id
stringlengths 16
65
| document
sequence | doc_bio_tags
sequence |
---|---|---|
Breast_Cancer_Res_Treat-4-1-2217623 | [
"Estrogen",
"receptor",
"α",
"polymorphisms",
"and",
"postmenopausal",
"breast",
"cancer",
"risk",
"Background",
"The",
"estrogen",
"receptor",
"alpha",
"-LRB-",
"ESR1",
"-RRB-",
"is",
"a",
"mediator",
"of",
"estrogen",
"response",
"in",
"the",
"breast",
".",
"The",
"most",
"studied",
"variants",
"in",
"this",
"gene",
"are",
"the",
"PvuII",
"and",
"XbaI",
"polymorphisms",
",",
"which",
"have",
"been",
"associated",
"to",
"lower",
"sensitivity",
"to",
"estrogen",
".",
"We",
"evaluated",
"whether",
"these",
"polymorphisms",
"were",
"associated",
"with",
"breast",
"cancer",
"risk",
"by",
"means",
"of",
"an",
"association",
"study",
"in",
"a",
"population",
"of",
"Caucasian",
"postmenopausal",
"women",
"from",
"the",
"Rotterdam",
"study",
"and",
"a",
"meta-analysis",
"of",
"published",
"data",
".",
"Introduction",
"Family",
"history",
"is",
"one",
"of",
"the",
"strongest",
"risk",
"factors",
"for",
"breast",
"cancer",
"-LSB-",
"1",
"-RSB-",
".",
"It",
"has",
"been",
"shown",
"that",
"the",
"heritability",
"of",
"this",
"disease",
"is",
"∼",
"30",
"%",
"-LSB-",
"2",
"-RSB-",
".",
"The",
"most",
"important",
"determinants",
"of",
"risk",
"for",
"breast",
"cancer",
"are",
"related",
"to",
"endogenous",
"hormone",
"levels",
"and",
"major",
"reproductive",
"events",
"-LSB-",
"3",
"-RSB-",
",",
"thus",
",",
"suggesting",
"that",
"genes",
"in",
"the",
"estrogen",
"pathway",
"may",
"influence",
"breast",
"cancer",
"risk",
".",
"The",
"estrogen",
"receptor",
"alpha",
"-LRB-",
"ESR1",
"-RRB-",
"is",
"one",
"of",
"the",
"most",
"important",
"mediators",
"of",
"hormonal",
"response",
"in",
"estrogen-sensitive",
"tissues",
"such",
"as",
"the",
"breast",
"-LSB-",
"4",
"-RSB-",
"and",
"plays",
"a",
"crucial",
"role",
"in",
"breast",
"growth",
"and",
"differentiation",
"as",
"well",
"as",
"in",
"the",
"development",
"of",
"cancer",
"-LSB-",
"5",
"-RSB-",
".",
"The",
"human",
"ESR1",
"gene",
"is",
"localized",
"on",
"chromosome",
"6q24-q27",
"-LSB-",
"6",
"-RSB-",
",",
"it",
"extends",
"more",
"than",
"140",
"kb",
"and",
"includes",
"eight",
"exons",
"-LSB-",
"7",
"-RSB-",
".",
"The",
"most",
"studied",
"variants",
"in",
"this",
"gene",
"are",
"the",
"PvuII",
"-LRB-",
"C/T",
"-RRB-",
"and",
"XbaI",
"-LRB-",
"G/A",
"-RRB-",
"polymorphisms",
"in",
"intron",
"1",
",",
"397",
"and",
"351",
"bp",
"upstream",
"of",
"exon",
"2",
"respectively",
"-LSB-",
"8",
",",
"9",
"-RSB-",
".",
"These",
"variants",
"have",
"been",
"implicated",
"in",
"gene",
"expression",
"by",
"influencing",
"transcription",
"-LSB-",
"10",
"-RSB-",
".",
"While",
"some",
"studies",
"have",
"found",
"an",
"increased",
"risk",
"for",
"the",
"A",
"and",
"T",
"alleles",
"of",
"the",
"XbaI",
"and",
"PvuII",
"polymorphisms",
"-LSB-",
"4",
",",
"9",
",",
"10",
"-RSB-",
",",
"others",
"have",
"found",
"an",
"increased",
"risk",
"only",
"for",
"the",
"X",
"-LRB-",
"G",
"-RRB-",
"allele",
"of",
"XbaI",
"-LSB-",
"11",
",",
"12",
"-RSB-",
".",
"In",
"addition",
",",
"other",
"studies",
"found",
"no",
"effect",
"at",
"all",
"for",
"either",
"of",
"these",
"polymorphisms",
"-LSB-",
"4",
",",
"13",
"-RSB-",
".",
"These",
"alleles",
"were",
"correlated",
"with",
"high",
"bone",
"mineral",
"density",
"and",
"height",
"in",
"other",
"studies",
",",
"including",
"one",
"performed",
"in",
"our",
"study",
"population",
",",
"-LSB-",
"14",
",",
"15",
"-RSB-",
",",
"suggesting",
"a",
"stronger",
"estrogenic",
"effect",
"in",
"P",
"-LRB-",
"C",
"-RRB-",
"and",
"X",
"-LRB-",
"G",
"-RRB-",
"allele",
"carriers",
"-LSB-",
"14",
"-RSB-",
".",
"The",
"aim",
"of",
"our",
"study",
"was",
"to",
"evaluate",
"the",
"effect",
"of",
"these",
"polymorphisms",
"on",
"breast",
"cancer",
"risk",
"by",
"performing",
"an",
"association",
"analysis",
"in",
"a",
"population",
"based",
"study",
"of",
"Caucasian",
"postmenopausal",
"women",
".",
"Further",
",",
"we",
"performed",
"meta-analyses",
"of",
"all",
"available",
"published",
"data",
"on",
"these",
"polymorphisms",
"and",
"the",
"risk",
"of",
"breast",
"cancer",
".",
"Materials",
"and",
"methods",
"Study",
"population",
"and",
"measurements",
"Our",
"study",
"population",
"is",
"part",
"of",
"the",
"Rotterdam",
"study",
"-LSB-",
"16",
"-RSB-",
".",
"Inhabitants",
"of",
"the",
"suburb",
"of",
"Ommoord",
"aged",
"55",
"or",
"older",
"were",
"invited",
"to",
"participate",
"and",
"7983",
"agreed",
"to",
"do",
"so",
"-LRB-",
"response",
"rate",
"78.1",
"%",
"-RRB-",
".",
"Study",
"participants",
"signed",
"an",
"informed",
"consent",
"and",
"the",
"Medical",
"Ethics",
"Committee",
"of",
"the",
"Erasmus",
"Medical",
"Center",
"approved",
"the",
"study",
".",
"Our",
"study",
"group",
"was",
"composed",
"of",
"4,878",
"postmenopausal",
"women",
".",
"Information",
"on",
"risk",
"factors",
"such",
"as",
"age",
"at",
"entry",
",",
"age",
"at",
"menarche",
",",
"age",
"at",
"menopause",
",",
"parity",
",",
"body",
"mass",
"index",
"-LRB-",
"BMI",
"-RRB-",
",",
"waist",
"hip",
"ratio",
"-LRB-",
"WHR",
"-RRB-",
"and",
"hormone",
"replacement",
"therapy",
"use",
"-LRB-",
"HRT",
"-RRB-",
"was",
"retrieved",
"at",
"baseline",
"through",
"a",
"questionnaire",
".",
"BMI",
"was",
"calculated",
"by",
"dividing",
"the",
"weight",
"in",
"kilograms",
"by",
"the",
"height",
"-LRB-",
"in",
"meters",
"-RRB-",
"squared",
"-LSB-",
"17",
"-RSB-",
".",
"Case",
"identification",
"and",
"validation",
"Three",
"different",
"databases",
"were",
"used",
"for",
"patient",
"identification",
".",
"First",
",",
"cases",
"diagnosed",
"by",
"general",
"practitioners",
"in",
"the",
"research",
"area",
"-LRB-",
"Ommoord",
"-RRB-",
"were",
"collected",
"-LRB-",
"International",
"Classification",
"of",
"Primary",
"Care",
"-LRB-",
"code",
"X76",
"-RRB-",
"-RRB-",
".",
"Second",
",",
"the",
"Dutch",
"National",
"Registry",
"of",
"all",
"hospital",
"admissions",
"-LRB-",
"LMR",
"-RRB-",
"was",
"consulted",
"to",
"detect",
"all",
"malignancy",
"related",
"hospital",
"admissions",
"for",
"study",
"participants",
".",
"Finally",
",",
"regional",
"pathology",
"databases",
"were",
"linked",
"to",
"the",
"Rotterdam",
"Study",
"to",
"identify",
"patients",
".",
"Subsequently",
",",
"breast",
"cancer",
"cases",
"were",
"validated",
"by",
"a",
"physician",
"on",
"the",
"basis",
"of",
"medical",
"records",
"of",
"the",
"general",
"practitioner",
",",
"discharge",
"letters",
"and",
"pathology",
"reports",
".",
"Only",
"pathologically",
"confirmed",
"cases",
"were",
"considered",
"in",
"the",
"analysis",
".",
"The",
"index",
"date",
"was",
"defined",
"as",
"the",
"earliest",
"date",
"found",
"in",
"the",
"pathology",
"report",
".",
"Genotyping",
"&",
"data",
"analysis",
"Out",
"of",
"the",
"4,878",
"women",
"participating",
"in",
"our",
"study",
",",
"3,893",
"-LRB-",
"80",
"%",
"-RRB-",
"were",
"successfully",
"genotyped",
"for",
"the",
"PvuII",
"and",
"XbaI",
"polymorphisms",
".",
"The",
"genotyping",
"procedures",
"have",
"been",
"described",
"previously",
"-LSB-",
"14",
"-RSB-",
".",
"Loss",
"to",
"follow",
"up",
"was",
"assessed",
"to",
"verify",
"it",
"was",
"independent",
"of",
"genotype",
".",
"Categorical",
"variables",
",",
"such",
"as",
"parity",
"and",
"HRT",
",",
"were",
"compared",
"between",
"genotype",
"groups",
"using",
"the",
"chi-squared",
"test",
".",
"Continuous",
"variables",
",",
"-LRB-",
"age",
"at",
"entry",
",",
"age",
"at",
"menopause",
",",
"BMI",
"and",
"WHR",
"-RRB-",
"were",
"compared",
"using",
"the",
"independent",
"sample",
"Mann",
"--",
"Whitney",
"test",
".",
"We",
"used",
"logistic",
"regression",
"to",
"study",
"the",
"risk",
"of",
"breast",
"cancer",
"by",
"ESR1",
"genotype",
".",
"This",
"analysis",
"was",
"performed",
"using",
"SPSS",
"version",
"11",
",",
"since",
"there",
"is",
"no",
"clear",
"risk",
"allele",
"from",
"the",
"literature",
",",
"we",
"took",
"the",
"TT",
"-LRB-",
"PvuII",
"-RRB-",
"and",
"AA",
"-LRB-",
"XbaI",
"-RRB-",
"genotypes",
"as",
"reference",
"because",
"they",
"have",
"been",
"associated",
"to",
"lower",
"sensitivity",
"to",
"estrogen",
"in",
"our",
"population",
"-LSB-",
"14",
"-RSB-",
".",
"We",
"also",
"performed",
"a",
"trend",
"test",
"to",
"evaluate",
"if",
"the",
"number",
"of",
"risk",
"alleles",
"carried",
"had",
"an",
"effect",
"on",
"disease",
"risk",
".",
"Hardy-Weinberg",
"equilibrium",
"-LRB-",
"HWE",
"-RRB-",
"was",
"assessed",
"for",
"both",
"polymorphisms",
"using",
"Markov-Chain",
"Monte-Carlo",
"approximation",
"of",
"the",
"exact",
"test",
"implemented",
"in",
"the",
"GENEPOP",
"package",
"V",
"3.3",
"-LSB-",
"18",
"-RSB-",
".",
"Meta-analysis",
"We",
"searched",
"PubMed",
"until",
"October",
"2006",
"for",
"all",
"case-control",
"studies",
"on",
"the",
"association",
"of",
"the",
"PvuII",
"and",
"XbaI",
"polymorphisms",
"in",
"the",
"ESR1",
"gene",
"and",
"breast",
"cancer",
".",
"Our",
"search",
"strategy",
"was",
"based",
"on",
"the",
"keyword",
"``",
"breast",
"cancer",
"''",
"combined",
"with",
"``",
"estrogen",
"receptor",
"''",
"and",
"``",
"polymorphism",
"''",
".",
"To",
"verify",
"that",
"all",
"studies",
"were",
"retrieved",
",",
"the",
"reference",
"lists",
"of",
"all",
"publications",
"were",
"searched",
"for",
"additional",
"studies",
".",
"We",
"excluded",
"studies",
"from",
"our",
"analyses",
"if",
"the",
"genotype",
"frequencies",
"in",
"the",
"control",
"population",
"were",
"out",
"of",
"Hardy-Weinberg",
"or",
"if",
"their",
"data",
"had",
"been",
"previously",
"used",
"in",
"another",
"study",
".",
"To",
"quantify",
"the",
"strength",
"of",
"association",
",",
"pooled",
"odds",
"ratios",
"-LRB-",
"ORs",
"-RRB-",
"and",
"95",
"%",
"confidence",
"intervals",
"-LRB-",
"CI",
"-RRB-",
"were",
"calculated",
"using",
"the",
"random-effects",
"model",
"of",
"the",
"DerSimonian",
"and",
"Laird",
"method",
"-LSB-",
"19",
"-RSB-",
".",
"The",
"degree",
"of",
"heterogeneity",
"between",
"the",
"study",
"results",
"was",
"tested",
"by",
"the",
"inconsistency",
"statistic",
"-LRB-",
"I2",
"-RRB-",
".",
"Funnel",
"plots",
"were",
"used",
"to",
"evaluate",
"publication",
"bias",
"-LSB-",
"20",
"-RSB-",
".",
"Data",
"were",
"analysed",
"using",
"Review",
"Manager",
",",
"version",
"4.2",
"-LRB-",
"Cochrane",
"Collaboration",
",",
"Oxford",
",",
"UK",
"-RRB-",
".",
"Results",
"The",
"total",
"loss",
"of",
"follow-up",
"for",
"the",
"genotyped",
"participants",
"was",
"8.4",
"%",
"and",
"it",
"was",
"not",
"dependent",
"on",
"ESR1",
"genotype",
"-LRB-",
"P",
"=",
"0.51",
"-RRB-",
".",
"The",
"genotype",
"frequencies",
"of",
"both",
"polymorphisms",
"were",
"in",
"HWE",
"proportions",
"-LRB-",
"X2",
"P",
"=",
"0.33",
"for",
"PvuII",
"and",
"X2P",
"=",
"0.31",
"for",
"XbaI",
"-RRB-",
".",
"In",
"Table",
"1",
"we",
"show",
"the",
"baseline",
"characteristics",
"of",
"our",
"study",
"population",
".",
"We",
"found",
"that",
"all",
"cases",
"-LRB-",
"incident",
"and",
"prevalent",
"-RRB-",
"were",
"significantly",
"younger",
"at",
"entry",
"than",
"controls",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
"and",
"also",
"died",
"earlier",
"during",
"follow-up",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
",",
"when",
"using",
"incident",
"cases",
"only",
"we",
"found",
"the",
"same",
"significant",
"differences",
"-LRB-",
"P",
"for",
"age",
"at",
"entry",
"<",
"0.0001",
",",
"P",
"for",
"age",
"at",
"death",
"<",
"0.0001",
"-RRB-",
".",
"We",
"also",
"found",
"that",
"cases",
"had",
"significantly",
"fewer",
"children",
"than",
"controls",
"-LRB-",
"P",
"=",
"0.04",
"-RRB-",
".",
"We",
"did",
"not",
"find",
"any",
"significant",
"differences",
"in",
"these",
"baseline",
"characteristics",
"between",
"genotype",
"groups",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Table",
"1General",
"characteristics",
"of",
"the",
"study",
"populationCasesControlsTotalTotal",
"studied",
"-LRB-",
"%",
"-RRB-",
"190",
"-LRB-",
"4.7",
"%",
"-RRB-",
"3513",
"-LRB-",
"95.3",
"-RRB-",
"3703Mean",
"age",
"of",
"entry",
"-LRB-",
"SD",
"-RRB-",
"*",
"67.80",
"-LRB-",
"7.7",
"-RRB-",
"70.36",
"-LRB-",
"9.6",
"-RRB-",
"70.24",
"-LRB-",
"9.6",
"-RRB-",
"Mean",
"age",
"at",
"death",
"-LRB-",
"SD",
"-RRB-",
"*",
"77.30",
"-LRB-",
"8.6",
"-RRB-",
"84.46",
"-LRB-",
"8.7",
"-RRB-",
"84.12",
"-LRB-",
"8.8",
"-RRB-",
"Mean",
"age",
"at",
"menarche",
"-LRB-",
"SD",
"-RRB-",
"13.57",
"-LRB-",
"1.7",
"-RRB-",
"13.68",
"-LRB-",
"1.8",
"-RRB-",
"13.67",
"-LRB-",
"1.8",
"-RRB-",
"Mean",
"age",
"at",
"menopause",
"-LRB-",
"SD",
"-RRB-",
"*",
"49.51",
"-LRB-",
"4.8",
"-RRB-",
"52.19",
"-LRB-",
"13.6",
"-RRB-",
"52.07",
"-LRB-",
"13.3",
"-RRB-",
"Mean",
"number",
"of",
"children",
"-LRB-",
"SD",
"-RRB-",
"*",
"1.77",
"-LRB-",
"1.6",
"-RRB-",
"2.12",
"-LRB-",
"1.7",
"-RRB-",
"2.10",
"-LRB-",
"1.7",
"-RRB-",
"Parity",
"-LRB-",
"SD",
"-RRB-",
"-LRB-",
"≥",
"1",
"child",
"-RRB-",
"*",
"121",
"-LRB-",
"71.6",
"-RRB-",
"2640",
"-LRB-",
"79.4",
"-RRB-",
"2761",
"-LRB-",
"79",
"-RRB-",
"Hormone",
"replacement",
"therapy",
"-LRB-",
"%",
"-RRB-",
"27",
"-LRB-",
"21.1",
"-RRB-",
"504",
"-LRB-",
"19.5",
"-RRB-",
"531",
"-LRB-",
"19.6",
"-RRB-",
"Mean",
"BMI",
"-LRB-",
"SD",
"-RRB-",
"27.10",
"-LRB-",
"3.9",
"-RRB-",
"26.67",
"-LRB-",
"4.1",
"-RRB-",
"26.69",
"-LRB-",
"4.1",
"-RRB-",
"Mean",
"WHR",
"-LRB-",
"SD",
"-RRB-",
"0.87",
"-LRB-",
".09",
"-RRB-",
"0.87",
"-LRB-",
".09",
"-RRB-",
"0.87",
"-LRB-",
".09",
"-RRB-",
"*",
"P-value",
"<",
"0.05",
"There",
"were",
"38",
"women",
"with",
"previously",
"diagnosed",
"postmenopausal",
"breast",
"cancer",
"who",
"entered",
"the",
"study",
".",
"During",
"follow-up",
",",
"152",
"were",
"additionally",
"diagnosed",
".",
"There",
"were",
"no",
"significant",
"differences",
"in",
"the",
"number",
"of",
"cases",
"between",
"the",
"PvuII",
"-LRB-",
"P",
"=",
"0.43",
"for",
"overall",
"cases",
"-RRB-",
"and",
"XbaI",
"genotypes",
"-LRB-",
"P",
"=",
"0.33",
"for",
"overall",
"cases",
"-RRB-",
".",
"We",
"carried",
"out",
"a",
"logistic",
"regression",
"analysis",
"adjusting",
"for",
"age",
"at",
"entry",
",",
"age",
"at",
"menopause",
",",
"BMI",
",",
"WHR",
"and",
"HRT",
"for",
"both",
"polymorphisms",
"separately",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"Since",
"the",
"T",
"and",
"A",
"alleles",
"of",
"these",
"polymorphisms",
"have",
"been",
"correlated",
"to",
"lower",
"estrogenic",
"effects",
",",
"we",
"used",
"the",
"TT",
"and",
"AA",
"genotypes",
"as",
"our",
"reference",
"categories",
"in",
"the",
"analyses",
".",
"There",
"were",
"no",
"significant",
"differences",
"in",
"risk",
"for",
"breast",
"cancer",
"among",
"carriers",
"of",
"the",
"different",
"genotypes",
"of",
"the",
"PvuII",
"or",
"XbaI",
"polymorphisms",
"in",
"the",
"ESR1",
"gene",
".",
"There",
"was",
"a",
"non-significant",
"tendency",
"of",
"the",
"C",
"allele",
"of",
"PvuII",
"-LRB-",
"P-for",
"trend",
"=",
"0.22",
"-RRB-",
"and",
"G",
"allele",
"of",
"the",
"XbaI",
"-LRB-",
"P-for",
"trend",
"0.26",
"-RRB-",
"to",
"be",
"over",
"represented",
"in",
"patients",
".",
"Table",
"2Odds",
"ratios",
"for",
"breast",
"cancer",
"risk",
"for",
"PvuII",
"and",
"XbaI",
"genotypesOverallIncidentPrevalentPvuIITTRefRefRefTC0",
".9",
"-LRB-",
"0.6",
"--",
"1.4",
"-RRB-",
"1.0",
"-LRB-",
"0.6",
"--",
"1.6",
"-RRB-",
"0.8",
"-LRB-",
"0.3",
"--",
"2.1",
"-RRB-",
"CC1",
".4",
"-LRB-",
"0.8",
"--",
"2.2",
"-RRB-",
"1.4",
"-LRB-",
"0.8",
"--",
"2.5",
"-RRB-",
"1.2",
"-LRB-",
"0.4",
"--",
"3.3",
"-RRB-",
"XbaIAARefRefRefGA1",
".2",
"-LRB-",
"0.8",
"--",
"1.7",
"-RRB-",
"1.3",
"-LRB-",
"0.8",
"--",
"2.0",
"-RRB-",
"0.8",
"-LRB-",
"0.4",
"--",
"1.9",
"-RRB-",
"GG1",
".3",
"-LRB-",
"0.7",
"--",
"2.2",
"-RRB-",
"1.5",
"-LRB-",
"0.8",
"--",
"2.8",
"-RRB-",
"0.5",
"-LRB-",
"0.2",
"--",
"2.4",
"-RRB-",
"To",
"evaluate",
"our",
"data",
"together",
"with",
"those",
"in",
"the",
"literature",
"we",
"performed",
"meta-analyses",
".",
"We",
"identified",
"nine",
"articles",
"studying",
"the",
"relation",
"between",
"XbaI",
"and",
"PvuII",
"polymorphisms",
"and",
"the",
"risk",
"of",
"breast",
"cancer",
"-LSB-",
"4",
",",
"9",
"--",
"12",
",",
"21",
"--",
"24",
"-RSB-",
".",
"We",
"excluded",
"from",
"our",
"analyses",
"one",
"study",
"-LSB-",
"11",
"-RSB-",
",",
"since",
"the",
"data",
"was",
"used",
"in",
"another",
"study",
"-LSB-",
"4",
"-RSB-",
".",
"Furthermore",
",",
"two",
"studies",
"were",
"excluded",
"since",
"genotype",
"frequencies",
"of",
"controls",
"were",
"out",
"of",
"HWE",
"proportions",
"-LSB-",
"9",
",",
"10",
"-RSB-",
".",
"Using",
"the",
"random",
"effects",
"model",
"we",
"did",
"not",
"find",
"any",
"difference",
"in",
"risk",
"among",
"XbaI",
"and",
"PvuII",
"genotypes",
"-LRB-",
"Figs.",
"1",
"and",
"2",
"-RRB-",
".",
"High",
"inter-study",
"heterogeneity",
"can",
"render",
"the",
"interpretation",
"of",
"the",
"results",
"of",
"a",
"meta-analysis",
"difficult",
"and",
"although",
"we",
"found",
"high",
"heterogeneity",
"in",
"the",
"G/A",
"versus",
"GG",
"comparison",
"there",
"was",
"no",
"significant",
"heterogeneity",
"in",
"the",
"other",
"three",
"comparisons",
".",
"Additionally",
",",
"the",
"evaluation",
"of",
"the",
"funnel",
"plots",
"did",
"not",
"suggest",
"evidence",
"for",
"publication",
"bias",
".",
"Fig.",
"1Meta-Analyses",
"ESR1",
"XbaI",
"polymorphism",
"and",
"breast",
"cancer",
"riskFig",
".",
"2Meta",
"Analysis",
"ESR1",
"PvuII",
"polymorphism",
"and",
"breast",
"cancer",
"risk",
"Discussion",
"We",
"performed",
"an",
"association",
"study",
"to",
"evaluate",
"the",
"relationship",
"of",
"two",
"well-studied",
"polymorphisms",
"in",
"the",
"ESR1",
"gene",
"and",
"the",
"risk",
"of",
"breast",
"cancer",
"in",
"Caucasian",
"postmenopausal",
"women",
"from",
"the",
"Rotterdam",
"Study",
".",
"Using",
"logistic",
"regression",
"analysis",
",",
"we",
"found",
"no",
"evidence",
"of",
"effect",
",",
"with",
"only",
"a",
"non-significant",
"increase",
"in",
"breast",
"cancer",
"risk",
"for",
"AA",
"carriers",
"of",
"the",
"XbaI",
"polymorphism",
"-LRB-",
"overall",
"OR",
"=",
"1.3",
",",
"95",
"%",
"CI",
"=",
"0.7",
"--",
"2.2",
"-RRB-",
"and",
"for",
"TT",
"carriers",
"of",
"the",
"PvuII",
"variant",
"-LRB-",
"overall",
"OR",
"=",
"1.4",
",",
"95",
"%",
"CI",
"=",
"0.8",
"--",
"2.2",
"-RRB-",
".",
"Additionally",
"we",
"performed",
"meta-analyses",
"of",
"published",
"data",
"to",
"examine",
"the",
"effect",
"of",
"both",
"polymorphisms",
".",
"These",
"meta-analyses",
"also",
"suggest",
"there",
"are",
"no",
"differences",
"in",
"risk",
"among",
"genotype",
"groups",
"of",
"these",
"two",
"ESR1",
"variants",
".",
"The",
"XbaI",
"and",
"PvuII",
"polymorphisms",
"are",
"situated",
"in",
"intron",
"1",
"and",
"their",
"functionality",
"has",
"not",
"yet",
"been",
"demonstrated",
".",
"Moreover",
",",
"it",
"has",
"been",
"suggested",
"their",
"effects",
"could",
"be",
"the",
"result",
"of",
"high",
"linkage",
"disequilibrium",
"with",
"functional",
"variants",
"that",
"affect",
"sensitivity",
"to",
"estrogen",
"-LSB-",
"13",
"-RSB-",
".",
"One",
"of",
"the",
"limitations",
"of",
"our",
"study",
"is",
"the",
"limited",
"number",
"of",
"breast",
"cancer",
"cases",
"present",
"in",
"our",
"population",
".",
"Nevertheless",
",",
"we",
"have",
"sufficient",
"power",
"-LRB-",
"β",
"=",
"0.8",
"-RRB-",
"to",
"detect",
"effects",
"of",
"1.6",
"or",
"higher",
".",
"We",
"further",
"conducted",
"meta-analyses",
"off",
"all",
"studies",
"conducted",
"to",
"date",
".",
"Our",
"data",
"suggests",
"that",
"these",
"two",
"polymorphisms",
"do",
"not",
"play",
"a",
"role",
"in",
"the",
"susceptibility",
"of",
"breast",
"cancer",
"in",
"elderly",
"Caucasian",
"women",
"."
] | [
"B",
"I",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O"
] |
Crit_Care-8-6-1065076 | [
"Tight",
"blood",
"glucose",
"control",
":",
"a",
"recommendation",
"applicable",
"to",
"any",
"critically",
"ill",
"patient",
"?",
"The",
"issue",
"of",
"tight",
"glucose",
"control",
"with",
"intensive",
"insulin",
"therapy",
"in",
"critically",
"ill",
"patients",
"remains",
"controversial",
".",
"Although",
"compelling",
"evidence",
"supports",
"this",
"strategy",
"in",
"postoperative",
"patients",
"who",
"have",
"undergone",
"cardiac",
"surgery",
",",
"the",
"use",
"of",
"tight",
"glucose",
"control",
"has",
"been",
"challenged",
"in",
"other",
"situations",
",",
"including",
"in",
"medical",
"critically",
"ill",
"patients",
"and",
"in",
"those",
"who",
"have",
"undergone",
"non-cardiac",
"surgery",
".",
"Similarly",
",",
"the",
"mechanisms",
"that",
"underlie",
"the",
"effects",
"of",
"high-dose",
"insulin",
"are",
"not",
"fully",
"elucidated",
".",
"These",
"arguments",
"emphasize",
"the",
"need",
"to",
"study",
"the",
"effects",
"of",
"tight",
"glucose",
"control",
"in",
"a",
"large",
"heterogeneous",
"cohort",
"of",
"intensive",
"care",
"unit",
"patients",
".",
"Until",
"the",
"end",
"of",
"the",
"past",
"millenium",
",",
"relatively",
"little",
"attention",
"was",
"given",
"to",
"control",
"of",
"blood",
"sugar",
"levels",
".",
"In",
"critically",
"ill",
"patients",
",",
"hyperglycaemia",
"was",
"considered",
"to",
"be",
"physiological",
"because",
"it",
"results",
"from",
"the",
"metabolic",
"and",
"hormonal",
"changes",
"that",
"accompany",
"the",
"stress",
"response",
"to",
"injury",
".",
"In",
"most",
"intensive",
"care",
"units",
"-LRB-",
"ICUs",
"-RRB-",
",",
"blood",
"sugar",
"was",
"checked",
"every",
"4",
"--",
"6",
"hours",
"and",
"hyperglycaemia",
"-LRB-",
"defined",
"as",
"blood",
"sugar",
"levels",
">",
"10",
"--",
"12",
"mmol/l",
"-LSB-",
"180",
"--",
"216",
"mg/dl",
"-RSB-",
"-RRB-",
"was",
"corrected",
"by",
"subcutaneous",
"or",
"intravenous",
"insulin",
".",
"The",
"presence",
"of",
"pre-existing",
"diabetes",
"mellitus",
"or",
"post-neurosurgical",
"status",
"often",
"prompted",
"more",
"intense",
"control",
"of",
"hyperglycaemia",
".",
"Furthermore",
",",
"the",
"issue",
"of",
"glucose",
"control",
"was",
"discussed",
"in",
"few",
"sessions",
"or",
"satellite",
"symposia",
"during",
"intensive",
"care",
"meetings",
".",
"The",
"deleterious",
"effects",
"of",
"hyperglycaemia",
"during",
"critical",
"illness",
"have",
"been",
"characterized",
"over",
"the",
"past",
"few",
"years",
",",
"and",
"include",
"an",
"increased",
"susceptibility",
"to",
"infections",
"and",
"thromboses",
",",
"macrovascular",
"and",
"microvascular",
"changes",
",",
"and",
"delayed",
"wound",
"healing",
",",
"among",
"other",
"effects",
"-LRB-",
"for",
"review",
"-LSB-",
"1",
"-RSB-",
"-RRB-",
".",
"Renewed",
"interest",
"in",
"control",
"of",
"hyperglycaemia",
"in",
"critically",
"ill",
"patients",
"-LRB-",
"Fig.",
"1",
"-RRB-",
"followed",
"the",
"publication",
"of",
"a",
"study",
"conducted",
"by",
"Van",
"den",
"Berghe",
"and",
"coworkers",
"in",
"2001",
"-LSB-",
"2",
"-RSB-",
".",
"Those",
"investigators",
"reported",
"a",
"43",
"%",
"decrease",
"in",
"relative",
"intensive",
"care",
"mortality",
"as",
"well",
"as",
"consistent",
"decreases",
"in",
"several",
"surrogate",
"markers",
"of",
"disease",
"severity",
"in",
"patients",
"randomly",
"assigned",
"to",
"tight",
"glucose",
"control",
"by",
"intensive",
"intravenous",
"insulin",
"therapy",
".",
"A",
"post",
"hoc",
"multivariate",
"logistic",
"regression",
"analysis",
"of",
"these",
"data",
"suggested",
"that",
"control",
"of",
"hyperglycaemia",
"played",
"a",
"more",
"important",
"role",
"than",
"did",
"the",
"amount",
"of",
"insulin",
"administered",
"-LSB-",
"3",
"-RSB-",
".",
"Interestingly",
"enough",
",",
"at",
"least",
"two",
"recent",
"retrospective",
",",
"large-scale",
"studies",
"-LSB-",
"4,5",
"-RSB-",
"confirmed",
"that",
"outcome",
"was",
"improved",
"in",
"patients",
"whose",
"average",
"blood",
"glucose",
"was",
"maintained",
"below",
"8",
"mmol/l",
"-LRB-",
"144",
"mg/dl",
";",
"Table",
"1",
"-RRB-",
".",
"Although",
"the",
"findings",
"reported",
"by",
"Van",
"den",
"Berghe",
"and",
"coworkers",
"are",
"impressive",
",",
"some",
"concern",
"arose",
"regarding",
"the",
"applicability",
"of",
"these",
"results",
"to",
"other",
"types",
"of",
"patients",
".",
"Of",
"the",
"patients",
"studied",
",",
"63",
"%",
"were",
"admitted",
"for",
"follow",
"up",
"after",
"cardiac",
"surgery",
";",
"this",
"high",
"proportion",
"was",
"felt",
"to",
"be",
"consistent",
"with",
"a",
"particular",
"benefit",
"from",
"tight",
"glucose",
"control",
"with",
"intensive",
"insulin",
"in",
"these",
"patients",
",",
"but",
"there",
"is",
"uncertainty",
"regarding",
"whether",
"tight",
"glucose",
"control",
"is",
"beneficial",
"in",
"patients",
"who",
"have",
"not",
"undergone",
"cardiac",
"surgery",
".",
"Fear",
"of",
"life-threatening",
"hypoglycaemia",
"and",
"increased",
"workload",
"and",
"costs",
"probably",
"underlie",
"the",
"reluctance",
"of",
"many",
"intensivists",
"to",
"launch",
"systematic",
"protocols",
"of",
"tight",
"glucose",
"control",
".",
"Indeed",
",",
"many",
"intensivists",
"still",
"use",
"a",
"high",
"glucose",
"threshold",
"-LRB-",
"10",
"mmol/l",
"-LSB-",
"180",
"mg/dl",
"-RSB-",
"-RRB-",
"-LSB-",
"6",
"-RSB-",
".",
"In",
"a",
"European",
"survey",
"-LRB-",
"unpublished",
"data",
"-RRB-",
"we",
"found",
"considerable",
"variation",
"in",
"the",
"glycaemic",
"thresholds",
"employed",
"in",
"ICUs",
",",
"which",
"ranged",
"from",
"6",
"to",
"11.1",
"mmol/l",
"-LRB-",
"108",
"--",
"200",
"mg/dl",
"-RRB-",
".",
"Some",
"arguments",
"against",
"generalized",
"use",
"of",
"tight",
"glucose",
"control",
"are",
"reported",
"in",
"the",
"present",
"issue",
"of",
"Critical",
"Care",
"by",
"Vriesendorp",
"and",
"coworkers",
"-LSB-",
"7",
"-RSB-",
".",
"In",
"a",
"retrospective",
"study",
"performed",
"at",
"one",
"centre",
"in",
"Amsterdam",
",",
"those",
"authors",
"found",
"that",
",",
"after",
"oesophageal",
"surgery",
"in",
"patients",
"without",
"significant",
"cardiovascular",
"compromise",
"-LRB-",
"ASA",
"class",
"I",
"--",
"II",
"-RRB-",
",",
"postoperative",
"hyperglycaemia",
"was",
"not",
"a",
"risk",
"factor",
"for",
"infectious",
"complications",
".",
"Only",
"by",
"univariate",
"analysis",
"were",
"they",
"able",
"to",
"find",
"an",
"improvement",
"in",
"patients",
"with",
"blood",
"glucose",
"levels",
"below",
"9.3",
"mmol/l",
"-LRB-",
"167",
"mg/dl",
"-RRB-",
"in",
"terms",
"of",
"length",
"of",
"ICU",
"stay",
".",
"These",
"findings",
"differ",
"strikingly",
"from",
"those",
"of",
"other",
"studies",
"-LSB-",
"2,4,5",
"-RSB-",
".",
"Although",
"the",
"report",
"by",
"Vriesendorp",
"and",
"coworkers",
"challenges",
"the",
"concept",
"of",
"tight",
"glucose",
"control",
",",
"it",
"can",
"hardly",
"be",
"considered",
"a",
"major",
"piece",
"of",
"evidence",
"against",
"it",
".",
"Indeed",
",",
"blood",
"glucose",
"concentrations",
"were",
"presented",
"as",
"means",
"of",
"values",
"recorded",
"only",
"over",
"48",
"hours",
",",
"whereas",
"the",
"ICU",
"stay",
"extended",
"up",
"to",
"71",
"days",
",",
"with",
"a",
"median",
"of",
"3",
"days",
".",
"Insulin",
"was",
"administered",
"to",
"only",
"9",
"%",
"of",
"the",
"patients",
"during",
"the",
"48-hour",
"period",
"of",
"observation",
".",
"In",
"addition",
",",
"patients",
"received",
"a",
"mean",
"of",
"only",
"22.5",
"g",
"glucose/day",
",",
"and",
"were",
"fed",
"early",
"after",
"surgery",
"with",
"an",
"enteral",
"solution",
"of",
"`",
"immunonutrients",
"'",
"--",
"a",
"potential",
"confounding",
"factor",
"with",
"respect",
"to",
"infectious",
"morbidity",
".",
"However",
",",
"despite",
"these",
"limitations",
",",
"as",
"well",
"as",
"others",
"that",
"are",
"acknowledged",
"by",
"the",
"authors",
",",
"the",
"findings",
"of",
"the",
"study",
"support",
"the",
"hypothesis",
"that",
"tight",
"glucose",
"control",
"could",
"be",
"of",
"greater",
"benefit",
"to",
"patients",
"with",
"cardiovascular",
"disease",
"than",
"to",
"those",
"without",
".",
"In",
"conclusion",
",",
"as",
"recently",
"suggested",
"by",
"Van",
"den",
"Berghe",
"-LSB-",
"8",
"-RSB-",
",",
"further",
"studies",
"are",
"needed",
"to",
"confirm",
"the",
"benefits",
"of",
"tight",
"blood",
"glucose",
"control",
"with",
"intensive",
"insulin",
"therapy",
"in",
"a",
"heterogeneous",
"population",
"of",
"ICU",
"patients",
".",
"Hence",
",",
"a",
"large",
"randomized",
"prospective",
"multicentre",
"trial",
"is",
"warranted",
".",
"Such",
"study",
"will",
"also",
"help",
"in",
"determining",
"the",
"physiological",
"importance",
"of",
"the",
"effects",
"of",
"insulin",
"and",
",",
"more",
"importantly",
",",
"will",
"provide",
"intensive",
"care",
"workers",
"with",
"key",
"information",
"for",
"guiding",
"the",
"management",
"of",
"blood",
"glucose",
"in",
"critically",
"ill",
"patients",
".",
"Abbreviation",
"ICU",
"=",
"intensive",
"care",
"unit",
".",
"Competing",
"interests",
"The",
"author",
"-LRB-",
"s",
"-RRB-",
"declare",
"that",
"they",
"have",
"no",
"competing",
"interests",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Breast_Cancer_Res_Treat-3-1-2137941 | [
"The",
"spectrum",
"of",
"ATM",
"missense",
"variants",
"and",
"their",
"contribution",
"to",
"contralateral",
"breast",
"cancer",
"Heterozygous",
"carriers",
"of",
"ATM",
"mutations",
"are",
"at",
"increased",
"risk",
"of",
"breast",
"cancer",
".",
"In",
"this",
"case-control",
"study",
",",
"we",
"evaluated",
"the",
"significance",
"of",
"germline",
"ATM",
"missense",
"variants",
"to",
"the",
"risk",
"of",
"contralateral",
"breast",
"cancer",
"-LRB-",
"CBC",
"-RRB-",
".",
"We",
"have",
"determined",
"the",
"spectrum",
"and",
"frequency",
"of",
"ATM",
"missense",
"variants",
"in",
"443",
"breast",
"cancer",
"patients",
"diagnosed",
"before",
"age",
"50",
",",
"including",
"247",
"patients",
"who",
"subsequently",
"developed",
"CBC",
".",
"Twenty-one",
"per",
"cent",
"of",
"the",
"women",
"with",
"unilateral",
"breast",
"cancer",
"and",
"17",
"%",
"of",
"the",
"women",
"with",
"CBC",
"had",
"at",
"least",
"one",
"ATM",
"germline",
"missense",
"variant",
",",
"indicating",
"no",
"significant",
"difference",
"in",
"variant",
"frequency",
"between",
"these",
"two",
"groups",
".",
"We",
"have",
"found",
"that",
"carriers",
"of",
"an",
"ATM",
"missense",
"mutation",
",",
"who",
"were",
"treated",
"with",
"radiotherapy",
"for",
"the",
"first",
"breast",
"tumour",
",",
"developed",
"their",
"second",
"tumour",
"on",
"average",
"in",
"a",
"92-month",
"interval",
"compared",
"to",
"a",
"136-month",
"mean",
"interval",
"for",
"those",
"CBC",
"patients",
"who",
"neither",
"received",
"RT",
"nor",
"carried",
"a",
"germline",
"variant",
",",
"-LRB-",
"p",
"=",
"0.029",
"-RRB-",
".",
"Our",
"results",
"indicate",
"that",
"the",
"presence",
"of",
"ATM",
"variants",
"does",
"not",
"have",
"a",
"major",
"impact",
"on",
"the",
"overall",
"risk",
"of",
"CBC",
".",
"However",
",",
"the",
"combination",
"of",
"RT",
"and",
"-LRB-",
"certain",
"-RRB-",
"ATM",
"missense",
"variants",
"seems",
"to",
"accelerate",
"tumour",
"development",
".",
"Introduction",
"Homozygous",
"or",
"compound",
"heterozygous",
"germline",
"mutations",
"in",
"the",
"ATM",
"gene",
"cause",
"the",
"autosomal",
"recessive",
"disorder",
"ataxia-telangiectasia",
"-LRB-",
"A-T",
"-RRB-",
".",
"This",
"progressive",
"neurological",
"childhood",
"disease",
"is",
"characterized",
"by",
"cerebellar",
"degeneration",
",",
"immunological",
"defects",
",",
"extreme",
"sensitivity",
"for",
"ionising",
"radiation",
"and",
"increased",
"risk",
"for",
"cancers",
",",
"particularly",
"lymphomas",
"-LSB-",
"1",
"-RSB-",
".",
"ATM",
"mutations",
"identified",
"in",
"A-T",
"families",
"can",
"be",
"classified",
"in",
"three",
"categories",
";",
"truncating",
"mutations",
",",
"mutations",
"that",
"lead",
"to",
"some",
"expression",
"of",
"mutant",
"protein",
"that",
"lacks",
"kinase",
"activity",
"and",
"missense",
"mutations",
"with",
"reduced",
"kinase",
"activity",
"-LRB-",
"http://chromium.liacs.nk/lovd/",
"-RRB-",
".",
"Heterozygous",
"pathogenic",
"ATM",
"mutation",
"carriers",
",",
"∼",
"0.5",
"--",
"1",
"%",
"of",
"the",
"general",
"population",
",",
"do",
"not",
"display",
"the",
"symptoms",
"observed",
"in",
"A-T",
"patients",
".",
"Several",
"epidemiological",
"studies",
"have",
"consistently",
"shown",
"elevated",
"rates",
"of",
"breast",
"cancer",
"among",
"female",
"blood",
"relatives",
"of",
"patients",
"with",
"A-T",
"-LSB-",
"2",
",",
"3",
"-RSB-",
".",
"Thompson",
"et",
"al.",
"have",
"shown",
"that",
"the",
"overall",
"relative",
"risk",
"in",
"carriers",
"was",
"2.23",
"-LSB-",
"95",
"%",
"confidence",
"interval",
"-LRB-",
"CI",
"-RRB-",
"1.16",
"--",
"4.28",
"-RSB-",
"compared",
"to",
"the",
"general",
"population",
"and",
"4.95",
"-LRB-",
"95",
"%",
"CI",
"1.9",
"--",
"12.9",
"-RRB-",
"in",
"those",
"younger",
"that",
"age",
"50",
".",
"A",
"large",
"review",
"showed",
"that",
"ATM",
"mutations",
"are",
"more",
"frequent",
"in",
"breast",
"cancer",
"patients",
"selected",
"on",
"the",
"basis",
"of",
"a",
"family",
"history",
"of",
"breast",
"cancer",
"than",
"in",
"unselected",
"patients",
"-LSB-",
"4",
"-RSB-",
".",
"Besides",
"pathogenic",
"ATM",
"mutations",
",",
"a",
"large",
"number",
"of",
"ATM",
"variants",
"-LRB-",
"common",
"polymorphisms",
"and",
"unclassified",
"variants",
"-RRB-",
"have",
"been",
"described",
",",
"which",
"were",
"found",
"in",
"cancer",
"patients",
"as",
"well",
"as",
"in",
"the",
"general",
"population",
".",
"It",
"has",
"been",
"hypothesized",
"that",
"the",
"cancer",
"risk",
"among",
"ATM",
"heterozygotes",
"might",
"be",
"related",
"to",
"mutation",
"type",
",",
"suggesting",
"that",
"particularly",
"missense",
"mutations",
"are",
"associated",
"with",
"an",
"increased",
"risk",
"-LSB-",
"5",
",",
"6",
"-RSB-",
".",
"However",
",",
"two",
"recent",
"studies",
"by",
"Thompson",
"et",
"al.",
"and",
"Renwick",
"et",
"al.",
"showed",
"that",
"pathogenic",
"ATM",
"mutations",
"that",
"cause",
"A-T",
"are",
"breast",
"cancer",
"susceptibility",
"alleles",
"-LSB-",
"2",
",",
"7",
"-RSB-",
".",
"This",
"argues",
"against",
"the",
"hypothesis",
"that",
"missense",
"rather",
"that",
"truncating",
"are",
"associated",
"with",
"breast",
"cancer",
".",
"Women",
"with",
"breast",
"cancer",
"have",
"in",
"general",
"a",
"three",
"to",
"fourfold",
"increased",
"risk",
"of",
"developing",
"a",
"new",
"primary",
"cancer",
"in",
"the",
"opposite",
"breast",
"-LSB-",
"8",
"-RSB-",
".",
"The",
"contralateral",
"breast",
"cancer",
"-LRB-",
"CBC",
"-RRB-",
"risk",
"might",
"be",
"explained",
"by",
"the",
"same",
"genetic",
"and",
"hormonal",
"factors",
"that",
"caused",
"the",
"first",
"breast",
"cancer",
".",
"Treatment",
"related",
"factors",
",",
"e.g.",
"radiotherapy",
"for",
"primary",
"breast",
"cancer",
",",
"may",
"also",
"contribute",
"to",
"the",
"development",
"of",
"cancer",
"in",
"the",
"contralateral",
"breast",
"-LSB-",
"9",
"-RSB-",
"-LRB-",
"our",
"own",
"data",
",",
"manuscript",
"under",
"review",
"-RRB-",
".",
"To",
"evaluate",
"whether",
"germline",
"ATM",
"missense",
"variants",
"are",
"significantly",
"associated",
"with",
"CBC",
"risk",
"-LRB-",
"results",
"regarding",
"ATM",
"truncating",
"mutations",
"are",
"reported",
"elsewhere",
"-RRB-",
"and",
"whether",
"treatment",
"modifies",
"this",
"risk",
",",
"we",
"conducted",
"a",
"case-control",
"study",
"in",
"which",
"we",
"assessed",
"the",
"ATM",
"missense",
"mutation",
"spectrum",
"and",
"frequency",
"in",
"women",
"who",
"developed",
"their",
"first",
"breast",
"cancer",
"before",
"age",
"50",
",",
"with",
"and",
"without",
"a",
"second",
"primary",
"breast",
"cancer",
".",
"Methods",
"Patients",
"The",
"consecutive",
"breast",
"cancer",
"patients",
"included",
"in",
"this",
"study",
"were",
"all",
"selected",
"from",
"the",
"hospital",
"tumour",
"registries",
"of",
"The",
"Netherlands",
"Cancer",
"Institute",
",",
"Amsterdam",
"-LRB-",
"NKI-AVL",
"-RRB-",
"or",
"The",
"Dr.",
"Daniel",
"den",
"Hoed",
"Cancer",
"Center/Erasmus",
"Medical",
"Center",
",",
"Rotterdam",
"-LRB-",
"DDHK",
"-RRB-",
".",
"Of",
"all",
"patients",
"that",
"were",
"invited",
"to",
"participate",
"we",
"achieved",
"an",
"80",
"%",
"response",
"rate",
".",
"The",
"breast",
"cancer",
"patients",
"were",
"included",
"if",
"their",
"-LRB-",
"first",
"-RRB-",
"breast",
"cancer",
"was",
"diagnosed",
"before",
"age",
"50",
"-LRB-",
"n",
"=",
"443",
"-RRB-",
".",
"For",
"CBC",
"we",
"required",
"an",
"interval",
"of",
"at",
"least",
"1",
"year",
"-LRB-",
"n",
"=",
"247",
"-RRB-",
".",
"The",
"unilateral",
"breast",
"cancer",
"patients",
"-LRB-",
"UBC",
"-RRB-",
"patients",
"all",
"had",
"to",
"be",
"disease-free",
"-LRB-",
"of",
"a",
"second",
"breast",
"cancer",
"-RRB-",
"for",
"at",
"least",
"5",
"years",
".",
"The",
"first",
"57",
"CBC",
"patients",
"were",
"individually",
"age-matched",
"-LRB-",
"1:3",
"-RRB-",
"to",
"UBC",
"controls",
".",
"All",
"patients",
"had",
"invasive",
"breast",
"carcinoma",
"and",
"were",
"treated",
"with",
"surgery",
".",
"Of",
"the",
"CBC",
"patients",
"169",
"did",
"and",
"78",
"did",
"not",
"receive",
"radiotherapy",
"treatment",
"for",
"their",
"primary",
"breast",
"tumour",
".",
"Average",
"age",
"at",
"diagnosis",
"for",
"the",
"first",
"breast",
"cancer",
"in",
"the",
"RT",
"group",
"was",
"41.2",
"/",
"41.3",
"years",
"-LRB-",
"mean/median",
"-RRB-",
"and",
"the",
"non-exposed",
"group",
"42.0",
"/",
"43.2",
"years",
"-LRB-",
"mean/median",
"-RRB-",
".",
"Detailed",
"treatment",
"data",
",",
"disease",
"and",
"patient",
"characteristics",
"were",
"obtained",
"from",
"medical",
"records",
"and",
"risk",
"factor",
"questionnaires",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
"-LSB-",
"10",
",",
"11",
"-RSB-",
".",
"Patients",
"were",
"asked",
"to",
"donate",
"a",
"20",
"ml",
"blood",
"sample",
"or",
"permission",
"for",
"use",
"of",
"paraffin-embedded",
"tissue",
"blocks",
"and",
"patients",
"gave",
"their",
"written",
"informed",
"consent",
"for",
"mutation",
"analysis",
".",
"This",
"study",
"received",
"approval",
"of",
"the",
"Medical",
"Ethical",
"Committees",
"of",
"NKI-AVL",
"and",
"DDHK",
".",
"Genomic",
"DNA",
"isolation",
"Genomic",
"DNA",
"was",
"either",
"isolated",
"from",
"peripheral",
"blood",
"lymphocytes",
"with",
"DNAzol",
"-LRB-",
"Invitrogen",
",",
"Breda",
",",
"The",
"Netherlands",
"-RRB-",
"methods",
"according",
"to",
"the",
"manufacturer",
"'s",
"instructions",
",",
"or",
"from",
"three",
"10-μm",
"paraffin",
"embedded",
"normal",
"tissue",
"slides",
"according",
"to",
"standard",
"protocols",
"-LSB-",
"12",
"-RSB-",
".",
"For",
"histopathological",
"examination",
"we",
"used",
"a",
"hematoxylin-eosin",
"stained",
"slide",
".",
"Mutation",
"analysis",
"The",
"complete",
"ATM",
"Open",
"Reading",
"Frame",
"-LRB-",
"ORF",
"-RRB-",
"was",
"analysed",
",",
"each",
"exon",
"-LRB-",
"exon",
"4-65",
"-RRB-",
"and",
"all",
"intron-exon",
"boundaries",
"were",
"screened",
"for",
"germline",
"mutations",
"using",
"Denaturing",
"Gradient",
"Gel",
"Electrophoresis",
"-LRB-",
"DGGE",
"-RRB-",
"identifying",
"∼",
"90",
"%",
"of",
"all",
"ATM",
"mutations",
"and",
"polymorphisms",
"-LRB-",
"details",
"from",
"the",
"author",
"upon",
"request",
"-RRB-",
".",
"All",
"aberrations",
"were",
"confirmed",
"with",
"genomic",
"sequence",
"analysis",
",",
"performed",
"using",
"the",
"ABI",
"PRISM",
"BigDyeTerminator",
"Cycle",
"Sequencing",
"Ready",
"Reaction",
"Kit",
"Version",
"3.1",
"-LRB-",
"Applied",
"Biosystems",
",",
"Nieuwerkerk",
"a/d",
"yssel",
",",
"The",
"Netherlands",
"-RRB-",
".",
"Sequencing",
"products",
"were",
"analysed",
"with",
"the",
"ABI",
"PRISM",
"3700",
"DNA",
"Analyzer",
"and",
"corresponding",
"software",
".",
"Statistical",
"analysis",
"Statistical",
"analyses",
"were",
"performed",
"using",
"standard",
"methods",
"for",
"analysis",
"of",
"case-control",
"studies",
"-LSB-",
"13",
"-RSB-",
".",
"We",
"compared",
"the",
"mutation",
"frequency",
"between",
"UBC",
"and",
"CBC",
"and",
"between",
"CBC",
"cases",
"previously",
"treated",
"with",
"RT",
"and",
"cases",
"not-treated",
"with",
"RT.",
".",
"Odds",
"ratios",
"-LRB-",
"ORs",
"-RRB-",
"and",
"95",
"%",
"CI",
"were",
"calculated",
"to",
"evaluate",
"the",
"association",
"between",
"mutation",
"carriers",
"status",
"and",
"breast",
"cancer",
"risk",
".",
"We",
"have",
"used",
"the",
"Mann",
"--",
"Whitney",
"test",
"to",
"determine",
"whether",
"the",
"difference",
"between",
"the",
"intervals",
"between",
"the",
"two",
"breast",
"cancers",
"of",
"the",
"CBC",
"patients",
"was",
"significant",
".",
"All",
"analyses",
"were",
"performed",
"using",
"SPSS",
"12.0",
"-LRB-",
"SPSS",
"Inc.",
",",
"Chicago",
",",
"IL",
",",
"USA",
"-RRB-",
".",
"Results",
"and",
"discussion",
"ATM",
"germline",
"mutations",
"In",
"the",
"present",
"study",
",",
"we",
"have",
"used",
"the",
"DGGE",
"method",
"to",
"screen",
"the",
"complete",
"ATM",
"ORF",
"to",
"obtain",
"insight",
"in",
"the",
"ATM",
"missense",
"mutation",
"spectrum",
"in",
"-LRB-",
"contralateral",
"-RRB-",
"breast",
"cancer",
"patients",
".",
"With",
"DGGE",
"we",
"were",
"able",
"to",
"confirm",
"all",
"the",
"previously",
"identified",
"truncating",
"mutations",
".",
"A",
"subset",
"of",
"the",
"CBC",
"patients",
"described",
"in",
"this",
"study",
"had",
"been",
"screened",
"in",
"the",
"past",
"for",
"ATM",
"truncating",
"mutations",
"with",
"the",
"Protein",
"Truncating",
"Test",
",",
"revealing",
"seven",
"ATM",
"truncating",
"mutations",
"-LRB-",
"including",
"a",
"non-sense",
"mutation",
"and",
"small",
"insertions",
"and",
"deletions",
";",
"generating",
"stop",
"codons",
"within",
"a",
"previously",
"functional",
"protein",
"coding",
"sequence",
"causing",
"premature",
"termination",
"of",
"translation",
"of",
"the",
"protein",
"-RRB-",
"-LSB-",
"10",
"-RSB-",
".",
"Among",
"all",
"443-breast",
"cancer",
"patients",
"that",
"were",
"tested",
"in",
"this",
"study",
"with",
"DGGE",
"we",
"detected",
"a",
"large",
"number",
"of",
"ATM",
"silent",
"mutations",
"-LRB-",
"presumed",
"neutral",
"polymorphisms",
",",
"data",
"not",
"shown",
"and",
"excluded",
"from",
"all",
"analyses",
"-RRB-",
"and",
"missense",
"mutations",
"-LRB-",
"causing",
"an",
"amino",
"acid",
"substitution",
"in",
"the",
"coded",
"protein",
",",
"most",
"common",
"ones",
";",
"i.e.",
"D1853N",
",",
"not",
"included",
"in",
"further",
"analysis",
"-RRB-",
".",
"ATM",
"missense",
"mutation",
"spectrum",
"In",
"our",
"study",
"cohort",
"we",
"have",
"detected",
"35",
"distinct",
"ATM",
"missense",
"variants",
"and",
"6",
"distinct",
"truncating",
"mutations",
".",
"Several",
"of",
"the",
"detected",
"missense",
"variants",
"have",
"been",
"reported",
"in",
"the",
"ATM",
"database",
"as",
"being",
"detected",
"in",
"A-T",
"patients/or",
"as",
"polymorphisms",
"-LRB-",
"Table",
"1",
"-RRB-",
".",
"None",
"of",
"the",
"missense",
"variants",
"identified",
"in",
"this",
"study",
"are",
"known",
"as",
"pathogenic",
"A-T",
"causing",
"missense",
"mutations",
".",
"Seventeen",
"of",
"the",
"missense",
"variants",
"have",
"not",
"been",
"reported",
"previously",
".",
"Eleven",
"missense",
"variants",
"were",
"exclusively",
"found",
"in",
"the",
"CBC",
"group",
"and",
"10",
"exclusively",
"in",
"the",
"UBC",
"group",
".",
"Whether",
"this",
"distinction",
"in",
"the",
"spectrum",
"indicates",
"an",
"association",
"between",
"particular",
"variants",
"and",
"bilateral",
"breast",
"cancer",
"risk",
"can",
"not",
"be",
"concluded",
"from",
"the",
"small",
"numbers",
"obtained",
"in",
"this",
"study",
"population",
".",
"The",
"ATM",
"protein",
"has",
"several",
"functional",
"domains",
"and",
"the",
"identified",
"missense",
"variants",
"are",
"located",
"throughout",
"the",
"ORF",
".",
"Potential",
"functional",
"implications",
"of",
"the",
"newly",
"identified",
"unclassified",
"variants",
"remain",
"to",
"be",
"established",
".",
"Table",
"1ATM",
"missense",
"variant",
"and",
"truncating",
"mutation",
"spectrum",
"in",
"contralateral",
"and",
"unilateral",
"breast",
"cancer",
"patientsMissense",
"variantsAmino",
"acid",
"changeCBC",
"n",
"=",
"247UBC",
"n",
"=",
"190Databasea",
"or",
"literature37C",
">",
"TR13C1",
"-LSB-",
"10",
"-RSB-",
"146C",
">",
"GS49C55database162T",
">",
"CY54H21",
"-LSB-",
"4",
"-RSB-",
",",
"-LSB-",
"14",
"-RSB-",
"378A",
">",
"TD126E1database1009C",
">",
"TR337C1Novel1132A",
">",
"GS377G1Novel1229T",
">",
"GV410A21",
"-LSB-",
"4",
"-RSB-",
"1810C",
">",
"TP604S1database2119T",
">",
"CS707P78database2276G",
">",
"A",
"S759NNovel2336T",
">",
"CM779T1Novel2414G",
">",
"AR805Q2Novel2572T",
">",
"CF858L43database2650C",
">",
"TP884S12650C",
">",
"TP884S1Novel2614C",
">",
"TP872S",
"-LSB-",
"15",
"-RSB-",
"3161C",
">",
"GP1054R813database3925G",
">",
"AA1309T11",
"-LSB-",
"16",
"-RSB-",
"4138C",
">",
"TH1380Y1database4258C",
">",
"TL1420F54database4324T",
">",
"CY1442H2Novel4362A",
">",
"CK1454N1database4477C",
">",
"GL1493V1Novel4664T",
">",
"AL1555H1Novel4722G",
">",
"TL1574F1Novel5044G",
">",
"TD1682Y1database5071A",
">",
"CS1691R22database5557G",
">",
"AbD1853N3549database5558A",
">",
"TD1853V31database5741A",
">",
"GD1914GNovel6067G",
">",
"AG2023R1database6820G",
">",
"AA2274T1database6919C",
">",
"TL2307F1",
"-LSB-",
"14",
"-RSB-",
"7446G",
">",
"AM2482I1Novel7874A",
">",
"GD2625G1Novel8659C",
">",
"GH2887D1NovelTruncating",
"mutationsIVS10-6T",
">",
"G419X12database",
"-LSB-",
"10",
"-RSB-",
",",
"-LSB-",
"17",
"-RSB-",
"1563delAG521X1database1660delA554X1NovelIVS14",
"+",
"2T",
">",
"Gdel",
"601-6331database2572insTF858X1Novel3115A",
">",
"TR1039X1Novela",
"http://chromium.liacs.nk/lovd/b Not",
"included",
"in",
"frequency",
"analysis",
"Despite",
"the",
"fact",
"that",
"ATM",
"plays",
"a",
"role",
"in",
"breast",
"cancer",
"risk",
",",
"the",
"role",
"of",
"most",
"distinct",
"ATM",
"missense",
"variants",
"remains",
"unclear",
".",
"Some",
"studies",
"tried",
"to",
"predict",
"the",
"relevance",
"of",
"each",
"particular",
"mutation",
"on",
"basis",
"of",
"co-segregation",
"with",
"breast",
"cancer",
"in",
"families",
",",
"the",
"location",
"in",
"a",
"functional",
"domain",
"or",
"interference",
"with",
"the",
"splicing",
"machinery",
".",
"Only",
"a",
"few",
"studies",
"present",
"functional",
"analysis",
"that",
"are",
"necessary",
"to",
"assess",
"the",
"biological",
"impact",
"of",
"unidentified",
"variants",
"found",
"frequently",
"in",
"ATM",
"-LSB-",
"18",
"--",
"20",
"-RSB-",
".",
"ATM",
"missense",
"mutations",
"and",
"contralateral",
"breast",
"cancer",
"Twenty-one",
"per",
"cent",
"of",
"the",
"patients",
"carried",
"at",
"least",
"one",
"ATM",
"germline",
"variant",
"-LRB-",
"missense",
"and",
"truncating",
";",
"Table",
"2",
"-RRB-",
".",
"Among",
"the",
"patients",
"with",
"CBC",
"-LRB-",
"n",
"=",
"247",
"-RRB-",
"we",
"identified",
"in",
"total",
"55",
"ATM",
"variants",
"in",
"45",
"individuals",
"-LRB-",
"18",
"%",
"-RRB-",
";",
"51",
"missense",
"variants",
"and",
"4",
"truncating",
"mutations",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"Eight",
"CBC",
"patients",
"had",
"multiple",
"ATM",
"missense",
"variants",
"and",
"2",
"patients",
"carried",
"both",
"a",
"missense",
"and",
"a",
"truncating",
"ATM",
"mutation",
".",
"In",
"the",
"women",
"with",
"UBC",
"-LRB-",
"n",
"=",
"196",
"-RRB-",
"we",
"identified",
"52",
"ATM",
"variants",
"in",
"46",
"individuals",
"-LRB-",
"23",
"%",
"-RRB-",
";",
"48",
"missense",
"and",
"4",
"truncating",
"mutations",
".",
"Three",
"UBC",
"patients",
"carried",
"double",
"missense",
"and",
"3",
"patients",
"both",
"a",
"truncating",
"and",
"a",
"missense",
"variant",
".",
"Although",
"it",
"is",
"known",
"from",
"the",
"literature",
"that",
"ATM",
"missense",
"variants",
"might",
"be",
"involved",
"in",
"breast",
"cancer",
"pathogenesis",
",",
"the",
"identified",
"17",
"%",
"missense",
"variant",
"carriers",
"among",
"the",
"CBC",
"patients",
"compared",
"to",
"the",
"21",
"%",
"missense",
"variants",
"among",
"the",
"UBC",
"patients",
"indicate",
"that",
"there",
"is",
"not",
"a",
"significantly",
"increased",
"risk",
"for",
"bilateral",
"breast",
"cancer",
"among",
"ATM",
"missense",
"variant",
"carriers",
",",
"OR",
"0.77",
"-LRB-",
"95",
"%",
"CI",
"0.48",
"--",
"1.24",
"-RRB-",
".",
"Table",
"2ATM",
"variant",
"frequencies",
"in",
"all",
"breast",
"cancer",
"patients",
"diagnosed",
"under",
"age",
"50",
"and",
"according",
"to",
"uni",
"-",
"or",
"contralateral",
"breast",
"cancerBreast",
"cancer",
"patients",
"withAll",
"patients",
"n",
"=",
"443CBC",
"n",
"=",
"247UBC",
"n",
"=",
"196Total",
"ATM",
"variantsa55",
":",
"51",
"missense",
"and",
"4",
"truncating52",
":",
"48",
"missense",
"and",
"4",
"truncatingAt",
"least",
"one",
"ATM",
"variant91",
"-LRB-",
"21",
"%",
"-RRB-",
"45",
"-LRB-",
"18",
"%",
"-RRB-",
"46",
"-LRB-",
"23",
"%",
"-RRB-",
"At",
"least",
"one",
"ATM",
"missense",
"variant85",
"-LRB-",
"19",
"%",
"-RRB-",
"43",
"-LRB-",
"17",
"%",
"-RRB-",
"42",
"-LRB-",
"21",
"%",
"-RRB-",
"Only",
"one",
"ATM",
"truncating",
"mutations321One",
"truncating",
"and",
"one",
"missense",
"variant523Double",
"missense",
"variants1183a",
"Not",
"included",
"are",
"the",
"most",
"common",
"and",
"silent",
"variants",
"Association",
"with",
"radiation",
"treatment",
"Women",
"at",
"high",
"risk",
"for",
"developing",
"breast",
"cancer",
"may",
"respond",
"differently",
"to",
"radiation",
"exposures",
"associated",
"with",
"screening",
"and",
"treatment",
",",
"than",
"the",
"general",
"population",
".",
"Candidate-genes",
"like",
"ATM",
"are",
"implicated",
"in",
"maintenance",
"of",
"genome",
"integrity",
".",
"Their",
"involvements",
"in",
"breast",
"cancer",
"susceptibility",
"as",
"well",
"as",
"their",
"role",
"in",
"DNA-damage",
"repair",
"signalling",
"make",
"them",
"excellent",
"candidates",
"for",
"a",
"role",
"in",
"radiation-induced",
"breast",
"cancer",
"-LSB-",
"21",
"-RSB-",
".",
"Recently",
",",
"we",
"showed",
"that",
"women",
"with",
"a",
"pathogenic",
"germline",
"mutation",
"in",
"a",
"DNA",
"repair",
"pathway",
"gene",
"-LRB-",
"e.g.",
"BRCA1",
",",
"BRCA2",
",",
"CHEK2",
"and",
"ATM",
"-RRB-",
"have",
"an",
"over",
"2-fold",
"increased",
"risk",
"of",
"developing",
"radiation-associated",
"breast",
"cancer",
"-LRB-",
"manuscript",
"under",
"review",
"-RRB-",
".",
"Therefore",
",",
"we",
"now",
"investigated",
"whether",
"exposure",
"to",
"ionising",
"radiation",
"had",
"a",
"greater",
"biological",
"impact",
"on",
"certain",
"ATM",
"genotypes",
"than",
"on",
"others",
".",
"We",
"did",
"not",
"detect",
"a",
"significantly",
"increased",
"risk",
"of",
"developing",
"radiation-associated",
"CBC",
"among",
"missense",
"mutation",
"carriers",
".",
"Among",
"those",
"169",
"CBC",
"patients",
"who",
"had",
"developed",
"a",
"second",
"primary",
"breast",
"tumour",
"following",
"radiotherapy",
"for",
"their",
"first",
"breast",
"tumour",
"we",
"identified",
"19.5",
"%",
"ATM",
"missense",
"variants",
"carriers",
"compared",
"to",
"13",
"%",
"among",
"those",
"CBC",
"patients",
"who",
"did",
"not",
"receive",
"RT",
",",
"the",
"OR",
"from",
"this",
"case-only",
"analysis",
"is",
"1.65",
"-LSB-",
"95",
"%",
"CI",
"-LRB-",
"0.77",
"--",
"3.55",
"-RRB-",
"p",
"=",
"0.2",
"-RSB-",
".",
"Furthermore",
",",
"we",
"have",
"observed",
"that",
"21",
"%",
"of",
"the",
"UBC",
"patients",
",",
"who",
"received",
"RT",
"but",
"did",
"not",
"develop",
"a",
"CBC",
"carried",
"an",
"ATM",
"missense",
"variant",
",",
"compared",
"to",
"19.5",
"%",
"of",
"the",
"CBC",
"patients",
"that",
"received",
"RT",
"for",
"their",
"first",
"tumour",
"-LSB-",
"OR",
"0.86",
"-LRB-",
"95",
"%",
"CI",
"0.52",
"--",
"1.43",
"-RRB-",
"-RSB-",
".",
"These",
"results",
"suggest",
"that",
"RT",
"is",
"not",
"a",
"strong",
"risk",
"factor",
"for",
"the",
"development",
"of",
"CBC",
"among",
"carriers",
"of",
"those",
"ATM",
"missense",
"variants",
".",
"It",
"has",
"however",
"been",
"shown",
"that",
"particular",
"alterations",
"in",
"the",
"ATM",
"gene",
"are",
"associated",
"with",
"increased",
"radiation",
"sensitivity",
"-LSB-",
"22",
"--",
"24",
"-RSB-",
".",
"Gutierrez-Enriquez",
"et",
"al.",
"showed",
"that",
"lymfoblastoid",
"cell",
"lines",
"carrying",
"the",
"ATM",
"variant",
"3161G",
"-LRB-",
"linked",
"to",
"2572C",
"-RRB-",
"was",
"associated",
"with",
"increased",
"in",
"vitro",
"chromosomal",
"radio-sensitivity",
",",
"perhaps",
"by",
"interfering",
"with",
"ATM",
"function",
"in",
"a",
"dominant-negative",
"manner",
"-LSB-",
"22",
"-RSB-",
".",
"We",
"found",
"this",
"particular",
"variant",
"allele",
"-LRB-",
"3161G/2572C",
"-RRB-",
"exclusively",
"in",
"our",
"CBC",
"group",
"exposed",
"to",
"radiotherapy",
"-LRB-",
"four",
"times",
"-RRB-",
"and",
"not",
"in",
"the",
"non-RT-exposed",
"CBC",
"group",
".",
"This",
"finding",
"supports",
"the",
"hypothesis",
"that",
"particular",
"ATM",
"variants",
"might",
"play",
"a",
"differential",
"role",
"in",
"radiation",
"response",
".",
"Although",
"a",
"subset",
"of",
"the",
"missense",
"variants",
"was",
"only",
"detected",
"in",
"the",
"RT",
"exposed",
"subpopulation",
",",
"individual",
"numbers",
"were",
"probably",
"too",
"small",
"to",
"detect",
"a",
"significant",
"effect",
"of",
"particular",
"mutations",
"associated",
"with",
"treatment",
".",
"We",
"observed",
"that",
"CBC",
"patients",
"with",
"an",
"ATM",
"missense",
"variant",
"had",
"an",
"mean",
"interval",
"between",
"the",
"first",
"and",
"second",
"breast",
"tumour",
"of",
"∼",
"101",
"months",
",",
"compared",
"to",
"122",
"months",
"for",
"non-carriers",
"CBC",
"patients",
"-LRB-",
"p",
"=",
"0.085",
"-RRB-",
".",
"Interestingly",
",",
"the",
"combination",
"of",
"radiation",
"treatment",
"and",
"a",
"missense",
"variant",
"resulted",
"in",
"an",
"even",
"shorter",
"mean",
"interval",
"of",
"a",
"92",
"months",
"in",
"the",
"CBC",
"patients",
"compared",
"to",
"a",
"136-month",
"interval",
"for",
"CBC",
"patients",
"who",
"neither",
"received",
"RT",
"nor",
"carried",
"a",
"germline",
"variant",
"-LRB-",
"p",
"=",
"0.029",
"-RRB-",
".",
"These",
"data",
"suggest",
"that",
"carrier-ship",
"of",
"an",
"ATM",
"missense",
"variant",
"may",
"accelerate",
"the",
"development",
"of",
"a",
"second",
"tumour",
"and",
"decreases",
"the",
"age",
"at",
"onset",
"of",
"the",
"second",
"breast",
"tumour",
",",
"especially",
"in",
"case",
"of",
"exposure",
"to",
"RT.",
".",
"The",
"suggestion",
"of",
"a",
"shorter",
"induction",
"period",
"of",
"RT-associated",
"breast",
"cancer",
"in",
"patients",
",",
"who",
"carry",
"an",
"ATM",
"missense",
"mutation",
",",
"while",
"the",
"proportion",
"of",
"patients",
"with",
"missense",
"variants",
"was",
"similar",
"in",
"CBC",
"and",
"UBC",
"cases",
",",
"might",
"be",
"attributable",
"to",
"a",
"different",
"spectrum",
"of",
"mutations",
"in",
"those",
"patients",
"who",
"developed",
"CBC",
".",
"A",
"big",
"challenge",
"in",
"such",
"a",
"study",
"remains",
"to",
"assess",
"which",
"particular",
"missense",
"mutations",
"have",
"an",
"impact",
"on",
"ATM",
"function",
".",
"Large",
"association",
"studies",
",",
"as",
"performed",
"by",
"the",
"Breast",
"Cancer",
"Association",
"Consortium",
"-LRB-",
"coordinated",
"by",
"Doug",
"Easton",
"and",
"Paul",
"Pharoah",
",",
"Cambridge",
"-RRB-",
",",
"and",
"functional",
"studies",
"are",
"clearly",
"necessary",
"to",
"determine",
"the",
"importance",
"of",
"particular",
"variants",
"and",
"their",
"contribution",
"to",
"the",
"breast",
"cancer",
"risk",
"."
