ability of compounds of the formulae i to inhibit nos may be determined using procedures described in the literature . the ability of compounds of the formulae i to inhibit endothelial nos may be determined by using the procedures described by schmidt et al ., in proc . natl . acad . sci . u . s . a ., 88 , pp . 365 - 369 ( 1991 ) and by pollock et al ., in proc . natl . acad . sci . u . s . a ., 88 , pp . 10480 - 10484 ( 1991 ). the ability of compounds of the formulae i to inhibit inducible nos may be determined using the procedures described by schmidt et al ., in proc . natl . acad , sci . u . s . a ., 88 pp . 365 - 369 ( 1991 ) and by garvey et al . in j . biol . chem ., 269 , pp 26669 - 26676 ( 1994 ). the ability of the compounds of the formulae i to inhibit neuronal nos may be determined using the procedure described by bredt and snyder in proc . natl . acad . sci . u . s . a ., 87 , 682 - 685 ( 1990 ). of 100 compounds of the formula i that were tested , all exhibited an ic 50 & lt ; 10 μm for inhibition of either inducible or neuronal nos . the present invention is illustrated by the following examples . it will be understood , however , that the invention is not limited to the specific details of these examples . melting points are uncorrected . proton nuclear magnetic resonance spectra ( 1 h nmr ) and c 13 nuclear magnetic resonance spectra were measured for solutions in deuterochloroform ( cdcl 3 ) or in cd 3 od or cd 3 socd 3 and peak positions are expressed in parts per million ( ppm ) downfield from tetramethylsilane ( tms ). the peak shapes are denoted as follows : s , singlet ; d , doublet ; t , triplet ; q , quartet , m , multiplet , b , broad . to a 100 ml 3 - necked round - bottomed flask equipped with septum and nitrogen ( n 2 ) inlet were added 3 . 54 gram ( g ) ( 15 mmol ) 1 , 4 - dibromobenzene and 15 ml dry ether . the solution was cooled to − 70 ° c ., and 6 . 25 ml ( 10 mmol ) of a 1 . 6 m solution of butyl lithium in tetrahydrofuran added dropwise over 5 minutes . the reaction was stirred 5 minutes at − 70 ° c ., then warmed to room temperature over 15 minutes . to the resulting solution was added a solution of 1 . 72 g ( 10 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- pyridine in 5 ml ether , producing a deep red color , and the reaction stirred 3 hours at room temperature . it was then quenched with aqueous ammonium chloride solution , taken up in ethyl acetate , and washed with aqueous ammonium chloride and brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using hexane / ethyl acetate as eluant to afford 820 mg ( 25 %) of an oil . [ 0086 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 30 ( s , 6h ), 6 . 03 ( s , 2h ), 7 . 20 ( dd , j = 1 , 8 , 1h ), 7 . 64 ( m , 2h ), 7 . 73 ( dd , j = 1 , 8 , 1h ), 7 . 90 ( dt , j = 1 , 8 , 1h ), 8 . 00 ( m , 2h ). [ 0087 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 107 . 2 , 118 . 1 , 120 . 2 , 123 . 9 , 127 . 0 , 128 . 6 , 132 . 0 , 1337 . 3 , 138 . 8 , 151 . 8 , 155 . 7 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 630 mg ( 1 . 93 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 - bromophenyl )- pyridine , 289 mg ( 1 . 93 mmol ) 4 - formyl phenylboronic acid , 817 mg ( 7 . 71 mmol ) sodium carbonate , 112 mg ( 0 . 096 mmol ) tetrakistriphenylphosphine palladium , 9 ml ethanol , and 1 ml water . the mixture was heated at reflux for 14 hours , cooled , poured into water , and extracted into ethyl acetate . the organic layer was washed with brine , dried , and evaporate , and the residue chromatographed on silica gel using 25 % ethyl acetate in hexane as eluant to afford 540 mg ( 80 %) of the product . [ 0091 ] 1 h - nmr ( δ cdcl 3 ): 2 . 23 ( s , 6h ), 5 . 94 ( s , 2h ), 7 . 17 ( δ j = 8 , 1h ), 7 . 74 ( m , 2h ), 7 . 80 ( m , 3h ), 7 . 90 ( t , j = 8 , 1h ), 7 . 96 ( m , 2h ), 8 . 19 ( m , 2h ), 10 . 05 ( s , 1h ). [ 0092 ] 13 c - nmr ( δ cdcl 3 ): 13 . 5 , 107 . 1 , 118 . 4 , 120 . 2 , 127 . 6 , 127 . 7 , 130 . 3 , 138 . 7 , 140 . 5 , 146 . 4 , 156 . 0 , 191 . 9 . to a 100 ml 3n round - bottomed flask equipped with septum and n 2 inlet were added 354 mg ( 3 . 16 mmol ) potassium t - butoxide and 5 ml dry 1 , 2 - dimethoxyethane . the mixture as cooled in a − 60 ° c . bath ( chcl 3 / co 2 ), and a solution of 317 mg ( 1 . 62 mmol ) tosylmethylisocyanide in 5 ml dry 1 , 2 - dimethoxyethane added dropwise . after a few minutes , a solution of 540 mg ( 1 . 53 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 4 - formylphenyl ) phenyl ))- pyridine in 10 ml dry 1 , 2 - dimethoxyethane was added dropwise , and stirring continued at − 60 ° c . for 50 minutes . then 5 ml methanol was added and the reaction warmed and then refluxed for 15 minutes . the reaction was cooled and evaporated , and the residue taken up in water with 0 . 5 ml acetic acid and methylene chloride . the aqueous layer was reextracted with methylene chloride , and the combined organic layer washed with aqueous sodium bicarbonate solution , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using 25 % ethyl acetate in hexane as eluant to afford 220 mg ( 40 %) of the product . [ 0096 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 26 ( s , 6h ), 3 . 78 ( s , 2h ), 5 . 98 ( s , 2h ), 7 . 17 ( δ , j = 8 , 1h ), 7 . 41 ( m , 2h ), 7 . 6 - 7 . 7 ( m , 4h ), 7 . 79 ( δ j = 8 , 1h ), 7 . 89 ( t , j = 8 , 1h ), 8 . 17 ( m , 2h ). [ 0097 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 23 . 3 , 107 . 1 , 118 . 3 , 120 . 0 , 127 . 4 , 127 . 5 , 127 . 8 , 128 . 5 , 128 . 7 , 129 . 3 , 137 . 6 , 138 . 7 , 140 . 3 , 141 . 0 , 151 . 8 , 156 . 3 . a byproduct eluting after the product was characterized as the oxazole , 40 mg ( 7 %): to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 220 mg ( 0 . 606 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 4 -( cyanomethyl ) phenyl ) phenyl ))- pyridine and 7 ml ethanol to form a solution at reflux . a 10 % solution of sodium hydroxide in water was added slowly dropwise at reflux to maintain solution , requiring 30 - 60 minutes for 15 ml ( and a little further ethanol ). refluxing was maintained for a total of 2 . 5 hours . the reaction was cooled to 0 ° c . and the ph adjusted with 6n hydrochloric acid to 1 , and the reaction was extracted into ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated to afford the product as an oil , used directly in the next step . [ 0102 ] 1 h - nmr ( δ cdcl 3 ): 2 . 24 ( s , 6h ), 3 . 70 ( s , 2h ), 5 . 95 ( s , 2h ), 7 . 14 ( 6 j = 8 , 1h ), 7 . 38 ( m , 2h ), 7 . 61 ( m , 2h ), 7 . 68 ( m , 2h ), 7 . 77 ( δj = 8 , 1h ), 7 . 87 ( t , j = 8 , 1h ), 8 . 13 ( m , 2h ). [ 0103 ] 13 c - nmr ( δ . cdcl 3 ): 13 . 5 , 20 . 8 , 107 . 1 , 118 . 4 , 120 . 2 , 127 . 3 , 127 . 4 , 128 . 7 , 129 . 9 , 132 . 9 , 137 . 2 , 138 . 8 , 139 . 5 , 141 . 6 , 151 . 7 , 156 . 4 . to a 100 ml round - bottomed flask equipped with n 2 inlet were added 420 mg ( 1 . 099 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 4 -( carboxymethyl ) phenyl ) phenyl ))- pyridine , 218 mg ( 1 . 099 mmol ) 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 6 - ylamine t - butylcarbamate , 211 mg ( 1 . 099 mmol ) edac , 10 mg hobt , 7 ml dry acetonitrile , and 337 ul ( 2 . 42 mmol ) triethylamine . the reaction was stirred at room temperature for 20 hours evaporated , and the residue chromatographed on silica gel using 5 % methanol in methylene chloride as eluant to afford the product , 280 mg ( 45 %). [ 0107 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 69 ( m , 2h ), 2 . 22 ( s , 6h ), 3 . 4 - 3 . 9 ( multiplets , 7h ), 4 . 97 ( bs , 1h ), 5 . 93 ( s , 2h ), 7 . 12 ( δ , j = 8 , 1h ), 7 . 29 ( m , 2h ), 7 . 57 ( m , 2h ), 7 . 67 ( m , 2h ), 7 . 75 ( δ , j = 8 , 1h ), 7 . 85 ( t , j = 8 , 1h ), 8 . 12 ( m , 2h ). [ 0108 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 28 . 4 , 42 . 0 , 47 . 9 , 48 . 8 , 53 . 5 , 79 . 8 , 107 . 0 118 . 3 , 119 . 9 , 127 . 3 , 127 . 4 , 128 . 7 , 129 . 5 , 134 . 0 , 137 . 2 , 138 . 7 , 138 . 9 , 141 . 6 , 151 . 7 , 156 . 2 , 156 . 4 , 169 . 8 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 280 mg ( 0 . 498 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 4 -( 6 - t - butylcarboxamido - 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 3 - ylcarboxamido ) methyl ) phenyl ) phenyl ))- pyridine , 173 mg ( 2 . 49 mmol ) hydroxylamine hydrochloride , 1 ml water and 5 ml ethanol . the reaction was refluxed 40 hours , an additional 173 mg hydroxylamine hydrochloride and 5 ml ethanol added , and refluxing continued 24 hours . the reaction was cooled , poured into aqueous sodium bicarbonate solution , and extracted with a mixture of ethyl acetate and methanol , due to the limited solubility of the product in ethyl acetate . the organic layer was dried over sodium sulfate and evaporated . the residue was taken up in 6 ml dry methylene chloride and treated with 1 . 5 ml triflurooacetic acid at room temperature for 1 . 5 hours . the reaction was evaporated , taken up in 1 n hydrochloric acid , washed with ethyl acetate , then the ph adjusted to 10 with 1 n sodium hydroxide solution , and extracted with a mixture of ethyl acetate and methanol . the organic layer was dried over sodium sulfate and evaporated to afford 160 mg ( 84 %) of the product as a low - melting solid . [ 0113 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 39 ( bs , 2h ), 1 . 78 ( bs , 1h ), 3 . 2 - 3 . 6 ( multiplets , 2h ), 3 . 41 ( bs , 2h ), 4 . 90 ( bs , 1h ), 6 . 30 ( δ , j = 8 , 1h ), 6 . 83 ( δ , j = 7 . 5 , 1h ), 7 . 06 ( m , 2h ), 7 . 29 ( t , j = 8 , 1h ), 7 . 38 ( m , 2h ), 7 . 44 ( m , 2h ), 7 . 69 ( m , 2h ). [ 0114 ] 13 c - nmr ( δ , cdcl 3 ): 25 . 0 , 25 . 3 , 34 . 9 , 41 . 5 , 107 . 6 , 110 . 7 , 126 . 8 , 127 . 0 , 127 . 1 , 129 . 1 , 133 . 2 , 138 . 5 , 129 . 0 , 140 . 5 , 155 . 3 , 158 . 8 , 170 . 6 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 160 mg ( 0 . 417 mmol ) 3 -{ 2 -[ 4 ′-( 6 - amino - pyridin - 2 - yl )- biphenyl - 4 - yl ]}- 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 6 - ylamine acetamide , 5 ml dry tetrahydrofuran , and 0 . 625 ml of a 2 m solution of borane methyl sulfide in tetrahydrofuran . the reaction was refluxed 12 hours , and additional 0 . 625 ml portion of borane methyl sulfide added along with a few ml tetrahydrofuran , and refluxing continued 12 hours ( due to the limited solubility of the starting material in tetrahydrofuran ). the reaction was cooled and evaporated , and 20 ml ethanol , 1 g . sodium carbonate , and 1 g cesium fluoride added , and the mixture refluxed 14 hours . the reaction was cooled and evaporated , taken up in water and ethyl acetate / methanol , and the organic layer separated , dried over sodium sulfate , and evaporated . the resulting solid , 80 mg ( 52 %) was taken up in methylene chloride / methanol / ether and precipitated with 1 n hcl in ether , then evaporated . the residue was triturated with tetrahydrofuran to afford 48 mg ( 24 %) of a white solid , mp 205 ° c . ( dec . above this point ). [ 0118 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 33 ( bs , 2h ), 1 . 63 ( bs , 1h ), 2 . 60 ( m , 2h ), 2 . 71 ( m , 2h ), 3 . 05 ( m , 2h ), 3 . 59 ( m , 2h ), 4 . 56 ( bs , 2h ), 6 . 42 ( δ , j = 8 , 1h ), 7 . 08 ( δ , j = 7 . 5 , 1h ), 7 . 22 ( m , 2h ), 7 . 4 - 7 . 5 ( m , 3h ), 7 . 61 ( m , 2h ), 7 . 95 ( m , 2h ). [ 0119 ] 13 c - nmr ( 8 , cdcl 3 ): 20 . 9 , 32 . 2 , 34 . 8 , 55 . 0 , 57 . 6 , 107 . 4 , 110 . 9 , 126 . 9 , 127 . 0 , 128 . 9 , 129 . 0 , 136 . 3 , 138 . 3 , 138 . 5 , 139 . 4 , 141 . 0 , 155 . 6 , 158 . 5 . anal . calc &# 39 ; d for c 24 h 26 n 4 . 3hcl . 3h 2 o : c , 53 . 99 ; h , 6 . 61 ; n , 10 . 49 . found : c , 53 . 79 , h , 6 . 46 , n , 8 . 70 . to a 100 ml round - bottomed flask equipped with n 2 inlet were added 176 mg ( 0 . 50 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 4 ′- formylbiphenyl - 4 - yl ))- pyridine ( example 1b ), 105 mg ( 0 . 55 mmol ) 2 - phenylethylpiperazine , 7 ml methanol , 30 ul ( 0 . 50 mmol ) acetic acid , and 38 mg ( 0 . 60 mmol ) sodium cyanoborohydride . the reaction was stirred at room temperature for 12 hours poured into aqueous sodium bicarbonate solution and extracted into ethyl acetate . the organic layer was washed with water and brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methanol / methylene chloride as eluant to afford 190 mg ( 72 %) of an oil . [ 0125 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 26 ( s , 6h ), 2 . 5 - 2 . 7 ( m , 8h ), 2 . 83 ( m , 2h ), 3 . 60 ( s , 2h ), 5 . 97 ( s , 2h ), 7 . 15 ( δ , j = 8 , 1h ), 7 . 2 - 7 . 3 ( m , 5h ), 7 . 44 ( m , 2h ), 7 . 62 ( m , 2h ), 7 . 72 ( m , 2h ), 7 . 79 ( δ , j = 8 , 1h ), 7 . 87 ( t , j = 8 , 1h ), 8 . 16 ( m , 2h ). [ 0126 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 33 . 7 , 53 . 1 , 53 . 2 , 60 . 6 , 62 . 8 , 107 . 0 , 118 . 2 , 119 . 8 , 126 . 1 , 126 . 9 , 127 . 4 , 128 . 4 , 128 . 7 , 128 . 8 , 129 . 8 , 137 . 2 , 137 . 7 , 138 . 6 , 139 . 3 , 140 . 3 , 141 . 9 , 151 . 7 , 156 . 5 . to a 100 ml round - bottomed flask equipped with n2 inlet were added 190 mg ( 0 . 361 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -[ 4 ′-( 4 - phenethyl - piperazin - 1 - ylmethyl )- biphenyl - 4 - yl ]- pyridine , 126 mg ( 1 . 81 mmol ) hydroxylamine hydrochloride , 1 ml water , and 5 ml ethanol . the reaction was heated at reflux for 36 hours followed by treatment with an additional 50 mg hydroxylamine hydrochloride and refluxing for 24 hours . the reaction was cooled , poured into dilute aqueous hydrochloric acid , and washed with ethyl acetate . the aqueous layer was adjusted to ph 10 with 1 n sodium hydroxide solution and extracted with ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated . the residue was converted to the hydrochloride salt using 1 n hcl in ether to afford 110 mg ( 55 %) of a solid , mp 267 - 269 ° c . [ 0130 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 5 - 2 . 7 ( m , 8h ), 2 . 81 ( m , 2h ), 3 . 57 ( s , 2h ), 4 . 66 ( bs , 2h ), 6 . 42 ( δ , j = 8 , 1h ), 7 . 10 ( δ , j = 7 . 5 , 1h ), 7 . 21 ( m , 3h ), 7 . 26 ( m , 2h ), 7 . 41 ( m , 2h ), 7 . 47 ( t , j = 8 , 1h ), 7 . 59 ( m , 2h ), 7 . 66 ( m , 2h ), 8 . 00 ( m , 2h ). [ 0131 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 7 , 53 . 1 , 53 . 2 , 60 . 6 , 62 . 8 , 107 . 2 , 110 . 8 , 126 . 1 , 126 . 9 , 127 . 2 , 127 . 3 , 128 . 4 , 128 . 7 , 129 . 7 , 137 . 4 , 138 . 4 , 139 . 5 , 140 . 4 , 141 . 0 , 155 . 7 , 158 . 4 . anal . calc &# 39 ; d for c 30 h 32 n 4 . 3hcl . { fraction ( 3 / 2 )} h 2 o : c , 61 . 59 ; h , 6 . 55 ; n , 9 . 58 . found : c , 61 . 64 , h , 6 . 31 , n , 9 . 51 . prepared as in example 2 , using 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 6 - ylamine t - butyl carbamate for the reductive amination step ( 2a ) in 67 % yield as an oil : [ 0136 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 46 ( s , 9h ), 1 . 52 ( bs , 2h ), 2 . 26 ( s , 6h ), 2 . 43 and 3 . 11 ( multiplets , 4h ), 2 . 94 ( m , 1h ), 3 . 61 ( s , 2h ), 5 . 97 ( s , 2h ), 7 . 14 ( dd , j = 1 , 8 , 1h ), 7 . 34 ( m , 2h ), 7 . 57 ( m , 2h ), 7 . 70 ( m , 2h ), 7 . 78 ( δ , j = 7 , 1h ), 7 . 87 ( t , j = 8 , 1h ), 8 . 16 ( m , 2h ). [ 0137 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 24 . 6 , 28 . 4 , 30 . 6 , 54 . 2 , 58 . 6 , 107 . 0 , 118 . 2 , 119 . 8 , 126 . 8 , 127 . 1 , 127 . 3 , 127 . 5 , 128 . 7 , 128 . 9 , 132 . 1 , 137 . 1 , 138 . 6 , 138 . 9 , 142 . 0 , 151 . 7 , 156 . 5 . followed by removal of the protecting groups with hydroxylamine hydrochloride in aqueous ethanol ( as in example 2b ) and treatment with trifluoroacetic acid in methylene chloride at room temperature for 3 hours to give overall 65 % yield of the trifluoroacetate salt , triturated with tetrahydrofuran , mp 112 - 119 ° c . : [ 0140 ] 1 h - nmr ( 6 , tfa salt in cdcl 3 ): 2 . 33 ( bs , 2h ), 2 . 99 ( bs , 1h ), 3 . 29 ( m , 2h ), 3 . 70 ( m , 2h ), 4 . 41 ( s , 2h ), 6 . 98 ( δ , j = 8 , 1h ), 7 . 20 ( δ , j = 7 . 5 , 1h ), 7 . 60 ( m , 2h ), 7 . 78 ( m , 2h ), 7 . 88 ( m , 2h ), 7 . 98 ( t , j = 8 , 1h ). [ 0141 ] 13 c - nmr ( 6 , tfa salt in cdcl 3 ): 23 . 7 , 27 . 5 , 57 . 1 , 60 . 1 , 6 . 9 ., 113 . 1 , 113 . 9 , 129 . 9 , 130 . 0 , 130 . 1 , 132 . 7 , 133 . 4 , 133 . 6 , 143 . 5 , 145 . 1 , 146 . 7 , 149 . 1 , 157 . 9 . anal . calc &# 39 ; d for c 23 h 24 n 4 . 3 ( c 2 f 3 o 2 h ) ½h 2 o : c , 49 . 23 ; h , 3 . 99 ; n , 7 . 92 . found : c , 49 . 14 , h , 3 . 90 , n , 7 . 80 . prepared as in example 1b using 3 - tolyl boronic acid as an oil in 39 % yield . [ 0147 ] 1 h - nmr ( δ , cdcl 3 ) 2 . 32 ( s , 6h ), 2 . 49 ( s , 3h ), 6 . 03 ( s , 2h ), 7 . 19 ( dd , j = 1 , 8 , 1h ), 7 . 25 ( m , 1h ), 7 . 41 ( t , j = 7 . 5 , 1h ), 7 . 53 ( m , 2h ), 7 . 77 ( m , 2h ), 7 . 81 ( dd , j = 1 , 8 , 1h ), 7 . 90 ( t , j = 8 , 1h ), 8 . 21 ( m , 2h ). [ 0148 ] 13 c - nmr ( δ , cdcl 3 ) 13 . 6 , 21 . 7 , 107 . 1 , 118 . 3 , 119 . 9 , 124 . 3 , 127 . 0 , 127 . 4 , 127 . 5 , 127 . 9 , 128 . 5 , 128 . 7 , 128 . 8 , 137 . 2 , 138 . 5 , 138 . 7 , 140 . 5 , 142 . 3 , 151 . 8 , 156 . 5 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 200 mg ( 0 . 592 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 3 - tolyl ) phenyl ))- pyridine , 206 mg ( 2 . 96 mmol ) hydroxylamine hydrochloride , 4 ml ethanol and 1 ml water . the reaction was refluxed 36 hours cooled , and poured into dilute aqueous sodium bicarbonate solution and extracted into ethyl acetate . the organic layer was separated , washed with brine , and dried . the residue , as a brown oil , 138 mg ( 90 %), was taken up in 10 ml dry toluene and treated with 116 mg ( 0 . 531 mmol ) n - carbethoxyphthalimide . the resulting solution was refluxed 20 hours cooled and evaporated . the residue was chromatographed on silica gel using hexane / ethyl acetate as eluant to give 130 mg ( 56 % overall ) of an oil . [ 0152 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 40 ( s , 3h ), 7 . 15 ( m , 1h ), 7 . 34 ( m , 2h ), 7 . 42 ( m , 2h ), 7 . 65 ( m , 2h ), 7 . 79 ( m , 3h ), 7 . 92 ( m , 3h ), 8 . 07 ( m , 2h ). [ 0153 ] 13 c - nmr ( δ , cdcl 3 ): 21 . 6 , 119 . 9 , 120 . 1 , 123 . 5 , 123 . 9 , 124 . 2 , 122 . 2 , 122 . 4 , 127 . 5 , 127 . 9 , 128 . 3 , 128 . 7 , 131 . 9 , 133 . 7 , 134 . 2 , 134 . 5 , 135 . 3 , 138 . 4 , 139 . 0 , 157 . 3 , 166 . 8 . to a 100 ml round - bottomed flask equipped with condenser and n2 inlet were added 130 mg ( 0 . 333 mmol ) 2 - phthalimido - 6 -( 4 -( 3 - tolyl ) phenyl ))- pyridine , 59 mg ( 0 . 333 mmol ) n - bromosuccinimide , 10 mg diazo - bis ( 1 - cyanocyclohexane ), and 10 ml carbon tetrachloride . the reaction was refluxed 1 hour an additional 10 mg of diazo - bis ( 1 - cyanocyclohexane ) added , and refluxing continued 1 hour . the reaction was then cooled , filtered and evaporated . the residue was taken up in 10 ml dry acetonitrile and treated with 66 mg ( 0 . 333 mmol ) 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 6 - ylamine and 28 mg ( 0 . 333 mmol ) sodium bicarbonate . the reaction was refluxed 12 hours cooled , and evaporated . the residue was taken up in ethyl acetate and water , and the organic layer separated , washed with brine , dried over sodium sulfate and evaporated . the residue was chromatographed on silica gel using methanol / methylene chloride as eluant to afford 130 mg ( 67 %) of an oil . [ 0158 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 38 ( s , 9h ), 1 . 6 - 1 . 8 ( m , 2h ), 3 . 2 - 3 . 5 ( m , 5h ), 3 . 57 ( m , 2h ), 7 . 15 ( dd , j = 1 , 8 , 1h ), 7 . 2 - 7 . 5 ( m , 4h ), 7 . 65 ( m , 3h ), 7 . 78 ( m , 3h ), 7 . 92 ( m , 2h ), 8 . 05 ( m , 2h ). [ 0159 ] 13 c - nmr ( δ , cdcl 3 ): 28 . 3 , 47 . 6 , 50 . 5 , 54 . 1 , 62 . 1 , 116 . 5 , 118 . 8 , 119 . 9 , 120 . 1 , 123 . 9 , 126 . 5 , 127 . 3 , 127 . 4 , 127 . 5 , 128 . 8 , 129 . 2 , 131 . 8 , 134 . 5 , 136 . 4 , 136 . 8 , 138 . 9 , 155 . 1 , 157 . 2 , 165 . 6 , 166 . 7 , 169 . 6 , 169 . 8 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 130 mg ( 0 . 222 mmol ) 3 -[ 4 ′-( 6 - phthalimido - pyridin - 2 - yl )- biphenyl - 3 - ylmethyl ]- 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 6 - ylamine t - butyl carbamate , 20 ml methanol and 0 . 3 ml hydrazine . the reaction was heated at 50 ° c . for 2 . 5 hours cooled , and evaporated . the residue was taken up in ethyl acetate and washed with 0 . 2 n sodium hydroxide solution , water and brine , dried over sodium sulfate , and evaporated . the residue , 110 mg , was taken up in 6 ml dry methylene chloride and treated with 1 . 5 ml trifluoroacetic acid at room temperature for 2 hours . the reaction was evaporated and taken up in ethyl acetate / 0 . 3 n hydrochloric acid . the aqueous layer was separated , the ph adjusted to 10 with 6 n sodium hydroxide solution , and extracted into ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated . the resulting oil was converted to the hydrochloride using 1 n hcl in ether and triturated with tetrahydrofuran to afford 21 mg ( 20 %) of a solid , mp 184 - 196 ° c . [ 0164 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 37 ( bs , 2h ), 1 . 51 ( bs , 1h ), 2 . 46 and 3 . 02 ( multiplets , 4h ), 3 . 64 ( s , 2h ), 4 . 60 ( bs , 2h ), 6 . 46 ( δ , j = 8 , 1h ), 7 . 13 ( δ , j = 7 . 5 , 1h ), 7 . 2 - 7 . 6 ( m , 5h ), 8 . 00 ( m , 2h ). [ 0165 ] 13 c - nmr ( δ , cdcl 3 ): 14 . 0 , 38 . 7 , 54 . 5 , 59 . 2 , 107 . 1 , 110 . 8 , 115 . 1 , 125 . 7 , 126 . 8 , 127 . 1 , 127 . 3 , 127 . 7 , 128 . 6 , 138 . 3 , 138 . 5 , 139 . 0 , 140 . 6 , 141 . 3 , 155 . 7 , 158 . 3 . prepared as in example 1b , using 3 - nitrophenyl boronic acid as an oil in 66 % yield . [ 0170 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 24 ( s , 6h ), 5 . 96 ( s , 2h ), 7 . 15 ( δ , j = 8 , 1h ), 7 . 54 ( t , j = 8 , 1h ), 7 . 67 ( m , 2h ), 7 . 76 ( m , 1h ), 7 . 88 ( m , 2h ), 8 . 15 ( m , 3h ), 8 . 42 ( bs , 1h ). [ 0171 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 107 . 3 , 118 . 4 , 120 . 2 , 121 . 9 , 123 . 2 , 123 . 4 , 127 . 6 , 128 . 6 , 129 . 9 , 132 . 9 , 138 . 5 , 138 . 9 , 139 . 2 , 141 . 9 , 148 . 7 , 151 . 8 , 155 . 8 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 520 mg ( 1 . 41 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 3 - nitrophenyl ) phenyl ))- pyridine , 445 mg ( 7 . 05 mmol ) ammonium formate , 10 ml ethanol , and 80 mg 10 % palladium on carbon ( a few ml 1 , 2 - dichloroethane added to dissolve the nitro compound ). the reaction was refluxed 40 min , cooled , and filtered with ethanol through celite . the filtrate was evaporated , taken up in ethyl acetate / dilute aqueous sodium hydroxide solution , and the organic layer separated and washed with brine , dried over sodium sulfate , and evaporated to an oil , 400 mg ( 84 %). [ 0175 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 26 ( s , 6h ), 3 . 77 ( bs , 2h ), 5 . 99 ( s , 2h ), 6 . 67 ( m , 1h ), 6 . 92 ( bs , 1h ), 7 . 04 ( m , 1h ), 7 . 14 ( m , 1h ), 7 . 23 ( t , j = 8 , 1h ), 7 . 67 ( m , 2h ), 7 . 75 ( δ , j8 , 1h ), 7 . 84 ( t , j = 8 , 1h ), 8 . 14 ( m , 2h ). [ 0176 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 107 . 0 , 113 . 6 , 114 . 4 , 117 . 3 , 118 . 2 , 119 . 8 , 127 . 1 , 127 . 3 , 128 . 6 , 129 . 7 , 137 . 1 , 138 . 6 , 141 . 4 , 142 . 3 , 147 . 0 , 151 . 6 , 156 . 4 . to a 100 ml round - bottomed flask equipped with n 2 inlet were added 200 mg ( 0 . 590 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 3 - aminophenyl ) phenyl ))- pyridine , 117 mg ( 0 . 590 mmol ) n - t - butoxycarbonylalanine , 113 mg ( 0 . 590 mmol ) edac , 159 mg ( 1 . 30 mmol ) 4 - dimethylaminopyridine , and 10 ml dry acetonitrile . the reaction was stirred at room temperature for 12 hours evaporated , and the residue chromatographed on silica gel using methanol / methylene chloride as eluant to afford 230 mg ( 76 %) of an oil . [ 0180 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 46 ( s , 9h ), 1 . 48 ( δ , j = 7 , 3h ), 2 . 24 ( s , 6h ), 4 . 55 ( m , 1h ), 5 . 62 ( m , 1h ), 5 . 96 ( s , 2h ), 7 . 11 ( δ , j = 8 , 1h ), 7 . 23 ( m , 2h ), 7 . 47 ( m , 1h ), 7 . 57 ( m , 2h ), 7 . 69 ( m , 1h ), 7 . 81 ( m , 2h ), 8 . 05 ( m , 2h ). [ 0181 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 18 . 0 , 28 . 3 , 50 . 9 , 80 . 4 , 106 . 9 , 118 . 2 , 118 . 9 , 119 . 7 , 122 . 6 , 127 . 1 , 127 . 3 , 128 . 6 , 129 . 2 , 137 . 2 , 138 . 5 , 138 . 6 , 140 . 9 , 141 . 4 , 151 . 6 , 156 . 3 , 171 . 8 . to a 100 ml round - bottomed flask equipped with n2 inlet were added 230 mg ( 0 . 451 mmol ) 2 -( t - butylcarbamoylamino )- n -[ 4 ′-( 6 -( 2 , 5 - dimethylpyrrolyl )- pyridin - 2 - yl )- biphenyl - 3 - yl ]- propionamide and 25 ml ethyl acetate . the solution was cooled to 0 ° c . and saturated with hcl , then stirred at 0 ° c . for 30 minutes and 1 hour at room temperature . the resulting precipitate was collected and dissolved in 20 ml methanol , treated with 1 ml water and 157 mg ( 2 . 255 mmol ) hydroxylamine hydrochloride , and refluxed 2 days . the reaction was cooled , evaporated , and taken up in ethyl acetate / dilute hydrochloric acid . the aqueous layer was separated , the ph adjusted to 10 with 6 n sodium hydroxide solution , and extracted with ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated . the oil was taken up in methylene chloride , treated with decolorizing carbon , filtered through celite , and evaporated . the resulting oil ( 90 mg ) was converted to the hydrochloride salt using 1 n hcl in ether to afford a solid , 73 mg ( 40 %), mp & gt ; 215 ° c . ( dec .). [ 0185 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 39 ( δ , j = 7 , 3h ), 3 . 57 ( q , j = 7 , 1h ), 4 . 66 ( bs , 2h ), 6 . 40 ( δ , j = 8 , 1h ), 7 . 05 ( δ , j = 7 . 5 , 1h ), 7 . 34 ( m , 2h ), 7 . 43 ( t , j = 8 , 1h ), 7 . 62 ( m , 4h ), 7 . 93 ( m , 2h ), 9 . 57 ( bs , 1h ). [ 0186 ] 13 c - nmr ( δ , cdcl 3 ): 21 . 5 , 51 . 1 , 107 . 2 , 110 . 7 , 117 . 9 , 118 . 3 , 122 . 6 , 127 . 1 , 127 . 2 , 129 . 3 , 138 . 3 , 138 . 6 , 140 . 6 , 141 . 3 , 155 . 4 , 158 . 3 , 173 . 9 . prepared as in example 5 , using t - butoxycarbonylphenylalanine , with the coupling step proceeding in 58 % yield , and the deblocking in 57 % yield to afford the product as the hydrochloride salt , mp 180 - 200 ° c . ( dec .) [ 0191 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 81 and 3 . 37 ( multiplets , 2h ), 3 . 74 ( dd , j = 4 , 9 , 1h ), 4 . 62 ( bs , 2h ), 6 . 43 ( δ , j = 8 , 1h ), 7 . 10 ( δ , j = 7 . 5 , 1h ), 7 . 2 - 7 . 4 ( m , 8h ), 7 . 47 ( t , j = 8 , 1h ), 7 . 65 ( m , 3h ), 7 . 97 ( m , 2h ), 9 . 53 ( bs , 1h ). [ 0192 ] 13 c - nmr ( δ , cdcl 3 ): 40 . 6 , 56 . 8 , 107 . 2 , 110 . 8 , 118 . 0 , 118 . 5 , 122 . 8 , 126 . 9 , 127 . 0 , 127 . 1 , 127 . 2 , 128 . 8 , 129 . 2 , 129 . 4 , 1137 . 6 , 138 . 1 , 138 . 4 , 138 . 6 , 140 . 7 , 141 . 4 , 155 . 4 , 158 . 2 , 172 . 4 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 271 mg ( 2 . 20 mmol ) 3 - pyridylboronic acid ( rec . trav . chim ., 93 , 21 ( 1974 )), 720 mg ( 2 . 20 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 - bromophenyl )- pyridine , 933 mg ( 8 . 81 mmol ) sodium carbonate , 128 mg ( 0 . 110 mmol ) tetrakistriphenylphosphine palladium , 9 ml ethanol , and 1 ml water . the mixture was refluxed 20 hours 100 mg 3 - pyridiylboronic acid added , and refluxing continued for 2 hours . the reaction was then cooled , poured into water and extracted into ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methanol / methylene chloride as eluant to afford the product as an oil , 350 mg ( 49 %). [ 0197 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 25 ( s , 6h ), 5 . 97 ( s , 2h ), 7 . 12 ( δ , j = 8 , 1h ), 7 . 31 ( dd , j = 5 , 8 , 1h ), 7 . 64 ( m , 2h ), 7 . 74 ( δ , j = 8 , 1h ), 7 . 83 ( m , 2h ), 8 . 16 ( m , 2h ), 8 . 59 ( m , 1h ), 8 . 90 ( m , 1h ). [ 0198 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 107 . 2 , 118 . 3 , 120 . 1 , 123 . 7 , 127 . 4 , 127 . 6 , 128 . 1 , 128 . 6 , 129 . 1 , 134 . 2 , 135 . 9 , 138 . 6 , 138 . 8 , 148 . 2 , 148 . 5 , 128 . 8 , 151 . 8 , 156 . 0 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 350 mg ( 1 . 077 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -[ 4 -( pyrid - 3 - yl )- phenyl ]- pyridine , 10 ml dry acetonitrile , and 128 ul ( 1 . 077 mmol ) benzyl bromide . the reaction was heated at 70 ° c . for 14 hours cooled , evaporated , and the residue taken up in 5 ml ethanol and 4 ml water , and treated with 149 mg ( 2 . 37 mmol ) sodium cyanoborohydride ( a few ml dichloromethane was added to improve solubility ). the reaction was stirred at room temperature for 20 hours poured into dilute aqueous sodium bicarbonate solution , and extracted with ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methanol / methylene chloride as eluant to afford two product fractions : [ 0203 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 26 ( s , 6h ), 2 . 41 ( m , 2h ), 2 . 67 ( m , 2h ), 3 . 45 ( m , 2h ), 3 . 76 ( s , 2h ), 5 . 98 ( s , 2h ), 6 . 28 ( bs , 1h ), 7 . 13 ( δ , j = 8 , 1h ), 7 . 3 - 7 . 5 ( m , 7h ), 7 . 73 ( δ , j = 8 , 1h ), 7 . 85 ( t , j = 8 , 1h ), 8 . 05 ( m , 2h ). [ 0204 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 26 . 6 , 49 . 2 , 54 . 6 , 62 . 9 , 107 . 0 , 118 . 1 , 119 . 7 , 123 . 5 , 125 . 2 , 126 . 9 , 127 . 2 , 128 . 4 , 128 . 7 , 129 . 3 , 134 . 8 , 136 . 9 , 138 . 2 , 138 . 6 , 141 . 1 , 151 . 7 , 156 . 5 . [ 0207 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 82 ( m , 4h ), 2 . 23 ( s , 6h ), 2 . 67 ( m , 1h ), 2 . 9 - 3 . 1 ( m , 4h ), 3 . 66 ( s , 2h ), 5 . 95 ( s , 2h ), 7 . 12 ( δ , j = 8 , 1h ), 7 . 2 - 7 . 5 ( m , 7h ), 7 . 73 ( δ , j = 8 , 1h ), 7 . 86 ( t , j = 8 , 1h ), 8 . 01 ( m , 2h ). [ 0208 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 6 , 25 . 2 , 31 . 3 , 42 . 3 , 53 . 5 , 60 . 3 , 63 . 2 , 107 . 0 , 118 . 2 , 119 . 7 , 127 . 1 , 127 . 6 , 127 . 7 , 128 . 4 , 128 . 5 , 128 . 7 , 129 . 5 , 129 . 9 , 133 . 3 , 136 . 7 , 138 . 7 , 151 . 6 , 156 . 7 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 135 mg ( 0 . 322 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -[ 4 -( 1 - benzyl - 1 , 2 , 5 , 6 - tetrahydro - pyridin - 3 - yl )- phenyl ]- pyridine , 112 mg ( 1 . 61 mmol ) hydroxylamine hydrochloride , 5 ml ethanol , and 1 ml water . the reaction was refluxed 40 hours cooled , and the resulting precipitate , 6 -[ 4 -( 1 - benzyl - 1 , 2 , 5 , 6 - tetrahydro - pyridin - 3 - yl )- phenyl ]- pyridin - 2 - ylamine dihydrochloride , filtered and dried , 22 mg ( 16 . 5 %), mp 270 - 272 ° c . additional material was recovered from the filtrate , 60 mg ( 55 %) of the free base as an oil . [ 0212 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 35 ( m , 2h ), 2 . 64 ( m , 2h ), 3 . 40 ( m , 2h ), 3 . 71 ( s , 2h ), 4 . 58 ( bs , 2h ), 6 . 21 ( bs , 1h ), 6 . 40 ( δ , j = 8 , 1h ), 7 . 04 ( δ , j = 7 . 5 , 1h ), 7 . 2 - 7 . 4 ( m , 7h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 84 ( m , 2h ). [ 0213 ] 13 c - nmr ( δ , cdcl 3 ): 26 . 5 , 49 . 1 , 54 . 6 , 62 . 8 , 107 . 1 , 110 . 7 , 122 . 9 , 125 . 0 , 126 . 7 , 126 . 8 , 127 . 1 , 128 . 3 , 129 . 3 , 134 . 9 , 138 . 1 , 138 . 2 , 138 . 3 , 138 . 4 , 155 . 8 . anal . calc &# 39 ; d for c 23 h 23 n 3 . 2hcl . ½h 2 o : c , 65 . 25 ; h , 6 . 19 ; n , 9 . 92 . found : c , 65 . 62 , h , 6 . 42 , n , 9 . 93 . prepared as in example 7c using the intermediate from example 7b , to afford 50 mg ( 30 %) of a solid , mp 55 - 70 ° c . [ 0218 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 75 ( m , 2h ), 2 . 0 ( m , 2h ), 2 . 62 ( m , 1h ), 2 . 8 - 3 . 0 ( m , 4h ), 3 . 55 ( s , 2h ), 4 . 58 ( bs , 2h ), 6 . 40 ( δ , j = 8 , 1h ), 7 . 05 ( δ , j = 8 , 1h ), 7 . 2 - 7 . 4 ( m , 7h ), 7 . 44 ( t , j = 8 , 1h ), 7 . 82 ( m , 2h ). [ 0219 ] 13 c - nmr ( δ , cdcl 3 ): 25 . 7 , 31 . 7 , 42 . 7 , 53 . 7 , 61 . 0 , 63 . 6 , 106 . 9 , 110 . 7 , 126 . 8 , 127 . 0 , 127 . 5 , 128 . 2 , 128 . 3 , 129 . 2 , 129 . 3 , 133 . 8 , 137 . 8 , 138 . 3 , 145 . 7 , 156 . 1 , 158 . 3 . to a 100 ml round - bottomed flask equipped with n 2 inlet were added 250 mg ( 0 . 984 mmol ) 2 -( 4 - bromobenzyl )- piperidine ( prepared as described in tetrahedron letters , 7 , 631 ( 1977 )), 110 ul ( 1 . 08 mmol ) benzaldehyde , 7 ml methanol , 74 mg ( 1 . 18 mmol ) sodium cyanoborohydride , and a few drops of acetic acid . the reaction was stirred at room temperature , followed by additional benzaldehyde , sodium cyanoborohydride , and acetic acid , for a total of 16 hours then poured into dilute aqueous sodium bicarbonate solution , and extracted into ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methanol / methylene chloride as eluant , and the product further purified by conversion to the hydrochloride salt in ether followed by basification using aqueous sodium hydroxide solution to afford 175 mg ( 52 %) of an oil . [ 0224 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 29 ( m , 2h ), 1 . 53 ( m , 3h ), 1 . 6 ( m , 1h ), 2 . 26 and 2 . 79 ( multiplets , 2h ), 2 . 60 ( m , 2h ), 3 . 15 ( dd , j = 3 , 12 , 1h ), 3 . 77 ( ab q , j = 13 . 5 , dn = 41 , 2h ), 7 . 00 ( m , 1h ), 7 . 2 - 7 . 4 ( m , 8h ). [ 0225 ] 13 c - nmr ( δ , cdcl 3 ): 22 . 4 , 24 . 9 , 28 . 9 , 36 . 0 , 51 . 0 , 58 . 2 , 61 . 5 , 127 . 0 , 127 . 2 , 127 . 6 , 128 . 3 , 128 . 5 , 129 . 2 , 131 . 1 , 131 . 4 , 139 . 0 , 140 . 9 . to a 100 ml 3n round - bottomed flask equipped with septum and n 2 inlet were added 175 mg ( 0 . 509 mmol ) n - benzyl - 2 -( 4 - bromobenzyl )- piperidine and 7 ml dry ether . the solution was cooled to − 70 ° c ., and 0 . 38 ml ( 0 . 610 mmol ) of a 1 . 6 m solution of butyl lithium in hexane added dropwise over 1 minutes . the reaction was stirred at − 70 ° c . for 5 min , then warmed to room temperature over 20 minutes . to the stirring reaction was then added a solution of 105 mg ( 0 . 610 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- pyridine in 5 ml dry ether , and the reaction , turning dark orange , was stirred at room temperature for 4 hours then quenched with aqueous ammonium chloride solution . after extraction into ethyl acetate , the organic layer was washed with brine , dried over sodium sulfate for 16 hours to effect air - oxidation to the pyridine , and evaporated . the residue was chromatographed on silica gel using methanol / methylene chloride as eluant to afford 36 mg ( 16 %) of an oil . [ 0229 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 30 ( m , 2h ), 1 . 55 ( m , 3h ), 1 . 64 ( m , 1h ), 2 . 22 ( s , 6h ), 2 . 6 - 2 . 9 ( m , 4h ), 3 . 11 and 3 . 25 ( multiplets , 1h ), 3 . 54 and 4 . 07 ( multiplets , 2h ), 5 . 93 ( s , 2h ), 7 . 01 ( 6 , j = 8 , 1h ), 7 . 2 - 7 . 4 ( m , 7h ), 7 . 72 ( δ , j = 8 , 1h ), 7 . 85 ( t , j = 8 , 1h ), 7 . 98 ( m , 2h ). [ 0230 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 22 . 3 , 25 . 0 , 29 . 0 , 50 . 8 , 58 . 2 , 61 . 5 , 65 . 2 , 106 . 9 , 118 . 1 , 119 . 6 , 126 . 9 , 127 . 0 , 127 . 6 , 128 . 3 , 128 . 5 , 128 . 7 , 129 . 0 , 129 . 1 , 129 . 8 , 131 . 1 , 131 . 3 , 138 . 5 , 141 . 5 , 155 . 5 , 157 . 0 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 36 mg ( 0 . 0827 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -[ 4 -( 1 - benzyl - piperidin - 2 - ylmethyl )- phenyl ]- pyridine , 29 mg . ( 0 . 414 mmol ) hydroxylamine hydrochloride , 4 - ml ethanol and 1 ml water . the reaction was refluxed 84 h ( additional hydroxylamine hydrochloride was used to complete the reaction ), cooled , poured into dilute hydrochloric acid , and washed with ethyl acetate . the aqueous layer was adjusted to ph 10 with 6 n sodium hydroxide solution and extracted with ethyl acetate . the organic layer was washed with brine , dried over sodium sulfate , and evaporated . the resulting oil was converted to the hydrochloride salt using 1 n hcl in ether to afford a solid , 17 mg ( 48 %), mp 70 - 85 ° c . [ 0234 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 32 ( m , 2h ), 1 . 52 ( m , 3h ), 1 . 63 ( m , 1h ), 2 . 6 - 2 . 8 ( m , 2h ), 3 . 21 ( m , 1h ), 3 . 53 ( m , 2h ), 4 . 08 ( m , 2h ), 4 . 50 ( bs , 2h ), 6 . 42 ( δ , j = 8 , 1h ), 7 . 05 ( δ , j = 7 . 5 , 1h ), 7 . 2 - 7 . 4 ( m , 7h ), 7 . 47 ( t , j = 8 , 1h ), 7 . 81 ( m , 2h ). [ 0235 ] 13 c - nmr ( δ , cdcl 3 ): 22 . 4 , 23 . 8 , 25 . 3 , 36 . 2 , 38 . 7 , 50 . 9 , 61 . 8 , 106 . 8 , 110 . 8 , 126 . 7 , 126 . 8 , 128 . 2 , 128 . 8 , 128 . 9 , 129 . 0 , 129 . 6 , 131 . 1 , 131 . 3 , 138 . 3 , 141 . 0 , 156 . 2 , 158 . 6 . anal . calc &# 39 ; d for c 24 h 27 n 3 . 2hcl . 3h 2 o : c , 59 . 50 ; h , 7 . 28 ; n , 8 . 67 . found : c , 59 . 54 , h , 6 . 98 , n , 7 . 32 . prepared as in example 9 , using diphenylacetaldehyde in the step analogous to 9a , 59 % yield , followed by a 33 % yield in the organolithium addition , and a 31 % yield in the deblocking to afford the product as the dihydrochloride salt , mp 168 - 180 ° c . [ 0240 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 4 - 1 . 7 ( m , 6h ), 2 . 4 - 3 . 4 ( series of multiplets , 8h ), 4 . 49 ( bs , 2h ), 6 . 43 ( δ , j = 8 , 1h ), 7 . 04 ( δ , j = 7 . 5 , 1h ), 7 . 11 ( m , 2h ), 7 . 2 - 7 . 4 ( m , 10h ), 7 . 47 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0241 ] 13 c - nmr ( δ , cdcl 3 ): 23 . 0 , 23 . 8 , 29 . 7 , 38 . 7 , 49 . 5 , 50 . 5 , 59 . 6 , 61 . 6 , 106 . 8 , 110 . 8 , 126 . 2 , 126 . 7 , 128 . 3 , 129 . 5 , 130 . 9 , 138 . 4 , 141 . 9 , 144 . 0 , 156 . 0 , 158 . 2 . to a 100 ml round - bottomed flask equipped with dean - stark trap topped with a condenser and n 2 inlet were added 552 mg ( 2 . 0 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 - formylphenyl )- pyridine , 20 ml benzene , 0 . 384 ml ( 2 . 4 mmol ) 4 - morpholino - 1 - cyclohexene , and 10 mg camphorsulfonic acid . the solution was refluxed with removal of water for 13 hours cooled , and 25 ml 3n hydrochloric acid added . the mixture was stirred at room temperature for 1 hour then diluted with ethyl acetate and water . the organic layer was separated , washed with aqueous sodium bicarbonate solution and brine , dried over sodium sulfate , and evaporated . the crude oil solidified on standing , 460 mg (− 100 %), and was used directly in the next step . [ 0246 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 95 ( m , 2h ), 2 . 195 ( s , 6h ), 2 . 33 ( t , j = 8 , 2h ), 2 . 91 ( m , 2h ), 5 . 91 ( s , 2h ), 7 . 09 ( δ , j = 8 , 1h ), 7 . 36 ( bs , 1h ), 7 . 55 ( m , 2h ), 7 . 71 ( δ , j = 8 , 1h ), 7 . 81 ( t , j = 8 , 1h ), 8 . 07 ( m , 2h ). [ 0247 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 20 . 0 , 29 . 3 , 37 . 6 , 107 . 1 , 118 . 4 , 120 . 1 , 127 . 0 , 128 . 2 , 128 . 1 , 130 . 8 , 131 . 2 , 136 . 4 , 136 . 7 , 138 . 8 , 151 . 7 , 155 . 6 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added the crude material from above ( 2 mmol ) and 4 ml 1 , 2 - dichloroethane . after dissolution , 25 ml ethanol was added , followed by 631 mg ( 10 mmol ) ammonium formate and 100 mg 10 % palladium - on - carbon . the mixture was refluxed 1 hours then treated with additional ammonium formate and palladium - on - carbon ( pd — c ) and refluxed for 1 hour . the reaction was then cooled and filtered through celite with ethanol and methylene chloride . the filtrate was evaporated , taken up in ethyl acetate and aqueous sodium bicarbonate solution , the organic layer separated , washed with brine , dried over sodium sulfate and evaporated . the residue was chromatographed on silica gel using ethyl acetate / hexane as eluant to afford 410 mg ( 60 % overall ) of a foam . [ 0251 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 56 ( m , 1h ), 1 . 70 ( m , 1h ), 1 . 93 ( m , 1h ), 2 . 06 ( m , 2h ), 2 . 24 ( s , 6h ), 2 . 29 ( m , 1h ), 2 . 36 ( m , 1h ), 2 . 61 ( m , 1h ), 3 . 19 ( dd , j = 4 , 14 , 1h ), 5 . 95 ( s , 2h ), 7 . 10 ( 6 , j = 8 , 1h ), 7 . 27 ( m , 2h ), 7 . 71 ( δ , j = 8 , 1h ), 7 . 83 ( t , j = 8 , 1h ), 8 . 01 ( m , 2h ). [ 0252 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 20 . 5 29 . 0 , 35 . 3 , 38 . 1 , 50 . 8 , 107 . 0 , 118 . 1 , 119 . 6 , 126 . 9 , 128 . 5 , 129 . 3 , 136 . 3 , 138 . 7 , 141 . 5 , 151 . 6 , 156 . 6 . c . 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -[ 3 -( 2 - dimethylamino - cyclopentylmethyl )- phenyl ]- pyridine to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 205 mg ( 0 . 596 mmol ) 2 -( 4 -(( 2 -( 2 , 5 - dimethylpyrrolyl ))- pyrid - 6 - yl ) benzyl ) cyclopentanone , 10 ml methanol , 486 mg ( 5 . 96 mmol ) dimethylamine hydrochloride , 45 mg ( 0 . 715 mmol ) sodium cyanoborohydride , and 41 ul ( 0 . 715 mmol ) acetic acid . the reaction was heated at 50 ° c . for 40 hours , cooled , and poured into aqueous sodium bicarbonate solution . the mixture was extracted with ethyl acetate , and the organic layer washed with brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methanol / methylene chloride ( with a small amount of triethylamine ) as eluant to afford both diastereomers as an oil [ 0257 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 51 ( m , 2h ), 1 . 63 ( m , 2h ), − 186 ( m , 2h ), δ2 . 22 ( s , 6h ), 2 . 28 ( m , 3h ), 2 . 33 ( s , 6h ), 2 . 99 ( m , 1h ), 5 . 93 ( s , 2h ), 7 . 10 ( δ , j = 8 , 1h ), 7 . 27 ( m , 2h ), 7 . 71 ( δ , j = 8 , 1h ), 7 . 83 ( t , j = 8 , 1h ), 7 . 99 ( m , 2h ). [ 0258 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 4 , 20 . 3 , 27 . 3 , 28 . 2 , 32 . 4 , 42 . 8 , 45 . 3 , 71 . 8 , 106 . 8 , 118 . 0 , 119 . 4 , 126 . 7 , 128 . 6 , 129 . 4 , 135 . 7 , 138 . 4 , 143 . 8 , 151 . 5 , 156 . 8 . [ 0261 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 5 - 1 . 8 ( m , 6h ), 2 . 20 ( s , 6h ), 2 . 32 ( s , 6h ), 2 . 45 ( dd , j = 10 , 14 , 1h ), 2 . 60 ( m , 2h ), 2 . 95 ( dd , j = 5 , 13 . 5 , 1h ), 5 . 91 ( s , 2h ), 7 . 10 ( δ , j = 8 , 1h ), 7 . 27 ( m , 2h ), 7 . 71 ( δ , j = 8 , 1h ), 7 . 84 ( t , j = 8 , 1h ), 7 . 97 ( m , 2h ). [ 0262 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 4 , 23 . 5 27 . 5 , 30 . 85 , 41 . 0 , 42 . 3 , 43 . 3 , 72 . 1 , 106 . 8 , 118 . 0 , 119 . 5 , 126 . 8 , 128 . 6 , 129 . 4 , 136 . 0 , 138 . 4 , 142 . 7 , 151 . 5 , 156 . 7 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 140 mg ( 0 . 375 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -[ 3 -( 2 - dimethylamino - cyclopentylmethyl )- phenyl ]- pyridine , 9 ml ethanol , 1 ml water , and 261 mg ( 3 . 75 mmol ) hydroxylamine hydrochloride . the reaction was refluxed 24 hours treated with additional hydroxylamine hydrochloride , and refluxed a further 12 hours . it was then cooled , poured into dilute aqueous hydrochloric acid , and washed with ethyl acetate . the aqueous layer was adjusted to ph 10 with 6n sodium hydroxide solution , and extracted with two portions of ethyl acetate . the combined organic layer was washed with brine , dried over sodium sulfate , and evaporated . the resulting oil ( 109 mg , 98 . 5 %) was converted to the hydrochloride salt using 1n hcl in ether to afford 115 mg ( 83 %) of a white solid , mp 60 - 80 ° c . [ 0266 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 49 ( m , 2h ), 1 . 58 ( m , 2h ), 1 . 82 ( m , 2h ), 2 . 23 ( m , 2h ), 2 . 29 ( s , 6h ), 2 . 3 ( m , 1h ), 2 . 94 ( δ , j = 9 . 6 , 1h ), 4 . 57 ( bs , 2h ), 6 . 38 ( δ , j = 8 , 1h ), 7 . 02 ( δ , j = 8 , 1h ), 7 . 20 ( m , 2h ), 7 . 43 ( t , j = 8 , 1h ), 7 . 80 ( m , 2h ). [ 0267 ] 13 c - nmr ( δ , cdcl 3 ): 20 . 3 , 27 . 3 , 28 . 2 , 32 . 3 , 42 . 8 , 45 . 3 , 71 . 9 , 106 . 7 , 110 . 6 , 126 . 6 , 129 . 2 , 137 . 1 , 138 . 2 , 142 . 8 , 156 . 2 , 158 . 2 . prepared as in example 11 , using n - methylpiperazine , to afford a 64 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 212 - 224 ° c . [ 0271 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 44 ( m , 2h ), 1 . 51 ( m , 2h ), 1 . 7 - 1 . 8 ( m , 2h ), 2 . 21 ( m , 2h ), 2 . 25 ( s , 6h ), 2 . 3 ( m , 1h ), 2 . 4 - 2 . 6 ( ml 8h ), 2 . 88 ( m , 1h ), 4 . 60 ( bs , 2h ), 6 . 34 ( δ , j = 8 , 1h ), 6 . 99 ( 6 , j = 8 , 1h ), 7 . 16 ( m , 2h ), 7 . 40 ( t , j = 8 , 1h ), 7 . 77 ( m , 2h ). [ 0272 ] 13 c - nmr ( δ , cdcl 3 ): 20 . 1 , 27 . 3 , 27 . 4 , 32 . 5 , 42 . 1 , 46 . 0 , 52 . 7 , 55 . 1 , 70 . 0 , 106 . 7 , 110 . 5 , 126 . 6 , 129 . 1 , 137 . 0 , 138 . 2 , 142 . 8 , 156 . 1 , 158 . 2 . to a 250 ml round - bottomed flask equipped with condenser and n 2 inlet were added 4 . 77 g ( 17 . 72 mmol ) 3 -( 4 - bromophenyl ) glutaric anhydride ( prepared as described in j . org . chem ., 21 , 704 ( 1956 )), 1 . 90 g ( 17 . 72 mmol ) benzylamine , and 80 ml toluene . the reaction was refluxed 1 . 5 hours cooled , and concentrated . the residue was taken up in 80 ml acetic anhydride , and heated at 100 ° c . for 16 hours then cooled and evaporated several times with toluene to remove excess acetic anhydride . the residue was dissolved in 80 ml dry tetrahydrofuran and treated with 40 ml ( 80 mmol ) of a 2 n solution of borane methyl sulfide in tetrahydrofuran . the reaction was refluxed 18 hours cooled , and evaporated , then dissolved in 80 ml ethanol and treated with 3 . 5 g sodium carbonate and 3 . 5 g cesium fluoride . the reaction was refluxed 16 hours cooled , and concentrated . the residue was taken up in water and ethyl acetate . the organic layer was separated , washed with brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using ethyl acetate / hexane as eluant to afford 2 . 94 g ( 50 %) of an oil . [ 0277 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 78 ( m , 4h ), 2 . 08 ( m , 2h ), 2 . 47 ( m , 1h ), 3 . 02 ( m , 2h ), 3 . 56 ( s , 2h ), 7 . 10 ( d , j = 8 , 1h ), 7 . 2 - 7 . 4 ( m , 5h ), 7 . 41 ( d , j = 8 , 2h ). [ 0278 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 4 , 42 . 2 , 54 . 1 , 63 . 5 , 119 . 7 , 127 . 0 , 128 . 2 , 128 . 7 , 129 . 2 , 131 . 4 , 138 . 4 , 145 . 5 . ms (%): 328 / 330 ( parent , br 79 / br 81 , { fraction ( 15 / 19 )}), 91 ( 100 ). to a 125 ml three - necked round - bottomed flask equipped with septum and n 2 inlet were added 2 . 93 g ( 8 . 88 mmol ) n - benzyl - 4 -( 4 - bromophenyl ) piperidine and 30 ml dry ether . the solution was cooled to − 70 ° c ., and 6 . 66 ml ( 10 . 65 mmol ) of a 1 . 6 n solution of butyl lithium in hexane added dropwise over 5 minutes . after stirring a further 5 minutes at − 70 ° c ., the solution was warmed slowly to room temperature over 25 minutes . a solution of 1 . 83 g ( 10 . 65 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl ) pyridine in 10 ml dry ether was then added dropwise over 5 minutes , and the reaction , which turned slowly dark red , stirred at room temperature for 3 hours . the reaction was quenched with aqueous ammonium chloride solution , partitioned between ethyl acetate and water , and the organic layer separated , washed with brine , and dried over sodium sulfate , allowing it to stand overnight to effect rearomatization of the pyridine ring . after evaporation of the solvent , the residue was chromatographed on silica gel using ethyl acetate / hexane followed by methanol / methylene chloride as eluant to afford 1 . 21 g ( 32 %) of an oil . [ 0282 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 86 ( m , 4h ), 2 . 16 ( m , 2h ), 2 . 23 ( s , 6h ), 2 . 58 ( m , 1h ), 3 . 05 ( m , 2h ), 3 . 59 ( s , 2h ), 5 . 95 ( s , 2h ), 7 . 12 ( d , j = 8 , 1h ), 7 . 2 - 7 . 4 ( m , 7h ), 7 . 73 ( d , j = 7 , 1h ), 7 . 85 ( t , j = 8 , 1h ), 8 . 03 ( m , 2h ). [ 0283 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 33 . 4 , 42 . 5 , 54 . 2 , 63 . 5 , 106 . 9 , 118 . 1 , 119 . 6 , 127 . 1 , 127 . 3 , 128 . 2 , 128 . 7 , 129 . 3 , 131 . 4 , 136 . 3 , 138 . 3 , 138 . 5 , 148 . 0 , 151 . 7 , 156 . 8 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 1 . 21 g ( 2 . 87 mmol ) n - benzyl - 4 -( 4 -( 2 -( 2 , 5 - dimethylpyrrolyl ) pyrid - 6 - yl ) phenyl ) piperidine , 30 ml ethanol , 0 . 90 g ( 14 . 37 mmol ) ammonium formate , and 140 mg 10 % palladium - on - carbon ( pd — c ). the reaction was refluxed 1 hour treated with additional ammonium formate and pd — c , and refluxed 3 hours . it was then cooled and filtered through celite with ethanol and methylene chloride . the filtrate was evaporated , taken up in ethyl acetate and aqueous sodium bicarbonate solution , and the organic layer separated , washed with brine , dried over sodium sulfate , and evaporated to afford 734 mg ( 77 %) of an oil . [ 0287 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 80 ( m , 4h ), 2 . 20 ( s , 6h ), 2 . 69 ( m , 1h ), 2 . 78 ( m , 2h ), 3 . 23 ( m , 2h ), 3 . 68 ( bs , 1h ), 5 . 92 ( s , 2h ), 7 . 10 ( d , j = 8 , 1h ), 7 . 32 ( m , 2h ), 7 . 71 ( d , j = 8 , 1h ), 7 . 84 ( t , j = 8 , 1h ), 8 . 01 ( m , 2h ). [ 0288 ] 13 c - nmr ( 8 , cdcl 3 ): 13 . 5 , 33 . 7 , 42 . 5 , 46 . 7 , 106 . 9 , 118 . 1 , 119 . 6 , 127 . 2 , 128 . 5 , 128 . 7 , 136 . 4 , 138 . 5 , 147 . 7 , 151 . 7 , 156 . 8 . to a 100 ml round - bottomed flask equipped with condenser and n 2 inlet were added 100 mg ( 0 . 302 mmol ) 4 -( 4 -( 2 -( 2 , 5 - dimethylpyrrolyl ) pyrid - 6 - yl ) phenyl ) piperidine , 10 ml ethanol , 1 ml water , and 417 mg ( 6 . 04 mmol ) hydroxylamine hydrochloride . the reaction was refluxed 20 hours cooled , and poured into dilute aqueous hydrochloric acid , then washed with ethyl acetate . the aqueous layer was adjusted to ph 10 with 6 n sodium hydroxide solution and extracted twice with ethyl acetate . the combined organic layer was washed with brine , dried over sodium sulfate , and evaporated . the resulting oil ( 77 mg , 100 %) was converted to the hydrochloride salt using hcl in , ether to afford a tan solid , 32 mg ( 32 %), mp dec . above 150 ° c . [ 0292 ] 1 h - nmr ( 5 , cdcl 3 ): 1 . 63 ( m , 2h ), 1 . 80 ( m , 2h ), 2 . 60 ( m , 1h ), 2 . 68 ( m , 2h ), 3 . 14 ( m , 2h ), 4 . 68 ( bs , 2h ), 6 . 36 ( d , j = 8 , 1h ), 6 . 97 ( d , j = 7 . 5 , 1h ), 7 . 22 ( m , 2h ), 7 . 41 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0293 ] 13 c - nmr ( δ , cdcl 3 ): 34 . 1 , 42 . 5 , 46 . 8 , 106 . 9 , 110 . 5 , 126 . 9 , 128 . 3 , 137 . 6 , 138 . 2 , 147 . 0 , 155 . 9 , 158 . 3 . prepared as in example 11 , using cyclohexylamine , to afford a 76 % yield of the less polar isomer after separation of isomers , assigned the cis stereochemistry , as the hydrochloride salt , mp 198 - 205 ° c . [ 0297 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 0 - 1 . 9 ( m , 16h ), 2 . 21 ( m , 1h ), 2 . 34 ( m , 1h ), 2 . 45 ( m , 1h ), 2 . 82 ( dd , j = 5 , 13 , 1h , assigned cis stereochemistry ), 3 . 21 ( m , 1h ), 4 . 52 ( broad s , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 04 ( d , j = 8 , 1h ), 7 . 23 ( m , 2h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 81 ( m , 2h ). [ 0298 ] 13 c - nmr ( δ , cdcl 3 ): 20 . 6 , 25 . 2 , 26 . 1 , 28 . 3 , 31 . 1 , 33 . 9 , 34 . 1 , 43 . 8 , 54 . 9 , 58 . 3 , 106 . 7 , 110 . 6 , 126 . 6 , 129 . 1 , 137 . 0 , 138 . 2 , 142 . 7 , 156 . 2 , 158 . 1 . anal . calc &# 39 ; d . for c 23 h 31 n 3 . 2hcl . h 2 o : c , 62 . 72 ; h , 8 . 01 ; n , 9 . 54 . found : c , 62 . 66 , h , 8 . 12 , n , 8 . 83 . prepared as in example 11 , using cyclohexylamine , to afford a 85 % yield of the more polar isomer after separation of isomers , assigned the trans stereochemistry , as the hydrochloride salt , mp 175 - 185 ° c . [ 0303 ] 1 h - nmr ( δ , cdcl 3 ): 0 . 9 - 1 . 4 ( m , 6h ), 1 . 5 - 2 . 0 ( m , 11h ), 2 . 33 ( m , 1h ), 2 . 52 ( dd , j = 8 . 5 , 13 , 1h assigned trans stereochemistry ), 2 . 81 ( m , 2h ), 4 . 56 ( broad s , 2h , nh 2 ), 6 . 38 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 8 , 1h ), 7 . 21 ( m , 2h ), 7 . 43 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0304 ] 13 c - nmr ( δ , cdcl 3 ): 22 . 5 , 25 . 1 , 25 . 2 , 26 . 0 , 30 . 7 , 33 . 3 , 33 . 6 , 34 . 5 , 40 . 3 , 48 . 0 , 55 . 2 , 61 . 6 , 106 . 7 , 110 . 6 , 126 . 6 , 129 . 1 , 137 . 2 , 138 . 2 , 141 . 9 , 156 . 1 , 158 . 2 . anal . calc &# 39 ; d for c 23 h 31 n 3 . 2hcl . { fraction ( 3 / 2 )} h 2 o : c , 61 . 46 ; h , 8 . 07 ; n , 9 . 35 . found : c , 61 . 78 , h , 8 . 01 , n , 9 . 12 . prepared as in example 11 , using phenethylamine , to afford a 85 % yield of the less polar isomer after separation of isomers , assigned the cis stereochemistry , as the hydrochloride salt , mp 170 - 185 ° c . [ 0309 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 52 ( m , 6h ), 1 . 75 ( m , 2h ), 2 . 20 ( m , 1h ), 2 . 36 ( dd , j = 10 , 13 , 1h ), 2 . 7 - 3 . 0 ( m , 4h ), 4 . 53 ( broad s , 2h , nh 2 ), 6 . 41 ( d , j = 8 , 1h ), 7 . 04 ( d , j = 8 , 1h ), 7 . 14 ( m , 2h ), 7 . 2 - 7 . 3 ( m , 5h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0310 ] 13 c - nmr ( δ , cdcl 3 ): 21 . 2 , 28 . 9 , 30 . 7 , 34 . 2 , 36 . 7 , 44 . 6 , 49 . 9 , 61 . 7 , 106 . 9 , 110 . 8 , 126 . 3 , 126 . 8 , 128 . 6 , 128 . 9 , 139 . 1 , 137 . 3 , 138 . 4 , 140 . 4 , 142 . 7 , 156 . 3 , 158 . 3 . anal . calc &# 39 ; d for c 25 h 29 n 3 . 2hcl . 5 / 3h 2 o : c , 63 . 29 ; h , 7 . 29 ; n , 8 . 86 . found : c , 63 . 31 , h , 7 . 35 , n , 8 . 66 . prepared as in example 11 , using phenethylamine , to afford a 85 % yield of the more polar isomer after separation of isomers , assigned the trans stereochemistry , as the hydrochloride salt , mp 110 - 130 ° c . [ 0315 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 29 ( m , 2h ), 1 . 40 ( m , 1h ), 1 . 59 ( m , 2h ), 1 . 75 ( m , 1h ), 1 . 93 ( m , 2h ), 2 . 51 ( dd , j = 8 . 5 , 13 , 1h ), 2 . 6 - 2 . 8 ( m , 5h ), 4 . 55 ( broad s , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 05 ( d , j = 8 , 1h ), 7 . 2 - 7 . 4 ( m , 7h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 81 ( m , 2h ). [ 0316 ] 13 c - nmr ( δ , cdcl 3 ): 22 . 5 , 30 . 8 , 32 . 6 , 36 . 4 , 40 . 3 , 47 . 6 , 49 . 70 , 64 . 5 , 106 . 8 , 110 . 6 , 126 . 0 , 126 . 61128 . 3 , 128 . 6 , 129 . 0 , 137 . 25 , 138 . 2 , 140 . 0 , 141 . 8 , 156 . 0 , 158 . 2 . anal . calc &# 39 ; d for c 25 h 29 n 3 . 2hcl . { fraction ( 3 / 2 )} h 2 o : c , 63 . 69 ; h , 7 . 27 ; n , 8 . 91 . found : c , 63 . 80 , h , 7 . 41 , n , 8 . 53 . prepared as in example 11 , using n - methylpiperazine , to afford a 96 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 195 - 208 ° c . [ 0321 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 1 - 1 . 6 ( m , 8h ), 1 . 8 - 1 . 9 ( m , 3h ), 2 . 27 ( s , 3h ), 2 . 4 - 2 . 7 ( m , 8h ), 2 . 90 ( m , 1h ), 4 . 53 ( broad s , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 8 , 1h ), 7 . 18 ( m , 2h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0322 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 8 , 24 . 5 , 25 . 7 , 26 . 9 , 30 . 5 , 37 . 2 , 45 . 9 , 50 . 1 , 55 . 5 , 65 . 8 , 106 . 7 , 110 . 6 , 126 . 6 , 129 . 1 , 137 . 0 , 138 . 2 , 143 . 1 , 156 . 2 , 158 . 1 . anal . calc &# 39 ; d for c 23 h 32 n 4 . 3hcl . { fraction ( 5 / 2 )} h 2 o . ⅔ ( c 4 h 10 o ): c , 57 . 26 ; h , 8 . 11 ; n , 10 . 41 . found : c , 57 . 15 ; h , 7 . 81 ; n , 10 . 11 . prepared as in example 11 , using benzylamine , to afford a 72 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 170 - 185 ° c . [ 0327 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 3 - 1 . 4 ( m , 4h ), 1 . 6 - 1 . 8 ( m , 4h ), 2 . 57 ( dd , j = 9 , 13 , 2h ), 2 . 73 ( m , 1h ), 2 . 84 ( m , 1h ), 3 . 77 ( dd , j = 9 , 38 , 2h ), 4 . 58 ( broad s , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 05 ( d , j = 8 , 1h ), 7 . 2 - 7 . 4 ( m , 7h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 82 ( m , 2h ). [ 0328 ] 13 c - nmr ( δ , cdcl 3 ): 25 . 2 , 25 . 6 , 27 . 0 , 28 . 6 , 39 . 0 , 50 . 8 , 51 . 3 , 56 . 1 , 60 . 1 , 106 . 7 , 110 . 6 , 126 . 5 , 126 . 6 , 128 . 1 , 128 . 3 , 129 . 5 , 137 . 1 , 138 . 3 , 141 . 2 , 141 . 9 , 142 . 5 , 156 . 2 , 158 . 2 . anal . calc &# 39 ; d for c 25 h 29 n 3 . 2hcl . { fraction ( 3 / 2 )} h 2 o : c , 63 . 69 ; h , 7 . 27 ; n , 8 . 91 . found : c , 64 . 03 , h , 7 . 25 , n , 8 . 90 . prepared as in example 11 , using 2 - ethoxyethylamine , to afford a 100 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 70 - 90 ° c . [ 0333 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 21 ( t , j = 8 , 3h ), 1 . 2 - 1 . 7 ( m , 8h ), 2 . 5 - 2 . 9 ( multiplets , 3h ), 3 . 4 - 3 . 6 ( m , 7h ), 4 . 54 ( broad s , 2h , nh 2 ), 6 . 39 ( d , j = 8 , 1h ), 7 . 03 ( d , j = 7 . 5 , 1h ), 7 . 22 ( m , 2h ), 7 . 44 ( t , j = 8 , 1h ), 7 . 80 ( m , 2h ). [ 0334 ] 13 c - nmr ( δ , cdcl 3 ): 15 . 2 , 26 . 9 , 28 . 7 , 30 . 4 , 32 . 2 , 46 . 2 , 46 . 8 , 57 . 0 , 60 . 5 , 66 . 25 , 470 . 1 , 106 . 7 , 110 . 6 , 126 . 5 , 129 . 3 , 167 . 0 , 138 . 2 , 141 . 6 , 142 . 4 , 156 . 2 , 158 . 2 . anal . calc &# 39 ; d for c 22 h 31 n 3 o 2 hcl . 9h 2 o : c , 44 . 90 ; h , 8 . 73 ; n , 7 . 14 . found : c , 44 . 69 , h , 8 . 82 , n , 6 . 82 . prepared as in example 11 , using n - benzylpiperazine , to afford a 67 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 205 - 215 ° c . [ 0339 ] 1 h - nmr ( 5 , cdcl 3 ): 1 . 0 - 1 . 8 ( m , 8h ), 1 . 8 - 1 . 9 ( m , 3h ), 2 . 4 - 2 . 6 ( m , 8h ), 2 . 92 ( m , 1h ), 3 . 51 ( singlets , 2h ), 4 . 53 ( bs , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 03 ( d , j = 7 , 1h ), 7 . 1 - 7 . 3 ( m , 7h ), 7 . 45 ( t , j = 7 . 5 , 1h ), 7 . 79 ( m , 2h ). [ 0340 ] 13 c - nmr ( δ , cdcl 3 ): 19 . 8 , 24 . 5 , 25 . 7 , 26 . 9 , 30 . 5 , 37 . 2 , 50 . 1 , 53 . 0 , 53 . 5 , 63 . 1 , 65 . 9 , 106 . 7 , 110 . 6 , 126 . 6 , 126 . 9 , 128 . 1 , 129 . 1 , 129 . 2 , 137 . 0 , 138 . 0 , 138 . 2 , 143 . 1 , 156 . 2 , 158 . 1 . anal . calc &# 39 ; d for c 29 h 36 n 4 . 3hcl . { fraction ( 3 / 2 )} h 2 o : c , 60 . 36 ; h , 7 . 34 ; n , 9 . 71 . found : c , 60 . 53 , h , 7 . 35 , n , 8 . 97 . prepared as in example 11 , using n -( n - isopropylacetamido ) piperazine , to afford a 94 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 180 - 200 ° c . ( dec .). [ 0345 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 147 and 1 . 148 ( doublets , j = 6 , 6h ), 1 . 2 - 1 . 8 ( m , 11h ), 2 . 6 ( broad m , 8h ), 2 . 95 ( s , 2h ), 4 . 088 and 4 . 092 ( heptets , j = 6 , 1h ), 4 . 53 ( broad s , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 8 , 1h ), 7 . 17 ( m , 2h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0346 ] 13 c - nmr ( δ , cdcl 3 ): 22 . 75 , 24 . 5 , 25 . 7 , 26 . 1 , 30 . 6 , 60 . 5 , 50 . 2 , 53 . 8 , 61 . 5 , 65 . 8 , 106 . 7 , 110 . 6 , 126 . 6 , 129 . 1 , 137 . 0 , 138 . 2 , 143 . 0 , 156 . 1 , 158 . 2 , 169 . 2 . anal . calc &# 39 ; d for c 27 h 39 n 5 o 3 hcl . ½h 2 o ( c 4 h 110 ): c , 57 . 98 ; h , 8 . 32 ; n , 10 . 91 . found : c , 57 . 77 ; h , 7 . 90 ; n , 10 . 85 . prepared as in example 11 , using n - phenethylamine , to afford a 73 % yield of the product assigned the trans stereochemistry , mp 195 - 204 ° c . ( dec .). [ 0351 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 2 - 1 . 4 ( m , 4h ), 1 . 58 ( m , 2h ), 1 . 94 ( broad s , 1h ), 2 . 27 ( m , 1h ), 2 . 33 ( broad s , 1h ), 2 . 4904 ( dd , j = 10 , 14 , 2h ), 2 . 7 - 2 . 8 ( m , 4h ), 3 . 10 ( dd , j = 4 , 11 , 1h , assigned trans stereochemistry ), 4 . 54 ( bs , 2h , nh 2 ), 6 . 41 ( d , j = 8 , 1h ), 7 . 04 ( d , j = 7 , 1h ), 7 . 2 - 7 . 3 ( m , 5h ), 7 . 27 ( m , 2h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0352 ] 13 c - nmr ( δ , cdcl 3 ): 20 . 3 , 22 . 4 , 31 . 7 , 36 . 6 , 37 . 3 , 39 . 9 , 40 . 7 , 43 . 3 , 50 . 1 , 59 . 3 , 106 . 8 , 110 . 7 , 126 . 1 , 126 . 7 , 128 . 4 , 128 . 7 , 128 . 9 , 137 . 1 , 1138 . 3 , 140 . 4 , 142 . 8 , 156 . 2 , 158 . 2 . anal . calc &# 39 ; d for c 27 h 31 n 3 . 2hcl . h 2 o : c , 66 . 39 ; h , 7 . 22 ; n , 8 . 60 . found : c , 66 . 00 ; h , 7 . 22 , n , 8 . 60 . prepared as in example 11 , using 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 6 - ylamine , to afford a 78 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 248 - 260 ° c . ( dec .). [ 0357 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 04 ( broad d , j = 9 , 2h ), 1 . 29 ( m , 4h ), 1 . 53 ( m , 2h ), 1 . 59 ( broad s , 1h ), 1 . 89 ( broad s , 1h ), 2 . 12 ( m , 1h ), 2 . 21 ( ddd , j = 3 , 14 , 24 , 2h ), 2 . 48 ( broad s , 1h ), 2 . 78 ( dd , j = 4 , 13 , 1h assigned trans stereochemistry ), 3 . 02 ( m , 4h ), 4 . 55 ( broad s , 2h , nh 2 ), 6 . 39 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 7 . 5 , 1h ), 7 . 19 ( m , 2h ), 7 . 44 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0358 ] 13 c - nmr ( δ , cdcl 3 ): 22 . 4 , 25 . 5 , 25 . 6 , 27 . 35 , 32 . 5 , 36 . 3 , 36 . 8 , 38 . 3 , 41 . 3 , 49 . 5 , 52 . 6 , 53 . 6 , 106 . 8 , 110 . 6 , 126 . 7 , 128 . 9 , 137 . 1 , 138 . 3 , 142 . 5 , 156 . 2 , 158 . 3 . anal . calc &# 39 ; d for c 24 h 30 n 4 . 3hcl . ½h 2 o . ½ ( c 4 h 10 o ): c , 58 . 92 ; h , 7 . 42 ; n , 10 . 57 . found : c , 59 . 02 ; h , 7 . 50 ; n , 10 . 64 . prepared as in example 11 , using n - phenethylamine , to afford a 77 . 5 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 178 - 192 ° c . ( dec .). [ 0363 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 2 - 1 . 5 ( m , 6h ), 2 . 2 - 2 . 5 ( m , 3h ), 2 . 84 ( m , 4h ), 3 . 