] | [
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O"
] |
Diabetologia-3-1-1849422 | [
"Impact",
"of",
"the",
"population",
"at",
"risk",
"of",
"diabetes",
"on",
"projections",
"of",
"diabetes",
"burden",
"in",
"the",
"United",
"States",
":",
"an",
"epidemic",
"on",
"the",
"way",
"Aims/hypothesis",
"The",
"aim",
"of",
"this",
"study",
"was",
"to",
"make",
"projections",
"of",
"the",
"future",
"diabetes",
"burden",
"for",
"the",
"adult",
"US",
"population",
"based",
"in",
"part",
"on",
"the",
"prevalence",
"of",
"individuals",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
".",
"Introduction",
"Considerable",
"evidence",
"has",
"been",
"presented",
"on",
"the",
"rise",
"in",
"diabetes",
"prevalence",
"in",
"the",
"United",
"States",
"and",
"the",
"United",
"Kingdom",
"-LSB-",
"1",
",",
"2",
"-RSB-",
".",
"The",
"prevalence",
"of",
"diabetes",
"has",
"become",
"so",
"large",
"that",
"it",
"has",
"been",
"termed",
"an",
"epidemic",
"-LSB-",
"1",
",",
"3",
"-RSB-",
".",
"This",
"rise",
"is",
"particularly",
"important",
"for",
"healthcare",
"needs",
"in",
"the",
"US",
"because",
"almost",
"30",
"%",
"of",
"individuals",
"with",
"diabetes",
"are",
"currently",
"undiagnosed",
"and",
"diabetes",
"is",
"disproportionately",
"represented",
"in",
"minority",
"populations",
"-LSB-",
"4",
"-RSB-",
".",
"Projection",
"of",
"future",
"disease",
"prevalence",
"helps",
"to",
"plan",
"for",
"healthcare",
"needs",
".",
"An",
"understanding",
"of",
"the",
"population",
"at",
"risk",
"of",
"developing",
"the",
"disease",
"is",
"critical",
"when",
"projecting",
"future",
"disease",
"burden",
".",
"Several",
"studies",
"have",
"projected",
"future",
"diagnosed",
"diabetes",
"prevalence",
"for",
"the",
"US",
"and",
"other",
"countries",
"-LSB-",
"2",
",",
"5",
"--",
"9",
"-RSB-",
".",
"These",
"studies",
",",
"however",
",",
"did",
"not",
"consider",
"that",
"not",
"all",
"individuals",
"are",
"equally",
"at",
"risk",
"of",
"developing",
"diabetes",
",",
"thereby",
"possibly",
"distorting",
"estimates",
"of",
"downstream",
"prevalence",
".",
"For",
"example",
",",
"some",
"risk",
"factors",
"for",
"diabetes",
",",
"e.g.",
"obesity",
",",
"have",
"increased",
"substantially",
"in",
"the",
"population",
"-LSB-",
"10",
"--",
"12",
"-RSB-",
".",
"Moreover",
",",
"many",
"of",
"these",
"projections",
"are",
"based",
"on",
"estimates",
"of",
"diagnosed",
"diabetes",
"and",
"exclude",
"estimates",
"of",
"total",
"diabetes",
"-LRB-",
"diagnosed",
"and",
"undiagnosed",
"-RRB-",
",",
"which",
"may",
"lead",
"to",
"serious",
"underestimation",
"of",
"the",
"diabetes",
"burden",
"in",
"the",
"population",
".",
"Major",
"risk",
"factors",
"for",
"diabetes",
"have",
"been",
"identified",
"and",
"are",
"currently",
"used",
"by",
"the",
"American",
"Diabetes",
"Association",
"to",
"guide",
"screening",
"strategies",
".",
"Although",
"there",
"are",
"various",
"measures",
"for",
"assessing",
"the",
"risk",
"of",
"having",
"undiagnosed",
"diabetes",
"-LSB-",
"13",
"--",
"17",
"-RSB-",
",",
"few",
"measures",
"are",
"available",
"for",
"assessing",
"the",
"risk",
"of",
"developing",
"diabetes",
"-LSB-",
"18",
",",
"19",
"-RSB-",
".",
"Moreover",
",",
"accounting",
"for",
"changes",
"in",
"the",
"proportion",
"of",
"high-risk",
"individuals",
",",
"particularly",
"as",
"assessed",
"through",
"clinical",
"indicators",
",",
"has",
"not",
"been",
"incorporated",
"into",
"previous",
"projections",
"of",
"future",
"diabetes",
"burden",
".",
"The",
"purpose",
"of",
"this",
"study",
"was",
"to",
"project",
"the",
"prevalence",
"of",
"diabetes",
"for",
"the",
"adult",
"US",
"population",
"up",
"to",
"2031",
",",
"using",
"models",
"based",
"on",
"data",
"contained",
"in",
"the",
"nationally",
"representative",
"National",
"Health",
"and",
"Nutrition",
"Examination",
"Survey",
"-LRB-",
"NHANES",
"-RRB-",
"II",
"mortality",
"survey",
"-LRB-",
"1976",
"--",
"1992",
"-RRB-",
",",
"NHANES",
"III",
"-LRB-",
"1988",
"--",
"1994",
"-RRB-",
"and",
"NHANES",
"1999",
"--",
"2002",
".",
"Materials",
"and",
"methods",
"Diabetes",
"prevalence",
"model",
"The",
"model",
"for",
"diabetes",
"prevalence",
"used",
"in",
"this",
"study",
"was",
"created",
"using",
"data",
"from",
"the",
"NHANES",
"III",
"-LRB-",
"1988",
"--",
"1994",
"-RRB-",
",",
"and",
"then",
"fitted",
"to",
"data",
"from",
"the",
"NHANES",
"1999",
"--",
"2002",
"as",
"a",
"validity",
"check",
"of",
"the",
"accuracy",
"of",
"the",
"model",
"'s",
"projections",
".",
"The",
"resulting",
"model",
"was",
"then",
"used",
"to",
"project",
"the",
"number",
"of",
"individuals",
"with",
"diabetes",
"in",
"the",
"US",
"in",
"10-year",
"increments",
"into",
"the",
"future",
".",
"We",
"evaluated",
"10-year",
"age",
"classes",
"at",
"each",
"10-year",
"interval",
".",
"Our",
"model",
"has",
"the",
"following",
"components",
":",
"Number",
"of",
"individuals",
"with",
"diabetesTime",
"2",
"=",
"∑",
"-LRB-",
"number",
"of",
"individuals",
"with",
"diabetesTime",
"1i",
"+",
"incident",
"casesi",
"−",
"mortalityi",
"-RRB-",
",",
"where",
"i",
"equals",
"each",
"10-year",
"age",
"group",
",",
"and",
"incident",
"cases",
"consist",
"of",
":",
"-LRB-",
"1",
"-RRB-",
"persons",
"converting",
"from",
"a",
"disease-free",
"state",
"to",
"having",
"diabetes",
";",
"-LRB-",
"2",
"-RRB-",
"diabetic",
"patients",
"immigrating",
"to",
"the",
"United",
"States",
";",
"and",
"-LRB-",
"3",
"-RRB-",
"persons",
"with",
"diabetes",
"moving",
"into",
"the",
"20",
"to",
"29-year-old",
"age",
"class.The",
"percentage",
"of",
"persons",
"with",
"diabetes",
",",
"which",
"is",
"calculated",
"thus",
":",
"percentage",
"diabetesTime",
"2",
"=",
"-LRB-",
"number",
"of",
"individuals",
"with",
"diabetesTime",
"2",
"/",
"total",
"populationTime",
"2",
"-RRB-",
"×",
"100",
".",
"The",
"estimate",
"of",
"future",
"diabetes",
"is",
"therefore",
"based",
"on",
"this",
"equation",
",",
"including",
"the",
"number",
"of",
"individuals",
"with",
"diabetes",
"in",
"the",
"previous",
"time",
"period",
",",
"conversion",
"to",
"diabetes",
",",
"migration",
",",
"and",
"mortality",
",",
"rather",
"than",
"being",
"a",
"linear",
"extrapolation",
"of",
"the",
"change",
"in",
"diabetes",
"prevalence",
"from",
"the",
"known",
"values",
"of",
"1991",
"and",
"2001",
".",
"Data",
"sets",
"The",
"NHANES",
"is",
"a",
"programme",
"of",
"surveys",
"conducted",
"by",
"the",
"National",
"Center",
"for",
"Health",
"Statistics",
"and",
"designed",
"to",
"assess",
"the",
"health",
"and",
"nutritional",
"status",
"of",
"adults",
"and",
"children",
"in",
"the",
"United",
"States",
".",
"The",
"survey",
"is",
"unique",
"on",
"a",
"national",
"level",
"in",
"that",
"it",
"combines",
"interviews",
"and",
"physical",
"examinations",
".",
"The",
"NHANES",
"uses",
"a",
"complex",
"multistage",
"sampling",
"design",
",",
"making",
"it",
"representative",
"of",
"the",
"non-institutionalised",
"US",
"population",
"and",
"allowing",
"weighted",
"estimates",
"to",
"be",
"computed",
".",
"For",
"this",
"study",
"we",
"used",
"several",
"of",
"the",
"NHANES",
"data",
"sets",
".",
"Specifically",
",",
"we",
"used",
"the",
"NHANES",
"III",
"-LRB-",
"1988",
"--",
"1994",
"-RRB-",
"-LRB-",
"unweighted",
"n",
"=",
"4,950",
"-RRB-",
"and",
"the",
"NHANES",
"1999",
"--",
"2002",
"-LRB-",
"unweighted",
"n",
"=",
"3,804",
"-RRB-",
"to",
"estimate",
"among",
"individuals",
"of",
"20",
"years",
"of",
"age",
"and",
"older",
"the",
"prevalence",
"of",
"diagnosed",
"diabetes",
",",
"the",
"total",
"diabetes",
"burden",
"-LRB-",
"diagnosed",
"and",
"undiagnosed",
"diabetes",
"-RRB-",
",",
"and",
"the",
"proportion",
"of",
"the",
"population",
"at",
"risk",
"of",
"developing",
"diabetes",
".",
"Since",
"mortality",
"within",
"the",
"population",
"affects",
"future",
"prevalence",
"-LSB-",
"20",
"-RSB-",
",",
"we",
"also",
"used",
"the",
"cohort",
"from",
"the",
"NHANES",
"II",
"mortality",
"survey",
"-LRB-",
"1976",
"--",
"1992",
"-RRB-",
"-LRB-",
"unweighted",
"n",
"=",
"3,916",
"-RRB-",
"to",
"provide",
"estimates",
"of",
"diabetes",
"mortality",
".",
"Computation",
"of",
"all",
"analyses",
"using",
"the",
"NHANES",
"data",
"sets",
"to",
"provide",
"nationally",
"representative",
"estimates",
"for",
"the",
"models",
"was",
"designed",
"to",
"account",
"for",
"the",
"complex",
"survey",
"design",
"and",
"the",
"appropriate",
"sample",
"weights",
".",
"All",
"analyses",
"were",
"conducted",
"using",
"SUDAAN",
"software",
"-LRB-",
"Research",
"Triangle",
"Institute",
",",
"Research",
"Triangle",
"Park",
",",
"NC",
",",
"USA",
"-RRB-",
".",
"Variables",
"used",
"in",
"models",
"Prevalence",
"of",
"diabetes",
"Diabetes",
"burden",
"was",
"assessed",
"as",
"diagnosed",
"diabetes",
"plus",
"undiagnosed",
"diabetes",
".",
"Because",
"of",
"the",
"substantial",
"proportion",
"of",
"people",
"with",
"undetected",
"diabetes",
",",
"we",
"focused",
"on",
"this",
"formula",
"for",
"total",
"diabetes",
",",
"rather",
"than",
"using",
"diagnosed",
"diabetes",
"to",
"indicate",
"diabetes",
"burden",
"in",
"the",
"population",
".",
"Moreover",
",",
"by",
"focusing",
"on",
"diabetes",
"as",
"diagnosed",
"and",
"undiagnosed",
"disease",
",",
"we",
"minimised",
"the",
"possible",
"impact",
"on",
"future",
"diabetes",
"prevalence",
"of",
"changes",
"in",
"screening",
"practices",
"for",
"diagnosing",
"diabetes",
"during",
"an",
"ensuing",
"time",
"period",
".",
"Diagnosed",
"diabetes",
"was",
"assessed",
"as",
"individuals",
"who",
"answered",
"yes",
"to",
"a",
"question",
"of",
"whether",
"a",
"doctor",
"had",
"told",
"them",
"they",
"had",
"diabetes",
".",
"Undiagnosed",
"diabetes",
"was",
"estimated",
"on",
"the",
"basis",
"of",
"individuals",
"who",
"said",
"they",
"had",
"not",
"had",
"a",
"previous",
"diagnosis",
"of",
"diabetes",
",",
"but",
"who",
"had",
"fasting",
"plasma",
"glucose",
"-LRB-",
"FPG",
"-RRB-",
">",
"7.0",
"mmol/l",
".",
"Although",
",",
"the",
"diagnostic",
"criteria",
"for",
"diabetes",
"during",
"the",
"time",
"between",
"the",
"NHANES",
"II",
"and",
"the",
"NHANES",
"III",
"changed",
"from",
"FPG",
">",
"7.8",
"mmol/l",
"to",
"FPG",
">",
"7.0",
"mmol/l",
",",
"we",
"used",
"the",
"newer",
"criteria",
"to",
"gain",
"an",
"awareness",
"of",
"the",
"total",
"diabetes",
"burden",
"at",
"each",
"point",
"in",
"time",
"using",
"the",
"same",
"criteria",
"-LSB-",
"21",
"-RSB-",
".",
"Persons",
"converting",
"from",
"a",
"disease-free",
"state",
"to",
"having",
"diabetes",
"Although",
"a",
"variety",
"of",
"diabetes",
"risk",
"scores",
"exist",
",",
"most",
"have",
"been",
"created",
"from",
"cross-sectional",
"studies",
"and",
"have",
"as",
"their",
"aim",
"the",
"identification",
"of",
"individuals",
"with",
"undiagnosed",
"diabetes",
".",
"Their",
"ability",
",",
"therefore",
",",
"to",
"make",
"predictions",
"on",
"development",
"of",
"diabetes",
"is",
"unknown",
"-LSB-",
"13",
",",
"14",
",",
"16",
"-RSB-",
".",
"The",
"risk",
"score",
"used",
"in",
"this",
"study",
"is",
"based",
"on",
"one",
"developed",
"for",
"the",
"Atherosclerosis",
"Risk",
"in",
"Communities",
"-LRB-",
"ARIC",
"-RRB-",
"cohort",
"study",
"-LSB-",
"18",
"-RSB-",
".",
"Among",
"individuals",
"without",
"diagnosed",
"diabetes",
"or",
"FPG",
">",
"7.0",
"mmol/l",
",",
"we",
"used",
"a",
"scoring",
"strategy",
"which",
"includes",
":",
"high",
"waist",
"circumference",
"-LRB-",
">",
"102",
"cm",
"in",
"men",
",",
">",
"88",
"cm",
"for",
"women",
"-RRB-",
",",
"raised",
"blood",
"pressure",
"-LRB-",
">",
"130/85",
"mmHg",
"or",
"antihypertensive",
"medications",
"-RRB-",
",",
"low",
"HDL-cholesterol",
"-LRB-",
"<",
"1.03",
"mmol/l",
"for",
"men",
",",
"<",
"1.29",
"mmol/l",
"for",
"women",
"-RRB-",
",",
"high",
"triacylglycerol",
"-LRB-",
">",
"1.7",
"mmol/l",
"-RRB-",
",",
"BMI",
">",
"30",
"kg/m2",
",",
"and",
"hyperglycaemia",
".",
"Each",
"of",
"the",
"characteristics",
"is",
"worth",
"1",
"point",
"except",
"for",
"hyperglycaemia",
",",
"which",
"can",
"be",
"worth",
"2",
"points",
"if",
"FPG",
"is",
">",
"5.6",
"mmol/l",
"or",
"5",
"points",
"when",
"FPG",
"is",
">",
"6.1",
"mmol/l",
".",
"A",
"score",
"of",
">",
"4",
"puts",
"an",
"individual",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
",",
"whether",
"diagnosed",
"or",
"undiagnosed",
".",
"A",
"score",
"of",
"<",
"4",
"indicates",
"that",
"a",
"person",
"has",
"a",
"low",
"risk",
"of",
"developing",
"diabetes",
".",
"This",
"particular",
"risk",
"score",
"was",
"chosen",
"for",
"several",
"reasons",
".",
"First",
",",
"it",
"has",
"moderate",
"sensitivity",
"-LRB-",
"68",
"%",
"-RRB-",
"and",
"specificity",
"-LRB-",
"75",
"%",
"-RRB-",
".",
"Second",
",",
"it",
"is",
"computed",
"in",
"a",
"reasonably",
"straightforward",
"manner",
"without",
"having",
"to",
"use",
"coefficients",
"from",
"the",
"ARIC",
"cohort",
"that",
"may",
"be",
"specific",
"to",
"that",
"cohort",
".",
"Third",
",",
"data",
"and",
"results",
"provided",
"in",
"the",
"study",
"by",
"Schmidt",
"et",
"al.",
"-LSB-",
"18",
"-RSB-",
"allowed",
"for",
"computation",
"of",
"the",
"rate",
"of",
"development",
"of",
"diabetes",
"in",
"both",
"the",
"high-risk",
"group",
"and",
"the",
"low-risk",
"group",
".",
"The",
"ratio",
"of",
"development",
"of",
"diabetes",
"in",
"the",
"high-risk",
"group",
"versus",
"the",
"low-risk",
"group",
"was",
"4.5:1",
".",
"Variables",
"needed",
"to",
"compute",
"this",
"diabetes",
"risk",
"score",
"are",
"available",
"only",
"in",
"the",
"NHANES",
"III",
"and",
"the",
"NHANES",
"1999",
"--",
"2002",
".",
"Although",
"the",
"ARIC",
"diabetes",
"risk",
"score",
"did",
"not",
"specifically",
"consider",
"race",
"or",
"age",
"in",
"the",
"computation",
"-LSB-",
"18",
"-RSB-",
",",
"we",
"computed",
"conversion",
"rates",
"for",
"10-year",
"age",
"classes",
"for",
"three",
"race/ethnic",
"groups",
"-LRB-",
"non-Hispanic",
"Whites",
",",
"non-Hispanic",
"Blacks",
"and",
"Hispanic",
"individuals",
"-RRB-",
"by",
"fitting",
"age",
"categories",
"for",
"the",
"data",
"from",
"1991",
"to",
"2001",
"and",
"then",
"fitting",
"race/ethnicity",
"on",
"to",
"the",
"same",
"time",
"change",
".",
"We",
"did",
"not",
"compute",
"specific",
"sex-specific",
"conversion",
"rates",
"because",
"sex",
"was",
"already",
"differentiated",
"in",
"several",
"of",
"the",
"variables",
"in",
"the",
"ARIC",
"diabetes",
"risk",
"score",
"-LSB-",
"18",
"-RSB-",
".",
"Migration",
"of",
"persons",
"with",
"diabetes",
"Migration",
"of",
"individuals",
"with",
"or",
"without",
"diabetes",
"into",
"the",
"population",
"can",
"also",
"affect",
"future",
"diabetes",
"prevalence",
".",
"Recent",
"projections",
"have",
"included",
"migration",
"within",
"their",
"models",
"-LSB-",
"5",
"-RSB-",
".",
"Because",
"we",
"are",
"looking",
"at",
"changes",
"in",
"diabetes",
"prevalence",
"among",
"adults",
",",
"migration",
"of",
"adults",
",",
"particularly",
"from",
"ethnic",
"minorities",
",",
"could",
"substantially",
"affect",
"the",
"10-year",
"projections",
".",
"We",
"used",
"data",
"from",
"the",
"NHANES",
"III",
"to",
"estimate",
"migration",
"of",
"persons",
"with",
"diabetes",
"in",
"the",
"20",
"years",
"and",
"older",
"age",
"groups",
".",
"The",
"NHANES",
"III",
"measured",
"how",
"many",
"years",
"foreign-born",
"immigrants",
"had",
"been",
"in",
"the",
"US",
".",
"Thus",
",",
"we",
"estimated",
"the",
"number",
"of",
"foreign-born",
"individuals",
"who",
"had",
"been",
"in",
"the",
"country",
"for",
"9",
"years",
"or",
"less",
"for",
"the",
"total",
"population",
"as",
"well",
"as",
"for",
"different",
"racial/ethnic",
"groups",
".",
"The",
"NHANES",
"III",
"data",
"allowed",
"us",
"to",
"make",
"estimates",
"for",
"non-Hispanic",
"Whites",
",",
"non-Hispanic",
"Blacks",
"and",
"Hispanic",
"individuals",
".",
"Persons",
"with",
"diabetes",
"moving",
"into",
"the",
"20",
"to",
"29-year-old",
"age",
"class",
"For",
"2011",
",",
"2021",
"and",
"2031",
"the",
"total",
"number",
"of",
"persons",
"with",
"diabetes",
"in",
"the",
"20",
"to",
"29-year-old",
"age",
"class",
"was",
"estimated",
"using",
"a",
"linear",
"projection",
"of",
"the",
"NHANES",
"III",
"and",
"NHANES",
"1999",
"--",
"2002",
"data",
".",
"The",
"proportion",
"of",
"20",
"to",
"29-year-olds",
"with",
"diabetes",
"in",
"each",
"race/ethnic",
"group",
"was",
"held",
"constant",
"at",
"the",
"proportions",
"found",
"in",
"the",
"NHANES",
"1999",
"--",
"2002",
"data",
"at",
"the",
"later",
"time",
"intervals",
".",
"Mortality",
"among",
"individuals",
"with",
"diabetes",
"Diabetes",
"mortality",
"for",
"the",
"total",
"population",
"was",
"based",
"on",
"data",
"from",
"the",
"NHANES",
"II",
"mortality",
"survey",
"-LRB-",
"1976",
"--",
"1992",
"-RRB-",
".",
"This",
"population-based",
"cohort",
"study",
"was",
"used",
"to",
"provide",
"estimates",
"of",
"diabetes",
"mortality",
",",
"since",
"mortality",
"within",
"the",
"population",
"affects",
"future",
"prevalence",
"-LSB-",
"20",
"-RSB-",
".",
"Diabetes",
"mortality",
"was",
"estimated",
"as",
"all-cause",
"mortality",
"among",
"individuals",
"with",
"diabetes",
"-LRB-",
"either",
"diagnosed",
"or",
"undiagnosed",
"-RRB-",
"at",
"baseline",
",",
"rather",
"than",
"as",
"mortality",
"with",
"diabetes",
"listed",
"as",
"the",
"cause",
"of",
"death",
".",
"This",
"definition",
"is",
"more",
"consistent",
"with",
"the",
"potential",
"impact",
"of",
"diabetes",
"on",
"future",
"prevalence",
".",
"Mortality",
"estimates",
"were",
"computed",
"separately",
"for",
"the",
"total",
"population",
"by",
"age",
"classes",
".",
"The",
"NHANES",
"II",
"mortality",
"cohort",
"is",
"based",
"on",
"a",
"sample",
"of",
"individuals",
"aged",
"30",
"to",
"75",
",",
"whereas",
"we",
"made",
"diabetes",
"estimates",
"on",
"individuals",
"aged",
"20",
"years",
"and",
"older",
".",
"Consequently",
",",
"we",
"assumed",
"no",
"deaths",
"due",
"to",
"diabetes",
"in",
"the",
"20",
"to",
"29-year-old",
"age",
"group",
"over",
"the",
"10-year",
"period",
".",
"Population",
"estimates",
"Total",
"population",
"of",
"10-year",
"age",
"classes",
"was",
"estimated",
"using",
"data",
"from",
"NHANES",
"III",
"for",
"1991",
",",
"NHANES",
"1999",
"--",
"2002",
"for",
"2001",
",",
"and",
"US",
"Census",
"Bureau",
",",
"Middle",
"Series",
"projections",
"for",
"2011",
",",
"2021",
"and",
"2031",
"-LSB-",
"22",
"-RSB-",
".",
"Total",
"population",
"of",
"race/ethnic",
"groups",
"was",
"also",
"determined",
"by",
"10-year",
"age",
"classes",
"using",
"the",
"same",
"sources",
"of",
"information",
".",
"Analysis",
"In",
"an",
"effort",
"to",
"provide",
"an",
"estimate",
"of",
"future",
"trends",
"in",
"diabetes",
"and",
"the",
"population",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
",",
"we",
"employed",
"the",
"following",
"procedure",
".",
"We",
"used",
"the",
"NHANES",
"III",
"data",
"to",
"fit",
"a",
"model",
"to",
"predict",
"total",
"diabetes",
"in",
"the",
"NHANES",
"1999",
"--",
"2002",
".",
"We",
"used",
"this",
"strategy",
"prior",
"to",
"making",
"future",
"projections",
",",
"because",
"it",
"allowed",
"us",
"to",
"develop",
"and",
"fit",
"the",
"model",
"to",
"an",
"existing",
"national",
"estimate",
"of",
"diabetes",
"prevalence",
".",
"Because",
"both",
"the",
"NHANES",
"III",
"and",
"the",
"NHANES",
"1999",
"--",
"2002",
"are",
"based",
"on",
"multi-year",
"data",
"collection",
",",
"we",
"estimated",
"a",
"mid-point",
"of",
"1991",
"and",
"2001",
"for",
"the",
"two",
"surveys",
".",
"The",
"number",
"of",
"persons",
"with",
"diabetes",
"10",
"years",
"post-baseline",
"was",
"calculated",
"for",
"10-year",
"age",
"classes",
"by",
"first",
"adding",
"baseline",
"prevalence",
"and",
"incidence",
"-LRB-",
"the",
"number",
"of",
"low-risk",
"and",
"number",
"of",
"high-risk",
"persons",
"who",
"developed",
"diabetes",
"over",
"the",
"10-year",
"interval",
"-RRB-",
",",
"then",
"adding",
"persons",
"with",
"diabetes",
"who",
"immigrated",
"to",
"the",
"United",
"States",
",",
"and",
"persons",
"with",
"diabetes",
"who",
"moved",
"into",
"the",
"20",
"to",
"29-year-old",
"age",
"class",
",",
"and",
"finally",
"subtracting",
"the",
"number",
"of",
"diabetic",
"subjects",
"who",
"died",
".",
"Percentage",
"of",
"persons",
"with",
"diabetes",
"was",
"estimated",
"for",
"each",
"time",
"period",
"by",
"taking",
"the",
"total",
"number",
"of",
"persons",
"with",
"diabetes",
"and",
"dividing",
"by",
"the",
"expected",
"total",
"population",
",",
"then",
"multiplying",
"by",
"100",
".",
"Varying",
"model",
"assumptions",
"Our",
"initial",
"predictions",
"of",
"future",
"diabetes",
"burden",
"were",
"based",
"on",
"the",
"assumption",
"of",
"a",
"constant",
"proportion",
"of",
"individuals",
"at",
"high",
"risk",
"of",
"diabetes",
"at",
"the",
"levels",
"present",
"in",
"the",
"NHANES",
"1999",
"--",
"2002",
".",
"To",
"account",
"for",
"potential",
"changes",
"in",
"the",
"proportion",
"of",
"persons",
"at",
"high",
"risk",
"of",
"diabetes",
",",
"we",
"also",
"evaluated",
"increases",
"in",
"the",
"proportion",
"of",
"persons",
"at",
"high",
"risk",
"by",
"10",
",",
"20",
"and",
"30",
"%",
",",
"as",
"well",
"as",
"estimates",
"based",
"on",
"decreases",
"in",
"the",
"proportion",
"of",
"persons",
"at",
"high",
"risk",
"by",
"10",
",",
"20",
"and",
"30",
"%",
".",
"Theoretically",
",",
"it",
"is",
"unlikely",
"that",
"the",
"proportion",
"of",
"persons",
"at",
"high",
"risk",
"will",
"remain",
"stable",
",",
"because",
"from",
"NHANES",
"III",
"to",
"NHANES",
"1999",
"--",
"2002",
"the",
"proportion",
"at",
"high",
"risk",
"was",
"seen",
"to",
"increase",
".",
"Also",
",",
"a",
"major",
"risk",
"factor",
"for",
"diabetes",
",",
"obesity",
",",
"has",
"increased",
"substantially",
"over",
"a",
"40-year",
"time",
"period",
"-LSB-",
"10",
",",
"12",
"-RSB-",
".",
"We",
"evaluated",
"the",
"effect",
"of",
"decreasing",
"proportions",
"at",
"high",
"risk",
",",
"to",
"account",
"for",
"the",
"possibility",
"that",
"interventions",
"to",
"improve",
"lifestyle",
"of",
"adults",
"in",
"the",
"US",
"may",
"be",
"effective",
".",
"In",
"addition",
",",
"to",
"address",
"the",
"potential",
"impact",
"on",
"mortality",
"of",
"healthcare",
"interventions",
"in",
"management",
"of",
"diabetes",
",",
"we",
"examined",
"potential",
"reductions",
"of",
"10",
",",
"20",
"and",
"30",
"%",
"in",
"mortality",
"among",
"individuals",
"with",
"diabetes",
".",
"Finally",
",",
"we",
"computed",
"a",
"model",
"examining",
"a",
"combination",
"of",
"effects",
",",
"assuming",
"that",
"lifestyle",
"interventions",
"would",
"yield",
"a",
"10",
"%",
"decrease",
"of",
"persons",
"at",
"high",
"risk",
"and",
"healthcare",
"interventions",
"would",
"yield",
"a",
"10",
"%",
"decrease",
"in",
"mortality",
"of",
"persons",
"with",
"diabetes",
".",
"Results",
"Table",
"1",
"shows",
"estimates",
"of",
"the",
"total",
"diabetes",
"burden",
"from",
"the",
"NHANES",
"III",
"and",
"the",
"NHANES",
"1999",
"--",
"2002",
"and",
"the",
"future",
"10-year",
"projections",
"for",
"2011",
"through",
"to",
"2031",
".",
"The",
"number",
"of",
"individuals",
"at",
"high",
"risk",
"of",
"diabetes",
"based",
"on",
"the",
"multivariable",
"diabetes",
"risk",
"score",
"was",
"38.4",
"million",
"in",
"1991",
"and",
"49.9",
"million",
"in",
"2001",
".",
"Using",
"our",
"model",
"to",
"predict",
"the",
"known",
"diabetes",
"prevalence",
"in",
"2001",
"from",
"the",
"1991",
"data",
",",
"results",
"were",
"satisfactory",
"and",
"within",
"0.2",
"%",
"of",
"the",
"actual",
"population",
"prevalence",
"of",
"total",
"diabetes",
".",
"If",
"the",
"proportion",
"of",
"individuals",
"at",
"high",
"risk",
"within",
"the",
"adult",
"population",
"remains",
"stable",
"at",
"2001",
"levels",
",",
"we",
"could",
"expect",
"55.8",
"million",
"in",
"2011",
",",
"60.9",
"million",
"in",
"2021",
",",
"and",
"66.1",
"million",
"in",
"2031",
".",
"As",
"can",
"be",
"seen",
",",
"the",
"prevalence",
"of",
"diabetes",
"is",
"projected",
"to",
"increase",
".",
"The",
"diabetes",
"prevalence",
"of",
"6.3",
"%",
"in",
"1991",
"and",
"8.8",
"%",
"in",
"2001",
"is",
"projected",
"to",
"increase",
"to",
"14.5",
"%",
"in",
"2031",
"with",
"37.7",
"million",
"adults",
"having",
"diagnosed",
"or",
"undiagnosed",
"diabetes",
".",
"Assuming",
"stability",
"in",
"the",
"population",
"proportion",
"of",
"individuals",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
",",
"the",
"rate",
"of",
"increase",
"in",
"the",
"number",
"of",
"individuals",
"with",
"diabetes",
"and",
"the",
"proportion",
"with",
"diabetes",
"tends",
"to",
"slow",
"over",
"time",
".",
"Among",
"individuals",
"aged",
"30",
"to",
"39",
"years",
"who",
"are",
"not",
"currently",
"targeted",
"for",
"screening",
"according",
"to",
"age",
",",
"the",
"prevalence",
"of",
"diabetes",
"is",
"expected",
"to",
"rise",
"from",
"3.7",
"%",
"in",
"2001",
"to",
"5.2",
"%",
"in",
"2031",
".",
"Table",
"1Number",
"of",
"people",
"-LRB-",
"in",
"millions",
"of",
"persons",
"-RRB-",
"with",
"and",
"prevalence",
"of",
"diabetes",
"by",
"year",
"and",
"age",
"categoryAge",
"-LRB-",
"in",
"years",
"-RRB-",
"NHANES",
"IIINHANES",
"1999",
"--",
"200220112021203120",
"--",
"29Number0",
".20.40.50.70.9",
"Percentage0",
".51.01.31.72.030",
"--",
"39Number0",
".61.61.82.12.3",
"Percentage1",
".43.74.75.05.240",
"--",
"49Number1",
".53.54.34.34.9",
"Percentage4",
".58.110.311.111.250",
"--",
"59Number2",
".53.96.67.26.9",
"Percentage11",
".412.215.617.718.260",
"--",
"69Number3",
".14.16.59.810.2",
"Percentage15",
".319.822.025.126.6",
">",
"70Number3",
".24.15.78.412.4",
"Percentage16",
".217.420.522.623.9",
"TotalNumber11",
".117.525.432.637.7",
"Percentage6",
".38.811.513.514.5",
"NHANES",
"National",
"Health",
"and",
"Nutrition",
"Examination",
"Survey",
"The",
"results",
"shown",
"in",
"Electronic",
"supplementary",
"material",
"-LRB-",
"ESM",
"-RRB-",
"Table",
"1",
"show",
"the",
"projected",
"prevalence",
"of",
"diabetes",
"according",
"to",
"different",
"racial/ethnic",
"groups",
".",
"Non-Hispanic",
"White",
"adults",
"are",
"projected",
"to",
"continue",
"to",
"have",
"a",
"lower",
"prevalence",
"of",
"diabetes",
"than",
"both",
"non-Hispanic",
"Black",
"and",
"Hispanic",
"individuals",
".",
"By",
"2031",
",",
"the",
"Hispanic",
"community",
"will",
"have",
"an",
"overwhelming",
"diabetes",
"burden",
",",
"with",
"more",
"than",
"20",
"percent",
"of",
"the",
"adult",
"population",
"having",
"diabetes",
".",
"The",
"projections",
"in",
"ESM",
"Table",
"2",
"are",
"based",
"on",
"different",
"assumptions",
"regarding",
"changes",
"in",
"the",
"number",
"of",
"individuals",
"who",
"are",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
"and",
"changes",
"in",
"mortality",
"among",
"individuals",
"with",
"diabetes",
".",
"As",
"might",
"be",
"expected",
",",
"as",
"mortality",
"decreases",
"the",
"prevalence",
"of",
"diabetes",
"increases",
"in",
"the",
"subsequent",
"10",
"years",
".",
"The",
"estimate",
"for",
"2031",
"indicates",
"that",
"potential",
"decreases",
"in",
"mortality",
"and",
"a",
"potential",
"decrease",
"in",
"individuals",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
"yields",
"a",
"prevalence",
"similar",
"to",
"that",
"achieved",
"if",
"the",
"proportion",
"at",
"high",
"risk",
"is",
"kept",
"stable",
"from",
"2001",
".",
"All",
"of",
"these",
"estimates",
"indicate",
"a",
"larger",
"diabetes",
"burden",
"among",
"Hispanics",
".",
"Discussion",
"This",
"national",
"projection",
"of",
"diabetes",
"prevalence",
"for",
"the",
"US",
"is",
"the",
"first",
"to",
"model",
"the",
"projection",
"on",
"the",
"number",
"of",
"individuals",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
"using",
"a",
"multivariable",
"risk",
"assessment",
".",
"Projections",
"suggest",
"a",
"rising",
"and",
"substantial",
"diabetes",
"burden",
"for",
"the",
"population",
".",
"Hispanic",
"adults",
"will",
"be",
"most",
"affected",
",",
"with",
"estimates",
"suggesting",
"that",
"by",
"2031",
"more",
"than",
"20",
"%",
"of",
"the",
"adult",
"Hispanic",
"community",
"will",
"have",
"diabetes",
".",
"These",
"results",
"are",
"particularly",
"worrisome",
"for",
"this",
"community",
"in",
"light",
"of",
"recent",
"evidence",
"that",
"the",
"gap",
"in",
"healthcare",
"quality",
"between",
"Hispanic",
"and",
"non-Hispanic",
"White",
"individuals",
"has",
"continued",
"to",
"widen",
"-LSB-",
"23",
"-RSB-",
".",
"Many",
"previous",
"diabetes",
"projections",
"have",
"been",
"limited",
"to",
"estimates",
"of",
"diagnosed",
"diabetes",
"and",
"thus",
"have",
"lower",
"estimates",
"of",
"projected",
"diabetes",
"burden",
",",
"and",
"have",
"not",
"incorporated",
"an",
"evaluation",
"of",
"the",
"population",
"at",
"high",
"risk",
"of",
"diabetes",
",",
"with",
"clinical",
"indicators",
",",
"into",
"their",
"models",
"-LSB-",
"5",
",",
"9",
"-RSB-",
".",
"Our",
"estimates",
"will",
"be",
"less",
"likely",
"to",
"be",
"affected",
"by",
"changes",
"in",
"screening",
"strategies",
".",
"Additionally",
",",
"they",
"incorporate",
"potential",
"changes",
"in",
"the",
"level",
"of",
"risk",
"for",
"diabetes",
"in",
"the",
"US",
"population",
",",
"a",
"change",
"which",
"is",
"likely",
"given",
"national",
"trends",
"in",
"obesity",
"-LSB-",
"3",
"-RSB-",
".",
"Moreover",
",",
"recent",
"data",
"have",
"suggested",
"that",
"individuals",
"with",
"undiagnosed",
"diabetes",
"are",
"similar",
"to",
"those",
"with",
"diagnosed",
"diabetes",
"with",
"regard",
"to",
"the",
"development",
"of",
"complications",
";",
"thus",
"our",
"estimates",
"are",
"more",
"robust",
"in",
"describing",
"the",
"burden",
"of",
"disease",
"in",
"the",
"population",
"-LSB-",
"24",
"-RSB-",
".",
"Comparing",
"our",
"projections",
"with",
"those",
"from",
"other",
"studies",
",",
"we",
"note",
"that",
"an",
"estimate",
",",
"published",
"in",
"2006",
",",
"for",
"diagnosed",
"diabetes",
"in",
"the",
"US",
"among",
"individuals",
"aged",
"20",
"to",
"64",
"years",
"in",
"2030",
"is",
"16.8",
"million",
"-LSB-",
"25",
"-RSB-",
".",
"Our",
"estimates",
"are",
"based",
"both",
"on",
"diagnosed",
"and",
"undiagnosed",
"diabetes",
",",
"and",
"our",
"projection",
"of",
"total",
"diabetes",
"among",
"that",
"age",
"group",
"for",
"2031",
"is",
"higher",
",",
"namely",
"19",
"million",
".",
"It",
"is",
"possible",
"that",
"estimates",
"based",
"solely",
"on",
"diagnosed",
"diabetes",
"could",
"become",
"more",
"consistent",
"with",
"our",
"estimates",
",",
"if",
"greater",
"vigilance",
"were",
"shown",
"for",
"screening",
"for",
"undiagnosed",
"diabetes",
".",
"However",
",",
"not",
"accounting",
"for",
"the",
"at-risk",
"population",
"in",
"the",
"estimates",
"is",
"likely",
"to",
"lead",
"to",
"inaccurate",
"estimates",
".",
"A",
"comparison",
"of",
"our",
"estimates",
"of",
"total",
"diabetes",
"with",
"those",
"of",
"another",
"study",
"-LSB-",
"7",
"-RSB-",
",",
"which",
"projected",
"total",
"diabetes",
"but",
"did",
"not",
"account",
"for",
"the",
"population",
"at",
"high",
"risk",
"of",
"developing",
"diabetes",
",",
"reveals",
"that",
"the",
"latter",
"'s",
"projections",
"are",
"most",
"probably",
"underestimates",
".",
"Using",
"data",
"from",
"1993",
",",
"the",
"investigators",
"projected",
"a",
"population",
"prevalence",
"estimate",
"of",
"total",
"diabetes",
"in",
"the",
"US",
"among",
"individuals",
"aged",
"20",
"years",
"and",
"older",
"for",
"the",
"year",
"2000",
"to",
"be",
"7.6",
"%",
",",
"while",
"the",
"NHANES",
"1999",
"--",
"2002",
"yielded",
"a",
"prevalence",
"of",
"8.8",
"%",
".",
"For",
"2025",
"the",
"same",
"team",
"-LSB-",
"7",
"-RSB-",
"projected",
"a",
"prevalence",
"of",
"8.9",
"%",
"versus",
"13.5",
"%",
"for",
"2021",
"in",
"our",
"study",
".",
"The",
"results",
"have",
"several",
"implications",
"for",
"the",
"delivery",
"of",
"healthcare",
"and",
"healthcare",
"financing",
".",
"First",
",",
"we",
"estimated",
"our",
"models",
"under",
"several",
"assumptions",
"for",
"the",
"number",
"of",
"individuals",
"at",
"high",
"risk",
"of",
"diabetes",
"in",
"the",
"population",
".",
"Regardless",
"of",
"these",
"assumptions",
",",
"the",
"US",
"will",
"have",
"a",
"substantial",
"number",
"of",
"individuals",
"at",
"high",
"risk",
"of",
"diabetes",
"in",
"2011",
",",
"2021",
"and",
"2031",
".",
"Interventions",
"to",
"modify",
"lifestyle",
"are",
"critical",
"to",
"decrease",
"the",
"number",
"of",
"individuals",
"at",
"high",
"risk",
",",
"and",
"consequently",
"to",
"lower",
"the",
"expected",
"increase",
"in",
"diabetes",
"in",
"the",
"future",
".",
"Although",
"some",
"of",
"the",
"diabetes",
"estimates",
"suggest",
"seemingly",
"small",
"decreases",
"in",
"future",
"prevalence",
",",
"based",
"on",
"decreases",
"in",
"the",
"population",
"at",
"risk",
",",
"the",
"actual",
"numbers",
"are",
"substantial",
".",
"For",
"example",
",",
"a",
"one-percentage",
"point",
"drop",
"in",
"the",
"US",
"population",
"estimate",
"of",
"diabetes",
"among",
"individuals",
"aged",
"20",
"and",
"older",
"in",
"2031",
"is",
"quite",
"substantial",
"and",
"would",
"account",
"for",
"a",
"decrease",
"in",
"prevalence",
"of",
"diabetes",
"equivalent",
"to",
"2,600,000",
"people",
".",
"Second",
",",
"the",
"projection",
"that",
"a",
"substantial",
"proportion",
"of",
"the",
"population",
"will",
"have",
"diabetes",
"indicates",
"greater",
"spending",
"will",
"be",
"necessary",
"to",
"manage",
"the",
"disease",
".",
"This",
"will",
"include",
"spending",
"on",
"drugs",
",",
"ongoing",
"monitoring",
",",
"and",
"treating",
"of",
"complications",
"including",
"nephropathy",
",",
"retinopathy",
",",
"and",
"cardiovascular",
"disease",
".",
"Third",
",",
"the",
"disproportionate",
"impact",
"of",
"diabetes",
"on",
"minorities",
",",
"particularly",
"Hispanics",
",",
"demands",
"new",
"intervention",
"strategies",
"to",
"decrease",
"the",
"number",
"of",
"individuals",
"at",
"high",
"risk",
"and",
"to",
"deliver",
"care",
"to",
"individuals",
"who",
"have",
"historically",
"had",
"poor",
"access",
"to",
"care",
".",
"Additionally",
",",
"with",
"the",
"projected",
"increase",
"in",
"diabetes",
"prevalence",
"among",
"30",
"to",
"39-year-olds",
",",
"a",
"population",
"not",
"currently",
"targeted",
"for",
"screening",
",",
"a",
"re-examination",
"of",
"current",
"public",
"health",
"policy",
"and",
"screening",
"strategies",
"may",
"be",
"warranted",
"-LSB-",
"26",
"-RSB-",
".",
"There",
"are",
"several",
"strengths",
"to",
"the",
"design",
"of",
"this",
"study",
".",
"One",
"is",
"that",
"the",
"study",
"utilised",
"multiple",
"NHANES",
"data",
"sets",
",",
"which",
"have",
"the",
"advantage",
"of",
"allowing",
"for",
"nationally",
"representative",
"population",
"estimates",
".",
"Thus",
",",
"the",
"initial",
"data",
"used",
"to",
"fit",
"the",
"model",
"as",
"well",
"as",
"to",
"make",
"mortality",
"estimates",
"of",
"diabetes",
",",
"both",
"diagnosed",
"and",
"undiagnosed",
",",
"are",
"nationally",
"representative",
".",
"Another",
"strength",
"is",
"that",
"this",
"study",
"is",
"the",
"first",
"to",
"make",
"a",
"nationally",
"representative",
"assessment",
"of",
"the",
"at-risk",
"population",
"for",
"development",
"of",
"diabetes",
"and",
"then",
"use",
"that",
"assessment",
"to",
"model",
"the",
"future",
"prevalence",
"of",
"diabetes",
".",
"The",
"assessment",
"of",
"risk",
"used",
",",
"moreover",
",",
"is",
"based",
"on",
"the",
"ARIC",
"diabetes",
"risk",
"score",
"-LSB-",
"18",
"-RSB-",
",",
"a",
"multivariable",
"risk",
"score",
"that",
"used",
"clinical",
"indicators",
".",
"When",
"interpreting",
"our",
"results",
",",
"however",
",",
"several",
"limitations",
"need",
"to",
"be",
"considered",
".",
"Thus",
",",
"although",
"this",
"is",
"the",
"first",
"study",
"to",
"use",
"a",
"validated",
"diabetes",
"risk",
"score",
"to",
"assess",
"the",
"high-risk",
"population",
"for",
"the",
"development",
"of",
"diabetes",
"for",
"the",
"entire",
"US",
"population",
",",
"potential",
"limitations",
"exist",
"with",
"regard",
"to",
"the",
"diabetes",
"risk",
"score",
".",
"The",
"ARIC",
"diabetes",
"risk",
"score",
"-LSB-",
"18",
"-RSB-",
"was",
"based",
"on",
"a",
"cohort",
"of",
"individuals",
"aged",
"45",
"to",
"64",
"years",
"at",
"baseline",
"and",
"may",
"therefore",
"be",
"limited",
"when",
"estimating",
"diabetes",
"development",
"among",
"individuals",
"aged",
"20",
"years",
"and",
"older",
".",
"However",
",",
"we",
"estimated",
"diabetes",
"prevalence",
"in",
"10-year",
"age",
"increments",
".",
"Moreover",
",",
"the",
"risk",
"score",
"'s",
"moderate",
"sensitivity",
"and",
"specificity",
"may",
"cause",
"the",
"model",
"to",
"under",
"-",
"or",
"potentially",
"overestimate",
"future",
"prevalence",
"projections",
".",
"Another",
"possible",
"limitation",
"is",
"that",
"estimates",
"of",
"future",
"disease",
"burden",
"are",
"based",
"on",
"assumptions",
"about",
"the",
"number",
"at",
"risk",
"of",
"disease",
"and",
"about",
"mortality",
"within",
"the",
"population",
".",
"We",
"have",
"attempted",
"to",
"address",
"this",
"limitation",
"by",
"presenting",
"the",
"results",
"of",
"a",
"sensitivity",
"analysis",
",",
"which",
"includes",
"variations",
"in",
"the",
"proportion",
"of",
"the",
"population",
"at",
"risk",
"and",
"in",
"mortality",
".",
"The",
"third",
"limitation",
"is",
"the",
"diagnosis",
"of",
"diabetes",
"in",
"the",
"NHANES",
"data",
"on",
"the",
"basis",
"of",
"a",
"single",
"FPG",
"value",
".",
"This",
"strategy",
",",
"although",
"common",
"in",
"epidemiological",
"studies",
",",
"could",
"potentially",
"underestimate",
"the",
"prevalence",
"of",
"diabetes",
"associated",
"with",
"isolated",
"post-challenge",
"hyperglycaemia",
",",
"which",
"occurs",
"more",
"commonly",
"in",
"women",
",",
"the",
"elderly",
",",
"and",
"in",
"lean",
"populations",
".",
"It",
"could",
"also",
"overestimate",
"diabetes",
"prevalence",
",",
"because",
"a",
"clinical",
"diagnosis",
"of",
"diabetes",
"in",
"asymptomatic",
"patients",
"requires",
"two",
"abnormal",
"fasting",
"glucose",
"levels",
".",
"In",
"summary",
",",
"a",
"continued",
"focus",
"on",
"effective",
"interventions",
"for",
"lifestyle",
"modifications",
"to",
"decrease",
"diabetes",
"risk",
",",
"as",
"well",
"as",
"vigilant",
"ascertainment",
"of",
"diabetes",
",",
"appears",
"crucial",
"if",
"the",
"future",
"prevalence",
"and",
"burden",
"of",
"diabetes",
"in",
"the",
"US",
"population",
"are",
"to",
"be",
"adequately",
"addressed",
".",
"This",
"is",
"especially",
"important",
"for",
"minority",
"populations",
",",
"particularly",
"the",
"Hispanic",
"community",
",",
"which",
"is",
"projected",
"to",
"have",
"an",
"overwhelming",
"future",
"diabetes",
"burden",
".",
"Considering",
"that",
"minorities",
"have",
"historically",
"had",
"limited",
"access",
"to",
"healthcare",
",",
"these",
"findings",
"emphasise",
"the",
"importance",
"of",
"interventions",
"targeting",
"these",
"populations",
".",
"Electronic",
"supplementary",
"material",
"Below",
"is",
"the",
"link",
"to",
"the",
"electronic",
"supplementary",
"material",
".",
"Table",
"1",
"Projections",
"of",
"non-Hispanic",
"White",
",",
"non-Hispanic",
"Black",
"and",
"Hispanic",
"persons",
"with",
"diabetesa",
"and",
"prevalence",
"in",
"2011",
",",
"2021",
",",
"and",
"2031",
"-LRB-",
"43",
"kb",
"-RRB-",
"Table",
"2",
"Projections",
",",
"using",
"different",
"assumptions",
",",
"of",
"diabetes",
"prevalence",
"among",
"individuals",
"aged",
">",
"20",
"years",
"in",
"2031",
"-LRB-",
"32",
"kb",
"-RRB-"
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Calcif_Tissue_Int-3-1-1914224 | [
"The",
"-1997",
"G/T",
"and",
"Sp1",
"Polymorphisms",
"in",
"the",
"Collagen",
"Type",
"I",
"alpha1",
"-LRB-",
"COLIA1",
"-RRB-",
"Gene",
"in",
"Relation",
"to",
"Changes",
"in",
"Femoral",
"Neck",
"Bone",
"Mineral",
"Density",
"and",
"the",
"Risk",
"of",
"Fracture",
"in",
"the",
"Elderly",
":",
"The",
"Rotterdam",
"Study",
"The",
"COLIA1",
"Sp1",
"polymorphism",
"has",
"been",
"associated",
"with",
"bone",
"mineral",
"density",
"-LRB-",
"BMD",
"-RRB-",
"and",
"fracture",
".",
"A",
"promoter",
"polymorphism",
",",
"-1997",
"G/T",
",",
"also",
"has",
"been",
"associated",
"with",
"BMD",
".",
"In",
"this",
"study",
",",
"we",
"examined",
"whether",
"these",
"polymorphisms",
"alone",
"and",
"in",
"the",
"form",
"of",
"haplotypes",
"influence",
"bone",
"parameters",
"and",
"fracture",
"risk",
"in",
"a",
"large",
"population-based",
"cohort",
"of",
"elderly",
"Caucasians",
".",
"We",
"determined",
"the",
"COLIA1",
"-1997",
"G/T",
"-LRB-",
"promoter",
"-RRB-",
"and",
"Sp1",
"G/T",
"-LRB-",
"intron",
"-RRB-",
"polymorphisms",
"in",
"6,280",
"individuals",
"and",
"inferred",
"haplotypes",
".",
"Femoral",
"neck",
"BMD",
"and",
"BMD",
"change",
"were",
"compared",
"across",
"COLIA1",
"genotypes",
"at",
"baseline",
"and",
"follow-up",
"-LRB-",
"mean",
"6.5",
"years",
"-RRB-",
".",
"We",
"also",
"investigated",
"the",
"relationship",
"between",
"the",
"COLIA1",
"polymorphisms",
"and",
"incident",
"nonvertebral",
"fractures",
",",
"which",
"were",
"recorded",
"during",
"a",
"mean",
"follow-up",
"period",
"of",
"7.4",
"years",
".",
"Vertebral",
"fractures",
"were",
"assessed",
"by",
"radiographs",
"on",
"3,456",
"genotyped",
"individuals",
".",
"Femoral",
"neck",
"BMD",
"measured",
"at",
"baseline",
"was",
"3.8",
"%",