03 ( m , 1h ), 3 . 13 ( m , 1h ), 4 . 49 ( broad s , 2h , nh 2 ), 6 . 41 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 7 . 5 ( 1h ), 7 . 2 - 7 . 4 ( m , 12h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 74 ( m , 2h ). [ 0364 ] 13 c - nmr ( δ , cdcl 3 ): 32 . 6 , 33 . 0 , 36 . 7 , 338 . 7 , 38 . 8 , 43 . 8 , 44 . 7 , 48 . 1 , 60 . 4 , 106 . 8 , 110 . 8 , 125 . 9 , 126 . 3 , 126 . 6 , 126 . 8 , 128 . 3 , 128 . 5 , 128 . 8 , 129 . 6 , 137 . 3 , 138 . 3 , 140 . 1 , 141 . 0 , 146 . 8 , 156 . 2 , 158 . 2 . anal . calc &# 39 ; d for c 32 h 35 n 3 . 2hcl . ½ch 2 cl 2 . ( c 4 h 10 o ): c , 66 . 41 ; h , 7 . 48 ; n , 6 . 37 . found : c , 66 . 42 ; h , 7 . 29 ; n , 6 . 17 . prepared as in example 11 , using n - phenethylamine , to afford a 96 % yield of the product assigned the cis stereochemistry , mp 170 - 180 ° c . ( dec .). [ 0369 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 08 ( m , 1h ), 1 . 15 ( m , 1h ), 1 . 2 - 1 . 4 ( m , 4h ), 1 . 57 ( m , 2h ), 1 . 68 ( m , 1h ), 2 . 0 - 2 . 2 ( m , 2h ), 2 . 61 ( m , 1h ), 2 . 69 ( m , 4h ), 2 . 77 ( m , 1h ), 4 . 50 ( broad s , 2h , nh 2 ), 6 . 42 ( d , j = 8 , 1h ), 7 . 05 ( d , j = 8 , 1h ), 7 . 12 ( m , 2h ), 7 . 22 ( m , 5h ), 7 . 47 ( t , j = 8 , 1h ), 7 . 81 ( m 2h ). [ 0370 ] 13 c - nmr ( δ , cdcl 3 ): 22 . 1 , 27 . 4 , 36 . 4 , 36 . 6 , 37 . 1 , 39 . 0 , 41 . 7 , 49 . 7 , 52 . 5 , 68 . 5 , 106 . 8 , 110 . 7 , 126 . 0 , 126 . 7 , 128 . 4 , 128 . 6 , 128 . 9 , 137 . 3 , 138 . 3 , 140 . 1 , 142 . 3 , 156 . 1 , 158 . 2 . anal . calc &# 39 ; d for c 27 h 31 n 3 . 2hcl . h 2 o . ½ ( c 4 h 10 o ): c , 66 . 28 ; h , 7 . 67 ; n , 8 . 00 . found : c , 66 . 57 , h , 7 . 41 , n , 7 . 64 . prepared as in example 11 , using 3 - aza - bicyclo [ 3 . 1 . 0 ] hex - 6 - ylamino , to afford a 56 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 200 - 220 ° c . ( dec .). [ 0375 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 2 - 3 . 2 ( multiplets for 18h ), 4 . 53 and 4 . 58 ( broad singlets , 2h , nh 2 ), 6 . 40 and 6 . 44 ( doublets , j = 8 , 1h ), 7 . 02 and 7 . 05 ( doublets , j = 7 . 5 , 1h ), 7 . 16 ( m , 2h ), 7 . 25 ( m , 5h ), 7 . 40 and 7 . 45 ( triplets , j = 8 , 1h ), 7 . 89 and 7 . 87 ( multiplets , 2h ). [ 0376 ] 13 c - nmr ( δ , cdcl 3 ): 25 . 3 , 26 . 1 , 30 . 9 , 32 . 9 , 34 . 6 , 37 . 1 , 39 . 9 , 53 . 0 , 64 . 9 , 66 . 5 , 106 . 8 , 107 . 2 , 110 . 8 , 110 . 9 , 125 . 9 , 126 . 8 , 127 . 0 , 127 . 1 , 128 . 3 , 129 . 2 , 138 . 4 , 138 . 5 , 156 . 2 , 158 . 2 . prepared as in example 11 , using n - methyloxindole , to afford a 100 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 170 - 175 ° c . ( dec .). [ 0380 ] 1 h - nmr ( δ , cdcl 3 ): 3 . 26 ( s , 3h ), 4 . 60 ( broad s , 2h , nh 2 ), 6 . 47 ( d , j = 8 , 1h ), 6 . 80 ( d , j = 8 , 1h ), 6 . 86 ( t , j = 8 , 1h ), 7 . 12 ( d , j = 8 , 1h ), 7 . 24 ( m , 1h ), 7 . 50 ( t , j = 8 , 1h ), 7 . 70 ( m , 2h ), 7 . 85 ( s , 1h ), 8 . 02 ( m , 2h ). [ 0381 ] 13 c - nmr ( δ , cdcl 3 ): 26 . 1 , 107 . 7 , 108 . 1 , 110 . 9 , 121 . 1 , 121 . 7 , 122 . 8 126 . 8 , 127 . 1 , 129 . 7 , 132 . 3 , 135 . 0 , 136 . 7 , 138 . 4 , 140 . 6 , 144 . 1 , 154 . 9 , 158 . 3 , 168 . 45 . anal . calc &# 39 ; d for c 21 h 17 n 3 o . ¼h 2 o : c , 76 . 00 ; h , 5 . 31 ; n , 12 . 66 . found : c , 75 . 93 , h , 5 . 30 , n , 11 . 87 . prepared by reduction of example 28 , to afford a 60 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 45 - 55 ° c . ( dec .). [ 0386 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 91 ( dd , j = 10 , 14 , 1h ), 3 . 14 ( s , 3h ), 3 . 52 ( dd , j = 4 , 14 , 1h ), 3 . 73 ( m , 1h ), 4 . 53 ( broad s , 2h , nh 2 ), 6 . 42 ( d , j = 8 , 1h ), 6 . 725 ( di j = 8 , 1h ), 6 . 80 ( m 1h ), 6 . 88 ( t , j = 7 . 5 , 1h ), 7 . 05 ( d , j = 8 , 1h ), 7 . 21 ( m , 3h ), 7 . 46 ( t , j = 7 . 5 , 1h ), 7 . 81 ( m , 2h ). [ 0387 ] 13 c - nmr ( δ , cdcl 3 ): 26 . 1 , 36 . 5 , 47 . 0 , 107 . 0 , 107 . 9 , 110 . 7 , 122 . 1 , 124 . 6 , 126 . 7 , 127 . 9 , 129 . 6 , 138 . 0 , 138 . 3 , 138 . 5 , 144 . 2 , 155 . 7 , 158 . 3 , 177 . 0 . prepared as in example 28 , using n -( 2 - dimethylaminoethyl ) oxindole , to afford a 91 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 165 - 190 ° c . ( dec .). [ 0391 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 33 ( s , 6h ), 2 . 59 ( t , j = 7 , 2h ), 3 . 90 ( t , j = 7 , 2h ), 4 . 55 ( broad s , 2h , nh 2 ), 6 . 48 ( d , j = 8 , 1h ), 6 . 85 ( m , 2h ), 7 . 14 ( d , j = 7 . 5 , 1h ), 7 . 24 ( m , 2h ), 7 . 51 ( t , j = 8 , 1h ), 7 . 71 ( m , 2h ), 7 . 85 ( s , 1h ), 8 . 02 ( m , 2h ). [ 0392 ] 13 c - nmr ( δ , cdcl 3 ): 37 . 6 , 45 . 1 , 55 . 6 , 107 . 0 , 107 . 7 , 110 . 4 , 121 . 1 , 122 . 4 , 125 . 9 , 126 . 2 , 129 . 1 , 131 . 7 , 136 . 3 , 137 . 8 , 157 . 6 . not all carbons were visible in this scan due to limited compound solubility . anal . calc &# 39 ; d for c 24 h 24 n 4 o . 2hcl . h 2 o : c , 60 . 63 ; h , 5 . 94 ; n , 11 . 78 . found : c , 60 . 61 , h , 6 . 13 , n , 10 . 12 . prepared by reduction of example 30 using palladium - catalyzed ammonium formate , to afford a 97 % yield of the product as a mixture of diastereomers as the hydrochloride salt , mp 120 - 135 ° c . ( dec .). [ 0397 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 25 ( s , 6h ), 2 . 39 9 m , 2h ), 2 . 95 ( dd , j = 9 , 14 , 1h ), 3 . 48 ( dd , j = 4 , 14 , 1h ), 3 . 7 - 3 . 9 ( m , 3h ), 4 . 47 ( broad s , 2h , nh 2 ), 6 . 42 ( d , j = 8 , 1h ), 7 . 76 ( d , j = 8 , 1h ), 6 . 84 ( m , 1h ), 6 . 89 ( t , j = 7 , 1h ), 7 . 05 ( d , j = 7 . 5 , 1h ), 7 . 18 ( m , 2h ), 7 . 25 ( m , 1h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0398 ] 13 c - nmr ( δ , cdcl 3 ): 36 . 5 , 38 . 2 , 45 . 6 , 46 . 9 , 55 . 9 , 107 . 0 , 108 . 1 , 110 . 7 , 122 . 0 , 124 . 7 , 126 . 6 , 127 . 9 , 128 . 4 , 129 . 7 , 130 . 9 , 138 . 0 , 138 . 3 , 143 . 5 , 155 . 8 , 158 . 2 , 176 . 8 . prepared from example 13 , using 5 - bromomethylisoxazole to alkylate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in ethyl acetate , in 90 %, mp 122 - 127 ° c . [ 0402 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 81 ( m , 4h ), 2 . 18 ( m , 2h ), 2 . 485 ( m , 1h ), 3 . 00 ( m , 2h ), 3 . 735 ( s , 2h ), 4 . 57 ( broad s , 2h , nh 2 ), 6 . 17 ( d , j = 1 . 5 , 1h ), 6 . 38 ( d , j = 8 , 1h ), 7 . 01 ( d , j = 8 , 1h ), 7 . 24 ( m , 2h ), 7 . 43 ( t , j = 8 , 1h ), 7 . 81 ( m , 2h ), 8 . 18 ( d , j = 1 . 7 , 1h ). [ 0403 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 2 , 41 . 8 , 53 . 4 , 53 . 9 , 102 . 4 , 106 . 8 , 110 . 6 , 126 . 8 , 126 . 9 , 137 . 7 , 138 . 2 , 146 . 4 , 150 . 1 , 155 . 9 , 158 . 2 , 168 . 9 . anal . calc &# 39 ; d for c 20 h 22 n 4 o . ¼ ( c 4 h 8 o 2 ): c , 70 . 76 ; h , 6 . 79 ; n , 15 . 72 . found : c , 70 . 83 ; h , 6 . 62 ; n , 15 . 73 . prepared from example 13 , using iodoacetamide to alkylate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in 55 %, mp 224 - 227 ° c . [ 0408 ] 1 h - nmr ( 6 , dmso - d 6 ): 1 . 76 ( m , 2h ), 2 . 17 ( m , 1h ), 2 . 51 ( m , 2h ), 2 . 88 ( s , 2h ), 2 . 91 ( m , 4h ), 5 . 94 ( d , j = 4 . 5 , 1h ), 6 . 39 ( d , j = 8 , 1h ), 7 . 01 ( d , j = 7 , 1h ), 7 . 19 ( m , 1h ), 7 . 30 ( m , 2h ), 7 . 44 ( t , j = 8 , 1h ), 7 . 90 ( m , 2h ). [ 0409 ] 13 c - nmr ( 6 , dmso - d 6 ): 33 . 0 , 41 . 1 , 54 . 0 , 61 . 7 , 106 . 7 , 108 . 0 , 126 . 3 , 126 . 8 , 137 . 3 , 137 . 9 , 146 . 5 , 154 . 3 , 159 . 4 , 172 . 0 . anal . calc &# 39 ; d for c 18 h 22 n 4 o . ½h 2 o : c , 67 . 69 ; h , 7 . 26 ; n , 17 . 54 . found : c , 67 . 96 , h , 7 . 03 , n , 17 . 37 . prepared from example 13 , using phenacyl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl ) phenyl ]- pyridin - 2 - ylamine , in 75 %, mp 180 - 200 ° c . as the hydrochloride salt . [ 0414 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 8 - 2 . 0 ( m , 4h ), 2 . 27 ( m , 2h ), 2 . 55 ( m , 1h ), 3 . 12 ( m , 2h ), 3 . 85 ( s , 2h ), 4 . 57 ( broad s , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 03 ( d , j = 7 . 5 , 1h ), 7 . 28 ( m , 2h ), 7 . 45 ( m , 3h ), 7 . 55 ( t , j = 7 . 5 , 1h ), 7 . 83 ( m , 2h ), 8 . 01 ( m , 2h ). [ 0415 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 2 , 42 . 0 , 54 . 6 , 64 . 8 , 106 . 8 , 110 . 6 , 126 . 8 , 127 . 0 , 128 . 1 , 128 . 5 , 133 . 1 , 136 . 1 , 137 . 6 , 138 . 3 , 146 . 7 , 155 . 9 , 158 . 1 , 196 . 7 . anal . calc &# 39 ; d for c 24 h 25 n 3 o 2 hcl . 3 / 4h 2 o : c , 62 . 95 ; h , 6 . 27 ; n , 9 . 18 . found : c , 63 . 13 ; h , 6 . 38 ; n , 9 . 07 . prepared from example 13 , using 3 , 4 - dimethoxybenzyl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in 89 %, mp 150 - 165 ° c . as the hydrochloride salt . [ 0420 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 85 ( m , 4h ), 2 . 18 ( m , 2h ), 2 . 54 ( m , 1h ), 3 . 06 ( m , 2h ), 3 . 56 ( s , 2h ), 3 . 86 ( s , 3h ), 3 . 89 ( s , 3h ), 4 . 6 ( broad s , 2h ), 6 . 40 ( d , j = 8 , 1h ), 6 . 82 ( m , 2h ), 6 . 95 ( m , 1h ), 7 . 02 ( d , j = 7 . 5 , 1h ), 7 . 27 ( m , 2h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 82 ( m , 2h ). [ 0421 ] 13 c - nmr ( δ , cdcl 3 ): 32 . 9 , 42 . 2 , 53 . 8 , 55 . 91 , 55 . 935 , 60 . 4 , 62 . 8 , 106 . 9 , 1110 . 7 , 110 . 8 , 112 . 6 , 121 . 7 , 126 . 9 , 127 . 1 , 137 . 7 , 138 . 3 , 146 . 6 , 148 . 3 , 156 . 1 , 158 . 3 . anal . calc &# 39 ; d for c 25 h 29 n 3 o 2 . 2hcl . { fraction ( 7 / 4 )} h 2 o : c , 59 . 11 ; h , 6 . 85 ; n , 8 . 27 . found : c , 59 . 19 ; h , 6 . 92 ; n , 8 . 21 . prepared from example 13 , using 3 , 4 - methylenedioxybenzyl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in 82 %, mp 150 - 165 ° c . as the hydrochloride salt . [ 0426 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 87 ( m , 4h ), 2 . 11 ( m , 2h ), 2 . 53 ( m , 1h ), 3 . 05 ( m , 2h ), 3 . 51 ( s , 2h ), 5 . 94 ( s , 2h ), 6 . 41 ( d , j = 8 , 1h ), 6 . 76 ( m , 2h ), 6 . 89 ( s , 1h ), 7 . 02 ( d , j = 7 . 5 , 1h ), 7 . 27 ( m , 2h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 83 ( m , 2h ). [ 0427 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 0 , 42 . 2 , 53 . 8 , 62 . 8 , 100 . 9 , 106 . 9 , 107 . 9 , 109 . 8 , 110 . 7 , 122 . 6 , 126 . 9 , 127 . 1 , 131 . 4 , 137 . 7 , 138 . 4 , 146 . 7 , 147 . 6 , 156 . 1 , 158 . 3 . anal . calc &# 39 ; d for c 24 h 25 n 3 o 2 { fraction ( 3 / 2 )} h 2 o 2 hcl : c , 59 . 14 ; h , 6 . 20 ; n , 8 : 62 . found : c , 59 . 22 ; h , 6 . 32 ; n , 8 . 53 . prepared from example 13 , using furfuryl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl ) phenyl ]- pyridin - 2 - ylamine , in 100 %, mp 75 - 95 ° c . as the hydrochloride salt . [ 0432 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 8 - 1 . 9 ( m , 4h ), 2 . 11 ( m , 2h ), 2 . 49 ( m , 1h ), 3 . 02 ( m , 2h ), 3 . 56 ( s , 2h ), 4 . 6 ( broad s , 2h , nh 2 ), 6 . 21 ( m , 1h ), 6 . 30 ( m , 1h ), 6 . 38 ( d , j = 8 , 1h ), 7 . 00 ( d , j = 7 . 5 , 1h ), 7 . 25 ( m , 2h ), 7 . 37 ( m , 1h ), 7 . 43 ( t , j = 7 . 5 , 1h ), 7 . 80 ( m , 2h ). [ 0433 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 1 , 42 . 1 , 53 . 8 , 55 . 0 , 136 . 8 128 . 8 , 110 . 0 , 110 . 6 126 . 8 , 127 . 0 , 137 . 6 , 138 . 2 , 142 . 1 , 146 . 7 , 151 . 6 , 156 . 0 , 158 . 2 . anal . calc &# 39 ; d for c 21 h 23 n 3 o 2 hcl . ¾h 2 o : c , 57 . 60 ; h , 6 . 56 ; n , 9 . 60 . found : c , 57 . 66 ; h , 6 . 69 ; n , 9 . 47 . prepared as in example 2 , using 5 , 6 - dimethoxy - 1 , 2 , 3 , 4 - tetrahydroisoquinoline for the reductive amination step , with a 88 % yield for the final deblocking , mp 205 - 209 ° c . : [ 0438 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 72 ( m , 2h ), 2 . 77 ( m , 2h ), 3 . 52 ( s , 2h ), 3 . 66 ( s , 2h ), 3 . 72 ( s , 3h ), 3 . 75 ( s , 3h ), 3 . 8 ( broad s , 2h ), 6 . 39 ( d , j = 8 , 1h ), 6 . 43 ( s , 1h ), 6 . 53 ( s , 1h ), 6 . 98 ( d , j = 7 . 5 , 1h ), 7 . 3 - 7 . 4 ( m , 3h ), 7 . 5 - 7 . 7 ( m , 4h ), 7 . 85 ( m , 2h ). [ 0439 ] 13 c - nmr ( δ , cdcl 3 : 28 . 2 , 50 . 6 , 55 . 4 , 55 . 8 , 62 . 2 , 107 . 5 , 139 . 5 , 110 . 9 , 111 . 4 , 125 . 9 , 126 . 1 , 126 . 9 , 127 . 0 , 127 . 3 , 129 . 9 , 136 . 7 , 138 . 5 , 138 . 6 , 140 . 9 , 147 . 2 , 147 . 5 , 155 . 5 , 158 . 6 . anal . calc &# 39 ; d for c 29 h 29 n 3 o 21 / 2 h 2 o : c , 75 . 63 ; h , 6 . 57 ; n , 9 . 12 . found : c , 75 . 75 , h , 6 . 37 , n , 9 . 20 . prepared from example 13 , using 5 - isothiazolyl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in 95 %, mp 140 - 145 ° c . [ 0444 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 795 ( m , 4h ), 2 . 16 ( m , 2h ), 2 . 49 ( m , 1h ), 3 . 02 ( m , 4h ), 3 . 835 ( s , 2h ), 6 . 385 ( d , j = 8 , 1h ), 6 . 96 ( d , j = 7 . 5 , 1h ), 7 . 06 ( s , 1h ), 7 . 24 ( m , 2h ), 7 . 42 ( t , j = 8 , 1h ), 7 . 75 ( m , 2h ), 8 . 35 ( s , 1h ). [ 0445 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 1 , 41 . 9 , 54 . 1 , 55 . 4 , 107 . 1 , 110 . 75 , 122 . 2 , 126 . 9 , 127 . 0 , 1337 . 6 , 138 . 4 , 146 . 5 , 155 . 9 , 157 . 4 , 158 . 3 , 166 . 6 . anal . calc &# 39 ; d for c 20 h 22 n 4 s1 / 2h 2 o : c , 66 . 82 ; h , 6 . 45 ; n , 15 . 58 . found : c , 67 . 08 , h , 6 . 51 , n , 15 . 23 . prepared from example 13 , using 5 - thiazolyl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl ) phenyl ]- pyridin - 2 - ylamine , in 99 %, mp 151 - 154 ° c . [ 0450 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 81 ( m , 4h ), 2 . 145 ( m , 2h ), 2 . 50 ( m , 1h ), 3 . 00 ( m , 2h ), 3 . 77 ( s , 2h ), 4 . 57 ( broad s , 2h , nh 2 ), 6 . 39 ( d , j = 8 , 1h ), 7 . 01 ( d , j = 7 , 1h ), 7 . 25 ( m , 2h ), 7 . 44 ( t , j = 8 , 1h ), 7 . 70 ( s , 1h ), 7 . 81 ( m , 2h ), 8 . 74 ( s , 1h ). [ 0451 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 2 , 42 . 1 , 53 . 8 , 54 . 3 , 106 . 8 , 110 . 6 , 126 . 8 , 127 . 0 , 136 . 4 , 137 . 6 , 138 . 3 , 141 . 7 , 146 . 6 , 153 . 3 , 156 . 0 , 158 . 2 . anal . calc &# 39 ; d for c 20 h 22 n 4 s : c , 68 . 54 ; h , 6 . 33 ; n , 15 . 99 . found : c , 68 . 21 , h , 6 . 49 , n , 15 . 63 . prepared from example 13 , using 2 - pyridyl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl ) phenyl ]- pyridin - 2 - ylamine , in 97 %, mp 180 - 190 ° c . as the hydrochloride salt . [ 0456 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 82 ( m , 4h ), 2 . 19 ( m , 2h ), 2 . 53 ( m , 1h ), 3 . 02 ( m , 2h ), 3 . 69 ( s , 2h ), 4 . 54 ( broad s , 2h , nh 2 ), 6 . 38 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 7 . 5 , 1h ), 7 . 14 ( m , 1h ), 7 . 26 ( m , 2h ), 7 . 43 ( m , 2h ), 7 . 64 ( t , j = 8 , 1h ), 7 . 81 ( m , 2h ), 8 . 55 ( m , 1h ). [ 0457 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 2 , 42 . 2 , 54 . 4 , 64 . 9 , 106 . 8 , 110 . 6 , 121 . 9 , 123 . 2 , 126 . 8 , 127 . 0 , 136 . 3 , 137 . 6 , 138 . 2 , 146 . 8 , 149 . 1 , 156 . 0 , 158 . 2 , 158 . 7 . anal . calc &# 39 ; d for c 22 h 24 n 4 . 2hcl . { fraction ( 7 / 4 )} h 2 : c , 58 . 86 ; h , 6 . 62 ; n , 12 . 48 . found : c , 58 . 99 , h , 6 . 66 , n , 12 . 24 . prepared from example 13 , using 3 - pyridyl bromide to alkylate 6 -[ 4 -( piperidin - 4 - yl ) phenyl ]- pyridin - 2 - ylamine , in 86 %, mp 202 - 215 ° c . as the hydrochloride salt . [ 0462 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 81 ( m , 4h ), 2 . 10 ( m , 2h ), 2 . 51 ( m , 1h ), 2 . 96 ( m , 2h ), 3 . 53 ( s , 2h ), 4 . 625 ( broad s , 2h , nh 2 ), 6 . 38 ( d , j = 8 , 1h ), 7 . 01 ( d , j = 7 . 5 , 1h ), 7 . 24 ( m , 3h ), 7 . 43 ( t , j = 8 , 1h ), 7 . 69 ( m , 1h ), 7 . 82 ( m , 2h ), 8 . 49 ( m , 1h ), 8 . 54 ( m , 1h ). [ 0463 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 1 , 42 . 1 , 54 . 1 , 60 . 4 , 106 . 8 , 110 . 6 , 123 . 3 , 126 . 8 , 127 . 0 , 133 . 7 , 136 . 8 , 137 . 6 , 138 . 3 , 146 . 6 , 148 . 4 , 150 . 3 , 155 . 9 , 158 . 2 . anal . calc &# 39 ; d for c 22 h 24 n 4 . 3hcl . { fraction ( 3 / 2 )} h 2 o : c , 54 . 95 ; h , 6 . 29 ; n , 11 . 65 . found : c , 54 . 93 , h , 6 . 51 , n , 11 . 31 . prepared from example 13 , using 2 - imidazolyl aldehyde to reductively aminate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in 88 %, mp 160 - 163 ° c . [ 0468 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 81 ( m , 4h ), 2 . 28 ( m , 2h ), 2 . 54 ( m , 1h ), 3 . 00 ( m , 2h ), 3 . 75 ( broad s , 2h ), 6 . 395 ( d , j = 8 , 1h ), 6 . 94 ( m , 1h ), 7 . 00 ( d , j = 7 . 5 , 1h ), 7 . 20 ( m , 2h ), 7 . 43 ( t , j = 8 , 1h ), 7 . 79 ( m , 2h ). [ 0469 ] 13 c - nmr ( δ , cdcl 3 ): 32 . 6 , 41 . 6 , 54 . 0 , 55 . 7 , 107 . 0 , 110 . 7 , 127 . 0 , 137 . 9 , 138 . 4 , 146 . 0 , 155 . 9 , 158 . 3 . anal . calc &# 39 ; d for c 20 h 23 n 5 ½h 2 co 3 : c , 67 . 56 ; h , 6 . 64 ; n , 19 . 22 . found : c , 67 . 48 , h , 6 . 89 , n , 18 . 91 . prepared from example 13 , using 4 - imidazolyl aldehyde to reductively aminate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in 92 %, mp & gt ; 210 ° c . ( dec .) as the hydrochloride salt . [ 0474 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 74 ( m , 4h ), 2 . 07 ( m , 2h ), 2 . 5 ( m , 1h ), 2 . 97 ( m , 2h ), 3 . 47 ( s , 2h ), 5 . 94 ( broad s , 2h , nh 2 ), 6 . 39 ( d , j = 8 , 1h ), 6 . 90 ( broad s , 1h ), 7 . 00 ( d , j = 7 . 4 , 1h ), 7 . 27 ( m , 2h ), 7 . 42 ( t , j = 8 , 1h ), 7 . 56 ( m , 1h ), 7 . 88 ( m , 2h ). [ 0475 ] 13 c - nmr ( δ , cdcl 3 ): 32 . 8 , 41 . 4 , 53 . 3 , 54 . 1 , 106 . 7 , 108 . 0 , 126 . 3 , 126 . 7 , 137 . 3 , 137 . 9 , 146 . 5 , 154 . 3 , 159 . 5 . anal . calc &# 39 ; d for c 20 h 23 n 5 ½h 2 co 3 : c , 67 . 56 ; h , 6 . 64 ; n , 19 . 22 . found : c , 67 . 99 , h , 6 . 72 , n , 19 . 07 . prepared from example 13 , using 4 - pyridine carboxaldehyde to reductively aminate 6 -[ 4 -( piperidin - 4 - yl )- phenyl ]- pyridin - 2 - ylamine , in 74 %, mp 158 - 163 ° c . as the hydrochloride salt . [ 0480 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 81 ( m , 4h ), 2 . 10 ( m , 2h ), 2 . 52 ( m , 1h ), 2 . 94 ( m , 2h ), 3 . 51 ( s , 2h ), 4 . 57 ( broad s , 2h , n h 2 ), 6 . 39 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 7 , 1h ), 7 . 28 ( m , 4h ), 7 . 43 ( t , j = 8 , 1h ), 7 . 83 ( m , 2h ), 8 . 52 ( m , 2h ). [ 0481 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 4 , 42 . 2 , 54 . 4 , 62 . 1 , 106 . 9 , 110 . 7 , 123 . 9 , 126 . 9 , 127 . 1 , 137 . 7 , 138 . 3 , 146 . 7 , 148 . 1 , 149 . 7 , 156 . 0 , 158 . 3 . anal . calc &# 39 ; d for c 22 h 24 n 4 . { fraction ( 5 / 4 )} h 2 o : c , 72 . 00 ; h , 7 . 28 ; n , 15 . 27 . found : c , 72 . 23 ; h , 6 . 97 ; n , 15 . 47 . to a 125 ml round - bottomed flask equipped with n 2 inlet were added 3 . 3 g ( 11 . 96 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -( 4 -( 4 ′- formylbiphenyl - 4 - yl ))- pyridine ( example 1b ), 1 . 9 g ( 11 . 96 mmol ) diethyl malonate , 60 ml benzene , 51 mg ( 0 . 6 mmol ) piperidine , and 10 mg benzoic acid . the reaction was refluxed overnight , cooled , and poured into water and ethyl acetate . the organic layer was washed with 1n hydrochloric acid , aqueous sodium bicarbonate solution , and brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methylene chloride / ethyl acetate to afford the product as a yellow oil , 4 . 32 g ( 86 . 5 %). [ 0487 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 31 ( t , j = 7 , 3h ), 1 . 34 ( t , j = 7 , 3h ), 2 . 21 ( s , 6h ), 4 . 33 ( q , j = 7 , 2h ), 4 . 35 ( q , j = 7 , 2h ), 5 . 93 ( s , 2h ), 7 . 17 ( d , j = 8 , 1h ), 7 . 55 ( m , 2h ), 7 . 77 ( m , 2h ), 7 . 87 ( t , j = 8 , 1h ), 8 . 09 ( m , 2h ). [ 0488 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 14 . 0 , 14 . 2 , 61 . 7 , 61 . 8 , 106 . 1 , 118 . 5 , 120 . 5 , 126 . 7 , 127 . 2 , 128 . 6 , 129 . 9 , 130 . 1 , 133 . 7 , 138 . 8 , 140 . 2 , 141 . 3 , 151 . 8 , 155 . 6 , 164 . 1 , 166 . 7 . to a 250 ml round - bottomed flask equipped with condenser and n 2 inlet were added 4 . 32 g ( 10 . 33 mmol ) diethyl - 4 -[ 2 -( 2 , 5 - dimethylpyrrolyl )- 6 - pyridyl ] benzylidenemalonate and 100 ml ethanol . to the stirring solution was added a solution of 672 mg ( 10 . 33 mmol ) potassium cyanide in 2 . 6 ml water , and the reaction heated at 60 ° c . overnight . the reaction was cooled and quenched with dilute hydrochloric acid , then taken up in ethyl acetate and washed with acid and brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methylene chloride / ethyl acetate as eluant to afford 3 . 00 g ( 78 %) of an oil . [ 0493 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 21 ( s , 6h ), 2 . 96 ( m , 2h ), 3 . 71 ( s , 3h ), 4 . 355 ( t , j = 7 , 1h ), 5 . 93 ( s , 2h ), 7 . 17 ( d , j = 8 , 1h ), 7 . 47 ( m , 2h ), 7 . 74 ( d , j = 8 , 1h ), 7 . 89 ( t , j = 8 , 1h ), 8 . 09 ( m , 2h ). [ 0494 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 32 . 9 , 39 . 7 , 52 . 4 , 107 . 1 , 118 . 4 , 113 . 75 , 120 . 3 , 127 . 8 , 128 . 6 , 135 . 4 , 138 . 8 , 151 . 8 , 155 . 8 , 169 . 5 . to a 125 ml round - bottomed flask equipped with condenser and n 2 inlet were added 2 . 84 g ( 7 . 61 mmol ) ethyl - 3 -[ 2 -( 2 , 5 - dimethylpyrrolyl )- 6 - pyridyl ] phenyl - 3 - cyano - propionate , 50 ml ethanol , and 1 ml concentrated hydrochloric acid . the solution was heated as 700 mg 10 % palladium - on - carbon and 2 . 4 g ( 38 . 07 mmol ) ammonium formate were added , and the reaction heated at 80 ° c . for 4 . 75 hours , with additional catalyst and ammonium formate at 1 hour intervals . the reaction was cooled and filtered through celite , and the filtrate evaporated . the residue was taken up in ethyl acetate , washed with aqueous sodium hydroxide , dried over sodium sulfate , and evaporated . the residue was taken up in 50 ml dry toluene , treated with 5 ml triethylamine , and heated at reflux for 1 hour . the reaction was then cooled , washed with dilute aqueous hydrochloric acid and brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methylene chloride / methanol as eluant to afford 204 . 5 mg ( 8 . 1 %) of an oil . [ 0499 ] 1 h - nmr ( δ , cdcl 3 ): 2 . 21 ( s , 6h ), 2 . 64 ( ab , j = 8 . 5 , 17 , dn = 94 , 2h ), 3 . 43 ( dd , j = 7 , 9 , 1h ), 3 . 73 ( m , 1h ), 3 . 80 ( m , 1h ), 5 . 92 ( s , 2h ), 7 . 02 ( bs , 1h ), 7 . 13 ( d , j = 8 , 1h ), 7 . 34 ( m , 2h ), 7 . 72 ( d , j = 8 , 1h ), 7 . 86 ( t , j = 8 , 1h ), 8 . 04 ( m , 2h ). [ 0500 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 38 . 0 , 40 . 0 , 49 . 5 , 107 . 0 , 118 . 2 , 119 . 9 , 127 . 2 , 127 . 4 , 128 . 7 , 137 . 3 , 138 . 7 , 143 . 5 , 151 . 7 , 156 . 3 , 177 . 8 . to a 125 ml round - bottomed flask equipped with condenser and n 2 inlet were added 230 mg ( 1 . 73 mmol ) aluminum chloride and 8 ml dry tetrahydrofuran . the solution was cooled to 0 ° c ., and 4 . 04 ml ( 4 . 04 mmol ) of a 1 . 0 m solution was lithium aluminum hydride in tetrahydrofuran was added . the reaction was stirred 20 minutes at room temperature , and cooled to − 70 ° c . the reaction was treated with a solution of 191 mg ( 0 . 577 mmol ) 2 -( 2 , 5 - dimethylpyrrolyl )- 6 -[ 4 -( pyrrolidin - 3 - yl )- phenyl ]- pyridine in 2 ml dry tetrahydrofuran , and stirred 1 hour at − 70 ° c . and 14 hours at room temperature . the reaction was carefully quenched with dilute aqueous hydrochloric acid , then taken up in methylene chloride and aqueous sodium hydroxide solution , and the combined organic layer washed with water , dried over sodium sulfate , and evaporated to afford 145 mg ( 79 %) of an oil . [ 0505 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 90 ( m , 1h ), 2 . 21 ( s , 6h ), 2 . 27 ( m , 1h ), 2 . 89 ( dd , j = 8 , 10 , 1h ), 3 . 11 ( m , 1h ), 3 . 19 ( m , 1h ), 3 . 28 ( t , j = 8 , 1h ), 3 . 40 ( dd , j = 8 , 10 , 1h ), 3 . 5 ( bs , 1h ), 5 . 92 ( s , 2h ), 7 . 10 ( d , j = 8 , 1h ), 7 . 33 ( m , 2h ), 7 . 70 ( d , j = 8 , 1h ), 7 . 83 ( t , j = 8 , 1h ), 8 . 00 ( m , 2h ). [ 0506 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 34 . 4 , 45 . 3 , 47 . 2 , 54 . 8 , 106 . 9 , 118 . 1 , 119 . 7 , 125 . 5 , 127 . 1 , 127 . 2 , 127 . 4 , 127 . 6 , 128 . 6 , 136 . 5 , 138 . 6 , 145 . 3 , 151 . 6 , 156 . 6 . prepared using the procedure in example 43 to carry out the reductive amination with furfural , in 65 % yield as an oil . [ 0510 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 92 ( m , 1h ), 2 . 21 ( s , 6h ), 2 . 36 ( m , 1h ), 2 . 59 ( t , j = 9 , 1h ), 2 . 78 ( m , 1h ), 2 . 97 ( m , 1h ), 3 . 18 ( t , j = 9 , 1h ), 3 . 44 ( m , 1h ), 3 . 75 ( ab q , j = 14 , dn = 19 , 2h ), 5 . 92 ( s , 2h ), 6 . 24 ( d , j = 3 , 1h ), 6 . 32 ( dd , j = 2 , 3 , 1h ), 7 . 10 ( d , j = 8 , 1h ), 7 . 34 ( m , 2h ), 7 . 38 ( d , j = 2 , 1h ), 70 . 70 ( d , j = 8 , 1h ), 7 . 83 ( t , j = 8 , 1h ), 7 . 99 ( m , 2h ). [ 0511 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 4 , 33 . 0 , 43 . 1 , 51 . 7 , 54 . 1 , 61 . 4 , 106 . 8 , 108 . 2 , 110 . 1 , 118 . 0 , 119 . 6 , 126 . 9 , 127 . 1 , 127 . 3 , 128 . 7 , 130 . 8 , 136 . 3 , 138 . 5 , 142 . 1 , 146 . 05 , 151 . 5 , 152 . 0 , 156 . 6 . prepared as in example 11d , in 77 % yield , mp 60 - 70 ° c . as the hydrochloride salt . [ 0515 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 90 ( m , 1h ), 2 . 34 ( m , 1h ), 2 . 51 ( t , j = 9 , 1h ), 2 . 70 ( m , 1h ), 2 . 93 ( m , 1h ), 3 . 13 ( t , j = 9 , 1h ), 3 . 65 ( m , 1h ), 3 . 69 ( ab q , j = 14 , dn = 21 , 2h ), 4 . 55 ( bs , 2h , nh 2 ), 6 . 19 ( d , j = 3 , 1h ), 6 . 30 ( dd , j = 2 , 3 , 1h ), 6 . 40 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 7 , 1h ), 7 . 29 ( m , 2h ), 7 . 36 ( m , 1h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 81 ( m , 2h ). [ 0516 ] 13 c - nmr ( δ , cdcl 3 ): 33 . 1 , 43 . 1 , 52 . 0 , 54 . 2 , 61 . 75 , 106 . 8 , 107 . 7 , 110 . 0 , 110 . 6 , 126 . 8 , 127 . 1 , 127 . 4 , 167 . 6 , 138 . 3 , 141 . 9 , 145 . 5 , 152 . 6 , 155 . 9 , 158 . 2 . anal . calc &# 39 ; d for c 20 h 21 n 3 o . 2hcl . { fraction ( 5 / 3 )} h 2 o : c , 56 . 88 ; h , 6 . 28 ; n , 9 . 95 . found : c , 56 . 67 , h , 6 . 11 , n , 10 . 15 . prepared as in example 46 , using isobutyraldehyde , with a 73 % yield in the final deblocking step to afford the product as a solid , mp 55 - 70 ° c . [ 0521 ] 1 h - nmr ( δ , cdcl 3 ): 0 . 93 ( d , j = 6 . 5 , 6h ), 1 . 76 ( m , 1h ), 1 . 87 ( m , 1h ), 2 . 2 - 2 . 4 ( m , 3h ), 2 . 49 ( dd , j = 8 , 9 , 1h ), 2 . 64 ( m , 1h ), 2 . 76 ( m , 1h ), 2 . 98 ( t , j = 9 , 1h ), 3 . 37 ( h , j = 7 , 1h ), 4 . 56 ( bs , 2h , nh 2 ), 6 . 40 ( d , j = 8 , 1h ), 7 . 03 ( d , j = 7 . 5 , 1h ), 7 . 32 ( m , 2h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 81 ( m , 2h ). [ 0522 ] 13 c - nmr ( δ , cdcl 3 ): 21 . 0 , 27 . 4 , 33 . 2 , 43 . 0 , 54 . 9 , 62 . 4 , 64 . 9 , 106 . 8 , 110 . 7 , 126 . 8 , 127 . 5 , 137 . 5 , 138 . 3 , 146 . 4 , 156 . 0 , 158 . 2 . anal . calc &# 39 ; d for c 19 h 25 . n 3 . 2hcl . 2h 2 o : c , 56 . 43 , h , 7 . 73 , n , 10 . 39 . found : c , 56 . 13 , h , 7 . 52 , n , 10 . 40 . to a 125 ml 3 - necked round - bottomed flask equipped with septum and n 2 inlet were added 1 . 86 g ( 5 . 70 mmol ) 6 - bromo - 2 -( 2 , 5 - dimethylpyrrolyl )- pyridine and 40 ml dry tetrahydrofuran . the solution was cooled to − 60 ° c ., and 2 . 73 ml ( 6 . 84 mmol ) of a 2 . 5m solution of butyl lithium in hexane was added dropwise and the solution stirred 10 min at − 60 ° c . then a solution of 1 . 47 g ( 6 . 84 mmol ) 3 - benyl - 3 - aza - bicyclo [ 3 . 2 . 1 ] octan - 8 - one in 15 ml dry tetrahydrofuran was added dropwise , and the reaction stirred at − 60 ° c . for 10 minutes , and then at room temperature for 3 hours . the reaction was quenched with aqueous ammonium chloride solution and taken up in ethyl acetate . the organic layer was separated and washed with more aqueous ammonium chloride solution and brine , dried over sodium sulfate , and evaporated . the residue was chromatographed on silica gel using methanol and methylene chloride to afford 413 mg ( 16 %) of a yellow oil which solidified , mp 58 - 68 ° c . [ 0528 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 45 ( m , 2h ), 1 . 84 ( m , 2h ), 2 . 22 ( s , 6h ), 2 . 46 ( bs , 2h ), 2 . 66 ( m , 2h ), 2 . 92 ( m , 2h ), 3 . 64 ( s , 2h ), 5 . 94 ( s , 2h ), 7 . 14 ( d , j = 8 , 1h ), 7 . 2 - 7 . 4 ( m , 5h ), 7 . 959 ( m , 2h ), 7 . 74 ( d , j = 8 , 1h ), 7 . 865 ( t , j = 8 , 1h ), 8 . 065 ( m , 2h ). [ 0529 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 25 . 5 , 41 . 8 , 54 . 0 , 61 . 8 , 78 . 9 , 107 . 0 , 118 . 3 , 120 . 0 , 125 . 9 , 126 . 8 , 127 . 1 , 128 . 2 , 128 . 7 , 137 . 6 , 138 . 6 , 151 . 7 , 156 . 4 . prepared as in example 13c in 73 % yield as a solid , mp 185 - 190 ° c . [ 0533 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 52 ( m , 4h ), 2 . 19 ( s , 6h ), 2 . 35 ( m , 2h ), 2 . 53 ( m , 2h ), 3 . 48 ( m , 2h ), 5 . 91 ( s , 2h ), 7 . 12 ( d , j = 8 , 1h ), 7 . 55 ( m , 2h ), 7 . 72 ( d , j = 8 , 1h ), 7 . 85 ( t , j = 8 , 1h ), 8 . 04 ( m , 2h ). [ 0534 ] 13 c - nmr ( δ , cdcl 3 ): 13 . 5 , 24 . 7 , 42 . 0 , 47 . 1 , 78 . 9 , 107 . 0 , 118 . 3 , 119 . 9 , 125 . 6 , 127 . 1 , 128 . 6 , 137 . 5 , 138 . 6 , 147 . 1 , 151 . 7 , 156 . 4 . anal . calc &# 39 ; d for c 24 h 27 n 3 o . ¼ ( c 4 h 8 o 3 ): c , 75 . 92 ; h , 7 . 39 ; n , 10 . 62 . found : c , 76 . 13 ; h , 7 . 37 ; n , 10 . 33 . prepared as in example 11d in 84 % yield as a solid , mp 108 - 120 ° c . [ 0539 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 46 ( m , 4h ), 2 . 29 ( m , 2h ), 2 . 47 ( m , 2h ), 3 . 39 ( m , 2h ), 4 . 635 ( bs , 2h , nh 2 ), 6 . 365 ( d , j = 8 , 1h ), 6 . 94 ( d , j = 7 . 5 , 1h ), 7 . 41 ( t , j = 8 , 1h ), 7 . 44 ( m , 2h ), 7 . 75 ( m , 2h ). [ 0540 ] 13 c - nmr ( δ , cdcl 3 ): 24 . 4 , 41 . 5 , 46 . 7 , 78 . 3 , 107 . 3 , 110 . 8 , 125 . 3 , 125 . 5 , 126 . 9 , 138 . 4 , 138 . 6 , 145 . 8 , 155 . 6 , 158 . 4 . hrms calc &# 39 ; d for c 18 h 21 n 3 o : 286 . 1763 . found : 286 . 1776 . [ 0545 ] 1 h - nmr ( δ , cdcl 3 ): 0 . 90 ( d , j = 6 , 6h ), 1 . 39 ( m , 2h ), 1 . 8 ( broad m , 3h ), 2 . 2 ( broad m , 2h ), 2 . 425 ( bs , 2h ), 2 . 64 ( m , 2h ), 2 . 83 ( m , 2h ), 4 . 51 ( bs , 2h , nh 2 ), 6 . 42 ( d , j = 8 , 1h ), 7 . 04 ( d , j = 7 . 5 , 1h ), 7 . 465 ( t , j = 8 , 1h ), 7 . 52 ( m , 2h ), 7 . 86 ( m , 2h ). [ 0546 ] 13 c - nmr ( δ , cdcl 3 ): 20 . 8 , 25 . 15 , 25 . 6 , 41 . 5 , 54 . 4 , 65 . 6 , 78 . 45 , 107 . 4 , 111 . 1 , 125 . 6 , 127 . 0 , 138 . 6 , 138 . 8 , 155 . 7 , 158 . 4 . anal . calc &# 39 ; d for c 22 h 29 n 3 o 2 hcl . h 2 o : c , 57 . 64 ; h , 7 . 26 ; n , 9 . 17 . found : c , 57 . 60 , h , 7 . 34 , n , 8 . 84 . prepared as in example 48 , using furfural , with a 33 % yield in the final deblocking step to afford the product as a solid , mp 187 - 202 ° c . [ 0551 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 41 ( m , 2h ), 1 . 78 ( m , 2h ), 2 . 435 ( m , 2h ), 2 . 65 ( m , 2h ), 3 . 00 ( m , 2h ), 3 . 68 ( s , 2h ), 4 . 52 ( bs , 2h , nh 2 ), 6 . 24 ( d , j = 3 , 1h ), 6 . 32 ( dd , j = 2 , 3 , 1h ), 6 . 415 ( d , j = 8 , 1h ), 7 . 03 ( d , j = 7 . 5 , 1h ), 7 . 37 ( d , j = 2 , 1h ), 7 . 46 ( t , j = 8 , 1h ), 7 . 50 ( m , 2h ), 7 . 84 ( m , 2h ). [ 0552 ] 13 c - nmr ( δ , cdcl 3 ): 25 . 1 , 41 . 5 , 53 . 6 , 53 . 8 , 78 . 5 , 107 . 3 , 108 . 6 , 110 . 1 , 111 . 0 , 125 . 6 , 127 . 0 138 . 4 , 139 . 0 , 141 . 9 , 145 . 1 , 155 . 6 , 158 . 3 . anal . calc &# 39 ; d for c 23 h 25 n 3 o 2 . 2hcl . h 2 o : c , 59 . 23 ; h , 6 . 27 ; n , 9 . 01 . found : c , 59 . 17 , h , 6 . 50 , n , 8 . 71 . prepared as in example 46 , deblocking after step a . to afford the product as a solid , mp 185 - 200 ° c . ( dec .). [ 0557 ] 1 h - nmr ( δ , cdcl 3 ): 1 . 41 ( m , 2h ), 1 . 79 ( m , 2h ), 2 . 41 ( bs , 2h ), 2 . 63 ( m , 2h ), 2 . 91 ( m , 2h ), 3 . 62 ( s , 2h ), 4 . 58 ( bs , 2h , nh2 ), 6 . 41 ( d , j = 8 , 1h ), 7 . 02 ( d , j = 7 . 5 , 1h ), 7 . 23 ( m , 1h ), 7 . 31 ( m , 2h ), 7 . 37 ( m , 2h ), 7 . 45 ( t , j = 8 , 1h ), 7 . 51 ( m , 2h ), 7 . 83 ( m , 2h ). [ 0558 ] 13 c - nmr ( δ , cdcl 3 ): 25 . 4 , 41 . 7 , 54 . 0 , 61 . 8 , 78 . 7 , 107 . 3 , 111 . 0 , 125 . 6 , 126 . 8 , 127 . 0 , 128 . 2 , 128 . 8 , 138 . 4 , 138 . 9 , 145 . 4 , 155 . 7 , 158 . 3 . anal . calc &# 39 ; d for c 2 h 27 n 3 o . ¼ch 2 cl 2 . ½ ( c 4 h 10 o ): c , 63 . 34 ; h , 6 . 73 ; n , 8 . 13 . found : c , 63 . 11 , h , 6 . 44 , n , 8 . 12 .	2
referring to the figures in which like referenced features indicate corresponding elements throughout the several views , attention is first directed to fig1 which illustrates a first embodiment of the gift box container ( 10 a ) as delivered to a consumer with the lid ( 12 ) disposed atop the container ( 14 ). it is seen in this view that in this embodiment the lid ( 12 ) substantially conforms to the dimensions of the container ( 14 ). although both the lid ( 12 ) and the container ( 14 ) are cylindrical in this embodiment , it is contemplated that each may take any configuration capable of being formed into a container . for example , square , rectangle , pentagon , octagon , etc . on the upper surface of the lid ( 12 ) is seen an aperture ( 16 ). in this embodiment , the aperture ( 16 ) is removably sealed by a membrane ( 18 ). in the preferred embodiment , the membrane ( 18 ) is affixed to the lid ( 12 ) and is comprised of paper or easily torn plastic material , each of which may be perforated to allow easy access to the decorative element ( 20 ). the membrane ( 18 ) provides a view of and secures a decorative element ( 20 ) stored within the lid ( 12 ). in alternate embodiments , the membrane ( 18 ) may be opaque . an optional handle ( 15 ) is shown attached to the gift box container ( 14 ). the handle ( 15 ) may be composed of rope , string , ribbon , reed , or any other appropriate material . the decorative element ( 20 ) may be seen in fig2 which illustrates a first embodiment of the gift box container ( 10 a ) with the decorative element ( 20 ) removed from the lid ( 12 ) and the gift box ( 10 a ) ready for delivery to a recipient . the decorative element ( 20 ) is secured to the base of a shadow box ( 24 ) disposed within the lid ( 12 ) to prevent accidental removal of the decorative element ( 20 ). referring now to fig3 a and 3 b which illustrate exploded views of the first embodiment of the gift box container ( 10 a ). it is seen in these figures that the membrane ( 18 ) may be affixed to the inner surface of the lid ( 12 ), fig3 a , or to the outer surface of the lid ( 12 ), fig3 b . in fig3 a is seen a shadow box insert ( 22 ) which incorporates a shadow box ( 24 ). the shadow box insert ( 22 ) is affixed to the inner surface of the lid ( 12 ) generally aligning the shadow box ( 24 ) with the lid aperture ( 16 ). alternatively , as seen in fig3 b , the shadow box ( 24 ) may be fashioned on to the lid ( 12 ). in either configuration , the shadow box ( 24 ) stores the decorative element ( 20 ) for delivery and secures the decorative element ( 20 ) to the lid ( 12 ). in this embodiment the decorative element ( 20 ) is comprised of material , such as silk or lace ribbon or any other appropriate material , which may easily collapse for storage within the shadow box ( 24 ) but has the resiliency to rebound to a fully formed decoration . in some embodiments , the decorative element ( 20 ) may incorporate ribbons with lengths generally of the height of the container ( 14 ) and tabs ( 28 ) at the terminal ends thereof to secure the lid ( 12 ) to the container ( 14 ). an example of such ribbons may be seen in fig4 , item 26 . referring now to fig4 which illustrates another embodiment of the gift box container ( 10 b ). the gift box container ( 10 b ) as illustrated in fig4 is shown in a generally rectangular configuration , however , other configurations are contemplated . in this figure it is seen a decorative element ( 20 ) atop the lid ( 12 ). as referenced in the prior paragraph , ribbons ( 26 ) are shown drawn along the sides of ( 14 ). the ribbons ( 26 ) may have tabs ( 28 ) to engage the ribbons with the container ( 14 ) or may engage their opposite member at a meeting point along the bottom of the container ( 14 ). referring now to fig5 a and 5 b which illustrate exploded views of the second embodiment of the gift box container ( 10 b ). in fig5 a is seen a shadow box insert ( 22 ) which incorporates a shadow box ( 24 ). the shadow box insert ( 22 ) is affixed to the inner surface of the lid ( 12 ) generally aligning the shadow box ( 24 ) with the lid aperture ( 16 ). alternatively , as seen in fig3 b , the shadow box ( 24 ) may be fashioned on to the lid ( 12 ). in either configuration , the shadow box ( 24 ) is adapted to receive the decorative element ( 20 ) secure the decorative element ( 20 ) laterally to the lid ( 12 ). in the embodiments of fig5 a through 9 , the decorative element ( 20 ) may be stored within the container ( 14 ) for delivery to the consumer or , alternatively , may be purchased separately from the gift box ( 10 b and 10 c ). by this means , the decorative element ( 20 ) of the gift box ( 10 b and 10 c ) may be exchanged to alter the presentation . it is contemplated that the decorative element ( 20 ) may be comprised of live or dried flowers , artificial flowers , bows , toys , jewelry , beads , or any other decorative item which creates the appropriate mood for the gift - giving occasion . where the decorative element ( 20 ) is comprised of live flowers , it is contemplated that base ( 32 ) of the decorative element ( 20 ) will be comprised of a sponge , see fig6 , or other like material which retains water , to ensure that the live flowers stay fresh for an extended period of time . it is further contemplated that the shadow box ( 24 ), may be comprised of a water - proof material to ensure that the gift is not damaged by water when the decorative element ( 20 ) is comprised of live flowers . at the terminal ends of the ribbons ( 26 ) may be tabs ( 28 ). as seen in fig5 a and 5 b , the tabs ( 28 ) are adapted to be inserted into slots ( 30 ) when the decorative element ( 20 ) is in place in the shadow box ( 24 ) of the lid ( 12 ) and the lid ( 12 ) is in place on the container ( 14 ). this tab / slot arrangement serves the dual purpose of securing the lid ( 12 ) and decorative element ( 20 ) to the container ( 14 ) and providing a finished looked to the ribbons ( 26 ). as shown , the slots ( 30 ) are elongated slots within the side walls of the container ( 14 ). referring now to fig8 , it is seen that other securing arrangements are contemplated such as providing elongated slots within the base of the container ( 14 ). in one alternative arrangement , the tabs ( 28 a ) are fashioned into generally u - shaped hooks . in this arrangement , the elongated slots ( 30 a ) are formed in the base ( 14 a ) of the container ( 14 ). it is also contemplated that the decorative element ( 20 ) may not include a ribbon . in this configuration , the decorative element ( 20 ) may be secured to the lid ( 12 ) by means of removable plastic snap rivets ( 34 ), velcro ® ( not shown ), or some other attachment means which allows for secure attachment but easy removal of the secured item . referring now to fig9 in which it is seen another embodiment of the gift box container ( 10 c ). the gift box container ( 10 c ) as illustrated in fig9 is shown in a generally rectangular configuration , however , other configurations are contemplated . in this figure it is seen a decorative element ( 20 ), a lid ( 12 ) with an aperture ( 16 ), and a container ( 14 ). the decorative element ( 20 ) is fixedly mounted upon a generally flat base ( 36 ). although shown in rectangular form , the base ( 36 ) of the decorative element ( 20 ) will substantially conform to the general dimensions of the aperture ( 16 ) but be sufficiently large such that the base ( 36 ) may not pass through the aperture ( 16 ). as delivered to the consumer , the decorative element ( 20 ) is disposed within the container ( 14 ) and the lid ( 12 ) is in place over the open top of the container ( 14 ). to prepare the gift for presentation , the user pulls the decorative element ( 20 ) through the aperture ( 16 ), ensuring that the ribbons ( 26 ) are also pull through the aperture ( 16 ), until the decorative element base ( 36 ) comes into contact with the inner surface of the lid ( 12 ). a plurality of securing elements ( 38 ) are disposed around the perimeter of the aperture ( 16 ) along the inner surface of the lid ( 12 ). it is expected that there will be at least two securing elements ( 38 ). in the preferred embodiment , the securing elements ( 38 ) are plastic tabs , however , it is also contemplated that any means of securing one surface to another , such as magnetic fasteners , peel - off adhesives , self - adhesive fasteners , foam clip fasteners , hooks , screw posts , rubber bands , clamps , velcro ®, snaps , tacks , prongs , buttons , glue ( reusable or temporary , plastic , gel , acrylic , etc . ), picture - frame swivel lock fasteners , tape ( all types , mounting , magnetic , etc . ), ties ( all types ; plastic , fabric , metal , etc . ), wire , slots , double - sided tape , clips , push pins , rivets , bolts , or nuts . at the terminal ends of the ribbons ( 26 ) are seen tabs ( 28 ). the tabs ( 28 ) are adapted to be inserted into slots ( 30 ) when the decorative element ( 20 ) is mounted to the lid ( 12 ) and the lid ( 12 ) is in place on the container ( 14 ). this tab / slot arrangement serves the dual purpose of securing the lid ( 12 ) and decorative element ( 20 ) to the container ( 14 ) and providing a finished looked to the ribbons ( 26 ). as shown , the slots ( 30 ) are elongated slots within the side walls of the container ( 14 ). although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limited sense . any particular reference to a container shape or a securing mechanism is for illustrative purposes only and is intended to encompass alternate shapes and mechanisms . various modifications of the disclosed embodiments , as well as alternative embodiments of the inventions will become apparent to persons skilled in the art upon the reference to the description of the invention . it is , therefore , contemplated that the disclosure will cover such modifications that fall within the scope of the invention .	1
while embodiments of the present disclosure may take many forms , there are described in detail herein specific embodiments of the present disclosure . this description is an exemplification of the principles of the present disclosure and is not intended to limit the disclosure to the particular embodiments illustrated . the following detailed description should be read with reference to the drawings in which similar elements in different drawings are numbered the same . the drawings , which are not necessarily to scale , depict illustrative embodiments and are not intended to limit the scope of the disclosure . those skilled in the art will recognize that the dimensions and materials discussed herein are merely exemplary and are not intended to limit the scope of the present disclosure . in some embodiments , the present disclosure relates generally to a stent having a bulge or enlarged middle portion where the bulge is designed to adapt to the antrum pouch created during sleeve gastrectomy or biliopancreatic diversion with duodenal switch ( sg ) surgery . the role of the bulge is to prevent downwards and / or upwards stent migration and close / insulate any leaks that may occur . the present disclosure is discussed in more detail with respect to the figures below . in some embodiments , the stent includes a sleeve that extends past the distal end of the stent into the duodenum and past the common bile duct to prevent reflux . turning now to the figures , fig5 is a partial side view of one embodiment of a stent according to the disclosure . stent 20 includes a flared proximal end portion 22 , an enlarged middle portion 24 and a distal end portion 26 connected to a polymeric sleeve 28 . sleeve 28 is partially illustrated in fig5 . while the enlarged middle portion 24 is shown in fig5 as having a symmetrical ovular shape , the shape may also be non - symmetrical as well . this stent is designed to pass from the esophagus , through the stomach , and into the duodenum . sleeve 28 extends distally past the distal end of the distal end portion 26 of the stent 20 and past the common bile duct . sleeve 28 is suitably formed of a material that allows it to collapse upon itself . this , in combination with the extension of the sleeve 28 beyond the common bile duct , allows the bile to fun down the outside of the sleeve and continue into the small intestine rather than splashing back into the stomach . sleeve 28 is suitably formed of a polymer material , and can also be formed of an elastomeric polymeric material . examples of elastomeric polymers include , but are not limited to , silicone , polyurethane and polyether - block - amide to mention only a few . fig6 is a side view of a stent 20 similar to that shown in fig5 , with the relative length of sleeve 28 to stent 20 . fig7 illustrates a stent 20 similar to those shown in fig5 and 6 wherein stent 20 is illustrated passing from the esophagus , through the stomach and into the duodenum . the sleeve 28 of stent 20 extends distally past the distal end or the distal end portion 26 past the common bile duct into the duodenum . proximal end portion 22 of stent 20 is in the esophagus , the enlarged middle portion 24 is located in the antrum of stomach and distal end portion 26 along with sleeve 28 is located in the duodenum . fig8 is a side view of an alternative embodiment of a stent 20 wherein the distal end portion 26 of stent 20 is relatively short , or just slightly greater than 0 mm and ends almost at the distal end of the enlarged central portion 24 of stent 20 . in this embodiment , the stent / sleeve is configured such that the sleeve 28 of the stent terminates in the stomach rather extending into the duodenum as illustrated in the embodiment shown in fig7 . again , as in the embodiment shown in fig7 above , sleeve 20 extends beyond the common bile duct . again , sleeve 20 is configured to collapse and close upon itself to prevent bile reflux . in this embodiment , however , the pyloric valve is still able to close to further aid in the prevention of bile reflux . fig9 illustrates stent similar to that shown in fig8 wherein stent 20 is shown passing from the esophagus , through the stomach , and ending in the pylorus . the enlarged central portion and the distal end 26 thereof , thus terminates in the stomach . the sleeve 28 of stent 20 passes through the pylorus 16 of the stomach and into the duodenum 5 . in this embodiment , only the sleeve 28 is located in the duodenum . fig1 is a side view of an alternative embodiment of a stent 20 wherein the sleeve 28 is eliminated . in this embodiment a valve 30 is positioned in the distal end portion 26 of the stent between the enlarged central portion 24 and the distal end of stent 20 . in some embodiments , the one - way flow valve may comprise one cuspid or multiple cuspids . in one embodiment , the stent includes a tricuspid one - way valve as shown in fig1 . positioning of a one way valve in the distal end portion 26 of stent 20 aids in the prevention or significant reduction of bile reflux . the valve 30 is positioned within the distal end portion 26 of stent so as to reside at approximately the same location as the pyloric sphincter . in some embodiments , stent 20 is in the formed of a braided or woven structure . valve 30 may be coupled to the braided or woven construction . fig1 and 13 illustrate alternative embodiments wherein at least a portion of the distal end portion 26 which will be disposed in the pyloric sphincter comprises a collapsible stent portion . the collapsible portion can be created in a variety of ways such as by reducing the radial strength of the stent in at least a portion of the end portion 26 or the entire portion , or by placing a collapsible sleeve or band around at least a portion of the distal end portion 26 . fig1 is a side view illustrating an alternative embodiment of a stent 20 wherein the valve 30 has been replaced with an elastomeric band 32 . band 32 may be formed of any suitable elastomeric material . examples include , but are not limited to , silicone , polyurethane and poly - ether - block amide . elastomeric band 32 is located in the distal end portion at the distal end of the enlarged middle portion 24 of stent 20 . elastomeric band 32 applies an inward pressure such that stent 20 closes upon itself in the region of elastomeric band 32 . when the stomach muscles contract , the bolus of food will be pushed out of the stomach bulge , past the elastomeric band , and into the duodenum . this causes the elastomeric band to expand . once the bolus of food has passed , the elastomeric band returns to it &# 39 ; s at rest state wherein the stent 20 in the region of elastomeric band 32 is again closed , preventing or significantly reducing bile reflux . the distal end portion 26 of stent 20 can be formed of a braided or woven construction as the rest of stent 20 , but can be suitably formed of a continuous wall construction in this embodiment , as opposed to a braided or woven configuration . fig1 is an alternative embodiment wherein the distal end portion 26 of stent 20 extends through the pyloric sphincter . at this location , the radial force of stent 20 is lower than the enlarged middle portion 24 of stent 20 and the proximal end portion 22 of stent 20 to allow closure of the sphincter . the radial force can be reduced in a variety of different was such as reducing the wire diameter , lowering the braid angle , reducing the number of wires , etc . fig1 illustrates a reduction in braid angle in the distal end portion 26 of stent 20 . the radial force may also be reduced only on a segment of the distal end portion 26 of stent 20 such as that portion closest to the enlarged middle portion 24 of stent 20 . in any of the embodiments disclosed above , stent 20 may be formed from any suitable stent material . examples include , but are not limited to , nickel - titanium alloy ( nitinol ), cobalt - chromium - nickel alloy ( elgiloy ), cobalt - chromium alloy , or stainless steel . in any of the embodiments disclosed above , the entirety of the stent , or any portions thereof , may be formed of a braided or woven construction . in any of the embodiments disclosed above , the stent , or any portions thereof , may be a laser cut stent . in any of the embodiments disclosed above , the entirety of stent 20 may include any appropriate cover , or any portion or portions thereof . the covering may be formed of any suitable material . examples include , but are not limited to , polyesters , polypropylenes , polyethylenes , polyurethanes , polynaphthalenes , polytetrafluoroethylenes , expanded polytetrafluoroethylene , silicone , copolymers thereof and mixtures or combinations thereof . in some implementations , the polymeric cover is silicone . a description of some embodiments of a stent delivery catheter , stylet for use therein and methods of using the same is contained in one or more of the following statements :	0
referring to fig3 a rim according to the present invention is indicated generally at 100 and comprises a left side wall 102 and a right sidewall 104 . a bottom portion of the rim 106 extends between the side walls 102 and 104 . a wall 108 of a spoke bore defines a spoke opening through the bottom portion 106 of the rim 100 . the bottom portion 106 of the rim 100 has been upset adjacent to the wall 108 of the spoke bore . specifically , a tool t with a head h , including a spherical surface s , has been forced against the bottom portion 106 of the rim 100 to deform it to produce a concave , spherical surface 120 on the interior of the rim 100 . the act of upsetting the bottom portion 106 of the rim 100 is facilitated by the use of an anvil a . a cavity c is formed in a working surface of the anvil a . the anvil a is positioned against the outside surface of the bottom portion 106 of the rim 100 , with the cavity c aligned with and centered around the wall 108 of the spoke bore and the tool t is inserted into the rim 100 and aligned with the cavity c and the wall 108 of the spoke bore . the tool t is struck with enough force to upset the rim 100 , adjacent to the wall 108 of the spoke bore , to produce the concave , spherical surface 120 . referring now to fig4 a rim 140 according to the present invention comprises side walls 142 and 144 and a bottom portion 146 . a concave spherical surface 148 is formed on the interior surface of the bottom portion 146 of the rim 140 . a cutting tool ct with a spherical cutter head ch is used to form the surface 148 . a small amount of material is removed from the interior side of the bottom portion 146 of the rim 140 , around a wall 150 , which defines a spoke opening . referring now to fig5 a spoke nipple according to the present invention is indicated generally at 170 . the nipple 170 has a plurality of flats 172 so that torque can be applied to it by a suitable tool , such as a wrench ( not shown ). the nipple 170 is provided with an internally threaded longitudinally extending bore , indicated at 174 , for engaging external threads provided on the end of a spoke ( not shown in fig5 ). a lower end 176 of the nipple 170 terminates in a convex , rounded surface 178 . it is this rounded , convex surface that seats inside the rim 100 ( fig3 ) on the rounded , concave surface 120 , or inside the rim 140 ( fig4 ) on the rounded , concave surface 148 . it is preferred that the curvature of the surface 178 be the same as the curvature of the surface 120 or the surface 148 . referring now to fig6 a spoke 200 and a nipple 202 are shown connected to a rim 204 . the nipple 202 corresponds with the nipple 170 ( fig5 ) and the rim 204 corresponds with the rim 100 ( fig3 ). in this embodiment , the nipple 202 has a convex curved surface 206 , which is seated on a concave curved surface 208 formed in the rim . thus , the nipple 202 can pivot relative to the rim 204 . as tension in the spoke 200 increases , as by rotation of the nipple 202 , the nipple 202 will align itself with the longitudinal axis of the spoke 200 , which is determined by the location of the connection of the other end ( not shown ) of the spoke 200 to a hub ( not shown ). typically , this will involve a centering angle and , in the case of torque transmitting wheels , a torsional angle . excellent results have been achieved in a case where the curved surface 206 and the curved surface 208 are spherical and have a curvature corresponding with a radius of 5 millimeters or a diameter of 10 millimeters . a cylindrically shaped wall 210 defines a spoke hole in the rim 204 . a rim portion 212 of the spoke 200 is adjacent to the wall 210 . it will be appreciated that the rim portion 212 of the spoke 200 may be threaded , like the portion ( not shown ) of the spoke 200 that is inside of the nut 202 , or it may be unthreaded . in the case where the nipple 202 is relatively short , the internal threads 174 ( fig5 ) will extend pretty much the length of the nipple , and the rim portion 212 ( fig6 ) of the spoke 200 will likely be threaded , as well , with the spoke threads ( not shown ) terminating below the rim 204 in fig6 . in the case of a relatively long nipple 202 , it is possible to counterbore the nipple 202 , adjacent to the rounded surface 206 so that all of the spoke threads are within the nipple 202 and the spoke portion 212 is unthreaded . according to the preferred embodiment of the invention , excellent results have been achieved where the diameter of the cylindrically shaped wall 210 , i . e ., the diameter of the spoke hole , is approximately 0 . 141 inch in a case where the major diameter of the threaded rim portion 212 of the spoke 200 is about 0 . 090 inch . this provides enough clearance between the spoke 200 and the wall 210 to permit the spoke 200 to be skewed , according to the centering angle or the combination of the centering angle and the torsional angle , as the spoke 200 passes through the spoke bore in the rim 204 . in any case , according to the present invention , the diameter of the spoke hole through the rim must be greater than the diameter of the portion of the spoke , which extends through the spoke hole . however , the diameter of the spoke hole should be kept as small as possible , to maximize the area of contact between the curved surfaces 206 and 208 , while still providing the clearance required for the spoke to pivot . preferably , the diameter of the spoke opening is about 1 . 5 times the diameter , or the major diameter , of the rim portion of the spoke extending therethrough . in the example given above , the ratio is a little less than 1 . 6 to 1 . 0 . preferably , the diameter of the spoke opening in the rim is 2 . 0 times or less than the diameter of the rim portion of the spoke . more preferably , the diameter of the spoke opening in the rim is 1 . 8 times or less than the diameter of the rim portion of the spoke . even more preferred is the case where the diameter of the spoke opening in the rim is 1 . 6 times or less than the diameter of the rim portion of the spoke . it is noted that the spoke bore defined by the wall 210 extends radially , and that it is centered between the side walls of the rim 204 . this is preferred because it is very easy to machine . other spoke bore orientations are within the scope of the present invention , however . in a case where the axes of the spoke bores are oriented so that they are aligned with the axes of the spokes , taking into account the centering angle and the torsional angle , if present , the diameter of the spoke opening in the rim can be 1 . 4 times or less than diameter of the rim portion of the spoke extending therethrough , or , even more preferably , 1 . 2 times or less than the diameter of the rim portion of the spoke . however , the present invention eliminates the need , apparently felt by some wheel builders , to drill spoke holes off of the center plane of the wheel / rim , in a vain effort to align the axis of the spoke hole with the centering angle or the centering angle and the torsional angle of the spoke . the effort is in vain , especially in the case of rear or torque transmitting wheels , because dynamic forces will cause movement of the spokes that can &# 39 ; t be accounted for in static spoke connections . however , with a rim and spoke nipple according to the invention , such movement can be accommodated in the case where the spoke openings in the rim are aligned , more or less , with the axes of the spokes extending through them . referring now to fig7 a spoke 250 and a nipple 252 are shown connected to a rim 254 . the nipple 252 corresponds with the nipple 170 ( fig5 ) and the rim 254 corresponds with the rim 140 ( fig4 ). in this embodiment , the nipple 252 has a convex curved surface 256 , which is seated on a concave curved surface 258 formed in the rim , according to the method described above with reference to fig4 . thus , the nipple 252 can pivot relative to the rim 254 . as tension in the spoke 250 increases , as by rotation of the nipple 252 , the nipple 252 will align itself with the longitudinal axis of the spoke . excellent results have been achieved in a case where the curved surface 256 and the curved surface 258 are spherical and have a curvature corresponding with a radius of 5 millimeters or a diameter of 10 millimeters . a cylindrically shaped wall 260 defines a spoke hole in the rim 254 . a rim portion 262 of the spoke 250 is adjacent to the wall 260 . according to a preferred embodiment of the invention , the diameter of the cylindrically shaped wall , i . e ., the diameter of the spoke hole is approximately 0 . 141 inch in the case where the major diameter of the threaded rim portion 262 of the spoke 250 is about 0 . 090 inch . this provides the clearance between the spoke rim portion 262 and the wall 260 that is needed to permit the spoke 250 to be skewed , according to the centering angle or the combination of the centering angle and the torsional angle , as the spoke 250 passes through the spoke bore in the rim 254 . in any case according to the present invention , the diameter of the spoke hole through the rim must be greater than the diameter of the portion of the spoke , which extends through the spoke hole . however , the diameter of the spoke hole should be kept as small as possible , to maximize the area of contact between the curved surfaces 256 and 258 , while still providing the clearance required for the nipple and spoke to pivot . it is noted that the spoke bore defined by the wall 260 extends radially , and that it is centered between the side walls of the rim 264 . this is preferred , for the reasons set forth above . in the case of a wheel according to the present invention including external nipples as described in the claes patent , the rounded portion of the collar will be seated directly on a curved surface formed in the rim itself . because the nipple isn &# 39 ; t elevated off of the bottom portion of the rim , as in the case where an insert or eyelet is used as explicitly taught in the claes patent , the degree of clearance required in the spoke opening in the rim is minimized compared to the prior art . this maximizes the surface area of the rim bottom that actually supports the nipple , thereby producing a stronger spoke connection to the rim . the relationships described above , between the diameters of the spoke holes in the rim and the diameters of the rim portions of the spokes , applies equally to the diameters of the spoke openings and the outer diameter of the portion of an external nipple extending through the rim . the relationships described above between the diameters of spoke holes oriented to align with the axes of spokes extending through them and the diameters of the spokes extending through them , applies equally to the relationships between the diameters of the spoke openings and the outer diameters of the portion of an external nipple extending through the rim . it will be appreciated that the nipple and rim construction set forth above not only accommodates the centering angle , as illustrated in fig6 and 7 , but also accommodates the torsional angle , as well .	1
the major engineering challenge we faced in building a phased array echoplanar imaging system involved modifying the rf receiver system so that that data can be recorded from multiple rf coils ( instead of just one coil ) simultaneously , allowing several independent measurements to be made of the magnetic resonance signal arising from a sample . thus , we used multiple receiver / digitizers , and multiplexed the digital data stream from these receivers as they pass into the host computer which records the data . in other words , we employ parallel receivers , with multiplexing performed in the digital domains . system stability is easily maintained , and each channel operates at its full bandwidth , with no compromise in image quality . the analog channels are completely independent , preserving the full snr benefit of phased array coils . each data channel is sampled simultaneously , so no ghosts arise from interleaved sampling . the system data bottleneck is moved to the digital data acquisition bus ; the limit on data acquisition becomes the speed of the digital input port on the system host computer . referring to the block diagram of fig1 a ge signa 5 . 4rp system with the multicoil 11 , multi - preamp 13 imaging option ( general electric medical systems , milwaukee , wis .) was provided with an anmr ( advanced nmr systems , wilmington , mass .) echoplanar gradient upgrade . the anmr echoplanar system was designed as an add - on upgrade to a conventional general electric signa magnetic resonance system . in order to simplify the system integration , the echoplanar system operates completely independently of the signa system . the only connections between the systems are a synchronization signal derived from the signa &# 39 ; s data bus , a unidirectional control sequence sent from the signa to the anmr receiver system , and a tcp / ip connection which allows the transfer of data to and from the signa . control of the gradients during echoplanar acquisition is passed to the anmr system through high current transfer relays , and all rf data is diverted to the anmr system by the use of rf relays 18 , 19 . the anmr receiver system demodulates and digitizes the data , and passes it over a parallel bus 20 to the anmr host computer system 28 where it is placed into memory to await reconstruction and processing . by design , this data acquisition process is fully autonomous , and requires no intervention by the anmr host computer . the phased array system adds three additional anmr receiver systems 15 , operating in parallel to the standard receiver system . these receivers , called rf baseband units , or rfbbs , are separately packaged rack mounted units . the four rfbbs ( 15 , 16 ) perform the downconversion and sampling of the rf input signal , and output two 16 bit digital data words for each sample . this data stream is processed by a digital multiplexer 26 and passed to the host computer 28 . the major new component in the phased array data acquisition system is the digital multiplexer ( 26 in fig1 ). this device performs two major tasks . the first is to echo all the control and setup signals intended for the primary rfbb to all of the rfbbs . these signals include the sample trigger , local oscillator , and a 10 mhz frequency reference . in order to ensure simultaneous sampling in the four receivers , great care must be taken to ensure that the time delay to each receiver is the same , by using identical buffers and cables of the same length . a serial control line which sets reciever parameters , which is not time critical , is also echoed by the multiplexer . the second task performed by the multiplexer is to interleave the digital data streams from the separate rfbb &# 39 ; s into a single data stream which can be fed to the input port 36 on the anmr host vme system . when a sample pulse is sent to the rfbbs the multiplexer performs all the handshaking with the receivers , latching the sample data in a buffer when it becomes ready . when the data on all channels is ready , the samples from each receiver are clocked out sequentially to the input port on the vme computer . the data is sent at a rate slightly higher than four times the existing peak sampling rate of 1 complex number per 2 . 5 us ( 0 . 4 mhz ). the existing data bus and buffer was sufficiently fast to handle this increased data load without modification . the multiplexer can be set to use one , two , or four receivers by front panel switches . in single receiver mode , the multiplexer acts transparently , and operation is identical to the standard system . the digital multiplexer is built into a 12 inch high , 19 inch rack mount case ( not shown ). the multiplexer and the three additional receivers are housed in a 7 foot tall , 19 inch rack mount cabinet in the signa equipment room . the only additional hardware in the system is the four channel rf transfer switch to divert the multicoil data from the ge receiver system to the four rfbbs . this replaces the single channel switch already in the system . modifications to the host computer software to accept the additional data are minimal . an extra variable can be added to the header file generated by standard pulse sequences to specify the number of coils and increase the data buffer size accordingly , or the number of coils can be specified manually on the host computer at acquisition time . reconstruction is straightforward ; first , the interleaved raw data is separated by receiver and the images from the individual receivers are reconstructed independently . the single coil images are then combined in a way that optimizes the snr of the resultant image . this important step is easily performed on the magnitude images by using the ` sum of squares ` method ( 1 ). if p ( i , n ) denotes the n th pixel from receiver i , the n th pixel in the combined image , p c ( n ), is simply : ## equ1 ## reconstruction is performed offline , or it can be performed on the scanner to provide immediate feedback to the experimenter . in order to fully exploit the power of the phased array receiver system for functional imaging , phased array coils are preferably used which are optimized for the type of functional experiment being performed . two such arrays which we have evaluated are described below . the phased array coil configurations described are based on designs previously tested for high resolution neuro - imaging . ( wald et al . reson . med , 34 : 433 - 439 , 1995 ; wald et al ., magn . reson . med . 34 : 433 - 439 , 1995 ). these coils are constructed by etching flexible circuit board ( pyrolux r , dupont , wilmington , del .) to improve durability and reproducibility and are contoured to the shape of the head . activation experiments can benefit significantly from phased array functional imaging . a commonly used experimental paradigm in functional imaging are photic stimulation , where neural activation is measured in the calcerine fissure in response to stimulation with light ( ogawa et al ., proc . natl . acad . sci . usa 89 : 5675 - 5679 , 1990 ). the relatively small signal change resulting from neural activation makes optimization of the snr critical for fmri experiments , and has led to the widespread use of surface coils for these experiments . however the non - uniform spatial profiles of surface coils has meant that this additional snr has come at the expense of spatial coverage , so that correlated activity in different brain regions may go undetected . phased array coils with sensitivity profiles tailored to the expected areas of activation allow expanded spatial coverage without sacrificing the snr benefit of surface coils . fig2 a shows a design for one type of visual / temporal array 50 , a four coil horizontal array which covers the region of activation typically seen in photic experiments , while also detecting the signal from the middle temporal lobe with high efficiency . signal to noise comparisons performed using conventional imaging techniques show that in the region where photic activation is typically observed the average snr increase is 7 %. the increase in the temporal lobe is more dramatic -- 180 %. because the receiver design described above keeps the signals completely independent until after digitization , the snr gain in the phased array echoplanar system is expected to be identical to that in the phased array conventional system . another use of functional imaging is brain perfusion mapping with dynamic susceptibility contrast ( dsc ) imaging ( belliveau et al ., magn . reson . med . 14 : 538 - 546 , 1990 ; harris et al ., am . j . psychiatr . 153 : 721 - 724 , 1996 ). for this type of experiment , good coverage of a large fraction of the cortex is necessary ( depending on the brain area of interest ). to demonstrate this , we have used a bilateral temporal lobe array 52 optimized for coverage of the temporal and frontal cortices , the regions shown to have the largest perfusion defects in alzheimer &# 39 ; s disease . the coil is shown schematically in fig2 b . the snr in the frontal and temporal cortical regions ( the region of interest for dsc mapping ) measured using conventional images is increased with the phased array coil by ˜ 100 % relative to the quadrature head coil . two experiments were performed using the echoplanar phased array system in order to demonstrate the snr increase of the system relative to single coil fmri . in order to evaluate the effect of the phased array on the detection of activation in a bold experiment , a photic stimulation experiment was performed . the subject was a healthy 35 year old female volunteer . bilateral visual stimulation was provided by led goggles ( grass instrument company , quincy mass .) flashing at 8 hz . thirty seconds of stimulation were alternated with 30 seconds of rest , while echoplanar gradient echo images were recorded ( flip angle = 66 °, tr = 2 s , te = 40 ms , 128 × 64 pixels in a 40 cm × 20 cm fov , slice thickness = 7 mm with no gap between slices , obtained obliquely parallel to the calcerine fissure ). the experiment was performed twice ; first with a general electric 5 &# 34 ; general purpose surface coil placed over the visual cortex , and subsequently with the 4 coil visual / temporal array centered on the same position . care was taken to position the patient identically between the two exams , and the slices were relocalized when the coils were changed . after each experiment , the data sets were motion corrected using the dart registration algorithm ( maas et al ., magn . reson . med . 37 : 131 - 139 , 1997 ). activation maps were then calculated for each image series by cross correlating the time history of the image intensity value at each pixel in the image with a reference waveform , as described by bandettini et al ., ( magn . res . med . 20 : 161 - 173 , 1993 ). a comparison was also performed on a cbv mapping experiment . two cbv maps were made of a 37 year old healthy male volunteer . the first data set was obtained using the standard ge quadrature head coil . the coil was then replaced with the bilateral temporal lobe array described above . in each case , a series of 50 images of 10 slices were recorded ( spin echo , tr = 2s , te = 100 ms , 128 × 64 pixels over a 40 cm × 20 cm fov , slice thickness = 7 mm with a 3 mm gap between slices ). twenty seconds into each scan ( after 10 reference images ) a bolus of 0 . 10 meq / kg of prohance was injected into an iv line in the antecubital vein . cbv images were calculated from the data sets by the dynamic susceptibility contrast method described by belliveau , et al . supra . the cbv maps are compared in fig6 a and 6b . the image quality is clearly higher in the frontal and temporal regions of the phased array images . image quality is even in the center of the head . this is consistent with the superior signal to noise ratio of the bilateral temporal array previously demonstrated for conventional images calculated photic activation maps are shown in fig3 a and 3b . these image data sets have been processed identically ; the colored pixels represent activated pixels in the brain , with the color indicating the statistical significance and the sign of the correlation of the detected activation . the image on the right , taken with the phased array , detects activation with significantly higher statistical significance than the surface coil image throughout the visual cortex . in addition , this image shows activation in the visual association area which is not detected with the surface coil , due to the enhanced coverage of the temporal lobe area due to this coil . one interesting feature to note is that there are regions of detected activation in the temporal lobe areas which are negatively correlated with the activity detected in the visual cortex . whether this is due to neuronal inhibition or due to blood flow diversion from these areas to the visual cortex is not discernable from these images ; however , this phenomenon is clearly not detected using the standard surface coil method , and hints at the new types of phenomena which can be explored using this system . the single shot signal to noise ratio of echoplanar imaging is one of the fundamental limits to most functional imaging techniques . while the use of dedicated surface coils has provided great advantages for certain types of experiments , the more general problem of improving the snr of echoplanar imaging over large regions requires the use of phased array coils , high field scanners , or both . we have demonstrated that a standard clinical echoplanar system can be modified quite economically to take full advantage of the benefits of phased array imaging . the phased array coils can be used to increase the snr in a single region over conventional surface coils , increase the coverage area , or a combination of the two . in addition to increasing the quality of functional image data sets , phased array coils facilitate new types of experiments which detect patterns of functional response over large spatial areas . while we have focused on functional imaging in the brain in this study , this system could have great benefits for echoplanar studies of other organs , such as the heart . all references cited herein are hereby incorporated by reference .	6
referring now to fig1 an airbag module , comprises a reaction canister 11 , an inflator 22 inside the reaction canister near the bottom of the reaction canister 11 , and further comprises an airbag 26 inside the reaction canister 11 , and a deployment door 30 covering the open top of the canister 11 . an electrical conductor 24 is connected at one end of the inflator 22 to an igniter ( not shown ) inside the inflator and the conductor leads away to a deceleration detector ( not shown ) in the vehicle . the reaction canister 11 is a trough - like container defined by a hemi - cylindric bottom 20 , opposed sidewalls 12 and 14 extending outward from the bottom 20 , end walls 16 and 18 covering opposed ends of the canister 11 , and a transverse diffuser plate 28 which is attached to the canister 11 and extends across the inside of the reaction canister 11 between the sidewalls 12 and 14 where those walls join the bottom 20 . the diffuser plate separates a chamber containing the inflator 22 in the bottom 20 of the canister 11 and an airbag container between the diffuser plate 28 and the open top of the canister 11 . the airbag container in the embodiment shown is an integral part of the reaction canister , defined by the sidewalls 12 and 14 , and end walls 16 and 18 . it extends from the diffuser plate 28 outward to the open top of the canister 11 . an airbag 26 is folded inside the airbag container with the mouth of the airbag 26 attached to the diffuser plate 28 . gas will flow from inflator 22 through the diffuser plate 28 into the mouth of the airbag 26 . a deployment door 30 is fastened to the reaction canister 11 and covers the open top of the canister . the deployment door 30 comprises a face panel 32 which covers the airbag container at the open top of the reaction canister 11 and further comprises two side panels 34 and 36 extending at angles , generally essentially perpendicularly , from the inner side of the face panel 32 for attachment of the door 30 to the reaction canister 11 . each of the two side panels 34 and 36 on the deployment door 30 has a plurality of longitudinal keyways 38 spaced apart along its length near the distal edge of the side panel . fig2 shows the detail of the adjustable connection of one keyway 38 and one t - shaped key 46 . the key 46 shown in fig2 is standing on the sidewall 14 at one edge of the sidewall 14 . each of the longitudinal keyways 38 in the side panels 34 and 36 comprises a wide section 40 at one end of the keyway 38 and a narrow section 42 at the other end . the heads 44 at the outer ends of opposed t - shaped keys 46 on the sidewalls 12 and 14 can pass through the wide sections 40 of the keyways 38 in the side panels 34 and 36 but cannot pass through the narrow sections 42 . the stems 48 of the t - shaped keys 46 , however can pass into the narrow sections 42 of the keyways 38 . as shown in fig3 the deployment door 30 may further comprise fastening members 50 and 51 at the distal ends of side panels 34 and 36 which members provide a preferred means for immovably fixing the position of the deployment door 30 in the vehicle , after adjustment of the position of the deployment door 30 , by attaching the fastening members 50 and 51 to structural members of the instrument panel on its under side . the reaction canister sidewalls 12 and 14 are fitted on their outer surfaces with a plurality of standing keys 46 spaced apart along longitudinal lines on the outer surfaces of sidewalls 12 and 14 near the open top of the trough - shaped reaction canister 11 . as shown in fig5 each of the standing keys 46 has a narrow stem 48 attached to and extending outward from the sidewalls 12 and 14 of the reaction canister 11 and a wider head 44 at the distal end of the stem 48 . the standing keys 46 are positioned on the sidewalls 12 and 14 of the reaction canister for engagement with corresponding longitudinal keyways 38 in the side panels 34 and of the deployment door 30 . shown in fig1 on the outside of one of the sidewalls 14 of the reaction canister are three standing keys 46 , spaced apart symmetrically on a line parallel to and near the longer edges of the sidewalls 34 and 36 at the open top of the reaction canister 11 . in the embodiment shown , the body of the reaction canister 11 , except the end walls 16 and 18 , is a unitary aluminum extrusion product which comprises the curved bottom 20 and the sidewalls 12 and 14 of the reaction canister 11 and a number of sleeves with longitudinal slots for connecting other members of the airbag module to the reaction canister 11 , as discussed hereinafter . those walls , bottom , and sleeves are formed by extrusion as integral parts of the reaction canister 11 . the keys 46 on the sidewalls 12 and 14 of the reaction canister 11 can also be formed by extrusion as integral parts of the reaction canister . to do this , the unitary extrusion product is formed with a continuous linear boss having a t - shaped key cross section standing along the outer surface of sidewalls 12 and 14 of the reaction canister 11 near its open top . portions along the length of the continuous boss are then machined away leaving the standing keys 46 spaced apart on lines along the length of the each of the reaction canister sidewalls 12 and 14 . the stem 48 and the head 44 of each key 46 are of the same length along the axis of extrusion but the head 44 is wider in cross section than the stem 48 . in some preferred embodiments a key 46 may further comprise a retaining screw groove 52 , formed during extrusion , in the top of the head 44 along the center line of the key 46 , as best illustrated in fig2 and 5 . the retaining screw grooves 52 in keys 46 standing at the edges of the sidewalls 12 and 14 are used to fasten the end walls 16 and 18 to the sidewalls 14 and 16 by means of self - threading screws 54 , as shown in fig2 and 4 . the invention is not limited to use with a reaction canister that has been formed by extrusion . keys can be formed on walls of a reaction canister or an airbag container made in other ways and from other materials . for example , other suitable standing keys with narrow stems and wide heads can be formed on the walls of an airbag container or reaction canister made from sheet metal by metal stamping or such keys can be attached individually by welding or other means . the essential structure is a key standing on the outer wall surface of the reaction canister or a member attached thereto and comprising a narrow stem supporting a wider head . in the assembly of airbag module 10 , as shown in fig1 after the inflator 22 is placed inside the curved bottom 20 of the reaction canister 11 and the mouth of the airbag 26 is fastened to the diffuser plate 28 by means of retaining rods 56 held inside longitudinal sleeves 58 on opposed peripheral edges of the diffuser plate 28 . the diffuser plate 28 is fastened to the canister 11 separating the airbag container from the inflator 22 by slipping sleeves 58 in retaining grooves 59 on the inside wall of the canister . the airbag 26 is folded inside the airbag container . the end walls 16 and 18 of the canister are attached to the ends of sidewalls 12 and 14 and the electrical conductor 24 is suitably attached to inflator 22 . the airbag module 10 is now ready for attachment of deployment door 30 to the reaction canister 11 . to connect the deployment door 30 to the reaction canister 11 , the face panel 32 of the deployment door is placed over the open top of the canister and the side panels 34 and 36 of the deployment door are brought down against opposed sidewalls 12 and 14 of the airbag reaction canister , passing the wider heads 44 of the keys 46 on the reaction canister through the wide sections 40 of keyways 38 on the side panels 34 and 36 . from the position with the keys 46 standing in the wide sections of the keyways 38 , the deployment door 30 is moved lengthwise to bring the stems 48 of the keys 46 into the narrow sections 42 of the keyways 38 . now the narrow sections 42 of the keyways 38 are under the larger heads 44 of the keys . fig2 and 5 show detail of the structure of the adjustable connection joining the deployment door 30 to the reaction canister 11 at one of the keys 46 on the reaction canister . the key 46 is shown with its stem 48 inside the narrow section 42 of the corresponding keyway 38 . the deployment door 30 covers the open top of the reaction canister 11 and the keys 46 in the keyways 38 connect the door to the canister 11 . the connection allows a limited degree of play between the engaged keyways 38 and keys 46 to permit limited freedom of movement of the deployment door 30 with respect to the reaction canister 11 . the length and width of the narrow section 42 of the keyway 38 are larger than the length and width of the stem 48 of the key 46 , and the height of the stem 48 below the head 44 of the key is larger than the thickness of the side panels 34 and 36 , by limited amounts that will allow a degree of free movement of the deployment door 30 in at least three directions while at the same time securely fastening the deployment door 30 to the reaction canister 11 . this freedom of movement may be needed to make accurate adjustment of the fit and finish of the deployment door 30 in the instrument panel after the reaction canister 11 has been installed in the vehicle . after the deployment door 30 has been adjusted for accurate fit and finish it can be fixed in position to maintain accurate fit and finish by fastening it immovably to the instrument panel by means of fastening members 50 and 51 on the under side of the deployment door which can be fastened , for example by screws or stakes , to the instrument panel by means of corresponding structural members provided for this purpose on the under side of the instrument panel . to prevent the deployment door 30 from sliding back so that keys 46 would move out of the narrow sections 42 of the keyways 38 into the wide sections 40 , any locking means suitable for that purpose can be used . the locking means should not interfere with the limited adjustability of the connection . a preferred locking means , shown in fig2 and 3 and 6 , is a ramp 64 molded on the under surface of the side panel 34 of the deployment door 30 . the ramp 64 is located on the under surface of the side panel at a point where the ramp 64 will slide over the surface of the sidewall 12 or 14 of the canister 11 until the stem 48 of the key 46 is inside the narrow section 42 of the keyway and then the ramp 64 will slide off and catch the edge of the sidewall 12 or 14 . as the deployment door 30 is moved lengthwise along the reaction canister sidewalls 12 and 14 to bring the keys 46 into the narrow sections 42 of the keyways 38 , as described above , the side panels 34 and 36 of the deployment door so are flexible enough so the ramp 64 on the under side of the side panel can slide over the surface of the sidewall of the canister 11 . when the keys 46 have been brought into the narrow sections 42 of the keyways 38 , the ramp 64 has moved past the edge of the canister 11 . the resilience of the side panel snaps the side panel down towards the canister surface and thus moves the ramp 64 downward so it will engage the edge of the canister . the ramp engaging the edge of the canister then prevents the deployment door 30 from sliding back lengthwise . thus , the narrow section 42 of the keyway 38 is held in position under the wider head 44 of the key 46 so the deployment door 30 is securely held to the reaction canister 11 by the adjustable connection . fig2 and 4 illustrate the use of self - threading screws 54 which can be removably fastened into retaining screw grooves 52 formed along the top of the keys 46 . the screws 54 are inserted through holes in the end walls 16 and 18 of the canister 11 and screwed into center grooves 52 of keys 46 standing at each end of the sidewalls 12 and 14 on the canister 11 . this secures the end walls 16 and 18 to the sidewalls 12 and 14 near the open top of the canister . fig7 shows an airbag module with the airbag 26 folded and stored inside the reaction canister 11 and a deployment door 30 covering the open top of the canister . the deployment door 30 is fastened to opposite sidewalls 12 and 14 of the reaction canister 11 by means of keyways 38 on the side panels 34 and 36 of the deployment door engaging keys 46 on the sidewalls of the reaction canister as described above . one side panel is fastened to the face panel by a breakable tear seam 66 which holds the door shut until the tear seam is broken or torn by impact of the airbag 26 against the face panel 32 as the airbag is being deployed . when the tear seam 66 is broken , the face panel 32 is pushed away by the deploying airbag 26 and swings open on a hinge 68 which holds the face panel to the other side panel , making way for deployment of the airbag from the reaction canister as shown in fig8 . in the foregoing specific example the airbag container is an integral part of the reaction canister 11 , so the deployment door 30 is attached directly to the reaction canister 11 and the keys 46 are standing on the reaction canister . in other airbag modules embodying the invention a deployment door may be connected indirectly to the reaction canister through other members of the airbag module , e . g . connected to an airbag container on which the keys are standing and which in turn is attached to the reaction canister . in other embodiments the airbag container may be defined partly or entirely by extended side and end panels of the deployment door , which extended panels are connected to a reaction canister by an adjustable connection in accordance with the invention . in all of those cases the deployment door is connected by an adjustable connection , either directly or indirectly , to the reaction canister . with the foregoing description of the invention , those skilled in the art will appreciate that modifications may be made to the invention without departing from the spirit thereof . therefore , it is not intended that the scope of the invention be limited to the specific embodiments illustrated and described . the foregoing and other variations and equivalents of the invention described are within the intended scope of the invention defined by the following claims .	1
referring to the figures , an illustrative embodiment of a fairing removal tool according to the present invention is generally indicated by reference numeral 10 . fig1 and 2 illustrate a side view and a top view of one embodiment of a fairing removal tool 10 , respectively . the fairing removal tool 10 includes a handle 12 , a shaft 14 , and a head 16 . the handle 12 allows an operator to easily grip the fairing removal tool . the handle 12 may be contoured to fit comfortably in an operator &# 39 ; s hand . the handle 12 may also be shaped , textured , or covered with a non - slip material so that an operator may easily grip the handle securely with a minimum of slippage when the fairing removal tool is in use . the shaft 14 connects the handle 12 to the head 16 . the head 16 includes a prying radius 18 . while the fairing removal tool 10 of fig1 and 2 has a generally curved convex prying radius 18 , the fairing removal tool of the present invention is not limited to this configuration . the prying radius 18 may also have a flattened v - shape or other geometries suitable for providing a fulcrum or fulcrums necessary for effective prying . the prying radius 18 may include an effective prying area 24 and a prying relief 26 . the effective prying area 24 is the area of the head 16 that contacts the fairing as it is removed . contact points along the effective prying area 24 act as fulcrums as the fairing is pried from an inner strut . a more detailed discussion of fairing removal is provided below . in an exemplary embodiment , the effective prying area 24 will have a length approximately equal to the length of the bond between the fairing and the attached inner strut . in such an embodiment , the entire or nearly the entire effective prying area 24 can be utilized as a fulcrum during release of the bond joining the fairing and inner strut . the prying relief 26 is the area of the fairing removal tool head that does not directly contact the fairing during fairing removal . the head 16 also includes a hook 20 near the end of the head 16 distal the handle 12 and a notch 22 located between the hook 20 and the prying radius 18 . the hook 20 and notch 22 are configured to engage a downstream end of a fairing allowing an operator to pry and disengage the bond between the fairing and a joined inner strut , or a similar structure , bonded to the fairing . the hook 20 and notch 22 allow an operator to easily position the tool on a downstream end of a fairing . fig3 illustrates a fairing removal tool 10 engaged to a downstream end of a fairing 28 that is bonded to an inner strut 30 . the downstream end of the fairing is positioned within the notch 22 of the fairing removal tool during use . as fig3 illustrates , when the downstream end of the fairing 28 is engaged with the fairing removal tool 10 , the inner side of the fairing abuts the hook 20 and the end and outer sides of the fairing are located within the notch 22 . ideally , the hook 20 and notch 22 are configured so that when the fairing removal tool 10 is engaged to a downstream end of a first fairing 28 , an adjacent fairing 32 does not interfere with the shaft 14 and the handle 12 of the fairing removal tool as shown in fig3 . thus , an operator may both position the fairing removal tool on the downstream end of the fairing and operate the tool without interference from adjacent fairings . this is accomplished most easily near the outer diameter ring where adjacent struts 30 and fairings 28 , 32 are spaced apart farthest . closer to the central inner ring , however , the struts and fairings are closer together . in an exemplary embodiment , the hook 20 and notch 22 are configured so that even near the central inner ring , an adjacent fairing 32 does not interfere with the shaft 14 and the handle 12 of the fairing removal tool when engaged to a fairing . additionally , the hook 20 and notch 22 do not interfere with the first variable vanes 36 . the fairing removal tool acts as a first class lever . release of a bond 34 between a fairing 28 and an inner strut 30 is accomplished by first engaging a downstream end of the fairing 28 with the hook 20 and notch 22 of the fairing removal tool 10 as illustrated in fig3 and described above . once engaged , the operator applies force to the handle 12 or shaft 14 of the fairing removal tool 10 generally in a direction toward the longitudinal axis of the fairing 28 as shown in fig4 to pry the fairing away from the inner strut . as force is applied to the handle 12 or shaft 14 , the downstream end of the fairing 28 is pulled by the hook 20 away from the inner strut 30 . during prying , the downstream end of the fairing is pulled along the prying radius 18 . as the fairing is pulled , the bond 34 between the fairing 28 and inner strut 30 is released . in an exemplary embodiment , the length of the bond 34 is about equal to the length of the effective prying area 24 of the prying radius 18 . the length of the bond 34 between the fairing 28 and inner strut 30 is typically between about 2 inches ( 5 . 1 cm ) and about four inches ( 10 . 2 cm ). fig5 illustrates a view from an area of the engine inlet case downstream of the fairings where engagement of the fairing tool with a downstream end of a fairing has occurred and prying of the fairing has begun . the area of the fairing 28 engaged with fairing removal tool 10 has become separated from the inner strut 30 . areas of the fairing not directly engaged to the fairing removal tool but adjacent such areas have also separated from the inner strut , but to a lesser degree . due to the typical strength of the bond 34 between a fairing 28 and an inner strut 30 and the lengths of the fairing and inner strut , one instance of prying may be insufficient to release the bond 34 over the entire length of the inner strut . in these instances , it is necessary to repry the fairing at a different location along the length of the fairing . once the fairing has been pried at enough locations along its length , the bond 34 may be fully released . a fairing 28 is typically bonded to an inner strut 30 along both downstream sides ( fig3 and 4 ). thus , bonds 34 along both sides of the inner strut 30 must be released before the fairing 28 can be completely removed . the process described above is performed on both sides of the fairing 28 until both bonds 34 are released . once both bonds 34 are released , the operator may fully remove the fairing 28 from the inner strut 30 and the engine inlet case . dimensions of one exemplary embodiment of the fairing removal tool 10 are provided below . the description of this embodiment does not impose limitations on other possible configurations and dimensions of the fairing removal tool or its components , however . the overall length of one embodiment of the fairing removal tool is about eighteen inches ( 45 . 7 cm ). the lengths of the handle , shaft , and head are about four inches ( 10 . 16 cm ), ten inches ( 25 . 4 cm ), and four inches ( 10 . 16 cm ), respectively . the width of the head is about one inch ( 2 . 54 cm ). the depth of the notch 22 is about 0 . 1 inches ( 0 . 254 cm ) and the width of the notch 22 ( the distance from the hook to the prying radius ) is about 0 . 07 inches ( 0 . 178 cm ). the angle of the notch 22 relative to the longitudinal axis of the fairing removal tool 10 is about thirty degrees . the width of the head may affect the number of pries necessary to release the bondline between a fairing and an inner strut . thus , head widths between about 0 . 5 inches ( 1 . 27 cm ) and about two inches ( 5 . 08 cm ) may be suitable for smaller or larger engine inlet cases . the fairing removal tool and its components may be comprised of steel or any other materials strong enough to facilitate the fairing removal process . the configurations of the fairing , inner strut , and the fairing removal tool allow an operator to work from the front of the engine inlet without the need for the operator to position his hand downstream of the fairing . the design of the fairing removal tool also allows fairing removal without the need for removing engine inlet components downstream of the fairing and inner strut , such as the first row of variable vanes . the design of the fairing removal tool further allows an operator to engage in fairing removal from the ground or while on the wing of the aircraft near the engine inlet . although the present invention has been described with reference to exemplary embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .	8
referring to fig1 a plurality of reflective cells in an embodiment of the invention , are generally designated by reference character 10 and installed within a conventional microwave oven generally designated by reference character a . the cells 10 can be arranged in rectilinear rows in which the cells are spaced at least 1 / 16 inch in order to prevent arcing between the cells 10 . preferably , the rows of cells 10 cover substantially the entire bottom wall b of the oven a and the cells are elevated at a distance , for example 3 / 4 to 1 inch above the wall b . in this embodiment , the food to be cooked is placed above the cells 10 as more fully described hereinafter . referring to fig2 and 3a , each cell 10 includes three reflectors 12 , 14 and 16 formed by strips of aluminum or similar material which reflects microwaves . the reflectors 12 , 14 and 16 are bonded to a flexible rubber sheet 18 . the reflectors 12 , 14 and 16 are spaced approximately 1 / 16 to 1 / 8 inch in side - by - side parallel arrangement . the middle reflector 14 is attached to a lower surface of a fixed plate 20 of plastic or similar material which is transparent to microwaves . this central reflector 14 is held horizontally stationary by the plate 20 which preferably extends to support the central reflector in all of the cells 10 . the sheet 18 provides flexible hinging between the reflector 14 and each of the other reflectors 12 and 16 , which allows the reflectors 12 and 16 to pivot in relation to the fixed central reflector 14 . the reflectors 12 and 16 pivot about respective portions 18a and 18b of the sheet 18 narrowly separating the reflectors 12 and 16 from the fixed reflector 14 . as shown in fig2 when the oven a is not in operation , the reflectors 12 and 16 are pulled by gravity to extend in generally vertical parallel planes below the plane of the horizontally oriented reflector 14 . in this configuration , the reflectors 12 and 16 face one another in spaced opposition . between the vertically oriented reflectors 12 and 16 , a u - shaped bimetallic element 22 is disposed so that the arms 22a and 22b of the u - shaped element 22 extend horizontally in generally spaced , parallel opposition between the reflectors 12 and 16 , when the oven a is not in operation and the element 22 is in generally &# 34 ; cold &# 34 ; condition . any conventional bimetallic element , for example copper - aluminum , can be employed in suitably fabricated , u - shaped configuration . the arms 22a and 22b can be dimensioned , for example , approximately 3 / 4 inch in length and extend horizontally parallel and below the horizontal plane of the reflector 14 . between the arms 22a and 22b , a bar 24 of ferrite or similar material which readily absorbs microwaves is positioned to heat the element 22 . referring to fig3 the bight portion 22c of the element 22 is attached to the sheet 18 below the stationary reflector 14 so that the bight 22c is fixed while allowing the arms 22a and 22b to freely move horizontally between the positions illustrated in fig2 and 4b . the bar 24 is stationary and can be attached to the bottom surface of sheet 18 below the central reflector 14 . as shown in fig2 the cells 10 have a floor 26 of plastic or similar material which is transparent to microwaves and both the bight 22c and the bar 24 can be alternatively fixed to the upper surface of the floor 26 . plastic columns 28 separate the plate 20 from the floor 26 . the central reflector 14 shields the bar 24 from microwaves directly transmitted from the generator so that the bar 24 does not overheat . referring to fig4 a , a relatively large portion of food c is placed within the oven a above the plate 20 and will extend over a plurality of the cells 10 , which are in the range 1 - 2 inches long . when the oven a is operated , the conventional microwave generator ( not shown ) directs microwaves represented by arrows d downward through the food c which absorbs some of the microwaves while other microwaves pass through the food c and are reflected upward by impingement against the central reflector 14 or the bottom wall b of the oven . additionally , the microwave generator directs some of the microwaves angularly against the sidewalls of the oven a which reflects these microwaves ( not shown for simplicity ) angularly downward through the food . thus , microwaves are reflected from the bottom wall b in both normal and angular directions . as a result of numerous angularly reflected microwaves , the bar 24 will absorb microwaves and begin to generate heat . the heat generated by the bar 24 is conducted to the bimetallic element 22 . as the element 22 heats , the arms 22a and 22b move apart or spread horizontally and force the respectively engaged reflectors 12 and 16 to pivot upwardly into the sequential phantom positions shown in fig4 a . as a result of the pivotal motion of the reflectors 12 and 16 , some of the microwaves d which pass through the food c and the plate 20 will impinge on and reflect from the reflectors 12 and 16 at progressively different and decreasing angles as shown by the reflected microwaves d &# 39 ;. the reflected , microwaves d &# 39 ; pass through the food c at angles which change with the pivotal movement of the reflectors 12 and 16 and thus , traverse different paths through the food c as the pivotal motion progresses . referring to fig4 b , once the arms 22a and 22b have fully spread and forced the reflectors 12 and 16 into the horizontal coplanar position , the reflectors 12 and 16 will engage the lower surface of the plate 20 which is generally cooled by food which has only begun to heat . the reflectors 12 and 16 are thus cooled by the plate 20 resulting in cooling of the arms 22a and 22b which remain in respective engagement with the cooled reflectors 12 and 16 . as the arms 22a and 22b cool , they retract inwardly toward one another allowing the respective reflectors 12 and 16 to pivot downwardly in the reverse paths of motion illustrated in fig4 a . thus , after temporarily reaching the coplanar positions shown in fig4 b in which the reflected microwaves d &# 39 ; are directed upward and generally coincident with the impinging microwave d , the downwardly pivoting reflectors 12 and 16 will again reflect microwaves at progressively increasing angles in reverse of the progression shown in fig4 a . however , since the bar 24 continues to heat , the arms 22a and 22b become increasingly heated as they retract and will once again spread forcing the repeated upward pivot of the reflectors 12 and 16 . as a result of the cycled , upward and downward pivotal motion of the reflectors 12 and 16 , the microwaves reflected therefrom will also be directed at cycled , increasing and decreasing angles so that the food c is subjected to a changing gradient in concentration of microwaves d &# 39 ;. this changing gradient prevents absorption of microwaves at fixed concentrations in the various strata within the food , and thus eliminates creation of &# 34 ; hot spots &# 34 ;. the effect of the cycled change in the direction of reflected microwaves d &# 39 ; in fig4 a will be multiplied by the microwaves initially directed by the generator against the sidewalls of the oven which are reflected therefrom to impinge the reflectors 12 and 16 and thus , are subjected to the similar change in reflected angles . each cell 10 operates independently of the other cells . the combined effect of the action of the cells is an upward shifting in the focus of microwave concentration ( referred to as the power curve ) in the design of the oven , as well as a multiplicity of motions redirecting reflected microwaves , both of which are particularly beneficial in microwave cooking of large or thick portions of food . in modified embodiments , the cells can be incorporated into containers for cooking food , for example , a bowl . referring to fig6 a bowl generally designated by reference character 100 has a wall 102 within which are embedded a plurality of cells generally designated by a reference character 110 the wall 102 is plastic or similar material transparent to microwaves . referring to fig5 a , the cell 110 includes a stationary generally circular configuration of diametrically intersecting rods 112 of aluminum or similar material which reflects microwaves . as best shown in fig5 b , the rods 112 form a pattern of eight radial projections , however the number of projections may be variable and is dependent upon maintaining a distance between the peripheral ends 112a less than approximately 1 / 2 inch , and therefore , fewer or greater than eight radial projections may be required depending upon the length of the rods 112 and the size of the cell 110 . each cell 110 further includes a generally circular , bimetallic coil 114 which circumscribes and is connected to a wheel 115 on which the ends of eight ( 8 ) diametrical spokes 116 are attached . the spokes 116 intersect coaxially with the intersection of the rods 112 , and the coil 114 is dimensioned so that in its &# 34 ; cold &# 34 ; condition the spokes 116 are superimposed on rods 112 in congruent manner . the spokes 116 are also made of aluminum or similar material which reflects microwave . referring to fig5 b and 6 , when the bowl 110 containing food product ( not shown ) is placed in a microwave oven and cooking is begun , the food heats and conducts heat to the coil 114 . as best shown in fig5 b , the heated coil 114 expands in an unwinding motion so that spokes 116 are rotated from the superimposed position of fig5 a to the position of fig5 b in which the spokes 116 generally bisect the angles between the radial projections of the rods 112 . in this position , the adjacent ends 112a and 116a of the respective rods 112 and spokes 116 will be at a distance of approximately 1 / 4 inch . the microwave typically have a wavelength less than 1 / 4 inch and the configuration of alternating rods 112 and spokes 116 effectively reflects the bulk of the microwaves directed at the cell 110 . particularly when the food is very cold or frozen , the peripheral area of the food can become heated and thus heat the coil of a particular cell 110 , even though the interior of the food may temporarily remain cool or frozen . as a result , the peripheral area which heats the coil 114 can cool again by contact with flowing liquid produced in the heating process or by simple heat transfer to the remaining cool or frozen areas . thus , the peripheral area of the food can again cool the coil 114 and reverse the rotation of the spokes 116 to approach their original position as shown in fig5 a , which again allows the microwaves to pass through the cell 110 . the unwinding and winding of the coil 114 is thus dependent upon the heating and cooling of the peripheral area of the food in which a particular cell 110 is in contact . the combined effect of the coil motion in the plurality of cells 110 produces changing concentration of the microwave reflection passing through various strata within the food to promote uniform heating . referring to fig7 a , a reflective cell 210 is a modified embodiment of a cell for incorporation into the wall of a bowl or similar food heating container . the cell 210 includes a bimetallic element 212 which has four arms 212a which are bent from their central intersection to form a cone - like cruciform . the bimetallic element 212 can be stamped and bent into the cone - like configuration of fig7 a , and then incorporated into the wall of a container similar to the bowl in fig6 . referring to fig7 b , when the microwave oven is operated and cooking is begun , the heated periphery of the food ( not shown ) heats the element 212 causing the arms 212a to spread outwardly into a generally planar configuration in which the arms 212a intercept and reflect the bulk of the microwaves directed at the cell 210 . when the periphery of food products cools , the arms 212a will again fold inward to the cone - like configuration of fig7 a , followed by reheating into the configuration of fig7 b . in this embodiment , the element 212 serves as both the bimetallic element and the reflector . the combined motions of the cells 210 promote uniform heating of the food by changing the concentration of microwave reflection passing through various strata within the food . variation in the size and structural features of cooperating parts and the materials used may occur to the skilled artisan without departing from the scope of the invention which is set forth in the claims hereto appended .	8
the following is intended to provide a detailed description of an example of the invention and should not be taken to be limiting of the invention itself . rather , any number of variations may fall within the scope of the invention , which is defined in the claims following the description . fig1 is a component - level diagram showing a memory controller interacting with memory . memory controller 100 reads and writes data to memory 150 . in one embodiment , memory 150 includes one or more memory ranks ( memory ranks 151 , 152 , 153 . . . ). after data and error correction code ( 105 ) is written to memory 150 , memory controller reads the error correction code and determines whether bit errors are present in the stored data by executing error analysis logic 110 . one example of error correction code is a simple checksum with error analysis logic 110 comparing the checksum of data stored a memory location with the checksum that was stored with the data . small bit errors identified by error analysis logic 110 can be corrected by writing correction data ( 115 ) to the memory . error analysis logic 110 keeps track of the bit errors that occur in memory . in addition error analysis logic 110 tracks the particular memory ranks ( 151 , 152 , 153 . . . ) where the bit errors occur . some types of memory are periodically refreshed . memory that is refreshed is typically capacitor - based memory where the individual capacitors are periodically refreshed . when refreshable memory is being used , memory controller executes refresh logic 120 to adjust the refresh rate ( 125 ) based on the number of bit errors encountered . when increased numbers of bit errors are identified , refresh logic 120 increases the refresh rate . increasing the refresh rate likely results in fewer bit errors being encountered . as bit errors decrease , refresh logic 120 decreases the refresh rate . refresh rates can be established for both the overall memory as well as individual memory ranks . in this manner , a higher refresh rate can be set for a memory rank that is experiencing more bit errors than other memory ranks . likewise , if conditions , such as heat , cause increased bit errors from all of the memory ranks , the overall refresh rate for the memory can be set accordingly . memory controller 100 can also set memory usage delays . again , like refresh delays , memory usage delays can be set for both the overall memory as well as individual memory ranks . when bit errors are encountered , memory controller 100 executes delay logic 130 to adjust the usage delay ( 135 ) based on the number of bit errors encountered . when increased numbers of bit errors are identified , delay logic 130 increases the usage delay . increasing the usage delay likely results in fewer bit errors being encountered . as bit errors decrease , delay logic 130 decreases the usage delay . usage delays can be established for both the overall memory as well as individual memory ranks . in this manner , a higher usage delay can be set for a memory rank that is experiencing more bit errors than other memory ranks . likewise , if conditions , such as heat , cause increased bit errors from all of the memory ranks , the overall usage delay for the memory can be set accordingly . when a refreshable memory is being used , adjustments to both the refresh rate and usage delays can be made to either the overall memory as well as to individual memory ranks . in this manner , both types of adjustments work in conjunction to decrease bit errors while not overly increasing one of the delays . further , it might be found through adjustments to the refresh rates and usage delays that an adjustment to the refresh rate or usage delay is more beneficial in a particular type of environment . fig2 is a flowchart showing the steps taken during error analysis of data written to the memory . processing commences at 200 whereupon , at step 210 , the memory controller receives error correction code ( ecc ) data from the memory . at step 220 , the received error correction code is analyzed and , based on the analysis , a determination is made as to whether there are bit errors in the data that was written to memory ( decision 225 ). if the analysis reveals bit errors , decision 225 branches to “ yes ” branch 228 whereupon , at step 230 , an error record is added to error data store 240 . in one embodiment , error data store 240 is stored in a memory accessible to the memory controller . the error records stored in error data store 240 include the timestamps of when the bit errors were encountered . if multiple memory ranks are being managed by the memory controller , the identifier of the memory rank where the error occurred is also written to the error data store . returning to decision 225 , if a bit error was not revealed by analyzing the error correction code data , then decision 225 branches to “ no ” branch 245 bypassing step 230 . at step 250 the number of errors occurring in a particular time window are counted for the overall memory as well as the individual memory ranks ( if individual memory ranks are being managed by the memory controller ). a time window is a certain period of time ( e . g ., one second ). in one embodiment , step 250 is performed periodically rather than every time data is written to memory . the counts computed in step 250 are stored in error counts data store 260 . error counts data store 260 is also stored in a memory accessible to the memory controller . the counts stored in error counts data store 260 include the timestamps of when the count was performed along with the overall count for bit errors occurring in the memory . if multiple memory ranks are being managed by the memory controller , the error counts for each memory rank are also stored in the error count data store along with the timestamp of when the respective counts were taken . a determination is made as to whether bit errors were encountered within the time window ( decision 265 ). if no bit errors were encountered , then decision 265 branches to “ no ” branch 266 whereupon , at step 267 , the default refresh rate ( if applicable to the type of memory being used ) is used and the additive usage delay is set to zero ( 0 ). the memory controller &# 39 ; s error analysis processing thereafter ends at 295 . returning to decision 265 , if bit errors were encountered during the time window , then decision 265 branches to “ yes ” branch 268 whereupon another determination is made as to whether refreshable memory is being used ( decision 270 ). if refreshable memory is being used , then decision 270 branches to “ yes ” branch 275 whereupon the refresh rate ( s ) of the memory ( and individual memory ranks , if applicable ) are adjusted ( predefined process 280 , see fig3 and corresponding text for processing details ). on the other hand , if refreshable memory is not being used , then decision 270 branches to “ no ” branch 285 bypassing predefined process 280 . at predefined process 290 , the usage delays are adjusted ( see fig4 and corresponding text for processing details ). the memory controller &# 39 ; s error analysis processing thereafter ends at 295 . fig3 is a flowchart showing the steps taken to adjust refresh rates in response to errors occurring when writing data to the memory . processing commences at 300 whereupon , at step 320 , error thresholds are retrieved from thresholds data store 310 . as shown , thresholds 310 can include both overall bit error thresholds as well as thresholds for individual memory ranks if the memory controller is managing multiple ranks of memory . thresholds 310 can include actions used to address the bit error rate that is being encountered . the actions can include adjustments to the refresh rates as well as adjustments to the usage delays ( computation of which is shown in fig4 ). at step 325 , the error counts stored in error counts data store 260 are compared to the thresholds . at decision 330 , a determination is made as to whether the overall number of bit errors exceed a minimum threshold set for the memory . if the overall number of errors exceed the minimum threshold , decision 330 branches to “ yes ” branch 335 whereupon , at step 340 , the overall refresh rate is set based upon the retrieved thresholds . note that the refresh rate that is set may be an increased refresh rate , a decreased refresh rate , or the same refresh rate when compared to the refresh rate that was previous set for the memory . returning to decision 330 , if the overall number of bit errors does not exceed a minimum threshold , then decision 330 branches to “ no ” branch 345 whereupon , at step 350 , the default refresh rate is applied to the overall memory . a determination is made as to whether any individual memory ranks ( if individual memory ranks are being managed by the memory controller ) have bit error counts that exceed a minimum threshold ( decision 360 ). if any individual memory ranks have bit error counts that exceed a minimum threshold , then decision 360 branches to “ yes ” branch 365 whereupon , at step 370 , the refresh rate for the first memory rank with a bit error count exceeding the minimum threshold is retrieved from thresholds 310 . a determination is made as to whether the retrieved refresh rate is higher than the overall refresh rate set in either step 340 or 350 ( decision 375 ). if the refresh rate retrieved for the individual memory rank is higher than the overall refresh rate that has been set , decision 375 branches to “ yes ” branch 378 and the