"lower",
"in",
"women",
"carrying",
"two",
"copies",
"of",
"the",
"T-Sp1",
"allele",
"-LRB-",
"P",
"for",
"trend",
"=",
"0.03",
"-RRB-",
".",
"No",
"genotype",
"dependent",
"differences",
"in",
"BMD",
"loss",
"were",
"observed",
".",
"In",
"women",
"homozygous",
"for",
"the",
"T",
"allele",
"of",
"the",
"Sp1",
"polymorphism",
",",
"the",
"risk",
"of",
"fragility",
"fracture",
"increased",
"2.3",
"times",
"-LRB-",
"95",
"%",
"confidence",
"interval",
"1.4",
"--",
"3.9",
",",
"P",
"=",
"0.001",
"-RRB-",
".",
"No",
"such",
"association",
"was",
"observed",
"with",
"the",
"promoter",
"polymorphism",
".",
"In",
"men",
",",
"no",
"association",
"with",
"either",
"the",
"Sp1",
"or",
"the",
"-1997",
"G/T",
"promoter",
"polymorphism",
"was",
"seen",
"with",
"BMD",
"or",
"fracture",
".",
"High",
"linkage",
"disequilibrium",
"-LRB-",
"LD",
";",
"D",
"′",
"=",
"0.99",
",",
"r2",
"=",
"0.03",
"-RRB-",
"exists",
"between",
"the",
"two",
"studied",
"polymorphisms",
".",
"We",
"observed",
"three",
"haplotypes",
"in",
"our",
"population",
":",
"haplotype",
"1",
"-LRB-",
"Gpromoter",
"--",
"Gintron",
"-RRB-",
"frequency",
"-LRB-",
"f",
"-RRB-",
"=",
"69",
"%",
",",
"haplotype",
"2",
"-LRB-",
"Gpromoter",
"--",
"Tintron",
"-RRB-",
"f",
"=",
"17.6",
"%",
",",
"and",
"haplotype",
"3",
"-LRB-",
"Tpromoter",
"--",
"Gintron",
"-RRB-",
"f",
"=",
"13.4",
"%",
".",
"Haplotype",
"2",
"was",
"associated",
"with",
"a",
"2.1-fold",
"increased",
"risk",
"of",
"fragility",
"fracture",
"in",
"women",
"-LRB-",
"95",
"%",
"confidence",
"interval",
"1.2",
"--",
"3.7",
",",
"P",
"=",
"0.001",
"-RRB-",
".",
"We",
"confirm",
"that",
"the",
"COLIA1",
"Sp1",
"polymorphism",
"influences",
"BMD",
"and",
"the",
"risk",
"of",
"fracture",
"in",
"postmenopausal",
"Caucasian",
"women",
".",
"In",
"contrast",
",",
"we",
"found",
"no",
"independent",
"effect",
"of",
"the",
"-1997",
"G/T",
"promoter",
"polymorphism",
"on",
"BMD",
"or",
"fracture",
".",
"Introduction",
"Osteoporosis",
"is",
"a",
"multifactorial",
"disease",
"with",
"both",
"genetic",
"and",
"environmental",
"determinants",
".",
"It",
"is",
"characterized",
"by",
"a",
"reduction",
"in",
"bone",
"mineral",
"density",
"-LRB-",
"BMD",
"-RRB-",
"and",
"microarchitectural",
"deterioration",
"of",
"bone",
"tissue",
",",
"which",
"leads",
"to",
"an",
"increased",
"risk",
"of",
"fracture",
"in",
"later",
"life",
"-LSB-",
"1",
",",
"2",
"-RSB-",
".",
"Being",
"a",
"predictor",
"of",
"bone",
"fragility",
"and",
"susceptibility",
"to",
"fracture",
",",
"BMD",
"is",
"used",
"for",
"the",
"diagnosis",
"of",
"osteoporosis",
"-LSB-",
"3",
",",
"4",
"-RSB-",
".",
"The",
"risk",
"of",
"fracture",
"is",
"dependent",
"not",
"only",
"on",
"BMD",
"but",
"also",
"on",
"geometry",
",",
"architecture",
",",
"material",
"properties",
",",
"and",
"mass",
"distribution",
"-LSB-",
"5",
"-RSB-",
".",
"The",
"skeletal",
"determinants",
"of",
"osteoporotic",
"fracture",
"risk",
"such",
"as",
"BMD",
",",
"bone",
"loss",
",",
"and",
"bone",
"geometry",
"are",
"all",
"subject",
"to",
"strong",
"genetic",
"influences",
"-LSB-",
"2",
",",
"6",
",",
"7",
"-RSB-",
".",
"It",
"has",
"been",
"estimated",
"from",
"twin",
"studies",
"that",
"60-80",
"%",
"of",
"the",
"variance",
"in",
"BMD",
"is",
"attributable",
"to",
"genetic",
"factors",
"-LSB-",
"8",
",",
"9",
"-RSB-",
".",
"Several",
"genes",
"are",
"thought",
"to",
"be",
"involved",
"in",
"the",
"pathogenesis",
"of",
"osteoporosis",
".",
"Collagen",
"type",
"I",
"alpha",
"1",
"-LRB-",
"COLIA1",
"-RRB-",
"is",
"one",
"of",
"the",
"most",
"prominent",
"candidate",
"genes",
",",
"which",
"has",
"been",
"consistently",
"associated",
"with",
"osteoporosis",
"in",
"different",
"populations",
"-LSB-",
"10",
"--",
"12",
"-RSB-",
".",
"COLIA1",
"encodes",
"the",
"alpha",
"1",
"chain",
"of",
"collagen",
"type",
"I",
",",
"which",
"is",
"the",
"most",
"abundant",
"structural",
"protein",
"in",
"the",
"bone",
"matrix",
";",
"rare",
"mutations",
"in",
"this",
"gene",
"cause",
"osteogenesis",
"imperfecta",
",",
"a",
"mendelian",
"disorder",
"presenting",
"with",
"moderate",
"to",
"severe",
"bone",
"fragility",
"-LSB-",
"13",
",",
"14",
"-RSB-",
".",
"Previously",
",",
"Grant",
"et",
"al.",
"-LSB-",
"15",
"-RSB-",
"identified",
"a",
"relatively",
"common",
"guanine",
"to",
"thymidine",
"-LRB-",
"G",
"→",
"T",
"-RRB-",
"polymorphism",
"in",
"the",
"first",
"intron",
"of",
"COLIA1",
".",
"This",
"polymorphism",
"affects",
"one",
"of",
"the",
"binding",
"sites",
"of",
"the",
"transcription",
"factor",
"Sp1",
"and",
"results",
"in",
"increased",
"expression",
"of",
"collagen",
"type",
"I",
"alpha",
"1",
"in",
"bone",
"matrix",
"in",
"T",
"carriers",
"-LSB-",
"11",
"-RSB-",
".",
"We",
"and",
"others",
"have",
"shown",
"that",
"the",
"T",
"allele",
"is",
"associated",
"with",
"osteoporosis",
",",
"lower",
"BMD",
"-LSB-",
"10",
",",
"15",
"-RSB-",
",",
"and",
"increased",
"fracture",
"risk",
"-LSB-",
"10",
",",
"12",
",",
"16",
",",
"17",
"-RSB-",
".",
"Moreover",
",",
"in",
"a",
"very",
"large",
"prospective",
"meta-analysis",
"of",
"individual",
"data",
",",
"we",
"observed",
"that",
"the",
"Sp1",
"polymorphism",
"in",
"the",
"COLIA1",
"gene",
"is",
"associated",
"with",
"reduced",
"BMD",
"and",
"incident",
"vertebral",
"fractures",
"independent",
"of",
"BMD",
"-LSB-",
"18",
"-RSB-",
".",
"In",
"addition",
"to",
"the",
"Sp1",
"polymorphism",
",",
"Garcia-Giralt",
"et",
"al.",
"-LSB-",
"19",
"-RSB-",
"described",
"two",
"polymorphisms",
"within",
"the",
"COLIA1",
"promoter",
"region",
":",
"-1997",
"G/T",
"and",
"-1663",
"indelT",
".",
"The",
"study",
"showed",
"in",
"a",
"small",
"cohort",
"of",
"postmenopausal",
"Spanish",
"women",
"that",
"the",
"T",
"allele",
"of",
"the",
"-1997",
"G/T",
"polymorphism",
"was",
"significantly",
"associated",
"with",
"a",
"7.5",
"%",
"decreased",
"lumbar",
"spine",
"BMD",
"and",
"a",
"12",
"%",
"decreased",
"femoral",
"neck",
"BMD",
".",
"Furthermore",
",",
"they",
"analyzed",
"compound",
"genotypes",
"including",
"three",
"polymorphic",
"sites",
".",
"However",
",",
"this",
"small",
"study",
"of",
"the",
"promoter",
"polymorphisms",
"in",
"women",
"investigated",
"the",
"relation",
"in",
"form",
"of",
"compound",
"genotypes",
",",
"was",
"not",
"extended",
"to",
"haplotypes",
"of",
"promoter",
"and",
"Sp1",
"polymorphisms",
",",
"and",
"most",
"importantly",
",",
"did",
"not",
"analyze",
"fractures",
",",
"the",
"clinically",
"most",
"relevant",
"end",
"point",
"of",
"osteoporosis",
".",
"Therefore",
",",
"we",
"investigated",
"the",
"influence",
"of",
"both",
"COLIA1",
"polymorphisms",
"independently",
"and",
"in",
"the",
"form",
"of",
"haplotypes",
"in",
"relation",
"to",
"baseline",
"femoral",
"neck",
"BMD",
",",
"change",
"in",
"BMD",
"with",
"follow-up",
",",
"and",
"risk",
"of",
"vertebral",
"and",
"nonvertebral",
"fractures",
"in",
"a",
"large",
"population-based",
"cohort",
"of",
"elderly",
"Caucasian",
"men",
"and",
"women",
".",
"Materials",
"and",
"Methods",
"Study",
"Population",
"This",
"study",
"was",
"embedded",
"in",
"the",
"Rotterdam",
"Study",
",",
"a",
"population",
"--",
"based",
"cohort",
"study",
"in",
"which",
"all",
"residents",
"of",
"the",
"Rotterdam",
"suburb",
"Ommoord",
"aged",
"55",
"years",
"and",
"older",
"were",
"invited",
"to",
"take",
"part",
".",
"The",
"design",
"of",
"the",
"study",
"has",
"been",
"described",
"elsewhere",
"-LSB-",
"20",
"-RSB-",
".",
"Written",
"informed",
"consent",
"was",
"obtained",
"from",
"all",
"participants",
",",
"and",
"the",
"Medical",
"Ethics",
"Committee",
"of",
"the",
"Erasmus",
"Medical",
"Center",
"approved",
"the",
"study",
".",
"Baseline",
"data",
"collection",
"was",
"conducted",
"in",
"January",
"1990",
"and",
"June",
"1993",
",",
"while",
"two",
"follow-up",
"assessments",
"were",
"performed",
"between",
"July",
"1993",
"and",
"January",
"1996",
"and",
"from",
"July",
"1996",
"until",
"December",
"1999",
".",
"A",
"total",
"of",
"7,983",
"subjects",
"participated",
"in",
"the",
"study",
"-LRB-",
"response",
"rate",
"78",
"%",
"-RRB-",
",",
"and",
"for",
"the",
"present",
"study",
",",
"we",
"examined",
"6,280",
"individuals",
"who",
"were",
"genotyped",
".",
"Study",
"Design",
"This",
"study",
"was",
"performed",
"in",
"three",
"steps",
".",
"In",
"the",
"first",
"step",
",",
"we",
"performed",
"a",
"cross-sectional",
"analysis",
"where",
"we",
"examined",
"the",
"relation",
"between",
"the",
"genotype",
"and",
"baseline",
"BMD",
"-LRB-",
"n",
"=",
"5,737",
"-RRB-",
".",
"In",
"the",
"second",
"step",
",",
"we",
"performed",
"a",
"longitudinal",
"analysis",
"to",
"study",
"change",
"in",
"BMD",
"between",
"baseline",
"and",
"the",
"second",
"follow-up",
"-LRB-",
"mean",
"6.5",
"±",
"standard",
"deviation",
"-LSB-",
"SD",
"-RSB-",
"0.6",
"years",
",",
"n",
"=",
"2,670",
"-RRB-",
".",
"In",
"the",
"third",
"step",
",",
"we",
"looked",
"at",
"the",
"relation",
"between",
"COLIA1",
"polymorphisms",
"and",
"the",
"risk",
"of",
"incident",
"fracture",
".",
"We",
"studied",
"incidence",
"of",
"nonvertebral",
"fracture",
"-LRB-",
"mean",
"follow-up",
"7.4",
"±",
"3.3",
"years",
",",
"n",
"=",
"6,280",
"-RRB-",
"and",
"vertebral",
"fractures",
"assessed",
"by",
"radiographs",
"both",
"at",
"baseline",
"-LRB-",
"1990",
"--",
"1993",
"-RRB-",
"and",
"at",
"follow-up",
"visit",
"'",
"between",
"1997",
"and",
"1999",
",",
"thoracolumbar",
"radiographs",
"of",
"the",
"spine",
"were",
"available",
"for",
"3,469",
"individuals",
"in",
"a",
"mean",
"follow-up",
"of",
"6.4",
"years",
".",
"Measurements",
"BMD",
"-LRB-",
"g/cm2",
"-RRB-",
"of",
"the",
"hip",
"and",
"L2-L4",
"of",
"the",
"lumbar",
"spine",
"were",
"measured",
"by",
"dual-energy",
"X-ray",
"absorptiometry",
"-LRB-",
"DXA",
"-RRB-",
"using",
"a",
"Lunar",
"DPX",
"densitometry",
"-LRB-",
"DPX-L",
"-RRB-",
"-LRB-",
"Lunar",
"Radiation",
",",
"Madison",
",",
"WI",
"-RRB-",
"and",
"reanalyzed",
"with",
"DPX-IQ",
"software",
",",
"under",
"standard",
"protocols",
".",
"Methods",
",",
"quality",
"assurance",
",",
"accuracy",
",",
"and",
"precision",
"issues",
"of",
"the",
"DXA",
"measurements",
"have",
"been",
"described",
"previously",
"-LSB-",
"21",
"-RSB-",
".",
"The",
"relative",
"change",
"of",
"BMD",
"from",
"baseline",
"was",
"estimated",
"as",
"the",
"difference",
"in",
"BMD",
"between",
"assessment",
"periods",
"divided",
"by",
"the",
"BMD",
"at",
"baseline",
".",
"Height",
"-LRB-",
"cm",
"-RRB-",
"and",
"weight",
"-LRB-",
"kg",
"-RRB-",
"were",
"measured",
"with",
"a",
"stadiometer",
"at",
"the",
"initial",
"examination",
",",
"in",
"standing",
"position",
"wearing",
"indoor",
"clothes",
"without",
"shoes",
".",
"Body",
"mass",
"index",
"-LRB-",
"BMI",
"-RRB-",
"was",
"computed",
"as",
"weight",
"divided",
"by",
"height",
"-LRB-",
"kg/cm2",
"-RRB-",
".",
"Fracture",
"Follow-up",
"Information",
"on",
"incident",
"nonvertebral",
"fractures",
"was",
"collected",
"from",
"baseline",
"-LRB-",
"1990",
"--",
"1993",
"-RRB-",
"until",
"January",
"1",
",",
"2002",
"-LRB-",
"mean",
"follow-up",
"±",
"SD",
"7.4",
"±",
"3.3",
"years",
",",
"n",
"=",
"6,280",
"-RRB-",
".",
"Nonvertebral",
"fracture",
"events",
"were",
"retrieved",
"from",
"computerized",
"records",
"of",
"the",
"general",
"practitioners",
"-LRB-",
"GPs",
"-RRB-",
"in",
"the",
"research",
"area",
".",
"Research",
"physicians",
"regularly",
"followed",
"participant",
"information",
"in",
"GP",
"records",
"outside",
"the",
"research",
"area",
"and",
"made",
"an",
"independent",
"review",
",",
"encoding",
"all",
"reported",
"events",
".",
"Subsequently",
",",
"a",
"medical",
"expert",
"in",
"the",
"field",
"reviewed",
"all",
"coded",
"events",
"for",
"final",
"classification",
".",
"We",
"excluded",
"fractures",
"that",
"were",
"considered",
"nonosteoporotic",
",",
"i.e.",
",",
"caused",
"by",
"cancer",
"and",
"high",
"trauma",
",",
"including",
"fractures",
"of",
"the",
"hand",
",",
"foot",
",",
"skull",
",",
"and",
"face",
".",
"Subsequently",
",",
"we",
"analyzed",
"separately",
"``",
"fragility",
"''",
"fractures",
",",
"which",
"were",
"defined",
"as",
"any",
"fracture",
"of",
"the",
"hip",
",",
"pelvis",
",",
"or",
"proximal",
"humerus",
"that",
"had",
"occurred",
"with",
"minimal",
"trauma",
"at",
"older",
"age",
"-LRB-",
"mean",
">",
"75",
"years",
"-RRB-",
".",
"Vertebral",
"Fracture",
"Assessment",
"Both",
"at",
"baseline",
"and",
"at",
"first",
"follow-up",
",",
"between",
"1997",
"and",
"1999",
",",
"thoracolumbar",
"radiographs",
"of",
"the",
"spine",
"were",
"obtained",
".",
"The",
"follow-up",
"radiographs",
"were",
"available",
"for",
"3,456",
"individuals",
",",
"who",
"survived",
"an",
"average",
"of",
"6.4",
"-LRB-",
"SD",
"=",
"0.4",
"-RRB-",
"years",
"after",
"the",
"baseline",
"visit",
"and",
"who",
"were",
"still",
"able",
"to",
"come",
"to",
"our",
"research",
"center",
".",
"All",
"follow-up",
"radiographs",
"were",
"scored",
"for",
"the",
"presence",
"of",
"vertebral",
"fracture",
"by",
"the",
"McCloskey/Kanis",
"method",
",",
"as",
"described",
"previously",
"-LSB-",
"22",
"-RSB-",
".",
"Genotyping",
"Genomic",
"DNA",
"was",
"extracted",
"from",
"samples",
"of",
"peripheral",
"venous",
"blood",
"according",
"to",
"standard",
"procedures",
".",
"Genomic",
"DNA",
"-LRB-",
"1",
"--",
"2",
"ng",
"-RRB-",
"was",
"dispensed",
"into",
"384-well",
"plates",
"using",
"a",
"Sciclone",
"ALH3000",
"pipetting",
"robot",
"-LRB-",
"Caliper",
",",
"Mountain",
"View",
",",
"CA",
"-RRB-",
".",
"Genotypes",
"were",
"determined",
"using",
"the",
"Taqman",
"allelic",
"discrimination",
"assay",
".",
"The",
"Assay-by-Design",
"service",
"-LRB-",
"http://www.appliedbio-systems.com",
"-RRB-",
"was",
"used",
"to",
"set",
"up",
"a",
"Taqman",
"allelic",
"discrimination",
"assay",
"for",
"the",
"COL1PR-1997",
"polymorphism",
"-LRB-",
"primers",
":",
"Fw",
",",
"GCCTCCGGAGGGTGTCA",
",",
"Rv",
",",
"AAGGAGAGCAATTCTTACAGGTGTCT",
";",
"probes",
":",
"FAM-CCTGAGGGATGGAA-MGB",
",",
"VIC-CCTGAAGGATGGAAG-MGB",
".",
"The",
"polymerase",
"chain",
"reaction",
"-LRB-",
"PCR",
"-RRB-",
"mixture",
"included",
"1",
"--",
"2",
"ng",
"of",
"genomic",
"DNA",
"in",
"a",
"2",
"μL",
"volume",
"and",
"the",
"following",
"reagents",
":",
"FAM",
"and",
"VIC",
"probes",
"-LRB-",
"200",
"nM",
"-RRB-",
",",
"primers",
"-LRB-",
"0.9",
"μM",
"-RRB-",
",",
"and",
"2",
"×",
"Taqman",
"PCR",
"master",
"mix",
"-LRB-",
"ABgene",
",",
"Epsom",
",",
"UK",
"-RRB-",
".",
"Reagents",
"were",
"dispensed",
"in",
"a",
"384-well",
"plate",
"using",
"the",
"Deerac",
"Equator",
"NS808",
"-LRB-",
"Deerac",
"Fluidics",
",",
"Dublin",
",",
"Ireland",
"-RRB-",
".",
"PCR",
"cycling",
"was",
"performed",
"in",
"384-well",
"PCR",
"plates",
"in",
"an",
"ABI",
"9700",
"system",
"-LRB-",
"Applied",
"Biosystems",
",",
"Foster",
"City",
",",
"CA",
"-RRB-",
"and",
"consisted",
"of",
"initial",
"denaturation",
"for",
"15",
"minutes",
"at",
"95",
"°C",
",",
"40",
"cycles",
"with",
"denaturation",
"of",
"15",
"seconds",
"at",
"95",
"°C",
",",
"and",
"annealing",
"and",
"extension",
"for",
"60",
"seconds",
"at",
"60",
"°C",
".",
"Results",
"were",
"analyzed",
"by",
"the",
"ABI",
"Taqman",
"7900HT",
"using",
"the",
"sequence",
"detection",
"system",
"2.22",
"software",
"-LRB-",
"Applied",
"Biosystems",
"-RRB-",
".",
"To",
"confirm",
"the",
"accuracy",
"of",
"genotyping",
"results",
",",
"332",
"-LRB-",
"5",
"%",
"-RRB-",
"randomly",
"selected",
"samples",
"were",
"regenotyped",
"with",
"the",
"same",
"method",
".",
"No",
"inconsistencies",
"were",
"observed",
".",
"For",
"Sp1",
"-LRB-",
"intron1",
"-RRB-",
"an",
"assay",
"was",
"set",
"up",
"using",
"Primer",
"Express",
"Software",
"version",
"2.0",
"-LRB-",
"Applied",
"Biosystems",
",",
"Foster",
"city",
",",
"CA",
"-RRB-",
".",
"Forward",
"and",
"reverse",
"primer",
"sequences",
"were",
"5",
"′",
"-",
"GTTGTCTAGGTGCTGGAGGTT-3",
"′",
"and",
"5",
"′",
"-",
"GGCGAGGGAGGAGAGAAGG-3",
"′",
".",
"The",
"PCR",
"mixture",
"included",
"5",
"ng",
"of",
"genomic",
"DNA",
"in",
"a",
"4",
"μL",
"volume",
"and",
"the",
"following",
"reagents",
":",
"FAM-CCCGCCCACATTCCCTGG-MGB",
"probes",
"-LRB-",
"250",
"nM",
"-RRB-",
",",
"TET-CCCGCCCCCATTCCCTGG-MGB",
"probe",
"-LRB-",
"500",
"nM",
"-RRB-",
",",
"primers",
"-LRB-",
"300",
"nM",
"-RRB-",
",",
"2",
"×",
"Taqman",
"PCR",
"master",
"mix",
"-LRB-",
"Applied",
"Biosystems",
"-RRB-",
".",
"PCR",
"cycling",
"was",
"performed",
"in",
"384-well",
"PCR",
"plates",
"in",
"the",
"ABI",
"9700",
"PCR",
"system",
"and",
"consisted",
"of",
"initial",
"denaturation",
"for",
"15",
"minutes",
"at",
"95",
"°C",
",",
"40",
"cycles",
"with",
"denaturation",
"of",
"15",
"seconds",
"at",
"95",
"°C",
",",
"and",
"annealing",
"and",
"extension",
"for",
"60",
"seconds",
"at",
"60",
"°C",
".",
"Results",
"were",
"analyzed",
"by",
"the",
"ABI",
"Taqman",
"7900HT",
"using",
"the",
"sequence",
"detection",
"system",
"2.1",
"software",
"-LRB-",
"Applied",
"Biosystems",
"-RRB-",
".",
"To",
"confirm",
"the",
"accuracy",
"of",
"the",
"genotyping",
"results",
",",
"332",
"randomly",
"selected",
"samples",
"were",
"genotyped",
"for",
"a",
"second",
"time",
"with",
"the",
"same",
"method",
".",
"All",
"polymorphisms",
"had",
"an",
"error",
"rate",
"lower",
"than",
"1",
"%",
".",
"Statistical",
"Analysis",
"Hardy-Weinberg",
"equilibrium",
"of",
"the",
"COLIA1",
"polymorphism",
"genotypes",
"was",
"tested",
"using",
"the",
"GENEPOP",
"package",
"-LSB-",
"23",
"-RSB-",
".",
"Linkage",
"disequilibrium",
"-LRB-",
"LD",
"-RRB-",
"between",
"each",
"pair",
"of",
"alleles",
"at",
"both",
"polymorphic",
"loci",
"was",
"calculated",
"as",
"D",
"′",
"and",
"r2",
"-LSB-",
"24",
"-RSB-",
".",
"We",
"stratified",
"all",
"analyses",
"by",
"gender",
",",
"considering",
"peak",
"bone",
"mass",
",",
"changes",
"in",
"BMD",
",",
"and",
"fractures",
",",
"following",
"age",
"-",
"and",
"sex-specific",
"patterns",
".",
"Baseline",
"BMD",
"and",
"BMD",
"rate",
"of",
"change",
"were",
"compared",
"across",
"COLIA1",
"polymorphisms",
"using",
"univariate",
"analysis",
"of",
"variance",
"-LRB-",
"ANOVA",
"-RRB-",
".",
"Corrections",
"were",
"made",
"for",
"age",
"and",
"BMI",
".",
"Trend",
"analysis",
"assuming",
"an",
"underlying",
"additive",
"genetic",
"model",
"was",
"done",
"for",
"the",
"presence",
"of",
"zero",
",",
"one",
",",
"or",
"two",
"copies",
"of",
"the",
"associated",
"allele",
",",
"incorporating",
"the",
"genotype",
"variable",
"as",
"a",
"continuous",
"term",
"in",
"a",
"general",
"linear",
"regression",
"model",
".",
"For",
"the",
"analysis",
"of",
"nonvertebral",
"fracture",
"follow-up",
"data",
",",
"we",
"computed",
"the",
"incidence",
"rates",
"of",
"fracture",
"among",
"genotypes",
"and",
"used",
"Cox",
"'s",
"proportional",
"hazards",
"model",
",",
"adjusting",
"for",
"age",
"and",
"BMI",
"to",
"estimate",
"risk",
"of",
"fracture",
".",
"For",
"vertebral",
"fractures",
",",
"odd",
"ratios",
"with",
"95",
"%",
"confidence",
"intervals",
"-LRB-",
"95",
"%",
"CIs",
"-RRB-",
"were",
"calculated",
"using",
"logistic",
"regression",
"models",
"since",
"no",
"data",
"on",
"the",
"exact",
"time",
"of",
"occurrence",
"could",
"be",
"determined",
".",
"We",
"used",
"HaploStats",
"-LRB-",
"available",
"at",
"http://www.cran.r-project.org/",
"-RRB-",
"to",
"estimate",
"the",
"frequency",
"of",
"inferred",
"haplotypes",
"and",
"investigate",
"the",
"association",
"of",
"haplotypes",
"with",
"BMD",
"and",
"the",
"risk",
"of",
"fractures",
".",
"We",
"restricted",
"the",
"analysis",
"to",
"haplotypes",
"with",
"an",
"inferred",
"frequency",
"of",
"more",
"than",
"0.02",
".",
"The",
"first",
"haplotype",
",",
"which",
"was",
"most",
"frequent",
",",
"was",
"used",
"as",
"reference",
".",
"Significant",
"P",
"values",
"were",
"0.05",
"or",
"lower",
".",
"Finally",
",",
"model",
"assumptions",
"were",
"verified",
"and",
"model",
"residuals",
"checked",
"for",
"goodness-of-fit",
".",
"SPSS",
"11.0",
"-LRB-",
"SPSS",
",",
"Chicago",
",",
"IL",
"-RRB-",
"was",
"used",
"for",
"the",
"analyses",
".",
"Results",
"Allele",
"and",
"genotype",
"frequencies",
"of",
"the",
"-1997",
"G/T",
"and",
"Sp1",
"polymorphisms",
"were",
"in",
"Hardy-Weinberg",
"equilibrium",
"-LRB-",
"P",
"=",
"0.61",
"and",
"P",
"=",
"0.10",
",",
"respectively",
"-RRB-",
".",
"General",
"characteristics",
"of",
"the",
"study",
"population",
"at",
"baseline",
"and",
"follow-up",
"are",
"shown",
"in",
"Table",
"1",
".",
"Table",
"1General",
"characteristics",
"of",
"the",
"study",
"population",
"at",
"baseline",
"and",
"second",
"follow-upWomenMenBaselineSecond",
"follow-upBaselineSecond",
"follow-upNumbern",
"=",
"3,374",
"n",
"=",
"1,724",
"n",
"=",
"2,452",
"n",
"=",
"1,287",
"Age",
"-LRB-",
"years",
"-RRB-",
"68.3",
"±",
"8.272.7",
"±",
"6.867.6",
"±",
"7.772.2",
"±",
"6.5",
"Height",
"-LRB-",
"cm",
"-RRB-",
"161.1",
"±",
"6.8160.6",
"±",
"6.4174.6",
"±",
"6.8174.0",
"±",
"6.7",
"Weight",
"-LRB-",
"kg",
"-RRB-",
"69.3",
"±",
"11.470.3",
"±",
"12.278.2",
"±",
"10.879.5",
"±",
"11.3",
"BMI",
"-LRB-",
"kg/m2",
"-RRB-",
"26.7",
"±",
"4.127.2",
"±",
"4.425.6",
"±",
"3.026.3",
"±",
"3.2FN-BMD",
"-LRB-",
"g/cm2",
"-RRB-",
"a0",
".83",
"±",
"0.140.80",
"±",
"0.130.92",
"±",
"0.140.90",
"±",
"0.14",
"Lumbar",
"spine",
"BMD",
"-LRB-",
"g/cm2",
"-RRB-",
"1.03",
"±",
"0.18-1.16",
"±",
"0.20-FN-BMD",
"changen",
"=",
"1,527",
"n",
"=",
"1,143FN-BMD",
"change",
"-LRB-",
"relative",
"%",
"of",
"baseline",
"year",
"-RRB-",
"b",
"−",
"0.84",
"±",
"1.09-Values",
"are",
"means",
"±",
"SD",
".",
"Anthropometric",
"measurement",
"based",
"on",
"5,826",
"individuals",
"at",
"baseline",
"and",
"3,011",
"individuals",
"at",
"follow-upaBMD",
"measurements",
"based",
"on",
"5,737",
"individual",
"at",
"baseline",
"and",
"2,670",
"individual",
"at",
"second",
"follow-upbFemoral",
"neck",
"-LRB-",
"FN",
"-RRB-",
"BMD",
"change",
"was",
"measured",
"between",
"second",
"follow-up",
"and",
"baseline",
".",
"Second",
"follow-up",
"measurements",
"were",
"performed",
"on",
"average",
"6.5",
"-LRB-",
"SD",
"=",
"0.6",
"-RRB-",
"years",
"after",
"baseline",
"Baseline",
"BMD",
"by",
"COLIA1",
"Genotypes",
"In",
"both",
"genders",
",",
"age",
",",
"height",
",",
"weight",
",",
"and",
"BMI",
"did",
"not",
"differ",
"significantly",
"between",
"genotypes",
"for",
"the",
"-1997",
"G/T",
"and",
"Sp1",
"polymorphisms",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Table",
"2",
"shows",
"the",
"BMD",
"values",
"according",
"to",
"COLIA1",
"genotypes",
"in",
"men",
"and",
"women",
".",
"Femoral",
"neck",
"BMD",
"was",
"3.8",
"%",
"lower",
"-LRB-",
"mean",
"difference",
"=",
"0.03",
"g/cm2",
",",
"P",
"=",
"0.09",
"-RRB-",
"in",
"women",
"who",
"were",
"homozygous",
"carriers",
"of",
"the",
"Sp1",
"T",
"allele",
"compared",
"to",
"noncarriers",
",",
"with",
"evidence",
"for",
"an",
"allele",
"dose",
"effect",
"-LRB-",
"P",
"for",
"trend",
"=",
"0.03",
"-RRB-",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"No",
"association",
"was",
"found",
"between",
"the",
"-1997",
"promoter",
"polymorphism",
"and",
"lumbar",
"spine",
"BMD",
"or",
"femoral",
"neck",
"BMD",
"in",
"men",
"or",
"women",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"We",
"did",
"not",
"observe",
"any",
"significant",
"association",
"between",
"the",
"Sp1",
"and",
"-1997",
"promoter",
"polymorphisms",
"with",
"changes",
"in",
"BMD",
"during",
"follow-up",
"in",
"men",
"or",
"women",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"Table",
"2BMD",
"measurements",
"by",
"COLIA1",
"genotypes",
"at",
"baseline",
"and",
"follow-upPromoter",
"-1997",
"G/TIntron",
"1",
"Sp1",
"G/TGGGTTTP",
"*",
"GGGTTTP",
"*",
"Menn",
"=",
"1,663",
"n",
"=",
"494n",
"=",
"37n",
"=",
"1,484",
"n",
"=",
"655n",
"=",
"55Femoral",
"neck",
"-LRB-",
"g/cm2",
"-RRB-",
"0.92",
"±",
"0.130.92",
"±",
"0.140.90",
"±",
"0.141.000.92",
"±",
"0.140.92",
"±",
"0.140.90",
"±",
"0.120.45",
"Lumbar",
"spine",
"-LRB-",
"g/cm2",
"-RRB-",
"1.16",
"±",
"0.191.17",
"±",
"0.201.15",
"±",
"0.220.961.17",
"±",
"0.191.16",
"±",
"0.201.16",
"±",
"0.200.91",
"Numbern",
"=",
"668n",
"=",
"233n",
"=",
"16n",
"=",
"606n",
"=",
"293n",
"=",
"18FN-BMD",
"change",
"-LRB-",
"relative",
"%",
"of",
"baseline",
"year",
"-RRB-",
"−",
"0.46",
"±",
"0.91",
"−",
"0.36",
"±",
"0.93",
"−",
"0.38",
"±",
"0.600.62",
"−",
"0.39",
"±",
"0.93",
"−",
"0.56",
"±",
"0.87",
"−",
"0.30",
"±",
"0.820.01",
"Womenn",
"=",
"2,157",
"n",
"=",
"710n",
"=",
"53n",
"=",
"1,971",
"n",
"=",
"858n",
"=",
"91Femoral",
"neck",
"-LRB-",
"g/cm2",
"-RRB-",
"0.83",
"±",
"0.140.84",
"±",
"0.130.85",
"±",
"0.130",
".",
"220.83",
"±",
"0.130.82",
"±",
"0.140.80",
"±",
"0.140.09",
"**",
"Lumbar",
"spine",
"-LRB-",
"g/cm2",
"-RRB-",
"1.03",
"±",
"0.181.04",
"±",
"0.181.01",
"±",
"0.180.691.04",
"±",
"0.181.04",
"±",
"0.191.01",
"±",
"0.200.52",
"Numbern",
"=",
"820n",
"=",
"298n",
"=",
"24n",
"=",
"773n",
"=",
"340n",
"=",
"29FN-BMD",
"change",
"-LRB-",
"relative",
"%",
"of",
"baseline",
"year",
"-RRB-",
"−",
"0.84",
"±",
"1.11",
"−",
"0.83",
"±",
"1.01",
"−",
"0.78",
"±",
"1.030.85",
"−",
"0.85",
"±",
"1.08",
"−",
"0.80",
"±",
"1.04",
"−",
"0.74",
"±",
"1.490.55",
"Values",
"are",
"expressed",
"as",
"mean",
"±",
"SD",
".",
"Adjustments",
"for",
"age",
"and",
"BMI",
".",
"Femoral",
"neck",
"-LRB-",
"FN",
"-RRB-",
"BMD",
"change",
"was",
"measured",
"between",
"second",
"follow-up",
"and",
"baseline",
"*",
"P",
"for",
"ANOVA",
".",
"**",
"For",
"trend",
"linear",
"regression",
":",
"P",
"=",
"0.03",
"Risk",
"of",
"Fracture",
"by",
"COLIA1",
"Genotypes",
"The",
"relation",
"between",
"risk",
"of",
"fracture",
"and",
"COLIA1",
"Sp1",
"polymorphism",
"is",
"shown",
"in",
"Table",
"3",
".",
"Women",
"with",
"two",
"copies",
"of",
"the",
"T",
"allele",
"of",
"the",
"Sp1",
"polymorphism",
"had",
"a",
"2.3",
"times",
"higher",
"risk",
"of",
"fragility",
"fracture",
"-LRB-",
"95",
"%",
"CI",
"1.4-3.9",
",",
"P",
"=",
"0.001",
"-RRB-",
".",
"Adjustment",
"for",
"femoral",
"neck",
"BMD",
"did",
"not",
"essentially",
"modify",
"the",
"association",
".",
"A",
"similar",
"association",
"was",
"observed",
"in",
"men",
"who",
"were",
"homozygous",
"carriers",
"of",
"the",
"Sp1",
"T",
"allele",
",",
"which",
"was",
"borderline",
"significant",
"-LRB-",
"risk",
"ratio",
"=",
"2.3",
",",
"95",
"%",
"CI",
"0.9",
"--",
"5.8",
",",
"P",
"=",
"0.07",
"-RRB-",
".",
"For",
"the",
"-1997",
"promoter",
"polymorphism",
"no",
"association",
"was",
"found",
"with",
"any",
"type",
"of",
"fracture",
"in",
"either",
"men",
"or",
"women",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"Table",
"3Risk",
"of",
"fractures",
"by",
"COLIA1",
"genotypesCOLIA1",
"genotypesTypes",
"of",
"fractureEvent",
"-LRB-",
"%",
"-RRB-",
"Risk",
"ratio",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"GGGTTTGG",
"-LRB-",
"reference",
"-RRB-",
"GT",
"vs.",
"referenceTT",
"vs.",
"referenceMenPromoter",
"-1997",
"G/TNonvertebral147/1952",
"-LRB-",
"7.5",
"-RRB-",
"49/592",
"-LRB-",
"8.3",
"-RRB-",
"1/46",
"-LRB-",
"2.2",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"3.18",
"-LRB-",
"0.45",
"--",
"22.74",
"-RRB-",
"3.44",
"-LRB-",
"0.47",
"--",
"29.94",
"-RRB-",
"Fragility72/1952",
"-LRB-",
"3.7",
"-RRB-",
"14/592",
"-LRB-",
"2.4",
"-RRB-",
"1/46",
"-LRB-",
"1.8",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"1.46",
"-LRB-",
"0.20",
"--",
"10.55",
"-RRB-",
"0.94",
"-LRB-",
"0.12.7.14",
"-RRB-",
"Vertebral100/1056",
"-LRB-",
"9.5",
"-RRB-",
"35/340",
"-LRB-",
"10.3",
"-RRB-",
"3/28",
"-LRB-",
"10.7",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"1.07",
"-LRB-",
"0.71",
"--",
"1.61",
"-RRB-",
"1.23",
"-LRB-",
"0.36",
"--",
"4.18",
"-RRB-",
"Intron",
"1",
"Sp1",
"G/TNonvertebral91/1254",
"-LRB-",
"7.3",
"-RRB-",
"39/574",
"-LRB-",
"6.8",
"-RRB-",
"4/44",
"-LRB-",
"9.1",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"0.97",
"-LRB-",
"0.71",
"--",
"1.33",
"-RRB-",
"1.40",
"-LRB-",
"0.65",
"--",
"3.00",
"-RRB-",
"Fragility36/1254",
"-LRB-",
"2.9",
"-RRB-",
"14/574",
"-LRB-",
"2.4",
"-RRB-",
"2/44",
"-LRB-",
"4.5",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"0.94",
"-LRB-",
"0.58",
"--",
"1.51",
"-RRB-",
"2.34",
"-LRB-",
"0.94",
"--",
"5.85",
"-RRB-",
"Vertebral68/719",
"-LRB-",
"9.5",
"-RRB-",
"31/350",
"-LRB-",
"8.9",
"-RRB-",
"2/22",
"-LRB-",
"9.1",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"0.83",
"-LRB-",
"0.55",
"--",
"1.24",
"-RRB-",
"1.59",
"-LRB-",
"0.60",
"--",
"4.22",
"-RRB-",
"WomenPromoter",
"-1997",
"G/TNonvertebral528/2721",
"-LRB-",
"19.4",
"-RRB-",
"182/879",
"-LRB-",
"20.7",
"-RRB-",
"8/63",
"-LRB-",
"12.7",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"1.53",
"-LRB-",
"0.76",
"--",
"3.09",
"-RRB-",
"1.66",
"-LRB-",
"0.82",
"--",
"3.36",
"-RRB-",
"Fragility216/2721",
"-LRB-",
"7.9",
"-RRB-",
"73/879",
"-LRB-",
"8.3",
"-RRB-",
"4/63",
"-LRB-",
"6.3",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"1.13",
"-LRB-",
"0.42",
"--",
"3.05",
"-RRB-",
"1.19",
"-LRB-",
"0.44",
"--",
"3.26",
"-RRB-",
"Vertebral159/1320",
"-LRB-",
"12.0",
"-RRB-",
"52/445",
"-LRB-",
"11.7",
"-RRB-",
"5/35",
"-LRB-",
"14.3",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"0.98",
"-LRB-",
"0.70",
"--",
"1.37",
"-RRB-",
"1.31",
"-LRB-",
"0.49",
"--",
"3.45",
"-RRB-",
"Intron",
"1",
"Sp1",
"G/TNonvertebral279/1626",
"-LRB-",
"17.2",
"-RRB-",
"121/710",
"-LRB-",
"17.0",
"-RRB-",
"17/76",
"-LRB-",
"22.4",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"1.05",
"-LRB-",
"0.90",
"--",
"1.23",
"-RRB-",
"1.34",
"-LRB-",
"0.92",
"--",
"1.23",
"-RRB-",
"Fragility98/1626",
"-LRB-",
"6.0",
"-RRB-",
"42/710",
"-LRB-",
"5.9",
"-RRB-",
"10/76",
"-LRB-",
"13.2",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"1.01",
"-LRB-",
"0.78",
"--",
"1.31",
"-RRB-",
"2.33",
"-LRB-",
"1.39",
"--",
"3.87",
"-RRB-",
"Vertebral98/891",
"-LRB-",
"11.0",
"-RRB-",
"51/401",
"-LRB-",
"12.7",
"-RRB-",
"3/34",
"-LRB-",
"8.8",
"-RRB-",
"1.0",
"-LRB-",
"reference",
"-RRB-",
"1.21",
"-LRB-",
"0.88",
"--",
"1.65",
"-RRB-",
"1.37",
"-LRB-",
"0.56",
"--",
"3.35",
"-RRB-",
"Adjustments",
"for",
"age",
"and",
"BMI",
"Haplotype",
"Analysis",
"High",
"LD",
"exists",
"between",
"the",
"-1997",
"G/T",
"and",
"Sp1",
"polymorphisms",
",",
"as",
"assessed",
"by",
"D",
"′",
"measure",
"-LRB-",
"D",
"′",
"=",
"0.99",
",",
"r2",
"=",
"0.03",
"-RRB-",
".",
"We",
"observed",
"in",
"our",
"population",
"three",
"-1997",
"G/T",
",",
"Sp1",
"G/T",
"haplotype",
"alleles",
"-LRB-",
"Fig.",
"1",
"-RRB-",
":",
"haplotype",
"1",
"-LRB-",
"Gpromoter",
"--",
"GIntron",
"-RRB-",
",",
"69.0",
"%",
";",
"haplotype",
"2",
"-LRB-",
"Gpromoter",
"--",
"TIntron",
"-RRB-",
",",
"17.6",
"%",
";",
"and",
"haplotype",
"3",
"-LRB-",
"Tpromoter",
"--",
"GIntron",
"-RRB-",
",",
"13.4",
"%",
".",
"Haplotype",
"4",
"-LRB-",
"Tpromoter",
"--",
"TIntron",
"-RRB-",
"was",
"not",
"present",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"The",
"strong",
"LD",
"between",
"the",
"-1997",
"G/T",
"and",
"Sp1",
"G/T",
"polymorphism",
"and",
"the",
"virtual",
"nonexistence",
"of",
"haplotype",
"4",
"suggests",
"there",
"is",
"absence",
"of",
"ancestral",
"recombination",
"in",
"the",
"region",
".",
"We",
"observed",
"a",
"borderline",
"significant",
"association",
"-LRB-",
"P",
"=",
"0.06",
"-RRB-",
"between",
"haplotype",
"2",
"-LRB-",
"Gpromoter",
"--",
"TIntron",
"-RRB-",
"and",
"femoral",
"neck",
"BMD",
"in",
"women",
".",
"Women",
"who",
"carried",
"haplotype",
"2",
"-LRB-",
"Gpromoter",
"--",
"TIntron",
"-RRB-",
"had",
"lower",
"-LRB-",
"−",
"0.01",
"mg/cm2",
"-RRB-",
"femoral",
"neck",
"BMD",
"compared",
"with",
"those",
"who",
"carried",
"haplotype",
"1",
"-LRB-",
"Gpromoter",
"--",
"GIntron",
"-RRB-",
".",
"Fig.",
"1Schematic",
"representation",
"of",
"the",
"COLIA1",
"gene",
"with",
"the",
"structural-1997",
"G/T",
"polymorphism",
"in",
"the",
"promoter",
"region",
"and",
"G/T",
"Sp1",
"polymorphism",
"at",
"binding",
"site",
",",
"with",
"observed",
"haplotype",
"frequencies",
"in",
"the",
"Rotterdam",
"Study",
"The",
"relation",
"between",
"risk",
"of",
"fracture",
"and",
"COLIA1",
"haplotypes",
"is",
"shown",
"in",
"Table",
"4",
".",
"Women",
"with",
"haplotype",
"2",
"-LRB-",
"Gpromoter",
"--",
"TIntron",
"-RRB-",
"had",
"a",
"2.1",
"times",
"higher",
"relative",
"risk",
"of",
"fragility",
"fracture",
"-LRB-",
"P",
"=",
"0.03",
"-RRB-",
";",
"in",
"men",
"the",
"increase",
"in",
"risk",
"was",
"2.0",
"-LRB-",
"P",
"=",
"0.31",
"-RRB-",
".",
"These",
"results",
"were",
"essentially",
"unchanged",
"after",
"adjustment",
"for",
"femoral",
"neck",
"BMD",
".",
"For",
"haplotype",
"3",
"-LRB-",
"Tpromoter",
"--",
"GIntron",
"-RRB-",
"we",
"found",
"no",
"association",
"with",
"any",
"type",
"of",
"fracture",
"in",
"either",
"men",
"or",
"women",
".",
"Table",
"4Risk",
"of",
"fracture",
"by",
"COLIA1",
"haplotypesTypes",
"of",
"fractureMen",
",",
"OR",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"Women",
",",
"OR",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"Haplotype",
"1Haplotype",
"2Haplotype",
"3Haplotype",
"1Haplotype",
"2Haplotype",
"3Nonvertebral1",
"-LRB-",
"reference",
"-RRB-",
"1.29",
"-LRB-",
"0.55",
"--",
"3.02",
"-RRB-",
"0.00",
"-LRB-",
"0.00",
"-",
"∞",
"-RRB-",
"1",
"-LRB-",
"reference",
"-RRB-",
"1.31",
"-LRB-",
"0.83",
"--",
"2.07",
"-RRB-",
"0.61",
"-LRB-",
"0.29",
"--",
"1.29",
"-RRB-",
"Fragility1",
"-LRB-",
"reference",
"-RRB-",
"2.01",
"-LRB-",
"0.71",
"--",
"5.67",
"-RRB-",
"0.00",
"-LRB-",
"0.00",
"-",
"∞",
"-RRB-",
"1",
"-LRB-",
"reference",
"-RRB-",
"2.12",
"-LRB-",
"1.23",
"--",
"3.66",
"-RRB-",
"0.80",
"-LRB-",
"0.29",
"--",
"2.23",
"-RRB-",
"Vertebral1",
"-LRB-",
"reference",
"-RRB-",
"1.64",
"-LRB-",
"0.62",
"--",
"4.31",
"-RRB-",
"1.19",
"-LRB-",
"0.35",
"--",
"4.00",
"-RRB-",
"1",
"-LRB-",
"reference",
"-RRB-",
"1.23",
"-LRB-",
"0.51",
"--",
"2.95",
"-RRB-",
"1.31",
"-LRB-",
"0.50",
"--",
"3.42",
"-RRB-",
"Adjustments",
"for",
"age",
"and",
"BMI",
".",
"Haplotype",
"1",
",",
"-LRB-",
"Gpromoter",
"--",
"GIntron",
"-RRB-",
";",
"haplotype",
"2",
",",
"-LRB-",
"Gpromoter",
"--",
"TIntron",
"-RRB-",
";",
"haplotype",
"3",
",",
"-LRB-",
"Tpromoter",
"--",
"GIntron",
"-RRB-",
"Discussion",
"In",
"this",
"large",
"population-based",
"study",
",",
"we",
"found",
"that",
"the",
"Sp1",
"polymorphism",
"influences",
"the",
"risk",
"of",
"fragility",
"fracture",
"in",
"elderly",
"women",
",",
"with",
"a",
"similar",
"yet",
"not",
"significant",
"effect",
"in",
"men",
".",
"Similarly",
",",
"women",
"homozygous",
"for",
"the",
"T",
"allele",
"had",
"3.8",
"%",
"lower",
"BMD",
"at",
"baseline",
".",
"The",
"-1997",
"G/T",
"polymorphism",
"showed",
"no",
"independent",
"effect",
"on",
"fracture",
"risk",
"or",
"BMD",
"levels",
"in",
"both",
"genders",
".",
"The",
"haplotype",
"analysis",
"showed",
"an",
"association",
"with",
"BMD",
"and",
"fracture",
"in",
"women",
",",
"which",
"appeared",
"to",
"be",
"driven",
"by",
"the",
"effect",
"of",
"the",
"Sp1",
"polymorphism",
".",
"A",
"study",
"in",
"Spain",
"-LSB-",
"19",
"-RSB-",
"showed",
"that",
"the",
"-1997",
"G/T",
"polymorphism",
"located",
"in",
"the",
"promoter",
"region",
"of",
"the",
"COLIA1",
"gene",
"was",
"associated",
"with",
"BMD",
"in",
"postmenopausal",
"women",
"of",
"Spanish",
"origin",
".",
"In",
"addition",
",",
"analysis",
"of",
"compound",
"genotypes",
"of",
"the",
"three",
"studied",
"polymorphisms",
"-LRB-",
"-1997",
"G/T",
",",
"Sp1",
",",
"and",
"-1663",
"indelT",
"-RRB-",
"suggested",
"that",
"the",
"lowest",
"value",
"for",
"BMD",
"corresponded",
"to",
"GG",
"homozygous",
"at",
"-1997",
"and",
"heterozygous",
"at",
"the",
"other",
"two",
"loci",
".",
"Furthermore",
",",
"in",
"another",
"report",
",",
"the",
"same",
"group",
"observed",
"a",
"possible",
"functional",
"mechanism",
"for",
"the",
"-1997",
"G/T",
"polymorphism",
"-LSB-",
"25",
"-RSB-",
".",
"Our",
"population-based",
"study",
"suggests",
"there",
"is",
"no",
"independent",
"effect",
"of",
"the",
"-1997",
"polymorphism",
"on",
"BMD",
"and",
"the",
"risk",
"of",
"fractures",
".",
"Recently",
",",
"Stewart",
"et",
"al.",
"-LSB-",
"26",
"-RSB-",
"examined",
"the",
"three",
"polymorphisms",
"of",
"the",
"COLIA1",
"gene",
"in",
"forms",
"of",
"haplotypes",
"in",
"postmenopausal",
"women",
".",
"In",
"contrast",
"with",
"our",
"study",
",",
"they",
"observed",
"an",
"association",
"between",
"reduced",
"BMD",
"values",
"and",
"the",
"promoter",
"--",
"1997G/T",
"polymorphism",
".",
"Since",
"the",
"promoter",
"-1997",
"G/T",
"polymorphism",
"is",
"in",
"strong",
"LD",
"with",
"the",
"Sp1",
"polymorphism",
",",
"the",
"observed",
"association",
"of",
"haplotype",
"2",
"is",
"driven",
"by",
"the",
"SP1",
"polymorphism",
".",
"We",
"showed",
"that",
"the",
"association",
"between",
"fragility",
"fractures",
"and",
"Sp1",
"polymorphism",
"is",
"significant",
"only",
"in",
"women",
".",
"We",
"also",
"found",
"that",
"the",
"association",
"between",
"fragility",
"fracture",
"and",
"the",
"Sp1",
"polymorphism",
"was",
"independent",
"of",
"femoral",
"neck",
"BMD",
".",
"A",
"possible",
"explanation",
"for",
"an",
"increased",
"risk",
"of",
"fracture",
"is",
"the",
"different",
"number",
"of",
"fractures",
"between",
"men",
"and",
"women",
".",
"There",
"are",
"a",
"higher",
"number",
"of",
"fractures",
"in",
"women",
"compared",
"to",
"men",
"-LRB-",
"13.2",
"%",
"in",
"women",
"and",
"4.5",
"%",
"in",
"men",
"-RRB-",
".",
"This",
"suggests",
"that",
"other",
"underlying",
"biological",
"mechanisms",
"beyond",
"BMD",
"levels",
",",
"such",
"as",
"the",
"role",
"of",
"microarchitecture",
"and",
"composition",
"of",
"mineral",
"crystals",
"in",
"bone",
"tissue",
",",
"might",
"explain",
"the",
"increased",
"fracture",
"risk",
"-LSB-",
"11",
",",
"27",
",",
"28",
"-RSB-",
".",
"Biomechanical",
"testing",
"of",
"bone",
"samples",
"from",
"heterozygous",
"individuals",
"with",
"the",
"GT",
"genotype",
"showed",
"reduced",
"bone",
"strength",
"compared",
"to",
"the",
"homozygous",
"GG",
"genotype",
"and",
"a",
"slight",
"reduction",
"in",
"mineralization",
"of",
"bone",
"-LSB-",
"11",
"-RSB-",
".",
"Presence",
"of",
"the",
"T",
"allele",
"in",
"the",
"COLIA1",
"Sp1",
"binding",
"site",
"leads",
"to",
"an",
"abnormal",
"relative",
"level",
"of",
"COLIA1/COLIA2",
",",
"which",
"may",
"reduce",
"bone",
"quality",
"and",
"quantity",
"-LSB-",
"11",
"-RSB-",
".",
"Accordingly",
",",
"we",
"assume",
"that",
"a",
"weaker",
"network",
"of",
"abnormal",
"collagen",
"cross-linking",
"may",
"generate",
"a",
"three-dimensional",
"unstable",
"condition",
"that",
"may",
"be",
"responsible",
"for",
"its",
"relatively",
"greater",
"risk",
"of",
"fragility",
"fracture",
"in",
"elderly",
"women",
"homozygous",
"for",
"the",
"Sp1",
"T",
"allele",
".",
"Similarly",
",",
"it",
"is",
"likely",
"that",
"the",
"Sp1",
"polymorphism",
"drives",
"these",
"associations",
"since",
"evidence",
"of",
"functionality",
"of",
"this",
"polymorphism",
"has",
"been",
"reported",
"previously",
".",
"In",
"the",
"Genetic",
"Markers",
"for",
"Osteoporosis",
"-LRB-",
"GENOMOS",
"-RRB-",
"Study",
",",
"which",
"is",
"the",
"largest",
"study",
"examining",
"the",
"Sp1",
"polymorphism",
"-LRB-",
"n",
"=",
"20,786",
"-RRB-",
"in",
"relation",
"to",
"osteoporosis",
",",
"an",
"association",
"between",
"the",
"Sp1",
"polymorphism",
"and",
"a",
"1.3",
"times",
"incident",
"risk",
"of",
"vertebral",
"fractures",
"was",
"also",
"observed",
".",
"An",
"effect",
"of",
"the",
"-1997",
"promoter",
"polymorphism",
"due",
"to",
"power",
"limitations",
"can",
"not",
"be",
"fully",
"excluded",
"and",
"should",
"be",
"subject",
"to",
"study",
"in",
"a",
"larger",
"population",
"like",
"that",
"of",
"GENOMOS",
".",
"Our",
"present",
"study",
"has",
"some",
"limitations",
".",
"Survival",
"bias",
"may",
"play",
"a",
"role",
"if",
"individuals",
"who",
"were",
"lost",
"to",
"follow-up",
"were",
"associated",
"to",
"genotype",
".",
"Considering",
"this",
"selection",
"bias",
",",
"a",
"possible",
"relationship",
"of",
"the",
"COLIA1",
"polymorphisms",
"with",
"changes",
"in",
"BMD",
"can",
"not",
"be",
"fully",
"excluded",
".",
"In",
"conclusion",
",",
"we",
"observed",
"an",
"increased",
"risk",
"of",
"fragility",
"fractures",
"in",
"women",
"carriers",
"of",
"the",
"COLIA1",
"Sp1",
"T",
"allele",
".",
"In",
"contrast",
",",
"the",
"-1997",
"G/T",
"polymorphism",
"by",
"itself",
"appears",
"to",
"have",
"no",
"influence",
"on",
"fracture",
"or",
"BMD",
"in",
"postmenopausal",
"women",
",",
"though",
"the",
"role",
"of",
"power",
"limitations",
"can",
"not",
"be",
"excluded",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Cancer_Causes_Control-3-1-2039842 | [
"Dietary",
"fat",
"and",
"risk",
"of",
"colon",
"and",
"rectal",
"cancer",
"with",
"aberrant",
"MLH1",
"expression",
",",
"APC",
"or",
"KRAS",
"genes",
"Objective",
"To",
"investigate",
"baseline",
"fat",
"intake",
"and",
"the",
"risk",
"of",
"colon",
"and",
"rectal",
"tumors",
"lacking",
"MLH1",
"-LRB-",
"mutL",
"homolog",
"1",
",",
"colon",
"cancer",
",",
"nonpolyposis",
"type",
"2",
"-RRB-",
"repair",
"gene",
"expression",
"and",
"harboring",
"mutations",
"in",
"the",
"APC",
"-LRB-",
"adenomatous",
"polyposis",
"coli",
"-RRB-",
"tumor",
"suppressor",
"gene",
"and",
"in",
"the",
"KRAS",
"-LRB-",
"v-Ki-ras2",