individual memory rank &# 39 ; s refresh rate is set to the retrieved refresh rate . note again that the refresh rate that is set for the individual memory rank may be an increased refresh rate , a decreased refresh rate , or the same refresh rate when compared to the refresh rate that was previous set for the memory rank . returning to decision 375 , if the refresh rate retrieved for the individual memory rank is not higher than the overall refresh rate that has been set , then decision 375 branches to “ no ” branch 382 bypassing step 380 . a determination is made as to whether there are more memory ranks with bit error counts that exceed the minimum threshold ( decision 385 ). if there are more memory ranks with bit error counts exceeding the minimum threshold , decision 385 branches to “ yes ” branch 388 which loops back to retrieve the refresh rate for the next memory rank with a bit error count that exceeds the minimum threshold and process the memory rank &# 39 ; s refresh rate . this looping continues until all memory ranks with bit error counts exceeding the minimum threshold have been processed , at which point decision 385 branches to “ no ” branch 390 and processing used to adjust the refresh rates returns to the calling routine ( e . g ., see fig2 ) at 395 . returning to decision 360 , if there are no individual memory ranks with bit error counts exceeding the minimum threshold , then decision 360 branches to “ no ” branch 392 bypassing steps 370 through 385 . processing used to adjust the refresh rates then returns to the calling routine ( e . g ., see fig2 ) at 395 . fig4 is a flowchart showing the steps taken to adjust usage delays in response to errors occurring when writing data to the memory . processing commences at 400 whereupon , at step 420 , error thresholds are retrieved from thresholds data store 310 . as shown , thresholds 310 can include both overall bit error thresholds as well as thresholds for individual memory ranks if the memory controller is managing multiple ranks of memory . thresholds 310 can include actions used to address the bit error rate that is being encountered . the actions can include adjustments to the refresh rates ( computation of which is shown in fig3 ) as well as adjustments to the usage delays . at step 425 , the error counts stored in error counts data store 260 are compared to the thresholds . at decision 430 , a determination is made as to whether the overall number of bit errors exceed a minimum threshold set for the memory . if the overall number of errors exceed the minimum threshold , decision 430 branches to “ yes ” branch 435 whereupon , at step 440 , the overall usage delay is set based upon the retrieved thresholds . note that the usage delay that is set may be an increased usage delay , a decreased usage delay , or the same usage delay as compared to the usage delay that was previous set for the memory . returning to decision 430 , if the overall number of bit errors does not exceed a minimum threshold , then decision 430 branches to “ no ” branch 445 whereupon , at step 450 , the overall usage delay is set to zero ( 0 ) signifying no overall usage delay . a determination is made as to whether any individual memory ranks ( if individual memory ranks are being managed by the memory controller ) have bit error counts that exceed a minimum threshold ( decision 460 ). if any individual memory ranks have bit error counts that exceed a minimum threshold , then decision 460 branches to “ yes ” branch 465 whereupon , at step 470 , the usage delay for the first memory rank with a bit error count exceeding the minimum threshold is retrieved from thresholds 310 . a determination is made as to whether the retrieved usage delay is higher than the overall usage delay set in step 440 ( decision 475 ). if the usage delay retrieved for the individual memory rank is higher than the overall usage delay that has been set , decision 475 branches to “ yes ” branch 478 and the individual memory rank &# 39 ; s usage delay is set to the retrieved usage delay . note again that the usage delay that is set for the individual memory rank may be an increased usage delay a decreased usage delay , or the same usage delay as compared to the usage delay that was previous set for the memory rank . returning to decision 475 , if the usage delay retrieved for the individual memory rank is not higher than the overall usage delay that has been set , then decision 475 branches to “ no ” branch 482 bypassing step 480 . a determination is made as to whether there are more memory ranks with bit error counts that exceed the minimum threshold ( decision 485 ). if there are more memory ranks with bit error counts exceeding the minimum threshold , decision 485 branches to “ yes ” branch 488 which loops back to retrieve the usage delay for the next memory rank with a bit error count that exceeds the minimum threshold and process the memory rank &# 39 ; s usage delay . this looping continues until all memory ranks with bit error counts exceeding the minimum threshold have been processed , at which point decision 485 branches to “ no ” branch 490 and processing used to adjust the usage delay returns to the calling routine ( e . g ., see fig2 ) at 495 . returning to decision 460 , if there are no individual memory ranks with bit error counts exceeding the minimum threshold , then decision 460 branches to “ no ” branch 492 bypassing steps 470 through 485 . processing used to adjust the usage delay then returns to the calling routine ( e . g ., see fig2 ) at 495 . fig5 illustrates information handling system 501 which is a simplified example of a computer system capable of performing the computing operations described herein . computer system 501 includes processor 500 which is coupled to host bus 502 . a level two ( l2 ) cache memory 504 is also coupled to host bus 502 . host - to - pci bridge 506 is coupled to memory controller 100 , includes cache memory and main memory control functions , and provides bus control to handle transfers among pci bus 510 , processor 500 , l2 cache 504 , memory 150 , and host bus 502 . memory controller 100 is coupled to host - to - pci bridge 506 as well as host bus 502 . access to memory 150 is controlled by memory controller 100 . devices used solely by host processor ( s ) 500 , such as lan card 530 , are coupled to pci bus 510 . service processor interface and isa access pass - through 512 provides an interface between pci bus 510 and pci bus 514 . in this manner , pci bus 514 is insulated from pci bus 510 . devices , such as flash memory 518 , are coupled to pci bus 514 . in one implementation , flash memory 518 includes bios code that incorporates the necessary processor executable code for a variety of low - level system functions and system boot functions . pci bus 514 provides an interface for a variety of devices that are shared by host processor ( s ) 500 and service processor 516 including , for example , flash memory 518 . pci - to - isa bridge 535 provides bus control to handle transfers between pci bus 514 and isa bus 540 , universal serial bus ( usb ) functionality 545 , power management functionality 555 , and can include other functional elements not shown , such as a real - time clock ( rtc ), dma control , interrupt support , and system management bus support . nonvolatile ram 520 is attached to isa bus 540 . service processor 516 includes jtag and i2c busses 522 for communication with processor ( s ) 500 during initialization steps . jtag / i2c busses 522 are also coupled to l2 cache 504 , host - to - pci bridge 506 , and memory controller 100 providing a communications path between the processor , the service processor , the l2 cache , the host - to - pci bridge , and the memory controller . service processor 516 also has access to system power resources for powering down information handling device 501 . peripheral devices and input / output ( i / o ) devices can be attached to various interfaces ( e . g ., parallel interface 562 , serial interface 564 , keyboard interface 568 , and mouse interface 570 coupled to isa bus 540 . alternatively , many i / o devices can be accommodated by a super i / o controller ( not shown ) attached to isa bus 540 . in order to attach computer system 501 to another computer system to copy files over a network , lan card 530 is coupled to pci bus 510 . similarly , to connect computer system 501 to an isp to connect to the internet using a telephone line connection , modem 575 is connected to serial port 564 and pci - to - isa bridge 535 . while fig5 shows one information handling system , an information handling system may take many forms . for example , an information handling system may take the form of a desktop , server , portable , laptop , notebook , or other form factor computer or data processing system . in addition , an information handling system may take other form factors such as a personal digital assistant ( pda ), a gaming device , atm machine , a portable telephone device , a communication device or other devices that include a processor and memory . while particular embodiments of the present invention have been shown and described , it will be obvious to those skilled in the art that , based upon the teachings herein , that changes and modifications may be made without departing from this invention and its broader aspects . therefore , the appended claims are to encompass within their scope all such changes and modifications as are within the true spirit and scope of this invention . furthermore , it is to be understood that the invention is solely defined by the appended claims . it will be understood by those with skill in the art that if a specific number of an introduced claim element is intended , such intent will be explicitly recited in the claim , and in the absence of such recitation no such limitation is present . for non - limiting example , as an aid to understanding , the following appended claims contain usage of the introductory phrases “ at least one ” and “ one or more ” to introduce claim elements . however , the use of such phrases should not be construed to imply that the introduction of a claim element by the indefinite articles “ a ” or “ an ” limits any particular claim containing such introduced claim element to inventions containing only one such element , even when the same claim includes the introductory phrases “ one or more ” or “ at least one ” and indefinite articles such as “ a ” or “ an ”; the same holds true for the use in the claims of definite articles .	6
the method and apparatus for pattern defect inspection based on embodiments of this invention will be explained with reference to the drawings . fig1 shows an apparatus based on an embodiment of this invention . the apparatus includes a stage 2 , which is made up of x , y , z and θ ( rotation ) stages , on which a semiconductor wafer ( subject ) 1 having a pattern to be inspected is placed . the x , y and θ stages are operated by a drive circuit 100 . the z stage is operated by another drive circuit 101 . an illumination light source 3 which illuminates the subject 1 consists of a uv laser source having a wavelength of 266 nm or 355 nm for example . the uv laser source is a device which implements the wavelength conversion for the solid yag laser with nonlinear optical crystal , etc . to produce the third harmonic ( 355 nm ) or fourth harmonic ( 266 nm ) of the fundamental wave . a laser light source having a wavelength of 193 nm or 248 nm may be used alternatively . using a laser source having a wavelength of 193 nm or shorter , if available , will enhance the resolution of imaging . the laser oscillation mode can be either continuous oscillation or pulsative oscillation . the continuous oscillation mode is preferable in consideration of imaging of the subject 1 while moving the stage continuously . the illumination light source 3 emits a light beam l 1 , which is reflected by a mirror 4 for setting an intended optical axis , reflected by another mirror 5 , and conducted through an nd filter 10 so that the quantity of light is limited to the light level necessary for the inspection . the mirrors 4 and 5 are moved by a drive circuit 8 to adjust the light beam in the up / down and right / left directions in a certain manner ( not shown ). the nd filter 10 and the mirror 5 are interposed by a partial mirror 6 . the partial mirror 6 having a reflectivity of small percentage transmits most part of the light . the reflected light beam from the partial mirror 6 is cast onto a divisional sensor 7 . the sensor 7 having four divisions in this embodiment measures the balance of light levels of all divisions in a certain manner ( not shown ), and puts the difference values into the drive circuit 8 . for example , the divisional sensor 7 has its individual light quantities balanced when the optical axis of the illumination light beam is at the center of sensor . in this case , the mirrors 4 and 5 do not activate . if the optical axis of the illumination light source 3 varies by some reason , the divisional sensor 7 goes out of balance in light quantity . this variation of light quantity of the divisional sensor 7 indicates a positional error , causing the mirrors 4 and 5 to be operated by the drive circuit 8 on a feedback basis so that the divisional sensor 7 is kept balanced in light quantity . the total light quantity of the divisional sensor 7 indicates the output of the illumination light source 3 , and accordingly it can be utilized to monitor the fall of output of the illumination light source 3 . the drive circuit 8 implements the calculation for the sensor output , and a controller ( not shown ) controls the illumination light source 3 to keep a constant light output . the light beam emitted by the illumination light source 3 has a diameter of around 1 mm in general , which is too small to be used as illumination light , and therefore the light beam is expanded by a beam expander 11 . an illumination light path switching optical system 12 is intended to define the illumination range on the subject 1 . an limiting aperture 13 , which is located at the position conjugate with the pupil 14 a of an objective lens 14 , is intended to limit the na which is incident to the pupil 14 a . the expanded light beam is directed to a coherency diminishing optical system 15 which is intended to diminish the coherency of the laser beam emitted by the illumination light source 3 . the coherency diminishing optical system 15 can be any optical system which lower the coherency of laser in a time - wise or space - wise fashion . the coherency diminishing optical system 15 releases a light beam , which is directed by a beam splitter 16 to the objective lens 14 . the beam splitter 16 , which can be a polarization beam splitter , is designed to reflect the illumination light from the illumination light source 3 thereby to render the bright field illumination for example to the subject 1 through the objective lens 14 . the beam splitter 16 , if it is a polarization beam splitter , functions to reflect or transmit the laser beam when it has a polarization direction parallel or perpendicular , respectively , to the reflection plane . since a laser beam is a polarized light beam inherently , the polarization beam splitter 16 is capable of totally reflecting the laser beam . a set of polarizing devices 17 function to control the polarization direction of the laser illumination light and reflected light to adjust the polarization ratio of the illumination light arbitrarily so that the reflected light is not uneven in brightness at the destination due to the shape and difference of density of the pattern , and it consists of a halfwave plate and quarterwave plate for example . the reflected light from the subject 1 goes back through the objective lens 14 and conducted through the polarizing devices 17 and beam splitter 16 . the reflected light is focused by imagery lenses 18 and 19 on an image sensor 20 . a diaphragm 21 is located at the position conjugate with the pupil 14 a of the objective lens 14 . the diaphragm 21 which is operated by a drive circuit 22 is capable of squeezing the light beam in a certain manner ( not shown ). the maximum opening of diaphragm is to allow the pupil 14 a of the objective lens 14 to do full transmission , and it is adjusted appropriately . a movable mirror 23 can be placed between the beam splitter 16 and the lens 18 , in which case an image of the subject 1 can be formed in a camera 25 by a lens 24 . a movable mirror 26 can be placed between the diaphragm 21 and the imagery lens 18 , in which case an image of the subject 1 can be formed in a camera 27 by the lens 18 . the camera 25 is used for the wide - field overall observation of the subject 1 , i . e ., at low magnification , while the camera 27 is used for the narrow - field observation of the subject 1 , i . e ., at high magnification and high resolution . the image sensor 20 has a pixel size of 0 . 05 - 0 . 3 μm in terms of dimension on the subject depending on the combination of the imagery lenses 18 and 19 , and it is designed to produce a tonal image signal in response to the brightness ( tone ) of the reflected light from the pattern to be inspected on the subject 1 ( e . g ., semiconductor wafer ). the tonal image signal is put in to an image signal processing circuit 50 , which implements the image processing to detect defects of the pattern . the objective lens 14 has its focal depth decreasing with the decrease of wavelength , and therefore it is necessary to position ( adjust ) the surface of the subject 1 always at the focal point of the objective lens 14 . the objective lens 14 has its property of resolution affected by various kinds of aberration , and it can have the best performance by the optimal selection of the material of the lens 14 and the coating of the lens surface depending on the wavelength used . on this account , it is becoming difficult for the apparatus of this structure to implement the focusing operation by use of the objective lens 14 . therefore , it is advantageous to implement the off - line focusing operation without using the objective lens 14 . in this embodiment , a focal point detecting system 29 is disposed adjacently to the objective lens 14 . the height of subject 1 from the periphery of objective lens 14 is measured by a certain manner ( not shown ), and a feedback control circuit 30 operates on a drive circuit 101 to move the subject 1 toward the focal point . the focal point detecting system 29 is positioned to match with the focal point of objective lens 14 in advance . these optical systems are set up on an optical rack to organize the illumination light source , illumination optical system , imaging optical system , and optical sensor . the optical rack is installed in a certain manner ( not shown ) on a firm table , for example , where the stage 2 is set up , and this setup environment enables the stable inspection against disturbances including the temperature variation and vibration . fig2 shows the image signal processing circuit 50 . the circuit 50 includes an a / d converter 200 , gradation converter 201 , image filter 215 , delay memory 202 , image alignment portion 203 , local gradation converter 204 , comparator 205 , cpu 212 , image entry 206 , scatter plot graph generator 207 , memory means 208 , display means 209 , output means 210 , and input means 211 . the a / d converter 200 of 10 bits for example converts the tonal image signal 31 produced by the image sensor 20 into a digital image signal and releases an image signal of the subject . the gradation converter 201 renders the gradation conversion as described in japanese patent laid - open no . h8 ( 1996 )- 320294 to the 10 - bit image signal released by the a / d converter 200 . the gradation converter 201 performs the logarithmic conversion , exponential conversion , or polynomial conversion thereby to modify ( compensate ) the image , and releases an 8 - bit digital signal for example . the image filter 215 removes efficiently noises , which are specific to images formed by the uv light , from the image which has been rendered the gradation conversion and modification . the delay memory 202 for storing reference image signals delays and stores the output image signals released by the image filter 215 for one or more cells or one or more chips formed on the semiconductor wafer . one cell is the unit of pattern repetition within a chip . the image filter 215 may be located at the output of the delay memory 202 alternatively . the alignment portion 203 evaluates the positional deviation of the image signal ( image signal detected from the subject ) 213 which has been rendered the gradation conversion by the gradation converter 201 from delayed image signals ( reference image signals ) 214 read out of the delay memory 202 based on the normalized correlation , thereby implementing positional alignment by pixel unit between the image signals 213 , 214 . the local gradation converter 204 renders the gradation conversion to one or both image signals so that the characteristic values ( brightness , differentiation value , standard deviation , texture , etc .) of both signals become equal when a defect does not be existed . the comparator 205 compares the image signals resulting from gradation conversion by the gradation converter 204 to detect the defect based on the difference of characteristic values . specifically , the comparator 205 compares the detected image signal with the reference image signal which has been delayed in proportion to the cell pitch by the delay memory 202 . the cpu 212 produces defect inspection data based on layout coordinate data of the semiconductor wafer 1 , which has been entered through the input means 211 such as a keyboard or disk storage , and stores the produced data in the memory means 208 . the defect inspection data can be displayed on the display means 209 such as a display screen , and also can be put in to the output means 210 . the comparator 205 , which can be the one described in detail in japanese patent laid - open no . s61 ( 1986 )- 212708 , is made up of an image alignment circuit , differential image detecting circuit which detects the difference of the position - aligned images , inequality detecting circuit which binary - digitizes the differential image , and characteristics detecting circuit which calculates the area , length ( projection length ), coordinates , etc . from the binary output . the image entry 206 enters the images , which have been rendered the positional alignment of the images with pixel unit by the image alignment portion 203 , in synchronous or asynchronous manner for producing a scatter plot graph of the images . the scatter plot graph generator 207 produces a scatter plot graph between the characteristic values in terms of each category of the produced image and reference image entered by the image entry 206 , and displays a resulting figure on the display means 209 for example . an example of the image filter 215 will be explained with reference to fig3 showing the sequential process . initially , the input images 280 and 280 ′ undergo the noise elimination 281 to improve the image quality and enhance the s / n property . various kinds of filters can be used selectively for noise elimination depending on the subject of inspection and the nature of noise . one example is to apply a weight to the neighboring pixel values . specifically , a weighting factor is multiplied to the values of neighboring pixels of n × m around the pixel of one &# 39 ; s observation and the results are summed . fig4 shows an example , in which a weighting factor of ⅛ is applied to the n = 3 by m = 3 neighboring pixel values . the pixel of one &# 39 ; s observation ( i , j ) has its value f ( i , j ) expressed by formula ( 1 ). f ( i , j )= b · ⅛ + d · ⅛ + f · ⅛ + h · ⅛ + e · ½ the size and factor of the filter can be varied flexibly by use of a lookup table . another example is a median filter . this scheme is to take the center value of luminance values within the predetermined area , and it can eliminate the influence of singular points . still another example is to use a gaussian function . this scheme smoothes the image by convoluting a 2 - dimensional gaussian function ( formula ( 2 )) having a mean value of 0 and variance of σ 2 for the image f ( x , y ) based on formula ( 3 ). g ⁡ ( x , y ) = ( 1 / 2 ⁢ πσ 2 ) · exp ⁡ ( - ( x 2 + y 2 ) / 2 ⁢ σ 2 ) ( 2 ) f ⁡ ( x , y ) = ⁢ g ⁡ ( x , y ) ⊗ f ⁡ ( x , y ) = ⁢ ∫ ∫ g ⁡ ( x + u , y + v ) · f ⁡ ( x , y ) ⁢ ⅆ u ⁢ ⅆ v ( 3 ) still another example available is to use the fourier transform to remove noises which arise regularly . the subsequent step is the restoration 282 of the image which has been deteriorated in quality by the noise removal . one example of restoration is to use a wiener filter . this filtering results such an image that the mean square error of the restored image f ( x , y ) from the input image f ( x , y ) is minimal . next , it is examined as to whether the produced image and reference image to be compared differ significantly in appearance . assessment indexes include the contrast , disparity of brightness ( standard deviation ), and noise frequency . if the images have a large difference in characteristic quantities , the images undergo the characteristic quantity calculation 283 so that the difference of characteristic quantities is narrowed . this process can be based on the use of wiener filter between the produced image and the reference image . following the comparison of characteristic quantities 284 and fitting of images 285 , decision of sensitivity decrease 286 is implemented . in case the fitting of characteristic quantities is infeasible in the detection process , the comparator is lowered in sensitivity so as to suppress the false generation . the defect calculation by the image processor 24 can be accomplished based on the scheme described in detail in japanese patent laid - open no . 2001 - 194323 . next , the illumination light source 3 will be explained . a light source of the shorter wavelength is required to attain the higher resolution of imaging , and the laser is conceived to be advantageous significantly as a light source to perform high - luminance illumination in the uv wavelength range which is most effective for the enhancement of resolution . accordingly , the inventive method and apparatus adopt the laser - based illumination . fig5 a and 5b show by plan view and side view , respectively , the structure of an illumination light source . the illumination light source 3 is fixed on a plate 102 . another plate 101 is positioned and fixed on an optical base 100 . positioning of the plate 101 is , for example , based on guide pins 103 which are fixed on the optical base 100 . the pins 103 are assumed to be adjusted relatively to the optical axis of the optical system . the plate 102 is fixed to the plate 101 . the illumination light source 3 needs to be replaced when the life span of laser oscillator expires . in order to minimize the down - time of the apparatus when the illumination light source 3 is replaced , the light source 3 undergoes the optical axis adjustment prior to the placement on the plate so that it exerts the intended performance following the minimal adjustment of optical axis . fig6 a and 6b show by plan view and side view , respectively , an example of optical axis adjustment devices . on an optical axis adjustment base 104 , the positioning pins 103 are fixed in the same layout as the optical base 100 . targets 105 and 106 having the same height and having the formation of pin - holes 107 for transmitting a laser beam are fixed on the base 104 by being aligned in parallel to the alignment of pins 103 . the targets 105 and 106 are spaced out by a distance which is enough to adjust the laser light source 3 . the plate 101 is fixed to the optical axis adjustment base 104 . the illumination light source 3 is fixed temporarily on the plate 102 in advance . with the plate 102 being placed on the plate 101 , the laser source is activated to emit a laser beam . the position of the plate 102 is adjusted in the right / left direction and the laser source is adjusted in the inclination direction so that the laser beam l goes through the pin - holes 107 . following the adjustment , the illumination light source 3 is fixed to the plate 102 , and the plate 102 is fixed to the plate 101 . in consequence , the illumination light source 3 has its laser beam adjusted based on the position of the pins 103 . the illumination light source 3 fixed on the plate 101 is moved from the adjustment base 104 to the optical base 100 , resulting in a consistent optical axis before and after the replacement of light source . next , the nd filter 10 which limits the light quantity will be explained . the illumination light source 3 emits a laser beam at the maximum output , and it is necessary to limit the quantity of light which reaches the image sensor 20 . an nd filter 7 is placed to cut in the light path . fig7 a shows the disposition of the nd filter 10 , and fig7 b shows its characteristics . the nd filter 10 varies in transmissivity depending on the angle as shown in fig7 b . the nd filter 10 can be swung and fixed at an intended angle in a certain manner ( not shown ). the nd filter 10 has such an angle α relative to the optical axis that the reflected laser beam r from the filter 10 does not return directly to the laser emission port of the illumination light source 3 . the basis of this angle setting is to prevent the instability of the laser output due to the interference of the reflected beam from the nd filter 10 with the beam in the resonator of the illumination light source 3 . next , the limiting aperture system will be explained . fig8 a and 8b show examples of limiting aperture 13 . the limiting aperture 13 is conjugate in position with the pupil 14 a of the objective lens 14 . for the pupil 14 a having a maximum diameter of d , the limiting aperture 13 can vary the light transmission diameter d 1 depending on the pattern shape on the surface of the subject 1 . the limiting aperture 13 may be design to provide a ring - shaped aperture as shown in fig8 b to accomplish the ring - shaped illumination . for the pupil 14 a having a maximum diameter of d , the limiting aperture 9 a performs the ring - shaped light transmission having an inner diameter of d 2 and outer diameter of d 3 . by preparing limiting apertures having several sets of diameters and changing the limiting aperture in a certain manner ( not shown ), imaging at the higher resolution can be accomplished . fig9 a and 9b show the illumination state of the objective lens pupil 32 and the view field 33 , respectively , resulting from the illumination of the ordinary white light . a light source image 34 is focused at the position of the pupil 32 , while the whole view field 35 is illuminated virtually uniformly at the position of the view field 33 . fig1 a - 10d show the illumination state resulting from a laser light source . a light source image 36 having a shape of light spot is focused at the position of the pupil 32 as shown in fig1 a . a circuit pattern which has a cross section as indicated by 38 in fig1 c and is illuminated in the view field 33 as indicated by 37 in fig1 b results in a detected waveform 39 as shown in fig1 d . when the circuit pattern is imaged by the illumination of laser light , there arise overshooting and undershooting at the pattern edge and there also emerge speckles 40 . the cause of these waveforms is a small σ of illumination . it implies that the view field 33 beneath the objective lens 14 is not illuminated at multiple angles . illumination of the ordinary white light has a certain beam size on the pupil 32 and has a range of illumination angles comparable to the na ( numeral aperture ) of the objective lens 14 against the view field 33 . coherent lights such as the laser have a value of σ ( it is proportional to the size of light source on the pupil ) of zero , since the point light source of coherent light results in a point image at the pupil . although it is feasible to produce an expanded light beam 41 with another lens system and cast onto the pupil 32 as shown in fig1 a , the result is the same as if the whole light come from a position of σ = 0 ( indicated by 39 in fig1 d ), and the problem is left unsolved . on this account , it is necessary to have a means of diminishing the coherency , i . e ., time coherency or spatial coherency , of the laser beam . next , an embodiment of coherency diminishment will be explained . the invention proposes the operation in which the light source image is focused on the pupil 32 , a position 42 , for example , in fig1 a is illuminated at first , and subsequently positions 42 ′ and so on are scanned sequentially , thereby illuminating , as indicated by 43 , the view field 33 as shown in fig1 b . the pupil 32 may be scanned in a spiral fashion as indicated by 44 in fig1 c , or may be scanned in a 2 - dimensional fashion 45 as shown in fig1 d . although images of speckles , overshooting and undershooting are created at positions , they do not interfere with each other due to different timings of imaging . summing these images by the image sensor 20 results in a same image derived from a coherent light source . for the summation of images , the image sensor 20 is preferably of the accumulation type such as ccd ( specifically , tdi sensor ) having a pixel size of 0 . 05 - 0 . 3 μm in terms of dimension on the subject ( view field ). among various ccd sensors , the image sensor 20 is of the tdi ( time delay and integration ) type . the tdi sensor is a 1 - dimensional sensor in which n pieces of ( several tens to 1000 ) photosensors called “ stages ” are aligned in the lateral direction and multiple stages are aligned in the longitudinal direction . the sensor allows arbitrary control of drive frequency . next , an embodiment of coherency diminishment 15 based on the scanning of light source image will be explained . fig1 shows the arrangement of the coherency diminishing optical system 15 using a scanning means of a resonance - type galvanomirror . a lens 600 makes a light beam illuminated from the illumination light source 3 , at a position 606 which is conjugate with the pupil 14 a of the objective lens 14 . lenses 601 and 602 make a reflected light beam at a next conjugate position 606 ′. a lens 603 focuses the reflected light beam on the pupil 14 a of the objective lens 14 . a galvanomirror 605 which can swing in the up / down direction is disposed at the conjugate position 606 , and another galvanomirror 605 ′ which can swing in the right / left direction is disposed at the conjugate position 606 ′. a position 607 conjugate with the subject 1 is set between the lens 602 and the lens 603 . fig1 shows an embodiment of resonance - type galvanomirror . the galvanomirrors 605 and 605 ′ are each made by integrated fabrication inclusive of a stationary portion and swing portion . the galvanomirror has a swing flat 607 which is supported by bars 610 and 610 ′ extending from stationary members 608 and 609 . the flat 607 has the formation of a coil 611 . there are magnets 612 and 613 on both sides of the coil 611 . the coil 611 is supplied with a current 614 , and it reacts against the magnets 612 and 613 , causing the flat 607 to swing . the flat 607 has its rear surface coated to behave as a mirror so that the laser beam is totally reflected . the flat 607 can be confirmed to swing at a constant frequency by supplying with a certain amount of current to the coil 611 . fig1 shows the frequency characteristics 615 plotted along the horizontal axis of resonance frequency and the vertical axis of swing angle . the frequency which makes a peak swing angle can be set arbitrarily between 1000 hz and 5000 hz by adjusting the width of the bars 610 and 610 ′. frequencies below 1000 hz are also attainable obviously . the galvanomirror is designed so that the swing angle is maximal at the intended frequency . fig1 shows the relation between the current value and the swing angle plotted along the horizontal axis of current and the vertical axis of swing angle . the swing angle can be limited based on the amount of current supplied . the galvanomirrors disposed as shown in fig1 operate to swing the light beam horizontally and vertically , and the use of galvanomirrors having the same resonance frequency is desirable . the resonance frequency of galvanomirror is preferably tuned to the accumulation time of the image sensor 20 . the image sensor 20 gets images in a cycle time which is the product of the drive frequency and the number of stages in the lateral direction . for example , in the case of a 300 - khz drive frequency and 500 stages , it images at a frequency of 600 hz . by setting the characteristics of the resonance - type galvanomirror to have a swing frequency of 600 hz , the swing motion of one rotation can be accomplished in the accumulation time . in case the resonance - type galvanomirror has its characteristic frequency deviated to , such as 611 hz , from the ideal frequency due to the disparity of fabrication process or the like , the swing motion of one rotation in the accumulation time can be accomplished by altering the image sensor drive frequency to 305 . 5 khz . namely , based on the adjustment of either the image delivery time to the image sensor or the frequency of resonance - type galvanomirror , it is possible to have the ideal swing motion and imaging . next , a second embodiment of coherency diminishment will be explained . in this embodiment , a diffusion plate is placed on the laser light path , by which the incident angle is shifted in a time fashion thereby to diminish the coherency . fig1 shows the arrangement of the coherency diminishing optical system 15 . the light beam from the illumination light source 3 is conducted through a lens 600 to reach a position 606 which is conjugate with the pupil 14 a of the objective lens 14 . the reflected light beam is conducted through lenses 601 and 602 to reach a next conjugate position 606 ′. a lens 603 focuses the reflected light beam on the pupil 14 a of the objective lens 14 . mirrors 700 and 701 are placed at the conjugate positions 606 and 606 ′. a position 607 conjugate with the subject 1 is established between the lens 602 and the lens 603 . a diffusion plate 702 which is rotated by a motor 703 is placed near the conjugate position . fig1 a shows a front view of the diffusion plate 702 , fig1 b shows the details of the diffusion surface , and fig1 c shows the cross section taken along the x - x line of fig1 a . the diffusion plate 702 has preferably a random layout of particles 704 , 705 , 706 having a polygonal or circular shape and having random sizes around 0 . 1 mm in terms of surface observation . the particles are preferably random also in cross - sectional shape and size . the diffusion plate 702 is preferably driven to rotate once in the accumulating time of the image sensor 20 . however , this rotational speed will be infeasible due to the accumulating time of the image sensor 20 of the order of several hundreds hertz . an experiment was conducted to assess the relation between the rotational speed of diffusion plate and the noise of image sensor , with the result 707 being plotted along the horizontal axis of diffusion plate rotational speed and the vertical axis of image sensor noise on the graph of fig1 . the noise was defined to be the fluctuation of brightness of the image sensor which receives a reflected light from a subject of flat surface without exposing a circuit pattern . the noise level is smallest at the point where the rotational speed of diffusion plate matches with the accumulating time of image sensor . the basis of this fact is for being averaged by one revolution of particles 704 on the diffusion plate 702 in the accumulating time of the image sensor 20 . the noise level decreases in a fashion of second - degree function , and at noise levels which do not affect the performance of image processing , it is not compulsory to equalize the one - revolution time of diffusion plate to the accumulating time of image sensor . this critical rotational speed is around 12000 rpm . accordingly , the effect of noise level reduction can be attained by simply rotating the diffusion plate 702 with a conventional means . the same effect is attained when the diffusion plate 702 is replaced with a phase plate . fig2 a shows a front view of a phase plate 750 , fig2 b shows the details , and fig2 c shows the cross section taken along the x - x line of fig2 a . the phase plate 750 is stepped in width in terms of random phase shift to have a random layout of a segment 751 of phase λ , a segment 752 of ½ λ phase shift , a segment 753 of ¼ λ phase shift , a segment 754 of ¾ λ phase shift , and so on . the phase plate 750 , in place of the diffusion plate 702 , is fixed to and is rotated by the motor 703 so that the laser beam varies in phase in response to the depth of steps , and the coherency of laser can be diminished . the same effect is attained obviously when the diffusion plate and resonance - type galvanomirror are placed on the same light path . next , the range of illumination will be explained . fig2 shows the concept of illumination . generally , illumination of a microscope or the like is the circular illumination 300 on the subject . however , in the case of using a 1 - dimensional image sensor as employed by the inventive apparatus , only an elongated range 301 on the subject contributes to imaging , leaving other useless illuminated area . in order to raise the luminous intensity for the imaging by the image sensor , elongated illumination as shown by an area 302 in fig2 is suitable for the imaging range 301 of the image sensor . a tv camera used for observation necessitates a rectangular illumination range , which cannot be covered entirely by the above - mentioned elongated illumination . next , the illumination light path switching optical system 12 will be explained . fig2 a and 23b show the arrangement of this optical system 12 . the illumination light from the illumination light source 3 has a light path 60 , on which is placed a homogenizer 303 . mirrors 63 , 64 , 65 and 66 and a lens 67 are fixed to a base 62 . the base 62 is movable in a certain manner ( not shown ) toward the light path 60 . shown by fig2 a is the state of inspecting by the image sensor 20 , with illumination being achieved by the homogenizer 303 . shown by fig2 b is the state of observation with a tv camera 27 , in which case the base 62 is moved to insert in the light path 60 . in this state , the light path 60 of illumination runs to the light path 68 through the mirrors 63 , 64 , 65 and 66 and the lens 67 , and the ordinary circular illumination can be provided . next , the homogenizer which accomplishes the elongated illumination will be explained . fig2 shows the shape of the homogenizer 303 . the is homogenizer 303 is arranged a plurality of lens arrays 304 . each lens array 304 is arranged so as to image at the pupil 14 a of the objective lens 14 through a set of lenses placed on the light path . the each lens array 304 has a rectangular shape ( l × i ). a longish direction of the rectangular illumination is matched a longish direction of each lens array 304 . by arranging a plurality of this lens arrays , the intended rectangular illumination 302 is accomplished . next , the illumination light path switching mechanism will be explained . fig2 shows this mechanism 26 , 18 . the illumination light path switching mechanism functions to switch the light path for the image sensor 20 and tv camera 27 . a mirror 26 is adapted to insert in the light path in a certain manner ( not shown ). with the mirror 26 being located on the light path , the tv camera 27 is fixed at the position conjugate with the imagery position of the image sensor 20 . the mirror 26 is retracted from the light path when the image sensor 20 is inspected the image of the subject ( the specimen ) 1 . at the observation of inspection result , the mirror 26 is moved to insert in the light path in a certain manner ( not shown ), and the subject 1 can be observed with the tv camera 27 . the tv camera 27 is attached with a certain angle for the light axis . the tv camera 27 generally places a glass cover in front of a sensor with the intention of protecting the sensor . if a laser beam carries out incidence to the front and rear surface of this glass cover , multiplex interference will occur . therefore , interference fringes will occur on an observation screen of the sensor . on this account , angles α1 and α2 of the tv camera 27 are adjusted before fixing so that the emergence of interference fringes is prevented . the camera 25 is also fixed to have a certain angle . another mirror 23 has the same function as the mirror 26 . a variety of imagery lenses 18 of different magnifications are used selectively depending on the pixel size . for a different pixel size , the imagery lens is replaced , instead of the objective lens . imagery lenses 18 a and 18 b of different magnifications have the same imagery position . consequently , the image sensor 20 and tv camera 27 do not need to be relocated at the change of magnification , enabling the stable imaging operation . the magnification is determined by the focal distance of the objective lens 14 and the focal distances of the imagery lenses 18 , 18 a and 18 b , and the pixel size is determined by the aperture size of the image sensor 20 . the magnification can possibly fluctuate among production lots of optical system due to the fabrication error of the objective lens 14 and imagery lenses 18 , 18 a and 18 b and also their assembling error , and the difference of magnification results in different sensitivities of imaging among production lots of optical system , i . e ., among apparatus . on this account , the imagery lenses 18 , 18 a and 18 b are provided with a mechanism for making their focal distances adjustable . fig2 shows the cross section of an imagery lenses . the imagery lens 18 is made up of multiple lenses 501 , 502 , 503 and 504 combined in an optical tube 500 . the imagery lens 18 is designed to have variable focal distance based on , for example , the movement of one of the lens set . in the example shown , the focal distance is varied by the movement of the lens 503 . the lens 503 is framed in a lens holder 505 so that it can be operated for movement from the outside of the optical tube 500 . the lens holder 505 is moved in a certain manner ( not shown ) to vary the focal point ( focal distance ) of the lens 18 . with the objective lens 14 having a constant focal distance , the magnification can be varied . using a zoom lens for the imagery lens with the ability of variable magnification achieves the same effect obviously . next , the diaphragm 21 will be explained . fig2 shows an embodiment of the shape of the diaphragm 21 . the diaphragm has its light transmission range d set equal to the size of the pupil 14 a . the diameter d is varied by the control system 22 in a certain manner ( not shown ) to control ( adjust ) the light transmission range . based on the combination of the diameter d and the swing range of the resonance - type galvanomirror of the coherency diminishing optical system 15 , it is possible to control the diffracted light from the pattern of the subject 1 and put in to the image sensor 20 . fig2 a and 28b show an example of this affair . shown by 28 a is the locus of illumination 1000 in the pupil 14 a of the objective lens 14 , and shown by fig2 b is the control range of the diaphragm 21 . the control range is determined in terms of diameter d 1 so that the high - order components of diffracted light can be controlled . this combination is effectual for the grain and the like existed on the surface of the subject 1 . fig2 a and 29b show another example of the affair . shown by 29 a is the locus of illumination 1000 in the pupil 14 a of the objective lens 14 , and shown by fig2 b is the control range of the diaphragm 21 . the control range is determined in terms of diameters d 2 and d 3 so that the major component of diffracted light from the subject 1 can be controlled . this combination is effectual for the irregularity of color and the like existed on the surface of the subject 1 . next , an embodiment of the tdi sensor which is sensitive to the uv light , particularly the duv light , will be explained . fig3 shows a sensor of the surface reflection type . in the case of using the duv laser for the illumination light source 3 , an image sensor which is sensitive to the duv light must be used . in the surface - reflective image sensor 200 , the incident light 150 goes through a glass cover 151 , passes through a gate 154 , and enters a ccd 155 , causing incident light components of short wavelengths to be attenuated . the sensor is almost insensitive to wavelengths of 400 nm or less , and is not capable of detecting the duv light effectively . there is a scheme for coping with this matter , in which the glass cover is coated with an organic thin film which radiates visible light in response to the incident of duv light , and consequently an image sensor which is sensitive only to the visible light can sense the duv light . fig3 shows an image sensor based on the scheme of organic thin film coating . the image sensor 201 of this scheme has its glass cover 151 coated with a organic thin film 152 , which radiates the fluorescent light 153 in response to the incident light 150 transmitted through the glass cover 151 on the coated surface of the organic thin film 152 , enabling an image sensor of the surface illumination type , which is only sensitive to the visible light , to sense the duv light . fig3 shows spectral characteristics of image sensors . spectral characteristics 156 are of the ordinary image sensor 200 of the surface illumination type , and this sensor has no sensitivity to wavelengths of 400 nm or less . spectral characteristics 157 are of the image sensor 201 having an organic thin film coating , and this sensor has the rendition of additional sensitivity to wavelengths of 400 nm or less . for having much higher sensitivity to the duv light , an image sensor of the rear - surface irradiation type should be used . fig3 shows the structure of this image sensor . the incident light 150 are transmitted through a glass cover 158 and incident to the rear surface 159 without a gate structure . the incident light do not go through the gate 160 and therefore have spectral characteristics 161 shown in fig3 . this image sensor has a high quantization factor ( e . g ., 30 % or more ) and a wide dynamic range ( e . g ., 3000 or more ) and is sensitive to wavelengths of 400 nm or less , and it is particularly advantageous for the illumination of short wavelengths such as 200 nm or less . this type of image sensor is capable of dealing with several wavelengths of illumination . by designing the image sensor 20 to be of the tdi ( time delay integration ) type , the sensitivity can be raised . by designing the image sensor 20 to have the anti - blooming characteristics , it is possible to overcome the problem of overflowing charges to neighboring pixels at the input of excessive light quantity . next , the fitting of the image sensor 20 will be explained . fig3 shows the manner of fitting of the sensor . the image sensor 20 has a glass cover as mentioned previously , and therefore interference fringes can possibly emerge on the glass surface . by inclining the sensor 20 by angle θ against the direction of stages , it is possible to prevent the emergence of interference fringes caused by the interference of laser , while being free from the occurrence of out - focusing in the direction of pixels . next , a scheme of improving the contrast of pattern based on the control of a set of polarizing devices 17 which have been mentioned previously , in addition to the enhancement of resolution by use of the uv light , will be explained . based on the fact that the state of polarization of uv laser can be manipulated by controlling the polarizing devices 17 with the intention of improving the pattern contrast , it becomes possible to detect partially - polarized light components with the image sensor 20 by controlling the direction of polarization of illumination light and the elliptic factor . illumination by uv laser is characterized by having a single wavelength and linear polarization . therefore , the state of polarization can be controlled efficiently by use of the polarizing devices 17 including a halfwave plate and quarterwave plate placed on the light path . specifically , the halfwave plate and quarterwave plate are rotated about the optical axis . the pattern contrast varies significantly depending on the state of polarization of illumination , and accordingly the performance of optical system can be enhanced by making the polarization state controllable ( positioning of the wave plate by rotation ). more specifically , the direction of linear polarization is controlled with the halfwave plate , and the elliptic factor is controlled with the quarterwave plate . in consequence , the sensitivity of detection can be enhanced . based on the combination of these plates , a parallel nicol and orthogonal nicol can be accomplished . the state of circular polarization can also be accomplished obviously . these byproducts are not dependent on the wavelength of illumination . means of accomplishment is arbitrary , provided that the above - mentioned concept is satisfied . the polarization control means 17 includes one or both of the quarterwave plate or the halfwave plate and the quarterwave plate disposed on the light path ranging from the uv light source 3 up to the subject 1 , and an analyzer ( not shown ) disposed on the light path of the light reflected by the subject ranging from the subject 1 up to the detector of said image detecting means 20 . controlling the polarization enables the efficient detection of high - order diffracted light . an experiment conducted by the inventors of the present invention reveals that the contrast is improved by about 20 - 300 %. according to the foregoing setup of optical system , the illumination light ( e . g ., uv laser ) coming out of the illumination light source 3 is reflected by the mirrors 4 and 5 , transmitted through the nd filter 7 which limits the quantity of light , expanded by the beam expander 8 , incident to the objective lens 14 through the coherency diminishing optical system 15 , beam splitter 16 , polarizing devices 17 , and cast onto the subject ( semiconductor wafer ) 1 . the reflected light from the subject 1 goes up vertically , and is conducted through the objective lens 14 , polarizing devices 17 , beam splitter 16 and imagery lenses 18 and 19 , and detected by the image sensor 20 . at the time of inspection , the semiconductor wafer 1 , with a pattern being formed thereon , as an example of the subject of inspection is scanned by moving the stage 2 , and the focal point detecting system 29 is operated to detect the z - axis position of the inspection surface of the subject 1 continuously and control the z - axis position of the stage 2 so that the distance of the surface from the objective lens 14 is kept constant . the image sensor 20 senses the brightness ( tonal image ) of the pattern formed on the semiconductor wafer 1 accurately . resulting information ( tonal image signal ) is processed by an image processor 50 , and the inspection of microscopic defects of the subject 1 is accomplished . fig3 shows a second embodiment of this invention . this embodiment differs from the foregoing first embodiment in the removal of the imagery lens 19 based on the relocation of the diaphragm 21 from the position before the image sensor 20 to the position immediately before the objective lens . the rest is identical to the first embodiment . based on the disposition of the diaphragm 21 close to the pupil 14 a of the objective lens 14 , the same effect as the first embodiment is attained . fig3 shows the effective usage of the defect inspection apparatus of the foregoing embodiments for the semiconductor device fabrication process ( for example s 361 ). semiconductor devices such as lsis are fabricated through a variety of processing steps including steps of laminating transferred patterns . even if a single line breakage or short - circuit is created in any one step , the following processing will merely result in faulty products . using this inspection apparatus in inspection process s 362 , the existence of sudden abnormalities is acquired in process s 363 and it becomes possible by analyzing it in process s 366 to feed back to for example thickness measurement equipment in process 8367 . moreover , if poor analysis is performed and there is no fatal defect by observing the detected defective part in process s 364 , s 365 , s 368 , the rate of the defect will be reduced by letting a process pass as it is . if it is the fatal defect , it will become possible to prevent making a lot of poor products with feeding back to manufacturing apparatus promptly . as described above , by using the duv light having a wavelength of 266 nm , 248 nm or 192 nm , inspection of device defects of 0 . 07 μm rule or smaller can be accomplished . the inventive method and apparatus can be applied for the inspection of cu damascene as a subject of inspection . speckles are not created in subject portions where the circuit pattern is absent , and the comparison of a produced image with a reference image does not make a false indication . the uv light of 365 nm or less in wavelength used for the illumination light has large optical energy , and when optical parts are irradiated by it , organic contaminant decomposes or reacts and sticks on the part surface . by providing the optical parts with an air ventilation means or air blasting means , the deterioration of optical parts can prevented . although the bright field optical system has been explained for the embodiments of this invention , the same effectiveness is attained by use of a common focal point microscope for the imaging optical system . the inventive method and apparatus achieve the high - luminance uv or duv illumination , enabling the high - resolution imaging in a short time , and as a result a high speed and high sensitivity inspection apparatus is offered . defects of pattern are detected in terms of their positions and dimensions . inspection subjects can include damascene of cu and the like resulting from the buried wiring in contact holes or wiring grooves made by forming a conductive metallic film of cu or the like and burying in the holes or grooves which are formed on an insulation film of sio 2 or the like , and removing excessive deposited portions by cmp polishing or the like . accordingly , the inventive inspection method and apparatus can be applied to damascene of cu or the like . when the inventive method and apparatus using the duv light ( 266 nm , 248 nm or 193 nm in wavelength ) are applied to devices of 0 . 07 μm design rule or smaller , they are very effective in detecting microscopic defects smaller than 0 . 07 μm . when the illumination light which is shorter in wavelength than the duv light is used , the influence of chromatic aberration can be alleviated by use of a reflection objective lens for the objective lens 14 . according to this invention , it is possible based on the illumination of a short wavelength , which is indispensable for the enhancement of resolution , particularly based on a laser light source , which is advantageous for practicing , to produce an image , which is the same or better in quality as compared with the result from the ordinary discharge tube illumination , at the higher sensitivity and higher speed , whereby it is effectively possible to detect microscopic defects at high - sensitivity . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the present embodiment is therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .	6
materials having electromagnetic - energy - absorbing properties can be used to suppress the transmission of emi over a broad range of frequencies . such emi - absorbing materials can provide substantial electromagnetic shielding effectiveness , for example , up to about 5 db or more at emi frequencies occurring up to about 100 , 000 megahertz . according to the present invention , emi - absorbing materials can be formed in a solution capable of being applied to a suitable porous substrate . generally , the resulting absorptive solution includes an absorbing material and a binding agent that can be applied to new , custom air filters , or to commercially available non - emi air filters . referring to fig1 , procedural steps are illustrated for one embodiment of a process applying an emi - absorbing material to an air filter . in brief overview , a porous substrate is provided ( step 100 ) along with a curable , emi - absorbing solution ( step 110 ). next , the emi - absorbing solution is applied to the porous substrate ( step 120 ) followed by the removal of any excess solution ( step 130 ). the emi - absorbing solution deposited in the porous substrate is then cured ( step 140 ). if a greater emi - absorbing performance is required , steps 120 through 140 can be repeated one or more times ( step 150 ), thereby applying additional emi - absorbing material . in some embodiments , a fire retardant is optionally applied ( step 160 , shown in phantom ). in more detail , the porous substrate is generally selected as having properties desirable for an air filter , namely , a high dust arrestance and a low pressure drop ( or , conversely , a high air permeability ). one measure of the porosity of a given sample is pores per linear inch ( ppi ). numerous porous substrates are readily available , including fiberglass mats , non - woven polyester webs , and various foams . in one embodiment , the porous substrate provided in step 100 is an open - cell foam , such as a reticulated polyurethane foam . common applications of foam substrates used to filter air flow in electronic equipment applications can have 3 ppi to more than 20 ppi . foams , such as synthetic plastic foams , also provide the desirable characteristics of being compliant and resilient , offering the capability of “ giving ” and returning to their original shape . in general , however , the porous substrate can be a commercially available , standard air filter . in general , the emi - absorbing solution provided in step 110 includes one or more emi - absorbing materials and a binding agent . in some embodiments , the emi - absorbing solution also includes highly conductive material , such as copper or aluminum . emi - absorbing materials are selected to suppress the transmission of electromagnetic energy , for example , by converting the electromagnetic energy into another form of energy , such as thermal energy . emi - absorbing materials may exhibit dielectric or magnetic properties , or a combination of both . some examples of emi - absorbing materials include carbon , carbon fibers , alumina ( al 2 o 3 ), sapphire , silica ( sio 2 ), titanium dioxide ( tio 2 ), ferrite , iron , iron silicide , graphite , and composites with different combinations of iron , nickel , and copper . the aforementioned emi - absorbing materials are generally solids over anticipated ambient operating temperatures and pressures . as such , the emi - absorbing materials are generally prepared as particles suitable for suspension within the binding agent . various u . s . patents describe lossy materials and their uses . see , for example , u . s . pat . no . 4 , 408 , 255 issued to adkins , u . s . pat . no . 5 , 689 , 275 issued to moore et al ., u . s . pat . no . 5 , 617 , 095 issued to kim et al ., and u . s . pat . no . 5 , 428 , 506 issued to brown et al ., the disclosures of which are herein incorporated by reference in their entirety . some manufacturers of lossy materials are r & amp ; f products of san marcos , calif . ; arc technical resources , inc . of san jose , calif . ; tokin america , inc . of union city , calif . ; intermark - usa , inc . of long island city , n . y . ; tdk of mount prospect , ill . ; and capcon of inwood , n . y . the binding agent adheres the emi - absorbing material to a substrate , such as the porous substrate . in some embodiments , a binding agent is selected that cures with a resilient consistency . in one embodiment , for example , the binding agent is an elastomer , such as a resin binder . in other embodiments , the binding agent is a rubber , such as a natural latex rubber ( for example , stuart 1584 ), a synthetic rubber , such as styrene - butadiene rubber ( sbr ), or a proprietary binder . binders having a resilient consistency adhere the emi - absorbing material to the porous substrate , while allowing the porous substrate to remain flexible or supple . in other embodiments , however , a binding agent is selected that cures with a less resilient or even rigid consistency . one example of a rigidly curing binding agent is an epoxy resin . the application step ( step 120 ) applies the emi - absorbing solution to the porous substrate . in one embodiment , the porous substrate is dipped in a bath of the emi - absorbing solution . in another embodiment , the emi - absorbing solution is applied to the porous substrate as a paint , for example , by either a brush , roller , or spray applicator . in yet other embodiments , the emi - absorbing solution is applied to the porous substrate as an ink , for example , by one or more applicators bearing the emi - absorbing solution . generally , the emi - absorbing solution is applied liberally to the porous substrate , such that excess solution is thereafter removed . the removal of excess emi - absorbing solution ( step 130 ) primarily assures that the pores of the substrate treated with an application of the emi - absorbing solution remain substantially open , thereby ensuring that the substrate remains functional as an air filter . in one embodiment , removal of the excess emi - absorbing solution is accomplished by squeezing or otherwise compressing the treated substrate . for example , the treated substrate can be drawn through a roller , such as one formed between two opposing cylindrical rollers , or a single cylindrical roller opposing a rigid planar surface or plate . in other embodiments , removal of the excess emi - absorbing solution is accomplished by forcing or drawing air through the treated porous substrate . the air can be forced through the treated substrate by applying a positive pressure at a first surface of the substrate . alternatively , air can be drawn through the treated substrate by drawing a vacuum on one side of the substrate . the removal of excess emi - absorbing solution can be accomplished by a combination of the aforementioned methods . the curing step ( step 140 ) allows the applied finish of the emi - absorbing material and binding agent to set . in some embodiments , the finished substrate can be air - cured at ambient room temperature . in other embodiments , the finished substrate can be cured at elevated temperatures , for example in an oven . in some embodiments , a fire retardant , such as a phosphate or antimony trioxide , is optionally applied to the substrate ( step 160 ) to meet stringent flammability standards . one such flammability standard is the ul94v0 vertical flame test , described in detail in underwriters laboratories standard 94 , entitled “ tests for flammability of plastic materials for parts in devices and appliances ,” 5 th edition , 1996 , the disclosure of which is incorporated herein by reference in its entirety . in some embodiments , a fire retardant is applied in the same manner as described above for the emi - absorbing solution ( steps 100 through 140 ). in other embodiments , additional treatments , such as fungicides , are similarly applied . referring now to fig2 a , a perspective view is illustrated depicting a free - standing , planar , emi - absorbing air filter 200 . in general , the planar filter 200 defines an arbitrarily shaped cross section 210 ( shown as a rectangle ) having a predetermined thickness 205 . there are no particular constraints on the thickness 205 , however common values range from about 0 . 1 inch to 0 . 5 inch or more . the size of the cross section 210 is generally determined by the application , typically being larger than the air - vent opening to which it is affixed . fig2 b illustrates a perspective view of a framed configuration 208 including a planar , electromagnetic - interference - absorbing air filter 200 configured within a frame 210 . the frame 210 provides rigidity and can include structure for fastening the framed filter 208 to an equipment housing ( not shown ). for example , the frame 210 can include mounting holes 212 through which fasteners are inserted to secure the framed filter 208 to the equipment housing . as discussed above , the emi - absorbing material is generally most effective at higher frequencies ( for example , above 1 ghz ). in some applications , however , particularly where the cross section of the air filter is relatively large ( for example , greater than about 10 cm ), the emi - absorbing filter 200 can be combined advantageously with a low frequency emi - mitigating means . illustrated in fig3 is a perspective view depicting a combination emi / air filter . the combination filter 300 includes an emi - absorbing air filter 200 , as described above , and an electrically conducting layer 310 . the conducting layer 310 is an electrical conductor , such as aluminum or copper , with an array of apertures through which air can flow . the conducting layer 310 can be formed from a rigid plate or from a screen . in some embodiments , the conducting layer includes a conductive coating applied to the filter 200 . the conductive coating generally consists of a highly conductive material , such as copper , aluminum , or gold . the conductive coating can be prepared as a paint or ink and applied to the filter 200 by dipping , brushing or spraying . alternatively , the conductive coating can be prepared as particles and applied to the filter 200 in a sputtering process . the combination air filter 300 can be optionally mounted within a frame 210 ( illustrated in partial cutaway ). the frame 210 offers rigidity and also assists in forming a positive electrical ground from the conducting layer 300 to the equipment housing . the frame 210 itself can be conducting , thereby providing electrical bonding between the conducting layer 310 and an equipment housing . alternatively , the frame can be non - conducting , forming an electrical bond by compressing the conducting layer 310 against the chassis . generally , the frame 210 includes a fastening means 320 , such as a mechanical fastener ( for example , a screw , a rivet , and the like ). referring to fig4 , an alternative embodiment of a combination emi filter 400 is shown . a perspective view of the combination emi filter 400 is illustrated depicting an emi absorbing air filter 200 combined with a waveguide - below - cutoff layer 405 . the waveguide - below - cutoff layer 405 is formed from an electrical conductor , such as aluminum or copper , and includes an array of apertures 410 ( that is , waveguides ) distributed across the filter &# 39 ; s surface area . each aperture 410 can be constructed with arbitrary shapes , such as rectangular ( shown ), circular , and hexagonal . each aperture 410 preferentially attenuates electromagnetic radiation below a predetermined “ cutoff ” frequency controllable by the dimensions of the aperture 410 . the apertures 410 of the waveguide - below - cutoff layer 405 allow air to flow to the emi - absorbing air filter layer 200 . as the emi - absorbing layer 200 attenuates higher frequencies , the resulting combination emi filter 400 attenuates a broader range of frequencies than either layer 200 , 405 would otherwise attenuate alone . in general , the emi - absorbing air filters can be fashioned in any desired configuration . fig5 a and 5b illustrate exemplary non - planar applications depicting embodiments in which the porous substrate upon which emi - absorbing solution is applied is pleated 500 , and tubular 510 . fig6 illustrates one embodiment of a “ dipping ” manufacturing process for forming the emi - absorbing air filter . a container 600 , such as a trough , holds an emi - absorbing solution 610 . a porous substrate 200 is then immersed into the solution 610 thereby allowing the solution 610 to completely cover and penetrate the porous substrate 200 . the substrate 200 is then drawn from the solution 610 through a wringer 620 . the wringer 620 , shown as a dual cylindrical roller assembly compresses the substrate 200 by a predetermined amount to remove excess solution 610 and to ensure that the solution 610 is forced into the interior of the substrate 200 . fig7 illustrates an alternative embodiment of a “ spraying ” manufacturing process for forming the emi - absorbing air filter 200 . one or more sprayers 700 ′, 700 ″ ( generally 700 ), spray the emi - absorbing solution 710 onto the porous substrate 200 . generally , any type of spray applicator 700 known to those skilled in the art can be employed ( for example , pneumatic , mechanical , aerosol , etc .). the sprayer ( s ) 700 apply a liberal coating of the emi - absorbing solution 710 to completely cover and penetrate the porous substrate 200 . the substrate 200 is next drawn through a wringing device , such as a dual cylindrical roller assembly 730 . the wringing device 730 compresses the substrate 200 by a predetermined amount to remove excess solution 720 and again to ensure that the solution 710 is forced into the interior of the substrate 200 . fig8 illustrates test measurement results relating to the emi performance of a sample emi - absorbing air filter . the emi - absorbing air filter test sample was formed by applying a carbon - based absorber in an elastomer binder to an open - cell reticulated polyurethane foam planar substrate . the sample substrate was formed as a 0 . 25 - inch thick sheet having approximately 20 ppi . the sample was treated with a double carbon coating and flame retardant as described above . the electromagnetic transmission loss was measured across the filter over the frequency range from about 2 . 0 ghz to about 18 . 0 ghz . the resulting sample demonstrated a measured attenuation of more than 20 decibels ( db ) above a frequency of about 4 ghz . as the emi - absorbing air filter must also function as an air filter , it is important that the filter allow sufficient air flow after being treated with the emi - absorbing material and , optionally , with other coatings , such as a flame - retardant coating . one measure of the air filter &# 39 ; s air flow performance is pressure drop versus air flow . a discussion of an exemplary test setup for measuring the air flow performance , as well as measured air flow test results , are provided herein as an appendix and incorporated herein . generally , any reduction in air flow resulting from the application of the one or more coatings is controlled to reduce air flow by no more than a predetermined amount ( for example , a difference in pressure drop for the same air flow of not more than 10 %). having shown exemplary and preferred embodiments , one skilled in the art will realize that many variations are possible within the scope and spirit of the claimed invention . it is therefore the intention to limit the invention only by the scope of the claims , including all variants and equivalents . this test compares the airflow characteristics of a non - shielding air filter material to absorber - treated air filter materials . a “ baseline ” air - filter material has been selected to represent an exemplary electronic - equipment dirt and dust filter . the baseline filter consists of an open - cell polyurethane foam having approximately 20 ppi and a sample thickness of 0 . 25 inch . a first sample reference “ t - 15 ” represents an emi - absorbing air filter having a double coating of carbon and a flame - retardant treatment . the t - 15 sample has been formed using an open - cell polyurethane foam , approximately 15 ppi and a sample thickness of 0 . 25 inch . a second sample reference “ r - 20 ” represents an emi - absorbing air filter having a double coating of carbon and a flame - retardant treatment . the r - 20 sample has also been formed using an open - cell polyurethane foam , having approximately 20 ppi , and again having a sample thickness of 0 . 25 inch . airflow testing was conducted in accordance with air - permeability standard , astm d737 , described in the american society for testing and materials annual book of astm standards . the test set - up , a representation of which is shown in fig9 , consisted of a 6 inch &# 39 ; 6 inch sheet metal duct 900 with metal flanges at each end ( not shown ). a first end of the duct 902 was sealed against an opening in a plenum chamber 910 using suitable fixtures and sealant . the emi - absorbing air filter sample under test was attached to a second end of the duct 912 and sealed in a manner preventing leakage from the sides . a pressure tap 920 was made on the duct at a distance of 18 inches from its second open end 912 . a plenum chamber outlet 930 was connected to the suction side of a centrifugal blower ( vacuum pump ) 940 via a series of valves 950 and an airflow - metering device . calibrated instrumentation was used in measuring the test parameters . fig1 illustrates the resulting test data in graphical form comparing the performance of the absorber - treated foams ( t - 15 , r - 20 ) to the untreated baseline foam filter . the graph includes a vertical axis representing “ static pressure ” ( measured in inches of water ) and a horizontal axis representing “ airflow ” ( measured in cubic - feet - per - minute per square inch of vent panel , cfm / in 2 ). test results for the untreated baseline foam and two samples of treated foam are illustrated on the graph . the test results demonstrate that the static pressure increases with increasing airflow for all three samples . this gradual increase in static pressure is due to the inherent resistance to airflow that the test panel offers to the air stream . the results indicate that there is virtually no difference between the untreated baseline filter foam and the r - 20 absorber filter foam . as expected , the t - 15 absorber filter foam exhibits greater air flow than the baseline and r - 20 samples . this is due to its cell structure being more open with 15 ppi as compared to 20 ppi for the other two test samples . the data indicates that the airflow characteristics of the r - 20 sample should be similar to the baseline samples , while also providing emi absorption .	8
fig1 is a block diagram representation of an encoder 10 which is used in a transmitter for transmitting data , in a secure form , according to the invention , over a radio frequency , infrared , or other medium . the encoder can be implemented as an integrated circuit with its various components being part of this circuit or provided as discrete components . the encoder 10 has non - volatile memory 12 , a control unit or processor 14 , an interface or input module 16 which receives data from input sources 18 such as switches or push buttons , an oscillator 20 , a timer 22 and a voltage reference module 24 . information pertaining to the identity of the encoder is stored in the non - volatile memory 12 . the timer 22 runs continuously and is connected to the oscillator 20 , or to a crystal , to give a timing reference . the timer 22 changes at regular intervals to reflect time irrespective of whether the encoder is activated for transmission . the time measure can be in minutes or seconds but may be any regular period . the encoder is controlled by a user activating one or more of the inputs 18 and the resulting signals are interfaced to the control module 14 which interprets the input and causes corresponding operation of the encoder . fig5 illustrates an example of a data word 28 produced in the encoder . in this example the data word includes timer information 30 derived from the timer 22 , command information 32 which is produced by one or more of the inputs 18 , a serial number 34 , or a portion thereof , which relates to the identity of the encoder , fixed code or user derived information 36 , and utility information 38 which pertains to operational parameters of the encoder . the timer information 30 is essential to produce variance in the data word 28 in order to prevent replay attacks . the length of the timer and its resolution reflect a balance between cost , security , and practical implementation factors . for example the timer may be a 24 - bit device which increments every 10 seconds . due to the fact that the timer changes every 10 seconds a transmission value recorded away from the receiver will soon be invalid because the decoder will be able to determine that the timer value is out of date . the oscillator 20 in fig1 is preferably completely on - chip failing which the oscillating range must be restricted . as such the oscillator cannot be fast forwarded to achieve the same effect as in a “ fast stepping ” attack , or purely to make up time that can be used to record away from the receiver and then use the “ extra ” time to go back to the receiver . one of the major problems of a time based system is that power 40 ( see fig1 ), whether from a battery source or otherwise , may be lost . if this happens the encoder immediately loses its relative time compared to other encoders and decoders which form part of the security system in question . the time may be saved into non - volatile memory at regular intervals so that upon re - application of power to the encoder the timer can proceed from where it left off . it will , however , still be out of synchronisation by approximately the period that it was without power . continuously writing to memory requires “ waking up ” at regular intervals and over several years of usage the writing may be extensive . the waking up and writing operations consume meaningful quantities of energy which is not desirable in most applications . these operations may also limit the options on non - volatile memory due to the high number of read / write cycles and thus the quality of non - volatile memory which is required . another option is to save the time with each transmission . neither of these possibilities is however without drawbacks from the security point of view . the invention , as an alternative to the aforegoing approaches , makes use of a cold boot counter ( cbc ) 46 as is shown in the memory map 48 of fig2 . the cold boot counter value is incremented or changed each time the encoder is powered up or comes out of reset . the cold boot counter can also be changed when the timer overflows after an extended period of operation . the use of the cold boot counter holds several advantages in practice : ( a ) the encoder is generally cheaper . incrementing the timer in volatile memory ( ram ) at lower voltages is less costly than storing a value in non - volatile memory ( eeprom ) at very low voltages ; ( b ) fewer writes to non - volatile memory are required ; ( c ) the risk of writing errors is reduced ; ( d ) since the cold boot counter is changed only at the time of powering up or reset , time constraints are much relaxed . it may however be desirable from a security perspective to increase the time constraints from seconds to minutes ; and ( e ) the power requirement is reduced . it is noted that it is important that the cold boot counter value changes in a constant direction ( up or down ) in order to determine new and old transmissions ( possible replays ). as is shown in fig2 the memory map 48 at the encoder includes an identification number or key 50 , the cold boot counter ( cbc ) value 46 , a serial number 52 , a configuration word 54 , a seed 56 and user - derived key information 58 . the cold boot counter value can be used to influence the key or the algorithm at the encoder and does not necessarily form part of the data word 28 to be encrypted . it is however proposed that the cold boot counter value is transmitted to the receiver / decoder in the clear . this may not happen with every word but can for example only occur in an extended transmission , say of at least 15 seconds , or for the first hour after a power - up event . the cbc value may also be transmitted partially with successive transmission words . fig6 illustrates a transmission word 70 which includes the cold boot counter value 46 ( in the clear ), command information 72 , an encrypted version 74 of the data word 28 , the serial number 34 , a heading 74 and a cylic redundancy count ( crc ) value 78 . this word is transmitted to the decoder at which the word is decrypted and data extracted therefrom is used , in a manner which is described hereinafter . according to one aspect of the invention a number of high end bits of the timer value are used for a high speed timer to count down for a short time period , say of the order of 10 seconds . this is done immediately following a first transmission in a sequence of activations . one bit of the timer is used to designate an optional status bit to show what is reflected in the timer 22 . this high speed timer allows easy access and better time resolution in the period after a transmission has been activated and helps a decoder make time - based activation decisions . for example a second transmission activation within three seconds of a first activation may be a command to unlock all doors in a vehicle and not only the driver &# 39 ; s door . the decoder need not even receive the first transmission . as the timer 22 runs each transmission word from a single activation of the encoder may be based on the new timer value and may as such differ from a preceding word . this approach may however not always be desirable and according to a variation of the invention a new transmission word may be formed with every new activation of the encoder or after an extended period of transmission activation , say in excess of 5 seconds . fig3 is a block diagram representation of a decoder 80 . the decoder includes a control unit or processor 82 , an on - board oscillator 84 , a timer 86 , a decoding and key - generating algorithm 88 which is stored in non - volatile memory , a memory module 90 , a reset and voltage reference 92 , and an output module 94 which acts as an interface to output devices 96 eg . led &# 39 ; s or the like . data 98 may be transmitted to the control unit during a normal transmission whereas learning input 100 may be instructed to the control unit to enter a learning mode . preferably the oscillator is controlled by a crystal 102 . fig4 is a decoder memory map 104 of information held in the non - volatile memory 90 . the map includes a generation key 106 and a plurality of sets of data 108 ( 1 ), 108 ( 2 ) . . . etc . resulting from successive transmissions from respective transmitters / encoders . each transmission includes the respective cold boot counter value , the seed and serial number , the user identification number and the configuration word referred to in connection with fig2 . the decoder , in volatile memory , ( fig4 ( a )), may also include information about the relationship of each encoder timer with the decoder timer ( tr ). the decoder 80 has a learn mode in which it can “ learn ” a new authorised encoder . upon completion of the learn action the decoder is able to recognise transmissions from the now learned encoder . the learning process is , in general terms , known in the art . however it is proposed that each encoder has a user - derived changeable portion of its key 58 ( see fig2 ), which is a portion of the key that can be changed or influenced by the user and which is not known to the manufacturer . this has a number of security benefits . the user - derived key information can be determined through inputs 18 to the encoder , eg . dip switches or through a button operation procedure . an example is the time period between a first power - up action and the instance at which a button is pressed . the user - derived information 36 may also be inserted into the data word 28 and both methods will cause a change in the transmission word ( 70 ) values and sequence . since a key needs to be derived from data transferred from the encoder to the decoder during the learning process ( for example the serial number , seed and the user - derived key information ) it falls within the scope of the invention to store this information and to derive the key only during the process of receiving and interpreting commands . this does have the drawback of needing extra processing at the time of receiving a command but saves costs as non - volatile memory to store the keys is not required . when learning information from a transmitter , during the learn mode , this information is stored in a first - in - first - out ( fifo ) stack structure . as can be seen from fig7 and 8 each new encoder is learned into the same position . prior thereto all other positions have been programmed into the next memory location , overwriting the information that was there before . clearly the previous value that was in position “ n ” ( fig8 ) will be lost — hence the fifo designation . during the learning process a relationship ( tr ) is established between the timer value ( te ) of the encoder and the timer value ( td ) of the decoder . for example , if at the time of learning , te = 120 and td = 1243 , the mathematical difference , tr , between the two values , which is 1123 , can be stored . if it is accepted that the decoder and encoder timers are perfectly in synchronism then at the time of the next transmission when td = 1574 the received te value must correspond to mathematical difference of 1574 − 1123 = 451 . it is important that the tr value is stored for each learned encoder . as the encoder and decoder timers ( 22 and 86 respectively ) will inevitably exhibit drift between them in all but the most expensive systems it is important to accommodate such drift without undue sacrifices to security and with as little requirement for user intervention as possible . this also holds true for the handling of a power failure at the encoder or decoder . according to a preferred aspect of the invention the timers 22 and 86 are designed so that the encoder timer is always faster than the decoder timer . the design is such that even with the encoder timer at its slowest variance and the decoder timer at its fastest variance the encoder timer is the faster of the two . with each valid reception the decoder recalibrates the tr value for the specific encoder and the previous tr value is replaced with the new tr value which reflects the exact and latest relationship between the encoder and decoder timers ( 22 and 86 ). as such even if there is drift of ( say ) 1 minute per day and a 5 minute window is allowed for a valid transmission , a system which is used on a regular basis does not drift too far because with each use the previous drift is calibrated out . for example , a system in a car which is used twice a day ( evenly spaced ) will , based on the preceding assumptions , always be within about 0 . 5 minutes accuracy . due to security considerations a reception under conditions in which te is further advanced , with reference to td , is less of a problem than a slow te . the latter may be an attempted replay or a transmission recorded out of range from the decoder and then taken to the decoder ( hence the timer loss ) and replayed . production offsets ( ie . drift between the timers which is constant and which does not change over time ) can also be calibrated out with a coefficient . for example when an alarm system is installed in a controlled environment ( regulated temperature and voltage ), two transmissions with a reasonable time period between them ( of the order of several minutes ) can be used to trim out such manufacturing offsets . if it is known that under controlled voltage and temperature conditions the normal drift is 1 %, but it is found by measuring the drift between two successive transmissions that the drift is in fact 2 %, then the difference can in future always be multiplied by a factor ( 101 / 102 ). if the drift on the other hand is − 1 % then a factor ( 101 / 99 ) is used to adjust the drift . the invention allows two types of forward windows to be accommodated , namely an auto - synchronisation window wa and a re - synchronisation window wr . the auto - synchronisation window sets a time limit boundary for drift ( te greater than td ) which is not regarded as a problem . security requirements dictate this value should be as small as possible but , from a practical point of view , this should not enforce additional actions on a user to such an extent that the system becomes cumbersome or user - unacceptable . the auto - synchronisation window could be a fixed value but in a preferred embodiment is represented by a factor of , say , 3 % of usage time . in the latter case the window grows larger over time but is a more accurate representation of the drift between the counters . in the prior art which is embodied in bruwer et al and soum the counters represented a number of activations which are unrelated in time . in the present invention however the auto - synchronisation window is not related to the number of activations and is purely a function of the relative drift between the timers over the time elapsed since a previous valid reception . this is the case since tr was last calibirated at the minimum or at the time of the previous valid reception . note that in yoshizawa the window has to cover time elapsed since the encoder was first connected with the decoder . this is quite a severe impediment . the wa type of window which can be accommodated by the system can have a minimum and / or maximum value . this window can be specified even though a factor of the elapsed time is used for the determination of the window size . this has the advantage that in a system which is used on a regular basis the wa window is quite small but even if the system is not used for a long time , say in excess of a year , the size of the window wa is kept to an acceptable period of , say , 10 minutes . for example for a 0 . 1 % wa factor and 5 second minimum and 10 minute maximum caps the following occur : should the te value be faster so that it falls beyond wa in terms of security it is desirable to perform further security checks . a further window called a re - synchronisation window ( wr ) can be used and this window will require some further security checks that may not be too stringent . one such security check requires a further transmission in order to verify that the timing information correlates with the expected value with reference to that of the previous transmission which fell outside wa but inside wr . in some applications this check would suffice and , if the encoder timing information passes this test , the decoder accepts the command and also re - synchronises the tr value to remove the drift which has occurred . if the te value is beyond wr the decoder does not accept transmissions from that encoder and enforces a re - learn or other action as is described hereinafter , which totally resets the encoder / decoder relationship . with a te value which is slow with reference to the td value the security constraints required are much tighter . with correct design there is no reason why the te value should fall behind the expected value . it must be recognised however that any increment beyond the value previously received , even if slower with respect to the expected value , still yields better security than “ activation count ” based systems such as those described in the bruwer et al and soum . yoshizawa on the other hand treats slow and fast windows in the same way . depending on the security requirements various options can be designed into the system to “ double check ” the authenticity of the encoder . for example , if the te value is 30 seconds fast then the decoder can check for a new value 30 seconds later . a valid new code would mean that the encoder is present and therefore authentic . however with a sound design and a guarantee that te is faster than td , rather than slower , the reception of a slow te raises serious security concerns . it is possible to re - synchronise an encoder with a slow te , or a te falling outside the wa and wr windows , in one of three different ways described hereinafter : this is equivalent to adjusting the combination of a safe access code when it is open . as such another legal or approved mechanism must be used to put the system in an “ open ” state . this can be another encoder , a mechanical key , an electronic token or the like . once in an “ open ” mode the tr value can automatically adjust . ( b ) physical contact between the encoder and decoder can be established by means of an electric connector . this can be a requirement before further access is granted . physical contact may be established through an electrical connector situated on the outside of a security perimeter which is protected by an access control system linked to the encoder / decoder . for example if the system controls a garage door opener , the electrical connector can be in a house or an outer side of the house . on the other hand if the security system is used in connection with a vehicle , the connector may be on an outer side of the vehicle or some place which is accessible only with a mechanical key , eg . inside the trunk or boot of the vehicle . by using a physical electrical connector to transfer electrical signals the decoder can control activation buttons to create a quasi bi - directional system . electrical contacts to the activation inputs of the encoder allow the activations to be executed in such a way that the probability of codes , which do not originate from the authentic encoder , being presented to the decoder is very low . this probability can be statistically controlled by suitable design . in other words by making the communication via the electrical contacts more complex or expanded , the probability of a successful attack can be lowered . in a preferred embodiment the high speed timer and repeat ( activation ) counter play a major role . upon insertion in the connector the decoder activates the encoder . this first transmission starts the high speed timer and the decoder then randomly activates other buttons which influence the transmission words from the encoder via the command bits in the data word . the decoder verifies that the words have been constructed at the precise time with the correct command button information . by making sure the activation sequence is such that the high speed timer is used or that the normal timer would show , the pre - recording of multiple commands can be prevented , thereby lowering the probability of a successful attack . in another embodiment the sequence can also be checked via the repeat activation counter which counts the number of activations in a defined period after a first activation . again , this can prevent the pre - recording of multiple activations in order to have a replay response available to the decoder activations . the same mechanism can be used via feed back to a user but will probably not be acceptable for the average user . an example is a display panel indicating the sequence of buttons that must be pressed . full bi - directional communications may be used . if however bi - directional communication facilities are available then these facilities should be considered for more extensive use as they can enhance security when implemented correctly . a situation can however be foreseen in which communication in one direction will be of limited range . for example , the encoder to decoder medium may be rf whilst the decoder communicates with the encoder via optical , transponder or hard wiring means due to cost or other considerations . in an example of an application using the principles of the invention an ir led may be used to provide the communication medium from the decoder to the encoder . the encoder is part of a rf key fob . the encoder monitors an optical receiver ( pin diode ) after it has been activated and has transmitted a code word . if the decoder receives a code from the encoder with an unacceptable te , it communicates back to the encoder via the optical medium . if the key fob is held in the optical path , ( because the user notices that the decoder does not read ), it will receive the decoder data and the encoder / decoder can proceed with a bi - directional verification process . it must be mentioned that a physical connector can also solve the problem of a dead encoder battery by providing power , whereas the optical system cannot . if the authenticity of the encoder is established via any of these methods , the tr value is automatically adjusted to re - synchronise te and td by removing any drift that may have caused the problem . an example of an encoder operational life cycle is described with reference to fig9 . upon a power - up sequence or when a reset occurs ( 210 ) a number of functions take place to reset the integrated circuit which embodies the encoder . in essence the integrated circuit is put into a well - defined state to ensure that its function is predetermined upon coming out of reset . for example memories are cleared , and pointers and program counters are set to defined positions . the encoder now increments ( 212 ) the cold boot counter ( cbc ) value . it is important that redundancy or error correction is used in this step to prevent the cbc value from being erased or scrambled due to writing errors or the like . as such checks should also be done to verify that the voltage supplied to the circuit is sufficient to ensure successful writing into the non - volatile memory . once the cbc value has been incremented the encoder moves into the cycle in which it will spend most of its life . if the timer is to be incremented ( 216 ), and this takes place at regular intervals of , say , 10 seconds , then the timer count is advanced ( 218 ). a further check ( 220 ) is done to verify that the timer has not reached its limit and is about to overflow . this however is a rare occurrence . the inputs 18 ( see fig1 ) are monitored ( 222 ) to check if the encoder has been activated . if no inputs are active the cycle repeats itself endlessly . upon detecting active inputs , the inputs are debounced and read ( 224 ). if the inputs are valid ( 226 ) the timer value is read and the data word is constructed ( 228 ). it has been explained in connection with fig5 that the data word consist of several elements which are put together to prepare the encrypted data word 74 ( see fig6 ). if the inputs are not valid ( 229 ) then the earlier cycle steps are repeated . after reading the timer the controller checks if the high speed timer ( hst ) is already running or if this transmission is actually the first transmission which has taken place after a period of inactivity ( 230 ). if the hst is not running it is started and the flag for the hst is set so that it is recognised that the hst is active ( 232 ). the subsequent transmissions will include the high speed timer count as part of the data word . the resulting data word is encrypted ( 234 ) and the result is used in the construction of the transmission word 70 ( see fig6 ) in a step 236 ( see fig9 b ). before the transmission word is transmitted over the medium in question ( rf , ir or other ) the inputs 18 are checked to verify that the same command is still active ( 238 ). if not the transmission is abandoned and the controller 14 returns to its waiting cycle ( 216 , 222 ). if the command is still active the encoder starts to output the data of the transmission word so that it can be transmitted ( 240 ). typically the encoder is responsible for the data rates . although not shown the encoder can continuously check for a new input demanding that a new word should be formed immediately . under such circumstances the transmission can immediately be terminated in order to start preparing and transmitting the new transmission word . the controller can exchange some of the cbc bits that form part of the transmission word ( 242 ). for example if the cbc is 16 bits and only two bits at a time are being added to a transmission word then 8 consecutive words would be required to reconstruct the cbc counter at the receiver / decoder . this does not affect the security of the transmission but it does provide a convenient way of reducing the length of the transmission word . thereafter the controller can return the operation ( 244 ) to the phase prior to the step 238 . if however the system is designed to start output of the hst after a certain elapsed time ( say 5 seconds ) it proceeds to a step 246 at which the hst count is read . a check is then performed to see if the command currently active has been active for at least 5 seconds ( 248 ). if a transmission word has not been previously constructed ( 250 ) then a check is done ( 252 ) to see if the same input 18 is still active . a recycle or return to earlier process steps takes place depending on the outcome of this test . if a transmission word has previously been constructed then the process synchronises the addition of a new hst count with the completion of an earlier transmission and a new data word is formed ( 254 ) and encrypted ( 256 ), and a new transmission word is constructed ( 258 ). the transmitter cycle then continues from immediately prior to step 238 . at any time the process can be terminated when the inputs change or fall away ( 238 or 252 ). if the inputs change or are repeated within a short period , say from the start of the hst , the repeat counter increments with each new activation . once the hst overflows the normal timer is incremented . if the hst works within the same interval ( say 10 seconds ) this should prevent seamless timing . an encoding example is described with reference to fig1 a and 10 b . at the start of an encryption algorithm ( 300 ) all the initialisation of hardware and software is done . a specific key is read from non - volatile memory and the cbc count is obtained ( 302 ). the key is the key allocated to a specific encoder . if an encoder has multiple keys one of these is determined by means of a particular command . the key may be read 8 bits at a time . the data which is to be used in the encrypted data word , ie . the data word and the user derived information , is obtained ( 304 ) and the various elements are fed to the algorithm ( 306 ) to yield a scrambled data word ( 308 ) which is used in the transmission word . fig1 b schematically depicts an encoding algorithm 310 operating on the data word and user derived information 312 , and the key and the cbc count 314 , to yield the scrambled data word 74 . it is to be noted that in the decoding process which is carried out at the receiver the decoder algorithm performs the reverse operation in that if the decoding algorithm is provided with the correct key and cbc count the decoding algorithm transforms the scrambled data word 74 to yield the data word and the user derived information . an example of decoder operation is discussed with reference to fig1 . upon reset ( 350 ) the decoder , in a step ( 352 ), scan its input ( 98 in fig3 ) for data received . if a test 354 shows that the data format is incorrect then the preceding cycle is repeated . once a complete transmission word of the correct format has been received the decoder , in a step 356 , does a cyclical redundancy check ( crc ) to verify that the transmission word was correctly received , and checks the serial number and the cbc portion of the transmission word . thereafter in steps 358 and 360 respectively the serial number and the cbc value are matched against corresponding values stored in non - volatile memory 90 ( see fig3 ). if the cbc value is not matched against the stored value then a period of time elapses in which additional data is received and a new cbc value is constructed ( step 362 ). the validation process is then repeated . after the validation process has successfully been completed the decoder reads the timer data td ( step 364 ) and then uses the serial number and other information stored during a learning process to calculate a decryption key ( 366 ) corresponding to the encoder that generated the particular transmission word . the decoder uses the decryption key together with the cbc value to perform a decryption process ( 368 ) on the scrambled part of the transmission word . it is to be noted that some commands may not require any security and in this event the decoder may interpret and activate the command after the step 360 . however , since the only advantage would be that the command can be issued some milliseconds earlier this is not of particular significance . with the decrypted data word available the decoder performs a check to verify a match between the encoder user derived information and the decoder user derived information ( 370 ). a non - match forces a return to the scanning of the input for a valid transmission word ( step 352 ). if the match is positive the more complex checking between the encoder and decoder timers is performed . in this example a re - learn is assumed if the re - synchronisation window wr is exceeded or te lags behind td . firstly the automatic synchronisation window is checked ( 372 ) and if the check is passed then the command bits are interpreted and the outputs activated ( 374 ). the tr value is updated to reflect the latest relationship between the encoder and decoder timers ( 376 ) and thereafter the process is repeated . if the step 372 shows that the difference between the encoder and decoder timers displays a tr value falling outside the auto - synchronisation window wa then the value is checked against the less rigid re - synchronisation window wr ( step 378 ). if tr also falls outside of wr then the received transmission word is abandoned as being invalid and the decoder returns to the scanning input step 352 . if the timing difference tr falls within wr then the decoder prepares to receive another transmission word within a short time ( say 10 or 20 seconds ) and it then can use the hst data to confirm a second transmission ( 380 ) and verify the timing relationship ( 382 ). because the time interval in question is particularly short no significant drift can occur . a check is done against wa but , if necessary , a tighter check can be effected . if the test fails the decoder cancels the re - synchronisation process ( 384 ) and returns to step 352 . if the timer test ( 382 ) is successful the tr value is adjusted ( 386 ) and the commands are interpreted and activated ( 390 ) whereafter the process returns to the stage 352 . the preceding example does not cover the handling of the hst , repeat data , battery level indication , shift levels nor a situation in which the decoder loses or has lost power and therefore has lost timer information . usually the decoder is more expensive and complex than the encoder . a single decoder is also typically required to work with multiple encoders . power consumption is normally less constrained at the decoder , compared to the encoder . due to these factors it is desirable to have the decoder timer include the hst portion permanently . this may prove handy for comparisons at re - synchronisation actions or when second or third instructions are received within a short space of time . it is also important for handling a quasi - bidirectional synchronisation or authentication process as discussed earlier . the shift levels , battery level indications and repeat values all comprise information which may influence the outputs generated by the decoder . if the decoder should lose power then it would pass through the reset state ( 350 ) when power is restored . at this point a choice is made from a number of options . for example the time of every valid reception can be stored in non - volatile memory each time a valid word is received and successfully decoded . a flag can now be set to relax wa and wr for all encoders which have already been learnt , for one auto re - synchronisation action . a check is carried out that the encoder timer has increased beyond what was stored at the reception of the previous valid transmission word from the corresponding encoder . another option is to enforce the change of the cbc value at the encoder or the re - synchronisation of the decoder tr values by operating a transmitter while in the open state . in another variation the decoder can use a timer value from the next valid and previously learnt encoder activating it after the reset , to readjust its main timer . all tr values ( for other learnt encoders ) would automatically come into play again . this can be done with some provision for error by adjusting the decoder for only 99 % of the perceived lost time as can be derived from this single encoder timer . this is because it is far more difficult to handle encoders with timers lagging the decoder timer than for encoders with timers which lead the decoder timer . the decoder learn operation is discussed with reference to fig1 . the decoder must be instructed to switch from normal operation to learning mode and typically this is done using an input switch 100 ( see fig3 ). once the activation of the input switch is detected ( 400 ), the switch is debounced ( 402 ) to confirm that the input is activated . the input for the learn mode can operate on an interrupt basis or it can be tested from time to time in the program flow during normal operation of the decoder . once the learn mode has been confirmed ( 404 ) the decoder must receive sufficient transmission words to construct the cbc value that may not necessarily be completely included in every transmission word ( 406 ). if this process fails due to the transmission terminating before the complete cbc value has been received or due to the incorrect reception of code words , the learning process is abandoned ( 408 ) and the process returns to step 402 to verify that the learning mode is still selected . the decoder timer is also read for reference . if sufficient information is received to construct the cbc value ( 410 ) then the control unit 82 ( see fig3 ) constructs the cold boot counter value and reads the timer data td from the timer 86 ( step 412 ). the control unit then calculates ( step 414 ) the decryption key using the serial number , the cbc count and other information transferred via the transmission values . this key is used in the decryption process ( 414 ) to obtain the data word including the user derived information , commands and encoded timer information . in a step 416 the data is checked to see if it conforms to requirements . a further transmission a short time later may be required to verify the timer movement . once accepted as a valid learn the relevant information is stored into the decoder non - volatile memory 90 . this includes the tr value ( the relationship between the encoder and decoder timers ) and the te of the last valid received data word . the decoder may indicate ( step 418 ) the status of the learning process on some indicator to the user , eg . an led . the completion of the learning process of an encoder can also be indicated in the same way . this aforementioned process can be repeated to enable the learning of several encoders . the information from each encoder may be written to memory in a first - in , first - out sequence ( fifo ) as is shown in fig7 and 8 . in the aforementioned sequence it is not possible to perform selective erasing of encoders . it is possible though to erase the oldest encoder by the addition of a new encoder , once the memory for learned encoders is full . a further command to erase all learn encoders may be implemented . fig1 illustrates process steps in setting user derived information at the encoder 10 . when the encoder is powered up ( 450 ) a check is performed on internal non - volatile memory 12 ( see fig1 ) to determine if the user derived information (“ udi ”) has already been set . if not , the encoder can automatically enter a udi setting mode . in a variation the encoder can check if a special set of inputs has been activated ( 452 ) to cause the encoder to enter the udi setting mode . if not the encoder proceeds with normal operation ( 454 ). if special inputs are active ( 456 ) the encoder activates the high speed timer ( hst ) in a step ( 458 ). in a particular example the period for which the inputs are active is used to determine a value by stopping the hst changing at the time the inputs change ( 460 ). the substantially random value in the hst can be read and used as a udi value ( 462 ) to construct ( 464 ) a user defined information word which can then be stored ( 466 ) in the encoder non - volatile memory before proceeding with normal operation ( 454 ). the preceding description relates to a situation wherein the transmitter has a timer and the receiver has a timer . if an existing counter - based security system is to be upgraded to a timer - based security system then it is necessary to provide a dual capability so that the timer - based system can also be used with , and be compatible to , a counter - based system . to achieve this a timer - based transmitter is designed to work with a non - timer - based system ( ie . counter - based ), and with a timer - based system . the timer in the transmitter counts normally when powered up . when the transmitter is “ learnt ” to the receiver , the decoder at the receiver accepts any value which is assigned for the purpose or which otherwise is presented to the decoder . hence the decoder does not distinguish between counter - based and timer - based information . the need to synchronise the starting of the transmitter and receiver is therefore done away with . the transmitter timer is then operated for a period which is limited or controlled to ensure that the timer information is kept within the automatic re - synchronisation window of the count - based system ( ie . the earlier system which is to be upgraded ). when the transmitter time value reaches a point at which it will go outside the window , the timer stops . consequently , upon the next activation of the transmitter , the timer value which is used will be viewed by the previous ( counter - based ) system as a count value which is still within the limits of the automatic re - synchronisation window , and hence will be accepted . this procedure can be implemented until such time as a full timer - based system can be adopted .	6