"Kirsten",
"rat",
"sarcoma",
"viral",
"oncogene",
"homolog",
"-RRB-",
"oncogene",
".",
"Introduction",
"Although",
"dietary",
"fat",
"has",
"been",
"implicated",
"in",
"the",
"etiology",
"of",
"colorectal",
"cancer",
"-LSB-",
"1",
"-RSB-",
",",
"results",
"from",
"epidemiological",
"studies",
"are",
"inconsistent",
"-LSB-",
"2",
",",
"3",
"-RSB-",
"and",
"often",
"do",
"not",
"support",
"an",
"association",
",",
"as",
"observed",
"recently",
"in",
"the",
"Women",
"'s",
"Health",
"Study",
"-LSB-",
"4",
"-RSB-",
".",
"Fortunately",
",",
"current",
"molecular",
"techniques",
"to",
"detect",
"DNA",
"alterations",
"on",
"a",
"large",
"scale",
"allow",
"studying",
"molecular",
"endpoints",
"for",
"colorectal",
"cancer",
",",
"characterized",
"by",
"acquired",
"-LRB-",
"epi",
"-RRB-",
"genetic",
"defects",
"in",
"tumor",
"DNA",
"-LSB-",
"5",
"-RSB-",
".",
"This",
"approach",
"may",
"improve",
"our",
"ability",
"to",
"observe",
"associations",
"between",
"dietary",
"factors",
"and",
"cancer",
"that",
"may",
"otherwise",
"remain",
"undetected",
".",
"A",
"multistep",
"model",
"linking",
"sporadic",
"colorectal",
"carcinogenesis",
"to",
"molecular",
"aberrations",
"has",
"been",
"proposed",
"-LSB-",
"6",
"--",
"8",
"-RSB-",
",",
"with",
"DNA",
"repair",
"genes",
",",
"tumor",
"suppressor",
"genes",
"and",
"oncogenes",
",",
"operating",
"in",
"multiple",
"genetic",
"pathways",
".",
"About",
"10",
"--",
"20",
"%",
"of",
"sporadic",
"colon",
"carcinomas",
"are",
"characterized",
"by",
"microsatellite",
"instability",
",",
"predominantly",
"due",
"to",
"promoter",
"methylation",
"of",
"the",
"MLH1",
"-LRB-",
"mutL",
"homolog",
"1",
",",
"colon",
"cancer",
",",
"nonpolyposis",
"type",
"2",
"-RRB-",
"DNA",
"mismatch",
"repair",
"gene",
",",
"which",
"prevents",
"expression",
"of",
"the",
"enzyme",
"-LSB-",
"9",
"-RSB-",
".",
"Up",
"to",
"90",
"%",
"of",
"colon",
"and",
"rectum",
"carcinomas",
"are",
"chromosomally",
"instable",
"-LSB-",
"10",
",",
"11",
"-RSB-",
"and",
"are",
"associated",
"with",
"mutations",
"in",
"the",
"APC",
"-LRB-",
"adenomatous",
"polyposis",
"coli",
"-RRB-",
"and",
"TP53",
"-LRB-",
"tumor",
"protein",
"53",
"-RRB-",
"tumor",
"suppressor",
"genes",
"and",
"in",
"the",
"KRAS",
"-LRB-",
"v-Ki-ras2",
"Kirsten",
"rat",
"sarcoma",
"viral",
"oncogene",
"homolog",
"-RRB-",
"oncogene",
"-LSB-",
"12",
"-RSB-",
".",
"However",
",",
"simultaneous",
"occurrence",
"of",
"mutations",
"in",
"these",
"three",
"genes",
"is",
"rare",
"suggesting",
"that",
",",
"even",
"within",
"this",
"group",
"of",
"chromosomally",
"instable",
"tumors",
",",
"different",
"genetic",
"pathways",
"to",
"colorectal",
"cancer",
"exist",
"-LSB-",
"13",
",",
"14",
"-RSB-",
".",
"Mutations",
"in",
"the",
"APC",
"gene",
"are",
"found",
"to",
"occur",
"relatively",
"early",
"in",
"colorectal",
"tumorigenesis",
"and",
"are",
"observed",
"in",
"up",
"to",
"80",
"%",
"of",
"both",
"adenomas",
"and",
"carcinomas",
"-LSB-",
"8",
",",
"15",
"-RSB-",
".",
"Mutations",
"in",
"the",
"KRAS",
"gene",
"are",
"observed",
"in",
"approximately",
"10",
"--",
"20",
"%",
"of",
"small",
"adenomas",
"and",
"40",
"--",
"50",
"%",
"of",
"larger",
"adenomas",
"and",
"carcinomas",
",",
"suggesting",
"it",
"to",
"be",
"an",
"important",
"event",
"in",
"the",
"progression",
"of",
"adenoma",
"to",
"carcinoma",
"-LSB-",
"15",
"-RSB-",
".",
"Mutations",
"in",
"the",
"TP53",
"gene",
"are",
"postulated",
"to",
"affect",
"relatively",
"late",
"stages",
"of",
"colorectal",
"carcinogenesis",
"-LSB-",
"15",
"-RSB-",
".",
"Breivik",
"et",
"al.",
"proposed",
"that",
"the",
"type",
"of",
"genetic",
"instability",
"in",
"cancer",
"cells",
"reflects",
"the",
"selection",
"pressures",
"exerted",
"by",
"specific",
"carcinogens",
"-LSB-",
"16",
"-RSB-",
".",
"Bardelli",
"et",
"al.",
"subsequently",
"tested",
"this",
"hypothesis",
"in",
"immortal",
"genetically",
"stable",
"human",
"cells",
"and",
"concluded",
"that",
"exposure",
"to",
"specific",
"carcinogens",
"can",
"indeed",
"select",
"for",
"tumor",
"cells",
"with",
"distinct",
"forms",
"of",
"genetic",
"instability",
"and",
"vice",
"versa",
"-LSB-",
"17",
"-RSB-",
".",
"Therefore",
",",
"DNA",
"adducts",
"derived",
"from",
"dietary",
"fat",
"metabolism",
"could",
"also",
"be",
"associated",
"with",
"colorectal",
"tumors",
"exhibiting",
"chromosomal",
"instability",
".",
"This",
"is",
"supported",
"by",
"the",
"observations",
"that",
"malondialdehyde",
"-LRB-",
"MDA",
"-RRB-",
",",
"generated",
"during",
"lipid",
"peroxidation",
"and",
"arachidonic",
"acid",
"metabolism",
",",
"can",
"form",
"DNA",
"adducts",
"and",
"induce",
"G",
"→",
"T",
"transversions",
"and",
"G",
"→",
"A",
"transitions",
"in",
"DNA",
"-LSB-",
"18",
",",
"19",
"-RSB-",
".",
"In",
"addition",
",",
"higher",
"levels",
"of",
"MDA-DNA",
"adducts",
"have",
"been",
"observed",
"in",
"colorectal",
"tissue",
"of",
"adenoma",
"patients",
"than",
"in",
"tissue",
"of",
"controls",
"-LSB-",
"20",
"-RSB-",
".",
"MDA",
"levels",
"are",
"modulated",
"by",
"dietary",
"factors",
",",
"with",
"polyunsaturated",
"fatty",
"acids",
",",
"and",
"specifically",
"ω-6",
"polyunsaturated",
"fatty",
"acids",
",",
"presumably",
"increasing",
"MDA",
"levels",
"-LSB-",
"21",
"-RSB-",
".",
"This",
"is",
"in",
"line",
"with",
"our",
"previous",
"report",
"of",
"a",
"significant",
"association",
"between",
"the",
"intake",
"of",
"linoleic",
"acid",
",",
"the",
"most",
"abundant",
"ω-6",
"polyunsaturated",
"fatty",
"acid",
"in",
"the",
"diet",
",",
"and",
"increased",
"risk",
"of",
"colon",
"carcinomas",
"with",
"a",
"mutated",
"KRAS",
"gene",
"within",
"the",
"Netherlands",
"Cohort",
"Study",
"-LRB-",
"NLCS",
"-RRB-",
"on",
"diet",
"and",
"cancer",
"-LSB-",
"22",
"-RSB-",
".",
"These",
"observations",
"and",
"hypotheses",
"prompted",
"us",
"to",
"investigate",
"the",
"associations",
"between",
"the",
"intake",
"of",
"total",
"fat",
"and",
"different",
"types",
"of",
"fat",
"and",
"the",
"risk",
"of",
"colon",
"and",
"rectal",
"tumors",
"lacking",
"MLH1",
"expression",
"and",
"with",
"and",
"without",
"APC",
"gene",
"mutations",
",",
"two",
"early",
"events",
"in",
"colorectal",
"tumorigenesis",
",",
"independent",
"of",
"tumors",
"harboring",
"KRAS",
"gene",
"mutations",
".",
"Materials",
"and",
"methods",
"Study",
"population",
"The",
"prospective",
"NLCS",
"was",
"initiated",
"in",
"The",
"Netherlands",
"in",
"September",
"1986",
".",
"The",
"study",
"design",
"has",
"been",
"described",
"in",
"detail",
"elsewhere",
"-LSB-",
"23",
"-RSB-",
".",
"Briefly",
",",
"at",
"baseline",
"a",
"total",
"of",
"58,279",
"men",
"and",
"62,573",
"women",
",",
"between",
"the",
"ages",
"of",
"55",
"and",
"69",
"years",
",",
"completed",
"a",
"self-administered",
"food",
"frequency",
"and",
"lifestyle",
"questionnaire",
".",
"Incident",
"cancer",
"cases",
"are",
"identified",
"by",
"monitoring",
"of",
"the",
"entire",
"cohort",
"for",
"cancer",
"occurrence",
"through",
"annual",
"record",
"linkage",
"to",
"the",
"National",
"Cancer",
"Registry",
"-LRB-",
"NCR",
"-RRB-",
",",
"consisting",
"of",
"nine",
"regional",
"cancer",
"registries",
"throughout",
"The",
"Netherlands",
",",
"and",
"to",
"PALGA",
",",
"a",
"nationwide",
"network",
"and",
"registry",
"of",
"histo",
"-",
"and",
"cytopathology",
"-LSB-",
"24",
"-RSB-",
".",
"The",
"NCR",
"and",
"PALGA",
"together",
"provide",
"a",
"near",
"100",
"%",
"coverage",
"of",
"the",
"204",
"municipalities",
"included",
"in",
"the",
"NLCS",
".",
"Accumulation",
"of",
"person-time",
"in",
"the",
"cohort",
"was",
"estimated",
"through",
"biennial",
"vital",
"status",
"follow-up",
"of",
"a",
"subcohort",
"of",
"3,500",
"men",
"and",
"women",
"who",
"were",
"randomly",
"selected",
"after",
"baseline",
"exposure",
"measurement",
"-LSB-",
"24",
"-RSB-",
".",
"Cases",
"with",
"prevalent",
"cancer",
"other",
"than",
"non-melanoma",
"skin",
"cancer",
"were",
"excluded",
"from",
"the",
"subcohort",
",",
"which",
"left",
"3,346",
"men",
"and",
"women",
"for",
"analysis",
"next",
"to",
"all",
"colorectal",
"cancer",
"cases",
"from",
"the",
"entire",
"cohort",
".",
"No",
"subcohort",
"members",
"were",
"lost",
"to",
"follow-up",
".",
"A",
"flow",
"diagram",
"of",
"subcohort",
"members",
"and",
"patients",
"on",
"whom",
"the",
"analyses",
"are",
"based",
"is",
"given",
"in",
"Fig.",
"1",
".",
"Fig.",
"1Flow",
"diagram",
"of",
"the",
"number",
"of",
"subjects",
"on",
"whom",
"the",
"final",
"statistical",
"analyses",
"were",
"based",
".",
"aNetherlands",
"Cancer",
"Registry",
".",
"bPathologisch",
"Anatomisch",
"Landelijk",
"Geautomatiseerd",
"Archief",
".",
"cPatients",
"with",
"rectosigmoid",
"tumors",
"were",
"not",
"included",
"in",
"the",
"analyses",
".",
"dmutL",
"homolog",
"1",
",",
"colon",
"cancer",
",",
"nonpolyposis",
"type",
"2",
".",
"eAdenomatous",
"polyposis",
"coli",
".",
"fMutation",
"cluster",
"region",
".",
"gv-Ki-ras2",
"Kirsten",
"rat",
"sarcoma",
"viral",
"oncogene",
"homolog",
".",
"hPatients",
"with",
"rectal",
"tumors",
"were",
"not",
"included",
"in",
"the",
"analysis",
"according",
"to",
"MLH1",
"expression",
"The",
"first",
"2.3",
"years",
"of",
"follow",
"up",
"were",
"excluded",
"because",
"of",
"possible",
"preclinical",
"disease",
"affecting",
"exposure",
"status",
"and",
"because",
"of",
"incomplete",
"nationwide",
"coverage",
"of",
"PALGA",
"alone",
"-LRB-",
"i.e.",
",",
"not",
"in",
"combination",
"with",
"the",
"NCR",
"-RRB-",
"in",
"some",
"of",
"the",
"municipalities",
"included",
"in",
"the",
"NLCS",
".",
"Within",
"this",
"period",
",",
"83",
"subcohort",
"members",
"deceased",
"or",
"were",
"diagnosed",
"with",
"cancer",
"other",
"than",
"non-melanoma",
"skin",
"cancer",
",",
"leaving",
"3,263",
"subcohort",
"members",
"for",
"analysis",
".",
"From",
"1989",
"to",
"1994",
",",
"929",
"incident",
"cases",
"with",
"histologically",
"confirmed",
"colorectal",
"cancer",
"were",
"identified",
"within",
"the",
"entire",
"cohort",
",",
"of",
"whom",
"819",
"could",
"also",
"be",
"linked",
"to",
"a",
"PALGA",
"report",
"of",
"the",
"lesion",
".",
"The",
"PALGA",
"reports",
"were",
"used",
"to",
"identify",
"and",
"locate",
"tumor",
"tissues",
"from",
"eligible",
"colorectal",
"cancer",
"patients",
"in",
"54",
"pathology",
"laboratories",
"throughout",
"the",
"Netherlands",
".",
"Cancers",
"were",
"classified",
"according",
"to",
"site",
"as",
"follows",
",",
"colon",
":",
"cecum",
"through",
"sigmoid",
"colon",
"-LRB-",
"ICD-O",
"codes",
"153:0",
",",
"153.1",
",",
"153.2",
",",
"153.3",
",",
"153.4",
",",
"153.5",
",",
"153.6",
",",
"153.7",
"-RRB-",
",",
"proximal",
"colon",
"-LRB-",
"ICD-O",
"codes",
"153.0",
",",
"153.1",
",",
"153.4",
",",
"153.5",
",",
"153.6",
"-RRB-",
",",
"distal",
"colon",
"-LRB-",
"ICD-O",
"codes",
"153.2",
",",
"153,3",
",",
"`",
"53.7",
"-RRB-",
",",
"rectosigmoid",
"-LRB-",
"ICD-O",
"code",
"154.0",
"-RRB-",
",",
"and",
"rectum",
"-LRB-",
"ICD-O",
"code",
"154.1",
"-RRB-",
".",
"Tissue",
"samples",
"Approval",
"for",
"collection",
"of",
"archival",
"tissue",
"samples",
"from",
"colorectal",
"cancer",
"patients",
"was",
"obtained",
"from",
"the",
"Ethical",
"Review",
"Board",
"of",
"University",
"Maastricht",
",",
"the",
"NCR",
"and",
"PALGA",
".",
"The",
"tissue",
"specimen",
"collection",
"started",
"in",
"August",
"1999",
"and",
"was",
"completed",
"in",
"December",
"of",
"2001",
".",
"For",
"five",
"percent",
"of",
"patients",
",",
"tissue",
"samples",
"could",
"not",
"be",
"retrieved",
"-LRB-",
"44/819",
"-RRB-",
"due",
"to",
"administrative",
"inconsistencies",
".",
"Of",
"775",
"available",
"tissue",
"samples",
",",
"737",
"-LRB-",
"95",
"%",
"-RRB-",
"contained",
"sufficient",
"tumor",
"material",
"for",
"molecular",
"analyses",
"of",
"MLH1",
"expression",
"and",
"mutations",
"in",
"APC",
"and",
"KRAS",
"genes",
".",
"Since",
"the",
"rectosigmoid",
"can",
"be",
"considered",
"as",
"a",
"clinically",
"applied",
"term",
"rather",
"than",
"an",
"anatomically",
"defined",
"transitional",
"zone",
"between",
"the",
"colon",
"and",
"rectum",
",",
"the",
"85",
"patients",
"with",
"a",
"rectosigmoid",
"tumor",
"were",
"excluded",
"from",
"data",
"analysis",
".",
"Moreover",
",",
"the",
"group",
"of",
"patients",
"with",
"a",
"rectosigmoid",
"tumor",
"was",
"too",
"small",
"for",
"adequate",
"stratified",
"analysis",
".",
"MLH1",
"expression",
"analysis",
"Formalin-fixed",
",",
"paraffin-embedded",
"tissues",
"were",
"sectioned",
"at",
"4",
"μm",
"and",
"contained",
"tumor",
"tissue",
"and",
"normal",
"adjacent",
"mucosa",
".",
"Endogeneous",
"peroxidase",
"activity",
"was",
"blocked",
"with",
"3",
"%",
"H2O2",
".",
"Slides",
"were",
"submitted",
"to",
"microwave",
"antigen",
"retrieval",
"in",
"1mM",
"EDTA",
"buffer",
"-LRB-",
"pH",
"8.0",
"-RRB-",
"and",
"incubated",
"with",
"10",
"%",
"normal",
"horse",
"serum",
"for",
"10",
"min",
"at",
"room",
"temperature",
".",
"Then",
",",
"sections",
"were",
"incubated",
"overnight",
"at",
"4",
"°C",
"with",
"mouse",
"monoclonal",
"antibodies",
"against",
"MLH1",
"protein",
"-LRB-",
"clone",
"G168",
"--",
"15",
",",
"PharMingen",
",",
"San",
"Diego",
",",
"CA",
"-RRB-",
"at",
"a",
"1:100",
"dilution",
".",
"Antibody",
"binding",
"was",
"detected",
"by",
"incubating",
"the",
"sections",
"at",
"room",
"temperature",
"with",
"the",
"peroxidase-labeled",
"DAKO",
"Envision",
"System",
"-LRB-",
"DAKO",
",",
"Carpinteris",
",",
"CA",
"-RRB-",
"and",
"using",
"DAB",
"as",
"a",
"chromogen",
".",
"Sections",
"were",
"counterstained",
"with",
"haematoxylin",
".",
"Lesions",
"were",
"considered",
"to",
"lack",
"MLH1",
"protein",
"expression",
"when",
"unequivocal",
"absence",
"of",
"nuclear",
"staining",
"of",
"the",
"tumor",
"epithelial",
"cells",
"was",
"observed",
".",
"Nuclear",
"staining",
"of",
"normal",
"epithelial",
"and",
"stromal",
"cells",
"or",
"lymphocytes",
"served",
"as",
"internal",
"positive",
"control",
".",
"Two",
"investigators",
"reviewed",
"the",
"immunohistochemical",
"staining",
"independently",
"and",
"discrepancies",
"were",
"re-examined",
"and",
"discussed",
"with",
"a",
"pathologist",
"until",
"consensus",
"was",
"reached",
".",
"MLH1",
"expression",
"status",
"was",
"determined",
"successfully",
"in",
"98",
"%",
"of",
"samples",
",",
"i.e.",
",",
"468",
"colon",
"tumors",
"and",
"173",
"rectum",
"tumors",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"APC",
"mutation",
"analysis",
"The",
"majority",
"of",
"somatic",
"mutations",
"in",
"APC",
"occur",
"within",
"the",
"mutation",
"cluster",
"region",
".",
"Mutation",
"analysis",
"of",
"the",
"mutation",
"cluster",
"region",
"-LRB-",
"codons",
"1,286",
"--",
"1,520",
"-RRB-",
",",
"was",
"performed",
"on",
"archival",
"adenocarcinoma",
"specimens",
",",
"using",
"macrodissection",
"followed",
"by",
"extraction",
"of",
"tumor",
"DNA",
".",
"Then",
"nested",
"PCR",
"was",
"used",
"to",
"amplify",
"the",
"mutation",
"cluster",
"region",
"in",
"four",
"overlapping",
"DNA",
"fragments",
"and",
"the",
"purified",
"fragments",
"were",
"sequenced",
".",
"This",
"procedure",
"has",
"been",
"described",
"in",
"detail",
"elsewhere",
"-LSB-",
"25",
"-RSB-",
".",
"In",
"brief",
",",
"in",
"a",
"first",
"round",
"of",
"PCR",
",",
"two",
"overlapping",
"fragments",
"were",
"generated",
",",
"that",
"served",
"as",
"templates",
"for",
"a",
"second",
"round",
"of",
"PCR",
"to",
"amplify",
"four",
"overlapping",
"biotin-labeled",
"PCR",
"fragments",
"that",
"were",
"subsequently",
"used",
"for",
"direct",
"sequencing",
".",
"The",
"sequence",
"profile",
"was",
"analyzed",
"on",
"ALFexpress",
"DNA",
"Analysis",
"System",
"using",
"ALFwin",
"software",
"-LRB-",
"Amersham",
"Biosciences",
",",
"Roosendaal",
",",
"The",
"Netherlands",
"-RRB-",
".",
"Evaluation",
"of",
"the",
"sequence",
"patterns",
"and",
"data",
"entry",
"were",
"independently",
"performed",
"by",
"two",
"observers",
".",
"Sensitivity",
"and",
"specificity",
"was",
"assessed",
"by",
"analyzing",
"the",
"mutational",
"status",
"of",
"APC",
"in",
"six",
"colorectal",
"cancer",
"cell",
"lines",
".",
"Both",
"sensitivity",
"and",
"specificity",
"were",
"regarded",
"to",
"be",
"satisfactory",
"since",
"specific",
"mutations",
"in",
"the",
"mutation",
"cluster",
"region",
"of",
"APC",
"were",
"confirmed",
"in",
"CaCo2",
"cells",
",",
"SW480",
"cells",
"and",
"LOVO",
"cells",
",",
"as",
"previously",
"described",
"-LSB-",
"25",
",",
"26",
"-RSB-",
",",
"and",
"wild",
"type",
"sequences",
"were",
"confirmed",
"in",
"HCT116",
",",
"Colo205",
"and",
"HT29",
",",
"for",
"the",
"mutation",
"cluster",
"region",
"of",
"APC",
"-LSB-",
"25",
"-RSB-",
".",
"In",
"addition",
",",
"the",
"detection",
"limit",
"was",
"5",
"%",
"of",
"mutated",
"DNA",
"-LSB-",
"25",
"-RSB-",
".",
"Reproducibility",
"of",
"mutation",
"analysis",
"was",
"regarded",
"to",
"be",
"satisfactory",
"since",
"85",
"%",
"of",
"duplicate",
"analyses",
",",
"from",
"flank",
"PCR",
"of",
"genomic",
"DNA",
"to",
"sequencing",
"of",
"the",
"four",
"fragments",
"-LRB-",
"i.e.",
",",
"61",
"out",
"of",
"72",
"fragments",
"-RRB-",
",",
"revealed",
"identical",
"mutation",
"status",
"of",
"APC",
"-LSB-",
"25",
"-RSB-",
".",
"From",
"47",
"colon",
"cancer",
"patients",
"and",
"25",
"rectum",
"cancer",
"patients",
",",
"one",
"or",
"more",
"fragments",
"of",
"the",
"APC",
"gene",
"mutation",
"cluster",
"region",
"could",
"not",
"be",
"amplified",
"and",
"these",
"patients",
"were",
"not",
"included",
"in",
"this",
"study",
",",
"leaving",
"429",
"colon",
"and",
"151",
"rectum",
"cancer",
"cases",
"with",
"successful",
"analysis",
"of",
"the",
"mutation",
"cluster",
"region",
"of",
"the",
"APC",
"gene",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"KRAS",
"mutation",
"analysis",
"Mutation",
"analysis",
"of",
"the",
"exon1",
"fragment",
"of",
"the",
"KRAS",
"oncogene",
",",
"spanning",
"codons",
"8",
"--",
"29",
",",
"was",
"performed",
"on",
"archival",
"adenocarcinoma",
"specimens",
",",
"using",
"nested",
"PCR",
",",
"followed",
"by",
"direct",
"sequencing",
"of",
"purified",
"fragments",
"-LSB-",
"27",
"-RSB-",
".",
"The",
"detection",
"limit",
"was",
"5",
"%",
"mutated",
"DNA",
".",
"Reproducibility",
"was",
"regarded",
"to",
"be",
"satisfactory",
",",
"since",
"88",
"%",
"of",
"duplicate",
"analyses",
",",
"from",
"tissue",
"sectioning",
"to",
"DNA",
"sequencing",
"-LRB-",
"i.e.",
",",
"28",
"out",
"of",
"32",
"-RRB-",
",",
"revealed",
"identical",
"mutation",
"status",
"of",
"KRAS",
"-LSB-",
"27",
"-RSB-",
".",
"Mutation",
"analysis",
"was",
"performed",
"with",
"success",
"on",
"476",
"colon",
"and",
"176",
"rectum",
"cancer",
"cases",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"Exposure",
"assessment",
"The",
"150",
"--",
"item",
"semi-quantitative",
"food",
"frequency",
"questionnaire",
"concentrated",
"on",
"habitual",
"consumption",
"of",
"food",
"and",
"beverages",
"during",
"the",
"year",
"preceding",
"the",
"start",
"of",
"the",
"study",
".",
"Mean",
"individual",
"nutrient",
"intakes",
"per",
"day",
"were",
"computed",
"using",
"the",
"computerized",
"Dutch",
"food",
"composition",
"table",
"of",
"1986",
"-LSB-",
"28",
"-RSB-",
".",
"The",
"questionnaire",
"was",
"validated",
"against",
"a",
"9-day",
"diet",
"record",
"-LSB-",
"29",
"-RSB-",
".",
"Crude",
"and",
"energy-gender-adjusted",
"-LRB-",
"in",
"parentheses",
"-RRB-",
"correlation",
"coefficients",
"were",
"0.72",
"-LRB-",
"0.52",
"-RRB-",
"for",
"total",
"fat",
",",
"0.73",
"-LRB-",
"0.58",
"-RRB-",
"for",
"saturated",
"fat",
"and",
"0.73",
"-LRB-",
"0.75",
"-RRB-",
"for",
"polyunsaturated",
"fat",
"-LSB-",
"29",
"-RSB-",
".",
"For",
"energy",
"intake",
"the",
"correlation",
"coefficient",
"was",
"0.74",
".",
"On",
"average",
",",
"the",
"questionnaire",
"covered",
"91",
"%",
"of",
"the",
"energy",
"intake",
"assessed",
"by",
"the",
"record",
"intake",
".",
"Questionnaire",
"data",
"were",
"key-entered",
"twice",
"and",
"processed",
"for",
"all",
"incident",
"cases",
"in",
"the",
"cohort",
"and",
"for",
"all",
"subcohort",
"members",
"in",
"a",
"manner",
"blinded",
"with",
"respect",
"to",
"case/subcohort",
"status",
".",
"For",
"7",
"%",
"of",
"subjects",
"-LRB-",
"either",
"cases",
"or",
"subcohort",
"members",
"-RRB-",
",",
"dietary",
"data",
"were",
"incomplete",
"or",
"inconsistent",
",",
"and",
"they",
"were",
"excluded",
"from",
"the",
"analyses",
".",
"Questionnaires",
"were",
"considered",
"incomplete",
"when",
"either",
":",
"-LRB-",
"1",
"-RRB-",
"more",
"than",
"60",
"items",
"were",
"left",
"blank",
"and",
"less",
"than",
"35",
"items",
"were",
"eaten",
"at",
"least",
"once",
"a",
"month",
";",
"or",
"-LRB-",
"2",
"-RRB-",
"one",
"or",
"more",
"item",
"blocks",
"-LRB-",
"groups",
"of",
"items",
",",
"e.g.",
",",
"beverages",
"-RRB-",
"were",
"left",
"blank",
".",
"Additional",
"details",
"are",
"given",
"elsewhere",
"-LSB-",
"29",
"-RSB-",
".",
"This",
"resulted",
"in",
"the",
"availability",
"of",
"3,048",
"subcohort",
"members",
",",
"441",
"colon",
"cancer",
"cases",
"for",
"whom",
"MLH1",
"expression",
"status",
"was",
"known",
",",
"and",
"414",
"colon",
"and",
"136",
"rectal",
"cancer",
"cases",
"for",
"whom",
"APC",
"and",
"KRAS",
"mutation",
"status",
"was",
"known",
".",
"No",
"data-analyses",
"were",
"conducted",
"for",
"lack",
"of",
"MLH1",
"expression",
"in",
"rectal",
"cancer",
"cases",
"since",
"there",
"were",
"only",
"two",
"such",
"cases",
"in",
"the",
"cohort",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"Intake",
"of",
"specific",
"fatty",
"acids",
"was",
"based",
"on",
"a",
"food",
"composition",
"database",
"with",
"specific",
"fatty",
"acids",
"derived",
"from",
"the",
"TRANSFAIR",
"study",
"-LSB-",
"30",
"-RSB-",
".",
"For",
"this",
"database",
",",
"the",
"hundred",
"foods",
"that",
"contributed",
"most",
"to",
"fat",
"intake",
"in",
"the",
"Dutch",
"dietary",
"pattern",
"were",
"sampled",
"and",
"analyzed",
"as",
"methyl",
"esters",
"of",
"the",
"fatty",
"acids",
"present",
"in",
"the",
"foods",
".",
"In",
"the",
"database",
",",
"total",
"fat",
"includes",
"triglycerides",
"and",
"other",
"lipids",
"such",
"as",
"phospholipids",
"and",
"sterols",
".",
"The",
"percentage",
"of",
"triglycerides",
"in",
"total",
"fat",
"is",
"assumed",
"to",
"be",
"93",
"%",
"on",
"average",
",",
"but",
"varies",
"across",
"food",
"sources",
".",
"Daily",
"intakes",
"of",
"total",
"fat",
"-LRB-",
"g/day",
"-RRB-",
",",
"saturated",
"fat",
"-LRB-",
"g/day",
"-RRB-",
",",
"monounsaturated",
"fat",
"-LRB-",
"g/day",
"-RRB-",
",",
"polyunsaturated",
"fat",
"-LRB-",
"g/day",
"-RRB-",
",",
"and",
"linoleic",
"acid",
"-LRB-",
"C18",
":",
"2",
",",
"C9",
",",
"12",
"-RRB-",
"-LRB-",
"g/day",
"-RRB-",
"and",
"linolenic",
"acid",
"-LRB-",
"C18",
":",
"3",
",",
"C9",
",",
"12",
",",
"15",
"-RRB-",
"-LRB-",
"g/day",
"-RRB-",
"as",
"the",
"main",
"constituents",
"of",
"polyunsaturated",
"fat",
",",
"were",
"used",
"as",
"exposure",
"variables",
".",
"Linoleic",
"and",
"linolenic",
"acid",
"were",
"used",
"as",
"the",
"most",
"abundant",
"sources",
"of",
"ω-6",
"polyunsaturated",
"fatty",
"acids",
"and",
"ω-3",
"polyunsaturated",
"fatty",
"acids",
"in",
"the",
"diet",
".",
"In",
"all",
"analyses",
",",
"the",
"values",
"for",
"fat",
"intake",
"variables",
"are",
"adjusted",
"for",
"energy",
"intake",
"by",
"the",
"residual",
"method",
"-LSB-",
"31",
"-RSB-",
".",
"For",
"data",
"analyses",
",",
"quartiles",
"of",
"the",
"intake",
"of",
"fat",
"and",
"different",
"types",
"of",
"fats",
"were",
"computed",
"based",
"on",
"the",
"distribution",
"of",
"subcohort",
"members",
".",
"Daily",
"intake",
"of",
"dietary",
"fiber",
"-LRB-",
"g/day",
"-RRB-",
",",
"alcohol",
"-LRB-",
"g/day",
"-RRB-",
",",
"fruit",
"-LRB-",
"g/day",
"-RRB-",
",",
"vegetables",
"-LRB-",
"g/day",
"-RRB-",
"and",
"total",
"energy",
"-LRB-",
"kJ/day",
"-RRB-",
"and",
"age",
"at",
"baseline",
"-LRB-",
"years",
"-RRB-",
",",
"sex",
"-LRB-",
"men/women",
"-RRB-",
",",
"body",
"mass",
"index",
"-LRB-",
"kg/m2",
"-RRB-",
",",
"non-occupational",
"physical",
"activity",
"-LRB-",
"<",
"30",
"min/day",
",",
"30",
"--",
"60",
"min/day",
",",
"60",
"--",
"90",
"min/day",
",",
">",
"90",
"min/day",
"-RRB-",
",",
"family",
"history",
"of",
"colorectal",
"cancer",
"-LRB-",
"yes/no",
"-RRB-",
"and",
"smoking",
"status",
"-LRB-",
"never/ex/current",
"-RRB-",
"were",
"regarded",
"as",
"potential",
"confounders",
".",
"Statistical",
"analysis",
"Data",
"analyses",
"were",
"based",
"on",
"study",
"participants",
"for",
"whom",
"data",
"on",
"fat",
"intake",
"and",
"confounding",
"variables",
"were",
"complete",
",",
"i.e.",
",",
"2,948",
"subcohort",
"members",
",",
"428",
"colon",
"cancer",
"patients",
"for",
"whom",
"MLH1",
"expression",
"status",
"was",
"known",
",",
"and",
"401",
"colon",
"cancer",
"and",
"130",
"rectal",
"cancer",
"patients",
"for",
"whom",
"APC",
"and",
"KRAS",
"mutation",
"status",
"was",
"known",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"Data",
"analyses",
"were",
"conducted",
"separately",
"for",
"overall",
"colon",
"and",
"rectal",
"cancer",
",",
"colon",
"cancer",
"lacking",
"MLH1",
"expression",
",",
"colon",
"and",
"rectal",
"cancer",
"with",
"or",
"without",
"a",
"truncating",
"APC",
"mutation",
",",
"described",
"here",
"as",
"APC",
"+",
"and",
"APC",
"−",
"tumors",
"respectively",
".",
"Truncating",
"APC",
"mutations",
"lead",
"to",
"the",
"introduction",
"of",
"a",
"stop",
"codon",
"and",
"result",
"in",
"a",
"truncated",
"and",
"therefore",
",",
"inactive",
"APC",
"protein",
".",
"The",
"analyses",
"with",
"truncating",
"APC",
"mutations",
"were",
"also",
"conducted",
"separately",
"for",
"the",
"most",
"common",
"point",
"mutations",
"resulting",
"in",
"the",
"introduction",
"of",
"a",
"stop",
"codon",
",",
"i.e.",
",",
"C",
":",
"G",
"→",
"T",
":",
"A",
"or",
"G",
":",
"C",
"→",
"T",
":",
"A",
"point",
"mutations",
".",
"As",
"indicated",
"previously",
",",
"associations",
"between",
"fat",
"intake",
"and",
"KRAS",
"mutated",
"tumors",
"have",
"been",
"described",
"in",
"this",
"population",
"previously",
",",
"and",
"a",
"positive",
"association",
"between",
"the",
"intake",
"of",
"linoleic",
"acid",
"and",
"KRAS",
"mutated",
"colon",
"tumors",
"was",
"observed",
"-LSB-",
"22",
"-RSB-",
".",
"Therefore",
",",
"when",
"-LRB-",
"borderline",
"-RRB-",
"significant",
"associations",
"were",
"observed",
"with",
"any",
"of",
"the",
"colon",
"tumor",
"endpoints",
",",
"analyses",
"were",
"repeated",
"excluding",
"tumors",
"harboring",
"mutations",
"in",
"KRAS",
".",
"Since",
"tumors",
"may",
"harbor",
"multiple",
"mutations",
"it",
"is",
"difficult",
"to",
"assess",
"whether",
"observed",
"associations",
"are",
"specific",
"for",
"tumors",
"with",
"a",
"particular",
"gene",
"defect",
".",
"We",
"therefore",
",",
"conducted",
"additional",
"analyses",
"when",
"-LRB-",
"borderline",
"-RRB-",
"significant",
"associations",
"were",
"observed",
".",
"In",
"these",
"analyses",
"subgroups",
"of",
"tumors",
"were",
"formed",
"characterized",
"by",
"either",
"the",
"absence",
"of",
"the",
"three",
"gene",
"defects",
",",
"or",
"by",
"defects",
"in",
"a",
"single",
"gene",
",",
"i.e.",
",",
"either",
"only",
"lack",
"of",
"MLH1",
"expression",
",",
"only",
"a",
"truncating",
"APC",
"mutation",
"or",
"only",
"an",
"activating",
"KRAS",
"mutations",
".",
"Activating",
"KRAS",
"mutations",
"are",
"defined",
"as",
"mutations",
"in",
"codons",
"12",
"and",
"13",
"of",
"the",
"KRAS",
"gene",
"leading",
"to",
"an",
"altered",
"amino",
"acid",
".",
"Mean",
"values",
"of",
"the",
"intake",
"of",
"fat",
"variables",
"-LRB-",
"g/day",
"-RRB-",
",",
"and",
"possible",
"confounding",
"variables",
"including",
"age",
"at",
"baseline",
"-LRB-",
"years",
"-RRB-",
",",
"dietary",
"fiber",
"-LRB-",
"g/day",
"-RRB-",
",",
"alcohol",
"-LRB-",
"g/day",
"-RRB-",
",",
"intake",
"of",
"fruit",
"-LRB-",
"g/day",
"-RRB-",
",",
"vegetable",
"-LRB-",
"g/day",
"-RRB-",
",",
"energy",
"-LRB-",
"kJ/day",
"-RRB-",
",",
"and",
"BMI",
"-LRB-",
"kg/m2",
"-RRB-",
",",
"as",
"well",
"as",
"distributions",
"of",
"the",
"variables",
"sex",
",",
"family",
"history",
"of",
"colorectal",
"cancer",
"-LRB-",
"yes/no",
"-RRB-",
",",
"smoking",
"status",
"-LRB-",
"never/ex/current",
"smoker",
"-RRB-",
"and",
"physical",
"activity",
"in",
"leisure",
"time",
"-LRB-",
"<",
"30",
",",
"30",
"--",
"60",
",",
"60",
"--",
"90",
",",
">",
"90",
"min/day",
"-RRB-",
"were",
"evaluated",
"for",
"subcohort",
"members",
",",
"colon",
"and",
"rectal",
"cancer",
"patients",
"with",
"or",
"without",
"a",
"truncating",
"APC",
"mutation",
"and",
"colon",
"cancer",
"patients",
"lacking",
"MLH1",
"expression",
".",
"Differences",
"in",
"mean",
"values",
"of",
"the",
"continuous",
"variables",
"between",
"patients",
"with",
"or",
"without",
"truncating",
"nonsense",
"or",
"frameshift",
"mutations",
"in",
"the",
"mutation",
"cluster",
"region",
"of",
"the",
"APC",
"gene",
",",
"and",
"between",
"patients",
"with",
"or",
"without",
"MLH1",
"expression",
",",
"were",
"tested",
"using",
"the",
"Mann",
"--",
"Whitney-U-test",
"since",
"the",
"variables",
"were",
"not",
"normally",
"distributed",
"among",
"cases",
".",
"The",
"distributions",
"of",
"the",
"categorical",
"variables",
"between",
"patients",
"with",
"and",
"without",
"truncating",
"APC",
"mutations",
"were",
"tested",
"with",
"the",
"χ2",
"--",
"test",
".",
"Incidence",
"rate",
"ratios",
"-LRB-",
"RR",
"-RRB-",
"and",
"corresponding",
"95",
"%",
"confidence",
"intervals",
"-LRB-",
"CI",
"-RRB-",
"for",
"colon",
"and",
"rectal",
"cancer",
"patients",
"were",
"estimated",
"according",
"to",
"quartiles",
"of",
"intake",
"of",
"fat",
"variables",
",",
"and",
"one",
"standard",
"deviation",
"increment",
"of",
"intake",
",",
"using",
"Cox",
"proportional",
"hazards",
"regression",
"models",
".",
"In",
"addition",
",",
"associations",
"were",
"estimated",
"for",
"specific",
"molecular",
"endpoints",
"of",
"the",
"tumors",
".",
"Standard",
"errors",
"were",
"estimated",
"using",
"the",
"robust",
"Huber",
"--",
"White",
"sandwich",
"estimator",
"to",
"account",
"for",
"additional",
"variance",
"introduced",
"by",
"sampling",
"the",
"subcohort",
"from",
"the",
"entire",
"cohort",
"-LSB-",
"32",
",",
"33",
"-RSB-",
".",
"The",
"proportional",
"hazards",
"assumption",
"was",
"tested",
"using",
"the",
"scaled",
"Schoenfeld",
"residuals",
"-LSB-",
"34",
"-RSB-",
".",
"Tests",
"for",
"dose",
"response",
"trends",
"over",
"the",
"different",
"quartiles",
"and",
"categories",
"of",
"fat",
"intake",
"were",
"estimated",
"by",
"fitting",
"the",
"ordinal",
"exposure",
"variables",
"as",
"continuous",
"variables",
"and",
"evaluated",
"using",
"the",
"Wald",
"test",
".",
"The",
"covariates",
"included",
"in",
"the",
"multivariate",
"analyses",
"were",
"those",
"found",
"to",
"significantly",
"-LRB-",
"p",
"<",
"0.05",
"-RRB-",
"contribute",
"to",
"the",
"multivariate",
"model",
"for",
"colon",
"and/or",
"rectal",
"cancer",
"-LRB-",
"age",
"at",
"baseline",
",",
"sex",
",",
"body",
"mass",
"index",
",",
"family",
"history",
"of",
"colorectal",
"cancer",
",",
"and",
"smoking",
"status",
"-RRB-",
"or",
"to",
"influence",
"the",
"RR",
"by",
"more",
"than",
"ten",
"percent",
",",
"as",
"well",
"as",
"energy",
"intake",
".",
"Results",
"Lack",
"of",
"expression",
"in",
"MLH1",
"was",
"observed",
"in",
"13",
"%",
"-LRB-",
"54",
"out",
"of",
"428",
"-RRB-",
"of",
"tumors",
"from",
"colon",
"cancer",
"patients",
"-LRB-",
"Table",
"1",
"-RRB-",
".",
"APC",
"truncating",
"mutations",
"were",
"observed",
"in",
"tumors",
"from",
"32",
"%",
"of",
"colon",
"cancer",
"patients",
"-LRB-",
"127",
"out",
"of",
"401",
"-RRB-",
"and",
"44",
"%",
"of",
"rectal",
"cancer",
"patients",
"-LRB-",
"57",
"out",
"of",
"130",
"-RRB-",
"-LRB-",
"Table",
"1",
"-RRB-",
".",
"C",
":",
"G",
"→",
"T",
":",
"A",
"transitions",
"or",
"G",
":",
"C",
"→",
"T",
":",
"A",
"transversions",
"that",
"would",
"result",
"in",
"a",
"stop",
"codon",
"were",
"observed",
"in",
"10",
"%",
"and",
"5",
"%",
"of",
"colon",
"cancer",
"patients",
"and",
"12",
"%",
"and",
"5",
"%",
"of",
"rectal",
"cancer",
"patients",
",",
"respectively",
".",
"These",
"figures",
"are",
"similar",
"to",
"the",
"percentages",
"reported",
"for",
"the",
"total",
"group",
"of",
"colon",
"and",
"rectal",
"cancer",
"patients",
"for",
"whom",
"APC",
"mutation",
"status",
"was",
"available",
",",
"but",
"for",
"whom",
"dietary",
"intake",
"data",
"were",
"not",
"always",
"complete",
"-LSB-",
"25",
"-RSB-",
".",
"Table",
"1Baseline",
"dietary",
"intake",
"and",
"other",
"characteristics",
"of",
"the",
"subcohort",
"and",
"colon",
"and",
"rectum",
"cancer",
"patients",
"from",
"The",
"Netherlands",
"cohort",
"studySubcohortColon",
"cancer",
"-LRB-",
"n",
"=",
"428",
"-RRB-",
"p-valuebColon",
"cancer",
"-LRB-",
"n",
"=",
"401",
"-RRB-",
"p-valuebRectal",
"cancer",
"-LRB-",
"n",
"=",
"130",
"-RRB-",
"p-valuebMLH1",
"expressionaNo",
"MLH1",
"expressionaAPC",
"−",
"cAPC",
"+",
"cAPC",
"−",
"cAPC",
"+",
"cN2",
",948374542741277357",
"Sex",
"-LRB-",
"%",
"men",
"-RRB-",
"4856410.0452560.4964670.79",
"Age",
"-LRB-",
"years",
"-RRB-",
"61.3",
"±",
"4.263.0",
"±",
"4.062.8",
"±",
"4.50.9163.1",
"±",
"4.062.7",
"±",
"4.00.3462.2",
"±",
"4.462.6",
"±",
"3.50.63",
"Fat",
"variables",
"-LRB-",
"g/day",
"-RRB-",
"d",
"Total",
"fat83",
".8",
"±",
"15.885.1",
"±",
"14.784.1",
"±",
"17.50.5785.2",
"±",
"15.084.8",
"±",
"14.90.8085.1",
"±",
"14.286.7",
"±",
"14.80.52",
"Saturated",
"fat33",
".2",
"±",
"7.533.5",
"±",
"6.633.3",
"±",
"7.60.6433.3",
"±",
"6.733.5",
"±",
"7.00.9233.0",
"±",
"5.835.5",
"±",
"7.70.05",
"MUFAe31",
".4",
"±",
"7.031.9",
"±",
"6.531.1",
"±",
"7.50.4531.8",
"±",
"6.631.9",
"±",
"6.60.9831.8",
"±",
"6.132.8",
"±",
"6.20.37",
"PUFAf17",
".3",
"±",
"7.517.9",
"±",
"7.517.4",
"±",
"6.80.8518.2",
"±",
"7.317.8",
"±",
"7.60.4418.6",
"±",
"8.716.5",
"±",
"6.90.27",
"Linoleic",
"acid16",
".0",
"±",
"7.516.7",
"±",
"7.516.6",
"±",
"7.00.7617.0",
"±",
"7.416.6",
"±",
"7.70.3617.5",
"±",
"8.815.2",
"±",
"7.20.15",
"Linolenic",
"acid1",
".3",
"±",
"0.61.2",
"±",
"0.51.3",
"±",
"0.60.981.2",
"±",
"0.51.3",
"±",
"0.50.571.3",
"±",
"0.61.3",
"±",
"0.60.79",
"Other",
"dietary",
"factors",
"Fibre",
"-LRB-",
"g/day",
"-RRB-",
"27.0",
"±",
"8.224.5",
"±",
"8.125.2",
"±",
"7.10.1326.7",
"±",
"7.927.9",
"±",
"8.10.2028.1",
"±",
"7.028.2",
"±",
"9.00.78",
"Alcohol",
"-LRB-",
"g/day",
"-RRB-",
"g10",
".1",
"±",
"14.111.0",
"±",
"14.810.7",
"±",
"17.00.4911.0",
"±",
"14.911.3",
"±",
"16.50.8912.2",
"±",
"14.914.5",
"±",
"18.10.53",
"Fruit",
"-LRB-",
"g/day",
"-RRB-",
"177.0",
"±",
"118.0178.8",
"±",
"122.1160.5",
"±",
"137.70.07169.7",
"±",
"121.9187.5",
"±",
"132.20.11197.4",
"±",
"155.1205.0",
"±",
"118.30.21",
"Vegetables",
"-LRB-",
"g/day",
"-RRB-",
"193.8",
"±",
"82.2191.3",
"±",
"82.3185.4",
"±",
"73.80.80187.9",
"±",
"80.7192.7",
"±",
"85.20.71186.3",
"±",
"68.5169.0",
"±",
"122.20.69",
"Energy",
"-LRB-",
"kj/day",
"-RRB-",
"8,028",
"±",
"2,1648,080",
"±",
"2,0597,505",
"±",
"1,7180.077,845",
"±",
"1,8998,335",
"±",
"2,3060.098,433",
"±",
"1,9248,449",
"±",
"1,6160.92",
"Other",
"characteristics",
"BMIh",
"-LRB-",
"kg/m2",
"-RRB-",
"25.1",
"±",
"3.125.6",
"±",
"3.225.6",
"±",
"3.50.5725.5",
"±",
"3.2825.8",
"±",
"3.10.3025.3",
"±",
"3.125.1",
"±",
"2.80.92",
"Family",
"history",
"of",
"CRCi",
"-LRB-",
"%",
"yes",
"-RRB-",
"61390.4911110.9810110.86",
"Smoker",
"-LRB-",
"%",
"-RRB-",
"Never37373336382633",
"Ex-smoker35453746434739",
"Current",
"smoker2818300",
".1218190.8827280.59",
"Physical",
"activity",
"-LRB-",
"%",
"-RRB-",
"g",
"<",
"30",
"min/day21212219261726",
"30-60",
"min/day32332233282832",
"60-90",
"min/day21211922182418",
">",
"90",
"min/day2725370",
".2026270.3132250.43",
"aFor",
"rectal",
"cancer",
"there",
"were",
"only",
"two",
"patients",
"without",
"MLH1",
"expression",
",",
"these",
"are",
"not",
"shown",
"separately",
"in",
"this",
"tablebp-value",
"for",
"the",
"difference",
"between",
"cancer",
"patients",
"with",
"and",
"without",
"MLH1",
"expression",
"and",
"colon",
"and",
"rectal",
"cancer",
"patients",
"with",
"and",
"without",
"a",
"mutation",
"leading",
"to",
"the",
"introduction",
"of",
"a",
"stop",
"codon",
"in",
"APCcAPC",
"−",
":",
"cancer",
"patients",
"without",
"a",
"mutation",
"in",
"the",
"MCR",
"of",
"the",
"APC",
"gene",
"leading",
"to",
"a",
"stop",
"codon",
";",
"APC",
"+",
":",
"cancer",
"patients",
"with",
"a",
"mutation",
"in",
"the",
"MCR",
"of",
"the",
"APC",
"gene",
"leading",
"to",
"a",
"stop",
"codondAdjusted",
"for",
"energy",
"intakeeMonounsaturated",
"fatfPolyunsaturated",
"fatgFor",
"alcohol",
"intake",
"and",
"physical",
"activity",
"the",
"mean",
"levels",
"in",
"the",
"subcohort",
"are",
"based",
"on",
"2,862",
"and",
"2,915",
"subjects",
"respectively",
".",
"Four",
"and",
"six",
"colon",
"cancer",
"cases",
"had",
"missing",
"values",
"for",
"alcohol",
"intake",
"and",
"physical",
"activity",
"respectively",
".",
"Two",
"and",
"one",
"rectal",
"cancer",
"case",
"had",
"missing",
"values",
"for",
"alcohol",
"intake",
"and",
"physical",
"activity",
"respectivelyhBMI",
":",
"body",
"mass",
"indexiCRC",
":",
"colorectal",
"cancer",
"Colon",
"and",
"rectal",
"cancer",
"patients",
"were",
"generally",
"older",
"and",
"more",
"frequently",
"men",
"than",
"subcohort",
"members",
"-LRB-",
"Table",
"1",
"-RRB-",
".",
"Colon",
"cancer",
"patients",
"lacking",
"MLH1",
"expression",
"in",
"their",
"tumor",
"were",
"significantly",
"less",
"often",
"men",
"than",
"patients",
"with",
"expression",
"of",
"the",
"gene",
"-LRB-",
"41",
"%",
"vs.",
"56",
"%",
"-RRB-",
".",
"There",
"were",
"no",
"striking",
"differences",
"in",
"fat",
"intake",
"between",
"patients",
"and",
"subcohort",
"members",
"or",
"between",
"patients",
"with",
"or",
"without",
"MLH1",
"expression",
"or",
"APC",
"mutations",
"in",
"their",
"tumors",
".",
"Only",
"rectal",
"cancer",
"patients",
"with",
"a",
"tumor",
"harboring",
"a",
"truncating",
"APC",
"mutation",
"had",
"a",
"higher",
"intake",
"of",
"saturated",
"fat",
"than",
"rectal",
"cancer",
"patients",
"without",
"a",
"truncating",
"APC",
"mutation",
"-LRB-",
"p",
"=",
"0.05",
"-RRB-",
".",
"Neither",
"total",
"fat",
"nor",
"different",
"types",
"of",
"fat",
"appeared",
"to",
"be",
"associated",
"with",
"overall",
"colon",
"cancer",
"risk",
"in",
"this",
"population",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"For",
"different",
"subgroups",
"of",
"colon",
"cancer",
"based",
"on",
"absence",
"of",
"MLH1",
"expression",
"or",
"absence",
"or",
"presence",
"of",
"APC",
"truncating",
"mutations",
"in",
"their",
"tumors",
",",
"total",
"fat",
"intake",
"and",
"most",
"of",
"the",
"specific",
"types",
"of",
"fat",
"intake",
"variables",
"were",
"also",
"not",
"associated",
"with",
"risk",
".",
"However",
",",
"polyunsaturated",
"fat",
"intake",
",",
"and",
"especially",
"linoleic",
"acid",
"intake",
",",
"appeared",
"to",
"be",
"associated",
"with",
"an",
"increased",
"risk",
"of",
"colon",
"tumors",
"without",
"MLH1",
"expression",
"and",
"with",
"colon",
"tumors",
"without",
"APC",
"truncating",
"mutations",
",",
"but",
"not",
"with",
"colon",
"tumors",
"with",
"APC",
"truncating",
"mutations",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"For",
"colon",
"tumors",
"without",
"MLH1",
"expression",
",",
"the",
"RR",
"according",
"to",
"the",
"quartiles",
"of",
"linoleic",
"acid",
"intake",
"were",
"increased",
",",
"though",
"not",
"significantly",
",",
"for",
"all",
"the",
"categories",
"of",
"intake",
"above",
"the",
"reference",
"-LRB-",
"lowest",
"quartile",
"of",
"intake",
"-RRB-",
",",
"i.e.",
",",
"1.66",
"-LRB-",
"95",
"%",
"CI",
"0.69",
"--",
"3.98",
"-RRB-",
",",
"2.14",
"-LRB-",
"95",
"%",
"CI",
"0.91",
"--",
"5.00",
"-RRB-",
"and",
"2.02",
"-LRB-",
"95",
"%",
"CI",
"0.86",
"--",
"4.76",
"-RRB-",
"for",
"the",
"second",
"through",
"the",
"fourth",
"quartiles",
"respectively",
",",
"and",
"the",
"test",
"for",
"linear",
"trend",
"was",
"borderline",
"significant",
"-LRB-",
"p",
"=",
"0.08",
"-RRB-",
".",
"A",
"similar",
"trend",
"was",
"observed",
"for",
"the",
"risk",
"of",
"colon",
"tumors",
"without",
"APC",
"truncating",
"mutations",
"-LRB-",
"RR",
"over",
"the",
"quartiles",
"of",
"linoleic",
"acid",
"intake",
":",
"1.50",
"-LRB-",
"95",
"%",
"CI",
"1.02",
"--",
"2.21",
"-RRB-",
",",
"1.68",
"-LRB-",
"95",
"%",
"CI",
"1.15",
"--",
"2.45",
"-RRB-",
"and",
"1.44",
"-LRB-",
"95",
"%",
"CI",
"0.99",
"--",
"2.11",
"-RRB-",
"respectively",
",",
"p-trend",
"=",
"0.05",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"Additional",
"analyses",
"for",
"subgroups",
"of",
"colon",
"tumors",
"with",
"specific",
"truncating",
"point",
"mutations",
"in",
"APC",
"did",
"not",
"show",
"any",
"associations",
"with",
"the",
"intake",
"of",
"fat",
"or",
"different",
"types",
"of",
"fat",
"-LRB-",
"results",
"not",
"shown",
"-RRB-",
".",
"Table",
"2Adjusted",
"incidence",
"rate",
"ratios",
"and",
"95",
"%",
"confidence",
"intervals",
"for",
"colon",
"cancer",
"patients",
"overall",
",",
"without",
"MLH1",
"expression",
",",
"and",
"with",
"and",
"without",
"an",
"APC",
"mutation",
"leading",
"to",
"a",
"stop",
"codon",
",",
"according",
"to",
"the",
"intake",
"of",
"fat",
"variables",
"-LRB-",
"The",
"Netherlands",
"Cohort",
"Study",
"-RRB-",
"Dietary",
"fat",
"intakeMedian",
"intake",
"-LRB-",
"g/day",
"-RRB-",
"Person",
"yearsbColon",
"cancerOverallNo",
"MLH1",
"expressionAPC",
"--",
"aAPC",
"+",
"aMenWomenNumber",
"of",
"patientsRRc",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cNumber",
"of",
"patientsRRc",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cNumber",
"of",
"patientsRRc",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cNumber",
"of",
"patientsRRc",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cTotal",
"fat",
"Q178",
".063.03,5491101.00",
"-LRB-",
"reference",
"-RRB-",
"111.00",
"-LRB-",
"reference",
"-RRB-",
"611.00",
"-LRB-",
"reference",
"-RRB-",
"401.00",
"-LRB-",
"reference",
"-RRB-",
"Q290",
".271.43,5561251.09",
"-LRB-",
"0.82",
"--",
"1.44",
"-RRB-",
"171.47",
"-LRB-",
"0.69",
"--",
"3.14",
"-RRB-",
"871.34",
"-LRB-",
"0.94",
"--",
"1.90",
"-RRB-",
"320.80",
"-LRB-",
"0.49",
"--",
"1.28",
"-RRB-",
"Q398",
".577.63,579890.75",
"-LRB-",
"0.55",
"--",
"1.01",
"-RRB-",
"110.94",
"-LRB-",
"0.40",
"--",
"2.17",
"-RRB-",
"550.82",
"-LRB-",
"0.56",
"--",
"1.21",
"-RRB-",
"240.57",
"-LRB-",
"0.33",
"--",
"0.96",
"-RRB-",
"Q4108",
".885.33,5881100.96",
"-LRB-",
"0.72",
"--",
"1.28",
"-RRB-",
"151.30",
"-LRB-",
"0.59",
"--",
"2.86",
"-RRB-",
"711.11",
"-LRB-",
"0.77",
"--",
"1.59",
"-RRB-",
"310.74",
"-LRB-",
"0.46",
"--",
"1.20",
"-RRB-",
"p-valued0.290",
".820.710.13",
"1SD",
"incremente1",
".00",
"-LRB-",
"0.88",
"--",
"1.13",
"-RRB-",
"1.21",
"-LRB-",
"0.82",
"--",
"1.77",
"-RRB-",
"1.04",
"-LRB-",
"0.89",
"--",
"1.22",
"-RRB-",
"0.93",
"-LRB-",
"0.76",
"--",
"1.14",
"-RRB-",
"Saturated",
"fat",
"Q128",
".923.93,567991.00",
"-LRB-",
"reference",
"-RRB-",
"91.00",
"-LRB-",
"reference",
"-RRB-",
"591.00",
"-LRB-",
"reference",
"-RRB-",
"331.00",
"-LRB-",
"reference",
"-RRB-",
"Q233",
".727.83,5501201.20",
"-LRB-",
"0.89",
"--",
"1.61",
"-RRB-",
"141.48",
"-LRB-",
"0.63",
"--",
"3.49",
"-RRB-",
"841.38",
"-LRB-",
"0.97",
"--",
"1.97",
"-RRB-",
"300.94",
"-LRB-",
"0.55",
"--",
"1.61",
"-RRB-",
"Q338",
".330.93,5831151.11",
"-LRB-",
"0.82",
"--",
"1.49",
"-RRB-",
"191.93",
"-LRB-",
"0.86",
"--",
"4.32",
"-RRB-",
"731.15",
"-LRB-",
"0.79",
"--",
"1.66",
"-RRB-",
"331.01",
"-LRB-",
"0.60",
"--",
"1.68",
"-RRB-",
"Q445",
".836.63,5711000.94",
"-LRB-",
"0.69",
"--",
"1.27",
"-RRB-",
"121.25",
"-LRB-",
"0.52",
"--",
"3.00",
"-RRB-",
"580.90",
"-LRB-",
"0.62",
"--",
"1.32",
"-RRB-",
"310.89",
"-LRB-",
"0.53",
"--",
"1.48",
"-RRB-",
"p-valued0.540",
".480.350.72",
"1SD",
"incremente0",
".97",
"-LRB-",
"0.87",
"--",
"1.08",
"-RRB-",
"1.12",
"-LRB-",
"0.82",
"--",
"1.51",
"-RRB-",
"0.95",
"-LRB-",
"0.83",
"--",
"1.09",
"-RRB-",
"0.95",
"-LRB-",
"0.79",
"--",
"1.14",
"-RRB-",
"MUFAf",
"Q128",
".222.43,546981.00",
"-LRB-",
"reference",
"-RRB-",
"111.00",
"-LRB-",
"reference",
"-RRB-",
"561.00",
"-LRB-",
"reference",
"-RRB-",
"311.00",
"-LRB-",
"reference",
"-RRB-",
"Q233",
".226.03,5461221.20",
"-LRB-",
"0.89",
"--",
"1.61",
"-RRB-",
"141.15",
"-LRB-",
"0.52",
"--",
"2.53",
"-RRB-",
"791.33",
"-LRB-",
"0.92",
"--",
"1.91",
"-RRB-",
"361.18",
"-LRB-",
"0.72",
"--",
"1.95",
"-RRB-",
"Q336",
".928.93,5801131.12",
"-LRB-",
"0.83",
"--",
"1.52",
"-RRB-",
"141.15",
"-LRB-",
"0.52",
"--",
"2.54",
"-RRB-",
"761.30",
"-LRB-",
"0.89",
"--",
"1.89",
"-RRB-",
"311.03",
"-LRB-",
"0.60",
"--",
"1.77",
"-RRB-",
"Q442",
".533.13,6001010.99",
"-LRB-",
"0.73",
"--",
"1.34",
"-RRB-",
"151.25",
"-LRB-",
"0.58",
"--",
"2.71",
"-RRB-",
"631.08",
"-LRB-",
"0.74",
"--",
"1.57",
"-RRB-",
"290.90",
"-LRB-",
"0.54",
"--",
"1.52",
"-RRB-",
"p-valued0.790",
".590.800.57",
"1SD",
"incremente0",
".99",
"-LRB-",
"0.88",
"--",
"1.12",
"-RRB-",
"1.04",
"-LRB-",
"0.73",
"--",
"1.46",
"-RRB-",
"1.01",
"-LRB-",
"0.87",
"--",
"1.17",
"-RRB-",
"0.98",
"-LRB-",
"0.81",
"--",
"1.18",
"-RRB-",
"PUFAg",
"Q111",
".68.83,507911.00",
"-LRB-",
"reference",
"-RRB-",
"81.00",
"-LRB-",
"reference",
"-RRB-",
"491.00",
"-LRB-",
"reference",
"-RRB-",
"321.00",
"-LRB-",
"reference",
"-RRB-",
"Q216",
".012.43,5621181.37",
"-LRB-",
"1.02",
"--",
"1.86",
"-RRB-",
"162.03",
"-LRB-",
"0.86",
"--",
"4.81",
"-RRB-",
"731.55",
"-LRB-",
"1.06",
"--",
"2.28",
"-RRB-",
"331.13",
"-LRB-",
"0.68",
"--",
"1.89",
"-RRB-",
"Q320",
".916.23,6181131.24",
"-LRB-",
"0.91",
"--",
"1.68",
"-RRB-",
"162.00",
"-LRB-",
"0.84",
"--",
"4.76",
"-RRB-",
"781.57",
"-LRB-",
"1.07",
"--",
"2.31",
"-RRB-",
"300.96",
"-LRB-",
"0.57",
"--",
"1.62",
"-RRB-",
"Q429",
".322.53,5801121.21",
"-LRB-",
"0.89",
"--",
"1.63",
"-RRB-",
"141.75",
"-LRB-",
"0.72",
"--",
"4.24",
"-RRB-",
"741.47",
"-LRB-",
"1.01",
"--",
"2.16",
"-RRB-",
"320.98",
"-LRB-",
"0.59",
"--",
"1.63",
"-RRB-",
"p-valued0.380",
".260.060.79",
"1SD",
"incremente1",
".03",
"-LRB-",
"0.94",
"--",
"1.14",
"-RRB-",
"1.07",
"-LRB-",
"0.82",
"--",
"1.38",
"-RRB-",
"1.09",
"-LRB-",
"0.97",
"--",
"1.23",
"-RRB-",
"1.00",
"-LRB-",
"0.84",
"--",
"1.19",
"-RRB-",
"Linoleic",
"acid",
"Q110",
".07.53,509861.00",
"-LRB-",
"reference",
"-RRB-",
"81.00",
"-LRB-",
"reference",
"-RRB-",
"491.00",
"-LRB-",
"reference",
"-RRB-",
"261.00",
"-LRB-",
"reference",
"-RRB-",
"Q214",
".811.23,5861221.49",
"-LRB-",
"1.10",
"--",
"2.02",
"-RRB-",
"131.66",
"-LRB-",
"0.69",
"--",
"3.98",
"-RRB-",
"711.50",
"-LRB-",
"1.02",
"--",
"2.21",
"-RRB-",
"401.65",
"-LRB-",
"0.99",
"--",
"2.76",
"-RRB-",
"Q319",
".514.93,5991121.32",
"-LRB-",
"0.97",
"--",
"1.79",
"-RRB-",
"172.14",
"-LRB-",
"0.91",
"--",
"5.00",
"-RRB-",
"821.68",
"-LRB-",
"1.15",
"--",
"2.45",
"-RRB-",
"251.00",
"-LRB-",
"0.57",
"--",
"1.76",
"-RRB-",
"Q428",
".021.23,5741141.30",
"-LRB-",
"0.96",
"--",
"1.77",
"-RRB-",
"162.02",
"-LRB-",
"0.86",
"--",
"4.76",
"-RRB-",
"721.44",
"-LRB-",
"0.99",
"--",
"2.11",
"-RRB-",
"361.35",
"-LRB-",
"0.80",
"--",
"2.28",
"-RRB-",
"p-valued0.200",
".080.050.65",
"1SD",
"incremente1",
".06",
"-LRB-",
"0.96",
"--",
"1.17",
"-RRB-",
"1.15",
"-LRB-",
"0.90",
"--",
"1.48",
"-RRB-",
"1.12",
"-LRB-",
"0.99",
"--",
"1.26",
"-RRB-",
"1.02",
"-LRB-",
"0.86",
"--",
"1.21",
"-RRB-",
"Linolenic",
"acid",
"Q10",
".80.63,5181071.00",
"-LRB-",
"reference",
"-RRB-",
"111.00",
"-LRB-",
"reference",
"-RRB-",
"681.00",
"-LRB-",
"reference",
"-RRB-",
"311.00",
"-LRB-",
"reference",
"-RRB-",
"Q21",
".20.93,5741040.95",
"-LRB-",
"0.70",
"--",
"1.30",
"-RRB-",
"171.32",
"-LRB-",
"0.60",
"--",
"2.89",
"-RRB-",
"720.99",
"-LRB-",
"0.68",
"--",
"1.43",
"-RRB-",
"240.84",
"-LRB-",
"0.47",
"--",
"1.49",
"-RRB-",
"Q31",
".51.23,5711171.10",
"-LRB-",
"0.82",
"--",
"1.48",
"-RRB-",
"110.91",
"-LRB-",
"0.40",
"--",
"2.10",
"-RRB-",
"620.89",
"-LRB-",
"0.62",
"--",
"1.29",
"-RRB-",
"431.48",
"-LRB-",
"0.91",
"--",
"2.40",
"-RRB-",
"Q42",
".01.63,6041061.01",
"-LRB-",
"0.76",
"--",
"1.36",
"-RRB-",
"151.32",
"-LRB-",
"0.61",
"--",
"2.84",
"-RRB-",
"721.08",
"-LRB-",
"0.76",
"--",
"1.53",
"-RRB-",
"290.97",
"-LRB-",
"0.57",
"--",
"1.65",
"-RRB-",
"p-valued0.680",
".730.820.52",
"1SD",
"incremente0",
".98",
"-LRB-",
"0.89",
"--",
"1.09",
"-RRB-",
"1.07",
"-LRB-",
"0.79",
"--",
"1.44",
"-RRB-",
"0.97",
"-LRB-",
"0.85",
"--",
"1.10",
"-RRB-",
"1.01",
"-LRB-",
"0.86",
"--",
"1.19",
"-RRB-",
"aAPC",
"−",
":",
"cancer",
"patients",
"without",
"a",
"mutation",
"in",
"the",
"MCR",
"of",
"the",
"APC",
"gene",
"leading",
"to",
"a",
"stop",
"codon",
";",
"APC",
"+",
":",
"cancer",
"patients",
"with",
"a",
"mutation",
"in",
"the",
"MCR",
"of",
"the",
"APC",
"gene",
"leading",
"to",
"a",
"stop",
"codonbPerson",
"years",
"at",
"risk",
"are",
"estimated",
"from",
"the",
"subcohortcIncidence",
"rate",
"ratios",
"-LRB-",
"RR",
"-RRB-",
"and",
"95",
"%",
"confidence",
"intervals",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"are",
"adjusted",
"for",
"age",
",",
"sex",
",",
"body",
"mass",
"index",
",",
"smoking",
",",
"energy",
"intake",
"and",
"family",
"history",
"of",
"colorectal",
"cancerdp-value",
"for",
"trend",
"over",
"the",
"quartiles",
"of",
"intake",
"of",
"fat",
"variableseFor",
"1",
"standard",
"deviation",
"of",
"intake",
"of",
"fat",
"in",
"the",
"subcohort",
"-LRB-",
"see",
"Table",
"1",
"-RRB-",
";",
"i.e.",
",",
"15.8",
"g/day",
"for",
"total",
"fat",
",",
"7.5",
"g/day",
"for",
"saturated",
"fat",
",",
"7.0",
"g/day",
"for",
"monounsaturated",
"fat",
",",
"7.5",
"g/day",
"for",
"polyunsaturated",
"fat",
",",
"7.5",
"g/day",
"for",
"linoleic",
"acid",
"and",
"0.6",
"g/day",
"for",
"linolenic",
"acidfMonounsaturated",
"fatgPolyunsaturated",
"fat",
"For",
"overall",
"rectal",
"cancer",
",",
"associations",
"with",
"the",
"intake",
"of",
"total",
"fat",
"or",
"different",
"types",
"of",
"fat",
"were",
"not",
"observed",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"Also",
"after",
"taking",
"account",
"of",
"truncating",
"APC",
"mutations",
"in",
"rectal",
"tumors",
",",
"none",
"of",
"the",
"fat",
"intake",
"variables",
"were",
"significantly",
"associated",
"with",
"risk",
"of",
"rectal",
"cancer",
".",
"Only",
"the",
"intake",
"of",
"saturated",
"fat",
"appeared",
"to",
"be",
"inversely",
"associated",
"with",
"rectal",
"tumors",
"without",
"APC",
"truncating",
"mutations",
"-LRB-",
"RR",
"for",
"the",
"highest",
"versus",
"the",
"lowest",
"quartile",
"of",
"intake",
":",
"0.46",
"-LRB-",
"95",
"%",
"CI",
"0.22",
"--",
"0.97",
"-RRB-",
",",
"p-trend",
"=",
"0.07",
"-RRB-",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"For",
"rectal",
"tumors",
"with",
"specific",
"types",
"of",
"APC",
"truncating",
"mutations",
"no",
"associations",
"were",
"observed",
"with",
"any",
"of",
"the",
"fat",
"intake",
"variables",
"-LRB-",
"results",
"not",
"shown",
"-RRB-",
".",
"Table",
"3Adjusted",
"incidence",
"rate",
"ratios",
"and",
"95",
"%",
"confidence",
"intervals",
"for",
"rectal",
"cancer",
"patients",
"overall",
",",
"and",
"with",
"and",
"without",
"an",
"APC",
"mutation",
"leading",
"to",
"a",
"stop",
"codon",
",",
"according",
"to",
"the",
"intake",
"of",
"fat",
"variables",
".",
"-LRB-",
"The",
"Netherlands",
"Cohort",
"Study",
"-RRB-",
"Dietary",
"fat",
"intakeMedian",
"intake",
"-LRB-",
"g/day",
"-RRB-",
"Person",
"yearsbRectal",
"cancerOverallAPC",
"−",
"aAPC",
"+",
"aMenWomenNumber",
"of",
"patientsRRc",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cNumber",
"of",
"patientsRRc",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cNumber",
"of",
"patientsRRc",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cTotal",
"fat",
"Q178",
".063.03,549431.00",
"-LRB-",
"reference",
"-RRB-",
"241.00",
"-LRB-",
"reference",
"-RRB-",
"151.00",
"-LRB-",
"reference",
"-RRB-",
"Q290",
".271.43,556390.89",
"-LRB-",
"0.56",
"--",
"1.39",
"-RRB-",
"170.70",
"-LRB-",
"0.37",
"--",
"1.34",
"-RRB-",
"120.79",
"-LRB-",
"0.36",
"--",
"1.70",
"-RRB-",
"Q398",
".577.63,579330.74",
"-LRB-",
"0.46",
"--",
"1.19",
"-RRB-",
"160.65",
"-LRB-",
"0.33",
"--",
"1.26",
"-RRB-",
"140.91",
"-LRB-",
"0.43",
"--",
"1.90",
"-RRB-",
"Q4108",
".885.33,588380.87",
"-LRB-",
"0.55",
"--",
"1.36",
"-RRB-",
"150.60",
"-LRB-",
"0.31",
"--",
"1.16",
"-RRB-",
"161.06",
"-LRB-",
"0.51",
"--",
"2.19",
"-RRB-",
"p-valued0.420",
".130.80",
"1SD",
"incremente0",
".91",
"-LRB-",
"0.76",
"--",
"1.09",
"-RRB-",
"0.84",
"-LRB-",
"0.65",
"--",
"1.08",
"-RRB-",
"0.94",
"-LRB-",
"0.69",
"--",
"1.28",
"-RRB-",
"Saturated",
"fat",
"Q128",
".923.93,567431.00",
"-LRB-",
"reference",
"-RRB-",
"231.00",
"-LRB-",
"reference",
"-RRB-",
"141.00",
"-LRB-",
"reference",
"-RRB-",
"Q233",
".727.83,550340.80",
"-LRB-",
"0.49",
"--",
"1.29",
"-RRB-",
"180.81",
"-LRB-",
"0.42",
"--",
"1.56",
"-RRB-",
"120.87",
"-LRB-",
"0.39",
"--",
"1.91",
"-RRB-",
"Q338",
".330.93,583441.02",
"-LRB-",
"0.66",
"--",
"1.59",
"-RRB-",
"210.92",
"-LRB-",
"0.49",
"--",
"1.73",
"-RRB-",
"120.86",
"-LRB-",
"0.40",
"--",
"1.88",
"-RRB-",
"Q445",
".836.63,571330.74",
"-LRB-",
"0.46",
"--",
"1.18",
"-RRB-",
"110.46",
"-LRB-",
"0.22",
"--",
"0.97",
"-RRB-",
"191.30",
"-LRB-",
"0.65",
"--",
"2.63",
"-RRB-",
"p-valued0.380",
".070.47",
"1SD",
"incremente0",
".95",
"-LRB-",
"0.81",
"--",
"1.12",
"-RRB-",
"0.81",
"-LRB-",
"0.65",
"--",
"1.02",
"-RRB-",
"1.16",
"-LRB-",
"0.89",
"--",
"1.50",
"-RRB-",
"MUFAf",
"Q128",
".222.43,546441.00",
"-LRB-",
"reference",
"-RRB-",
"231.00",
"-LRB-",
"reference",
"-RRB-",
"151.00",
"-LRB-",
"reference",
"-RRB-",
"Q233",
".226.03,546310.70",
"-LRB-",
"0.44",
"--",
"1.13",
"-RRB-",
"180.79",
"-LRB-",
"0.41",
"--",
"1.49",
"-RRB-",
"90.62",
"-LRB-",
"0.27",
"--",
"1.43",
"-RRB-",
"Q336",
".928.93,580400.91",
"-LRB-",
"0.58",
"--",
"1.44",
"-RRB-",
"150.67",
"-LRB-",
"0.34",
"--",
"1.33",
"-RRB-",
"201.36",
"-LRB-",
"0.67",
"--",
"2.78",
"-RRB-",
"Q442",
".533.13,600390.88",
"-LRB-",
"0.56",
"--",
"1.37",
"-RRB-",
"170.72",
"-LRB-",
"0.38",
"--",
"1.36",
"-RRB-",
"130.88",
"-LRB-",
"0.40",
"--",
"1.90",
"-RRB-",
"p-valued0.820",
".280.76",
"1SD",
"incremente0",
".94",
"-LRB-",
"0.78",
"--",
"1.12",
"-RRB-",
"0.85",
"-LRB-",
"0.67",
"--",
"1.08",
"-RRB-",
"1.00",
"-LRB-",
"0.76",
"--",
"1.33",
"-RRB-",
"PUFAg",
"Q111",
".68.83,507451.00",
"-LRB-",
"reference",
"-RRB-",
"171.00",
"-LRB-",
"reference",
"-RRB-",
"211.00",
"-LRB-",
"reference",
"-RRB-",
"Q216",
".012.43,562320.74",
"-LRB-",
"0.46",
"--",
"1.18",
"-RRB-",
"191.17",
"-LRB-",
"0.60",
"--",
"2.28",
"-RRB-",
"100.49",
"-LRB-",
"0.23",
"--",
"1.07",
"-RRB-",
"Q320",
".916.23,618390.86",
"-LRB-",
"0.55",
"--",
"1.34",
"-RRB-",
"160.94",
"-LRB-",
"0.47",
"--",
"1.88",
"-RRB-",
"160.76",
"-LRB-",
"0.39",
"--",
"1.48",
"-RRB-",
"Q429",
".322.53,580380.82",
"-LRB-",
"0.53",
"--",
"1.29",
"-RRB-",
"211.20",
"-LRB-",
"0.63",
"--",
"2.29",
"-RRB-",
"100.47",
"-LRB-",
"0.22",
"--",
"1.00",
"-RRB-",
"p-valued0.530",
".730.11",
"1SD",
"incremente0",
".98",
"-LRB-",
"0.83",
"--",
"1.16",
"-RRB-",
"1.06",
"-LRB-",
"0.84",
"--",
"1.34",
"-RRB-",
"0.78",
"-LRB-",
"0.60",
"--",
"1.03",
"-RRB-",
"Linoleic",
"acid",
"Q110",
".07.53,509391.00",
"-LRB-",
"reference",
"-RRB-",
"181.00",
"-LRB-",
"reference",
"-RRB-",
"181.00",
"-LRB-",
"reference",
"-RRB-",
"Q214",
".811.23,586391.03",
"-LRB-",
"0.65",
"--",
"1.64",
"-RRB-",
"170.98",
"-LRB-",
"0.50",
"--",
"1.92",
"-RRB-",
"140.80",
"-LRB-",
"0.40",
"--",
"1.63",
"-RRB-",
"Q319",
".514.93,599350.90",
"-LRB-",
"0.56",
"--",
"1.44",
"-RRB-",
"160.90",
"-LRB-",
"0.45",
"--",
"1.79",
"-RRB-",
"150.84",
"-LRB-",
"0.42",
"--",
"1.68",
"-RRB-",
"Q428",
".021.23,574411.03",
"-LRB-",
"0.65",
"--",
"1.62",
"-RRB-",
"221.19",
"-LRB-",
"0.63",
"--",
"2.24",
"-RRB-",
"100.54",
"-LRB-",
"0.25",
"--",
"1.18",
"-RRB-",
"p-valued0.950",
".650.15",
"1SD",
"incremente0",
".99",
"-LRB-",
"0.84",
"--",
"1.17",
"-RRB-",
"1.09",
"-LRB-",
"0.86",
"--",
"1.38",
"-RRB-",
"0.79",
"-LRB-",
"0.60",
"--",
"1.04",
"-RRB-",
"Linolenic",
"acid",
"Q10",
".80.63,518421.00",
"-LRB-",
"reference",
"-RRB-",
"181.00",
"-LRB-",
"reference",
"-RRB-",
"181.00",
"-LRB-",
"reference",
"-RRB-",
"Q21",
".20.93,574380.92",
"-LRB-",
"0.57",
"--",
"1.48",
"-RRB-",
"201.16",
"-LRB-",
"0.58",
"--",
"2.31",
"-RRB-",
"100.55",
"-LRB-",
"0.25",
"--",
"1.24",
"-RRB-",
"Q31",
".51.23,571360.87",
"-LRB-",
"0.55",
"--",
"1.38",
"-RRB-",
"150.87",
"-LRB-",
"0.43",
"--",
"1.75",
"-RRB-",
"130.72",
"-LRB-",
"0.35",
"--",
"1.48",
"-RRB-",
"Q42",
".01.63604380.92",
"-LRB-",
"0.58",
"--",
"1.44",
"-RRB-",
"201.13",
"-LRB-",
"0.60",
"--",
"2.14",
"-RRB-",
"160.90",
"-LRB-",
"0.45",
"--",
"1.80",
"-RRB-",
"p-valued0.680",
".930.91",
"1SD",
"incremente0",
".95",
"-LRB-",
"0.81",
"--",
"1.12",
"-RRB-",
"0.98",
"-LRB-",
"0.77",
"--",
"1.24",
"-RRB-",
"1.03",
"-LRB-",
"0.81",
"--",
"1.31",
"-RRB-",
"aAPC",
"−",
":",
"cancer",
"patients",
"without",
"a",
"mutation",
"in",
"the",
"MCR",
"of",
"the",
"APC",
"gene",
"leading",
"to",
"a",
"stop",
"codon",
";",
"APC",
"+",
":",
"cancer",
"patients",
"with",
"a",
"mutation",
"in",
"the",
"MCR",
"of",
"the",
"APC",
"gene",
"leading",
"to",
"a",
"stop",
"codonbPerson",
"years",
"at",
"risk",
"are",
"estimated",
"from",
"the",
"subcohortcIncidence",
"rate",
"ratios",
"-LRB-",
"RR",
"-RRB-",
"and",
"95",
"%",
"confidence",
"intervals",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"are",
"adjusted",
"for",
"age",
",",
"sex",
",",
"body",
"mass",
"index",
",",
"smoking",
",",
"energy",
"intake",
"and",
"family",
"history",
"of",
"colorectal",
"cancerdp-value",
"for",
"trend",
"over",
"the",
"quartiles",
"of",
"intake",
"of",
"fat",
"variableseFor",
"1",
"standard",
"deviation",
"of",
"intake",
"of",
"fat",
"in",
"the",
"subcohort",
"-LRB-",
"see",
"Table",
"1",
"-RRB-",
";",
"i.e.",
",",
"15.8",
"g/day",
"for",
"total",
"fat",
",",
"7.5",
"g/day",
"for",
"saturated",
"fat",
",",
"7.0",
"g/day",
"for",
"monounsaturated",
"fat",
",",
"7.5",
"g/day",
"for",
"polyunsaturated",
"fat",
",",
"7.5",
"g/day",
"for",
"linoleic",
"acid",
"and",
"0.6",
"g/day",
"for",
"linolenic",
"acidfMonounsaturated",
"fatgPolyunsaturated",
"fat",
"Additional",
"analyses",
"were",
"conducted",
"to",
"assess",
"whether",
"the",
"observed",
"associations",
"of",
"polyunsaturated",
"fat",
"intake",
",",
"and",
"especially",
"linoleic",
"acid",
"intake",
",",
"with",
"the",
"increased",
"risk",
"of",
"colon",
"tumors",
"lacking",
"MLH1",
"expression",
"and",
"with",
"the",
"increased",
"risk",
"of",
"colon",
"tumors",
"without",
"APC",
"truncating",
"mutations",
",",
"were",
"observed",
"because",
"of",
"an",
"underlying",
"association",
"with",
"colon",
"tumors",
"harboring",
"a",
"KRAS",
"mutation",
",",
"as",
"previously",
"observed",
"-LSB-",
"22",
"-RSB-",
".",
"Excluding",
"tumors",
"with",
"a",
"KRAS",
"mutation",
"resulted",
"in",
"the",
"absence",
"of",
"a",
"statistically",
"significant",
"association",
"of",
"polyunsaturated",
"fat",
"intake",
"and",
"linoleic",
"acid",
"intake",
"with",
"colon",
"tumors",
"lacking",
"MLH1",
"expression",
"-LRB-",
"p-trend",
"=",
"0.34",
"and",
"0.12",
",",
"respectively",
"-RRB-",
"and",
"those",
"lacking",
"APC",
"tuncating",
"mutations",
"-LRB-",
"p-trend",
"=",
"0.77",
"and",
"0.99",
",",
"respectively",
"-RRB-",
".",
"Intake",
"of",
"polyunsaturated",
"fat",
"or",
"linoleic",
"acid",
"was",
"neither",
"associated",
"with",
"the",
"risk",
"of",
"colon",
"cancer",
"without",
"any",
"of",
"the",
"three",
"gene",
"defects",
",",
"nor",
"with",
"the",
"risk",
"of",
"colon",
"cancer",
"only",
"lacking",
"MLH1",
"expression",
",",
"nor",
"with",
"the",
"risk",
"of",
"colon",
"cancer",
"with",
"only",
"truncating",
"APC",
"mutations",
"-LRB-",
"Table",
"4",
"-RRB-",
".",
"With",
"increasing",
"intake",
"of",
"polyunsaturated",
"fat",
"and",
"of",
"linoleic",
"acid",
",",
"a",
"strongly",
"increased",
"risk",
"of",
"colon",
"cancer",
"with",
"only",
"activating",
"KRAS",
"mutations",
"was",
"observed",
"-LRB-",
"Table",
"4",
"-RRB-",
"-LRB-",
"p-trend",
"≤",
"0.001",
"for",
"both",
"polyunsaturated",
"fat",
"and",
"linoleic",
"acid",
"intake",
"-RRB-",
".",
"The",
"RRs",
"for",
"one",
"standard",
"deviation",
"increase",
"in",
"intake",
"were",
"1.40",
"-LRB-",
"95",
"%",
"CI",
"1.17",
"--",
"1.68",
"-RRB-",
"and",
"1.41",
"-LRB-",
"95",
"%",
"CI",
"1.18",
"--",
"1.69",
"-RRB-",
",",
"respectively",
".",
"The",
"RRs",
"for",
"polyunsaturated",
"fat",
"-LRB-",
"not",
"shown",
"-RRB-",
"and",
"linoleic",
"acid",
"intake",
"were",
"of",
"similar",
"size",
"when",
"estimated",
"separately",
"for",
"men",
"-LRB-",
"1.41",
",",
"95",
"%",
"CI",
"1.15",
"--",
"1.72",
"for",
"1",
"standard",
"deviation",
"increase",
"in",
"linoleic",
"acid",
"intake",
"-RRB-",
"and",
"women",
"-LRB-",
"1.42",
",",
"95",
"%",
"CI",
"0.96",
"--",
"2.10",
"-RRB-",
",",
"and",
"were",
"elevated",
"for",
"proximal",
"-LRB-",
"1.23",
",",
"95",
"%",
"CI",
"0.99",
"--",
"1.53",
"-RRB-",
"and",
"distal",
"colon",
"cancer",
"-LRB-",
"1.53",
",",
"95",
"%",
"CI",
"1.21",
"--",
"1.95",
"-RRB-",
".",
"Likewise",
",",
"a",
"positive",
"association",
"was",
"observed",
"for",
"all",
"colorectal",
"cancers",
"-LRB-",
"1.24",
",",
"95",
"%",
"CI",
"1.06",
"--",
"1.47",
"and",
"p-trend",
"=",
"0.01",
"-RRB-",
",",
"based",
"on",
"a",
"total",
"of",
"87",
"cases",
"-LRB-",
"i.e.",
",",
"including",
"the",
"rectosigmoid",
"-RRB-",
".",
"Table",
"4Adjusted",
"incidence",
"rate",
"ratios",
"and",
"95",
"%",
"confidence",
"intervals",
"for",
"colon",
"cancer",
"patients",
"without",
"any",
"of",
"the",
"gene",
"defects",
"or",
"with",
"only",
"a",
"single",
"gene",
"defect",
",",
"i.e.",
",",
"either",
"lack",
"of",
"MLH1",
"expression",
",",
"a",
"truncating",
"APC",
"gene",
"mutation",
"or",
"an",
"activating",
"KRAS",
"gene",
"mutation",
",",
"according",
"to",
"the",
"intake",
"of",
"polyunsaturated",
"fat",
"and",
"linoleic",
"acid",
"intake",
"-LRB-",
"The",
"Netherlands",
"Cohort",
"Study",
"-RRB-",
"Dietary",
"fat",
"intakePerson",
"yearseColon",
"cancerNo",
"gene",
"defectsaOnly",
"lack",
"of",
"MLH1",
"expressionbOnly",
"truncating",
"APC",
"mutationscOnly",
"activating",
"KRAS",
"mutationsdNumber",
"of",
"patientsRRf",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"fNumber",
"of",
"patientsRRf",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"fNumber",
"of",
"patientsRRf",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"fNumber",
"of",
"patientsRRf",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"fPUFAgQ13",
",507391.00",
"-LRB-",
"reference",
"-RRB-",
"61.00",
"-LRB-",
"reference",
"-RRB-",
"181.00",
"-LRB-",
"reference",
"-RRB-",
"41.00",
"-LRB-",
"reference",
"-RRB-",
"Q23",
",562441.15",
"-LRB-",
"0.73",
"--",
"1.81",
"-RRB-",
"142.48",
"-LRB-",
"0.94",
"--",
"6.54",
"-RRB-",
"211.31",
"-LRB-",
"0.68",
"--",
"2.53",
"-RRB-",
"143.76",
"-LRB-",
"1.21",
"--",
"11.69",
"-RRB-",
"Q33",
",618451.10",
"-LRB-",
"0.70",
"--",
"1.73",
"-RRB-",
"111.89",
"-LRB-",
"0.69",
"--",
"5.16",
"-RRB-",
"150.86",
"-LRB-",
"0.43",
"--",
"1.74",
"-RRB-",
"195.00",
"-LRB-",
"1.67",
"--",
"14.99",
"-RRB-",
"Q43",
",580350.86",
"-LRB-",
"0.54",
"--",
"1.38",
"-RRB-",
"101.72",
"-LRB-",
"0.61",
"--",
"4.81",
"-RRB-",
"130.70",
"-LRB-",
"0.34",
"--",
"1.45",
"-RRB-",
"286.74",
"-LRB-",
"2.36",
"--",
"19.51",
"-RRB-",
"p-valueh0.510",
".480.19",
"≤",
"0.0011",
"SD",
"incrementi0",
".96",
"-LRB-",
"0.82",
"--",
"1.13",
"-RRB-",
"1.01",
"-LRB-",
"0.72",
"--",
"1.40",
"-RRB-",
"0.90",
"-LRB-",
"0.71",
"--",
"1.14",
"-RRB-",
"1.40",
"-LRB-",
"1.17",
"--",
"1.68",
"-RRB-",
"Linoleic",
"acidQ13",
",509381.00",
"-LRB-",
"reference",
"-RRB-",
"71.00",
"-LRB-",
"reference",
"-RRB-",
"141.00",
"-LRB-",
"reference",
"-RRB-",
"41.00",
"-LRB-",
"reference",
"-RRB-",
"Q23",
",586451.20",
"-LRB-",
"0.77",
"--",
"1.90",
"-RRB-",
"101.51",
"-LRB-",
"0.58",
"--",
"0.93",
"-RRB-",
"262.03",
"-LRB-",
"1.03",
"--",
"3.99",
"-RRB-",
"154.06",
"-LRB-",
"1.32",
"--",
"12.46",
"-RRB-",
"Q33",
",599451.15",
"-LRB-",
"0.73",
"--",
"1.81",
"-RRB-",
"142.08",
"-LRB-",
"0.84",
"--",
"5.19",
"-RRB-",
"130.99",
"-LRB-",
"0.46",
"--",
"2.13",
"-RRB-",
"215.61",
"-LRB-",
"1.88",
"--",
"16.68",
"-RRB-",
"Q43",
",574350.90",
"-LRB-",
"0.56",
"--",
"1.44",
"-RRB-",
"101.49",
"-LRB-",
"0.56",
"--",
"3.97",
"-RRB-",
"140.97",
"-LRB-",
"0.46",
"--",
"2.06",
"-RRB-",
"256.02",
"-LRB-",
"2.09",
"--",
"17.41",
"-RRB-",
"p-valueh0.620",
".300.38",
"≤",
"0.0011",
"SD",
"incrementi0",
".98",
"-LRB-",
"0.84",
"--",
"1.15",
"-RRB-",
"1.08",
"-LRB-",
"0.79",
"--",
"1.49",
"-RRB-",
"0.91",
"-LRB-",
"0.73",
"--",
"1.14",
"-RRB-",
"1.41",
"-LRB-",
"1.18",
"--",
"1.69",
"-RRB-",
"aColon",
"cancer",
"patients",
"with",
"MLH1",
"expression",
"and",
"without",
"truncating",
"APC",
"or",
"activating",
"KRAS",
"gene",
"mutationsbColon",
"cancer",
"patients",
"lacking",
"MLH1",
"expression",
"but",
"without",
"truncating",
"APC",
"or",
"activating",
"KRAS",
"gene",
"mutationscColon",
"cancer",
"patients",
"with",
"a",
"truncating",
"APC",
"gene",
"mutation",
"but",
"with",
"MLH1",
"expression",
"and",
"without",
"activating",
"KRAS",
"gene",
"mutationsdColon",
"cancer",
"patients",
"with",
"an",
"activating",
"KRAS",
"gene",
"mutations",
"but",
"with",
"MLH1",
"expression",
"and",
"without",
"truncating",
"APC",
"gene",
"mutationsePerson",
"years",
"at",
"risk",
"are",
"estimated",
"from",
"the",
"subcohort.fIncidence",
"rate",
"ratios",
"-LRB-",
"RR",
"-RRB-",
"and",
"95",
"%",
"confidence",
"intervals",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"are",
"adjusted",
"for",
"age",
",",
"sex",
",",
"body",
"mass",
"index",
",",
"smoking",
",",
"energy",
"intake",
"and",
"family",
"history",
"of",
"colorectal",
"cancer.gPolyunsaturated",
"fathp-value",
"for",
"trend",
"over",
"the",
"quartiles",
"of",
"intake",
"of",
"fat",
"variablesiFor",
"1standard",
"deviation",
"if",
"intake",
"of",
"fat",
"in",
"the",
"subcohort",
"-LRB-",
"see",
"Table",
"1",
"-RRB-",
";",
"i.e.",
",",
"7.5",
"g/day",
"for",
"polyunsaturated",
"fat",
"and",
"7.5",
"g/day",
"for",
"linoleic",
"acid",
"Likewise",
",",
"additional",
"analyses",
"were",
"conducted",
"for",
"saturated",
"fat",
"intake",
"in",
"relation",
"to",
"risk",
"of",
"rectal",
"cancer",
"without",
"APC",
"truncating",
"mutations",
",",
"also",
"excluding",
"individuals",
"with",
"a",
"KRAS",
"mutation",
"and",
"lack",
"of",
"MLH1",
"expression",
".",
"The",
"association",
"did",
"not",
"change",
"substantially",
".",
"Again",
",",
"only",
"the",
"highest",
"level",
"of",
"intake",
"showed",
"a",
"significant",
"reduced",
"risk",
"of",
"cancer",
"compared",
"to",
"the",
"reference",
"category",
"-LRB-",
"RR",
"0.40",
"95",
"%",
"CI",
"0.14",
"--",
"1.15",
",",
"p-trend",
"=",
"0.09",
"-RRB-",
".",
"Discussion",
"In",
"this",
"prospective",
"study",
",",
"we",
"observed",
"that",
"the",
"intake",
"of",
"total",
",",
"saturated",
"and",
"monounsaturated",
"fat",
"was",
"not",
"associated",
"with",
"the",
"risk",
"of",
"colon",
"cancer",
",",
"rectal",
"cancer",
",",
"or",
"the",
"different",
"molecular",
"subgroups",
"of",
"cancer",
"based",
"on",
"lack",
"of",
"MLH1",
"expression",
"or",
"truncating",
"mutations",
"in",
"the",
"APC",
"gene",
".",
"This",
"was",
"also",
"found",
"for",
"polyunsaturated",
"fat",
"intake",
"and",
"rectal",
"cancer",
".",
"However",
",",
"linoleic",
"acid",
"showed",
"an",
"association",
"with",
"increased",
"risk",
"of",
"colon",
"tumors",
"with",
"only",
"an",
"activated",
"KRAS",
"mutation",
"and",
"no",
"additional",
"truncating",
"APC",
"mutation",
"or",
"lack",
"of",
"MLH1",
"expression",
".",
"None",
"of",
"the",
"other",
"epidemiological",
"studies",
"report",
"on",
"specific",
"fatty",
"acids",
"and",
"the",
"risk",
"of",
"molecular",
"surrogate",
"end-points",
"for",
"colon",
"or",
"rectal",
"cancer",
"or",
"adenomas",
"-LSB-",
"35",
"--",
"43",
"-RSB-",
".",
"Some",
"of",
"these",
"studies",
"report",
"on",
"various",
"types",
"of",
"fat",
"depending",
"on",
"saturation",
"level",
",",
"but",
"the",
"results",
"are",
"inconsistent",
"across",
"the",
"studies",
"-LSB-",
"35",
",",
"38",
",",
"41",
",",
"42",
"-RSB-",
"including",
"the",
"current",
"study",
".",
"Diergaarde",
"et",
"al.",
"observed",
"unsaturated",
"fat",
"intake",
"to",
"be",
"associated",
"with",
"increased",
"colon",
"carcinomas",
"with",
"a",
"truncating",
"APC",
"mutation",
"-LSB-",
"38",
"-RSB-",
".",
"No",
"distinction",
"was",
"made",
"between",
"mono",
"-",
"and",
"polyunsaturated",
"fats",
".",
"In",
"our",
"study",
",",
"we",
"did",
"not",
"observe",
"any",
"association",
"between",
"various",
"types",
"of",
"fat",
"intake",
"and",
"risk",
"of",
"colon",
"or",
"rectal",
"cancer",
"with",
"or",
"without",
"truncating",
"APC",
"mutations",
"after",
"patients",
"also",
"harboring",
"a",
"KRAS",
"mutation",
"in",
"their",
"tumor",
"were",
"excluded",
"from",
"the",
"analyses",
".",
"We",
"observed",
"a",
"possible",
"inverse",
"association",
"between",
"saturated",
"fat",
"intake",
"and",
"risk",
"of",
"rectal",
"tumors",
"without",
"a",
"truncating",
"APC",
"mutation",
".",
"However",
",",
"the",
"association",
"was",
"weak",
",",
"did",
"not",
"increase",
"gradually",
"according",
"to",
"the",
"quartiles",
"of",
"intake",
"and",
"was",
"only",
"a",
"result",
"of",
"the",
"reduced",
"risk",
"in",
"the",
"highest",
"category",
"of",
"intake",
".",
"Furthermore",
",",
"in",
"absence",
"of",
"a",
"biological",
"explanation",
"for",
"this",
"finding",
"and",
"considering",
"the",
"large",
"number",
"of",
"associations",
"investigated",
",",
"the",
"observation",
"may",
"best",
"be",
"attributed",
"to",
"chance",
".",
"Slattery",
"et",
"al.",
"observed",
"saturated",
"and",
"monounsaturated",
"fats",
",",
"but",
"not",
"polyunsaturated",
"fat",
",",
"to",
"be",
"associated",
"with",
"increased",
"risk",
"of",
"colon",
"tumors",
"with",
"specific",
"KRAS",
"mutations",
",",
"i.e.",
",",
"a",
"G",
"→",
"T",
"transversion",
"at",
"codon",
"12",
"-LSB-",
"41",
"-RSB-",
".",
"No",
"distinction",
"was",
"made",
"between",
"ω-6",
"and",
"ω-3",
"fatty",
"acids",
".",
"We",
"observed",
"an",
"association",
"between",
"polyunsaturated",
"fat",
"intake",
",",
"especially",
"linoleic",
"acid",
",",
"and",
"increased",
"risk",
"of",
"colon",
"tumors",
"with",
"a",
"KRAS",
"mutation",
",",
"regardless",
"of",
"the",
"type",
"of",
"mutations",
"-LSB-",
"22",
"-RSB-",
".",
"Finally",
",",
"Bautista",
"et",
"al.",
"observed",
"an",
"inverse",
"association",
"between",
"monounsaturated",
"fats",
",",
"mostly",
"derived",
"from",
"olive",
"oil",
"in",
"the",
"Spanish",
"diet",
",",
"and",
"risk",
"of",
"colon",
"cancer",
"without",
"KRAS",
"mutations",
"-LSB-",
"35",
"-RSB-",
".",
"Since",
"olive",
"oil",
"was",
"rarely",
"consumed",
"by",
"this",
"elderly",
"Dutch",
"population",
"in",
"the",
"years",
"preceding",
"1986",
"-LRB-",
"the",
"cohort",
"baseline",
"-RRB-",
",",
"this",
"could",
"explain",
"the",
"lack",
"of",
"association",
"for",
"this",
"type",
"of",
"fat",
"in",
"our",
"study",
".",
"However",
",",
"a",
"recent",
"Dutch",
"case",
"--",
"control",
"study",
"on",
"risk",
"factors",
"for",
"colorectal",
"adenomas",
"showed",
"a",
"significant",
"positive",
"association",
"between",
"monounsaturated",
"fats",
"and",
"adenoma",
"risk",
"-LSB-",
"42",
"-RSB-",
".",
"Several",
"factors",
"hamper",
"comparisons",
"between",
"our",
"findings",
"and",
"those",
"of",
"other",
"epidemiological",
"studies",
"and",
"may",
"in",
"part",
"explain",
"observed",
"inconsistencies",
".",
"First",
",",
"our",
"study",
"is",
"the",
"first",
"large",
"prospective",
"cohort",
"study",
"incorporating",
"molecular",
"end-points",
"for",
"colon",
"and",
"rectal",
"cancer",
".",
"One",
"of",
"the",
"other",
"studies",
"was",
"a",
"cross-sectional",
"case",
"--",
"case",
"comparison",
"study",
"-LSB-",
"40",
"-RSB-",
",",
"and",
"the",
"others",
"were",
"case",
"--",
"control",
"studies",
"of",
"varying",
"size",
"-LRB-",
"ranging",
"from",
"108",
"to",
"1,510",
"cases",
"-RRB-",
"-LSB-",
"35",
"--",
"39",
",",
"41",
"--",
"43",
"-RSB-",
".",
"Second",
",",
"varying",
"end-points",
"were",
"considered",
".",
"Three",
"of",
"the",
"other",
"studies",
"focused",
"on",
"adenomas",
"instead",
"of",
"carcinomas",
"-LSB-",
"37",
",",
"40",
",",
"42",
"-RSB-",
",",
"and",
"three",
"studies",
"also",
"incorporated",
"rectal",
"tumors",
"but",
"did",
"not",
"distinguish",
"between",
"colon",
"and",
"rectum",
"-LSB-",
"35",
",",
"37",
",",
"42",
"-RSB-",
".",
"Previously",
",",
"we",
"reported",
"the",
"association",
"between",
"linoleic",
"acid",
"intake",
"and",
"increased",
"risk",
"of",
"colon",
"tumors",
"with",
"KRAS",
"mutations",
"-LRB-",
"adjusted",
"RR",
"for",
"one",
"standard",
"deviation",
"of",
"increase",
"1.22",
"-LRB-",
"95",
"%",
"CI",
"1.05",
"--",
"1.42",
"-RRB-",
"-RRB-",
"-LSB-",
"22",
"-RSB-",
".",
"Now",
",",
"we",
"report",
"that",
"the",
"association",
"appears",
"to",
"be",
"confined",
"to",
"those",
"colon",
"tumors",
"with",
"activating",
"KRAS",
"mutations",
"and",
"an",
"otherwise",
"intact",
"APC",
"gene",
"and",
"with",
"MLH1",
"expression",
".",
"In",
"addition",
",",
"the",
"association",
"appears",
"to",
"be",
"robust",
"since",
"RRs",
"clearly",
"increase",
"over",
"the",
"quartiles",
"of",
"linoleic",
"acid",
"intake",
"and",
"the",
"RRs",
"for",
"one",
"standard",
"deviation",
"increase",
"in",
"linoleic",
"acid",
"intake",
"are",
"similar",
"for",
"men",
"and",
"women",
",",
"and",
"is",
"increased",
"for",
"proximal",
"and",
"distal",
"colon",
"cancer",
"as",
"well",
"as",
"for",
"overall",
"colorectal",
"cancer",
",",
"including",
"the",
"rectosigmoid",
".",
"The",
"activating",
"KRAS",
"mutations",
"at",
"codons",
"12",
"and",
"13",
"are",
"predominantly",
"G",
"→",
"T",
"and",
"G",
"→",
"A",
"mutations",
"-LSB-",
"27",
"-RSB-",
"which",
"could",
"be",
"a",
"result",
"of",
"MDA",
"DNA",
"adduct",
"formation",
"-LSB-",
"18",
",",
"19",
"-RSB-",
"associated",
"with",
"increased",
"ω-6",
"polyunsaturated",
"fat",
"intake",
"-LSB-",
"21",
"-RSB-",
".",
"Therefore",
",",
"even",
"though",
"chance",
"can",
"not",
"be",
"ruled",
"out",
"and",
"verification",
"by",
"others",
"is",
"warranted",
",",
"the",
"association",
"seems",
"quite",
"plausible",
".",
"Still",
"several",
"issues",
"remain",
"puzzling",
".",
"First",
",",
"why",
"is",
"the",
"observed",
"association",
"for",
"linoleic",
"acid",
"confined",
"to",
"colon",
"cancer",
"and",
"not",
"rectum",
"cancer",
"with",
"only",
"a",
"KRAS",
"mutation",
"?",
"The",
"multistep",
"model",
"for",
"molecular",
"aberrations",
"underlying",
"colorectal",
"carcinogenesis",
"is",
"likely",
"to",
"apply",
"equally",
"for",
"both",
"tumor",
"subsites",
"-LSB-",
"7",
",",
"8",
",",
"15",
"-RSB-",
".",
"However",
",",
"lack",
"of",
"MLH1",
"expression",
"in",
"our",
"study",
"is",
"rare",
"among",
"rectum",
"cancer",
"patients",
"and",
"there",
"is",
"growing",
"evidence",
"for",
"differences",
"in",
"the",
"etiology",
"of",
"colon",
"and",
"rectal",
"tumors",
"-LSB-",
"33",
"-RSB-",
".",
"Second",
",",
"why",
"is",
"the",
"association",
"with",
"linoleic",
"acid",
"observed",
"for",
"KRAS",
"and",
"not",
"for",
"truncating",
"APC",
"gene",
"mutations",
"?",
"It",
"is",
"unlikely",
"that",
"adduct",
"formation",
"selectively",
"occurs",
"in",
"one",
"gene",
"but",
"not",
"in",
"the",
"other",
".",
"However",
",",
"KRAS",
"is",
"an",
"oncogene",
"requiring",
"only",
"one",
"mutation",
"for",
"the",
"gene",
"to",
"be",
"activated",
",",
"whereas",
"APC",
"is",
"a",
"tumor",
"suppressor",
"gene",
"requiring",
"an",
"additional",
"aberration",
"in",
"the",
"other",
"allele",
"for",
"loss",
"of",
"function",
".",
"In",
"addition",
",",
"more",
"than",
"half",
"of",
"the",
"patients",
"with",
"an",
"APC",
"mutation",
"had",
"multiple",
"mutations",
"in",
"this",
"gene",
"-LSB-",
"25",
"-RSB-",
",",
"complicating",
"data",
"analyses",
"and",
"interpretation",
".",
"Additional",
"analyses",
"for",
"subgroups",
"of",
"colon",
"tumors",
"with",
"specific",
"truncating",
"point",
"mutations",
"in",
"APC",
"did",
"not",
"show",
"any",
"associations",
"with",
"the",
"intake",
"of",
"fat",
"or",
"different",
"types",
"of",
"fat",
".",
"This",
"still",
"does",
"not",
"satisfy",
"our",
"third",
"query",
",",
"i.e.",
",",
"why",
"are",
"the",
"associations",
"specifically",
"confined",
"to",
"this",
"subgroup",
"of",
"colon",
"cancer",
"patients",
"whose",
"tumors",
"are",
"characterized",
"by",
"activating",
"KRAS",
"mutations",
",",
"and",
"not",
"truncating",
"APC",
"mutations",
"or",
"lack",
"of",
"MLH1",
"expression",
"?",
"It",
"is",
"speculative",
",",
"but",
"plausible",
",",
"that",
"when",
"KRAS",
"is",
"the",
"only",
"one",
"of",
"the",
"three",
"genes",
"affected",
",",
"the",
"mutation",
"may",
"more",
"likely",
"be",
"the",
"result",
"of",
"exogenous",
"exposure",
",",
"for",
"example",
"a",
"relatively",
"high",
"linoleic",
"acid",
"intake",
".",
"In",
"contrast",
",",
"when",
"a",
"KRAS",
"mutation",
"co-occurs",
"with",
"a",
"mutation",
"in",
"APC",
"or",
",",
"although",
"more",
"rarely",
",",
"in",
"addition",
"to",
"a",
"defective",
"MLH1",
",",
"these",
"other",
"early",
"gene",
"defects",
"also",
"had",
"a",
"role",
"in",
"tumor",
"formation",
"and",
"may",
"have",
"resulted",
"in",
"a",
"mutator",
"phenotype",
"leading",
"to",
"mutations",
"in",
"other",
"genes",
"-LRB-",
"such",
"as",
"the",
"KRAS",
"gene",
"-RRB-",
"irrespective",
"of",
"exogenous",
"factors",
".",
"Since",
"there",
"is",
"no",
"information",
"on",
"the",
"timing",
"of",
"genetic",
"aberrations",
"in",
"this",
"type",
"of",
"human",
"studies",
",",
"we",
"can",
"not",
"verify",
"this",
"with",
"our",
"data",
".",
"Aberrations",
"in",
"other",
"genes",
",",
"not",
"available",
"for",
"this",
"study",
",",
"but",
"possibly",
"involved",
"in",
"early",
"tumorigenesis",
"of",
"colorectal",
"cancer",
",",
"could",
"not",
"be",
"accounted",
"for",
"in",
"analyses",
"and",
"may",
"have",
"influenced",
"results",
".",
"However",
",",
"a",
"recent",
"systematic",
"sequence",
"analysis",
"of",
"13,023",
"exons",
"in",
"individual",
"colorectal",
"cancers",
"showed",
"that",
"the",
"prevalence",
"of",
"mutations",
"other",
"than",
"in",
"APC",
",",
"KRAS",
"and",
"TP53",
"is",
"rather",
"low",
"-LSB-",
"44",
"-RSB-",
",",
"and",
"mutations",
"in",
"TP53",
"is",
"not",
"an",
"early",
"event",
"in",
"colorectal",
"carcinogenesis",
".",
"Finally",
",",
"results",
"are",
"based",
"on",
"relatively",
"small",
"numbers",
"of",
"patients",
",",
"especially",
"in",
"the",
"reference",
"group",
"of",
"polyunsaturated",
"fat",
"or",
"linoleic",
"acid",
"intake",
"-LRB-",
"four",
"patients",
",",
"see",
"Table",
"4",
"-RRB-",
",",
"and",
"point",
"estimates",
"of",
"RRs",
"for",
"quartiles",
"of",
"intake",
"of",
"polyunstaturated",
"fat",
"or",
"linoleic",
"acid",
"should",
"therefore",
",",
"be",
"interpreted",
"cautiously",
".",
"Nevertheless",
",",
"as",
"discussed",
"previously",
",",
"the",
"association",
"appears",
"to",
"be",
"robust",
"when",
"regarding",
"the",
"results",
"for",
"one",
"standard",
"deviation",
"increase",
"in",
"linoleic",
"acid",
"intake",
"-LRB-",
"based",
"on",
"a",
"total",
"of",
"65",
"patients",
"-RRB-",
".",
"Therefore",
",",
"Breivik",
"and",
"Glaudernack",
"'s",
"hypothesis",
"for",
"distinct",
"carcinogens",
"to",
"exert",
"their",
"effect",
"on",
"two",
"proposed",
"types",
"of",
"genetic",
"instability",
",",
"i.e.",
",",
"microsatellite",
"instability",
"and",
"chromosomal",
"instability",
"-LSB-",
"16",
"-RSB-",
",",
"may",
"be",
"extended",
"to",
"the",
"potential",
"effect",
"of",
"carcinogens",
"on",
"more",
"specific",
"genetic",
"pathways",
"to",
"colorectal",
"tumorigenesis",
",",
"as",
"for",
"example",
"the",
"KRAS",
"mutated",
"pathway",
".",
"The",
"data",
"from",
"this",
"large",
"prospective",
"cohort",
"study",
"suggest",
"that",
"linoleic",
"acid",
"intake",
"is",
"strongly",
"associated",
"with",
"colon",
"tumors",
"with",
"an",
"aberrant",
"KRAS",
"gene",
",",
"but",
"an",
"intact",
"APC",
"gene",
"and",
"MLH1",
"expression",
".",
"Verification",
"in",
"other",
"studies",
"is",
"warranted",
".",
"Possibly",
",",
"tumors",
"revealing",
"the",
"involvement",
"of",
"distinct",
"genetic",
"pathways",
"on",
"the",
"basis",
"of",
"specific",
"genetic",
"aberrations",
",",
"may",
"have",
"a",
"unique",
"etiology",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Brain_Struct_Funct-4-1-2226080 | [
"The",
"impact",
"of",
"maternal",
"separation",
"on",
"adult",
"mouse",
"behaviour",
"and",
"on",
"the",
"total",
"neuron",
"number",
"in",
"the",
"mouse",
"hippocampus",
"The",
"maternal",
"separation",
"paradigm",
"has",
"been",
"applied",
"to",
"C57BL/6J",
"mice",
"as",
"an",
"animal",
"developmental",
"model",
"for",
"understanding",
"structural",
"deficits",
"leading",
"to",
"abnormal",
"behaviour",
".",
"A",
"maternal",
"separation",
"-LRB-",
"MS",
"-RRB-",
"model",
"was",
"used",
"on",
"postnatal",
"day",
"-LRB-",
"PND",
"-RRB-",
"9",
",",
"where",
"the",
"pups",
"were",
"removed",
"from",
"their",
"mother",
"for",
"24",
"h",
"-LRB-",
"MS24",
"-RRB-",
".",
"When",
"the",
"pups",
"were",
"10",
"weeks",
"old",
",",
"the",
"level",
"of",
"anxiety",
"and",
"fear",
"was",
"measured",
"with",
"two",
"behavioural",
"tests",
";",
"an",
"open",
"field",
"test",
"and",
"an",
"elevated",
"plus",
"maze",
"test",
".",
"The",
"Barnes",
"platform",
"maze",
"was",
"used",
"to",
"test",
"spatial",
"learning",
",",
"and",
"memory",
"by",
"using",
"acquisition",
"trials",
"followed",
"by",
"reverse",
"trial",
"sessions",
".",
"The",
"MS24",
"mice",
"spent",
"more",
"time",
"in",
"the",
"open",
"arms",
"of",
"the",
"elevated",
"plus",
"maze",
"compared",
"to",
"controls",
",",
"but",
"no",
"other",
"treatment",
"differences",
"were",
"found",
"in",
"the",
"emotional",
"behavioural",
"tests",
".",
"However",
",",
"in",
"the",
"reverse",
"trial",
"for",
"the",
"Barnes",
"maze",
"test",
"there",
"was",
"a",
"significant",
"difference",
"in",
"the",
"frequency",
"of",
"visits",
"to",
"the",
"old",
"goal",
",",
"the",
"number",
"of",
"errors",
"made",
"by",
"the",
"MS24",
"mice",
"compared",
"to",
"controls",
"and",
"in",
"total",
"distance",
"moved",
".",
"The",
"mice",
"were",
"subsequently",
"sacrificed",
"and",