one embodiment of the invention is a computer system comprised of a software program that compares the combination of treatment parameters for a proposed treatment plan with that from historical data taken from patients previously treated for the same disease with the same type of treatment . the program will identify deviations from the historical data , prompting the user to verify that the deviation is not the result of an error that could lead to a catastrophic radiation event . the treatment plan is typically a data record containing component items that specify a plurality of beam dosages , that is , each treatment plan is a group of specified beams , each of a beam shape , beam angle or position , beam intensity and beam time . the historical data for any radiation therapy modality , such as forward planning 3d conformal treatment for whole brain patients may be used . the goal of this analysis is to : 1 . identify which parameters or combinations of parameters share similarities among patients ; 2 . identify which treatment parameters or combinations of parameters lead to a potentially catastrophic radiation event , should the setting be wrong ; 3 . analyze what constitutes a deviation that can potentially lead to a catastrophic radiation event ; 4 . create the mechanisms by which a deviation can be identified in a proposed treatment plan when comparing with historical data . this invention relates to reducing the potential for catastrophic radiation or other error by using historical treatment data when automatically monitoring treatment plans or the operation of a clinical treatment device itself , including a radiation treatment delivery device . the increasing complexity of imrt ( intensity modulated radiation therapy ) treatment plans requires carefully checking the correctness and consistency of an increasingly large number of treatment parameters between planning and each delivery session . a new level of safety can be added in the planning and delivery process by exploiting the similarities that exist among treatment parameters of a large pool of plans for the same disease using the same technique . the system includes a software program that analyzes either treatment plan data or clinical treatment device machine parameter distributions from historical treatment data for a given disease site and alerts the user or other party of any deviation . the system can alert treatment planning staff that a treatment plan is outside a calculated norm . the system can also stop or prevent the treatment if a difference between the treatment plan and the machine parameters is detected . the distribution of treatment parameters for a population of 60 patients treated with whole brain irradiation using a forward planning technique with parallel opposed beams was analyzed . a total of 15 treatment parameters were considered , including the number of beams , beam energy , gantry , collimator and couch angles , ssd , field size , number of monitor units , number of monitor units ( mu ) per gy at isocenter and beam weight . for each parameter , a range of acceptable values was extracted from the population distribution . a new plan was considered consistent with historical data if each of its parameter values was compatible with 60 % of the population . in order to test the software , errors such as a wrong number of beams , beam energy , ct dataset or absence of heterogeneity correction were manually introduced in new plans . as expected , the population of whole brain plans is very homogeneous . the ssd and number of mu per gy exhibited a narrow gaussian distribution . the field size , beam weight and number of mu show 2 gaussian peaks corresponding to the open field and field - in - field , respectively . all other parameters had a single value . these narrow distributions made deviations easy to detect . the plans with the wrong number of beams or beam energy were easily detectable . the plan using the wrong ct dataset led to an ssd that was outside the historical range and was detected . a computer system comprised of a software program can compare each new treatment plan to historical treatment parameters for the same disease . this has been successfully tested on a population of whole brain treatment plans . the use of such a program can detect potential errors that were accidentally introduced during data transfer and recording . in addition by using more standardized treatment approaches for a given disease , the risk for errors can be reduced . the system is comprised of a computer operatively connected over a data network to a clinical treatment device . the device transmits data to the computer representing the parameter values describing the specific clinical treatment that has been delivered . the computer has access to a database that store the information and associates that information with the patient that was treated as well as other relevant data , including , the area of the body treated , patient height , weight , age , the disease type , tumor size , tumor location , tumor stage , time , location , the prescribing physician , the technician operating the device and any other relevant data . the database is updated with each treatment . the database is also used to either continuously or periodically calculate the average of a parameter value for all the patients or a defined subset of patients . the defined subset can be determined by running a range based search query to find patients of sufficiently similar height , weight , age , tumor location or any other aspect or combination . in addition , the database can receive and store such average data received from some other system that has a larger group to calculate an average for the parameters . besides averaging , the system can calculate a mean or a weighted average . when the system is used , a set of parameters can be input into the computer to control the clinical device , or the clinical device can be directly controlled and the parameters retrieved by the system . the system can then check the parameters against the averages or other metrics to determine whether there is a potential error . if a discrepancy is detected , the system can issue a command to the clinical treatment device that prevents it from initiating the treatment and also it can issue an alarm to the technician . in one embodiment , the system and the clinical treatment device are distinct subsystems that communicate over a data network or other data interchange . in another embodiment , the system is integrated with the clinical treatment device . in one embodiment , the system operates by accessing the database over a data network . in another embodiment , the system and the database are integrated . in an example embodiment a data structure is stored in the database that has several elements in each entry : as an example , the location may be specified as “ cervical 3 ”, “ posterior ”, and the angle “ zero degrees ”. however , this point into the spinal column and therefore the dosage threshold would be a low number to avoid damaging the spinal cord . however , if the angle entry was “ 90 degrees ”, the dosage threshold entry may be higher . in some imrt systems , the dosage is a list of angles , collimations and dosage amounts that are delivered to the patient in each session . in this case , the entries in the imrt instructions can be matched against the database contents in the following manner : for each entry in the imrt prescription list , the geometry defined by the instruction is checked against the list of dosage limits to determine whether any of the geometries in the listed instructions are within the spatial geometry defined by any of the dosage limit entries . where that is the case , the dosage in the instructions is checked against the dosage limit . in other embodiments , the imrt instructions are not provided in terms of patient anatomy , but rather the actual measured position to references on the patient &# 39 ; s body . this increases the accuracy of the positioning of imrt , but introduces a problem : not all patients have identical size . in this case , the imrt instructions are mapped to a nominal model of the shape of a human body . for example , a size ratio in one or more dimensions may be specified that maps the actual patient to the nominal patient model . the safety limit list can then refer to the nominal patient model geometric locations . in this embodiment , the imrt instruction list for the patient is converted to a list of instructions where the geometries have been scaled with the ratios , in order that imrt instructions are mapped to the nominal patient body . then the list of instructions can be compared to the safety list that refers to geometric positions of the nominal patient body . the system is typically comprised of a central server that is connected by a data network to a user &# 39 ; s computer . the central server may be comprised of one or more computers connected to one or more mass storage devices . the precise architecture of the central server does not limit the claimed invention . in addition , the data network may operate with several levels , such that the user &# 39 ; s computer is connected through a firewall proxy to one server , which routes communications to another server that executes the disclosed methods . the precise details of the data network architecture do not limit the claimed invention . further , the user &# 39 ; s computer may be a laptop or desktop type of personal computer . it can also be a video game console , a cell phone , smart phone or other handheld device . the precise form factor of the user &# 39 ; s computer does not limit the claimed invention . in one embodiment , the user &# 39 ; s computer is omitted , and instead a separate computing functionality provided that works with the central server . in this case , a user would log into the server from another computer and access the simulated space . in another embodiment , the user can operate a local computer running a browser , which receives from a central server a video stream representing the rendering of the simulated space from the point of view associated with the user . further , the user may receive from and transmit data to the central server by means of the internet , whereby the user accesses an account using an internet web - browser and browser displays an interactive web page operatively connected to the central server . the central server transmits and receives data in response to data and commands transmitted from the browser in response to the customer &# 39 ; s actuation of the browser user interface . some steps of the invention may be performed on the user &# 39 ; s computer and interim results transmitted to a server . these interim results may be processed at the server and final results passed back to the user . the invention may also be entirely executed on one or more servers . a server may be a computer comprised of a central processing unit with a mass storage device and a network connection . in addition a server can include multiple of such computers connected together with a data network or other data transfer connection , or , multiple computers on a network with network accessed storage , in a manner that provides such functionality as a group . a server may be a virtual server , where one or more virtual servers are individual instances of software operating as independent servers but housed in the same computer hardware device . practitioners of ordinary skill will recognize that functions that are accomplished on one server may be partitioned and accomplished on multiple servers that are operatively connected by a computer network by means of appropriate inter process communication . in addition , the access of the website can be by means of an internet browser accessing a secure or public page or by means of a client program running on a local computer that is connected over a computer network to the server . a data message and data upload or download can be delivered over the internet using typical protocols , including tcp / ip , http , tcp , udp , smtp , rpc , ftp or other kinds of data communication protocols that permit processes running on two remote computers to exchange information by means of digital network communication . as a result a data message can be a data packet transmitted from or received by a computer containing a destination network address , a destination process or application identifier , and data values that can be parsed at the destination computer located at the destination network address by the destination application in order that the relevant data values are extracted and used by the destination application . it should be noted that the flow diagrams are used herein to demonstrate various aspects of the invention , and should not be construed to limit the present invention to any particular logic flow or logic implementation . the described logic may be partitioned into different logic blocks ( e . g ., programs , modules , functions , or subroutines ) without changing the overall results or otherwise departing from the true scope of the invention . oftentimes , logic elements may be added , modified , omitted , performed in a different order , or implemented using different logic constructs ( e . g ., logic gates , looping primitives , conditional logic , and other logic constructs ) without changing the overall results or otherwise departing from the true scope of the invention . the method described herein can be executed on a computer system , generally comprised of a central processing unit ( cpu ) that is operatively connected to a memory device , data input and output circuitry ( io ) and computer data network communication circuitry . computer code executed by the cpu can take data received by the data communication circuitry and store it in the memory device . in addition , the cpu can take data from the i / o circuitry and store it in the memory device . further , the cpu can take data from a memory device and output it through the io circuitry or the data communication circuitry . the data stored in memory may be further recalled from the memory device , further processed or modified by the cpu in the manner described herein and restored in the same memory device or a different memory device operatively connected to the cpu including by means of the data network circuitry . the memory device can be any kind of data storage circuit or magnetic storage or optical device , including a hard disk , optical disk or solid state memory . the io devices can include a display screen , loudspeakers , microphone and a movable mouse that indicate to the computer the relative location of a cursor position on the display and one or more buttons that can be actuated to indicate a command . examples of well known computing systems , environments , and / or configurations that may be suitable for use with the invention include , but are not limited to , personal computers , server computers , hand - held , laptop or mobile computer or communications devices such as cell phones and pda &# 39 ; s , multiprocessor systems , microprocessor - based systems , set top boxes , programmable consumer electronics , network pcs , minicomputers , mainframe computers , distributed computing environments that include any of the above systems or devices , and the like . the computer can operate a program that receives from a remote server a data file that is passed to a program that interprets the data in the data file and commands the display device to present particular text , images , video , audio and other objects . the program can detect the relative location of the cursor when the mouse button is actuated , and interpret a command to be executed based on location on the indicated relative location on the display when the button was pressed . the data file may be an html document , the program a web - browser program and the command a hyper - link that causes the browser to request a new html document from another remote data network address location . the html can also have references that result in other code modules being called up and executed , for example , flash or other native code . the internet is a computer network that permits customers operating a personal computer to interact with computer servers located remotely and to view content that is delivered from the servers to the personal computer as data files over the network . in one kind of protocol , the servers present webpages that are rendered on the customer &# 39 ; s personal computer using a local program known as a browser . the browser receives one or more data files from the server that are displayed on the customer &# 39 ; s personal computer screen . the browser seeks those data files from a specific address , which is represented by an alphanumeric string called a universal resource locator ( url ). however , the webpage may contain components that are downloaded from a variety of url &# 39 ; s or ip addresses . a website is a collection of related url &# 39 ; s , typically all sharing the same root address or under the control of some entity . in one embodiment different regions of the simulated space have different url &# 39 ; s . that is , the simulated space can be a unitary data structure , but different url &# 39 ; s reference different locations in the data structure . this makes it possible to simulate a large area and have participants begin to use it within their virtual neighborhood . computer program logic implementing all or part of the functionality previously described herein may be embodied in various forms , including , but in no way limited to , a source code form , a computer executable form , and various intermediate forms ( e . g ., forms generated by an assembler , compiler , linker , or locator .) source code may include a series of computer program instructions implemented in any of various programming languages ( e . g ., an object code , an assembly language , or a high - level language such as c , c ++, c #, action script , php , ecmascript , javascript , java , or html ) for use with various operating systems or operating environments . the source code may define and use various data structures and communication messages . the source code may be in a computer executable form ( e . g ., via an interpreter ), or the source code may be converted ( e . g ., via a translator , assembler , or compiler ) into a computer executable form . the invention may be described in the general context of computer - executable instructions , such as program modules , being executed by a computer . generally , program modules include routines , programs , objects , components , data structures , etc ., that perform particular tasks or implement particular abstract data types . the computer program and data may be fixed in any form ( e . g ., source code form , computer executable form , or an intermediate form ) either permanently or transitorily in a tangible storage medium , such as a semiconductor memory device ( e . g ., a ram , rom , prom , eeprom , or flash - programmable ram ), a magnetic memory device ( e . g ., a diskette or fixed hard disk ), an optical memory device ( e . g ., a cd - rom or dvd ), a pc card ( e . g ., pcmcia card ), or other memory device . the computer program and data may be fixed in any form in a signal that is transmittable to a computer using any of various communication technologies , including , but in no way limited to , analog technologies , digital technologies , optical technologies , wireless technologies , networking technologies , and internetworking technologies . the computer program and data may be distributed in any form as a removable storage medium with accompanying printed or electronic documentation ( e . g ., shrink wrapped software or a magnetic tape ), preloaded with a computer system ( e . g ., on system rom or fixed disk ), or distributed from a server or electronic bulletin board over the communication system ( e . g ., the internet or world wide web .) the invention may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network . in a distributed computing environment , program modules may be located in both local and remote computer storage media including memory storage devices . practitioners of ordinary skill will recognize that the invention may be executed on one or more computer processors that are linked using a data network , including , for example , the internet . in another embodiment , different steps of the process can be executed by one or more computers and storage devices geographically separated by connected by a data network in a manner so that they operate together to execute the process steps . in one embodiment , a user &# 39 ; s computer can run an application that causes the user &# 39 ; s computer to transmit a stream of one or more data packets across a data network to a second computer , referred to here as a server . the server , in turn , may be connected to one or more mass data storage devices where the database is stored . the server can execute a program that receives the transmitted packet and interpret the transmitted data packets in order to extract database query information . the server can then execute the remaining steps of the invention by means of accessing the mass storage devices to derive the desired result of the query . alternatively , the server can transmit the query information to another computer that is connected to the mass storage devices , and that computer can execute the invention to derive the desired result . the result can then be transmitted back to the user &# 39 ; s computer by means of another stream of one or more data packets appropriately addressed to the user &# 39 ; s computer . in one embodiment , the relational database ( i will use cloud storage services such as amazon simpledb , this is most often not relational db but column - oriented / nosql db ) may be housed in one or more operatively connected servers operatively connected to computer memory , for example , disk drives . the invention may be executed on another computer that is presenting a user a semantic web representation of available data . that second computer can execute the invention by communicating with the set of servers that house the relational database . in yet another embodiment , the initialization of the relational database may be prepared on the set of servers and the interaction with the user &# 39 ; s computer occurs at a different place in the overall process . the described embodiments of the invention are intended to be exemplary and numerous variations and modifications will be apparent to those skilled in the art . all such variations and modifications are intended to be within the scope of the present invention as defined in the appended claims . although the present invention has been described and illustrated in detail , it is to be clearly understood that the same is by way of illustration and example only , and is not to be taken by way of limitation . it is appreciated that various features of the invention which are , for clarity , described in the context of separate embodiments may also be provided in combination in a single embodiment . conversely , various features of the invention which are , for brevity , described in the context of a single embodiment may also be provided separately or in any suitable combination . it is appreciated that the particular embodiment described in the appendices is intended only to provide an extremely detailed disclosure of the present invention and is not intended to be limiting . the foregoing description discloses only exemplary embodiments of the invention . modifications of the above disclosed apparatus and methods which fall within the scope of the invention will be readily apparent to those of ordinary skill in the art . accordingly , while the present invention has been disclosed in connection with exemplary embodiments thereof , it should be understood that other embodiments may fall within the spirit and scope of the invention as defined by the following claims .	6
in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the invention . it will be apparent , however , to one skilled in the art that embodiments of the invention can be practiced without these specific details . in other instances , structures and devices are shown in block diagram form in order to avoid obscuring the invention . reference throughout this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , appearances of the phrases “ in one embodiment ” or “ in an embodiment ” in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures or characteristics may be combined in any suitable manner in one or more embodiments . fig1 is a diagram of a socket and a socket contact protector , in accordance with one example embodiment of the invention . in accordance with the illustrated example embodiment , assembly 100 may include socket housing 102 , socket contacts 104 and socket contact protector 106 . socket contact protector 106 includes openings 108 and integrated springs 110 as shown in fig1 . socket housing 102 is usually made of plastic and provides the structural support and limited protection for internal mechanisms of the socket , for example socket contacts 104 . additionally , the shape of socket housing 102 may provide alignment features for both socket contact protector 106 and a device package intended to mate with the socket . socket contacts 104 are often thin metal strip formed and cut in a particular shape which provide electrical coupling with pads of a device package . socket contacts made be of other materials and shapes . in one embodiment , socket contacts 104 rise from the base of socket housing 102 at an angle and are curved at the top end . in this embodiment , socket contacts 104 will tend to move down and out slightly when a downward force is applied , for example when a device package is mated with the socket . this movement of socket contacts 104 is colloquially referred to as a wiping action . socket contact protector 106 , when installed in socket housing 102 , is designed to protect socket contacts 104 from potential damage and contains openings 108 through which socket contacts 104 can emerge to couple with a device package . openings 108 may be circular or any other shape to accommodate the particular shape of the socket contacts and penetration of socket contacts 104 through socket contact protector 106 , including accommodating any wiping action of socket contacts 104 . in one embodiment , socket contact protector 106 is a substantially planar , thin , injection - molded plastic table . socket contact protector 106 may also include integrated springs 110 to provide a means for captivating socket contact protector 106 within socket housing 102 and a means for transitioning socket contact protector 106 between up and down positions as described in greater detail hereinafter . fig2 is a diagram of a socket with integral , retractable socket contact protector , in accordance with one example embodiment of the invention . in accordance with the illustrated example embodiment , device package socket 200 may include socket housing 202 , socket contact protector 204 , tabs 206 , and integrated springs 208 coupled as shown in fig2 . socket contact protector 204 , which was molded to align in shape and dimensions within the contact field of device package socket 200 , is shown installed and captivated within socket housing 202 after integrated springs 208 ( and possibly others not shown ) have been snapped under tabs 206 . when there is no force placed on socket contact protector 204 , and therefore no compression of integrated springs 208 , the top surface of socket contact protector 204 extends slightly above the contacts of device package socket 200 . when a force is placed on socket contact protector 204 , for example when a device package is installed in device package socket 200 , integrated springs 208 are compressed and socket contact protector 204 retracts ( or lowers along the z - axis ) exposing the contacts of device package socket 200 which emerge through corresponding openings in socket contact protector 204 . through designed alignment with socket housing 202 and integrated springs 208 , socket contact protector 204 is able to move through a slight up and down range in the z - axis , but is constrained to very limited movement in the x - axis or y - axis given the close x - y fit between features on the contact protector and corresponding features in the socket housing . one skilled in the art would appreciate that the physical alignment of socket contact protector 204 within socket housing 202 can facilitate proper installation of socket contact protector 204 into socket housing 202 . fig3 a - 3b are cross - sectional views of an example socket with integral , retractable socket contact protector , in accordance with one example embodiment of the invention . in accordance with the illustrated example embodiment , view 300 of device package socket 200 includes socket contacts 302 , socket contact protector 303 , openings 304 , integrated spring 306 , socket base 308 , and vertical space 310 , coupled as shown in fig3 a . socket contacts 302 are aligned with corresponding openings 304 in socket contact protector 303 . the top surface of socket contact protector 303 in this example is above socket contacts 302 , providing protection which would be recognized by one skilled in the art . vertical space 310 is the distance which the bottom of socket contact protector 303 is suspended above socket base 308 . in one embodiment , this distance is about 0 . 4 mm . while as shown integrated spring 306 maintains vertical space 310 by acting on socket base 308 , other configurations or types of springs or mechanical means may be utilized to provide vertical space 310 . fig3 b depicts view 300 of device package socket 200 with the addition of device package 312 . in this example embodiment , an actuation force has been applied to seat device package 312 , possibly through the use of , for example , a socket lever or metal clip ( not shown ). this actuation force pushes socket contact protector 303 down until it contacts socket base 308 . as socket contact protector 303 is forced down , socket contacts 302 emerge through openings 304 . socket contacts 302 are then able to contact pads , for example land grid array ( lga ) pads , of device package 312 . if the actuation force were removed , integrated spring 306 would unload and return socket contact protector 303 to the up position depicted in fig3 a . fig4 is a cross - sectional view of an example socket with integral , retractable socket contact protector , depicting view 400 in fig3 b . as shown , socket contact 404 is extending through opening 406 of table 402 to contact land 408 of device package 414 . to achieve the coupling of socket contact 404 and land 408 , a downward force would be applied to device package 414 thereby forcing table 402 down onto surface 412 of socket housing 410 . land 408 is a conductive element of a land grid array ( lga ). one skilled in the art would appreciate that while shown as part of a device package socket , the contact protector of the present invention can be applied to protect contacts in any number of applications , including but not limited to power connectors , i / o connectors , or other connections where a contact is to couple with a lga - style land . fig5 is a cross - sectional view of an example electronic appliance incorporating a socket with integral , retractable socket contact protector , in accordance with one example embodiment of the invention . electronic appliance 500 is intended to represent any of a wide variety of traditional and non - traditional electronic appliances , laptops , desktops , cell phones , wireless communication subscriber units , wireless communication telephony infrastructure elements , personal digital assistants , set - top boxes , or any electric appliance that would benefit from the teachings of the present invention . in accordance with the illustrated example embodiment , electronic appliance 500 may include substrate 502 , processor socket 504 , socket contact protector 506 , socket contacts 507 , processor 508 , memory socket 510 , memory module 512 , and network controller 514 coupled as shown in fig5 . substrate 502 may be a fiberglass motherboard with components soldered to it . for example , socket contacts 507 , memory socket 510 and network controller 514 may be soldered to a surface of substrate 502 . conductive elements , either on a surface of or embedded within substrate 502 , provide the means for electrically coupling the various components with one another . processor socket 504 may include socket contacts 507 and a socket contact protector 506 as depicted in fig1 , 3 a , or 3 b . processor 508 may represent any of a wide variety of control logic including , but not limited to one or more of a microprocessor , a programmable logic device ( pld ), programmable logic array ( pla ), application specific integrated circuit ( asic ), a microcontroller , and the like , although the present invention is not limited in this respect . memory module 512 may represent any type of memory device ( s ) used to store data and instructions that may have been or will be used by processor 508 . typically , though the invention is not limited in this respect , memory module 512 will consist of dynamic random access memory ( dram ). in one embodiment , memory module 512 may consist of rambus dram ( rdram ). in another embodiment , memory module 512 may consist of double data rate synchronous dram ( ddrsdram ). the present invention , however , is not limited to the examples of memory mentioned here . network controller 514 may represent any type of device that allows electronic appliance 500 to communicate with other electronic appliances or devices . in one embodiment , network controller 514 may comply with a the institute of electrical and electronics engineers , inc . ( ieee ) 802 . 11b standard ( approved sep . 16 , 1999 , supplement to ansi / ieee std 802 . 11 , 1999 edition ). in another embodiment , network controller 514 may be an ethernet network interface card . many of the methods are described in their most basic form but operations can be added to or deleted from any of the methods and information can be added or subtracted from any of the described messages without departing from the basic scope of the present invention . any number of variations of the inventive concept is anticipated within the scope and spirit of the present invention . in this regard , the particular illustrated example embodiments are not provided to limit the invention but merely to illustrate it . thus , the scope of the present invention is not to be determined by the specific examples provided above but only by the plain language of the following claims .	7
in this application , a composite material , as defined above , with nanoscale particles ( small particles with at least one dimension less than 100 nm , including nanopowder , nanocluster , nanocrystal , etc .) distributed in a solid matrix is called a nanoparticle composite . if the nanoparticles are made of a magnetic material , the composite is called a magnetic nanoparticle composite . the teachings hereof are based on the idea that certain magnetic properties of a suitably constructed magnetic nanoparticle composite can be locally fine - tuned by using external forces such as a combination of laser heating and an external magnetic field . in certain matrix materials , the modification can be permanently maintained , so that the composite has a spatial magnetic property distribution that is tailored to a specific application . an objective hereof is to teach fabrication of a transmission line of a predetermined impedance and electrical length by using a suitably constructed magnetic nanoparticle composite . although embodiments shown are mainly applied to the design and construction of transmission lines , including waveguides , for rf and / or microwave energy transmission , the same principle can be applied to other suitable applications and the teachings hereof are broadly applicable to these other applications as well . a magnetic nanoparticle composite is formed by uniformly dispersing nanometer - sized crystallite particles in a matrix material . the matrix material may be an insulating material or a conductive material . polymeric materials are advantageous for use as the matrix . conventional polymers are insulating materials , but polymers may be conductive , and they are also advantageous for the purposes of the particular embodiments shown . basically any polymer ( thermoplastic polymer , thermosetting polymer or even elastomer ) can be used as matrix . examples of thermoplastic polymers with good dielectric properties include polyethylene , polystyrene , syndiotactic polystyrene , polypropylene , cyclic olefin copolymer or fluoropolymers . examples of thermosetting polymers include epoxy , polyimide , etc . magnetic nanocrystallite particles ( or nanoparticles in short ) suitable for the embodiments are paramagnetic . in such embodiments , the paramagnetic nanoparticles should not exhibit ferromagnetic properties at a temperature range required for preparing the composite . therefore , during the preparation of the composite , these nanoparticles do not cluster or align with each other and they are easily dispersed in the matrix material . the paramagnetic nanoparticles can be for example either super - paramagnetic nanoparticles , which are paramagnetic at nearly all temperatures , or paramagnetic nanoparticles with a relatively low curie temperature ( i . e . the curie point is below the ambient temperature ). superparamagnetism occurs when the material is composed of very small crystallites ( less than 20 nm , preferably 1 - 10 nm ). even when the temperature is below the curie or neel temperature , the thermal energy is sufficient to change the direction of magnetization of the entire crystallite . the resulting fluctuations in the direction of magnetization cause the overall magnetic field to be zero . thus the material behaves in a manner similar to paramagnetism , except that instead of each individual atom being independently influenced by an external magnetic field , the magnetic moment of the entire crystallite tends to align with a magnetic field . the energy required to change the direction of magnetization of a crystallite is called the crystalline anisotropy energy and depends both on the material properties and the crystallite size . as the crystallite size decreases , so does the crystalline anisotropy energy , resulting in a decrease in the temperature at which the material becomes superparamagnetic . typical superparamagnetic nanoparticles include metals like fe , co and ni , alloys like fept , oxides like fe 3 o 4 , etc . as shown in fig1 ( a ), for the embodiments , a superparamagnetic nanocrystallite 12 is coated with a layer of surfactant 14 to form a coated nanoparticle 10 . as shown in fig1 ( b ), the surfactant - coated nanoparticles 10 are uniformly dispersed in a polymer matrix 32 as mentioned above to form a magnetic nanoparticle composite 30 . the dispersion of the nanoparticles in the polymer matrix can be performed by various conventional methods known in the art . for example , the composite can be made using solution or melt mixing techniques . for thermosetting polymers , solution method is suitable . a thermosetting polymer is dissolved in a solvent and mixed with nanoparticles . composite thin films are formed by casting or spin coating and traditional curing by heat or ultraviolet light . for thermoplastic polymers , solution mixing is also suitable for produce the composite . mixing with low viscosity solvent results in good dispersion of nanopatricles within the polymer . films can be formed either by casting or spin coating ( solvent evaporated away ). thin films can be made also by e . g . langmuir - blodgett technique or layer - by - layer deposition directly from the solution . alternatively , as the nanoparticles are coated with a surfactant , they can be mixed well with molten thermoplastic polymers . standard melt mixing techniques ( e . g . twin - screw extruder or single - screw extruder with mixing elements ) and plastic processing methods ( extrusion , injection or compression molding ) can be used . this method may be more favorable for high volume productions . as the composite material is solidified ( which means for thermoplastic polymer to cool down to below its glass transition temperature , or for the thermosetting polymer to be cured ) the polymer matrix becomes stiff and the magnetic nanoparticles are bound to the matrix , unable to move or rotate ( see fig1 ( b )). although the composite is preferably formed in a flat - sheet shape such as a thin film , other geometric shapes can also be considered according to the teachings hereof . in addition to above - mentioned methods for forming the flat - sheet shaped composite , other forming methods may also be considered by persons skilled in the art . the weight or volume fraction of the nanoparticles in the matrix is not limited , and it should be determined by specific applications to produce desired permeability values . for example , anything from a few percent up to a close packing of particles as the surfactant layer and polymer allow to keep the particles separated may be considered . suitable nanocrystallite particles may be characterized in that each nanoparticle has a so - called easy axis ( as illustrated in fig1 ( a )). the easy axis is an energetically favorable direction of spontaneous magnetization in a magnetic material . the easy axis is determined by various factors , including magnetocrystalline anisotropy and shape anisotropy . the two opposite directions along the easy axis are usually equivalent , and the actual direction of the magnetization can be either of them . in the as - formed composite , the easy axes of the nanoparticles are randomly oriented and nanoparticles are confined by the matrix . therefore , the net magnetization of the composite is zero . according to the teachings hereof , the formed composite is further processed to allow for a local alignment of the magnet nanoparticles according to a predetermined pattern ( the process is referred to as “ patterning ” hereinafter ). as the result , the nanoparticles inside the pattern are substantially aligned in their easy axes and the nanoparticles outside the pattern remain randomly oriented . a method for forming an aligned magnetic nanoparticle pattern in the composite is by heating locally , along the predetermined pattern , using a finely focused laser beam or other suitable heat sources . selection of a heat source depends on the shape of the pattern , and could take many different forms . therefore , it should be understood that there are other ways to provide the “ patterning ” and the technique shown is merely exemplary . fig2 shows an example in which a laser beam 40 is moving along a line on the composite 30 and the spot hit by the laser has a higher temperature than the surrounding areas . an external magnetic field b is applied while the composite is heated locally by the laser beam . along the line that the laser beam moves , the polymer matrix material is locally softened or liquefied . above a certain temperature , the nanoparticles 10 in the softened region are able to move around and / or rotate . the external magnetic field applied on the composite influences the particles &# 39 ; direction of rotation , so that their easy axes are substantially aligned in a relation with the magnetic field b . as the result of the alignment , the average particle - to - particle distance may decrease and nanoparticles may even become nearly connected to each other along the line . the heating laser beam may be precisely adjusted so that the polymer matrix is liquefied locally , enough to allow the rotation of nanoparticles . typically for amorphous thermoplastic polymers and thermosetting polymers , heating the polymer matrix slightly above its glass transition temperature is sufficient . however , for some highly crystalline thermoplastic polymers , local melting might be required . even more precisely , the laser beam or an alternative heat source may be controllably applied in such a way that only the surfactant layer around the nanoparticles is liquefied to allow only rotation but not linear movement of the nanoparticles . the matrix material cools down quickly after the heat source is removed . the external magnetic field is applied until the matrix completely solidifies again . as a result , the magnetic nanoparticle composite now has a patterned microstructure . the pattern may contain several lines , parallel or in different angles , depending on the design . the pattern can be made in several steps in which the directions of the external magnetic field and the laser heating line are carefully matched to ensue that the nanoparticles are oriented in a desired direction . the direction of the orientation depends on particular applications . for example , if the propagation mode of the electromagnetic wave is a transverse electromagnetic mode ( tem ), the nanoparticles should be oriented with their easy axes such that the current is parallel to the line and the magnetic field is perpendicular to the line , thus orienting the easy axes of the nanoparticles perpendicular to the line would have more effect than other directions . the patterned magnetic nanoparticle component can be used in fabricating transmission line components for directing rf or microwave frequency electromagnetic waves . in electromagnetism , permeability is the degree of magnetization of a material that responds linearly to an applied magnetic field . magnetic permeability is represented by the greek letter μ . basically , permeability of the composite depends on the density of the particles in the composite , the orientation of the particles , and the material choice . as can be seen above , the magnetic permeability of the composite at a certain location depends on the net easy axis of the magnetic nanoparticles at the location . at unpatterned locations , the net magnetization is zero . at the patterned locations the net axis of the nanoparticles is no longer random and the net magnetization is not zero . therefore , the magnetic permeability at the patterned locations is not the same as that of the unpatterned locations . with the fine - tuning of the nanoparticle orientation the local changes in the permeability is made . patterning the magnetic nanoparticle composite locally results in a desired spatial distribution of the permeability . the patterned magnetic nanoparticle composite can be used as the dielectric medium for transmission of electromagnetic energy or local adjustment of rf properties of distributed elements such as transmission lines or waveguides . a schematic drawing of a stripline according to the present disclosure is shown in fig3 . fig3 ( a ) shows a piece of magnetic nanoparticle composite prepared according to the above - mentioned process which results in a line of aligned nanoparticles in the composite . fig3 ( b ) shows a stripline in which the magnetic nanoparticle composite of fig3 ( a ), used as the dielectric medium , is sandwiched between two conductive plates . the aligned line of the nanoparticles plays the role of the central conductor in the stripline . if the polymer matrix is conductive ( consisting of any inherently conductive polymer ), the conductive plates are not needed . the magnetic nanoparticle composite is patterned in a similar way as described above and the stripline can be made entirely with the composite material . referring now to fig4 , an as - formed magnetic nanoparticle composite sheet ( a ) has a permeability μ which is determined by the material of the choice and the density of the nanoparticles . such a sheet of composite is subject to the process according to the present disclosure and , as the result , the nanoparticles are partially or entirely oriented in some or all of the locations depending on the process conditions . thus , after the process , the permeability of the composite changes to μ ′ ( b ). therefore , even though the dimensions of the composite remain the same , the magnetic properties of the composite are different . this feature can be used to simplify the design of the transmission line components . a conduit of electromagnetic energy ( i . e . a waveguide ) can be formed by locally tailoring the electromagnetic environment ( permeability ) of the wave conducting medium . thus there is no need for any extra cables for directing the electromagnetic wave . confinement in a waveguide so created can be estimated by the tm 01 mode cut - off frequency of a circular waveguide : this shows that the waveguides need to have a dimension in the range of three times the wavelength . dimension wise , the present invention is very useful in the thz frequency range where the wavelength is from 0 . 3 to 0 . 1 mm ( frequency 1 - 3 thz ). the fine - tuning of the material properties as suggested by the teachings hereof can be used for changing impedance levels of a microstrip or other transmission line . local , tunable magnetic property change is equivalent to changing the width of the microstripline and thus allows for the same size “ wiring ” with changing and variable microstrip impedance to be illustrated below . gradient in the permeability will cause the electromagnetic wave to reflect and will thus lead to a waveguide as in other transmission lines . if the net easy axes of the nanoparticles are partially aligned and the degree and / or orientation of the alignment varies gradually from location to location , the composite material can be used as a transformer , since the electromagnetic wave properties will depend on the environment &# 39 ; s permeability . very localized tuning of magnetic properties allows for the fabrication of transmission line components where the conductor width is not changed but instead the material properties of the environment of conductor are tuned . this leads to a design domain where only material properties are changed instead of wiring structure . this could be very beneficial in circuits where , for example , a 50 ohm input is matched to much lower impedance at very high frequencies . this also allows for the stripline component sizes ( width ) to be of the same order as that of the very small component dies that are used at microwave frequencies . fig5 ( a ) shows a conventional multi - section transformer with three different widths . each section has a permeability value that is determined by the width of the dielectric medium and each section thus has a characteristic impedance . fig5 ( b ) is a conventional waveguide with smoothly varying width , which corresponds to a smoothly varying permeability . fig5 ( c ) is a multi - section transformer according to the teachings hereof . by locally tuning the nanoparticle orientation , different sections of the composite have different permeability values μ 1 , μ 2 and μ 3 , which is equivalent to having three different characteristic impedance values . a waveguide with magnetic properties similar to that of fig5 ( b ) but with fixed width can also be fabricated by the composite and the process of the present invention . according to the embodiments , the local microstructure change is permanently maintained under normal operation conditions . with a further process , the change may be reversed . in order to reverse the change , for example re - randomize the particle orientation , simply bringing the composite to a liquefaction temperature without applying external magnetic field . ( 1 ) a transmission circuit can be made without thin wires , cables or strips . it can be composed of only plates and the composite material . if the matrix of the composite is conductive ( e . g . made with conductive polymers ), the circuit can be made with only the composite . for example , in a printed wiring board , the board can be replaced by a sheet made of the magnetic nanoparticle composite material and some or all of formerly required extra wiring can be omitted . ( 2 ) physical width of the wiring can remain the same , only material properties change underneath ( or inside ). this can be beneficial in very high frequency , low impedance circuits where physical sizes of the transmission line and the high frequency component need to match . ( 3 ) tuning of material properties of the circuit leads to reversible ways of adjusting circuitry without using adjustable components and thus enables a design - testing - tuning - retesting cycles that are very fast for designing the circuit . it is to be understood that the above - described arrangements are only illustrative of the applications of the principles of the teachings hereof . in particular , it should be understood that although transmission line embodiments have been shown , the teachings hereof are not restricted to transmission lines . the present disclosure has been disclosed in reference to specific examples . numerous modifications and alternative arrangements may be devised by those skilled in the art without departing from the scope of the teachings hereof .	7
in the figures , identical reference numerals designate identical or similar components or sets of components . fig1 shows that the packaging e according to the invention includes a wall 1 defining a volume which is substantially parallelepiped - shaped , for example , when the packaging is in a service configuration ( i . e . a configuration enabling it to be emptied or filled ). the parallelepiped - shaped volume can be obtained by folding and gluing a cutout blank 2 of semi - rigid material such as cardboard , for example ( see fig5 ). the wall 1 includes a first side 3 , a second side 5 , a third side 7 and a fourth side 9 , in succession in that order , and respectively having a first edge 11 , a second edge 13 , a third edge 15 and a fourth edge 17 defining an opening 21 , for example a rectangular opening . a first flap 23 , a second flap 25 , a third flap 27 and a fourth flap 29 are respectively articulated to each of the aforementioned edges , the first flap 23 and the third flap 27 being wide enough to overlap at least in part . according to one essential feature of the invention , a first group 31 and a second group 33 of deformation folding lines are formed on the second side 5 and the fourth side 9 of the wall 1 . the deformation folding lines are preferably formed by scoring , rows of perforations or other kinds of internal or external marking of the blank and substantially define inverted y - shapes ( when the opening 21 is at the top , i . e . as shown in fig1 ) whose branches 35 , 37 and 39 , 41 respectively extend substantially from the middles of the second edge 13 and fourth edge 17 to edges 43 , 45 and 47 , 49 respectively separating the second side 5 and the fourth side 9 from the first side 3 and the third side 7 , and whose stems 51 and 53 are in substantially median areas of the second flap 25 and the fourth flap 29 . the first flap 23 includes a tongue 55 and the third flap 27 and the third side 7 respectively include a first slot 57 and a second slot 59 , both of which slots are adapted to receive the tongue 55 . the bottom of the packaging e is closed by a fifth flap 61 , a sixth flap 63 , a seventh flap 65 and an eighth flap 67 which are glued or stapled together , for example . fig2 shows the packaging e in a first storage configuration . the first storage configuration is obtained from the previous configuration by folding the second flap 25 and the fourth flap 29 toward the interior of the packaging , folding the third flap 27 over them , and finally folding the first flap 23 over the third flap 27 and inserting the tongue 55 into the first slot 57 . fig3 shows the packaging e in an intermediate configuration preceding a second storage configuration . the intermediate configuration is obtained from the service configuration shown in fig1 by folding toward the interior of the packaging the portions 69 and 71 of the second side 5 and the fourth side 9 respectively situated between the branches 35 , 37 and 39 , 41 of the first group 31 and the second group 33 of deformation folding lines and by folding the second flap 25 and the fourth flap 29 in half around the stems 51 and 53 of the first and second groups of deformation folding lines so that the first edge 11 and the third edge 15 come into contact . fig4 shows the packaging e in its second storage configuration . the second storage configuration is obtained from the previous configuration by folding the first flap 23 , the second flap 25 , the third flap 27 and the fourth flap 29 over the third side 7 and inserting the tongue 55 into the second slot 59 . fig5 shows the blank 2 formed in a semi - rigid material such as cardboard and adapted to be folded and assembled to form the packaging e . the figure shows that the blank 2 includes a first rectangular panel 3 , a second rectangular panel 5 , a third rectangular panel 7 and a fourth rectangular panel 9 , in succession in that order , connected together by a first vertical folding line 43 , a second vertical folding line 45 and a third vertical folding line 47 . the blank 2 also includes a gluing tab 72 connected to the fourth panel 9 by a fourth folding line 49 . the blank 2 further includes a first flap 23 , a second flap 25 , a third flap 27 and a fourth flap 29 respectively connected to the first panel 3 , the second panel 5 , the third panel 7 and the fourth panel 9 by a first horizontal folding line 11 , a second horizontal folding line 13 , a third horizontal folding line 15 and a fourth horizontal folding line 17 . the blank 2 further includes a fifth flap 61 , a sixth flap 63 , a seventh flap 65 and an eighth flap 67 respectively connected to the first panel 3 , the second panel 5 , the third panel 7 and the fourth panel 9 opposite the aforementioned four flaps by a fifth horizontal folding line 81 , a sixth horizontal folding line 83 , a seventh horizontal folding line 85 and an eighth horizontal folding line 87 . the blank 2 further includes a first group 31 and a second group 33 of deformation folding lines formed on the second panel 5 and the fourth panel 9 and on the second flap 25 and the fourth flap 29 , substantially defining inverted y - shapes whose branches 35 , 37 and 39 , 41 respectively extend substantially from the middles of the second horizontal folding line 13 and the fourth horizontal folding line 17 to the first vertical folding line 43 and the second vertical folding line 45 , on the one hand , and to the third vertical folding line 47 and the fourth vertical folding line 49 , on the other hand , and whose stems 51 and 53 are in substantially median areas of the second flap 25 and the fourth flap 29 . the first flap 23 includes a tongue 55 and the third flap 27 and the third side 7 respectively include a first slot 57 and a second slot 59 adapted to receive the tongue . the first group 31 and the second group 33 of deformation folding lines are preferably formed by scoring , rows of perforations or other type of internal or external marking of the blank . how the packaging according to the invention is used and its advantages flow directly from the preceding description . to access the content of the packaging e for the first time , the conventional closure members ( not shown ) provided to make the packaging completely airtight are torn or peeled off and the first flap 23 , the second flap 25 , the third flap 27 and the fourth flap 29 are unfolded so that the packaging is in the service configuration shown in fig1 . the packaging e can be closed up again from the service configuration in two different ways . a first way is to fold the packaging e as described above into its first storage configuration , that is shown in fig2 . as anyone who eats breakfast cereal will be aware , this conventional storage configuration offers only a mediocre seal , given in particular the tendency of the first flap 23 and the third flap 27 to return to the open position because of their elasticity . the second way is to fold the packaging e as described above into its second storage configuration , which is that shown in fig4 . in this second storage configuration the first flap 1 clamps the wall 1 in a substantially airtight manner along the folding line 11 . this clamping is made possible by the first group 31 and the second group 33 of deformation folding lines . because of these lines and the relative flexibility of the material forming the wall 1 , the wall can be deformed locally from a state in which the sides 3 and 7 are parallel throughout their height to a state in which the sides are parallel only in their lower parts ( i . e . in the parts below the intersection of the branches 35 , 37 and 39 , 41 with the edges 43 , 45 and 47 , 49 ) and define a roof - shaped profile in their upper parts ( i . e . in the parts above said intersections ). when the first flap 23 , the second flap 25 , the third flap 27 and the fourth flap 29 are folded over the third side 7 of the wall 1 , the four edges 11 , 13 , 15 and 17 butt up against each other , which reinforces the clamping effect and thereby improves the seal obtained . note in particular that the second flap 25 and the fourth flap 29 prevent any ingress of air at the ends of the first edge 11 in the second storage configuration . note also that , if the contents of the packaging e are inside a flexible sachet , in the second storage configuration clamping the wall 1 can also hold the sachet in a position in which its top part is rolled up on itself , for example , which further improves the seal obtained . note also that in the second storage configuration the packaging e has a vertical overall size slightly less than that of its first storage configuration , enabling it to be stored on shelves with a relatively small distance between them , for example . note further that the locking of the opening 21 obtained when the packaging e is in its second storage configuration is significantly stronger than that obtained in its first storage configuration , and this enables the packaging to be stored on its side , for example , with no risk of its contents escaping and spilling . note further that the deformation which changes the packaging e from its service configuration to its second storage configuration is entirely reversible . what is more , the packaging tends to return spontaneously to its service configuration as soon as the first flap is raised , thanks to the elasticity of the material forming the wall 1 . this is very practical because it provides access to the contents of the packaging e with minimum manipulation . of course , the present invention is not limited to the embodiment described and shown , which is provided by way of illustrative and non - limiting example only . thus the blank for forming the packaging in accordance with the invention could be formed in a semi - rigid plastics material , for example . thus only the part of the packaging in the region of its opening could be formed in a semi - rigid material , other parts of the packaging , such as its bottom , being formed of rigid materials . thus the wall forming the packaging could have only one edge defining an opening , for example a circular or elliptical opening . thus the opening in the packaging could extend over only a portion of its top face . thus the deformation folding lines could be replaced by portions of the packaging that are easy to fold because they are more flexible than the remainder of the packaging .	8