"the",
"total",
"number",
"of",
"neurons",
"estimated",
"in",
"the",
"hippocampus",
"using",
"the",
"optical",
"fractionator",
".",
"We",
"found",
"a",
"significant",
"loss",
"of",
"neurons",
"in",
"the",
"dentate",
"gyrus",
"in",
"MS",
"mice",
"compared",
"to",
"controls",
".",
"Apparently",
"a",
"single",
"maternal",
"separation",
"can",
"impact",
"the",
"number",
"of",
"neurons",
"in",
"mouse",
"hippocampus",
"either",
"by",
"a",
"decrease",
"of",
"neurogenesis",
"or",
"as",
"an",
"increase",
"in",
"neuron",
"apoptosis",
".",
"This",
"study",
"is",
"the",
"first",
"to",
"assess",
"the",
"result",
"of",
"maternal",
"separation",
"combining",
"behaviour",
"and",
"stereology",
".",
"Introduction",
"Developing",
"an",
"animal",
"model",
"of",
"mental",
"disorders",
"is",
"controversial",
"due",
"to",
"the",
"human",
"nature",
"of",
"the",
"symptoms",
"such",
"as",
"hallucinations",
",",
"delusions",
"and",
"poverty",
"of",
"speech",
".",
"These",
"symptoms",
"can",
"only",
"be",
"adequately",
"assessed",
"by",
"psychological",
"assessments",
"and",
"therefore",
"can",
"not",
"be",
"modulated",
"in",
"animals",
".",
"A",
"way",
"to",
"try",
"to",
"circumvent",
"these",
"problems",
"is",
"studying",
"certain",
"psychological",
"or",
"psychophysiological",
"aspects",
"of",
"mental",
"disorders",
"such",
"as",
"latent",
"inhibition",
",",
"prepulse",
"inhibition",
"or",
"P50",
"gating",
"-LRB-",
"Ellenbroek",
"and",
"Cools",
"1990",
",",
"1995",
";",
"Geyer",
"and",
"Markou",
"1995",
";",
"Ellenbroek",
"et",
"al.",
"2004",
"-RRB-",
".",
"However",
",",
"it",
"is",
"still",
"unclear",
"how",
"-LRB-",
"and",
"if",
"-RRB-",
"these",
"abnormalities",
"are",
"linked",
"to",
"the",
"symptoms",
"of",
"mental",
"illness",
".",
"In",
"rodent",
"models",
"prepulse",
"inhibition",
"-LRB-",
"PPI",
"-RRB-",
"of",
"the",
"acoustic",
"startle",
"response",
"is",
"a",
"model",
"of",
"sensorimotor",
"gating",
"mechanisms",
"in",
"the",
"brain",
",",
"while",
"an",
"equivalent",
"reaction",
"in",
"humans",
"is",
"eye",
"blinking",
"-LRB-",
"Braff",
"et",
"al.",
"1978",
";",
"Ellenbroek",
"et",
"al.",
"1998",
"-RRB-",
".",
"It",
"has",
"been",
"shown",
"that",
"rat",
"pups",
"that",
"underwent",
"24",
"h",
"maternal",
"separation",
"on",
"postnatal",
"day",
"-LRB-",
"PND",
"-RRB-",
"6",
"or",
"9",
"expressed",
"reduced",
"prepulse",
"inhibition",
"-LRB-",
"PPI",
"-RRB-",
"on",
"postnatal",
"day",
"69",
"and",
"had",
"hyperactivity",
"of",
"the",
"dopamineric",
"system",
"involving",
"the",
"dopamine",
"neurotransmitter",
"system",
"via",
"the",
"hypothalamic",
"--",
"pituitary",
"--",
"adrenal",
"-LRB-",
"HPA",
"-RRB-",
"axis",
"-LRB-",
"Ellenbroek",
"and",
"Cools",
"1995",
"-RRB-",
".",
"Further",
",",
"the",
"PPI",
"deficits",
"could",
"be",
"reversed",
"with",
"typical",
"antipsychotic",
"drugs",
"like",
"haloperidol",
"and",
"were",
"not",
"detected",
"prior",
"to",
"puberty",
"-LRB-",
"Ellenbroek",
"et",
"al.",
"1998",
"-RRB-",
".",
"Due",
"to",
"the",
"changes",
"seen",
"in",
"the",
"HPA",
"axis",
",",
"the",
"dopamine",
"system",
",",
"hippocampus",
"and",
"long-term",
"behavioural",
"effects",
"modelling",
"deficits",
"seen",
"in",
"mental",
"patients",
"has",
"lead",
"Ellenbroek",
"and",
"co-workers",
"to",
"hypothesis",
"the",
"24-h",
"maternal",
"deprivation",
"model",
"to",
"be",
"a",
"``",
"schizophrenia-like",
"''",
"neurodevelopmental",
"animal",
"model",
"-LRB-",
"Ellenbroek",
"and",
"Cools",
"1998",
",",
"2002",
";",
"Ellenbroek",
"et",
"al.",
"1998",
",",
"2004",
",",
"2005",
"-RRB-",
".",
"One",
"of",
"the",
"striking",
"characteristics",
"of",
"the",
"developing",
"neuroendocrine",
"stress",
"system",
"in",
"the",
"mouse",
"and",
"rat",
"is",
"a",
"period",
"of",
"reduced",
"stress-responsiveness",
",",
"the",
"so-called",
"stress",
"hypo-responsive",
"period",
"-LRB-",
"SHRP",
"-RRB-",
"-LRB-",
"Schapiro",
"et",
"al.",
"1962",
";",
"Cirulli",
"et",
"al.",
"1994",
";",
"Schmidt",
"et",
"al.",
"2002",
"-RRB-",
".",
"From",
"about",
"postnatal",
"day",
"-LRB-",
"PND",
"-RRB-",
"4",
"--",
"14",
"in",
"the",
"rat",
",",
"and",
"PND",
"1",
"--",
"12",
"in",
"the",
"mouse",
",",
"the",
"animals",
"neuroendocrine",
"system",
"is",
"characterized",
"by",
"a",
"low",
"basal",
"corticosterone",
"level",
"and",
"by",
"the",
"inability",
"of",
"a",
"mild",
"stressor",
",",
"e.g.",
"exposure",
"to",
"novelty",
",",
"to",
"induce",
"a",
"corticosterone",
"response",
"-LRB-",
"Cirulli",
"et",
"al.",
"1994",
";",
"Schmidt",
"et",
"al.",
"2003",
"-RRB-",
".",
"In",
"this",
"study",
",",
"we",
"used",
"the",
"C57BL/6",
"inbred",
"mouse",
".",
"Due",
"to",
"a",
"similar",
"postnatal",
"neurodevelopmental",
"course",
"in",
"the",
"mouse",
"and",
"rat",
"-LRB-",
"Clancy",
"et",
"al.",
"2001",
"-RRB-",
",",
"we",
"used",
"PND",
"9",
"as",
"the",
"day",
"of",
"separation",
"equivalent",
"to",
"Ellenbroek",
"and",
"co-workers",
"day",
"of",
"choice",
"in",
"the",
"rat",
".",
"We",
"tested",
"if",
"a",
"24-h",
"maternal",
"separation",
"on",
"PND",
"9",
"can",
"cause",
"an",
"adult",
"phenotype",
"characterized",
"by",
"altered",
"levels",
"of",
"activity",
"and",
"anxiety",
",",
"learning",
"and",
"memory",
"dysfunction",
",",
"deficits",
"in",
"behavioural",
"flexibility",
"-LRB-",
"reversal",
"deficits",
"-RRB-",
"as",
"well",
"as",
"changes",
"in",
"number",
"of",
"neurons",
"in",
"the",
"hippocampus",
"and",
"its",
"subregions",
"in",
"the",
"mouse",
"brain",
".",
"Material",
"and",
"methods",
"Animals",
"The",
"offspring",
"of",
"4",
"male",
"and",
"8",
"female",
"C57BL/6J",
"mice",
"-LRB-",
"8",
"weeks",
"old",
"-RRB-",
"obtained",
"from",
"Taconic",
"Europe",
"-LRB-",
"Taconic",
"Farms",
"Inc.",
",",
"DK",
"-RRB-",
"were",
"used",
"in",
"this",
"study",
".",
"The",
"animals",
"were",
"acclimatized",
"to",
"the",
"animal",
"facility",
"for",
"1",
"week",
".",
"Multiparous",
"females",
"were",
"used",
",",
"since",
"there",
"is",
"a",
"higher",
"rate",
"of",
"offspring",
"survival",
".",
"The",
"animals",
"were",
"housed",
"under",
"a",
"12:12",
"h",
"light/dark",
"cycle",
"-LRB-",
"lights",
"on",
"at",
"6",
"a.m.",
"-RRB-",
"with",
"constant",
"temperature",
"-LRB-",
"21",
"±",
"2",
"°C",
"-RRB-",
"and",
"humidity",
"-LRB-",
"52",
"±",
"2",
"%",
"-RRB-",
"in",
"Macrolon",
"type",
"III",
"cages",
"with",
"environmental",
"enrichment",
"in",
"the",
"form",
"of",
"wood",
"splints",
"bedding",
"-LRB-",
"aspen",
"4HV",
"-RRB-",
",",
"wood",
"shavings",
",",
"1",
"piece",
"of",
"Aspen",
"Corner",
"15",
",",
"1",
"standard",
"mouse",
"house",
"made",
"of",
"recycled",
"cardboard",
",",
"1",
"aspen",
"chewing",
"stick",
"size",
"medium",
",",
"and",
"pads",
"of",
"nesting",
"material",
"-LRB-",
"all",
"obtained",
"from",
"Brogaarden",
",",
"DK",
"-RRB-",
".",
"Food",
"-LRB-",
"Altromin",
"pills",
"NR",
"1324",
"-RRB-",
"and",
"tap",
"water",
"were",
"available",
"ad",
"libitum",
".",
"Two",
"females",
"were",
"placed",
"in",
"a",
"male",
"'s",
"cage",
"for",
"a",
"period",
"of",
"1",
"week",
"to",
"ensure",
"conception",
",",
"followed",
"by",
"separation",
"of",
"the",
"two",
"females",
"to",
"their",
"own",
"cages",
".",
"Maternal",
"separation",
"Pregnant",
"females",
"were",
"checked",
"for",
"litters",
"daily",
"at",
"09:00",
"a.m.",
".",
"If",
"litters",
"were",
"found",
",",
"the",
"day",
"of",
"birth",
"was",
"defined",
"as",
"PND",
"0",
"for",
"that",
"litter",
".",
"On",
"PND",
"0",
",",
"litters",
"were",
"randomly",
"assigned",
"to",
"maternal",
"separation",
"-LRB-",
"MS",
"-RRB-",
"-LRB-",
"N",
"=",
"16",
",",
"9",
"males",
"and",
"7",
"females",
"-RRB-",
",",
"or",
"to",
"standard",
"facility",
"rearing",
"-LRB-",
"SFR",
"-RRB-",
".",
"For",
"the",
"behavioural",
"testing",
",",
"16",
"MS",
"animals",
"-LRB-",
"4",
"males",
"and",
"6",
"females",
"-RRB-",
"and",
"5",
"SFR",
"animals",
"-LRB-",
"2",
"males",
"and",
"3",
"females",
"-RRB-",
"were",
"included",
",",
"while",
"12",
"of",
"the",
"MS",
"animals",
"-LRB-",
"2",
"males",
"and",
"10",
"females",
"-RRB-",
"and",
"7",
"control",
"animals",
"-LRB-",
"2",
"males",
"and",
"5",
"females",
"-RRB-",
"were",
"used",
"for",
"cell",
"counting",
".",
"Litters",
"were",
"not",
"culled",
"or",
"sexed",
"at",
"birth",
"to",
"minimize",
"the",
"handling",
"of",
"the",
"pups",
",",
"but",
"male",
"and",
"female",
"pups",
"were",
"separated",
"at",
"weaning",
"-LRB-",
"PND",
"28",
"-RRB-",
"and",
"group",
"housed",
"with",
"their",
"siblings",
",",
"which",
"resulted",
"in",
"2",
"--",
"5",
"mice",
"per",
"cage",
".",
"The",
"environmental",
"enrichment",
"applied",
"to",
"the",
"mothers",
"was",
"also",
"applied",
"to",
"the",
"MS",
"and",
"control",
"animals",
".",
"The",
"24-h",
"deprivation",
"was",
"carried",
"out",
"on",
"PND",
"9",
"starting",
"at",
"8",
"a.m.",
".",
"The",
"pups",
"remained",
"in",
"the",
"home",
"cage",
"but",
"were",
"placed",
"in",
"a",
"separate",
"room",
"with",
"the",
"same",
"temperature",
",",
"humidity",
"and",
"lighting",
"conditions",
"as",
"the",
"home",
"stable",
".",
"The",
"cage",
"was",
"placed",
"on",
"a",
"heating",
"pad",
",",
"which",
"had",
"a",
"constant",
"temperature",
"of",
"31",
"°C",
".",
"No",
"food",
"or",
"water",
"was",
"available",
"during",
"the",
"separation",
".",
"The",
"dam",
"was",
"placed",
"in",
"a",
"cage",
"with",
"similar",
"facilities",
"as",
"the",
"home",
"cage",
"in",
"the",
"home",
"stable",
".",
"The",
"pups",
"were",
"checked",
"every",
"3",
"h",
",",
"using",
"a",
"red",
"light",
"during",
"the",
"night",
".",
"Body",
"weights",
"were",
"recorded",
"before",
"and",
"after",
"separation",
".",
"Immediately",
"after",
"24",
"h",
"the",
"dams",
"were",
"returned",
"to",
"the",
"home",
"cage",
"and",
"reunited",
"with",
"the",
"pups",
".",
"Test",
"for",
"anxiety",
"and",
"fear",
"related",
"behaviour",
"When",
"the",
"pups",
"reached",
"10",
"weeks",
"of",
"age",
"they",
"were",
"subjected",
"once",
"to",
"the",
"open",
"field",
"test",
"-LRB-",
"Hall",
"1934",
"-RRB-",
"and",
"the",
"elevated",
"plus",
"maze",
"test",
",",
"which",
"is",
"based",
"on",
"the",
"procedure",
"used",
"by",
"Montgomery",
"-LRB-",
"1955",
"-RRB-",
"and",
"later",
"validated",
"by",
"Pellow",
"et",
"al.",
"-LRB-",
"1985",
"-RRB-",
".",
"Behaviour",
"was",
"analysed",
"using",
"EthoVision",
"-LRB-",
"Noldus",
",",
"Groeningen",
",",
"The",
"Netherlands",
"-RRB-",
".",
"All",
"behavioural",
"testing",
"took",
"place",
"between",
"10",
"a.m.",
"and",
"3",
"p.m.",
"Open",
"field",
"test",
"-LRB-",
"OFT",
"-RRB-",
"The",
"open",
"field",
"consisted",
"of",
"a",
"circular",
"wooden",
"platform",
"-LRB-",
"diameter",
"90",
"cm",
"-RRB-",
"surrounded",
"by",
"a",
"43",
"cm",
"high",
"wall",
"with",
"a",
"camera",
"mounted",
"directly",
"above",
".",
"A",
"central",
"circle",
"of",
"31",
"cm",
"diameter",
"was",
"defined",
"in",
"the",
"behaviour",
"analysis",
"software",
".",
"Three",
"60-W",
"light",
"bulbs",
"illuminated",
"the",
"arena",
".",
"On",
"the",
"day",
"of",
"testing",
"each",
"animal",
"was",
"transported",
"in",
"a",
"cardboard",
"box",
"to",
"the",
"centre",
"of",
"the",
"open",
"field",
"and",
"behaviour",
"was",
"recorded",
"for",
"10",
"min",
".",
"After",
"the",
"trial",
"the",
"maze",
"was",
"cleaned",
"with",
"a",
"solution",
"of",
"acetic",
"acid",
"and",
"soap",
"water",
"and",
"faecal",
"boli",
"were",
"counted",
".",
"The",
"following",
"parameters",
"were",
"calculated",
";",
"total",
"distance",
"moved",
"-LRB-",
"cm",
"-RRB-",
",",
"time",
"spent",
"in",
"central",
"circle",
"and",
"time",
"spent",
"in",
"peripheral",
"zone",
"-LRB-",
"expressed",
"as",
"%",
"of",
"session",
"duration",
"-RRB-",
".",
"Elevated",
"plus",
"maze",
"The",
"plus",
"maze",
"was",
"elevated",
"50",
"cm",
"above",
"the",
"ground",
"and",
"consisted",
"of",
"two",
"opposing",
"open",
"arms",
"-LRB-",
"21",
"cm",
"×",
"8",
"cm",
"-RRB-",
"connected",
"by",
"a",
"central",
"square",
"-LRB-",
"8",
"cm",
"×",
"8",
"cm",
"-RRB-",
"to",
"two",
"opposing",
"enclosed",
"arms",
"of",
"the",
"same",
"size",
"with",
"32",
"cm",
"high",
"walls",
".",
"A",
"video",
"camera",
"placed",
"above",
"the",
"maze",
"recorded",
"the",
"animals",
"'",
"behaviour",
".",
"On",
"the",
"day",
"of",
"testing",
",",
"the",
"animal",
"was",
"placed",
"in",
"the",
"centre",
"of",
"the",
"maze",
"and",
"behaviour",
"was",
"recorded",
"for",
"10",
"min",
".",
"Between",
"trials",
"the",
"maze",
"was",
"cleaned",
"as",
"described",
"for",
"the",
"OFT",
".",
"The",
"following",
"parameters",
"were",
"calculated",
";",
"total",
"duration",
"-LRB-",
"s",
"-RRB-",
"in",
"open",
"and",
"closed",
"arms",
",",
"the",
"number",
"of",
"entries",
"into",
"the",
"open",
"and",
"closed",
"arms",
"and",
"the",
"total",
"distance",
"moved",
"-LRB-",
"cm",
"-RRB-",
".",
"From",
"these",
"parameters",
"the",
"ratio",
"of",
"entries",
"into",
"the",
"open",
"arms",
"to",
"the",
"total",
"number",
"of",
"arm",
"entries",
",",
"and",
"the",
"ratio",
"of",
"time",
"spent",
"in",
"the",
"open",
"arms",
"to",
"time",
"spent",
"in",
"both",
"open",
"and",
"closed",
"arms",
"was",
"calculated",
".",
"Test",
"for",
"spatial",
"memory",
";",
"Barnes",
"maze",
"The",
"Barnes",
"maze",
"-LRB-",
"Barnes",
"1975",
"-RRB-",
"consisted",
"of",
"a",
"circular",
",",
"white-coated",
"platform",
"90",
"cm",
"in",
"diameter",
"and",
"elevated",
"50",
"cm",
"over",
"the",
"ground",
".",
"Sixteen",
"5",
"cm",
"wide",
"holes",
"were",
"evenly",
"distributed",
"around",
"the",
"perimeter",
",",
"2.5",
"cm",
"from",
"the",
"edge",
".",
"A",
"pair",
"of",
"rails",
"was",
"placed",
"under",
"two",
"opposing",
"holes",
"to",
"hold",
"the",
"hidden",
"escape",
"box",
".",
"The",
"escape",
"box",
"was",
"a",
"dark",
"plastic",
"storage",
"box",
"with",
"a",
"5",
"cm",
"diameter",
"hole",
"in",
"the",
"lid",
".",
"A",
"dark",
"cylindrical",
"cardboard",
"tube",
"-LRB-",
"7.5",
"cm",
"×",
"7",
"cm",
"high",
"-RRB-",
"with",
"a",
"lid",
"was",
"used",
"as",
"the",
"transport",
"and",
"start",
"chamber",
".",
"Three",
"60-W",
"bulbs",
"illuminating",
"the",
"maze",
"and",
"high",
"irregular",
"rock",
"and",
"techno",
"music",
"played",
"from",
"a",
"computer",
"in",
"a",
"random",
"manner",
"provided",
"the",
"aversive",
"stimuli",
".",
"As",
"with",
"the",
"previous",
"test",
",",
"a",
"digital",
"video",
"camera",
"mounted",
"above",
"the",
"maze",
"recorded",
"animal",
"'s",
"behaviours",
".",
"Shaping",
"For",
"2",
"days",
"before",
"testing",
"commenced",
",",
"the",
"animals",
"were",
"trained",
"to",
"enter",
"the",
"hidden",
"escape",
"box",
".",
"Using",
"the",
"transport",
"cylinder",
",",
"the",
"mouse",
"was",
"placed",
"near",
"the",
"edge",
"of",
"the",
"target",
"hole",
"with",
"the",
"hidden",
"escape",
"box",
"underneath",
".",
"Two",
"cardboard",
"walls",
"blocked",
"entry",
"to",
"adjacent",
"holes",
".",
"Only",
"dim",
"lightning",
"and",
"no",
"noise",
"was",
"used",
"during",
"this",
"phase",
"of",
"the",
"experiment",
".",
"The",
"animal",
"was",
"allowed",
"5",
"min",
"to",
"enter",
"the",
"escape",
"box",
"and",
"if",
"this",
"failed",
",",
"it",
"was",
"placed",
"manually",
"inside",
".",
"When",
"the",
"animal",
"entered",
"the",
"box",
"it",
"was",
"quickly",
"carried",
"to",
"the",
"home",
"cage",
".",
"Acquisition",
"trials",
"Six",
"consecutive",
"trials",
"were",
"given",
",",
"one",
"per",
"day",
".",
"The",
"animal",
"was",
"placed",
"in",
"the",
"transport",
"cylinder",
",",
"oriented",
"in",
"a",
"random",
"direction",
",",
"in",
"the",
"centre",
"of",
"the",
"maze",
".",
"The",
"aversive",
"stimuli",
"were",
"turned",
"on",
"and",
"the",
"cylinder",
"removed",
".",
"Recording",
"in",
"the",
"behaviour-observation",
"software",
"began",
"immediately",
"after",
"the",
"experimenter",
"had",
"left",
"the",
"room",
".",
"The",
"trial",
"ended",
"after",
"5",
"min",
"or",
"when",
"the",
"animal",
"entered",
"the",
"hidden",
"escape",
"box",
".",
"If",
"the",
"animal",
"failed",
"to",
"enter",
"the",
"box",
"or",
"re-entered",
"the",
"maze",
"after",
"recording",
"was",
"stopped",
",",
"the",
"aversive",
"stimuli",
"were",
"turned",
"back",
"on",
"and",
"the",
"animal",
"was",
"allowed",
"5",
"min",
"more",
"to",
"enter",
"the",
"escape",
"box",
".",
"If",
"that",
"also",
"failed",
",",
"the",
"animal",
"was",
"manually",
"placed",
"in",
"the",
"box",
".",
"After",
"completion",
"of",
"each",
"trial",
",",
"the",
"box",
"was",
"placed",
"in",
"the",
"home",
"cage",
".",
"Reversal",
"trials",
"Three",
"days",
"after",
"acquisition",
"trials",
",",
"the",
"escape",
"box",
"was",
"placed",
"underneath",
"the",
"hole",
"opposite",
"to",
"the",
"hole",
"that",
"had",
"been",
"the",
"target",
"during",
"acquisition",
"training",
".",
"Reversal",
"training",
"was",
"conducted",
"for",
"seven",
"consecutive",
"days",
"as",
"described",
"above",
".",
"Parameters",
"Each",
"of",
"the",
"16",
"escape",
"holes",
"in",
"the",
"Barnes",
"maze",
"was",
"defined",
"as",
"a",
"separate",
"zone-of-interest",
"in",
"the",
"behaviour",
"analysis",
"software",
".",
"The",
"following",
"parameters",
"were",
"analysed",
":",
"latency",
"to",
"target",
"-LSB-",
"time",
"from",
"start",
"of",
"the",
"trial",
"to",
"first",
"entry",
"into",
"the",
"target",
"hole",
"zone",
"-LRB-",
"s",
"-RRB-",
"-RSB-",
",",
"total",
"distance",
"moved",
"-LRB-",
"cm",
"-RRB-",
"and",
"error",
"frequency",
"-LRB-",
"number",
"of",
"visits",
"to",
"other",
"holes",
"than",
"the",
"target",
"hole",
"-RRB-",
".",
"During",
"reversal",
"training",
"two",
"additional",
"parameters",
"were",
"analysed",
":",
"the",
"mean",
"number",
"of",
"visits",
"to",
"the",
"old",
"target",
"hole",
"over",
"the",
"seven",
"trials",
"-LRB-",
"the",
"hole",
"where",
"the",
"escape",
"box",
"was",
"located",
"during",
"acquisition",
"training",
"-RRB-",
"and",
"the",
"mean",
"number",
"of",
"visits",
"to",
"the",
"two",
"holes",
"adjacent",
"to",
"the",
"old",
"target",
"hole",
".",
"Three",
"different",
"search",
"strategies",
"could",
"be",
"distinguished",
"and",
"were",
"scored",
"manually",
".",
"The",
"random",
"search",
"strategy",
"is",
"characterized",
"by",
"a",
"non-systematic",
"exploration",
"of",
"the",
"maze",
"with",
"many",
"centre",
"maze",
"crossings",
"and",
"some",
"perseverations",
".",
"Perseverations",
"were",
"defined",
"as",
"repeatedly",
"searching",
"the",
"same",
"hole",
"or",
"two",
"adjacent",
"holes",
"-LRB-",
"Bach",
"et",
"al.",
"1995",
"-RRB-",
".",
"Secondly",
",",
"there",
"is",
"the",
"serial",
"search",
"strategy",
",",
"defined",
"as",
"systematic",
"consecutive",
"hole",
"searching",
"in",
"a",
"clockwise",
"or",
"counter",
"clockwise",
"manner",
"and",
"finally",
"a",
"spatial",
"search",
"strategy",
",",
"defined",
"as",
"searching",
"less",
"than",
"three",
"holes",
"from",
"the",
"location",
"of",
"the",
"goal",
"-LRB-",
"Barnes",
"1979",
";",
"Bach",
"et",
"al.",
"1995",
";",
"Inman-Wood",
"et",
"al.",
"2000",
";",
"Zhang",
"et",
"al.",
"2002",
";",
"Raber",
"et",
"al.",
"2004",
"-RRB-",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"Fig.",
"1Three",
"different",
"search",
"strategies",
"could",
"be",
"applied",
":",
"Random",
",",
"a",
"pattern",
"that",
"include",
"many",
"hole",
"examinations",
"in",
"a",
"random",
"manner",
";",
"Serial",
",",
"a",
"relative",
"systematic",
"search",
"either",
"clockwise",
"or",
"counterclockwise",
";",
"Spatial",
",",
"a",
"pattern",
"where",
"the",
"target",
"box",
"is",
"found",
"within",
"relative",
"short",
"time",
"and",
"with",
"high",
"accuracy",
"Fixation",
"and",
"embedding",
"Approximately",
"1",
"week",
"after",
"all",
"tests",
"were",
"concluded",
",",
"the",
"animals",
"were",
"scarified",
"by",
"CO2",
"asphyxiation",
"and",
"within",
"1",
"h",
"the",
"brains",
"were",
"dissected",
"out",
"and",
"placed",
"in",
"a",
"37",
"%",
"formalin",
"solution",
"-LRB-",
"Fixatin",
"-RRB-",
".",
"The",
"brains",
"were",
"split",
"through",
"corpus",
"callosum",
",",
"separating",
"the",
"two",
"hemispheres",
".",
"After",
"systematic",
"random",
"assignment",
"of",
"left",
"or",
"right",
"hemisphere",
"they",
"were",
"coloured",
"on",
"the",
"outer",
"surface",
"to",
"preserve",
"a",
"coded",
"sequence",
"and",
"embedded",
"in",
"paraffin",
"with",
"an",
"automatic",
"vacuum",
"tissue",
"processor",
"-LRB-",
"Leica",
"ASP300",
"-RRB-",
".",
"The",
"hemispheres",
"were",
"then",
"mounted",
"horizontally",
"balancing",
"on",
"needles",
"and",
"embedded",
"in",
"a",
"paraffin",
"block",
"with",
"up",
"to",
"four",
"hemispheres",
"in",
"one",
"block",
"Sectioning",
"The",
"whole",
"hemisphere",
"was",
"cut",
"horizontally",
"with",
"a",
"Leica",
"-LRB-",
"model",
"SM",
"2400",
"-RRB-",
"microtome",
"with",
"a",
"microtome",
"setting",
"of",
"40",
"μm",
"thickness",
".",
"All",
"sections",
"were",
"mounted",
"on",
"silicone-coated",
"glass",
"-LRB-",
"Frost",
"+",
"-RRB-",
".",
"After",
"a",
"minimum",
"of",
"24",
"h",
"in",
"a",
"40",
"°C",
"heating",
"cupboard",
",",
"the",
"sections",
"were",
"sampled",
"systematic",
"uniformly",
"randomly",
"-LRB-",
"SURS",
"-RRB-",
".",
"The",
"first",
"section",
"was",
"randomly",
"selected",
"from",
"a",
"random",
"number",
"table",
",",
"hereafter",
"every",
"6th",
"section",
"was",
"sampled",
"systematically",
"for",
"staining",
"and",
"counting",
".",
"This",
"provided",
"a",
"total",
"of",
"8",
"--",
"10",
"sections",
"containing",
"the",
"hippocampus",
"per",
"specimen",
".",
"To",
"be",
"able",
"to",
"account",
"for",
"block",
"advance",
"-LRB-",
"BA",
"-RRB-",
"the",
"block",
"height",
"was",
"measured",
"for",
"every",
"100th",
"section",
".",
"The",
"BA",
"determines",
"the",
"hitting",
"probability",
"of",
"the",
"particles",
"within",
"the",
"block",
"-LRB-",
"see",
"later",
"for",
"calculation",
"-RRB-",
".",
"Furthermore",
",",
"the",
"paraffin",
"shrinkage",
"effect",
"was",
"calculated",
"and",
"amounted",
"to",
"about",
"70",
"%",
".",
"The",
"sections",
"were",
"stained",
"with",
"a",
"modified",
"Vogt",
"'s",
"Cresyl",
"violet",
"acetate",
"-LRB-",
"Armed",
"forces",
"-RRB-",
".",
"Optical",
"design",
"equipment",
"The",
"optical",
"design",
"equipment",
"consisted",
"of",
"an",
"Olympus",
"BH-2",
"microscope",
"with",
"an",
"oil",
"immersion",
"100",
"×",
"objective",
"of",
"high",
"numerical",
"aperture",
"-LRB-",
"NA",
"=",
"1.40",
"-RRB-",
",",
"which",
"allows",
"focusing",
"in",
"a",
"thin",
"focal",
"plane",
"inside",
"a",
"thick",
"section",
".",
"A",
"camera",
"transmits",
"the",
"image",
"to",
"a",
"computer",
"screen",
"where",
"a",
"counting",
"frame",
"is",
"superimposed",
"using",
"the",
"computer-assisted",
"stereological",
"-LRB-",
"CAST",
"-RRB-",
"-",
"Grid",
"software",
"-LRB-",
"Visiopharm",
",",
"Hørsholm",
",",
"DK",
"-RRB-",
".",
"A",
"motorized",
"automatic",
"stage",
"was",
"used",
"to",
"control",
"movement",
"in",
"the",
"x",
",",
"y",
"-",
"plane",
"via",
"a",
"connected",
"joystick",
".",
"Movement",
"in",
"the",
"z-axis",
"was",
"controlled",
"manually",
"with",
"the",
"focus",
"button",
"on",
"the",
"microscope",
"and",
"the",
"distance",
"between",
"the",
"upper",
"and",
"lower",
"surfaces",
"of",
"the",
"sections",
"was",
"measured",
"with",
"a",
"Heidenhein",
"microcator",
"-LRB-",
"Heidenhain",
",",
"Germany",
"-RRB-",
"with",
"a",
"precision",
"of",
"0.5",
"μm",
".",
"Definitions",
"and",
"divisions",
"of",
"the",
"hippocampus",
"The",
"hippocampus",
"was",
"subdivided",
"into",
"five",
"regions",
";",
"the",
"dentate",
"gyrus",
"-LRB-",
"DG",
"-RRB-",
",",
"the",
"hilus",
"of",
"the",
"dentate",
"gyrus",
"-LRB-",
"CA4",
"-RRB-",
",",
"regio",
"inferior",
"-LRB-",
"CA3/2",
"-RRB-",
",",
"region",
"superior",
"-LRB-",
"CA1",
"-RRB-",
"and",
"subiculum",
".",
"Neurons",
"were",
"counted",
"manually",
"in",
"the",
"sub-sampled",
"sections",
"containing",
"the",
"hippocampus",
",",
"using",
"the",
"optical",
"disector",
"design",
".",
"The",
"layers",
"comprising",
"the",
"hippocampus",
"were",
"defined",
"consistently",
"in",
"all",
"sections",
"using",
"the",
"terminology",
"of",
"Blackstad",
"-LRB-",
"1956",
"-RRB-",
".",
"It",
"was",
"not",
"considered",
"too",
"difficult",
"to",
"differentiate",
"the",
"neuronal",
"layers",
"in",
"horizontal",
"sections",
"-LRB-",
"Fig.",
"2",
"-RRB-",
".",
"The",
"granule",
"cell",
"layer",
"and",
"the",
"pyramidal",
"cell",
"layers",
"also",
"contain",
"the",
"cell",
"bodies",
"of",
"basket",
"cells",
"and",
"glial",
"cells",
".",
"The",
"glial",
"cells",
"can",
"be",
"easily",
"identified",
"and",
"counted",
"separately",
",",
"but",
"the",
"basket",
"cells",
"are",
"so",
"similar",
"in",
"appearance",
"to",
"the",
"granule",
"and",
"pyramidal",
"cells",
"that",
"they",
"are",
"included",
"in",
"the",
"estimates",
".",
"It",
"was",
"previously",
"shown",
"that",
"they",
"comprise",
"less",
"than",
"1",
"%",
"of",
"the",
"neurons",
"in",
"these",
"layers",
"-LRB-",
"review",
"West",
"et",
"al.",
"1991",
"-RRB-",
".",
"Fig.",
"2A",
"schematic",
"drawing",
"of",
"the",
"hippocampus",
"with",
"the",
"five",
"subregions",
"identified",
"in",
"this",
"study",
".",
"Dg",
",",
"the",
"granule",
"cell",
"layer",
"of",
"the",
"dentate",
"gyrus",
";",
"h/CA4",
",",
"hilus",
"of",
"the",
"dentate",
"gyrus",
";",
"ri",
",",
"regio",
"inferior",
";",
"CA3/2",
",",
"rs",
",",
"region",
"superior",
";",
"CA1",
",",
"s",
",",
"subiculum",
"Stereological",
"equations",
"Estimation",
"of",
"the",
"total",
"neuron",
"number",
",",
"N",
"For",
"the",
"estimation",
"of",
"total",
"neuron",
"numbers",
",",
"neurons",
"were",
"counted",
"in",
"optical",
"disectors",
"and",
"sampled",
"according",
"to",
"the",
"so-called",
"fractionator",
"principles",
".",
"In",
"a",
"fractionator",
",",
"cells",
"are",
"counted",
"directly",
"in",
"a",
"known",
"fraction",
"of",
"the",
"different",
"hippocampal",
"subdivisions",
"and",
"the",
"total",
"neuron",
"number",
",",
"N",
",",
"is",
"estimated",
"by",
"multiplying",
"the",
"number",
"of",
"particles",
"counted",
"with",
"the",
"reciprocal",
"sampling",
"fractions",
":",
"where",
"ssf",
"is",
"the",
"section",
"sampling",
"fractions",
",",
"asf",
"the",
"area",
"sampling",
"fraction",
",",
"and",
"hsf",
"the",
"height",
"sampling",
"fraction",
".",
"The",
"bilateral",
"cell",
"number",
"is",
"estimated",
"by",
"multiplying",
"the",
"unilateral",
"number",
"∑",
"Q",
"−",
"by",
"2",
".",
"This",
"is",
"admissible",
"when",
"the",
"right",
"or",
"left",
"hippocampus",
"is",
"sampled",
"systematically",
"randomly",
".",
"The",
"asf",
"is",
"known",
"as",
"the",
"area",
"of",
"the",
"counting",
"frame",
"of",
"the",
"disector",
"relative",
"to",
"the",
"area",
"associated",
"with",
"each",
"x,y-step",
"movement",
"of",
"the",
"disector",
":",
"After",
"having",
"ascertained",
"that",
"the",
"cell",
"density",
"was",
"constant",
"within",
"the",
"disector",
"height",
",",
"the",
"height",
"sampling",
"fraction",
"was",
"defined",
"as",
":",
"is",
"the",
"q",
"−",
"weighted",
"mean",
"section",
"thickness",
"-LRB-",
"Gundersen",
"et",
"al.",
"1988",
";",
"Dorph-Petersen",
"2001",
"-RRB-",
".",
"Estimation",
"of",
"total",
"volume",
"--",
"the",
"Cavalieri",
"estimator",
"Besides",
"estimating",
"total",
"neuron",
"numbers",
",",
"it",
"was",
"also",
"decided",
"to",
"estimate",
"total",
"volume",
"of",
"the",
"different",
"compartments",
"of",
"the",
"hippocampus",
"although",
"the",
"main",
"purpose",
"was",
"estimation",
"of",
"cell",
"numbers",
".",
"Estimates",
"of",
"volume",
"were",
"obtained",
"according",
"to",
"the",
"principles",
"of",
"Cavalieri",
"'s",
"basic",
"estimator",
"-LRB-",
"Gundersen",
"and",
"Jensen",
"1987",
"-RRB-",
"and",
"corrected",
"for",
"shrinkage",
".",
"Notice",
"that",
"these",
"volumes",
"were",
"not",
"used",
"for",
"the",
"estimation",
"of",
"total",
"neuron",
"number",
".",
"The",
"estimates",
"of",
"total",
"neuron",
"number",
"obtained",
"by",
"the",
"fractionator",
"design",
"are",
"independent",
"of",
"the",
"containing",
"volume",
".",
"Further",
",",
"when",
"total",
"number",
"and",
"volume",
"is",
"estimated",
",",
"the",
"density",
",",
"NV",
"-LRB-",
"cells/mm3",
"-RRB-",
"can",
"be",
"obtained",
"as",
"well",
"without",
"extra",
"work",
".",
"Error",
"predictions",
"The",
"precision",
"of",
"the",
"two",
"different",
"estimates",
"-LRB-",
"neuron",
"number",
"and",
"volume",
"-RRB-",
"can",
"be",
"expressed",
"by",
"the",
"coefficient",
"of",
"error",
",",
"CE",
".",
"The",
"CE",
"for",
"the",
"Cavalieri",
"estimation",
"of",
"volume",
"was",
"first",
"formulated",
"and",
"described",
"by",
"Gundersen",
"and",
"Jensen",
"-LRB-",
"1987",
"-RRB-",
"revised",
"in",
"Gundersen",
"et",
"al.",
"-LRB-",
"1999",
"-RRB-",
".",
"Table",
"1",
"gives",
"an",
"example",
"of",
"how",
"CE",
"for",
"both",
"volume",
"and",
"neuron",
"estimates",
"are",
"calculated",
"in",
"this",
"study",
"-LRB-",
"see",
"also",
"Gundersen",
"et",
"al.",
"1999",
"-RRB-",
".",
"Table",
"1Example",
"of",
"how",
"the",
"CE",
"is",
"calculated",
"for",
"neuron",
"number",
"and",
"volume",
"respectivelySectionQj",
"−",
"A",
":",
"Qi",
"×",
"QiB",
":",
"Qi",
"×",
"Qi",
"+",
"1C",
":",
"Qi",
"×",
"Qi",
"+",
"2SectionPj",
"−",
"A",
":",
"Pi",
"×",
"PiB",
":",
"Pi",
"×",
"Pi",
"+",
"1C",
":",
"Pi",
"×",
"Pi",
"+",
"21111216162311242282563,1361,1761,0642111214433321441399378341612124193613425743993518324541985393963933486113371112117616573996816256240352839615915225330909241081022484132",
"--",
"1052520",
"--",
"11636",
"--",
"--",
"11416",
"--",
"--",
"Sum1985",
",5143,4982,583",
"Sum4122313897",
"When",
"an",
"appropriate",
"number",
"of",
"sections",
"have",
"been",
"chosen",
"-LRB-",
"10",
"or",
"a",
"little",
"less",
"-RRB-",
",",
"it",
"is",
"the",
"number",
"of",
"points",
"counted",
"-LRB-",
"the",
"noise",
"-RRB-",
"which",
"decides",
"the",
"precision",
"of",
"the",
"estimate",
".",
"To",
"count",
"about",
"200",
"points",
"per",
"sample",
"is",
"usually",
"enough",
"to",
"obtain",
"a",
"CE",
"around",
"5",
"--",
"8",
"%",
",",
"unless",
"the",
"object",
"is",
"very",
"irregular",
"-LRB-",
"Gundersen",
"and",
"Jensen",
"1987",
";",
"Gundersen",
"et",
"al.",
"1988",
";",
"West",
"and",
"Gundersen",
"1990",
"-RRB-",
".",
"When",
"CE",
"is",
"estimated",
"for",
"the",
"cell",
"counting",
",",
"Noise",
"is",
"equal",
"to",
"∑",
"Q",
"−",
".",
"Statistical",
"analyses",
"All",
"data",
"were",
"analysed",
"with",
"the",
"statistical",
"software",
"packages",
"SPSS",
"-LRB-",
"Statistical",
"Package",
"for",
"the",
"Social",
"Sciences",
",",
"version",
"14.00",
"-RRB-",
"or",
"SigmaStat",
"-LRB-",
"version",
"2.0",
"-RRB-",
".",
"If",
"Levene",
"'s",
"test",
"for",
"equality",
"of",
"variances",
"did",
"not",
"fail",
",",
"a",
"t",
"test",
"was",
"applied",
"to",
"test",
"for",
"differences",
"between",
"the",
"two",
"experimental",
"groups",
".",
"For",
"data",
"where",
"normality",
"tests",
"failed",
",",
"the",
"non-parametric",
"tests",
"Mann",
"--",
"Whitney",
"U",
"test",
"and",
"Kruskal",
"--",
"Wallis",
"test",
"were",
"applied",
".",
"The",
"animals",
"performance",
"over",
"the",
"six",
"acquisition",
"trials",
"and",
"the",
"seven",
"reversal",
"trials",
"in",
"the",
"Barnes",
"maze",
"was",
"analysed",
"by",
"mixed-model",
"analysis",
"of",
"variance",
"with",
"trial",
"as",
"within-subject",
"factor",
"and",
"experimental",
"group",
"as",
"between-subjects",
"factor",
".",
"Homogeneity",
"of",
"the",
"variance-difference",
"scores",
"was",
"determined",
"by",
"Mauchly",
"'s",
"test",
"of",
"sphericity",
"-LSB-",
"SPSS",
"Inc.",
".",
"Chicago",
",",
"IL",
",",
"USA",
".",
"SPSS",
"Base",
"version",
"11.5",
"User",
"Manual",
";",
"2004",
"-RSB-",
".",
"When",
"the",
"assumption",
"of",
"sphericity",
"was",
"violated",
",",
"degrees",
"of",
"freedom",
"were",
"adjusted",
"with",
"the",
"Huynh",
"--",
"Feldt",
"correction",
".",
"Group",
"differences",
"in",
"strategy",
"selection",
"in",
"the",
"Barnes",
"maze",
"were",
"analysed",
"with",
"the",
"likelihood-ratio",
"chi-square",
"test",
"for",
"each",
"trial",
"separately",
".",
"Group",
"differences",
"were",
"considered",
"significant",
"when",
"P",
"<",
"0.05",
".",
"Results",
"Only",
"significant",
"behavioural",
"results",
"are",
"depicted",
"and",
"statistically",
"elaborated",
".",
"Body",
"weights",
"A",
"significant",
"weight",
"loss",
"was",
"found",
"in",
"the",
"pups",
"after",
"separation",
"-LRB-",
"P",
"=",
"0.019",
",",
"paired",
"t",
"test",
"-RRB-",
".",
"However",
",",
"8",
"weeks",
"after",
"separation",
"the",
"body",
"weights",
"of",
"MS",
"and",
"SFR",
"animals",
"were",
"similar",
"-LRB-",
"P",
"=",
"0.61",
",",
"unpaired",
"t",
"test",
"-RRB-",
".",
"Open",
"field",
"test",
"Both",
"experimental",
"groups",
"spent",
"more",
"time",
"in",
"the",
"periphery",
"of",
"the",
"open",
"field",
"than",
"the",
"centre",
"-LRB-",
"P",
"<",
"0.001",
",",
"t",
"test",
"-RRB-",
".",
"There",
"was",
"no",
"significant",
"difference",
"between",
"MS",
"and",
"SFR",
"groups",
"in",
"either",
"distance",
"moved",
"or",
"frequency",
"of",
"visits",
"to",
"and",
"time",
"spent",
"in",
"the",
"centre",
"or",
"periphery",
"of",
"the",
"open",
"field",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Elevated",
"plus",
"maze",
"The",
"MS",
"animals",
"spent",
"more",
"time",
"in",
"the",
"open",
"arms",
"than",
"the",
"SFR",
"animals",
"and",
"allotted",
"a",
"greater",
"percentage",
"of",
"time",
"spent",
"in",
"both",
"open",
"and",
"closed",
"arms",
"to",
"the",
"open",
"arms",
"-LRB-",
"P",
"=",
"0.035",
"and",
"P",
"=",
"0.046",
",",
"t",
"test",
",",
"respectively",
";",
"Fig.",
"3",
"-RRB-",
".",
"Fig.",
"3The",
"mean",
"-LRB-",
"+",
"SEM",
"-RRB-",
"time",
"spent",
"in",
"both",
"the",
"open",
"and",
"closed",
"arms",
".",
"*",
"There",
"was",
"a",
"significant",
"difference",
"between",
"MS",
"24",
"-LRB-",
"N",
"=",
"16",
"-RRB-",
"and",
"SFR",
"24",
"-LRB-",
"N",
"=",
"5",
"-RRB-",
"in",
"time",
"spent",
"in",
"open",
"arms",
"-LRB-",
"P",
"<",
"0.05",
",",
"ANOVA",
"-RRB-",
".",
"**",
"Time",
"spent",
"in",
"closed",
"arms",
"compared",
"with",
"time",
"spent",
"in",
"open",
"arms",
"-LRB-",
"P",
"<",
"0.001",
",",
"t",
"test",
"-RRB-",
"In",
"trial",
"progress",
"there",
"was",
"a",
"significant",
"difference",
"in",
"both",
"frequency",
"and",
"duration",
"in",
"closed",
"and",
"open",
"arms",
"-LSB-",
"Closed",
"arms",
"frequency",
":",
"-LRB-",
"F",
"-LRB-",
"9,171",
"-RRB-",
"=",
"3.544",
",",
"P",
"<",
"0.0001",
"-RRB-",
"and",
"duration",
":",
"-LRB-",
"Wilk",
"'s",
"λ",
"F",
"-LRB-",
"9,11",
"-RRB-",
"=",
"6.045",
",",
"P",
"=",
"0.004",
"-RRB-",
",",
"Open",
"arms",
"frequency",
":",
"-LRB-",
"Wilk",
"'s",
"λ",
"F",
"-LRB-",
"9,11",
"-RRB-",
"=",
"8.086",
",",
"P",
"=",
"0.001",
"-RRB-",
"and",
"duration",
":",
"-LRB-",
"F",
"-LRB-",
"9,171",
"-RRB-",
"=",
"6.253",
",",
"P",
"<",
"0.0001",
"-RRB-",
"-RSB-",
".",
"There",
"was",
"no",
"significant",
"difference",
"in",
"any",
"of",
"the",
"other",
"parameters",
"analysed",
".",
"Barnes",
"maze",
"Acquisition",
"trials",
"Latency",
"to",
"reach",
"the",
"target",
"hole",
",",
"total",
"distance",
"moved",
"on",
"the",
"maze",
",",
"and",
"error",
"frequency",
"all",
"decreased",
"significantly",
"over",
"the",
"course",
"of",
"the",
"six",
"acquisition",
"trials",
"-LRB-",
"F",
"-LRB-",
"4.3,77.4",
"-RRB-",
"=",
"3.88",
",",
"P",
"=",
"0.005",
";",
"F",
"-LRB-",
"5,90",
"-RRB-",
"=",
"2.56",
",",
"P",
"=",
"0.033",
";",
"F",
"-LRB-",
"3.9,70.1",
"-RRB-",
"=",
"2.49",
",",
"P",
"=",
"0.05",
";",
"respectively",
"-RRB-",
",",
"indicating",
"that",
"the",
"animals",
"indeed",
"learned",
"the",
"task",
".",
"There",
"was",
",",
"however",
",",
"no",
"significant",
"difference",
"between",
"the",
"two",
"experimental",
"groups",
".",
"Reversal",
"trials",
"Latency",
"to",
"reach",
"the",
"new",
"target",
"hole",
"-LRB-",
"Fig.",
"4",
"left",
"-RRB-",
"total",
"distance",
"moved",
"on",
"the",
"maze",
"-LRB-",
"Fig.",
"5",
"-RRB-",
",",
"and",
"error",
"frequency",
"-LRB-",
"Fig.",
"6",
"-RRB-",
"all",
"decreased",
"significantly",
"over",
"the",
"course",
"of",
"the",
"seven",
"reversal",
"trials",
"-LRB-",
"F",
"-LRB-",
"3.1",
";",
"55.95",
"-RRB-",
"=",
"3.08",
",",
"P",
"<",
"0.05",
";",
"F",
"-LRB-",
"1.85",
";",
"33.41",
"-RRB-",
"=",
"16.24",
",",
"P",
"<",
"0.001",
";",
"F",
"-LRB-",
"3.43,61.68",
"-RRB-",
"=",
"18.79",
",",
"P",
"<",
"0.001",
",",
"respectively",
"-RRB-",
".",
"The",
"MS24",
"animals",
"made",
"significantly",
"more",
"errors",
"over",
"the",
"course",
"of",
"reversal",
"training",
"-LRB-",
"F",
"-LRB-",
"1",
",",
"18",
"-RRB-",
"=",
"4.79",
",",
"P",
"<",
"0.05",
";",
"Fig.",
"6",
"-RRB-",
"and",
"travelled",
"longer",
"distances",
"-LRB-",
"Fig.",
"5",
";",
"P",
"=",
"0.008",
",",
"Mann",
"--",
"Whitney",
"U-test",
"-RRB-",
".",
"This",
"might",
"indicate",
"that",
"the",
"MS",
"animals",
"did",
"not",
"learn",
"the",
"reversal",
"task",
"as",
"fast",
"as",
"the",
"controls",
".",
"Fig.",
"4Left",
":",
"Mean",
"-LRB-",
"±",
"SEM",
"-RRB-",
"latency",
"to",
"``",
"Goal",
"''",
".",
"There",
"was",
"a",
"significant",
"difference",
"in",
"Trial",
"progress",
"and",
"a",
"significant",
"Trial",
"x",
"Group",
"interaction",
"-LRB-",
"P",
"<",
"0.05",
"-RRB-",
".",
"Right",
":",
"Mean",
"-LRB-",
"±",
"SEM",
"-RRB-",
"frequency",
"of",
"visits",
"to",
"``",
"Old",
"Goal",
"''",
".",
"There",
"was",
"*",
"a",
"significant",
"difference",
"between",
"the",
"two",
"groups",
"-LRB-",
"P",
"<",
"0.05",
",",
"Mann",
"--",
"Whitney",
"U",
"test",
"-RRB-",
"and",
"a",
"significant",
"decrease",
"over",
"time",
"-LRB-",
"P",
"<",
"0.05",
",",
"RM",
"ANOVA",
"-RRB-",
".",
"MS",
"24",
"-LRB-",
"N",
"=",
"16",
"-RRB-",
"and",
"SFR",
"-LRB-",
"N",
"=",
"5",
"-RRB-",
"Fig.",
"5Mean",
"-LRB-",
"±",
"SEM",
"-RRB-",
"distance",
"moved",
"in",
"reverse",
"trials",
".",
"There",
"was",
"a",
"significant",
"decrease",
"over",
"time",
"-LRB-",
"P",
"<",
"0.05",
",",
"RM",
"ANOVA",
"-RRB-",
"and",
"*",
"a",
"significant",
"difference",
"between",
"the",
"two",
"treatment",
"groups",
"-LRB-",
"P",
"<",
"0.05",
",",
"Mann",
"--",
"Whitney",
"U",
"test",
"-RRB-",
"but",
"no",
"significant",
"Trial",
"x",
"Group",
"interaction",
".",
"MS",
"24",
"-LRB-",
"N",
"=",
"16",
"-RRB-",
"and",
"SFR",
"-LRB-",
"N",
"=",
"5",
"-RRB-",
"Fig.",
"6Mean",
"-LRB-",
"±",
"SEM",
"-RRB-",
"frequency",
"of",
"errors",
"in",
"MS",
"24",
"-LRB-",
"N",
"=",
"16",
"-RRB-",
"and",
"SFR",
"-LRB-",
"N",
"=",
"5",
"-RRB-",
"*",
"there",
"was",
"a",
"significant",
"difference",
"between",
"the",
"two",
"treatment",
"groups",
"and",
"a",
"significant",
"decrease",
"in",
"Trial",
"progress",
"-LRB-",
"P",
"<",
"0.05",
"-RRB-",
".",
"MS",
"24",
"-LRB-",
"N",
"=",
"16",
"-RRB-",
"and",
"SFR",
"-LRB-",
"N",
"=",
"5",
"-RRB-",
"The",
"MS24",
"animals",
"made",
"significantly",
"more",
"visits",
"to",
"the",
"old",
"target",
"hole",
"-LRB-",
"Fig.",
"4",
"right",
"-RRB-",
"and",
"the",
"two",
"adjacent",
"holes",
"over",
"the",
"course",
"of",
"the",
"seven",
"reversal",
"trials",
"-LRB-",
"t",
"-LRB-",
"17.5",
"-RRB-",
"=",
"3.72",
",",
"P",
"<",
"0.01",
";",
"t",
"-LRB-",
"17.5",
"-RRB-",
"=",
"4.34",
",",
"P",
"<",
"0.001",
"-RRB-",
".",
"This",
"tendency",
"to",
"venture",
"to",
"the",
"old",
"goal",
"and",
"the",
"adjacent",
"holes",
"could",
"be",
"an",
"indication",
"of",
"perseveration",
",",
"a",
"behavioural",
"pattern",
"also",
"found",
"in",
"other",
"animal",
"models",
"and",
"in",
"schizophrenic",
"patients",
"-LRB-",
"Bleuler",
"1950",
";",
"Bach",
"et",
"al.",
"1995",
";",
"review",
"Crider",
"1997",
"-RRB-",
"Search",
"strategies",
"The",
"animal",
"'s",
"search",
"pattern",
"evolved",
"over",
"time",
"-LRB-",
"Fig.",
"7",
"-RRB-",
".",
"The",
"usual",
"behaviour",
"sequence",
"was",
"a",
"progression",
"from",
"a",
"random",
"to",
"a",
"serial",
",",
"and",
"finally",
"to",
"a",
"spatial",
"search",
"strategy",
".",
"This",
"sequence",
"indicates",
"that",
"the",
"animals",
"became",
"more",
"accurate",
"and",
"more",
"efficient",
"in",
"locating",
"the",
"correct",
"hole",
".",
"Likelihood-ratio",
"chi-square",
"tests",
"showed",
"that",
"the",
"experimental",
"groups",
"differed",
"in",
"their",
"choice",
"of",
"search",
"strategy",
"on",
"days",
"2",
"and",
"3",
"of",
"acquisition",
"training",
"-LRB-",
"χ",
"-LRB-",
"2",
"-RRB-",
"=",
"10.5",
",",
"P",
"<",
"0.01",
";",
"χ",
"-LRB-",
"2",
"-RRB-",
"=",
"6.6",
",",
"P",
"<",
"0.05",
",",
"respectively",
"-RRB-",
".",
"Already",
"at",
"this",
"early",
"time",
"the",
"SFR",
"animals",
"adopted",
"a",
"serial",
"search",
"strategy",
"while",
"the",
"MS",
"animals",
"maintained",
"a",
"random",
"search",
"strategy",
".",
"On",
"all",
"other",
"acquisition",
"and",
"reversal",
"training",
"days",
"the",
"two",
"experimental",
"groups",
"did",
"not",
"differ",
"significantly",
"with",
"respect",
"to",
"their",
"choice",
"of",
"search",
"strategy",
".",
"Fig.",
"7Overview",
"of",
"mean",
"-LRB-",
"%",
"-RRB-",
"search",
"strategies",
"applied",
"in",
"the",
"acquisition",
"and",
"reverse",
"trial",
"sessions",
".",
"The",
"search",
"pattern",
"evolved",
"over",
"time",
"from",
"a",
"random",
"to",
"a",
"serial",
",",
"and",
"finally",
"to",
"a",
"spatial",
"search",
"strategy",
".",
"From",
"acquisition",
"days",
"2",
"and",
"3",
",",
"the",
"SFR",
"animals",
"adopted",
"a",
"serial",
"search",
"strategy",
",",
"while",
"the",
"MS",
"animals",
"maintained",
"a",
"random",
"search",
"strategy",
".",
"On",
"all",
"other",
"acquisition",
"and",
"reversal",
"training",
"days",
"the",
"two",
"experimental",
"groups",
"did",
"not",
"differ",
"significantly",
"with",
"respect",
"to",
"their",
"choice",
"of",
"search",
"strategy",
".",
"SFR",
"-LRB-",
"N",
"=",
"5",
"-RRB-",
"animals",
"to",
"the",
"left",
"and",
"MS",
"-LRB-",
"N",
"=",
"16",
"-RRB-",
"animals",
"to",
"the",
"right",
"Neuron",
"number",
"The",
"stereological",
"sampling",
"is",
"shown",
"in",
"Table",
"2",
".",
"Table",
"2Overview",
"of",
"the",
"stereological",
"sampling",
"used",
"in",
"this",
"studySubiculumCA4CA1CA3DGMS",
"-LRB-",
"maternal",
"separated",
"-RRB-",
"Area",
"-LRB-",
"frame",
"-RRB-",
"-LRB-",
"μm2",
"-RRB-",
"770",
"--",
"1,160710",
"--",
"1,100259259259",
"Z",
"depth",
"-LRB-",
"μm",
"-RRB-",
"2020202020X",
"and",
"Y",
"step",
"-LRB-",
"μm",
"-RRB-",
"17580100100170",
"∑",
"Q",
"−",
"208",
"±",
"36.5140",
"±",
"23.8254",
"±",
"15.7193",
"±",
"10.3205",
"±",
"15.4",
"Mean",
"section",
"thickness",
",",
"tq",
"−",
"-LRB-",
"μm",
"-RRB-",
"39.5",
"±",
"0.240.0",
"±",
"0.3039.0",
"±",
"0.338.9",
"±",
"0.3039.3",
"±",
"0.30",
"Height",
"sampling",
"fraction",
",",
"hsf1",
".97",
"±",
"0.012.00",
"±",
"0.011.95",
"±",
"0.021.95",
"±",
"0.011.96",
"±",
"0.02",
"Area",
"sampling",
"fraction",
",",
"asf57",
".4",
"±",
"11.516.8",
"±",
"4.0638.7",
"±",
"0.0030.7",
"±",
"0.01111",
"±",
"0.00",
"Section",
"sampling",
"fraction",
"-LRB-",
"k",
"-RRB-",
",",
"ssf66666Guard",
"zone",
",",
"-LRB-",
"μm",
"-RRB-",
"5.5",
"--",
"75.5",
"--",
"75.5",
"--",
"75.5",
"--",
"75.5",
"--",
"7SFR",
"-LRB-",
"Control",
"-RRB-",
"Area",
"-LRB-",
"frame",
"-RRB-",
"-LRB-",
"μm2",
"-RRB-",
"1,222",
"±",
"61.61,388",
"±",
"34.7197",
"±",
"0.1240",
"±",
"6.2197",
"±",
"0.1",
"Z",
"depth",
"-LRB-",
"μm",
"-RRB-",
"2020202020X",
"and",
"Y",
"step",
"-LRB-",
"μm",
"-RRB-",
"20095100100170",
"∑",
"Q",
"−",
"245",
"±",
"14.7190",
"±",
"14.4215",
"±",
"13.6188",
"±",
"11.8201",
"±",
"7.5",
"Mean",
"section",
"thickness",
",",
"tq",
"−",
"-LRB-",
"μm",
"-RRB-",
"39.0",
"±",
"0.6039.1",
"±",
"0.538.5",
"±",
"0.638.2",
"±",
"0.438.6",
"±",
"0.4",
"Height",
"sampling",
"fraction",
",",
"hsf1",
".95",
"±",
"0.031.95",
"±",
"0.021.93",
"±",
"0.031.91",
"±",
"0.021.93",
"±",
"0.02",
"Area",
"sampling",
"fraction",
",",
"asf33",
".3",
"±",
"1.626.46",
"±",
"0.2950.9",
"±",
"0.0342.0",
"±",
"1.28147",
"±",
"0.07",
"Section",
"sampling",
"fraction",
"-LRB-",
"k",
"-RRB-",
",",
"ssf66666Guard",
"zone",
",",
"-LRB-",
"μm",
"-RRB-",
"5.5",
"--",
"75.5",
"--",
"75.5",
"--",
"75.5",
"--",
"75.5",
"--",
"7",
"There",
"was",
"no",
"significant",
"difference",
"in",
"the",
"total",
"bilateral",
"neuron",
"number",
"in",
"hippocampus",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"However",
",",
"in",
"the",
"five",
"subregions",
"of",
"hippocampus",
",",
"there",
"was",
"a",
"significant",
"difference",
"in",
"the",
"dentate",
"gyrus",
"-LRB-",
"P",
"=",
"0.029",
",",
"Students",
"t",
"test",
"-RRB-",
",",
"but",
"none",
"in",
"the",
"four",
"other",
"regions",
"-LRB-",
"see",
"Fig.",
"8",
";",
"Table",
"3",
"-RRB-",
".",
"The",
"neuron",
"loss",
"in",
"the",
"dentate",
"gyrus",
"is",
"equivalent",
"to",
"a",
"20",
"%",
"reduction",
"in",
"the",
"maternal",
"separated",
"animals",
"compared",
"with",
"controls",
".",
"The",
"results",
"should",
"be",
"interpreted",
"with",
"caution",
"due",
"to",
"the",
"low",
"number",
"of",
"subjects",
".",
"Table",
"3Total",
"estimated",
"neuron",
"number",
"in",
"five",
"subregions",
"of",
"the",
"hippocampusMaternally",
"separated",
"-LRB-",
"MS",
"-RRB-",
"N",
"=",
"12SexSubiculumCA4CA1CA3DGTotalSubjectNeurons",
"-LRB-",
"103",
"-RRB-",
"CENeurons",
"-LRB-",
"103",
"-RRB-",
"CENeurons",
"-LRB-",
"103",
"-RRB-",
"CE",
"Neurons",
"-LRB-",
"103",
"-RRB-",
"CE",
"Neurons",
"-LRB-",
"103",
"-RRB-",
"CENeurons",
"-LRB-",
"103",
"-RRB-",
"CEFemale3310",
".0842.90.132920.061900.076720.071.5290.09",
"Female2640",
".1034.80.132430.061890.075760.071.3070.09",
"Female3710",
".0818.60.183030.062260.064740.081.3930.09",
"Female1070",
".0821.20.081420.081120.093340.107160.09",
"Female1480",
".0723.10.072130.071440.083540.108820.08",
"Female1320",
".0720.60.082620.061740.076650.071.2540.07",
"Female1380",
".0720.20.071550.081630.085520.071.0280.07",
"Female1890",
".1267.90.132020.071340.084600.081.0530.10",
"Female1440",
".0523.10.072300.071710.075970.071.1660.07",
"Female1970",
".0520.90.072290.072030.074840.091.1350.07",
"Male2370",
".1067.20.122570.061910.074870.091.2390.09",
"Male2420",
".1037.40.132240.061860.077880.061.4880.09",
"Mean2080",
".0833.20.112290.071740.075380.081.1820.08",
"CVcontrol",
"-LRB-",
"SFR",
"-RRB-",
"N",
"=",
"70.500.360.280.210.260.25",
"Female1860",
".0726.30.072850.071750.088040.071.4760.07",
"Female1760",
".0730.20.092400.071910.086580.081.2960.08",
"Female1690",
".0731.50.072730.072050.076550.081.3330.07",
"Female1940",
".0525.30.091820.081860.076170.061.2040.08",
"Female1620",
".0834.10.092780.071990.087250.071.3970.05",
"Male1570",
".0820.30.092060.081150.096130.091.1120.07",
"Male2210",
".0628.00.072850.071910.076440.091.3680.07",
"Mean1810",
".0727.90.082500.071800.086740.081.3120.08",
"CV0",
".070.120.170.060.110.08",
"Student",
"'s",
"t",
"testP",
"=",
"0.41",
"P",
"=",
"0.46",
"P",
"=",
"0.37",
"P",
"=",
"0.65",
"P",
"=",
"0.02",
"*",
"P",
"=",
"0.20",
"*",
"P",
"<",
"0.05",
"Fig.",
"8The",
"total",
"neuron",
"number",
"for",
"the",
"two",
"treatment",
"groups",
"in",
"five",
"sub-regions",
"of",
"the",
"mouse",
"hippocampus",
"for",
"the",
"pooled",
"data",
"in",
"MS",
"-LRB-",
"N",
"=",
"12",
"-RRB-",
"and",
"SFR",
"-LRB-",
"N",
"=",
"7",
"-RRB-",
".",
"*",
"MS",
"≠",
"SFR",
",",
"P",
"<",
"0.05",
",",
"Student",
"'s",
"t",
"test",
"in",
"the",
"dentate",
"gyrus",
".",
"filled",
"circle",
"MS",
";",
"open",
"circle",
"SFR",
";",
"Sub",
"Subiculum",
",",
"CA",
"4",
"Hilus",
",",
"DG",
"Dentate",
"Gyrus",
"Volume",
"After",
"Cavalieri",
"estimation",
"of",
"volume",
"and",
"correction",
"for",
"shrinkage",
"-LRB-",
"67.7",
"%",
"-RRB-",
"a",
"Student",
"'s",
"t",
"test",
"did",
"not",
"show",
"any",
"significant",
"difference",
"in",
"either",
"the",
"total",
"hippocampal",
"volume",
"or",
"in",
"the",
"five",
"subregions",
"of",
"the",
"hippocampus",
"between",
"groups",
"-LRB-",
"Table",
"4",
"-RRB-",
".",
"Table",
"4Total",
"estimated",
"volume",
"in",
"five",
"subregions",
"of",
"the",
"hippocampusMaternally",
"separated",
"-LRB-",
"MS",
"-RRB-",
"N",
"=",
"12SexSubiculumCA4CA1CA3DGTotalSubjectVolume",
"mm2CEVolume",
"mm2CEVolume",
"mm2CEVolume",
"mm2CEVolume",
"mm2CEVolume",
"mm2CEFemale4",
".330.050.690.081.460.051.520.051.800.039.790.05",
"Female3",
".380.050.690.061.140.061.390.051.230.047.840.05",
"Female4",
".250.050.590.071.540.051.720.041.180.049.290.05",
"Female1",
".660.120.600.070.520.091.000.061.060.044.840.08",
"Female2",
".400.090.860.060.790.081.260.051.290.046.590.07",
"Female1",
".730.120.650.071.070.061.390.051.330.036.170.07",
"Female2",
".260.100.690.060.680.091.420.051.220.046.260.07",
"Female2",
".290.071.040.081.000.061.260.051.120.066.710.06",
"Female2",
".150.070.790.060.910.071.450.051.130.036.430.06",
"Female3",
".000.060.740.060.980.071.470.051.130.067.320.06",
"Male2",
".980.061.010.061.070.061.390.051.150.057.000.06",
"Male3",
".310.050.910.051.220.061.630.042.180.039.250.05",
"Mean2",
".810.080.770.071.030.071.410.051.320.047.340.06",
"CVContol",
"-LRB-",
"SFR",
"-RRB-",
"N",
"=",
"70.320.200.290.130.250.20",
"Female2",
".970.080.780.071.260.061.690.041.560.038.250.06",
"Female2",
".290.090.910.071.010.061.220.051.450.036.880.07",
"Female2",
".510.090.870.061.160.061.880.041.380.047.820.06",
"Female2",
".550.090.520.090.850.071.300.050.730.046.050.07",
"Female2",
".100.110.860.070.980.071.480.051.300.046.730.07",
"Male2",
".320.100.520.101.030.071.190.051.730.056.780.08",
"Male2",
".830.080.700.071.170.051.460.051.580.047.720.06",
"Mean2",
".510.090.750.081.070.051.460.051.390.047.180.07",
"CV0",
".120.190.130.170.230.11",
"Student",
"'s",
"t",
"testP",
"=",
"0.40",
"P",
"=",
"0.79",
"P",
"=",
"0.76",
"P",
"=",
"0.62",
"P",
"=",
"0.66",
"P",
"=",
"0.79",
"Discussion",
"In",
"the",
"present",
"study",
",",
"24",
"h",
"maternal",
"separation",
"on",
"PND",
"9",
"in",
"mice",
"pups",
"resulted",
"in",
"a",
"20",
"%",
"neuron",
"decrease",
"in",
"the",
"dentate",
"gyrus",
"and",
"behavioural",
"perseverations",
"in",
"the",
"Barnes",
"maze",
".",
"The",
"anxiety",
"and",
"thus",
"stress",
"related",
"behavioural",
"tests",
"conducted",
"did",
"not",
"show",
"any",
"indications",
"of",
"an",
"elevated",
"anxiety",
"level",
".",
"On",
"the",
"contrary",
",",
"the",
"MS",
"mice",
"showed",
"a",
"reduced",
"sign",
"of",
"anxiety",
",",
"since",
"they",
"ventured",
"more",
"often",
"onto",
"the",
"open",
"arms",
"than",
"the",
"equivalent",
"control",
"group",
".",
"This",
"could",
"indicate",
"that",
"the",
"SHRP",
"was",
"not",
"repressed",
",",
"in",
"spite",
"of",
"our",
"expectations",
".",
"The",
"results",
"were",
"thus",
"surprising",
"and",
"contradicted",
"some",
"but",
"not",
"all",
"other",
"findings",
"-LRB-",
"Pihoker",
"et",
"al.",
"1993",
";",
"Plotsky",
"and",
"Meany",
"1993",
";",
"Cirulli",
"et",
"al.",
"1994",
";",
"Wigger",
"and",
"Neuman",
"1999",
";",
"Boccia",
"and",
"Pedersen",
"2001",
";",
"Parfitt",
"et",
"al.",
"2004",
"-RRB-",
".",
"A",
"study",
"by",
"Lehman",
"et",
"al.",
"-LRB-",
"1999",
"-RRB-",
"found",
"that",
"MS",
"24",
"at",
"PND",
"9",
"did",
"not",
"result",
"in",
"the",
"anxiety/fear",
"response",
"predicted",
"by",
"the",
"group",
"-LRB-",
"Lehmann",
"et",
"al.",
"1999",
"-RRB-",
".",
"Others",
"have",
"also",
"found",
"that",
"effects",
"of",
"a",
"manipulation",
"of",
"the",
"HPA",
"axis",
"can",
"not",
"always",
"be",
"used",
"to",
"predict",
"effects",
"of",
"the",
"same",
"manipulation",
"of",
"fear/anxiety",
"expression",
"at",
"the",
"behavioural",
"level",
"-LRB-",
"see",
"Lehmann",
"et",
"al.",
"1999",
";",
"Parfitt",
"et",
"al.",
"2004",
"-RRB-",
".",
"Furthermore",
",",
"Parfitt",
"et",
"al.",
"-LRB-",
"2004",
"-RRB-",
"reported",
"that",
"maternally",
"separated",
"C57BL/6",
"male",
"mice",
"had",
"a",
"prolonged",
"increase",
"in",
"plasma",
"CORT",
"after",
"an",
"acute",
"stressor",
",",
"but",
"in",
"adulthood",
"showed",
"no",
"increased",
"fear/anxiety",
"behavioural",
"response",
"-LRB-",
"Parfitt",
"et",
"al.",
"2004",
"-RRB-",
".",
"The",
"lack",
"of",
"fear",
"response",
"does",
"evidently",
"not",
"necessarily",
"mean",
"that",
"the",
"corticosterone",
"plasma",
"level",
"is",
"not",
"elevated",
"in",
"MS",
"animals",
"but",
"since",
"the",
"corticosterone",
"level",
"was",
"not",
"measured",
"this",
"question",
"remains",
"unanswered",
".",
"Finally",
",",
"a",
"study",
"by",
"Francis",
"et",
"al.",
"-LRB-",
"2002",
"-RRB-",
"concluded",
"that",
"MS",
"rats",
"subjected",
"to",
"an",
"enriched",
"environment",
"could",
"reverse",
"the",
"effect",
"from",
"MS",
"on",
"the",
"HPA",
"function",
"and",
"anxiety",
"behaviour",
"-LRB-",
"Francis",
"et",
"al.",
"2002",
"-RRB-",
".",
"In",
"conclusion",
",",
"we",
"found",
"that",
"the",
"MS",
"mice",
"in",
"our",
"study",
"did",
"not",
"show",
"behavioural",
"indications",
"on",
"a",
"repressed",
"SHRP",
",",
"which",
"might",
"be",
"explained",
"by",
"the",
"enriched",
"environment",
"the",
"mice",
"were",
"kept",
"in",
".",
"The",
"corticosterone",
"plasma",
"level",
"was",
"not",
"measured",
".",
"In",
"the",
"data",
"presented",
"for",
"the",
"Barnes",
"maze",
",",
"there",
"were",
"no",
"significant",
"differences",
"between",
"the",
"two",
"treatment",
"groups",
"during",
"the",
"acquisition",
"period",
".",
"Latency",
"to",
"reach",
"the",
"target",
"hole",
",",
"total",
"distance",
"moved",
"on",
"the",
"maze",
",",
"and",
"error",
"frequency",
"all",
"decreased",
"significantly",
"over",
"the",
"course",
"of",
"the",
"six",
"acquisition",
"trials",
"and",
"seven",
"reversal",
"trials",
",",
"indicating",
"that",
"the",
"animals",
"were",
"able",
"to",
"learn",
"the",
"task",
"with",
"time",
",",
"which",
"is",
"in",
"agreement",
"with",
"other",
"studies",
"-LRB-",
"e.g.",
"Pompl",
"et",
"al.",
"1999",
"-RRB-",
".",
"One",
"consequence",
"of",
"hippocampal",
"dysfunction",
"is",
"perseveration",
"-LRB-",
"Devenport",
"et",
"al.",
"1988",
"-RRB-",
".",
"For",
"the",
"MS",
"animals",
"the",
"group",
"differences",
"in",
"the",
"number",
"of",
"errors",
"made",
",",
"the",
"goal",
"parameter",
"and",
"the",
"distance",
"moved",
"were",
"therefore",
"of",
"interest",
".",
"The",
"differences",
"found",
"in",
"the",
"parameter",
"``",
"Close",
"to",
"Old",
"Goal",
"''",
"the",
"significantly",
"higher",
"frequency",
"of",
"``",
"Errors",
"''",
"and",
"visits",
"to",
"``",
"Old",
"Goal",
"''",
"by",
"the",
"MS",
"24",
"animals",
"indicate",
"that",
"the",
"MS",
"animals",
"were",
"more",
"perseverant",
"which",
"could",
"point",
"to",
"a",
"hippocampal",
"lesion",
"-LRB-",
"Devenport",
"et",
"al.",
"1988",
";",
"Bach",
"et",
"al.",
"1995",
"-RRB-",
".",
"However",
",",
"since",
"perseveration",
"is",
"also",
"a",
"feature",
"of",
"prefrontal",
"cortical",
"dysfunction",
"and",
"there",
"was",
"no",
"hippocampal",
"dysfunction",
"in",
"the",
"acquisition",
"trials",
",",
"we",
"can",
"only",
"conclude",
"that",
"the",
"behaviour",
"in",
"reversal",
"trial",
"may",
"be",
"related",
"to",
"hippocampus",
",",
"but",
"we",
"can",
"not",
"exclude",
"that",
"it",
"is",
"was",
"caused",
"by",
",",
"e.g.",
"a",
"prefrontal",
"cortical",
"deficit",
".",
"One",
"of",
"the",
"advantages",
"of",
"the",
"Barnes",
"maze",
"is",
"its",
"ability",
"to",
"reveal",
"the",
"search",
"strategies",
"applied",
"by",
"the",
"mice",
".",
"The",
"search",
"strategies",
"can",
"be",
"an",
"indication",
"of",
"how",
"well",
"the",
"cognitive",
"abilities",
"in",
"the",
"mice",
"are",
"due",
"to",
"the",
"use",
"of",
"extra-maze",
"cues",
"-LRB-",
"Barnes",
"1979",
";",
"Holmes",
"et",
"al.",
"2002",
"-RRB-",
".",
"In",
"this",
"study",
",",
"an",
"overall",
"search",
"pattern",
"evolved",
"with",
"time",
".",
"On",
"initial",
"trials",
"the",
"mice",
"tended",
"to",
"use",
"a",
"random",
"pattern",
"and",
"explore",
"many",
"incorrect",
"holes",
",",
"often",
"returning",
"to",
"the",
"centre",
"after",
"investigating",
"the",
"edge",
"of",
"the",
"platform",
".",
"With",
"more",
"experience",
"the",
"number",
"of",
"centre",
"crossings",
"decreased",
"and",
"a",
"more",
"systematic",
"search",
"was",
"applied",
".",
"Thus",
"in",
"later",
"trials",
"many",
"mice",
"went",
"directly",
"to",
"the",
"correct",
"hole",
"or",
"one",
"or",
"two",
"holes",
"away",
"before",
"locating",
"the",
"hidden",
"box",
".",
"The",
"mice",
"learned",
"the",
"task",
"better",
"after",
"a",
"previous",
"introduction",
"to",
"the",
"platform",
"and",
"used",
"the",
"``",
"Spatial",
"''",
"search",
"strategy",
"earlier",
".",
"Furthermore",
",",
"the",
"SFR",
"mice",
"used",
"the",
"search",
"strategy",
"``",
"Serial",
"''",
"significantly",
"faster",
"than",
"the",
"MS",
"mice",
"in",
"the",
"acquisition",
"trials",
",",
"but",
"this",
"was",
"not",
"true",
"in",
"the",
"reversal",
"trials",
".",
"The",
"serial",
"search",
"strategy",
"requires",
"the",
"mouse",
"to",
"use",
"the",
"multiple",
"relationships",
"among",
"extra-maze",
"stimuli",
"to",
"find",
"the",
"escape",
"tunnel",
"-LRB-",
"Barnes",
"1979",
";",
"Bach",
"et",
"al.",
"1995",
"-RRB-",
".",
"So",
"apparently",
"the",
"MS",
"mice",
"needed",
"more",
"time",
"to",
"acquire",
"to",
"the",
"spatial",
"search",
"strategy",
"when",
"learning",
"the",
"task",
",",
"which",
"could",
"indicate",
"a",
"learning",
"disability",
".",
"However",
",",
"since",
"the",
"MS",
"mice",
"did",
"not",
"show",
"difficulties",
"in",
"using",
"the",
"spatial",
"search",
"strategy",
"in",
"the",
"reverse",
"trials",
",",
"no",
"firm",
"conclusions",
"can",
"be",
"made",
"on",
"this",
"point",
".",
"Over",
"85",
"%",
"of",
"granule",
"cell",
"neurogenesis",
"are",
"previously",
"described",
"to",
"occur",
"postnatally",
"in",
"the",
"rodent",
"with",
"peak",
"neurogenesis",
"between",
"PND",
"5",
"and",
"7",
"and",
"total",
"cell",
"number",
"increasing",
"throughout",
"the",
"first",
"year",
"and",
"continuing",
"throughout",
"life",
"-LRB-",
"Altman",
"and",
"Das",
"1965",
";",
"Schlessinger",
"et",
"al.",
"1975",
";",
"Bayer",
"et",
"al.",
"1982",
";",
"Kuhn",
"et",
"al.",
"1996",
";",
"Kempermann",
"et",
"al.",
"1998",
"-RRB-",
".",
"Much",
"research",
"has",
"focused",
"on",
"the",
"neurogenesis",
"in",
"both",
"the",
"adult",
"and",
"newborn",
"hippocampus",
"of",
"mammals",
"-LRB-",
"Kempermann",
"et",
"al.",
"1997",
";",
"Gould",
"et",
"al.",
"1997",
";",
"Eriksson",
"et",
"al.",
"1998",
";",
"Tanapat",
"et",
"al.",
"1998",
",",
"2001",
";",
"Gould",
"et",
"al.",
"1999",
";",
"Lemaire",
"et",
"al.",
"2000",
";",
"Malberg",
"et",
"al.",
"2000",
";",
"Raber",
"et",
"al.",
"2004",
";",
"Mirescu",
"et",
"al.",
"2004",
";",
"Greisen",
"et",
"al.",
"2005",
"-RRB-",
"but",
"only",
"a",
"few",
"of",
"these",
"studies",
"have",
"used",
"modified",
"stereological",
"methods",
"-LRB-",
"Kempermann",
"et",
"al.",
"1997",
";",
"Eriksson",
"et",
"al.",
"1998",
";",
"Gould",
"et",
"al.",
"1999",
";",
"Lemaire",
"et",
"al.",
"2000",
";",
"Malberg",
"et",
"al.",
"2000",
";",
"Greisen",
"et",
"al.",
"2005",
"-RRB-",
".",
"None",
"of",
"these",
"previous",
"studies",
"have",
"quantified",
"the",
"total",
"cell",
"numbers",
"in",
"the",
"hippocampus",
"using",
"stereology",
"in",
"early",
"trauma",
"animal",
"models",
"or",
"in",
"humans",
".",
"The",
"model",
"can",
"apparently",
"induce",
"a",
"neuron",
"change",
"in",
"the",
"hippocampus",
"but",
"whether",
"the",
"lower",
"neuron",
"number",
"is",
"a",
"decrease",
"due",
"to",
"a",
"neuron",
"loss",
"or",
"because",
"neurogenesis",
"has",
"been",
"affected",
"in",
"the",
"peak",
"period",
"could",
"not",
"be",
"determined",
"in",
"this",
"study",
".",
"Secondly",
",",
"the",
"impact",
"of",
"the",
"neuron",
"loss",
"is",
"not",
"immediately",
"linked",
"to",
"a",
"possible",
"memory",
"deficit",
".",
"Even",
"though",
"the",
"MS",
"animals",
"had",
"a",
"reduced",
"emotional",
"responds",
"in",
"the",
"elevated",
"plus",
"maze",
"and",
"showed",
"perseverance",
"in",
"the",
"Barnes",
"maze",
",",
"the",
"cognitive",
"deficits",
"could",
"just",
"as",
"well",
"be",
"due",
"to",
"a",
"prefrontal",
"damage",
"and",
"thus",
"not",
"a",
"result",
"of",
"the",
"decreased",
"neuron",
"numbers",
"in",
"DG",
".",
"We",
"tested",
"if",
"a",
"24-h",
"maternal",
"separation",
"on",
"PND",
"9",
"can",
"cause",
"an",
"adult",
"phenotype",
"characterized",
"by",
"altered",
"levels",
"of",
"activity",
"and",
"anxiety",
",",
"learning",
"and",
"memory",
"dysfunction",
",",
"deficits",
"in",
"behavioural",
"flexibility",
"-LRB-",
"reversal",
"deficits",
"-RRB-",
"as",
"well",
"as",
"changes",
"in",
"number",
"of",
"neurons",
"in",
"the",
"hippocampus",
"and",
"its",
"subregions",
"in",
"the",
"mouse",
"brain",
".",
"We",
"found",
"that",
"a",
"single",
"24",
"h",
"maternal",
"separation",
"on",
"PND",
"9",
"could",
"elicit",
"a",
"reduced",
"stress",
"response",
"in",
"the",
"elevated",
"plus",
"maze",
"and",
"induce",
"perseveration",
"behaviour",
"in",
"the",
"Barnes",
"maze",
".",
"Further",
",",
"a",
"20",
"%",
"reduction",
"in",
"total",
"neuron",
"numbers",
"was",
"found",
"in",
"the",
"dentate",
"gyrus",
"of",
"the",
"hippocampus",
".",
"Ethics",
"The",
"experiment",
"was",
"carried",
"out",
"in",
"accordance",
"with",
"the",
"European",
"Communities",
"Council",
"Directive",
"of",
"24",
"November",
"1986",
"-LRB-",
"86/609/EEC",
"-RRB-",
"and",
"the",
"Danish",
"legislation",
"regulating",
"animal",
"experiments",
"-LRB-",
"Animal",
"care",
"and",
"housing",
"BEK",
"nr",
"687",
"from",
"25/07/2003",
"-RRB-",
".",
"The",
"Danish",
"Animal",
"Experiments",
"Inspectorate",
"approved",
"the",
"protocols",
"-LRB-",
"Journal",
"No.",
"2003/561",
"--",
"781",
"-RRB-",
"."
] | [
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Childs_Nerv_Syst-4-1-2367395 | [
"Microsurgical",
"third",
"ventriculocisternostomy",
"as",
"an",
"alternative",
"to",
"ETV",
":",
"report",
"of",
"two",
"cases",
"Objective",
"To",
"describe",
"a",
"microsurgical",
"alternative",
"to",
"endoscopic",
"third",
"ventriculocisternostomy",
".",
"Introduction",
"In",
"the",
"last",
"two",
"decades",
",",
"endoscopic",
"third",
"ventriculocisternostomy",
"-LRB-",
"ETV",
"-RRB-",
"via",
"a",
"precoronal",
"burr",
"hole",
"and",
"transfrontal",
"approach",
"became",
"a",
"good",
"therapeutic",
"alternative",
"to",
"shunt",
"placing",
"and",
"in",
"non-communicating",
"hydrocephalus",
",",
"ETV",
"has",
"become",
"the",
"first",
"choice",
"of",
"treatment",
"-LSB-",
"29",
"-RSB-",
".",
"Also",
",",
"ETV",
"is",
"more",
"and",
"more",
"offered",
"to",
"patients",
"with",
"shunt",
"at",
"the",
"time",
"of",
"shunt",
"malfunction",
"or",
"in",
"case",
"of",
"slit-ventricle",
"syndrome",
"-LRB-",
"SVS",
"-RRB-",
"as",
"a",
"means",
"to",
"become",
"shunt",
"independent",
".",
"However",
",",
"in",
"a",
"subpopulation",
"of",
"patients",
",",
"ETV",
"is",
"technically",
"not",
"feasible",
"due",
"to",
"small",
"ventricular",
"system",
"or",
"slit",
"ventricles",
".",
"Patients",
"with",
"such",
"small",
"ventricles",
"and",
"multiple",
"shunt",
"malfunctions",
"possess",
"a",
"highly",
"therapeutic",
"challenge",
".",
"Other",
"means",
"of",
"internal",
"shunting",
",",
"as",
"an",
"alternative",
"to",
"ventriculoperitoneal",
"or",
"ventriculoatrial",
"shunting",
",",
"have",
"been",
"described",
"in",
"the",
"decades",
"before",
"ETV",
"became",
"a",
"routine",
"procedure",
".",
"Third",
"ventriculocisternostomy",
"-LRB-",
"TVS",
"-RRB-",
"has",
"been",
"performed",
"by",
"subtemporal",
"craniotomy",
"-LSB-",
"5",
"-RSB-",
",",
"anterior",
"subfrontal",
"approach",
"-LSB-",
"6",
",",
"7",
",",
"24",
"-RSB-",
",",
"Torkildsen",
"ventriculocisternostomy",
"-LSB-",
"26",
",",
"27",
"-RSB-",
",",
"microsurgical",
"ventriculocisternostomy",
"-LSB-",
"17",
",",
"20",
"-RSB-",
",",
"stereotactic",
"ventriculocisternostomy",
"-LSB-",
"4",
",",
"13",
",",
"19",
"-RSB-",
",",
"fluoroscopic",
"ventriculocisternostomy",
"-LSB-",
"10",
"--",
"12",
"-RSB-",
",",
"microsurgical",
"opening",
"of",
"the",
"lamina",
"terminalis",
"-LSB-",
"21",
"-RSB-",
",",
"reconstruction",
"of",
"or",
"stent",
"placement",
"in",
"the",
"aqueduct",
"-LSB-",
"15",
"-RSB-",
",",
"and",
"endoscopic",
"aqueductoplasty",
"-LSB-",
"22",
"-RSB-",
".",
"TVS",
"by",
"lamina",
"terminalis",
"fenestration",
"is",
"still",
"a",
"routine",
"procedure",
"in",
"aneurysm",
"surgery",
"for",
"subarachnoid",
"hemorrhage",
",",
"especially",
"in",
"case",
"of",
"anterior",
"communicating",
"artery",
"aneurysms",
".",
"However",
",",
"the",
"possibility",
"of",
"a",
"microsurgical",
"TVS",
"-LRB-",
"MTV",
"-RRB-",
"for",
"obstructive",
"hydrocephalus",
"seems",
"to",
"be",
"lost",
"to",
"oblivion",
"by",
"the",
"widespread",
"use",
"of",
"ETV",
".",
"In",
"this",
"report",
",",
"we",
"describe",
"two",
"patients",
"in",
"whom",
"an",
"ETV",
"could",
"not",
"be",
"performed",
"because",
"of",
"slit",
"ventricles",
"and",
"who",
"became",
"shunt",
"independent",
"after",
"MTV",
"by",
"a",
"minimally",
"invasive",
"supraorbital",
"approach",
".",
"Case",
"reports",
"Case",
"1",
"This",
"eight-year-old",
"boy",
"was",
"born",
"with",
"an",
"occipital",
"meningocele",
"and",
"a",
"thoracolumbar",
"myelomeningocele",
".",
"Both",
"of",
"these",
"congenital",
"abnormalities",
"were",
"operated",
"upon",
"1",
"day",
"after",
"birth",
".",
"Within",
"several",
"days",
",",
"the",
"patient",
"developed",
"a",
"hydrocephalus",
"which",
"was",
"treated",
"with",
"a",
"ventriculoperitoneal",
"shunt",
".",
"One",
"month",
"later",
",",
"a",
"Chiari",
"type",
"II",
"malformation",
"was",
"treated",
"by",
"a",
"suboccipital",
"craniotomy",
"and",
"a",
"duraplasty",
".",
"Since",
"then",
",",
"the",
"patient",
"experienced",
"multiple",
"drain",
"infections",
"and",
"both",
"proximal",
"and",
"distal",
"drain",
"dysfunctions",
".",
"Ventriculoperitoneal",
"shunting",
"and",
"ventriculoatrial",
"shunting",
"with",
"different",
"types",
"of",
"valves",
"were",
"implanted",
"but",
"none",
"of",
"them",
"led",
"to",
"problem-free",
"shunting",
",",
"largely",
"due",
"to",
"stiff",
"slit",
"ventricles",
".",
"In",
"March",
"2003",
",",
"the",
"patient",
"experienced",
"another",
"drain",
"dysfunction",
"with",
"an",
"intracranial",
"pressure",
"-LRB-",
"ICP",
"-RRB-",
"of",
"50",
"cm",
"H2O",
"while",
"maintaining",
"slit",
"ventricles",
"followed",
"by",
"infection",
"necessitating",
"external",
"ventricular",
"drainage",
"and",
"antibiotics",
"treatment",
".",
"In",
"search",
"for",
"a",
"more",
"definitive",
"treatment",
"of",
"his",
"recurrent",
"drain",
"dysfunctions",
",",
"we",
"considered",
"to",
"perform",
"an",
"ETV",
".",
"However",
",",
"the",
"very",
"narrow",
"slit-like",
"lateral",
"ventricles",
"and",
"third",
"ventricle",
"did",
"not",
"allow",
"a",
"safe",
"execution",
"of",
"this",
"procedure",
"-LRB-",
"Fig.",
"1a",
"--",
"c",
"-RRB-",
".",
"As",
"an",
"alternative",
",",
"a",
"microsurgical",
"fenestration",
"of",
"the",
"lamina",
"terminalis",
"and",
"Liliequist",
"'s",
"membrane",
"was",
"performed",
"via",
"a",
"right-sided",
"eyebrow",
"incision",
"and",
"a",
"small",
"supraorbital",
"craniotomy",
"-LRB-",
"Fig.",
"2",
"-RRB-",
".",
"The",
"postoperative",
"course",
"was",
"uneventful",
".",
"The",
"patient",
"did",
"not",
"experience",
"any",
"symptoms",
"suspect",
"for",
"hydrocephalus",
"or",
"raised",
"intracranial",
"pressure",
"during",
"a",
"follow-up",
"of",
"3",
"years",
".",
"MRI",
"control",
"examination",
"did",
"not",
"reveal",
"a",
"significant",
"increase",
"in",
"the",
"size",
"of",
"the",
"ventricular",
"system",
"-LRB-",
"Fig.",
"1d",
"--",
"f",
"-RRB-",
".",
"Fig.",
"1Case",
"report",
"1",
".",
"a",
",",
"b",
"Axial",
"T1",
"MRI",
"depicting",
"very",
"small",
"slit-like",
"lateral",
"and",
"third",
"ventricles",
",",
"c",
"sagittal",
"T2",
"MRI",
"showing",
"small",
"third",
"ventricle",
"and",
"lamina",
"terminalis",
",",
"d",
",",
"e",
"postoperative",
"axial",
"T1",
"MRI",
"showing",
"minimal",
"increase",
"in",
"size",
"of",
"the",
"lateral",
"ventricles",
";",
"f",
"postoperative",
"sagittal",
"T2",
"MRI",
"shows",
"a",
"minimal",
"increase",
"of",
"the",
"third",
"ventricle",
",",
"but",
"no",
"flow",
"void",
"phenomenon",
"at",
"the",
"lamina",
"terminalisFig",
".",
"2Postoperative",
"photograph",
"of",
"case",
"1",
"showing",
"the",
"hardly",
"visible",
"scar",
"of",
"the",
"eyebrow",
"incision",
"Case",
"2",
"This",
"16-year-old",
"boy",
",",
"born",
"with",
"a",
"lumbosacral",
"meningocele",
"and",
"shunt",
"dependent",
"from",
"birth",
"on",
",",
"developed",
"with",
"13",
"years",
"of",
"age",
"an",
"increasing",
"overdrainage",
"syndrome",
"with",
"positional",
"headaches",
".",
"In",
"another",
"hospital",
",",
"many",
"valve",
"revisions",
"were",
"performed",
"in",
"order",
"to",
"solve",
"this",
"problem",
"and",
"to",
"rule",
"out",
"underdrainage",
".",
"The",
"original",
"differential",
"pressure",
"valve",
"was",
"exchanged",
"over",
"a",
"period",
"of",
"3",
"years",
"for",
"several",
"different",
"Delta",
"valves",
"and",
"a",
"Codman",
"Medos",
"programmable",
"valve",
",",
"with",
"which",
"practical",
"all",
"settings",
"were",
"tried",
".",
"Also",
",",
"a",
"shunt",
"explantation",
"was",
"tried",
"but",
"after",
"initial",
"improvement",
",",
"this",
"led",
"to",
"a",
"secondary",
"increase",
"of",
"headaches",
"and",
"papilledema",
"within",
"several",
"weeks",
",",
"after",
"which",
"again",
",",
"a",
"Codman",
"Medos",
"valve",
"was",
"inserted",
".",
"From",
"this",
"procedure",
",",
"we",
"obtained",
"the",
"security",
"that",
"the",
"patient",
"was",
"still",
"shunt",
"dependant",
"at",
"that",
"age",
".",
"A",
"new",
"ICP",
"monitoring",
"was",
"performed",
"in",
"the",
"other",
"hospital",
"which",
"showed",
"negative",
"intracranial",
"pressures",
"in",
"upright",
"sitting",
"position",
"and",
"an",
"ICP",
"of",
"5",
"--",
"10",
"cm",
"H2O",
"in",
"the",
"supine",
"position",
".",
"The",
"headache",
"continued",
",",
"even",
"seemed",
"to",
"increase",
"and",
"became",
"also",
"chronic",
"with",
"positional",
"increase",
"of",
"headaches",
"in",
"the",
"upright",
"position",
".",
"The",
"largest",
"problem",
",",
"however",
",",
"became",
"the",
"frequent",
"absenteeism",
"from",
"school",
"because",
"of",
"these",
"headaches",
".",
"Chronic",
"consultation",
"of",
"a",
"pediatric",
"neurologist",
"and",
"conservative",
"treatment",
"measures",
"did",
"not",
"alter",
"the",
"symptoms",
"either",
".",
"At",
"this",
"time",
",",
"he",
"was",
"referred",
"to",
"our",
"department",
".",
"As",
"a",
"first",
"measure",
",",
"a",
"PaediGav",
"9/29",
"gravitational",
"valve",
"was",
"applied",
"because",
"we",
"had",
"gained",
"good",
"experience",
"with",
"this",
"type",
"of",
"valve",
"but",
"without",
"any",
"positive",
"effect",
"on",
"the",
"headaches",
".",
"Although",
"the",
"patient",
"did",
"not",
"improve",
"after",
"many",
"shunt",
"upgrading",
",",
"it",
"was",
"felt",
"that",
"his",
"headaches",
"most",
"likely",
"were",
"to",
"be",
"attributed",
"to",
"chronic",
"overdrainage",
".",
"Therefore",
",",
"we",
"sought",
"for",
"a",
"means",
"to",
"have",
"the",
"patient",
"shunt",
"independent",
"-LRB-",
"after",
"proven",
"shunt",
"dependency",
"at",
"the",
"time",
"-RRB-",
".",
"Because",
"an",
"ETV",
"was",
"considered",
"to",
"be",
"impossible",
",",
"a",
"right",
"supraorbital",
"craniotomy",
"with",
"a",
"lamina",
"terminalis",
"fenestration",
"and",
"fenestration",
"of",
"Liliequist",
"'s",
"membrane",
"was",
"executed",
"and",
"the",
"shunt",
"was",
"completely",
"removed",
",",
"except",
"for",
"the",
"ventricular",
"catheter",
"that",
"was",
"fixated",
"and",
"therefore",
"left",
"behind",
".",
"Again",
",",
"no",
"significant",
"change",
"of",
"the",
"headache",
"could",
"be",
"observed",
".",
"A",
"24-h",
"continuous",
"ICP",
"monitoring",
",",
"performed",
"after",
"6",
"weeks",
"because",
"of",
"unchanged",
"symptoms",
",",
"revealed",
"a",
"normal",
"ICP",
"in",
"supine",
"and",
"upright",
"positions",
"with",
"a",
"maximum",
"nightly",
"increase",
"to",
"13",
"mm",
"Hg",
".",
"Two",
"years",
"after",
"surgery",
",",
"the",
"patient",
"is",
"still",
"shunt",
"independent",
"with",
"chronic",
"headaches",
",",
"no",
"papilledema",
"-LRB-",
"contrary",
"to",
"the",
"first",
"shunt",
"explantation",
"before",
"MTV",
"-RRB-",
",",
"and",
"in",
"a",
"rehabilitation",
"program",
".",
"A",
"computed",
"tomography",
"-LRB-",
"CT",
"-RRB-",
"scan",
"1.5",
"years",
"after",
"surgery",
"shows",
"a",
"minimal",
"increase",
"in",
"the",
"size",
"of",
"the",
"ventricles",
"-LRB-",
"Fig.",
"3",
"-RRB-",
".",
"Fig.",
"3Case",
"report",
"2",
".",
"a",
",",
"b",
"Preoperative",
"CT",
"scan",
"depicting",
"slit-like",
"ventricles",
";",
"c",
",",
"d",
"postoperative",
"CT",
"scan",
"with",
"minimal",
"increase",
"of",
"ventricle",
"size",
"and",
"a",
"residual",
"ventricular",
"catheter",
"that",
"could",
"not",
"be",
"removed",
"Discussion",
"There",
"are",
"many",
"complications",
"related",
"to",
"shunt",
"dependency",
".",
"In",
"10.9",
"--",
"29",
"%",
"of",
"cases",
"complications",
"-LRB-",
"other",
"than",
"mechanical",
"obstruction",
"-RRB-",
"occur",
",",
"the",
"majority",
"of",
"which",
"is",
"a",
"shunt",
"infection",
"-LSB-",
"9",
",",
"14",
",",
"18",
"-RSB-",
".",
"Mechanical",
"complications",
"in",
"shunts",
"including",
"late",
"shunt",
"malfunction",
"may",
"even",
"occur",
"in",
"up",
"to",
"45.9",
"%",
"in",
"the",
"first",
"postoperative",
"year",
"and",
"up",
"to",
"81",
"%",
"of",
"patients",
"at",
"12",
"years",
"follow-up",
"-LSB-",
"8",
",",
"9",
",",
"18",
"-RSB-",
".",
"Also",
",",
"the",
"long-term",
"shunt-related",
"mortality",
"rate",
"of",
"the",
"shunt-treated",
"patient",
",",
"despite",
"many",
"improvements",
"in",
"shunt",
"technique",
",",
"diagnostics",
",",
"and",
"follow-up",
",",
"remains",
"high",
"-LRB-",
"2.9",
"%",
"to",
"12.4",
"%",
"at",
"10",
"years",
"follow-up",
"-RRB-",
"-LSB-",
"10",
",",
"16",
",",
"30",
"-RSB-",
".",
"Therefore",
",",
"the",
"ultimate",
"goal",
"in",
"hydrocephalus",
"therapy",
"is",
"to",
"get",
"the",
"patient",
"shunt",
"free",
".",
"Since",
"the",
"first",
"experience",
"by",
"Guiot",
"-LSB-",
"10",
"-RSB-",
",",
"transcortical",
"or",
"transventricular",
"endoscopic",
"third",
"ventriculocisternostomy",
"has",
"proved",
"to",
"be",
"a",
"valid",
"alternative",
"in",
"the",
"treatment",
"of",
"obstructive",
"hydrocephalus",
".",
"Also",
",",
"several",
"studies",
"have",
"shown",
"that",
"ETV",
"is",
"an",
"effective",
"treatment",
"in",
"patients",
"with",
"obstructive",
"hydrocephalus",
"who",
"had",
"undergone",
"previous",
"shunting",
"procedures",
"-LSB-",
"1",
",",
"23",
",",
"25",
"-RSB-",
".",
"It",
"can",
"provide",
"a",
"definitive",
"cure",
"for",
"patients",
"with",
"difficult-to-manage",
"shunt",
"dysfunction",
".",
"The",
"potential",
"advantages",
"of",
"ETV",
"over",
"conventional",
"shunting",
"are",
"clear",
".",
"However",
",",
"ETV",
"requires",
"a",
"certain",
"degree",
"of",
"lateral",
"and",
"third",
"ventricle",
"dilatation",
"to",
"be",
"performed",
"safely",
".",
"In",
"case",
"of",
"small",
"ventricles",
",",
"the",
"potential",
"risks",
"of",
"this",
"procedure",
"-LRB-",
"injuring",
"fornix",
",",
"thalamostriate",
"or",
"internal",
"cerebral",
"veins",
",",
"hypothalamus",
"-RRB-",
"outweigh",
"the",
"advantages",
".",
"One",
"might",
"consider",
"to",
"enlarge",
"the",
"ventricles",
"and",
",",
"thus",
",",
"to",
"facilitate",
"an",
"ETV",
".",
"This",
"has",
"been",
"safely",
"and",
"successfully",
"performed",
"by",
"Butler",
"and",
"Khan",
"-LSB-",
"2",
"-RSB-",
"with",
"an",
"external",
"ventricular",
"drain",
"and",
"by",
"Chernov",
"et",
"al.",
"-LSB-",
"3",
"-RSB-",
"by",
"using",
"a",
"programmable",
"valve",
"of",
"which",
"the",
"pressure",
"was",
"increased",
"in",
"a",
"stepwise",
"fashion",
".",
"In",
"our",
"department",
",",
"we",
"have",
"practised",
"both",
"techniques",
"for",
"ventricular",
"dilatation",
"successfully",
",",
"but",
"we",
"also",
"encountered",
"serious",
"complications",
"from",
"this",
"strategy",
".",
"In",
"both",
"cases",
"described",
"here",
",",
"we",
"already",
"knew",
"from",
"previous",
"shunt",
"malfunctions",
"that",
"the",
"ventricles",
"hardly",
"dilate",
"with",
"increased",
"intracranial",
"pressure",
".",
"A",
"shunt",
"revision",
"in",
"case",
"1",
"for",
"proximal",
"catheter",
"obstruction",
"only",
"several",
"months",
"before",
"the",
"MTV",
"revealed",
"an",
"intracranial",
"pressure",
"of",
"50",
"cm",
"H2O",
"with",
"only",
"minimal",
"ventricular",
"dilatation",
".",
"Therefore",
",",
"in",
"our",
"two",
"patients",
",",
"we",
"opted",
"to",
"perform",
"an",
"open",
"microsurgical",
"TVS",
"by",
"opening",
"the",
"lamina",
"terminalis",
"via",
"a",
"small",
"supraorbital",
"craniotomy",
"and",
"did",
"not",
"consider",
"achieving",
"ventricular",
"expansion",
".",
"Both",
"patients",
"became",
"shunt",
"independent",
".",
"Open",
"surgical",
"TVS",
"once",
"was",
"a",
"popular",
"therapeutic",
"technique",
"for",
"the",
"treatment",
"of",
"obstructive",
"hydrocephalus",
"before",
"the",
"advent",
"of",
"VP",
"shunt",
"systems",
".",
"The",
"idea",
"of",
"third",
"ventricular",
"communication",
"into",
"the",
"chiasmatic",
"cisterns",
"was",
"initially",
"proposed",
"by",
"Dandy",
"-LSB-",
"7",
"-RSB-",
"in",
"1922",
"as",
"a",
"surgical",
"procedure",
"to",
"alleviate",
"obstructive",
"hydrocephalus",
".",
"It",
"was",
"first",
"performed",
"by",
"Dandy",
"via",
"a",
"subfrontal",
"approach",
"and",
"frequently",
"required",
"the",
"sacrifice",
"of",
"one",
"optic",
"nerve",
"and",
"elevating",
"the",
"chiasm",
".",
"Later",
",",
"Dandy",
"-LSB-",
"5",
"-RSB-",
"described",
"the",
"alternative",
"subtemporal",
"approach",
".",
"In",
"1936",
",",
"Stookey",
"and",
"Scarff",
"-LSB-",
"24",
"-RSB-",
"described",
"a",
"subfrontal",
"anterior",
"approach",
"for",
"TVS",
"through",
"the",
"lamina",
"terminalis",
"and",
"the",
"hypothalamus",
"to",
"the",
"lumen",
"of",
"the",
"third",
"ventricle",
".",
"Scarff",
"-LSB-",
"21",
"-RSB-",
"published",
"a",
"review",
"of",
"527",
"patients",
"subjected",
"to",
"this",
"operation",
"by",
"both",
"the",
"subfrontal",
"and",
"subtemporal",
"procedures",
",",
"as",
"reported",
"by",
"many",
"authors",
".",
"The",
"over-all",
"operative",
"mortality",
"was",
"15",
"%",
"and",
"the",
"permanent",
"arrest",
"of",
"the",
"hydrocephalus",
"was",
"obtained",
"in",
"70",
"%",
"of",
"the",
"survivors",
".",
"Open",
"surgical",
"TVS",
"for",
"obstructive",
"hydrocephalus",
"was",
"then",
"abandoned",
"due",
"to",
"better",
"and",
"reliable",
"shunting",
"systems",
"and",
"because",
"the",
"advent",
"of",
"endoscopic",
"techniques",
"of",
"this",
"procedure",
"is",
"not",
"reported",
"to",
"be",
"in",
"widespread",
"use",
".",
"Nevertheless",
",",
"it",
"remained",
"a",
"routine",
"procedure",
"during",
"aneurysm",
"surgery",
"in",
"order",
"to",
"get",
"more",
"slack",
"ventricles",
"and",
"to",
"prevent",
",",
"or",
"decrease",
"the",
"number",
"of",
",",
"posthemorrhagic",
"hydrocephalus",
".",
"To",
"the",
"best",
"of",
"our",
"knowledge",
",",
"MTV",
",",
"by",
"opening",
"the",
"lamina",
"terminalis",
"for",
"the",
"treatment",
"of",
"hydrocephalus",
",",
"was",
"last",
"reported",
"in",
"1988",
".",
"In",
"this",
"report",
"from",
"Reddy",
"et",
"al.",
"-LSB-",
"17",
"-RSB-",
",",
"five",
"shunted",
"patients",
"with",
"aqueduct",
"stenosis",
"and",
"slit",
"ventricle",
"syndrome",
"described",
"are",
"treated",
"successfully",
"with",
"MTV",
"via",
"opening",
"of",
"the",
"lamina",
"terminalis",
".",
"The",
"lamina",
"terminalis",
"was",
"approached",
"in",
"all",
"patients",
"via",
"a",
"classic",
"pterional",
"craniotomy",
".",
"Since",
"then",
",",
"reports",
"on",
"ETV",
"dominate",
"the",
"literature",
".",
"Operative",
"technique",
"Many",
"neurosurgeons",
"consider",
"craniotomy",
"and",
"MTV",
"too",
"large",
"and",
"risky",
"a",
"procedure",
".",
"However",
",",
"the",
"procedure",
"described",
"in",
"this",
"report",
"is",
"a",
"truly",
"minimally",
"invasive",
"procedure",
".",
"The",
"operation",
"time",
"is",
"about",
"1",
"h",
",",
"the",
"wound",
"and",
"scar",
"are",
"minimal",
",",
"recuperation",
"is",
"very",
"fast",
",",
"and",
"the",
"potential",
"risks",
"are",
"very",
"low",
".",
"One",
"might",
"even",
"suggest",
"that",
"this",
"procedure",
"is",
"safer",
"than",
"an",
"ETV",
"because",
"it",
"has",
"an",
"extracerebral",
"approach",
",",
"in",
"contrast",
"to",
"ETV",
",",
"and",
"that",
"surgery",
"is",
"better",
"controlled",
"with",
"more",
"opportunities",
"for",
"hemostasis",
".",
"The",
"supraorbital",
"craniotomy",
"with",
"eyebrow",
"incision",
"has",
"been",
"described",
"previously",
"-LSB-",
"28",
"-RSB-",
".",
"The",
"Sylvian",
"fissure",
"needs",
"not",
"to",
"be",
"dissected",
".",
"The",
"ipsilateral",
"optic",
"nerve",
"and",
"the",
"optic",
"chiasm",
",",
"the",
"ICA",
"and",
"the",
"ipsilateral",
"ACA",
"as",
"well",
"as",
"the",
"ACoA",
"are",
"exposed",
"after",
"which",
"the",
"lamina",
"terminalis",
"is",
"reached",
".",
"Lamina",
"terminals",
"fenestration",
"is",
"a",
"standard",
"procedure",
"easily",
"performed",
"with",
"the",
"bipolar",
"forceps",
"or",
"an",
"arachnoid",
"diamond",
"knife",
".",
"This",
",",
"however",
",",
"is",
"not",
"sufficient",
".",
"It",
"is",
"essential",
"to",
"open",
"Liliequist",
"'s",
"membrane",
"to",
"allow",
"free",
"and",
"sufficient",
"CSF",
"communication",
"between",
"the",
"posterior",
"fossa",
"and",
"the",
"suprasellar",
"and",
"frontobasal",
"cisterns",
".",
"Recovery",
"of",
"this",
"operative",
"procedure",
"is",
"fast",
"and",
"without",
"major",
"side-effects",
".",
"Usually",
",",
"hospitalization",
"time",
"is",
"2",
"to",
"3",
"days",
".",
"Conclusion",
"In",
"conclusion",
",",
"open",
"microsurgical",
"third",
"ventriculocisternostomy",
"by",
"opening",
"the",
"lamina",
"terminalis",
"should",
"be",
"kept",
"in",
"mind",
"as",
"an",
"alternative",
"technique",
"for",
"treating",
"patients",
"with",
"multiple",
"shunt",
"failures",
"and",
"small",
"ventricles",
"not",
"accessible",
"for",
"an",
"endoscopic",
"approach",
"in",
"an",
"effort",
"to",
"make",
"these",
"patients",
"shunt",
"independent",
"."