referring to fig1 a wrap - around carrier 10 comprises a top panel 12 connected along fold lines 14 to side panels 16 which generally follow the contour of tapered articles t in the carrier . for purpose of illustrating the invention , the articles t are shown as comprising tubs of the type used to contain soft food , such as pudding or margarine or the like . it can be seen that the side panels are inwardly tapered at the bottom portion of the carrier as a result of being tightly wrapped around the sloped side portions of the tubs . the side panels adjacent the bottom panel are provided with cutouts or apertures 18 through which the bottom portions of the tubs t extend . the bottom panel is formed by overlapped inner and outer bottom panel flaps 20 and 22 . the inner bottom panel flap 20 is connected to one of the side panels 16 along fold line 24 while the outer bottom panel flap 22 is connected to the other side panel 16 along fold line 26 . extending up from the bottom panel adjacent the end articles t in the adjacent rows of articles is a retainer flap 28 . the retainer flap is contoured , as described more fully below , and fits snugly between the angled bottom portions of the articles t , preventing the bottom portions from moving either toward the open end of the carrier or in a transverse direction away from the side panels 16 . as shown in fig2 wherein like reference numerals to those used in fig1 denote like elements , a blank for forming the carrier 10 comprises a substantially rectangular sheet 30 of paperboard or other suitable material having adequate flexibility and strength , with the top panel section 12 being centrally located and the other panel sections described above being successively connected along the fold lines referred to above . the inner bottom panel flap 20 incorporates the retainer flaps 28 at opposite ends as well as primary female locking openings 32 between the flaps . the outer bottom panel flap 22 includes a fold line 34 spaced from and parallel to the fold line 26 . primary locking tabs 36 are formed by slits 38 which interrupt the fold line 32 . two spaced secondary locking tabs 40 are connected to the flap 22 along fold lines 42 . the edges of the locking tabs 40 that face each other curve toward the blank and terminate adjacent the end edge of the bottom panel flap 22 in spaced shoulders 44 , while the edges of the tabs facing away from each other terminate in projections such as catch hooks or shoulders 46 . referring back to the opposite end of the blank of fig2 and to fig3 each retainer flap structure 28 is connected to the inner bottom panel flap 20 by a fold line 48 which is spaced from and substantially parallel to an end edge of the flap 20 . identical slits 50 extend transversely from the ends of the fold line 48 and connect with the ends of slit 52 , which is parallel to the fold line 48 . curved fold lines 54 extend from spaced points on the slit 52 to points on the slits 50 to form identical spaced extensions 56 of the retainer flap . the main body 57 of the retainer flap is thus connected to the bottom panel flap 20 by the fold line 48 and extends between the extensions 56 . a slit 58 extends from outside the retainer flap structure into the narrow neck of the retainer flap body between the extensions 56 and terminates in a cross slit 60 to form a t - shaped cut . the portions of the retainer flap connected to the fold line 54 and slits 58 , 60 and 52 comprise flaps or wings 61 . in addition , an s - shaped slit 62 in the bottom panel flap 20 connects with the end of the slit 58 located outside the retainer flap 28 . to form a carrier the blank 30 is wrapped around the tubs or other articles to be packaged with the inner bottom panel flap 20 folded down against the bottoms of the tubs and the outer bottom panel flap 22 folded back along fold line 34 as illustrated in fig4 . this moves the primary locking tabs 36 out of the plane of the bottom panel flap 22 . with the primary locking tabs 36 thus exposed , the outer bottom panel flap 22 is folded down about the fold line 26 and the tabs 36 are caused to enter the primary locking openings 32 of the inner bottom panel flap . the outer portion of the outer bottom panel flap is then folded down about fold line 34 and the secondary locking tabs 40 are folded down about their fold lines 42 so as to enter the slits 58 . although it is not essential that the s - shaped slits 62 be provided at the ends of the slits 58 , this structure is preferred because it enables the locking tabs 40 to readily enter the slits while providing a degree of protection against subsequent withdrawal . as can be understood from fig5 which illustrates the location of a locking tab 40 , shown in broken lines , as it is about to enter an associated slit 58 , the tabs 40 push aside the small tabs 64 formed by the s - shaped slits as the tabs 40 enter the slits 58 . then when the small tabs snap back to their original position after the shoulder 44 of the locking tabs 40 have passed , they prevent easy withdrawal of the locking tabs . it will be clear from fig5 that as the tabs 40 enter the portions of the slits 58 in the bottom panel 20 , the outer portions of the tabs engage the main retainer flap bodies 57 and pivot them into the interior of the carrier about the fold lines 48 . because the retainer flaps are located between the bottoms of the two rows of tubs , the retainer flaps are able to freely move in this manner in the space between the rows of tubs . as the main retainer flap bodies 57 pivot toward the top panel and the open ends of the carrier , the foldable extensions 56 contact the adjacent tubs and are caused to fold up about the fold lines 54 . as the retainer flap bodies move toward the adjacent open ends of the carrier the portions of the slits 58 separating the wings 61 also move closer to the ends of the carrier until a point is reached where the ends of the cross hooks 46 of the tabs 40 no longer engage the flap bodies 57 but pass through these slits . when this occurs the bias of the fold lines 48 toward their closed positions causes the flap bodies 57 to snap back toward each other , causing the edges formed by the cross slits 60 to be located beneath the hooks or projections 46 . this final condition is illustrated in fig6 which omits the tubs in order that the relationship between the retainer tab structure and the secondary locking tab 40 can more clearly be seen . it is also shown in the sectional view of fig7 and in the end view of the completed carrier of fig8 o as shown in these drawing figures , contact between the hook 46 and the edge 66 formed by the slit 60 in the flap body 57 prevents withdrawal of the tabs 40 from their locked positions . the final position of the retainer tab structure is also illustrated in fig9 which shows the bottom of the carrier of fig1 . note that the structure visible in this view is seen through the opening in the bottom panel flap 20 which has been vacated by the inward pivoting of the retainer flap structure . it is contemplated that the main retainer flap bodies may be modified as shown in fig1 , wherein the flap body 57 &# 39 ; is connected to the bottom panel flap 20 by short fold lines 48 &# 39 ; separated by a cutout in the flap body , thus forming legs 68 . this arrangement requires less force to fold the flap body into operative position and may be employed where this is a concern . it will be understood that the dimensions of the retaining flap and the location of the side extension fold lines are selected to cause the retainer flap extensions to engage and be folded against adjacent articles in the carrier . it is preferred that the wing flaps 61 be present for the extra stability and the additional support surface which they provide . it will be appreciated , however , that even if they were eliminated , so that a cutout area is provided in their place , the locking tabs 40 would still be positioned with respect to the retainer flap edge 64 so as to prevent withdrawal of the locking tabs from the retainer flaps . it can be appreciated that the article retaining means of the invention provides an effective retainer which engages substantial portions of the end tubs or other articles in a carrier which have spaced bottom portions , and does so without adding to the material cost of the carrier blank . in addition , the retaining means provides an additional mechanical lock between the flaps forming the bottom panel , thus further ensuring against the accidental escape of articles from the carrier through failure of the bottom panel . although not illustrated , it will be understood that the top panel may be provided with handle openings if desired , to facilitate lifting and carrying . while the invention has been illustrated in connection with tub - shaped articles , it may also be employed to hold articles of different shapes , including beverage bottles and cans , against outward movement in a carrier . it should now be apparent that the invention need not be limited to all the specific details described in connection with the preferred embodiments , but that changes to certain features of the preferred embodiments which do not alter the overall basic function and concept of the invention may be made without departing from the spirit and scope of the invention , as defined in the claims .	1
while this invention is being described in its preferred embodiment for a high speed motorcycle application , as one skilled in this art will appreciate this invention has application for any type of rotary motion machine where at least two bearings are required and the inner diameter of the inventive journal bearing is one working surface and the outer diameter is another working surface and where the bearing is fixed in place . suffice it to say that the journal bearing of this invention is fixed in place and one rotary member is rotary supported on the inner diameter of the bearing and another rotary member is rotary supported on the outer diameter of the bearing . it also should be understood that in the preferred embodiment one of the piston rods of the v - type of combustion engine rotates 360 degrees while the other piston rod operating in unison with the first piston rod articulates over a small angle . in another embodiment of this invention a roller bearing supported in a cage is mounted on the inner surface of the inside diameter of the journal bearing so that it rotary supports the inner rotating member . obviously , as one skilled in this art will appreciate , ball bearings can be readily substituted for the roller bearings and the bearing selection will be predicated on costs and load factors . the invention can best be understood by referring to fig1 which schematically illustrates a prior art v - type combustion engine generally illustrated by reference numeral 10 having a pair of angularly disposed cylinders 12 and 14 and pistons 16 and 18 respectively disposed therein . piston rod 20 is suitably and hingedly connected to piston 16 and piston rod 22 is suitably and hingedly connected to piston 18 in any well known manner . the remote ends of piston rods are suitably connected to a pair of fly wheels where only fly wheel 24 is shown . the other fly wheel is mounted on the opposite face of the piston rod 20 and each fly wheel is connected to the piston rod 20 and piston rod 22 via the eccentric pin or shaft crank journal 26 . as is apparent from the foregoing , the piston rods when displaced drive the fly wheel in the direction of arrow a and in turn , drive the main shaft 30 for extracting power from the engine . as this invention is merely concerned with the bearings supporting the piston rods 20 and 22 to fly wheel 24 , the description of the drive train for powering the motorcycle is omitted here from for the sake of brevity and convenience . suffice it to say that the drive wheel drives either a spoke , pulley or power gear that , in turn , drives the wheel of the motorcycle . the invention can best be seen by referring to fig2 which shows the piston rod 20 having a bifurcated end 32 including arms 34 and 36 . the journal bearing of this invention generally illustrated by reference numeral 40 comprises a cylindrical body 42 having a central through bore 44 , an outer working surface 46 on the outer diameter and an inner working surface 48 on the inner diameter . obviously , these surfaces are suitably finished as is typical in journal bearings to accommodate the rotary motion of the rotary machine . in this embodiment as best seen through fig2 through 4 , the bearing 40 is shrunk fitted into the aligned complementary bores 50 and 52 formed in arms 34 and 36 , respectively , of the bifurcated end 32 . the fit is done in a well known manner by heating the bifurcated end and shrinking the bearing 40 just prior to inserting the bearing into the central bore . the heat / cool ratio for the shrink fit is predicated on the end use of the rotary machine . obviously the respective end portions 54 and 56 are rigidly secured to the inner diameter surface of the bores 50 and 52 so that the bearing can not rotate during the entire operating envelope of the engine . the end portion 60 of male piston rod 22 includes a through bore 62 whose diameter is slightly larger than the outer diameter of the journal bearing 40 so that it can articulate about the outer surface 46 thereof . in assembling the unit the bearing 40 is first fitted into the bores of the female piston rod 20 and the male piston rod 22 is then inserted into the bifurcated portion of female piston rod 20 noting that the bore 62 aligns with the bore 44 of the bearing 40 . the now assembled male piston rod 22 , female piston rod 20 and journal bearing 40 are installed on the shaft crank journal 26 . the bearing surfaces are lubricated by feeding pressurized oil into the passage 70 , into drilled hole 72 formed in the shaft crank journal 26 and then , into a plurality of circumferentially spaced drilled holes 73 where the oil migrates to the bearing surfaces of the bifurcated portion 32 and the female piston rod 20 ( an annular space out of proportion is shown in fig3 for purposes of illustrating the bearing surface , but in actuality these surfaces are closely spaced ) where the space is sufficient to define a hydrodynamic film of oil , and the bearing surface 74 intermediate the ends of journal bearing 40 . the oil is pumped in a well known manner with commercially available equipment including a sump pump that collects and returns the spent oil to the pumping system for continuous flow of oil into and out of the bearing . it is apparent from the foregoing that the shaft crank journal 26 rotates 360 degrees around the journal bearing 40 within the central bores 50 and 52 at the speed ( rpm ) of the fly wheel being powered by the pistons of the engine and that the male piston rod 22 articulates about the outer surface portion 74 of the journal bearing 40 . in another embodiment as is exemplified by fig5 the journal bearing 40 is utilized in the same manner as the apparatus is described in connection with fig1 - 4 except in this embodiment a roller bearing generally illustrated by reference numeral 80 is inserted in the central bore 44 of journal bearing 40 . the roller bearing comprises a commercially available suitable cage 82 having the annular end members 84 and 86 and a plurality of spaced axial rods 88 , separating the rollers 90 . when this embodiment is utilized in the embodiment of fig2 the shaft crank journal 26 will fit inside of the roller bearing 80 and will be rotary supported thereby . in other words the rollers engage the surface on the inner diameter of the journal bearing and the shaft crank journal 26 . the male piston rod will be rotary supported in the same manner as was described in connection with fig2 through 4 , namely the journal bearing 40 will extend through the bores in the bifurcated section of the female piston rod and the male piston rod will be mounted over the top of the journal bearing so that the outer diameter surface of the journal bearing supports the articulating motion of the male piston rod . the shaft crank journal 26 will , obviously , be rotary supported by the rollers 90 of the roller bearing 80 . as one skilled in this art will appreciate , when designing the actual hardware of a rotary machine , the type of bearing will be predicated on the loads , speeds and cost of the component parts . however , by virtue of this invention , in one embodiment , a single bearing serves the purpose of three bearings without sacrificing function and durability , and in the other embodiment two bearings serve the same purpose of the three bearings and , again without sacrificing function and durability . by virtue of this invention the flywheel is rotary driven by the pistons in a v - shaped engine utilizing a single journal bearing 40 or a combined journal bearing and roller bearing that serve the dual function of supporting the female piston rod 20 and the male piston rod 22 and eliminating the need of three bearings that have heretofore been utilized for the same environment . in the high speed motorcycle environment the material that is preferred for the journal bearing is silicon nitride while in a lower speed motorcycle environment the material for the journal bearing can be any well known bearing material such as bronze , brass , aluminum , iron or their alloys etc . although this invention has been shown and described with respect to detailed embodiments thereof , it will be appreciated and understood by those skilled in the art that various changes in form and detail thereof may be made without departing from the spirit and scope of the claimed invention .	5
generally , the present invention provides a method and system for collecting and analyzing system data , continuously monitoring system operation , coordinating data backup functions , and predicting future system occurrences based upon qualitative and quantitative historical analysis of system data . the present invention is utilized for numerous reasons and in numerous settings . the present invention relates to various processes that include , but are not limited to , data backup , data analysis , system monitoring , coordination of data backup media , historical analysis of system data , and any other process that relates to data backup , qualitative and quantitative historical data analysis , and continuous system monitoring . preferably though , the present invention is well suited for use with regard to a data backup and system monitoring process process , which integrates data storage and archiving , continuous system monitoring and data analysis , and predicting future system behaviors based upon quantitative and qualitative computations of historical system data . the preferred embodiment of the present invention is for use in the data backup / systems maintenance field , although the present invention is operable in fields including , but not limited to , geology , meteorology , engineering and any other fields needing the data archiving , system monitoring , and qualitative and quantitative historical data analyzing systems and methods as described herein . in particular , the present invention is well suited in fields involving rapidly changing sensitive data , fields requiring continuous system operation and continuity , and fields requiring forecasting of future system behaviors . in one of its current implementations , a backup application is storing ‘ meta data ’ ( data that describes data ) in a relational database . the term “ meta data ” in the context herein used refers to structural descriptions , stored as digital data that attempts to describe the essential properties of other discrete computer data objects . in fact , meta data can describe other meta data , and so on . it is organized and analyzed much like information in the stock market . each type of meta data is assigned a weight that defines how important it is in the evaluation and prediction of what is occurring in the backup process . once the weight is defined , mathematical formulas can be applied . an analogy drawn from the stock market is stochastic , macd , oct . 30 , 1990 ( time period ) moving averages . because the actions of a computer are much more deterministic than the stock market , related analysis provides a more accurate prediction . this enhanced predictability has been documented and used to successfully rectify a failure before it happened in a live production environment . the failing system was a windows 2000 server . other applications have been developed , and are being developed to derive even more accurate predictivity . the potential applications for this technology are significant . in a backup application , the time it takes to do each backup , the size of each backup , the number of files backed up , and the number of directories backed up are recorded . this information can then be compared on a technical , one - time basis , as well as on an historical basis . any deviation from the history stored in the system can initiate a warning or identify an error . for example , if the backup takes 15 % longer than its historical average , it can be compared to the amount of data currently being backed up . if there is an equivalent amount of data added to justify the extra time , no warning flag would occur . however , if no additional data has been added , or if even less data has been recorded the indication of potential problems would occur and preemptive action could be triggered . integrating this technology into existing firewalls also provides a significantly enhanced level of intrusion detection . for example , by monitoring the flow of traffic through a firewall and storing that information appropriately , any deviation from historical norms would immediately point to a possible attempt to breach the security of the system . in turn , a reverse firewall monitors all outbound traffic . if a system is compromised by a trojan that replicates itself via email , there would be a distinct and identifiable change from the norm . a compromised desktop system could be identified by the reverse firewall within micro - seconds , and be disconnected automatically from the network . the entire activity could be designed to take place without the intervention of a system administrator . two benefits would occur . first , the network would be protected from other potentially disastrous infections . second , the viability of the internet would be served . the savings in lost man hours has the potential to be enormous ( i . e . 500 systems × 3 hours to clean each system = 1 , 500 hours ). file storage can also be monitored . by recording who has access to what over a period of time , the behaviors of employees can be profiled . if an employee accesses new areas , the unique activity can be isolated and verified as either legitimate or not . the obvious benefit is the potential for a reduction in destructive internal activity . information lifetime management ( ilm ) has become an important initiative in the computer industry . by monitoring files that are not accessed in a pre - determined amount of time , predictive information can be gathered to identify alternative access pattern intervals . by applying a margin of error to the intervals , the information can either be retained for future access , or marked for deletion or secondary storage . also , in the event of a significant virus attack , such as the “ i love you ” virus , an email system could be enhanced with predictive properties to monitor the normal operation of events , and if the enhancement detects a significant increase in unique activity , the system can be shut down or throttled to protect the server from failure due to overload . such predictive capability would again be based on an established history of normal behavior . in all cases , the system has the ability to adapt to natural growth , with tolerances calibrated over a period of time . using historic information , the system can recalibrate the tolerances to adjust to a gradual shift , mirroring the natural growth of an organization . in some applications , the system does not need the intervention or re - configuration of a system administrator because actions can be designed to be applied by the system independently . the actions can be complex , or as simple as notifying an administrator of a requirement for consideration . the present invention generally operates through the use of a software program that allows for the continuous monitoring of a system &# 39 ; s operation , the coordination of routine data backups , and data analysis means for analyzing historical data to predict future system behaviors . the present invention is also fully customizable and thus is adaptable for a variety of system types , data types , and media types . moreover , the present invention is fully expandable for use in settings involving complex , enterprise - level systems , and large amounts of rapidly changing data . the present invention is accessible through any device possessing the appropriate hardware capable of operating the system of the present invention . appropriate devices include , but are not limited to personal computers ( pc &# 39 ; s ), portable computers , hand - held devices , wireless devices , web - based technology systems , touch screen devices , typing devices , and any other similar electronic device . the user interacts with the system using a graphical user interface ( gui ), which configures and controls the operation of the system . entry of information occurs through input devices including , but not limited to , mouse / pointing devices , keyboards , electronic pens together with handwriting recognition software , mouse devices , touch - screen devices , scanners , and any other similar electronic input devices known to those of skill in the art . the present invention works in unison with other networked devices , and also works independently on a single device . thus , wired or wireless transmission from the device to a common server is possible . the data is stored on the device itself , a local server , a central server via the internet , or a central data warehouse outside of a facility . the present invention allows for simultaneous , multiple users . the present invention is compatible with all standard networks , such as novell netware , unix nfs , microsoft windows ( smb and cifs ), etc . the present invention includes a software program for all of the functions of the data backup and system monitoring system , including arranging and organizing data backup , computing system operation data , storing system data , monitoring and analyzing collected historical system data , predicting a future system occurrence , taking the appropriate steps to notify a specified party of a future occurrence , and taking the appropriate steps to correct or prevent a future occurrence . the software program is accessible through communication systems including , but not limited to , the internet , intranet , extranet , and any other similar digital network mechanism know to those of skill in the art . additionally , the software can be interfaced and integrated with currently existing software programs involving digital data such as microsoft office , microsoft outlook , and other such business software programs , as well as existing electronic document storage systems , including databases . fig1 represents a process flow diagram of the present invention . the backup process is started ( 2 ) by the system scheduler , and the system loads all information relevant to the present backup job ( 4 ). the scheduler can be implemented as a standard ‘ vixie - cron ’ software package ( which initiates programs based on time and / or date ), or as an integrated scheduling program within the backup system . a log is created ( 6 ), which continuously logs information relating to the system &# 39 ; s operation and integrity . the log is a time - stamped record of the meta - data of the associated operation . each operation provides meta - data that is recorded with a time stamp and is inserted into a file or database to be uploaded to the central server . the system then scans the given computer system ( 8 ), taking inventory of system information such as available memory ( ram ), available hard disk space , as well as currently running programs . this information is compared ( 10 ) with archived system information , reflecting the expected values for each piece of system information ( available memory , hard disk space , etc .). any discrepancies between the current and expected system operation are recorded ( 12 ). the system then computes a value based upon the current collected system information . in doing so , the system identifies (“ qualifies ”) ( 14 ) the useful elements of the collected information , and measures (“ quantifies ”) ( 16 ) the usefulness of this identified data . alternatively , the system can be configured so that the system “ qualifies ” the relevant data , and then alerts or reports the results to a human user or administrator , who is then capable of measuring (“ quantifying ”) the value of this data . the system can also be configured to analyze any number of system or network data items ( i . e ., hard disk integrity , network flow , network integrity , etc .). this information is transmitted ( via an electronic communication interface such as the internet ) ( 18 ) to a remote monitoring system . alternatively , this process can occur locally , within the given computer , thereby negating the necessity of an electronic connection or a remote system . the transmission of this information at regular intervals ( as determined by the system administrator ) is a strong indication that the given computer is operational ( 20 ). if the remote monitoring system senses that a certain number of intervals have passed without data transmission , the remote monitoring system notifies the appropriate party ( based upon pre - determined system settings ), and / or attempts to repair the connection ( 22 ). meta - data is also transmitted and archived by a central server to perform historical analysis for predictive purposes . in the event of an interruption , the system also provides a powerful interface for viewing and sorting the collected system data . the user may view the system operation log , and can track the system &# 39 ; s performance based on the previously collected system data . this interface allows the user to pinpoint various system errors or malfunctions that may have lead to a system failure . the notification system is then initiated . fig2 represents a process flow diagram of the notification system . this system collects ( 30 ) all relevant system data , as well as any system failures / warnings , and stores and analyzes this data for further reporting process ( 32 ). if any errors are detected ( 34 ), based upon the comparison of current system values with the system &# 39 ; s historical values ( using the data qualified and quantified above ), the notification system alerts the user ( 36 ) of the discrepancy . furthermore , the system analyzes the stored historical data to identify the parameters of the system &# 39 ; s normal operating state . once enough data is collected , the system can accurately define the expected normal operating state , and can alert the user whenever the system &# 39 ; s operational data deviates from it . fig3 represents a process flow diagram of the backup / media verification system . the system computes the appropriate media to be used for the current data backup ( 50 ), and prompts the user accordingly ( 52 ). the system then retrieves the desired ( either selected automatically by the system , or manually by the user ) backup process ( 54 ) from the backup configuration information . the user inserts the appropriate storage media ( hard drive , tape drive , dvd - r , etc .) ( 56 ), and the system verifies the integrity of the inserted media ( 58 ). then , the system creates a new job log ( 60 ), which continuously logs the status and results of every step in the backup process . the system verifies that the expected and appropriate storage media is present ( 62 ). if the expected media is not present , the system sends a warning to the user not to overwrite the media . the system utilizes the collected and archived system data to calculate the way the system being analyzed will behave or respond in the future ( 64 ). the system first identifies (“ qualifies ”) important and relevant portions of the collected system and backup data and meta - data ( data recorded based on the collected system data ). this identified (“ qualified ”) data is then weighed (“ quantified ”), to determine its relative value , from the perspective of the entire system &# 39 ; s operation , or any other such value . alternatively , the system can be configured so that the system “ qualifies ” the relevant data , and then alerts or reports the results to a human user or administrator , who is then capable of measuring (“ quantifying ”) the value of this data . the data and meta - data are further analyzed from a historical perspective , comparing them quantitatively and quantitatively with previously collected system data . the results of this analysis are attributed a value , which is added to an overall system ‘ score ’ ( 66 ). if the system ‘ score ’ reaches a pre - determined point ( as determined by the user and the system ), the system alerts the user that the present computer may be unstable ( 68 ). to calculate the proper system ‘ score ,’ the system analyzes the stored historical data to identify the parameters of the system &# 39 ; s normal operating state . once enough data is collected , the system can accurately define the expected normal operating state , and can alert the user whenever the system &# 39 ; s operational data deviates from it . further deviations from the norm prompt further alerts to the user . in this fashion , even a slight deviation from a computer &# 39 ; s expected operation can help predict a system failure or malfunction . the results of this data analysis , together with the data backup itself , are stored in an intermediate storage area ( i . e ., central hard drive or other such mass storage device ) ( 70 ), and are further stored on recordable media ( i . e ., cd - rom , dvd - rom , etc .) for backup purposes ( 72 ). throughout this application , various publications , including united states patents , are referenced by author and year and patents by number . full citations for the publications are listed below . the disclosures of these publications and patents in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains . the invention has been described in an illustrative manner , and it is to be understood that the terminology , which has been used is intended to be in the nature of words of description rather than of limitation . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is , therefore , to be understood that within the scope of the appended claims , the invention can be practiced otherwise than as specifically described .	6
mune is a technology developed to evaluate neuromuscular functions . as noted above , mune automation using the traditional is method needs to address the issue of motor unit alternation . the present invention provides an automation method to estimate mun more accurately and reliably by minimizing the adverse effect of alternation based on waveforms acquired with pre - configured electrode array under controlled stimulation conditions . the methodology of the preferred embodiment of the invention is illustrated in fig5 . 1 . pre - configured electrode array . a surface electrode array 50 ( fig4 ) consists of pre - arranged electrodes on a single housing . the array is placed on the surface of skin of the subject according to anatomical landmarks ( e . g ., distal wrist crest 53 in fig4 ). the electrodes are used to deliver stimuli and to acquire response waveforms . the stimulator portion of the electrode comprises two or more electrodes 64 , 65 , and 66 ( fig4 ). the stimulator electrodes are placed over or near the nerve axons which are to be stimulated ( e . g ., median nerve 54 in fig4 ). the geometric relationship between stimulator electrodes are controlled , fixed and known . through electric circuit design , each electrode is connected as a cathode and one of the remaining electrodes is connected as an anode . alternatively , more than one electrode can be connected as cathode or anode . the ability to alter anode and cathode electrode connections allows a greater diversity in electric current patterns delivered to nerve axons . this diversity , combined with fine control of varying electric current intensity , provides a greater assortment of stimulated axons . as a result , a better sampling of motor units is achieved . multiple electrodes are used to acquire response waveform ( e . g ., electrodes 61 , 62 , and 63 in fig4 ). the spatial associations of the signal acquisition electrodes with respect to each other are fixed and known ( or is controlled with accuracy ). the spatial relationship of the signal acquisition electrodes with respect to stimulator electrodes is also fixed . after the application of each stimulus , more than one response waveform can be acquired through a different pairing of detection electrodes . as an example , two response waveforms may be acquired simultaneously , one from electrode pair 61 and 63 and the other from electrode pair 62 and 63 . all electrodes are insulated from each other and held on the skin with an adhesive . from the electrode array , with known and fixed geometric associations among all electrodes , stable and more certain response waveforms are acquired during each study session as well as from study to study . 2 . automated data acquisition . an electrodiagnostic device acquires motor responses via detection electrodes of the electrode array . the motor responses are evoked by the activation of the nerve axon under the stimulus electrode when a controlled electric shock is delivered to the nerve via stimulus electrodes . the motor responses ( both smup and cmap ) are acquired with adjustable analog gain so that the response range spans the dynamic range of the data acquisition system . the responses are also optionally filtered to reduce the measurement noise outside the primary energy band of the motor responses . a significant portion of motor response energy lies in the frequency range of 30 - 800 hz . to avoid aliasing , the analog response waveform is lowpass filtered and sampled at rates in excess of twice of its nyquist frequency . as an example , if the cmap is filtered with a lowpass filter of 2500 hz , the waveform is sampled at a rate at or greater than 5000 hz . the stimulation parameters may depend upon the subject demographics . for example , higher stimulus intensity is used when the subject has an above - average body mass index . the body mass index correlates with adipose tissue volume . a higher body mass index is a good predictor of a thicker layer of adipose tissue separating skin and nerve axon , and therefore a higher stimulus intensity is needed to activate the axon . the stimulation parameters depend upon the prior electrophysiological responses . for example , a stimulus response curve 102 ( fig7 ) for the nerve under study is generally available when stimuli with a gradual increase in intensity are delivered to obtain maximum cmap response . the is method operates at the threshold region 101 ( the boxed area of the stimulus response curve shown in fig7 ). using the electrode placement arrangement identical to that for acquiring maximum cmap response , the is response waveforms are acquired . the stimulation parameters are digitally controlled with finer precision ( e . g ., 0 . 1 ma increments in stimulus intensity ). more than one stimuli of the same intensity are delivered to the nerve axon in order to elicit responses from distinct motor units with overlapping activation thresholds . the control of the stimulation parameters is tightly integrated with the subsequent waveform analysis procedures . if alternation activities are detected and cannot be separated effectively from activation activities , an even finer stimulus intensity increment is used to differentiate the motor units with overlapping activation threshold . in addition to stimulus intensity 110 ( fig6 ), other controllable and adjustable parameters include duration 111 , polarity 112 , and repetition interval 113 . for example , instead of stimulus intensity adjustment , both duration and intensity are altered simultaneously to attempt to evoke different motor units . the real - time integration of response waveform analysis and data acquisition control improves the efficiency , accuracy , and reliability of the mune . i . mus activity region determination and noise estimation . the baseline and any dc offset of the acquired response waveforms are removed . the onset 49 ( fig2 ) and the duration 46 ( fig2 ) of the maximum cmap are used to determine the response activity region 47 ( fig2 ). the response activity region 47 is searched within the maximum cmap duration . in this search , the absolute deviations of the response waveforms from their median are averaged across waveforms at each time sample so as to form an activity profile . the region of the activity profile where the value exceeds the noise level defines the response activity region . segments of the response waveform falling outside the activity region are no longer considered in the mune analysis . the waveform segment outside of the maximum cmap region is used to estimate background noise . the noise power is calculated and a multiple of the noise power is then used to screen response waveforms . any waveform having a power less than this threshold is considered a null response waveform and is removed from further analysis . ii . identical waveform measure and merging . a similarity measure is used to evaluate whether the differences between two waveforms are exclusively due to noise . the measure is based on euclidian distance and is calculated as follows : the sample - by - sample difference between the two waveforms are calculated and squared ; the squared difference values are added ; and the summation is divided by the number of samples or the length of the waveform . measures based on other metrics such as mean absolute value and correlation coefficient are also possible . the similarity of a given pair of waveforms is compared with the noise threshold . a pair of waveforms is considered as having identical responses if the similarity measure is below the noise threshold . the identical waveforms are then combined to produce a single , consolidated waveform for subsequent analysis . waveform combination is done by averaging the two waveforms . consolidated waveforms have better waveform quality and reduced noise . waveform combination also improves the efficiency of alternation pattern determination process by reducing the number of waveforms to be examined . iii . waveforms sorting . the response waveforms are sorted by waveform energy and the stimulus intensity to facilitate alternation identification . i . deferment decision level . because of the possibility of alternation , morphological differences between consolidated response waveforms cannot be automatically attributed to activation of additional motor units . a decision has to be made as to whether waveform variations are due to the activation of a new motor unit or due to alternation . previously , such a decision would generally be made sequentially , based on manual examination of each pair of waveforms . in the global search method , the decision is deferred in order to assess consequence of either possibility ( new motor unit or alternation ) by considering more than two waveforms . the level of decision deferment ( i . e ., how many additional waveforms need to be considered before a decision is made ) is controlled via automation parameter settings . when the level of deferment is set at one , then the decision process utilizes step - by - step sequential manual processing . global search with a deferment level of two will determine the best path of alternation or activation based on two new response waveforms . when the level of deferment is set to be the same as the total number of acquired waveforms , the decision is made only after all possible combinations of alternation and new motor units are considered . a higher deferment level will lead to a better discrimination of alternation activities , and thus a more accurate estimate of motor unit number . however , a greater computational complexity is associated with a higher deferment level . ii . global search paths . the global search method evaluates all possible combinations of smups at a pre - set decision deferment level . the approach is illustrated with an example below ( shown in fig8 ). if the deferment level is one , a decision is made as to whether the changes in x 2 is a result of new motor unit or alternation . the scores of the two candidate paths are calculated ( see waveform scoring section ): { x 1 , x 2 − x 1 } and { x 1 , x 2 }. the path with a higher score is selected . if the path { x 1 , x 2 − x 1 } is selected , the next step is to form candidate paths that include x 3 : { x 2 − x 1 , x 3 − x 1 } ( x 3 is a result of alternation ) and { x 2 − x 1 , x 3 − x 2 } ( x 3 is a result of new activation ). the scores for the two paths are calculated and the path with a higher score is selected . if more response waveforms are available , the process is repeated for all other waveforms . the lower half of the candidate paths shown in fig8 are not considered further by the search algorithm once the boxed x 2 node is excluded from the first segment of path . if the deferment level is greater than one ( e . g ., two ), no commitment needs to be made at the x 2 level until x 3 is observed . this will allow the evaluation of all paths shown in fig8 . when candidate paths are constructed , the path { x 1 , x 2 , x 3 − x 2 } will be one of them . a score may be higher than { x 1 , x 2 − x 1 , x 3 − x 1 }, suggesting that the path with boxed nodes is a better solution . in effect , a higher deferment level allows for a global optimization solution instead of a sequence of local optimization solutions . iii . smup waveform extracting . for each search path , a set of smups are obtained , depending upon the assumption made to form that path . for example , if it was assumed that the path consists of all new motor unit activities from one node to another , the smups will be differences between successive response waveforms associated with each node ( for the most top path in fig8 ). iv . smup waveform scoring . multiple candidate paths are formed as a result of decision deferment . the candidate smup waveform set obtained from each path is scored based on ranking criteria . all candidate paths are ranked based on the scores of the candidate smup waveforms associated with the paths . the quantitative ranking criteria capture the desired features of true smups . a set of smups receive a higher score if the individual smup waveforms meet the criteria of initial negativity ( up peak followed by down peak ) and biphasic morphology . a similar onset for all smup waveforms will yield a higher score as well . in the case that two successive response waveforms are due to alternation but the path search dictates that they are considered as new motor unit activation , the candidate smup derived from the path will be the difference between the two individual motor unit responses . thus , it will likely have smaller amplitude , irregular morphology , and perhaps a delayed onset time because of the phase cancellation . consequently , the score for the candidate smup will be low and the incorrect candidate path will be penalized with a lower score . additional scoring components for candidate smup waveforms include : the offset of a smup waveform power over the average power level of all smups ; the offset of a smup waveform onset over that of the cmap ; the offset of a smup waveform duration over that of the cmap ; the offset of a smup waveform maximum negative peak location over that of the cmap ; the offset of the waveform numbers of this smup group over the total number of consolidated mu waveforms . each feature is weighted by a weighting factor that is consistent in determining its relative importance to other features . the weighting factors are based on prior data analysis , physiological factors , and other considerations . the weighted feature scores are summed for all features and all smups to form the final ranking score for a group of smups . fig9 shows two groups of smups : the left panel shows a group of smups with a lower ranking score , and the right panel shows a group of smups with a higher ranking score . ( i ) mus alternation equation . as an example , a frequently observed alternation pattern is shown in table 1 where two motor units ( mu 3 and mu 4 ) alternate before both of them are activated together . the first column is the recording waveforms , and the second column describes the individual mus included in these recordings . direct subtraction of the mus responses would result in creating three motor units : mu 3 = x 1 − x 0 , mu 4 a = x 2 − x 1 = mu 4 − mu 3 , and mu 5 = x 3 − x 2 = mu 3 . as a result , mu 4 a will be an under - estimation of mu 4 , leading to an over - estimation of mune . to identify the alternation patterns , one first removes the common component x 0 ( mu 1 + mu 2 ) to obtain residuals r i = x i − x 0 , i = 1 , 2 , 3 . the residuals r i , i = 1 , 2 , 3 and their mus are listed in the third and fourth columns of table 1 , respectively . these residuals satisfy the following alternation equation : the above equation condition indicates that alternations are present in the recording waveforms x 1 and x 2 . subsequently , x 2 − x 1 is not a true smup . instead , the components r 1 and r 2 are considered as potential motor units for further evaluation . in general , for a set of consolidated recording waveforms x 0 , x 1 , . . . x l , ∀ l ≧ 3 , one needs to remove the common component x 0 to obtain residual signals r i = x i − x 0 ≠ φ , i = 1 , . . . , l , ∀ l ≧ 3 . if the residual components r i satisfy the alternation equation : ∑ r i i ∈ j , j ≠ i , j ∈ [ 1 , … ⁢ , l ] = r j , ( 1 ) ( here index set j is a subset of [ 1 , 2 , . . . , l ]), then these components r i , iεj , are candidates to be assessed as alternating motor units . direct subtraction between their original waveforms x i , iεj should be avoided . a . potential smups extracting . the flow chart in fig1 describes the methods of extracting potential smups by using alternation equations . in this step , all the consolidated mu response waveforms x i , are re - arranged at different positions according to their power . the large power waveforms are placed on high positions . the base waveform ( aforementioned common components among the mu responses ) is first considered as a null signal , and then each of the mu response waveforms x i is tested once as a base waveform . at each determined base waveform position , the residual components r i , are obtained by subtracting the base waveform from all those mu response waveforms which are at a higher position than that of this base waveform . this set of residual waveforms is checked using alternation equations ( 1 ). the residual waveforms that satisfy an “ alternation equation ” are identified and recorded . this procedure is repeated until all the mu response waveforms have been used as the base waveforms . those residual components of r i satisfying alternation equations indicate a fact that their corresponding original mu waveforms x i are alternating mu response waveforms . all of the alternating waveforms that have an overlap range form an alternation range . the recording waveforms from a muscle group may contain many alternation ranges . in any particular alternation range , the smaller residual waveforms on the left side of the alternation equations ( 1 ) are taken as potential smups . beyond the alternation ranges , the potential smups are extracted using traditional is method , i . e ., a potential smup is extracted by directly subtracting an mu waveform from another mu waveform that is one position above . the procedure discussed above can be further explained using the following example . table 2 shows a case involving 5 alternating motor units : mu 1 - mu 5 . the first column lists the recording mu response waveforms x i . the first ( i . e ., lowest ) waveform x 0 has the least power , and the last ( i . e ., highest ) waveform x 9 has the largest power . the second column describes their corresponding motor unit components . while waveform x 0 is determined as the base waveform , the residual waveforms are obtained by subtracting the base waveform x 0 from all the higher position waveforms from x 1 to x 9 . the resulting residual waveforms r i , i = 1 , . . . , 9 , and their corresponding components , are listed in the third column and fourth column , respectively . those residual waveforms only presenting on the left side of the above equations are extracted as potential smups . accordingly , they are : r 1 ( mu 1 ), r 2 ( mu 2 ), r 3 ( mu 3 ), and r 4 ( mu 4 ). the residual waveform r 5 ( mu 1 + mu 2 ) appears on both sides of the equations , thus it cannot be a smup . these five alternation equations relate to seven response waveforms from x 1 to x 6 , and x 8 . these seven mu response waveforms form an alternation range including waveforms from x 1 to x 8 . beyond this range , only one recording waveform exists , which is x 9 . within this alternation range , the direct subtraction among the alternating waveforms from x 1 to x 8 is avoided . beyond this alternation range , traditional is method is used . that is , the waveforms sequential subtraction result is taken as potential smups , which result in x 9 − x 8 ( mu 3 + mu 5 − mu 2 ). b . smups validation . the flow chart in fig1 describes the methods of smup validation by using self - check method . this process is explained as follows . the aforementioned smup search process has extracted a group of potential smups , and they are r 1 ( mu 1 ), r 2 ( mu 2 ), r 3 ( mu 3 ), r 4 ( mu 4 ), and x 9 − x 8 ( mu 3 + mu 5 − mu 2 ). these potential smups do not include all the true motor units ( mu 5 is missed ), and also contain potential smups that are not true motor units ( x 9 − x 8 is not a correct one ). to validate the potential smups , firstly , identical waveforms or any composite smup waveforms ( combinations of other smups ) are identified and removed from this potential smup group . in the above example , none of candidate waveforms are removed . the potential smups are r 1 ( mu 1 ), r 2 ( mu 2 ), r 3 ( mu 3 ), r 4 ( mu 4 ), and x 9 − x 8 ( mu 3 + mu 5 − mu 2 ). secondly , a self - check method is provided . that is , if the potential smup combinations with the original base waveform x 0 are used to compare with the recording waveforms x 1 , at least one subset of potential smups must exist and their summation matches a given recording waveform . otherwise , the recording waveform without a match must have a new smup component . in table 2 , a self - check can identify waveform x 7 does not meet the matching criteria . thus , it must contain new potential smups . then , the mis - matched waveforms are used to obtain additional smups . the mismatched waveform subtracts lower level waveforms sequentially to obtain new residual waveforms . if a newly obtained residual waveform can be combined with existing smup candidates to match two or more recording waveforms , the new residual waveform is added to the potential smup pool . as noted above , waveform x 7 is a mis - matched waveform . new residual waveforms are formed by subtracting lower position waveforms from waveform × 7 . two residual waveforms x 7 − x 5 ( mu 5 ) and x 7 − x 2 ( mu 1 + mu 5 ) meet the matching criteria twice for waveform x 7 and x 9 . thus , they are added to the potential smup pool . now , the potential smups group consists of r 1 ( mu 1 ), r 2 ( mu 2 ), r 3 ( mu 3 ), r 4 ( mu 4 ), x 9 − x 8 ( mu 3 + mu 5 − mu 2 ), and new potential smups x 7 − x 5 ( mu 5 ) and x 7 − x 2 ( mu 1 + mu 5 ). after this self - check process , identical waveforms and composite smup waveforms are detected and removed . in this example , x 7 − x 2 ( mu 1 + mu 5 ) is the combination of r i ( mu 1 ) and x 7 − x 5 ( mu 5 ), and thus removed . the final selection is a set of smups from the potential smup group that has a minimum number of smups , but matches all the consolidated mus responses . this last step can exclude incorrect waveforms x 9 − x 8 ( mu 3 + mu 5 − mu 2 ), and keep the true motor units which are r 1 ( mu 1 ), r 2 ( mu 2 ), r 3 ( mu 3 ), r 4 ( mu 4 ), and x 7 − x 5 ( mu 5 ) 6 . motor unit number estimation . mune is used to estimate the number of smup waveforms that will take to match the maximum cmap waveform . each smup is from an individual motor unit and the maximum cmap is the result of all motor units in the muscle group . a specific feature of the waveform is used for matching waveforms instead of the total waveform morphology . for example , if the peak - to - base amplitude of a smup is 20 uv and the amplitude for cmap is 5 mv , then the number of smup waveforms needed to match the cmap is 250 . commonly - used measures for waveform size are peak - to - base amplitude , peak - to - peak amplitude , and peak area of smup and cmap waveforms . the smup waveforms extracted from response waveforms do not have the same morphology and the size feature from each smup waveform is also different . different methods are used to obtain the average smup feature : calculating the features of each smup waveform , and then average individual features ; averaging all the smup waveforms , and then calculating the feature of the averaged smup ; calculating the size feature of the largest response waveform with a known number of motor units , and then normalizing the value of the feature by the number of motor units . global search method provides multiple sets of smups . each set of smups will lead to an estimate of mun . in addition to the mean estimate of mun , the variance of the estimates is also calculated to describe the variations of the mun estimates . a smaller variance gives a higher confidence of the robustness of the estimates . thus it will be seen that this invention describes methods and apparatus for estimating motor unit number of a muscle group . a pre - configured electrode array is used to acquire more stable and more certain response waveforms . based on intermediate waveform processing results , the experimental condition is dynamically adjusted through digitally controlled stimulation and acquisition setup for fast and repeatable motor unit number estimation . an automation algorithm enhances the response waveform quality ; determines the optimal solutions for alternation and activation patterns of the response waveforms ; derives individual single motor unit potentials ; calculates waveform features useful for motor unit number estimation ; and reports an estimated value of motor unit number as well as the confidence level of the estimation . it will be appreciated that still further embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure . it is to be understood that the present invention is by no means limited to the particular constructions and method steps herein disclosed and / or shown in the drawings , but also comprises any modifications or equivalents within the scope of the invention .	0
referring now to fig1 , 2 and 3 , a tag body 20 is illustrated having a first half 22 and a second half 24 . first and second halves 22 and 24 are preferably made of a hard or rigid material and are adapted to attach to one another and form a front end 21 and a rear end 23 . a usable rigid or hard material might be a hard plastic such as , for purposes of illustration but not limitation , an injection molded abs plastic or like material . second half 24 has a peripheral wall 26 extending inwardly from an inner surface 28 a of second half 24 and securely engaging — along a substantial portion of the periphery thereof — first half 22 . peripheral outer wall 26 of tag 20 encloses the tag body except for the front end 21 . if plastic or like material is used for the body of tag 20 , the mating of peripheral wall 26 to first half 22 can be accomplished via an ultrasonic weld or like joining mechanism . however , it is to be understood that other joining methods , such as adhesives for example , may also be used . inner surface 28 b of first half 22 and inner surface 28 a of second half 24 create a cavity 30 within which a marker 32 is enclosed . marker 32 may be an electronic article surveillance (“ eas ”) device or any electronic means of monitoring an article to which it is attached . conventional eas devices or tags include a resonator that , when activated , causes an alarm to sound when the eas tag is brought within operative proximity of detection apparatus ( which is typically located at the exit of a store ). marker 32 may also be a radio - frequency (“ rfid ”) device . rfid is a generic term for technologies that use radio waves to automatically identify objects such as tagged products . there are several conventional methods of identifying objects using rfid , the most common of which is to store a serial number ( and other information if desired ) that identifies the object on a microchip that is attached to an antenna . the chip and the antenna , together with any supporting substrate , herein are called an rfid device or an rfid tag . the antenna enables the chip to transmit the identification information to a reader . the reader converts the radio waves from the rfid device into a form that can then be utilized by a computer and read by a user . marker 32 may also be any transponder or a combination of both an eas and rfid device , and can also incorporate any later developed technology to track inventory or surveil articles . marker 32 is adapted to operate along the lines of a frequency modulated ( fm ) radio and also amplitude modulated ( am ) radio signals . a chamber 34 — defined between first half 22 and second half 24 — securely maintains an attaching member 36 therein in a swiveling or rotating manner . chamber 34 is created by a first protrusion 38 extending outwardly from first half 22 and a second protrusion 40 extending outwardly from second half 24 . in one preferred embodiment , chamber 34 is located proximal to front end 21 of tag body 20 . first protrusion 38 and second protrusion 40 have an inwardly extending lip 44 such that lip 44 defines an opening 42 . inner surface of first protrusion 38 and second protrusion 40 are substantially concave and form a substantially cylindrical chamber 34 when the tag body is attached . although a cylindrical embodiment is herein presented , it is to be understood that attaching member 36 and chamber 34 may be substantially spherical , or any other appropriate shape that would allow the swiveling of attaching member 36 within chamber 34 . in fact , attaching member 36 may take any shape that does not prevent it from being moveably maintained within chamber 34 . and , as a further example , attaching member 36 may be substantially conical . now also referring to fig5 through 9 , an engaging element 46 has a first end 48 and a second end 50 , at points distal to one another , and a middle region 52 therebetween . engaging element 46 may be a lanyard preferably formed of stainless steel cable or like material that is flexible yet strong . a first catch 54 is attached to first end 48 and a second catch 56 is attached to second end 56 and are preferably cylindrical in shape . first catch 54 and second catch 56 may be formed by crimping a metal element onto first end 48 and second end 50 , respectively , or by soldering thereon . in addition , first and second catches 54 and 56 may also preferably be formed by crimp splices . in one preferred embodiment , first catch 54 has a smaller diameter than second catch 56 such that first catch 54 can pass through a first aperture 58 defined through attaching member 36 , as defined below in greater detail . attaching member 36 is substantially cylindrically shaped having a leading end 60 and a trailing end 62 . in one preferred embodiment , leading end 60 has a smaller diameter than trailing end 62 such that a peripherally extending ridge 64 is formed at the transition between leading end 60 and trailing end 62 . ridge 64 is engaged by lip 44 of tag body 20 in a swiveling yet secure manner such that leading end 60 is substantially flush with front end 21 when assembled . first aperture 58 is defined by the attaching member and traverses from leading end 60 to trailing end 62 . first catch 54 is fed through aperture 58 from trailing end 62 such that first catch 54 emanates from leading end 60 . however , as a result of the larger diameter of second catch 56 , it cannot pass through the aperture 58 and is securely maintained within attaching member 36 . a second aperture 66 is also defined by and extends from leading end 60 to trailing end 62 of attaching member 36 . first end 48 of engaging element 46 is passed through an article to be monitored and first catch 54 is inserted into second aperture 66 and is securely therein via an attaching mechanism 68 . in such a state , the article to be monitored is maintained within a loop formed by engaging element 46 . furthermore , in said state , an unscrupulous individual will not be able to insert a screw driver or similar tool within the loop and turn the same into a tightening helical form in an attempt to break the engaging element 46 or cause failure of the tag body 20 . attempts to turn the screw driver in order to twist the engaging element 46 upon itself will not be successful because it will result in the swiveling of the attaching member 36 within tag body 20 . attaching mechanism 68 is comprised of a cap 70 , a biasing member 72 , and a ball 74 . ball 74 is larger in diameter than second aperture 66 and cannot travel therethrough . cap 70 is substantially disc shaped and is adapted to be received on trailing end 62 of attaching member 36 . cap 70 has an elevated region 76 — that is substantially shaped like a right triangle — extending inwardly therefrom . cap 70 also has a first hole 78 and a second hole 80 defined through the disc region thereof . first hole 78 and second hole 80 have the same size as and are axially aligned with first aperture 58 and second aperture 66 , respectively . elevated region 76 has a first side 82 that is inclined and is similar to a hypotenuse of a right triangle , a second side 84 extends downwardly from a top portion 86 of first side 82 in a substantially perpendicular manner to disc region of cap 70 . a third side 88 is defined on said flat region of the cap 70 and forms the final side of the triangular elevated region 76 and attaches to a bottom portion 90 of first side 82 . bottom portion 90 is distal to top portion 86 of first side 82 . a base 92 emanates vertically from disc region of cap 70 at bottom portion 90 of first side 82 . base 92 is adapted to receive one end of biasing member 72 thereon such that biasing member 72 is maintained in parallel alignment with and rests on top of first side 82 . the other end of biasing member 72 rests proximal to top portion 86 of first side 82 . in one preferred embodiment , first side 82 and second side 84 have an axially extending concavity along the lengths thereof such that a first channel 94 is defined along first side 82 and a second channel 96 is defined along second side 84 . biasing member 72 and ball 74 are adapted to travel on top of the side rail like structures created by first channel 94 without falling into second channel 96 . now referring more particularly to fig7 , a crevice 98 is formed within attaching member 36 from trailing end 62 thereof , the apex of crevice 98 communicating with second aperture 66 . a first wall 100 and a second wall 102 oppose one another , with first wall 100 being angled such that it is in parallel alignment with first side 82 and first wall 100 culminating at second aperture 66 . second wall 102 being vertically aligned such that it is in substantial parallel alignment with second side 84 , and second wall 102 culminating at second aperture 66 at one end and at second hole 80 at another end . when attaching mechanism 68 is inserted into crevice 98 of attaching member 36 , ball 74 is maintained at top portion 86 of first side 82 by the application of force from biasing member 72 thereto . ball 74 and biasing member 72 are moveably maintained between first side 82 and first wall 100 and maintained within first channel 94 . now referring more particularly to fig9 , when first catch 54 is inserted into second aperture 66 , it pushes ball 74 toward biasing member 72 , whereby biasing member 72 is compressed and ball 66 moves away from top portion 86 and toward base 92 . first catch 54 travels into second channel 96 defined between second wall 102 and second side 84 . when first catch 54 is inserted up to a predetermined length such that first end 48 is proximal to ball 74 , biasing member 72 expands and forces ball 74 toward top portion 86 and second aperture 66 thereby occluding second aperture 66 and preventing withdrawal of first catch 54 . a loop is thereby formed by engaging element 46 such that an article to be monitored can securely be maintained therein . it is to be understood that while a ball mechanism is illustrated herein , other attaching mechanisms known in the art may be substituted therefor without departing from the essence of the invention . in a single use theft deterrent device , the authorized user is provided with a cutting tool that is capable of cutting engaging element 46 from the article that is enclosed within the loop . while the above description contains many specificities , these should not be construed as limitations on the scope of the invention , but rather as an exemplification of preferred embodiments thereof . many other variations are possible without departing from the essential spirit of this invention . accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents .	6
in the following , the embodiments of the present invention are described in detail in reference to the drawings . here , the same symbols are attached to parts having the same functions throughout all the drawings illustrating the embodiments , and repeated descriptions are omitted . fig1 is a cross sectional diagram schematically showing a main portion of the cross sectional structure of one subpixel of the semi - transmission type liquid crystal display device according to an embodiment of the present invention . fig2 is a plan diagram showing the electrode structure of the semi - transmission type liquid crystal display device according to an embodiment of the present invention . here , fig1 is a cross sectional diagram showing the cross sectional structure along line a - a ′ of fig2 . in the semi - transmission type liquid crystal display device according to the present embodiment , a first substrate ( sub 1 ) and a second substrate ( sub 2 ) are provided so as to sandwich a liquid crystal layer ( lc ). in the semi - transmission type liquid crystal display device according to the present embodiment , the main surface side of the second substrate ( sub 2 ) is a viewed side . as shown in fig1 , a scanning line ( which is also referred to as gate line ) ( gl ) or a reflection layer ( ral ), an interlayer insulating film ( pas 3 ), a video line ( which is also referred to as source line or drain line , not shown ) ( dl ) or a thin film transistor ( tft ), an interlayer insulating film ( pas 2 ), a facing electrode ( which is also referred to as common electrode ) ( ct ), an interlayer insulating film ( pas 1 ), a pixel electrode ( px ) and an orientation film ( al 1 ) are formed on the liquid crystal layer side of the first substrate ( which is also referred to as tft substrate ) ( sub 1 ) sequentially from the first substrate ( sub 1 ) to the liquid crystal layer ( lc ). here , a polarization plate ( pol 1 ) is formed on the outside of the first substrate ( sub 1 ). in addition , the reflection layer ( ral ) is connected to the facing electrode ( ct ), and the same drive voltage as that for the facing electrode ( ct ) is supplied to the reflection layer ( ral ). here , the reflection layer ( ral ) may be a diffuse reflection layer where unevenness is created on the surface . a light shielding film ( bm ), an orientation film ( al ) for orienting an incorporated phase difference film , the incorporated phase difference film ( ret ), a color filter for red , green and blue ( cf ), a flattened film ( oc ), a step forming layer ( mr ) and an orientation film ( al 2 ) are formed on the liquid crystal layer side of a second substrate ( which is also referred to as color filter substrate ) ( sub 2 ) sequentially from the second substrate ( sub 2 ) to the liquid crystal layer ( lc ). here , a polarization plate ( pol 2 ) is formed on the outside of the second substrate ( sub 2 ). in addition , as shown in fig2 , the facing electrode ( ct ) is formed in plane form , and the pixel electrode ( px ) is a comb shaped electrode having a number of linear electrodes . in general , the pixel electrode ( px ) and the facing electrode ( ct ) are formed of a transparent conductive film , such as of ito ( indium tin oxide ), or the like . furthermore , the pixel electrode ( px ) and the facing electrode ( ct ) overlap via the interlayer insulating film ( pas 1 ), and as a result , a capacitor is formed . here , the interlayer insulating film ( pas 1 ) is not limited to being one layer , but may be of two or more layers . here , as shown in fig2 , one subpixel is formed within a rectangular region surrounded scanning lines ( gl ) and video lines ( dl ). light is shielded by the light shielding film ( bm ) formed on the second substrate ( sub 2 ) side in the region where this one subpixel is formed , and therefore , the region ( pt ) which functions as the region where one subpixel is substantially formed is the opening of the light shielding film ( bm ). in addition , fig2 shows the reflection layer ( ral ) with broken lines . in the present embodiment , the reflection layer ( ral ) is formed on the first substrate ( sub 1 ) side . the region where this reflection layer ( ral ) is formed is a reflection portion 31 , and light entering through the second substrate ( sub 2 ) side is reflected from the reflection layer ( ral ) in the reflection portion 31 . in addition , the region where the reflection layer ( ral ) is not formed is a transmission portion 30 , and illumination light from a backlight arranged on the rear side of the first substrate ( sub 1 ) passes through the transmission portion 30 and is emitted through the main surface side of the second substrate ( sub 2 ). the reflection layer ( ral ) may be a metal film , such as of aluminum ( al ), or may have a two - layer structure of molybdenum ( mo ) in the lower layer and aluminum ( al ) in the upper layer . in the semi - transmission type liquid crystal display device according to the present embodiment , the linear pixel electrode ( px ) and the facing electrode in plane form ( ct ) are layered on top of each other via the interlayer insulating film ( pas 1 ) so that lines of electric force in arch form formed between the pixel electrode ( px ) and the facing electrode ( ct ) are distributed so as to penetrate through the liquid crystal layer ( lc ), and thus , the orientation of the liquid crystal layer ( lc ) is changed . in the present embodiment , the gap between the first substrate ( sub 1 ) and the second substrate ( sub 2 ) is set to a predetermined length by the spacer in columnar form ( spa ), and the length of the gap between cells in the reflection portion 31 is set at approximately half of the length of the gap between cells in the transmission portion 30 due to the step forming layer ( mr ). this is because light passes through the reflection portion 31 twice , traveling forward and then backwards , and the light path length should be the same in the transmission portion 30 and the reflection portion 31 . the brightness and darkness of light are displayed using the birefringence of the liquid crystal layer ( lc ) in the transmission portion 30 , while the brightness and darkness of light are displayed using the birefringence of the incorporated phase difference film ( ret ) and the liquid crystal layer ( lc ) arranged inside the liquid crystal display panel in the reflection portion . fig3 is a diagram illustrating a manufacturing method for the second substrate ( sub 2 ) shown in fig1 . in the present embodiment , the second substrate ( sub 2 ) shown in fig1 is formed in accordance with the following method , for example . as shown in fig3 ( a ), a light shielding film ( bm ) is formed on the second substrate ( sub 2 ). this light shielding film ( bm ) is formed using a publicly known photoetching technique , for example . next , an orientation film ( al ) for an incorporated phase difference film is formed on this light shielding film ( bm ), and an orientation process is carried out on this orientation film ( al ) in accordance with a rubbing method . here , the orientation film ( al ) has a function of determining the direction of the late phase axis of the incorporated phase difference film ( ret ). next , a phase difference resist ( for example , an organic solvent including a liquid crystal having a photoreactive acryl group at a terminal of the molecule and a reaction initiator ) is applied onto the orientation film ( al ), and the organic solvent is removed through heating . at this point in time , the photoreactive liquid crystal is oriented in the direction of the orientation process for the orientation film ( al ). next , the acryl group is photopolymerized through irradiation with ultraviolet rays 10 via the photomask 11 so that the portion irradiated with ultraviolet rays 10 is cured . next , the unexposed portion which is not irradiated with ultraviolet rays 10 is eluded in an organic solvent for development , and thus , as shown in fig3 ( b ), an incorporated phase difference film ( ret ) patterned in the same manner as the reflection portion 31 is formed . subsequently , a color filter ( cf ), a flattened film ( oc ), a step forming layer ( mr ), a spacer in columnar form ( spa ) and an orientation film ( al 2 ) are formed . here , the flattened film ( oc ), the step forming layer ( mr ) and the spacer in columnar form ( spa ) may not be formed if unnecessary . fig4 is a diagram showing the light shielding film ( bm ) of the semi - transmission type liquid crystal display device according to the present embodiment , and fig5 is a diagram showing the light shielding film ( bm ) of the conventional semi - transmission type liquid crystal display device described in the above patent document 1 . here , in fig4 and 5 as well as the below described fig6 , the regions ( pt ) which function as the region where one subpixel is substantially formed are shown with thick lines , and furthermore , the incorporated phase difference films ( ret ) are shown with broken lines . as shown in fig5 , in the conventional semi - transmission type liquid crystal display device , the light shielding film ( bm ) is formed so as to surround one subpixel , but no light shielding film ( bm ) is formed in the border portion between the transmission portion 30 and the reflection portion 31 . in contrast , in the semi - transmission type liquid crystal display device according to the present embodiment , the light shielding film ( bm ) is formed so as to surround one subpixel , and at the same time , the light shielding film ( bm ) is formed in the border portion between the transmission portion 30 and the reflection portion 31 . that is to say , according to the present embodiment , the light shielding film ( bm ) is in a pattern having a portion which only surrounds the reflection portion 31 , and thus , a resist film for an incorporated phase difference film having no gap can be formed , and therefore , the effects of repelling of the film can be reduced while the film is surrounded by the light shielding film ( bm ) even when repelling of the film occurs so that the incorporated phase difference film ( ret ) does not flow out into the transmission portion 30 , and the incorporated phase difference film ( ret ) can be formed inside the reflection portion 31 without fail . here , as shown in fig4 ( b ), it is not necessary to form a light shielding film ( bm ) in the border between the reflection portion 31 and the reflection portion 31 between two subpixels adjacent to each other . here , as shown in fig4 ( b ), it is necessary to surround the reflection portion 31 in the outermost portion . here , as shown in fig6 , the light shielding film ( bm ) may be formed only around the reflection portion 31 . in this case , the amount of transmitted light from the backlight , which is shielded by the light shielding film ( bm ), can be increased , and therefore , it becomes possible to increase the brightness of the liquid crystal display panel . in addition , in the same manner as in fig4 ( b ), it is not necessary to form the light shielding film ( bm ) in the border between the reflection portion 31 and the reflection portion 31 between two subpixels adjacent to each other , as shown in fig6 ( b ). here , as shown in fig6 ( b ), it is necessary to surround the reflection portion 31 in the outermost portion . in addition , the orientation film ( al ) for an incorporated phase difference film may be formed only in the region where the incorporated phase difference film ( ret ) is formed . in addition to the above described effects , it is possible to gain resistance to corrosion of the incorporated phase difference film ( ret ) as well as coloring and decomposing prevention effects of the orientation film through irradiation with uv or duv during the process for exposure to uv or duv when the spacer in columnar form ( spa ) is formed , for example , by using an already existing film , since in the present embodiment , the orientation film ( al ) for orienting an incorporated phase difference film and the incorporated phase difference film ( ret ) are formed after the formation of the light shielding film ( bm ) on the second substrate ( sub 2 ), and top of this , the color filter ( cf ) and the flattened film ( oc ) are formed . as described above , in the present embodiment , the color filter ( cf ) and the flattened film ( oc ) can also be used as a protective transparent resin film for protecting the incorporated phase difference film , and therefore , the protective transparent resin film becomes unnecessary , and furthermore , it is possible to form the incorporated phase difference film ( ret ) without changing the conventional process for patterning through development . in addition , the color filter ( cf ) and the flattened film ( oc ) are formed on top of the incorporated phase difference film ( ret ), and therefore , the flatness of the base on which the step forming layer ( mr ) is formed can be increased , and the control of the film thickness of the step forming layer ( mr ) becomes easy , and thus , it becomes easy to adjust the length of the gap between the transmission portion 30 and the reflection portion 31 . furthermore , a sequence of processes for forming the incorporated phase difference film ( ret ) is arranged after the process for forming the light shielding film ( bm ), and thus , it becomes possible to prevent the yield from lowering due to factors caused in the process , such as the flatness of the base on which the step forming layer ( mr ) is formed and a foreign substance . moreover , the light shielding film ( bm ) is patterned so as to have a portion which surrounds only the reflection portion 31 , and thus , a resist film for an incorporated phase difference film without a gap can be formed so that it becomes possible to reduce the effects of repelling of the film . here , though an embodiment where the present invention is applied to a semi - transmission type liquid crystal display having an ips system is described in the above , the present invention is not limited to this and can be applied to a semi - transmission type liquid crystal display device having an ecb system and a semi - transmission type liquid crystal display device having a va system , for example . in these cases , the facing electrode ( ct ) is formed on the second substrate ( sub 2 ) side instead of on the first substrate ( sub 1 ) side . though the invention made by the present inventor is described concretely on the basis of the above described embodiments , the invention is not limited to the above described embodiments and can , of course , be modified variously within the scope of not deviating from the gist of the invention .	6
for the manipulation of dna , standard methods are used such as are described by maniatis et al . ( 1982 ) in molecular cloning , ( cold spring harbor laboratory , cold spring harbor , n . y . 11724 ). the molecular biological reagents used are employed according to the instructions of the manufacturer . the structural gene of α - glucosidase pi ( fig1 ) from bakers &# 39 ; yeast is constructed via an adaptor ( correct binding between promotor and n - terminus ) and two α - glucosidase - coding dna fragments of the plasmid yrp / glucpi , dsm 4173p ( fig2 ). the 3 ′- untranslated region of the α - glucosidase from yeast is removed up to 25 bp . for this purpose , the plasmid yrp / glucpi is digested with ecori and bcli and the bcli / ecori fragment ( 1 . 7 kb ), as well as the ecori fragment ( about 0 . 3 kb ), isolated . the ecori fragment is post - cleaved with fnudii and the ecori / fnudii fragment ( 0 . 13 kb ) isolated . the vector pkk177 - 3 dsm 3062 , is cleaved with ecori and smai . into the resulting vector fragment ( 2 . 85 kb ) the bcli / ecori fragment the ecori / fnudii fragment , as well as the synthetic dna fragment the desired construction was identified and isolated on 5 - bromo - 4 - chloroindolyl - α - d - glucopyranoside indicator plates α - xgl , 40 mg / liter ) and 1 mm iptg on the basis of low α - glucosidase activity in ed82 - i q . the correct construction of the α - glucpi gene is confirmed by restriction analysis . the plasmid has the designation pkk177 - 3 / glucpi . the host strain ed82 - i q has no α - glucosidase activity under the test conditions . expression of yeast α - glucosidase pi in escherichia coli under standard conditions for the heterologous expression of α - glucosidase pi from yeast , there was used the escherichia coli k - 12 strain ed82 - i q which contains the vector pkk177 - 3 / glucpi . the experiments were carried out in roller cultures ( 20 ml reagent glass with 5 ml of medium ) in lb medium ( maniatis et al ., molecular cloning , cold spring harbor laboratory , 1982 ) with 40mg / liter of ampicillin at 37 ° c . the cultures were inoculated with 50 μl of overnight culture and , upon achieving a cell density of od 550 of from 0 . 5 to 0 . 6 , were induced with 5 mm iptg ( end - concentration ). after 2 to 3 hours 0 , 5 ml culture samples were harvested , the cell pellets washed with 10 mm phosphate buffer ph 6 . 8 and immediately frozen . frozen all pellets were resuspended in 0 . 25 ml 10 mm phosphate buffer ph 6 . 8 with 1 mm edta and disrupted by sonification . after centrifugation soluble active α - glucosidase was assayed in the supernatant in 0 . 1 m phosphate buffer ph 6 . 8 at 25 ° c . with 2mm p - nitrophenyl - α - d - glucopyranoside ( pnpg ) as substrat . for the calculation of spezific activities the protein was estimated according to the micro - biuret method ( zamenhof , methods enzymol . 696 - 704 / 1957 ) with bovine serum albumin as a standard . specific activities are expressed as nanomoles of substrate hydrolyzed per minute per milligram of protein . the β - galactosidase was determined analogously using 2 - nitrophenyl - β - d - galactopyranoside as substrate instead of pnpg . the chromosomally coded β - galactosidase in ed82 - i q served for the control of the course of induction of the lac operon . a ) dependency of the yield of active protein ( α - glucosidase pi and β - galactosidase ) depending upon the period of induction and upon the iptg inducer concentration . working was carried out as described in example 2 , the inducer concentration ( iptg ) and the period of culturing thereby being varied . the results obtained are shown in the following table i . the results show that the specific activity of the β - galactosidase ( internal control ) continuously increases with increasing inducer concentration and increasing period of induction . in contradistinction to β - galactosidase , the specific activity of the β - glucosidase achieves a maximum at a concentration of 0 . 01 mm of iptg . b ) dependency of the yield of active protein ( α - glucosidase and β - galactosidase ) upon the lactose inducer concentration working was carried out as described in example 2 , the inducer concentration ( lactose ) thereby being varied . the results obtained are shown in the following table ii . the results show that the β - galactosidase is fully induced ( internal control ) by a lactose concentration of 2 %. in contradistinction thereto , in the case of the same inducer concentration , the α - glucosidase only achieves a specific activity of 5 % of the maximum achievable specific enzyme activity . dependency of the yield of active protein ( α - glucosidase and β - galactosidase ) on the ph value and upon the concentration of inducer iptg working was carried out as described in example 2 , the ph value at the time of induction being adjusted by the addition of tris - hcl or phosphate buffer ( end concentration 0 . 1 m ) and an inducer concentration of 0 . 01 mm iptg ( table iiia ) and 0 . 5 % lactose ( table iiib ) being used . the results obtained are given in the following tables iiia and iiib . it can be seen that at the ph range optimal for culturing escherichia coli ( 7 . 0 to 7 . 5 ), there is surprisingly obtained the lowest yield of active protein . the optimum ranges are from 4 . 8 to 5 . 6 , as well as from 7 . 5 to 8 . 5 . furthermore , the enzyme activity is increased by a factor of 8 in comparison with the sole induction with lactose ( 0 . 5 %). ( table ii , line 4 , compared with table iiib ), line 5 ). dependency of the yield of active protein ( α - glucosidase and β - galactosidase ) upon the culturing temperature working was carried out as described in example 2 , the temperature and the inducer iptg ( 0 . 01 mm ) and lactose ( 0 . 5 %) being varied . the results are given in the following table iv . the results show that the specific activity of the β - galactosidase ( internal control ) is not influenced by the culturing temperature . surprisingly , however , the specific activity of the α - glucosidase increases in the case of lower culturing temperatures . dependency of the yield of active protein ( α - glucosidase and β - galactosidase ) upon the medium and period of culturing working was carried out as described in example 2 , the medium being varied and 0 . 5 % lactose being used as inducer . the results obtained are shown in the following table v . dependency of the yield of active protein ( α - glucosidase and β - galactosidase ) upon the carbon source for the synthesis of active α - glucosidase , ed 82 - i q with plasmid - coded α - glucosidase was cultured in lb medium or in minimal medium at 37 ° c . up to an od 550 of 0 . 4 to 0 . 6 . thereafter , the culture was cooled ( 20 to 30 ° c . ), induced with lactose ( end concentration 0 . 5 %) and either a carbon source ( end concentration 1 to 2 %; preferably glycerol and / or maltose ) added thereto or the ph value lowered with phosphate buffer ( 0 . 1 m ) to ph 4 . 8 to 5 . 5 and the cells cultured at 20 to 30 ° c . up to a cell density of od 550 of 3 to 5 . the results obtained are given in the following table vii . it will be understood that the specification and examples are illustrative but not limitative of the present invention and that other embodiments within the spirit and scope of the invention will suggest themselves to those skilled in the art . a deposit was made under the terms of the budapest treaty of the following materials with the deutsche sammlung von mikroorganismen , mascheroder weg 1b , 3300 braunschweig , germany . the deposited materials are listed with their accession numbers and submission :	2
the fan blade technology disclosed in u . s . pat . no . 6 , 039 , 541 followed the assumption that all air flow into the fan blades is from a direction that is perpendicular to the plane of rotation for the blades . in addition , it assumed that the airflow is of a constant velocity from the root end to the tip end of the blades as used in aircraft propeller theory . using this assumption the blades were designed with a constant twist rate from root end to tip end . twisting of the blade is done in an attempt to optimize the relative angle of attack of the airflow direction relative to the blade surface . this is done to ensure that the blade is operating at its optimum angle of attack from root end to tip end . this angle changes to accommodate the fact that the tip of the blade moves faster than the root end of the blade diameter . this increase in velocity changes the direction of the relative wind over the blade . again , this assumption has now been found to be invalid for ceiling fans . ceiling fans are air re - circulating devices that do not move through air as an aircraft propeller does . air does not move in the same vector or even velocity over their blades from root end to tip end . fig1 illustrates a ceiling fan that is of conventional construction with the exception of the shape of its blades . the fan is seen to be mounted beneath a ceiling by a downrod that extends from the ceiling to a housing for an electric motor and switch box . here the fan is also seen to have a light kit at its bottom . power is provided to the motor that drives the blades by electrical conductors that extend through the downrod to a source of municipal power . the fan blades are seen to be twisted rather than flat and to have a graduated dihedral . air flow to and from the fan blades is shown by the multiple lines with arrowheads . from these it can be visually appreciated how the fan blades do not encounter an air mass as does an airplane propeller . rather , the restricted space above the blades alters the vectors of air flow into the fan contrary to that of an aircraft . each fan blade is tapered with regard to its width or chord as shown diagrammatically in fig2 . each tapers from base or root end to tip end so as to be narrower at its tip . in addition , each preferably has a dihedral as shown in fig1 although that is not necessary to embody the advantages of the invention . the dihedral is provided for a wider distribution of divergence of air in the space beneath the fan . with continued reference to fig2 and 3 it is seen that the blade is demarked to have three sections although the blade is , of course , of unitary construction . here the 24 - inch long blade has three sections of equal lengths , i . e . 8 inches each . all sections are twisted as is evident in fig1 . however the rate of twist from root to tip is nonuniform . the twist or angle of attack deceases from root end down to 10 ° at the tip end . this decrease , however , which is also apparent in fig1 is at three different rates . in the first 8 - inch section adjacent the root end the change in twist rate is 0 . 4 ° per inch . for the mid section it is 0 . 7 ° per inch . for the third section adjacent the tip it is at a change rate of 1 . 0 ° per inch . of course there is a small transition between each section of negligible significance . thus in fig3 there is an 8 ° difference in angle of attack from one end of the outboard section to its other ( 1 ° per inch × 8 inches ). for the mid section there is about 6 ° difference and for the inboard section about 3 °. fig5 - 7 show one of the blades 10 of the fan of fig1 in greater detail . the blade is seen to have its root end 11 mounted to the fan motor rotor hub 12 with its tip end 13 located distally of the hub . the hub rotates about the axis of the downrod from the ceiling as shown in fig1 which is substantially vertical . as most clearly noted by the blade centerline 15 , the blade has a 0 ° dihedral at its root end 11 and a 10 ° dihedral d t at its tip 13 . the fan blade here is continuously arched or curved from end to end so that its dihedral is continuously changing from end to end . as shown by the air flow distribution broken lines in fig1 this serves to distribute air both directly under the fan as well as in the ambient air space that surrounds this space . conversely , fans of the prior art have mostly directed the air downwardly beneath the fan with air flow in the surrounding space being indirect and weak . though those fans that have had their blades inclined at a fixed dihedral throughout their length have solved this problem , such has been at the expense of diminished air flow directly under the fan . the blade dihedral may increase continuously from end to end . however , it may be constant near its root end and / or near its tip with its arched or curved portion being along its remainder . indeed , the most efficient design , referred to as the gull design , has a 0 ° dihedral from its root end to half way to its tip , and then a continuously increasing dihedral to its tip where it reaches a dihedral of 10 °. in the preferred embodiment shown the blade root end has a 0 ° dihedral and its tip a 10 ° dihedral . however , its root end dihedral may be less than or more than 0 ° and its tip less than or more than 10 °. fan size , power , height and application are all factors that may be considered in selecting specific dihedrals . the fan was tested at the hunter fan company laboratory which is certified by the environmental protection agency , for energy star compliance testing . the fan was tested in accordance with the energy star testing requirements except that air velocity sensors were also installed over the top and close to the fan blades . this allowed for the measurement of air velocity adjacent to the fan blade . during the testing it was determined that the velocity of the air is different at various places on the fan blades from root end to tip end . test parameters are shown in fig4 . the actual test results appear in table 1 . comparative test results appear in table 2 where blade 1 was the new one just described with a 10 ° fixed dihedral , blade 2 was a hampton bay gossomer wind / windward blade of the design taught by u . s . pat . no . 6 , 039 , 541 , and blade 3 was a flat blade with a 15 ° fixed angle of attack . the tabulated improvement was in energy efficiency as previously defined . it thus is seen that a ceiling fan now is provided of substantially higher energy efficiency than those of the prior art and with enhanced flow distribution . the fan may of course be used in other locations such as a table top . although it has been shown and described in its preferred form , it should be understood that other modifications , additions or deletions may be made thereto without departure from the spirit and scope of the invention as set forth in the following claims .	5
fig1 is a perspective view of a first form a - 1 of the modular pad in which it will be seen to include a base board 10 that is illustrated as being rectangular , although other shapes may be used if desired . the base board 10 serves as a mounting for a pair of laterally spaced generally parallel , femoral support blocks 12 and 12 &# 39 ; that are preferably substantially rigid , but may be inflatable . the base board 10 and the pair of femoral support blocks 12 and 12 &# 39 ; may be molded as an integral unit from rubber , fiberglass , thermoplastic resins or the like at the option of the manufacturer . fig2 better illustrates the corrective action exerted by the novel pad , in its basic form equivalent to that shown in fig1 on the pelvis of a person seated with the pad 10 &# 39 ; placed on a seat s underneath a user p . the primed numerals in fig2 correspond or are equivalent to elements indicated by unprimed numerals in fig1 . the support pad has a base board 10 &# 39 ; which is of generally rectangular shape as shown in fig1 analogous to the base board 10 in fig1 . the rear end 26 &# 39 ; of the base board is oriented towards and placed against the back rest b of the seat s , while the front end 22 &# 39 ; of the base board is near the front edge of the seat s . the pad includes a femoral support which is comprised collectively of three cylindrical elements 25 &# 39 ; parallel to each other and attached to the top surface of the base board 10 &# 39 ; transversely to the board , i . e . parallel to the front and rear ends of the board and fully extending between two side edges of the base board . further the three support elements 25 &# 39 ; are near the front end 22 &# 39 ; of the base board , the diameter of the rear most cylinder 25 &# 39 ; terminating at its rear most end at about the mid point of the base board between the front and rear ends of the base board . consequently , a bare 28 &# 39 ; of the base board between the rear most cylinder 25 &# 39 ; and the rear end 26 &# 39 ; is devoid of the femoral support elements . an optional sheet of relatively soft , resilient synthetic foam 27 &# 39 ; covers the rear area 28 &# 39 ; of the base board and also the three cylinders 25 &# 39 ; constituting the femoral support . the three cylinders 25 &# 39 ; together define an elevated support plane which is tangential to the tops of the cylinders and generally parallel to the base board 10 &# 39 ;. the cylinders 25 &# 39 ; are preferably cylindrical inflatable chambers pressurized to a substantial degree of stiffness so as to support the size of the patient p as shown in fig2 , spaced several inches above the top surface of the base board 10 &# 39 ;. the base board 10 &# 39 ; and the support elements 25 &# 39 ; are dimensioned so as to provide a definite and steep transition from the elevated support plane to the top surface 25 &# 39 ; of the base board at a point located just forwardly of the femoral head f of the patient p , as indicated by the vertical dotted line r in fig2 . the femoral head f is a pivot point for the pelvis v , which therefore tends to drop down towards the base board surface 28 &# 39 ;, pivoting about the femoral head f in a counterclockwise direction in fig2 . in an individual who has poor spinal lower back posture , suggested by the parallel dotted lines in fig2 in the lower back area , the rotation of the pelvis effectively repositions the spinal column to a more erect condition shown in solid lining in the drawing . the thick sheet of foam 27 &# 39 ; is selected to provide a degree of comfort for the user p between the buttock and the base board surface 28 &# 39 ;, as well as to fill in the longitudinal voids defined between the cylinders 25 &# 39 ;. it is contemplated that the board 10 &# 39 ; can be cut to a custom dimension for a particular user as well as for particular seat , to maintain proper positioning of the femoral supports 25 &# 39 ; in relation to the users pelvis . alternatively , standard sizes of the base board 10 &# 39 ; in graded sizes , can also be provided . the femoral supports 25 &# 39 ; may be of a variety of materials , so long as firm thigh support results . in the case of inflatable supports 25 &# 39 ;, it is possible to inflate the cylinders to variant degrees so as to elevate the thigh of a particular user to an optimum level above the base board 10 &# 39 ;, so as to achieve optimum pelvic repositioning and lower back posture correction . the supporting pad of fig2 may be reversed on the seat s in the manner already described in connection with the pad of fig1 and as illustrated in fig8 and 9 . specifically , the base board is reversed on the seats so that the front end 22 &# 39 ; is now proximal to the back rest b of the seat , while the rear end 26 &# 39 ; is now at the front of the seat . in such rearrangement , the buttock and pelvis v of the user p are elevated above the seat s and base board 10 &# 39 ;, while the front end of the thigh and knees of the subject are unsupported and thus tend to slope downwardly from the pelvis towards the knees . this causes an opposite displacement of the pelvis v , so that it rotates in a clockwise direction about the femoral head f , bringing about a corresponding repositioning of the spine which may be helpful to certain individuals . the specific posture correction required by a particular subject depends on the individuals anatomy , different people finding relief from back pain in one position of the base board 10 &# 39 ;, while others find relief with the base board in the reverse position on the seat s . the pair of femoral support blocks 12 and 12 &# 39 ; have upper support surfaces 14 and 14 &# 39 ;, and forward and rearward end surfaces 16 , 16 &# 39 ; and 18 , 18 &# 39 ; respectively . the blocks 12 and 12 &# 39 ; have inner side surfaces 20 , 20 &# 39 ; that cooperate to define a longitudinal space 22 therebetween that is situated above the base board 10 , and the pair of blocks also having outer side surfaces 24 , 24 &# 39 ;. in some instances it may be desirable to have the side surfaces 20 , 20 &# 39 ; in abutting contact . the forward end surfaces 16 , 16 &# 39 ; are substantially flush with the forward end of the base board 10 . the rearward end surfaces 18 , 18 &# 39 ; are situated forwardly a substantial distance from the rear edge surface 26 of base board 10 . the base board 10 has an upper surface 28 that extends rearwardly from the pair of blocks 12 , 12 &# 39 ; to the rear edge 26 . a patient p is shown in fig8 and 10 , which patient has a body 30 that includes buttocks 30a and legs 30b . the patient p also has an ischial tuberosity 30c . when the modular pad a - 1 is used as shown in fig8 the height of the side surfaces 12 , 12 &# 39 ; of the blocks is critical , for the blocks must be of sufficient height as to support the buttocks 30a of the patient p above the upper surface 28 of the base board 10 . the length that the upper surface 28 extends rearwardly from the pair of blocks 12 , 12 &# 39 ; is important , for it must be of sufficient magnitude as to provide clearance for the buttocks 30a . in fig9 the patient p is illustrated as resting on the modular pad a - 1 , but with the position of the pad reversed relative to that shown in fig8 to tilt pelvis in opposite direction to that shown in fig8 . in fig1 the form a - 1 of the modular pad is serving as a part of a bed in which the patient lays in a supine position with the buttocks 30a rearwardly of the femoral support blocks 12 , 12 &# 39 ;. in the three positions for the patient p as shown in fig8 and 10 the body 30 of the patient is held in a different pelvic rotation . if desired , the pair of femoral blocks 12 , 12 &# 39 ; may be coated or covered with a soft somewhat resilient sheet material or envelope ( not shown ) that imparts a more desirable feel to the blocks . also , free upper surfaces of the base may support a soft or forgiving material ( not shown ). the second form a - 2 of the invention as shown in fig2 is particularly adapted for use by patients p suffering from emmorhoidal and pirineum stitch problems . the second form a - 2 of the modular pad includes all of the elements of the first form a - 1 but in addition includes a first rectangular or suitable shaped insert 32 mounted on the upper surface 28 of the base board 10 and is centrally disposed thereon and extends rearwardly from the blocks 12 , 12 &# 39 ; and is axially aligned with the space 22 . the second form a - 2 may also include a pair of second inserts 36 that are mounted on the upper surface 28 of the base board 10 and situated on each side of the first insert 32 . only one of the second inserts 36 is shown in fig2 . by varying the height of the first and second inserts 32 and 36 relative to one another the pressure on the anus of the patient p may be controlled . the sides of the insert may be shaped to present a more narrow surface to the anus area to increase and control pressure on the affected site . the upper forward portion of the first insert 32 if desired may be tapered forwardly and downwardly to reduce testicular pressure and perineum pressure on the patient . the inserts 32 and 36 are preferably removably secured to the surface 28 of the base board 10 by &# 34 ; velcro &# 34 ; or other suitable fastening material . it will be apparent that perineum pressure may be relieved completely on the part of the patient p by removal of the first insert 32 from the base board 10 . patients p suffering from enervation , ( lack of feeling ) may be subject to tissue death by excessive pressure being applied over boney prominences while the patient is seated . accordingly this form a - 3 of the modular pad shown in fig3 provides pressure relief over the ischial tuberosities , coccyx , and greater trochanter , as well as by separation , perineal relief , and reduction of shear forces to the skin . in fig3 it will be seen that the third form a - 3 of the invention includes a rectangular base board 40 that has a pair of laterally spaced pair of femoral support blocks 42 , 42 &# 39 ; that may be flexible or rigid mounted on the upper surface of the base board . the pair of blocks 42 , 42 &# 39 ; have flat upper surfaces 44 , 44 &# 39 ; that on the forward edge develop into forwardly and downwardly extending surfaces 46 , 46 &# 39 ;. the pair of blocks 42 , 42 &# 39 ; may be placed in abutting contact . insert 48 of generally rectangular shape is centrally and removably disposed on the upper surface of the base board 40 , preferably by &# 34 ; velcro &# 34 ; or other suitable means , and is illustrated as longitudinally aligned with the space between the pair of support blocks 42 , 42 &# 39 ; and extending upwardly thereabove . the form a - 3 if desired may be an integral unit . a pair of rear inserts 52 , 52 &# 39 ; are fixed or removably secured to the upper surface of the base board 40 by suitable means , with the rear inserts having flat or shaped upper surfaces 54 , 54 &# 39 ;. the forward insert 48 serves as an abduction wedge to keep the legs 30b of the patient p separated . the longitudinally extending space 56 if desired may be filled with graduated or other padding to control the pressure exerted on the patient p when resting on the third form a - 3 of the modular pad . the base board 40 as well as the pair of blocks 42 , 42 &# 39 ;, and the forward insert 48 , as well as the rearward insert 52 , 52 &# 39 ;, may be fabricated from polyethelene , polyurethane neoprene , or other type of somewhat resilient material that will give adequate patient support . it is desirable that the components described in conjunction with the third form a - 3 of the modular support be removably secured to one another , to permit either a modular support a - 3 in standard sizes to be provided or to provide customized modular supports in which the dimensions of the various components of the third form a - 3 are assembled to conform to the physical needs of the patient p . the fourth form of the invention a - 4 as shown in fig4 includes all of the elements common to the first form a - 1 but in addition includes a back support 60 that is preferably pivotally connected to the rearward edge 26 of the base board 10 by suitable hinges of pivotal connections 62 . for convenience , both support and seat may be separate components , however , if modular seat and back are to be used in a fabric support it is possible that the base 40 and 60 are one continuous flexible surface and which all blocks are appropriately attached . in this instance blocks 12 , 12 &# 39 ; and 64 &# 39 ; may be divided into sections to follow curved line of sling seat , base board 10 and 60 . a pair of laterally spaced , upwardly extending , elongate pads 64 and 64 &# 39 ; are fixed or removably secured to the back board 60 , and laterally separated from one another . the pad 64 , 64 &# 39 ; have forwardly disposed supporting surfaces 66 , 66 &# 39 ; that preferably taper rearwardly and inwardly towards one another to maintain the patient p in a centered position when resting on the femoral block 12 , 12 &# 39 ;. a strap 68 is provided as shown in fig4 that is removably connected to the base board 10 and back board 60 , to support the back board in a desired angular relationship to the base board 10 . the pads 64 , 64 &# 39 ;, tend to support the patient p conformably on the fourth form a - 4 of the modular support , and provide relief of boney spine or rotation of the part of the patient at the lumbar area . surfaces 66 and 66 &# 39 ; may be shaped to further support lumbar area of the body if desired or lumbar support may be laterally connected across back board 60 in lieu of either 64 or 64 &# 39 ;. the fourth form a - 4 of the modular support is adapted for use in automobiles , stadiums , in wheel - chairs , sling seat wheel - chairs or standard chairs . if the height of the femoral support blocks 12 , 12 &# 39 ; is too high in the first form a - 1 of the invention for ischial tuberosity pressure relief , a fifth form a - 5 of the invention as shown in fig5 may be utilized . the fifth form a - 5 as may be seen in fig5 includes a second base board 70 of substantially the same width as the base board 10 , but with a cut - out . the second base board 70 supports a block 72 that has a forward transverse edge 74 and a flat upper surface 76 . the block 72 has a rear edge surface 78 from which a centrally disposed cut - out portion 80 extends forwardly . the form a - 5 of the invention has the second base board support 70 replacing the base board 10 , and with the pair of femoral support blocks 12 , 12 &# 39 ; resting and removably secured to the flat upper surface 76 . required thickness of block 72 and support 70 may be such that only one block shaped similarly to 72 is used to replace 10 of fig1 . the second and third forms a - 2 and a - 3 of the modular pad may have a sixth form a - 6 of the invention as shown in fig6 used in conjunction therewith . the sixth form a - 6 of the invention includes a second base board 82 that has a block 84 mounted thereon , with the block having a protuberance 86 projecting from the end edge 88 thereof . this also may be of such thickness as to replace 10 of fig1 . a seventh form a - 7 of the invention is shown in fig7 that is particularly adapted for use in an automobile that has a seat 90 that has a rearwardly and downwardly extending upper surface 92 that forms a part of the seat 90 . the seventh form a - 7 may include form a - 1 through a - 6 , and in addition a wedge shaped body 94 that rests on the upper surface 92 of a reclined seat 90 , with the upper surface 96 of the wedge shaped body 94 being substantially horizontal . the surface 96 has the base board 10 resting thereon , as a result the forms a - 1 through a - 6 of the invention that forms a part of the seventh forms a - 7 are held in a stationary horizontal position . even though the surface 92 of the seat 90 slopes downwardly and rearwardly , when the seventh form a - 7 of the invention is used , the patient p is postured in the same manner as though he was resting on the first form a - 1 , which first form is in a substantially horizontal position . fig1 and 14 illustrate a modified form a &# 39 ;- 3 of the third form a - 3 of the modular pad , and in this modified form the modified form a - 3 includes a pressure sensitive transducer 100 that is preset to close at a specific pressure . the numeral 102 and 104 in fig1 indicate a battery and a visual or audible alarm . the eighth form a - 8 of the invention includes the elements of the third form a - 3 arranged in the same manner as illustrated in fig3 but in addition includes resilient hollow pads 110 mounted on the upper surfaces of the blocks 44 and 44 &# 39 ;. each of the pads has an air inlet to which a flexible tube 112 is connected that has a manually operable valve 114 connected to the outer end thereof . each valve 114 has a resilient bulb 116 connected thereto . the eighth form a - 8 of the invention also includes pressure sensitive switches 100 and a battery 102 and alarm 104 that are operatively associated therewith . when the pressure sensitive switches are contacted by a portion of the patient p , the alarm 104 is actuated , which alarm may be visual or audible . upon the alarm being actuated , the valves 114 are in turn placed in open positions , and the bulbs 116 manually squeezed to further inflate the pads 110 and raise the patient p relative to the base board 40 . when the patient p has been raised to a desired degree relative to the base board 40 , the valves are placed in the closed positions . elevation of the patient p as above described will be to the extent that the alarm 104 is not actuated . in fig1 it will be seen that each pad 110 is formed from a pliable sheet material that has stitching 118 or other fastening means therein that provide a number of transverse , interiorly connected inflatable pockets 120 . in fig1 a pad 110a is shown that is a pliable sheet material that is made with transverse tubes covering the entire top of femoral blocks of previous figures . a smooth surfaced pad 110b with a non inflated middle section is shown in fig1 . in fig1 an inflatable pad 110c is shown , that when inflated has a number of spaced bulbs 124 extending upwardly therefrom . an alternate form a &# 39 ;- 8 of the eighth form a - 8 of the invention is shown in fig2 , that is the same as the latter with the exception it includes a power operated pump 140 to inflate the pads 110 , which pump may be actuated either manually or by completing an electric circuit thereto in conjunction with a power source and the pressure sensitive switches 100 . a ninth form a - 9 of the invention is shown in fig2 and 23 that is the same as the eighth form a - 8 with the exception that is further includes two hollow resilient pads 150 filled with a gel , water or a viscous type of material 152 . the pads 150 rest on the blocks 110 and are removably secured thereto by conventional means . a tenth form a - 10 of the invention is shown in fig2 and 25 that is the same as the third form a - 3 with the exception that a resilient pad 160 that may be hollow and filled with a viscous liquid or gel overlies both the blocks 42 , 42 &# 39 ; and may deform when subjected to the weight of a patient p as illustrated in fig2 . the blocks 42 and 42 &# 39 ; may be of differing height and or different material to correct for pelvic tilt of the patient . the use and operation of the various forms of the invention have been explained previously in detail and need not be repeated .	0

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.