] | [
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Breast_Cancer_Res_Treat-3-1-2001218 | [
"Letrozole",
"as",
"upfront",
"endocrine",
"therapy",
"for",
"postmenopausal",
"women",
"with",
"hormone-sensitive",
"breast",
"cancer",
":",
"BIG",
"1-98",
"The",
"BIG",
"1-98",
"trial",
"is",
"a",
"large",
",",
"randomized",
",",
"independently",
"conducted",
"clinical",
"trial",
"designed",
"to",
"compare",
"the",
"efficacy",
"of",
"upfront",
"letrozole",
"versus",
"tamoxifen",
"monotherapy",
"and",
"to",
"compare",
"sequential",
"or",
"up-front",
"use",
"of",
"letrozole",
"and/or",
"tamoxifen",
"as",
"an",
"early",
"adjuvant",
"therapy",
"for",
"patients",
"with",
"early",
"breast",
"cancer",
".",
"We",
"report",
"on",
"the",
"results",
"from",
"the",
"primary",
"core",
"analysis",
"of",
"the",
"BIG",
"1-98",
"trial",
"of",
"8,010",
"patients",
",",
"which",
"compares",
"monotherapy",
"with",
"letrozole",
"versus",
"tamoxifen",
".",
"This",
"pre-planned",
"core",
"analysis",
"allowed",
"the",
"use",
"of",
"patient",
"data",
"from",
"the",
"monotherapy",
"arms",
"of",
"letrozole",
"and",
"tamoxifen",
"and",
"from",
"the",
"sequential",
"arms",
"prior",
"to",
"the",
"drug",
"switch",
"point",
".",
"Patients",
"randomized",
"to",
"letrozole",
"had",
"a",
"19",
"%",
"improved",
"disease-free",
"survival",
"-LRB-",
"hazard",
"ratio",
"-LSB-",
"HR",
"-RSB-",
"=",
"0.81",
";",
"P",
"=",
"0.003",
"-RRB-",
",",
"due",
"especially",
"to",
"reduced",
"distant",
"metastases",
"-LRB-",
"HR",
"=",
"0.73",
";",
"P",
"=",
"0.001",
"-RRB-",
".",
"A",
"14",
"%",
"risk",
"reduction",
"of",
"fatal",
"events",
"in",
"favor",
"of",
"letrozole",
"was",
"also",
"observed",
"-LRB-",
"P",
"=",
"NS",
"-RRB-",
".",
"The",
"results",
"from",
"the",
"monotherapy",
"arms",
"alone",
"confirmed",
"the",
"findings",
"from",
"the",
"primary",
"core",
"analysis",
".",
"Based",
"on",
"the",
"results",
"from",
"this",
"trial",
",",
"the",
"aromatase",
"inhibitor",
"letrozole",
"-LRB-",
"Femara",
"®",
"-RRB-",
"is",
"currently",
"recommended",
"as",
"a",
"part",
"of",
"standard",
"adjuvant",
"therapy",
"for",
"postmenopausal",
"women",
"with",
"endocrine-responsive",
"breast",
"cancer",
"and",
"has",
"recently",
"been",
"approved",
"in",
"the",
"early",
"adjuvant",
"setting",
"in",
"both",
"Europe",
"and",
"the",
"United",
"States",
".",
"A",
"subsequent",
"analysis",
"after",
"additional",
"follow-up",
"will",
"address",
"the",
"question",
"of",
"monotherapy",
"versus",
"sequential",
"therapy",
".",
"Introduction",
"and",
"rationale",
"During",
"the",
"last",
"century",
"the",
"management",
"of",
"primary",
"breast",
"cancer",
"has",
"evolved",
"from",
"gross",
"surgical",
"intervention",
"to",
"a",
"sophisticated",
"approach",
"involving",
"surgical",
",",
"radiotherapeutic",
",",
"hormonal",
",",
"chemotherapeutic",
",",
"and",
"targeted",
"biologic",
"strategies",
".",
"Currently",
",",
"pharmacologic",
"treatment",
"is",
"tailored",
"according",
"to",
"disease",
"and",
"patient",
"characteristics",
",",
"including",
"tumor",
"size",
",",
"histologic",
"grade",
",",
"lymph-node",
"involvement",
",",
"hormone",
"receptor",
"-LRB-",
"HR",
"-RRB-",
"status",
",",
"and",
"human",
"epidermal",
"growth",
"factor",
"receptor-2",
"-LRB-",
"HER2",
"-RRB-",
"overexpression",
".",
"The",
"benefits",
"from",
"adjuvant",
"chemotherapy",
",",
"adjuvant",
"hormonal",
"therapy",
",",
"and",
"adjuvant",
"therapy",
"with",
"trastuzumab",
"have",
"been",
"well-established",
"-LSB-",
"1",
",",
"2",
"-RSB-",
".",
"Patients",
"with",
"early",
"breast",
"cancer",
"presenting",
"with",
"estrogen",
"receptor",
"-LRB-",
"ER",
"-RRB-",
"-",
"positive",
"and/or",
"progesterone",
"receptor",
"-LRB-",
"PgR",
"-RRB-",
"-",
"positive",
"tumors",
"typically",
"receive",
"adjuvant",
"hormonal",
"therapy",
".",
"Adjuvant",
"therapy",
"with",
"tamoxifen",
",",
"a",
"selective",
"estrogen",
"receptor",
"modulator",
"-LRB-",
"SERM",
"-RRB-",
",",
"significantly",
"reduces",
"the",
"risk",
"of",
"breast",
"cancer",
"recurrence",
"-LSB-",
"1",
"-RSB-",
";",
"the",
"Early",
"Breast",
"Cancer",
"Trialists",
"Collaborative",
"Group",
"reported",
"that",
"5",
"years",
"of",
"tamoxifen",
"reduces",
"the",
"annual",
"breast",
"cancer",
"death",
"rate",
"by",
"31",
"%",
"and",
"is",
"significantly",
"more",
"effective",
"than",
"just",
"1",
"--",
"2",
"years",
"of",
"tamoxifen",
"in",
"ER-positive",
"breast",
"cancer",
"-LSB-",
"1",
"-RSB-",
".",
"However",
",",
"intrinsic",
"estrogenic",
"activity",
"-LSB-",
"3",
"--",
"5",
"-RSB-",
"and",
"increased",
"risk",
"of",
"endometrial",
"cancer",
"-LSB-",
"6",
"-RSB-",
"and",
"thromboembolism",
"-LSB-",
"7",
",",
"8",
"-RSB-",
"have",
"emerged",
"as",
"disadvantages",
"when",
"using",
"tamoxifen",
".",
"Based",
"on",
"current",
"published",
"data",
",",
"extending",
"the",
"course",
"of",
"adjuvant",
"tamoxifen",
"beyond",
"5",
"years",
"is",
"not",
"beneficial",
"-LSB-",
"9",
"-RSB-",
"despite",
"the",
"persistent",
"risk",
"of",
"relapse",
"in",
"patients",
"with",
"HR",
"+",
"breast",
"cancer",
"-LSB-",
"10",
"-RSB-",
".",
"In",
"the",
"first-line",
"treatment",
"of",
"advanced",
"breast",
"cancer",
",",
"the",
"third-generation",
"aromatase",
"inhibitors",
"-LRB-",
"AIs",
"-RRB-",
"have",
"shown",
"superior",
"or",
"equivalent",
"efficacy",
"compared",
"with",
"tamoxifen",
"-LSB-",
"11",
"--",
"15",
"-RSB-",
".",
"Letrozole",
"demonstrated",
"significant",
"superiority",
"in",
"time",
"to",
"progression",
"and",
"overall",
"response",
"rate",
"-LSB-",
"12",
"-RSB-",
"and",
",",
"in",
"addition",
",",
"an",
"early",
"survival",
"benefit",
"-LSB-",
"11",
"-RSB-",
".",
"This",
"indicates",
"that",
"a",
"subset",
"of",
"the",
"breast",
"tumors",
"is",
"inherently",
"less",
"sensitive",
"to",
"tamoxifen",
"-LSB-",
"16",
"-RSB-",
"and",
"that",
"resistance",
"to",
"tamoxifen",
"is",
"acquired",
"more",
"quickly",
"-LSB-",
"17",
"-RSB-",
".",
"This",
"superiority",
"of",
"letrozole",
"over",
"tamoxifen",
"in",
"the",
"advanced",
"setting",
"led",
"to",
"the",
"hypothesis",
"that",
"this",
"AI",
"may",
"also",
"be",
"superior",
"to",
"tamoxifen",
"when",
"administered",
"in",
"the",
"adjuvant",
"setting",
".",
"The",
"Breast",
"International",
"Group",
"-LRB-",
"BIG",
"-RRB-",
"1-98",
"was",
"designed",
",",
"coordinated",
",",
"analyzed",
",",
"and",
"reported",
"by",
"an",
"independent",
"academic",
"group",
"and",
"currently",
"is",
"the",
"largest",
"ongoing",
"adjuvant",
"trial",
"in",
"breast",
"cancer",
"investigating",
"the",
"role",
"of",
"an",
"AI",
".",
"This",
"review",
"summarizes",
"the",
"design",
"and",
"results",
"from",
"the",
"primary",
"core",
"analysis",
"of",
"the",
"BIG",
"1-98",
"trial",
",",
"which",
"compared",
"monotherapy",
"with",
"letrozole",
"to",
"monotherapy",
"with",
"tamoxifen",
"and",
"identified",
"letrozole",
"as",
"a",
"better",
"alternative",
"to",
"tamoxifen",
"in",
"this",
"setting",
".",
"It",
"also",
"summarizes",
"some",
"of",
"the",
"additional",
"published",
"research",
"using",
"the",
"BIG",
"1-98",
"database",
".",
"Trial",
"design",
"and",
"patients",
"BIG",
"1-98",
"was",
"a",
"randomized",
",",
"phase",
"III",
",",
"double-blind",
"trial",
"with",
"two",
"randomization",
"options",
":",
"two-arms",
"-LRB-",
"A",
"or",
"B",
"-RRB-",
"and",
"four-arms",
"-LRB-",
"A",
",",
"B",
",",
"C",
"or",
"D",
"-RRB-",
"-LRB-",
"see",
"Fig.",
"1",
"-RRB-",
"for",
"women",
"with",
"operable",
"invasive",
"HR",
"+",
"-LRB-",
"ER",
"+",
"and/or",
"PgR",
"+",
"-RRB-",
"breast",
"cancer",
".",
"The",
"treatment",
"arms",
"were",
":",
"-LRB-",
"A",
"-RRB-",
"initial",
"therapy",
"with",
"tamoxifen",
"for",
"5",
"years",
",",
"-LRB-",
"B",
"-RRB-",
"initial",
"therapy",
"with",
"letrozole",
"for",
"5",
"years",
",",
"-LRB-",
"C",
"-RRB-",
"initial",
"therapy",
"with",
"tamoxifen",
"for",
"2",
"years",
"followed",
"by",
"letrozole",
"for",
"3",
"years",
",",
"or",
"-LRB-",
"D",
"-RRB-",
"initial",
"therapy",
"with",
"letrozole",
"for",
"2",
"years",
"followed",
"by",
"tamoxifen",
"for",
"3",
"years",
".",
"The",
"doses",
"administered",
"were",
"2.5",
"mg/day",
"of",
"letrozole",
"and",
"20",
"mg/day",
"of",
"tamoxifen",
".",
"Fig.",
"1BIG-98",
"trial",
"design",
"Between",
"March",
"1998",
"and",
"March",
"2000",
",",
"1,835",
"women",
"were",
"randomly",
"assigned",
"to",
"arms",
"A",
"or",
"B",
",",
"and",
"between",
"April",
"1999",
"and",
"May",
"2003",
"a",
"further",
"6,193",
"were",
"assigned",
"to",
"arms",
"A",
",",
"B",
",",
"C",
",",
"or",
"D",
".",
"The",
"primary",
"core",
"analysis",
"compared",
"treatment",
"effects",
"of",
"patients",
"randomized",
"to",
"receive",
"letrozole",
"initially",
"-LRB-",
"arms",
"B",
"and",
"D",
"-RRB-",
"and",
"those",
"assigned",
"to",
"receive",
"tamoxifen",
"initially",
"-LRB-",
"arm",
"A",
"and",
"C",
"-RRB-",
".",
"In",
"the",
"sequential",
"treatment",
"groups",
"-LRB-",
"arms",
"C",
"and",
"D",
"-RRB-",
",",
"only",
"events",
"that",
"occurred",
"up",
"to",
"30",
"days",
"after",
"switching",
"treatments",
"were",
"included",
"in",
"the",
"analysis",
".",
"In",
"total",
",",
"8,010",
"patients",
"were",
"included",
"in",
"the",
"primary",
"core",
"analysis",
":",
"4,003",
"in",
"the",
"initial",
"letrozole",
"group",
"-LRB-",
"arms",
"B",
"and",
"D",
"-RRB-",
"and",
"4,007",
"in",
"the",
"initial",
"tamoxifen",
"group",
"-LRB-",
"arms",
"A",
"and",
"C",
"-RRB-",
"-LRB-",
"see",
"Fig.",
"2",
"-RRB-",
".",
"Patient",
"characteristics",
"were",
"similar",
"in",
"the",
"two",
"treatment",
"groups",
".",
"Overall",
",",
"the",
"trial",
"included",
"41.3",
"%",
"node-positive",
"and",
"57.3",
"%",
"node-negative",
"women",
",",
"while",
"1.4",
"%",
"had",
"unknown",
"nodal",
"status",
".",
"Positive",
"HR",
"status",
"was",
"an",
"eligibility",
"criterion",
".",
"The",
"majority",
"of",
"patients",
"-LRB-",
"63.1",
"%",
"-RRB-",
"had",
"both",
"ER",
"+",
"and",
"PgR",
"+",
"tumors",
".",
"A",
"total",
"of",
"25.3",
"%",
"of",
"women",
"received",
"adjuvant",
"or",
"neoadjuvant",
"chemotherapy",
".",
"Fig.",
"2CONSORT",
"-LRB-",
"Consolidated",
"Standards",
"of",
"Reporting",
"Trials",
"-RRB-",
"flowchart",
"of",
"the",
"BIG",
"1-98",
"trial",
".",
"The",
"primary",
"core",
"analysis",
"includes",
"all",
"8,010",
"assessable",
"patients",
",",
"but",
"events",
"and",
"follow-up",
"in",
"the",
"sequential",
"treatment",
"groups",
"-LRB-",
"L",
"→",
"T",
"and",
"T",
"→",
"L",
"-RRB-",
"are",
"truncated",
"at",
"30",
"days",
"after",
"switching",
"to",
"the",
"other",
"treatment",
".",
"L",
"denotes",
"letrozole",
"and",
"T",
"tamoxifen",
".",
"Reprinted",
"from",
"-LSB-",
"18",
",",
"Supplementary",
"Appendix",
"-RSB-",
"End",
"points",
"The",
"primary",
"end",
"point",
"of",
"the",
"trial",
"was",
"disease-free",
"survival",
"-LRB-",
"DFS",
"-RRB-",
",",
"defined",
"as",
"the",
"time",
"from",
"randomization",
"to",
"first",
"occurrence",
"of",
":",
"invasive",
"recurrence",
"in",
"ipsilateral",
"breast",
",",
"chest",
"wall",
",",
"regional",
"site",
"-LRB-",
"internal",
"mammary/axilla",
"-RRB-",
",",
"or",
"distant",
"site",
"-LRB-",
"including",
"ipsilateral",
"supraclavicular",
"-RRB-",
";",
"contralateral",
"breast",
"cancer",
"-LRB-",
"invasive",
"-RRB-",
";",
"second",
"malignancy",
"-LRB-",
"non-breast",
"-RRB-",
";",
"or",
"death",
"without",
"prior",
"cancer",
"event",
".",
"Protocol-specified",
"secondary",
"end",
"points",
"in",
"the",
"BIG",
"1-98",
"trial",
"were",
":",
"overall",
"survival",
"-LRB-",
"OS",
"-RRB-",
",",
"defined",
"as",
"time",
"from",
"randomization",
"to",
"death",
"from",
"any",
"cause",
";",
"systemic",
"DFS",
",",
"defined",
"as",
"time",
"from",
"randomization",
"to",
"distant",
"recurrence",
";",
"second",
"non-breast",
"malignancy",
"or",
"death",
"from",
"any",
"cause",
"-LRB-",
"ignoring",
"local",
"and",
"contralateral-breast",
"events",
"-RRB-",
";",
"and",
"safety",
".",
"Three",
"additional",
"end",
"points",
"were",
"defined",
"in",
"the",
"statistical",
"analysis",
"plan",
":",
"-LRB-",
"1",
"-RRB-",
"DFS",
"excluding",
"second",
",",
"non-breast",
"malignancies",
";",
"-LRB-",
"2",
"-RRB-",
"time",
"to",
"recurrence",
",",
"defined",
"as",
"time",
"from",
"randomization",
"to",
"first",
"breast",
"cancer",
"recurrence",
"-LRB-",
"excluding",
"second",
",",
"non-breast",
"cancers",
"and",
"censoring",
"data",
"on",
"patients",
"who",
"died",
"without",
"a",
"prior",
"cancer",
"event",
"-RRB-",
";",
"and",
"-LRB-",
"3",
"-RRB-",
"time",
"to",
"distant",
"recurrence",
",",
"defined",
"as",
"the",
"time",
"from",
"randomization",
"to",
"the",
"first",
"breast",
"cancer",
"recurrence",
"at",
"a",
"distant",
"site",
".",
"Efficacy",
"analyses",
"Primary",
",",
"secondary",
",",
"and",
"additional",
"end",
"points",
"At",
"25.8",
"months",
"of",
"follow-up",
",",
"letrozole",
"improved",
"DFS",
"by",
"19",
"%",
"-LRB-",
"P",
"=",
"0.003",
"-RRB-",
".",
"The",
"cumulative",
"incidence",
"of",
"breast",
"cancer",
"relapse",
"was",
"significantly",
"reduced",
"with",
"letrozole",
"compared",
"with",
"tamoxifen",
"-LRB-",
"see",
"Fig.",
"3",
"-RRB-",
".",
"The",
"difference",
"was",
"evident",
"from",
"1",
"year",
"after",
"randomization",
"and",
"at",
"5",
"years",
"was",
"10.3",
"%",
"in",
"the",
"letrozole",
"group",
"compared",
"with",
"13.6",
"%",
"in",
"the",
"tamoxifen",
"group",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
".",
"In",
"addition",
",",
"letrozole",
"significantly",
"improved",
"systemic",
"DFS",
"compared",
"with",
"tamoxifen",
"-LRB-",
"hazard",
"ratio",
"0.83",
";",
"95",
"%",
"CI",
"0.72",
"--",
"0.97",
"-RRB-",
".",
"There",
"was",
"significant",
"improvement",
"with",
"letrozole",
"compared",
"with",
"tamoxifen",
"for",
"the",
"additional",
"end",
"point",
"of",
"DFS",
"excluding",
"second",
"non-breast",
"cancers",
"-LRB-",
"hazard",
"ratio",
"0.79",
";",
"95",
"%",
"CI",
"0.68",
"--",
"0.92",
"-RRB-",
".",
"Letrozole",
"was",
"particularly",
"effective",
"in",
"decreasing",
"the",
"risk",
"of",
"distant",
"recurrence",
"by",
"27",
"%",
"compared",
"with",
"tamoxifen",
"-LRB-",
"hazard",
"ratio",
"0.73",
";",
"95",
"%",
"CI",
"0.60",
"--",
"0.88",
";",
"P",
"=",
"0.001",
"-RRB-",
"-LRB-",
"see",
"Fig.",
"4",
"-RRB-",
".",
"A",
"non-significant",
"14",
"%",
"improvement",
"in",
"OS",
"was",
"observed",
"in",
"patients",
"receiving",
"letrozole",
".",
"Thus",
",",
"166",
"deaths",
"-LRB-",
"4.1",
"%",
"-RRB-",
"were",
"observed",
"in",
"the",
"letrozole",
"group",
"compared",
"with",
"192",
"deaths",
"-LRB-",
"4.8",
"%",
"-RRB-",
"in",
"the",
"tamoxifen",
"group",
".",
"Fig.",
"3Cumulative",
"incidence",
"of",
"a",
"breast",
"cancer",
"relapse",
"in",
"the",
"BIG",
"1-98",
"trial",
".",
"Reprinted",
"from",
"-LSB-",
"18",
"-RSB-",
"with",
"permission",
"from",
"the",
"Massachusetts",
"Medical",
"SocietyFig",
".",
"4Cox",
"proportional-hazards",
"model",
"of",
"data",
"from",
"the",
"BIG",
"1-98",
"trial",
".",
"The",
"size",
"of",
"the",
"boxes",
"is",
"inversely",
"proportional",
"to",
"the",
"standard",
"error",
"of",
"the",
"hazard",
"ratio",
".",
"The",
"dashed",
"vertical",
"shows",
"the",
"hazard-ratio",
"estimate",
"for",
"the",
"overall",
"analysis",
"of",
"the",
"primary",
"study",
"end",
"point",
"-LRB-",
"disease-free",
"survival",
"-RRB-",
".",
"Reprinted",
"from",
"-LSB-",
"18",
"-RSB-",
"with",
"permission",
"from",
"the",
"Massachusetts",
"Medical",
"Society",
"Subgroup",
"analyses",
"Prospectively",
"planned",
"subgroup",
"analyses",
",",
"using",
"the",
"Cox",
"proportional-hazards",
"model",
",",
"for",
"primary",
",",
"secondary",
",",
"and",
"additional",
"end",
"points",
"are",
"summarized",
"in",
"Fig.",
"4",
".",
"Subgroup",
"analysis",
"showed",
"that",
"the",
"beneficial",
"effect",
"of",
"letrozole",
"on",
"DFS",
"was",
"seen",
"in",
"ER",
"+",
"tumors",
"irrespective",
"of",
"PgR",
"receptor",
"status",
"or",
"patient",
"age",
"-LSB-",
"18",
"-RSB-",
".",
"The",
"role",
"of",
"ER",
"and",
"PgR",
"in",
"trials",
"comparing",
"AIs",
"with",
"tamoxifen",
"remains",
"an",
"area",
"of",
"continued",
"research",
"-LSB-",
"19",
",",
"20",
"-RSB-",
".",
"To",
"explore",
"this",
"further",
",",
"a",
"central",
"assessment",
"of",
"ER",
",",
"PgR",
",",
"and",
"HER2",
"was",
"recently",
"completed",
"for",
"6,500",
"patients",
"in",
"BIG",
"1-98",
".",
"Results",
"from",
"the",
"first",
"3,533",
"patients",
"on",
"the",
"two",
"monotherapy",
"arms",
"with",
"ER",
"+",
"tumors",
"-LRB-",
"by",
"central",
"assessment",
"-RRB-",
"and",
"centrally",
"assessed",
"PgR",
"and",
"HER2",
"confirmed",
"the",
"results",
"reported",
"above",
"from",
"the",
"local",
"assessment",
"of",
"receptor",
"status",
"-LSB-",
"18",
",",
"21",
"-RSB-",
",",
"indicating",
"that",
"PgR",
"status",
"in",
"ER",
"+",
"tumors",
"does",
"not",
"predict",
"responsiveness",
"to",
"letrozole",
"when",
"compared",
"with",
"tamoxifen",
".",
"The",
"small",
"group",
"of",
"patients",
"with",
"HER2",
"overexpression/amplification",
"in",
"the",
"tumor",
"had",
"a",
"higher",
"rate",
"of",
"recurrence",
"with",
"both",
"treatments",
",",
"but",
"the",
"superiority",
"of",
"letrozole",
"over",
"tamoxifen",
"was",
"similar",
"irrespective",
"of",
"HER2",
"status",
"-LSB-",
"21",
"-RSB-",
".",
"For",
"the",
"primary",
"end",
"point",
"of",
"DFS",
",",
"the",
"relative",
"risk",
"reductions",
"for",
"letrozole",
"compared",
"with",
"tamoxifen",
"were",
"29",
"%",
"in",
"patients",
"with",
"node-positive",
"tumors",
"-LRB-",
"hazard",
"ratio",
"0.71",
",",
"95",
"%",
"CI",
"0.59",
"--",
"0.85",
"-RRB-",
",",
"24",
"%",
"in",
"patients",
"with",
"tumors",
">",
"2",
"cm",
"-LRB-",
"hazard",
"ratio",
"0.76",
",",
"95",
"%",
"CI",
"0.63",
"--",
"0.92",
"-RRB-",
",",
"and",
"30",
"%",
"in",
"patients",
"with",
"prior",
"chemotherapy",
"-LRB-",
"hazard",
"ratio",
"0.70",
",",
"95",
"%",
"CI",
"0.54",
"--",
"0.92",
"-RRB-",
".",
"An",
"additional",
"logistic",
"regression",
"analysis",
"of",
"BIG",
"1-98",
"was",
"performed",
"to",
"retrospectively",
"identify",
"clinical",
"and",
"pathological",
"factors",
"predictive",
"of",
"early",
"breast",
"cancer",
"recurrence",
"-LSB-",
"22",
"-RSB-",
".",
"The",
"final",
"model",
",",
"based",
"on",
"5,980",
"patients",
"from",
"the",
"four-arm",
"option",
"and",
"212",
"events",
",",
"identified",
"the",
"following",
"significant",
"factors",
":",
"tumor",
"size",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
",",
"ER/PgR",
"status",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
",",
"node",
"positivity",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
",",
"and",
"tumor",
"grade",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
".",
"There",
"was",
"a",
"significant",
"interaction",
"between",
"node",
"positivity",
"and",
"treatment",
"-LRB-",
"P",
"=",
"0.003",
"-RRB-",
".",
"Patients",
"with",
"the",
"greatest",
"risk",
"of",
"recurrence",
"had",
"≥",
"4",
"positive",
"nodes",
",",
"tumors",
"≥",
"5",
"cm",
",",
"ER",
"+",
"/",
"PgR",
"−",
"tumors",
",",
"and",
"grade",
"3",
"tumors",
".",
"The",
"increase",
"in",
"risk",
"associated",
"with",
"increased",
"node",
"positivity",
"was",
"greater",
"for",
"patients",
"randomized",
"to",
"tamoxifen",
"than",
"to",
"letrozole",
"-LSB-",
"22",
"-RSB-",
".",
"Letrozole-only",
"versus",
"tamoxifen-only",
"arms",
"The",
"superiority",
"of",
"letrozole",
"was",
"confirmed",
"in",
"a",
"protocol-defined",
"supplementary",
"analysis",
",",
"which",
"was",
"restricted",
"to",
"the",
"4,922",
"patients",
"randomized",
"to",
"the",
"monotherapy",
"tamoxifen",
"or",
"letrozole",
"arms",
".",
"At",
"a",
"median",
"follow-up",
"of",
"51",
"months",
",",
"letrozole",
"provided",
"a",
"significant",
"benefit",
"for",
"the",
"end",
"points",
"DFS",
"-LRB-",
"P",
"=",
"0.007",
"-RRB-",
",",
"DFS",
"excluding",
"secondary",
"malignancy",
"-LRB-",
"P",
"=",
"0.01",
"-RRB-",
",",
"time",
"to",
"recurrence",
"-LRB-",
"P",
"=",
"0.004",
"-RRB-",
",",
"and",
"time",
"to",
"distant",
"recurrence",
"-LRB-",
"P",
"=",
"0.03",
"-RRB-",
"-LRB-",
"see",
"Table",
"1",
"-RRB-",
"-LSB-",
"23",
"-RSB-",
".",
"Table",
"1Efficacy",
"end",
"points",
"in",
"patients",
"randomized",
"to",
"treatment",
"with",
"letrozole",
"-LRB-",
"n",
"=",
"2,463",
"-RRB-",
"or",
"tamoxifen",
"-LRB-",
"n",
"=",
"2,459",
"-RRB-",
"for",
"5",
"years",
"in",
"the",
"BIG",
"1-98",
"trial",
"-LSB-",
"23",
"-RSB-",
"End",
"pointEvents",
"Hazard",
"ratio95",
"%",
"CIP-valueLetTamDFS",
"-LRB-",
"primary",
"protocol",
"definition",
"-RRB-",
"3524180.820.71",
"--",
"0.950.007",
"Overall",
"survival1942110",
".910.75",
"--",
"1.110.35",
"Systemic",
"DFS3313740",
".870.75",
"--",
"1.010.07",
"DFS",
"-LRB-",
"ignoring",
"second",
"non-breast",
"cancer",
"-RRB-",
"3073640.830.71",
"--",
"0.960.01",
"Time",
"to",
"recurrence2312910",
".780.65",
"--",
"0.920.004",
"Time",
"to",
"distant",
"recurrence1932340",
".810.67",
"--",
"0.980.03",
"DFS",
"disease-free",
"survival",
",",
"Let",
"letrozole",
",",
"Tam",
"tamoxifen",
",",
"CI",
"confidence",
"interval",
"Safety",
"All",
"adverse",
"events",
"were",
"graded",
"according",
"to",
"the",
"Common",
"Toxicity",
"Criteria",
"of",
"the",
"National",
"Cancer",
"Institute",
"-LRB-",
"version",
"2",
"-RRB-",
".",
"Predefined",
"adverse",
"events",
"were",
"specifically",
"asked",
"and",
"documented",
"at",
"each",
"study",
"visit",
".",
"Furthermore",
",",
"the",
"IBCSG",
"Coordinating",
"Center",
"conducted",
"a",
"medical",
"review",
"-LRB-",
"reviewers",
"were",
"blinded",
"to",
"randomization",
"-RRB-",
"of",
"all",
"grade",
"3",
"--",
"5",
"cardiovascular",
"events",
"and",
"other",
"grade",
"3",
"--",
"5",
"adverse",
"events",
"that",
"were",
"considered",
"clinically",
"relevant",
"but",
"whose",
"cause",
"was",
"unclear",
",",
"and",
"all",
"deaths",
"of",
"women",
"in",
"whom",
"there",
"was",
"no",
"prior",
"cancer-related",
"event",
".",
"The",
"results",
"of",
"BIG",
"1-98",
"showed",
"that",
"letrozole",
"was",
"well-tolerated",
"and",
"had",
"a",
"safety",
"profile",
"different",
"from",
"tamoxifen",
"-LRB-",
"see",
"Table",
"2",
"-RRB-",
"-LSB-",
"18",
"-RSB-",
".",
"A",
"more",
"detailed",
"analysis",
"of",
"cardiovascular",
"side",
"effects",
",",
"including",
"baseline",
"risk",
"factors",
"and",
"cholesterol",
"values",
"over",
"time",
",",
"has",
"recently",
"been",
"presented",
"-LSB-",
"24",
"-RSB-",
".",
"Table",
"2Cardiovascular",
"adverse",
"events",
"and",
"significant",
"other",
"adverse",
"events",
"among",
"patients",
"included",
"in",
"the",
"BIG",
"1-98",
"safety",
"analysis",
"-LSB-",
"18",
"-RSB-",
"Adverse",
"event",
"Incidence",
"of",
"any",
"grade",
"-LRB-",
"%",
"-RRB-",
"P-valueLetrozole",
"-LRB-",
"n",
"=",
"3,975",
"-RRB-",
"Tamoxifen",
"-LRB-",
"n",
"=",
"3,988",
"-RRB-",
"Cerebrovascular",
"accident",
"or",
"transient",
"ischemic",
"attack1",
".01.00.91",
"Thromboembolic",
"event1",
".53.5",
"<",
"0.001",
"Cardiac",
"event4",
".13.80.61",
"Other",
"cardiovascular",
"event0",
".50.20.04",
"Vaginal",
"bleeding3",
".36.6",
"<",
"0.001",
"Hot",
"flashes33",
".538.0",
"<",
"0.001",
"Night",
"sweats13",
".916.20.004",
"Fracture5",
".74.0",
"<",
"0.001",
"Arthralgia20",
".312.3",
"<",
"0.001",
"Tamoxifen",
"compared",
"with",
"letrozole",
"was",
"associated",
"with",
"an",
"increased",
"risk",
"of",
"thromboembolism",
",",
"vaginal",
"bleeding",
",",
"and",
"more",
"endometrial",
"biopsies",
"-LRB-",
"9.1",
"%",
"vs.",
"2.3",
"%",
",",
"respectively",
";",
"P",
"<",
"0.001",
"-RRB-",
",",
"with",
"a",
"higher",
"incidence",
"of",
"invasive",
"endometrial",
"cancers",
"-LRB-",
"0.3",
"%",
"vs.",
"0.1",
"%",
",",
"respectively",
";",
"P",
"=",
"0.18",
"-RRB-",
".",
"In",
"addition",
",",
"tamoxifen",
"was",
"associated",
"with",
"a",
"higher",
"incidence",
"of",
"hot",
"flushes",
"-LRB-",
"38.0",
"%",
"vs.",
"33.5",
"%",
",",
"respectively",
";",
"P",
"<",
"0.001",
"-RRB-",
"and",
"night",
"sweats",
"-LRB-",
"16.2",
"%",
"vs.",
"13.9",
"%",
";",
"respectively",
";",
"P",
"=",
"0.004",
"-RRB-",
".",
"There",
"was",
"a",
"higher",
"incidence",
"of",
"arthralgia",
"and",
"skeletal",
"events",
"with",
"letrozole",
"compared",
"with",
"tamoxifen",
",",
"including",
"a",
"higher",
"rate",
"of",
"fractures",
"-LRB-",
"5.7",
"%",
"vs.",
"4.0",
"%",
",",
"respectively",
";",
"P",
"<",
"0.001",
"-RRB-",
"and",
"a",
"shorter",
"time",
"to",
"first",
"fracture",
".",
"Hypercholesterolemia",
"was",
"among",
"the",
"adverse",
"events",
"listed",
"on",
"the",
"case-report",
"forms",
"and",
"was",
"graded",
"at",
"each",
"study",
"visit",
"during",
"treatment",
"-LSB-",
"18",
"-RSB-",
".",
"A",
"total",
"of",
"43.6",
"%",
"of",
"letrozole-treated",
"and",
"19.2",
"%",
"of",
"patients",
"in",
"the",
"tamoxifen",
"group",
"had",
"hypercholesterolemia",
",",
"reported",
"at",
"least",
"once",
"during",
"treatment",
"-LSB-",
"18",
"-RSB-",
".",
"Nevertheless",
",",
"more",
"than",
"80",
"%",
"of",
"reported",
"hypercholesterolemia",
"was",
"grade",
"1",
",",
"and",
"thus",
"of",
"uncertain",
"clinical",
"significance",
".",
"In",
"addition",
",",
"serum",
"total",
"cholesterol",
"values",
"remained",
"stable",
"throughout",
"the",
"trial",
"in",
"the",
"letrozole",
"arm",
"but",
"decreased",
"in",
"the",
"tamoxifen",
"arm",
"by",
"approximately",
"13",
"%",
",",
"which",
"is",
"consistent",
"with",
"the",
"known",
"lipid-lowering",
"effect",
"of",
"tamoxifen",
"-LSB-",
"25",
"-RSB-",
".",
"Thus",
",",
"median",
"changes",
"in",
"cholesterol",
"values",
"from",
"baseline",
"were",
"0",
",",
"0",
",",
"and",
"−",
"1.8",
"%",
"at",
"6",
",",
"12",
",",
"and",
"24",
"months",
"in",
"the",
"letrozole",
"group",
"and",
"−",
"12.0",
",",
"−",
"13.5",
",",
"and",
"−",
"14.1",
"%",
"in",
"the",
"tamoxifen",
"group",
".",
"The",
"overall",
"incidence",
"of",
"cardiovascular",
"events",
"was",
"similar",
"for",
"the",
"letrozole",
"and",
"tamoxifen",
"groups",
".",
"Although",
"there",
"were",
"higher",
"incidences",
"of",
"grade",
"3",
"--",
"5",
"cardiac",
"events",
"and",
"cardiac",
"failure",
"in",
"the",
"letrozole",
"arm",
",",
"the",
"incidences",
"were",
"low",
"in",
"both",
"groups",
"-LRB-",
"2.1",
"%",
"vs.",
"1.1",
"%",
";",
"P",
"<",
"0.001",
"and",
"0.8",
"%",
"vs.",
"0.4",
"%",
",",
"P",
"=",
"0.01",
",",
"respectively",
"-RRB-",
"in",
"this",
"older",
"patient",
"population",
"at",
"competing",
"risk",
"for",
"cardiovascular",
"events",
"-LSB-",
"18",
"-RSB-",
".",
"Discussion",
"Clinical",
"implications",
"of",
"BIG",
"1-98",
"The",
"results",
"of",
"the",
"primary",
"core",
"analysis",
"-LSB-",
"18",
"-RSB-",
",",
"which",
"included",
"all",
"available",
"data",
"from",
"patients",
"randomly",
"assigned",
"to",
"the",
"monotherapy",
"arms",
"and",
"data",
"from",
"the",
"sequential",
"therapy",
"arms",
"censored",
"at",
"the",
"time",
"of",
"the",
"therapy",
"switch",
",",
"as",
"well",
"as",
"the",
"results",
"from",
"a",
"recently",
"published",
"analysis",
"limited",
"to",
"patients",
"randomly",
"assigned",
"to",
"the",
"continuous",
"therapy",
"arms",
"-LSB-",
"23",
"-RSB-",
",",
"demonstrate",
"a",
"significant",
"benefit",
"of",
"letrozole",
"over",
"tamoxifen",
".",
"Letrozole",
"is",
"at",
"least",
"as",
"well-tolerated",
"as",
"tamoxifen",
",",
"offering",
"patients",
"and",
"physicians",
"a",
"true",
"alternative",
".",
"However",
",",
"bone",
"metabolism",
"is",
"differently",
"affected",
"by",
"letrozole",
"and",
"tamoxifen",
".",
"Patients",
"receiving",
"AIs",
"are",
"at",
"increased",
"risk",
"for",
"bone",
"loss",
"and",
"osteoporosis",
"and",
"should",
"therefore",
"receive",
"appropriate",
"monitoring",
"and",
"medical",
"intervention",
"as",
"part",
"of",
"daily",
"practice",
".",
"As",
"a",
"result",
"of",
"the",
"findings",
"from",
"BIG",
"1-98",
",",
"letrozole",
"was",
"approved",
"both",
"in",
"Europe",
"and",
"the",
"United",
"States",
"as",
"an",
"early",
"adjuvant",
"treatment",
"for",
"postmenopausal",
"women",
"with",
"HR",
"+",
"breast",
"cancer",
".",
"The",
"2007",
"St.",
"Gallen",
"international",
"consensus",
"guidelines",
"-LSB-",
"26",
"-RSB-",
"and",
"updated",
"National",
"Comprehensive",
"Cancer",
"Network",
"-LRB-",
"NCCN",
"-RRB-",
"guidelines",
"-LSB-",
"27",
"-RSB-",
"recommend",
"letrozole",
"as",
"an",
"option",
"for",
"adjuvant",
"treatment",
"of",
"early",
"breast",
"cancer",
".",
"In",
"the",
"2007",
"St.",
"Gallen",
"Guidelines",
",",
"use",
"of",
"an",
"AI",
"is",
"considered",
"as",
"an",
"alternative",
"to",
"tamoxifen",
"for",
"postmenopausal",
"women",
"with",
"low",
"-",
",",
"intermediate",
"-",
",",
"or",
"high-risk",
"tumors",
"that",
"are",
"classified",
"as",
"endocrine-responsive",
"or",
"endocrine",
"response",
"uncertain",
"-LSB-",
"26",
"-RSB-",
".",
"Similarly",
",",
"in",
"the",
"NCCN",
"guidelines",
",",
"letrozole",
"is",
"a",
"recommended",
"adjuvant",
"hormonal",
"therapy",
"for",
"all",
"postmenopausal",
"women",
"with",
"hormone-responsive",
"tumors",
",",
"regardless",
"of",
"HER2",
"status",
"-LSB-",
"27",
"-RSB-",
".",
"The",
"current",
"guidelines",
"do",
"not",
"recommend",
"one",
"AI",
"over",
"another",
"but",
"emphasize",
"that",
"treatment",
"should",
"be",
"selected",
"on",
"the",
"basis",
"of",
"clinical",
"trial",
"evidence",
"in",
"specific",
"settings",
"-LSB-",
"27",
"-RSB-",
",",
"nor",
"do",
"the",
"guidelines",
"provide",
"recommendations",
"as",
"concerns",
"the",
"optimal",
"use",
"of",
"the",
"AIs",
"as",
"upfront",
"monotherapy",
"or",
"sequenced",
"with",
"tamoxifen",
".",
"Results",
"from",
"the",
"Arimidex",
",",
"Tamoxifen",
",",
"Alone",
"or",
"in",
"Combination",
"-LRB-",
"ATAC",
"-RRB-",
"trial",
"provided",
"evidence",
"for",
"superior",
"DFS",
"with",
"anastrozole",
"versus",
"tamoxifen",
"used",
"as",
"initial",
"adjuvant",
"hormonal",
"therapy",
"in",
"postmenopausal",
"women",
"with",
"HR",
"+",
"breast",
"cancer",
"-LSB-",
"28",
",",
"29",
"-RSB-",
".",
"At",
"a",
"median",
"follow-up",
"of",
"68",
"months",
",",
"no",
"survival",
"advantage",
"has",
"been",
"observed",
"in",
"the",
"ATAC",
"trial",
",",
"and",
"it",
"remains",
"an",
"open",
"question",
"whether",
"the",
"DFS",
"advantage",
"observed",
"in",
"AI",
"trials",
"will",
"translate",
"into",
"an",
"OS",
"advantage",
".",
"Both",
"letrozole",
"and",
"anastrozole",
"have",
"demonstrated",
"superiority",
"over",
"tamoxifen",
"as",
"initial",
"adjuvant",
"therapy",
"-LSB-",
"18",
",",
"28",
"-RSB-",
",",
"but",
"a",
"direct",
"comparison",
"of",
"letrozole",
"with",
"anastrozole",
"awaits",
"the",
"results",
"of",
"a",
"randomized",
"head-to-head",
"trial",
"-LRB-",
"Femara",
"Anastrozole",
"Clinical",
"Evaluation",
"-LSB-",
"FACE",
"-RSB-",
"-RRB-",
"-LSB-",
"30",
",",
"31",
"-RSB-",
".",
"The",
"adjuvant",
"FACE",
"trial",
"compares",
"upfront",
"therapy",
"with",
"letrozole",
"2.5",
"mg",
"with",
"anastrozole",
"1",
"mg",
"daily",
"for",
"up",
"to",
"5",
"years",
"in",
"postmenopausal",
",",
"HR",
"+",
",",
"node-positive",
"breast",
"cancer",
"patients",
".",
"In",
"addition",
",",
"recruitment",
"of",
"a",
"direct",
"comparison",
"of",
"anastrozole",
"and",
"exemestane",
"-LRB-",
"MA",
".27",
"-RRB-",
"has",
"been",
"completed",
"recently",
".",
"Other",
"trials",
"demonstrated",
"better",
"disease",
"control",
"when",
"an",
"AI",
"was",
"given",
"after",
"2",
"--",
"3",
"years",
"of",
"adjuvant",
"tamoxifen",
"-LSB-",
"32",
"-RSB-",
",",
"but",
"so",
"far",
",",
"no",
"trial",
"has",
"reported",
"on",
"a",
"regimen",
"of",
"an",
"AI",
"given",
"2",
"--",
"3",
"years",
"before",
"tamoxifen",
".",
"Initial",
"treatment",
"with",
"the",
"``",
"gold",
"standard",
"''",
"tamoxifen",
"followed",
"by",
"an",
"AI",
"may",
"be",
"a",
"logical",
"long-term",
"strategy",
"because",
"of",
"the",
"lack",
"of",
"complete",
"cross-resistance",
"between",
"these",
"hormonal",
"strategies",
".",
"On",
"the",
"other",
"hand",
",",
"the",
"greater",
"anti-estrogenic",
"potency",
"and",
"higher",
"anti-tumor",
"activity",
"of",
"AIs",
"over",
"tamoxifen",
",",
"as",
"demonstrated",
"in",
"preclinical",
"models",
"and",
"randomized",
"clinical",
"trials",
"-LSB-",
"12",
",",
"17",
",",
"33",
",",
"34",
"-RSB-",
",",
"may",
"suggest",
"that",
"it",
"is",
"preferable",
"to",
"use",
"an",
"AI",
"upfront",
"to",
"avoid",
"early",
"relapses",
"that",
"may",
"occur",
"while",
"on",
"tamoxifen",
"therapy",
".",
"Thus",
",",
"the",
"key",
"question",
",",
"``",
"should",
"AIs",
"be",
"given",
"as",
"initial",
"therapy",
"or",
"used",
"sequentially",
"after",
"tamoxifen",
"?",
"''",
"is",
"as",
"yet",
"unanswered",
".",
"Physicians",
"often",
"extrapolate",
"data",
"from",
"switch",
"trials",
",",
"e.g.",
",",
"the",
"Intergroup",
"Exemestane",
"Study",
"-LSB-",
"35",
",",
"36",
"-RSB-",
"or",
"the",
"MA",
".17",
"trial",
"-LSB-",
"33",
",",
"37",
"-RSB-",
"to",
"sequential",
"trials",
"-LRB-",
"e.g.",
",",
"BIG",
"1-98",
",",
"Austrian",
"Breast",
"and",
"Colorectal",
"Cancer",
"Study",
"Group",
"-LSB-",
"ABCSG",
"-RSB-",
"8",
"-LSB-",
"38",
"-RSB-",
"-RRB-",
".",
"In",
"these",
"sequential",
"trials",
",",
"events",
"are",
"included",
"in",
"the",
"analysis",
"from",
"treatment",
"start",
"and",
"not",
"from",
"point",
"of",
"switch",
"after",
"2",
"--",
"3",
"years",
"of",
"tamoxifen",
".",
"Sequential",
"and",
"switch",
"trials",
"investigate",
"obviously",
"the",
"same",
"intervention",
"but",
"are",
"conducted",
"in",
"different",
"patient",
"groups",
",",
"thus",
",",
"results",
"are",
"expected",
"to",
"be",
"different",
"and",
"are",
"different",
"indeed",
".",
"Best",
"use",
"of",
"AIs",
"remains",
"an",
"open",
"question",
",",
"at",
"least",
"until",
"results",
"of",
"BIG",
"1-98",
"from",
"the",
"sequential",
"use",
"of",
"letrozole",
"and",
"tamoxifen",
",",
"in",
"comparison",
"with",
"continuous",
"monotherapy",
",",
"as",
"well",
"as",
"from",
"the",
"Tamoxifen",
"and",
"Exemestane",
"Adjuvant",
"Multicenter",
"trial",
"investigating",
"exemestane",
"monotherapy",
"versus",
"tamoxifen",
"followed",
"by",
"exemestane",
"-LSB-",
"39",
"-RSB-",
"and",
"from",
"an",
"updated",
"analysis",
"of",
"ABCSG-8",
",",
"become",
"available",
".",
"Conclusions",
"BIG",
"1-98",
"has",
"shown",
"that",
"the",
"AI",
"letrozole",
"results",
"in",
"better",
"disease",
"control",
"than",
"tamoxifen",
"when",
"given",
"as",
"initial",
"endocrine",
"therapy",
"for",
"postmenopausal",
"women",
"with",
"hormone-responsive",
"early",
"breast",
"cancer",
".",
"Letrozole",
"significantly",
"reduced",
"the",
"risk",
"of",
"recurrence",
"and",
"of",
"distant",
"recurrence",
"and",
"has",
"a",
"reasonable",
"safety",
"profile",
"-LSB-",
"18",
"-RSB-",
".",
"The",
"comparison",
"between",
"the",
"monotherapy",
"and",
"the",
"sequential",
"treatment",
"arms",
"within",
"the",
"BIG",
"1-98",
"trial",
"are",
"eagerly",
"awaited",
"and",
"are",
"expected",
"to",
"have",
"an",
"important",
"impact",
"on",
"the",
"management",
"of",
"breast",
"cancer",
"."
] | [
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O"
] |
Cancer_Causes_Control-3-1-1914283 | [
"Alcohol",
"consumption",
",",
"cigarette",
"smoking",
",",
"and",
"endometrial",
"cancer",
"risk",
":",
"results",
"from",
"the",
"Netherlands",
"Cohort",
"Study",
"Objective",
"To",
"examine",
"the",
"association",
"between",
"alcohol",
"consumption",
",",
"cigarette",
"smoking",
",",
"and",
"endometrial",
"cancer",
".",
"Introduction",
"Endometrial",
"cancer",
"is",
"the",
"most",
"frequently",
"diagnosed",
"gynecologic",
"cancer",
"in",
"Europe",
"-LSB-",
"1",
"-RSB-",
".",
"The",
"development",
"of",
"endometrial",
"cancer",
"has",
"been",
"related",
"to",
"exposure",
"to",
"estrogens",
"unopposed",
"by",
"progestagens",
"-LSB-",
"2",
"-RSB-",
".",
"Many",
"studies",
"have",
"shown",
"a",
"positive",
"association",
"between",
"alcohol",
"ingestion",
"and",
"estrogen",
"levels",
"in",
"postmenopausal",
"women",
".",
"For",
"instance",
",",
"cross-sectional",
"data",
"from",
"the",
"European",
"Prospective",
"Investigation",
"into",
"Cancer",
"and",
"Nutrition",
"-LRB-",
"EPIC",
"-RRB-",
"suggested",
"that",
"elevated",
"blood",
"levels",
"of",
"estrone",
"are",
"observed",
"with",
"increasing",
"alcohol",
"consumption",
"in",
"postmenopausal",
"women",
"-LSB-",
"3",
"-RSB-",
".",
"Thus",
",",
"alcohol",
"could",
"be",
"expected",
"to",
"increase",
"endometrial",
"cancer",
"risk",
"by",
"elevating",
"estrogen",
"levels",
".",
"An",
"important",
"determinant",
"of",
"estrogen",
"levels",
"in",
"women",
"is",
"use",
"of",
"unopposed",
"hormone",
"replacement",
"therapy",
"-LRB-",
"HRT",
"-RRB-",
".",
"Accordingly",
",",
"use",
"of",
"unopposed",
"HRT",
"is",
"consistently",
"associated",
"with",
"an",
"increased",
"risk",
"of",
"endometrial",
"cancer",
"-LSB-",
"4",
"--",
"6",
"-RSB-",
".",
"Furthermore",
",",
"it",
"has",
"been",
"suggested",
"that",
"alcohol",
"consumption",
"increases",
"estradiol",
"levels",
"in",
"particular",
"in",
"postmenopausal",
"women",
"who",
"are",
"on",
"HRT",
"-LSB-",
"7",
",",
"8",
"-RSB-",
".",
"However",
",",
"previous",
"studies",
"have",
"indicated",
"that",
"alcohol",
"consumption",
"is",
"either",
"weakly",
"or",
"not",
"associated",
"with",
"a",
"reduced",
"risk",
"of",
"endometrial",
"cancer",
"and",
"no",
"significant",
"interaction",
"with",
"use",
"of",
"HRT",
"has",
"been",
"found",
"-LSB-",
"9",
"-RSB-",
".",
"Although",
"several",
"studies",
"have",
"analyzed",
"the",
"association",
"between",
"alcohol",
"consumption",
"and",
"endometrial",
"cancer",
"risk",
"-LSB-",
"10",
"--",
"22",
"-RSB-",
",",
"only",
"few",
"studies",
"have",
"examined",
"the",
"risk",
"associated",
"with",
"various",
"measures",
"of",
"alcohol",
"consumption",
"-LRB-",
"e.g.",
",",
"amount",
"and",
"type",
"of",
"alcohol",
"-RRB-",
"including",
"only",
"one",
"comprehensive",
"prospective",
"cohort",
"study",
"-LSB-",
"18",
"-RSB-",
".",
"In",
"contrast",
"to",
"alcohol",
",",
"smoking",
"has",
"been",
"hypothesized",
"to",
"exert",
"anti-estrogenic",
"effects",
"-LSB-",
"23",
"-RSB-",
"and",
"to",
"lower",
"the",
"risk",
"of",
"endometrial",
"cancer",
"in",
"this",
"way",
".",
"Also",
",",
"an",
"effect",
"modification",
"by",
"use",
"of",
"HRT",
"seems",
"reasonable",
"-LSB-",
"24",
"-RSB-",
".",
"Furthermore",
",",
"it",
"has",
"been",
"suggested",
"that",
"body",
"mass",
"index",
"-LRB-",
"BMI",
"-RRB-",
"and",
"age",
"at",
"menopause",
"might",
"mediate",
"part",
"of",
"the",
"inverse",
"association",
"between",
"smoking",
"and",
"endometrial",
"cancer",
"-LSB-",
"24",
"-RSB-",
".",
"Earlier",
"prospective",
"studies",
"-LSB-",
"22",
",",
"25",
"--",
"29",
"-RSB-",
"have",
"generally",
"suggested",
"that",
"smoking",
"is",
"associated",
"with",
"a",
"slight",
"to",
"moderate",
"protection",
"against",
"endometrial",
"cancer",
".",
"However",
",",
"to",
"date",
",",
"only",
"the",
"largest",
"and",
"most",
"recent",
"prospective",
"cohort",
"study",
"has",
"reported",
"a",
"significantly",
"reduced",
"risk",
"in",
"both",
"current",
"and",
"past",
"smokers",
"-LSB-",
"29",
"-RSB-",
".",
"Moreover",
",",
"this",
"large",
"study",
"explored",
"the",
"relationship",
"between",
"HRT",
"and",
"smoking",
"and",
"found",
"no",
"effect-modification",
",",
"and",
"also",
"found",
"that",
"the",
"association",
"between",
"smoking",
"and",
"endometrial",
"cancer",
"was",
"not",
"confounded",
"by",
"alcohol",
"use",
"-LSB-",
"29",
"-RSB-",
".",
"The",
"evidence",
"from",
"other",
"epidemiological",
"studies",
"with",
"regard",
"to",
"an",
"effect-modification",
"by",
"use",
"of",
"HRT",
"is",
"ambiguous",
"-LSB-",
"24",
"-RSB-",
".",
"As",
"many",
"case",
"--",
"control",
"-LSB-",
"24",
"-RSB-",
",",
"but",
"only",
"a",
"few",
"cohort",
"studies",
"have",
"reported",
"on",
"the",
"association",
"between",
"smoking",
"and",
"endometrial",
"cancer",
"-LSB-",
"22",
",",
"25",
"--",
"29",
"-RSB-",
",",
"the",
"International",
"Agency",
"for",
"Research",
"on",
"Cancer",
"concludes",
"that",
"prospective",
"cohort",
"studies",
",",
"in",
"which",
"selection",
"and",
"recall",
"bias",
"are",
"minimized",
",",
"are",
"scarce",
"-LSB-",
"30",
"-RSB-",
".",
"Only",
"two",
"cohort",
"studies",
"have",
"explored",
"the",
"association",
"between",
"smoking",
"and",
"endometrial",
"cancer",
"comprehensively",
"by",
"examining",
"the",
"risk",
"associated",
"with",
"all",
"common",
"quantitative",
"smoking",
"measures",
"-LRB-",
"e.g.",
",",
"smoking",
"duration",
",",
"time",
"since",
"cessation",
"-RRB-",
"-LSB-",
"28",
",",
"29",
"-RSB-",
".",
"Since",
"only",
"few",
"prospective",
"cohort",
"studies",
"have",
"investigated",
"the",
"association",
"between",
"alcohol",
"consumption",
",",
"cigarette",
"smoking",
",",
"and",
"endometrial",
"cancer",
"comprehensively",
",",
"important",
"features",
"of",
"this",
"relationship",
"are",
"under-explored",
".",
"Hence",
",",
"we",
"aim",
"to",
"provide",
"additional",
"evidence",
"based",
"on",
"prospective",
"data",
".",
"Moreover",
",",
"we",
"intend",
"to",
"elucidate",
"the",
"hormonal",
"mechanisms",
"underlying",
"endometrial",
"carcinogenesis",
"by",
"investigating",
",",
"first",
",",
"whether",
"BMI",
"and",
"age",
"at",
"menopause",
"might",
"act",
"as",
"intermediary",
"variables",
"in",
"the",
"association",
"between",
"smoking",
"and",
"endometrial",
"cancer",
"and",
"by",
"examining",
",",
"second",
",",
"whether",
"there",
"is",
"evidence",
"regarding",
"a",
"potential",
"effect",
"modification",
"by",
"HRT",
"use",
".",
"Materials",
"and",
"methods",
"The",
"Netherlands",
"Cohort",
"Study",
"-LRB-",
"NLCS",
"-RRB-",
"started",
"in",
"September",
"1986",
"when",
"62,573",
"women",
"aged",
"55",
"--",
"69",
"years",
"were",
"enrolled",
"in",
"the",
"cohort",
".",
"Ethical",
"approval",
"was",
"obtained",
"from",
"the",
"ethics",
"committee",
"of",
"the",
"University",
"Hospital",
"Maastricht",
".",
"All",
"women",
"were",
"presumed",
"to",
"be",
"postmenopausal",
".",
"At",
"baseline",
",",
"data",
"on",
"dietary",
"habits",
"and",
"other",
"risk",
"factors",
"-LRB-",
"such",
"as",
"alcohol",
"consumption",
",",
"smoking",
"history",
",",
"reproductive",
"history",
",",
"and",
"anthropometry",
"-RRB-",
"were",
"collected",
"by",
"means",
"of",
"a",
"self-administered",
"questionnaire",
".",
"Data",
"analysis",
"was",
"conducted",
"according",
"to",
"the",
"case",
"--",
"cohort",
"approach",
".",
"In",
"this",
"approach",
",",
"cases",
"are",
"derived",
"from",
"the",
"cohort",
"-LRB-",
"providing",
"numerator",
"information",
"for",
"the",
"incidence",
"rates",
"-RRB-",
",",
"while",
"the",
"accumulated",
"person-years",
"at",
"risk",
"of",
"the",
"cohort",
"are",
"estimated",
"from",
"a",
"random",
"sample",
"from",
"the",
"cohort",
",",
"i.e.",
",",
"the",
"subcohort",
"-LRB-",
"providing",
"denominator",
"information",
"for",
"the",
"incidence",
"rates",
"-RRB-",
".",
"Following",
"this",
"approach",
",",
"a",
"subcohort",
"of",
"2,589",
"women",
"was",
"sampled",
"after",
"the",
"baseline",
"exposure",
"measurement",
".",
"The",
"subcohort",
"has",
"been",
"followed",
"up",
"biennially",
"by",
"mail",
"for",
"vital",
"status",
"information",
".",
"The",
"vital",
"status",
"of",
"subcohort",
"members",
",",
"who",
"did",
"not",
"respond",
"was",
"completed",
"by",
"contacting",
"the",
"municipal",
"population",
"registers",
".",
"Incident",
"cases",
"occurring",
"in",
"the",
"entire",
"cohort",
"were",
"detected",
"by",
"annual",
"record",
"linkages",
"to",
"the",
"Netherlands",
"Cancer",
"Registry",
"and",
"the",
"nationwide",
"network",
"and",
"registry",
"of",
"histopathology",
"and",
"cytopathology",
"in",
"the",
"Netherlands",
"-LRB-",
"PALGA",
"-RRB-",
".",
"Further",
"details",
"on",
"the",
"design",
"of",
"the",
"study",
"and",
"methods",
"of",
"follow-up",
"have",
"been",
"presented",
"elsewhere",
"-LSB-",
"31",
",",
"32",
"-RSB-",
".",
"The",
"present",
"analysis",
"is",
"restricted",
"to",
"cancer",
"incidence",
"in",
"the",
"11.3-year",
"follow-up",
"period",
"from",
"September",
"1986",
"to",
"December",
"1997",
".",
"The",
"completeness",
"of",
"cancer",
"follow",
"up",
"was",
"estimated",
"to",
"be",
"at",
"least",
"96",
"%",
"-LSB-",
"33",
"-RSB-",
",",
"and",
"no",
"subcohort",
"members",
"were",
"lost",
"to",
"follow",
"up",
".",
"Three",
"hundred",
"and",
"twenty-seven",
"incident",
",",
"microscopically",
"confirmed",
",",
"invasive",
",",
"primary",
"endometrial",
"carcinomas",
"were",
"detected",
"after",
"a",
"follow-up",
"period",
"of",
"11.3",
"years",
".",
"Cases",
"were",
"excluded",
"from",
"analysis",
"if",
"they",
"had",
"been",
"diagnosed",
"with",
"non-epithelial",
"tumors",
"-LRB-",
"n",
"=",
"12",
"-RRB-",
",",
"and",
"if",
"information",
"on",
"either",
"alcohol",
"consumption",
"or",
"cigarette",
"smoking",
"was",
"incomplete",
"-LRB-",
"n",
"=",
"35",
"-RRB-",
".",
"Women",
"were",
"eligible",
"for",
"the",
"subcohort",
"if",
"they",
"did",
"not",
"report",
"at",
"baseline",
"that",
"they",
"had",
"undergone",
"hysterectomy",
".",
"Application",
"of",
"this",
"inclusion",
"criterion",
"yielded",
"a",
"subcohort",
"of",
"2,229",
"members",
".",
"Individuals",
"were",
"excluded",
"from",
"the",
"analysis",
"if",
"they",
"had",
"been",
"diagnosed",
"with",
"cancer",
"other",
"than",
"skin",
"cancer",
"at",
"baseline",
"-LRB-",
"n",
"=",
"151",
"-RRB-",
"and",
"if",
"information",
"on",
"either",
"alcohol",
"consumption",
"or",
"cigarette",
"smoking",
"was",
"missing",
"-LRB-",
"n",
"=",
"177",
"-RRB-",
".",
"After",
"these",
"exclusions",
",",
"280",
"cases",
"and",
"1,901",
"subcohort",
"members",
"remained",
"available",
"for",
"analysis",
".",
"Questionnaire",
"data",
"Consumption",
"of",
"alcoholic",
"beverages",
"during",
"the",
"year",
"preceding",
"the",
"baseline",
"interview",
"was",
"assessed",
"by",
"consumption",
"frequency",
"questions",
"on",
"beer",
",",
"red",
"wine",
",",
"white",
"wine",
",",
"sherry",
",",
"other",
"fortified",
"wine",
",",
"liqueur",
",",
"and",
"liquor",
".",
"Categories",
"ranked",
"from",
"`",
"never",
"'",
"to",
"`",
"6",
"--",
"7",
"times",
"per",
"week",
"'",
"and",
"information",
"on",
"the",
"number",
"of",
"glasses",
"per",
"consumption",
"day",
"was",
"also",
"requested",
".",
"Questionnaire",
"data",
"of",
"all",
"cases",
"and",
"subcohort",
"members",
"were",
"key",
"entered",
"twice",
"and",
"processed",
"in",
"a",
"manner",
"blinded",
"with",
"regard",
"to",
"case/subcohort",
"status",
"in",
"order",
"to",
"minimize",
"observer",
"bias",
"in",
"the",
"coding",
"and",
"interpretation",
"of",
"data",
".",
"The",
"questionnaire",
"has",
"been",
"validated",
"against",
"a",
"nine-day",
"diet",
"record",
"-LSB-",
"34",
",",
"35",
"-RSB-",
".",
"The",
"Pearson",
"correlation",
"coefficient",
"between",
"the",
"mean",
"daily",
"ethanol",
"intake",
"assessed",
"by",
"the",
"questionnaire",
"and",
"that",
"estimated",
"by",
"the",
"nine-day",
"record",
"was",
"0.86",
"for",
"all",
"subjects",
"and",
"0.78",
"for",
"users",
"of",
"alcoholic",
"beverages",
"-LSB-",
"34",
"-RSB-",
".",
"Respondents",
"that",
"reported",
"to",
"drink",
"alcohol",
"less",
"than",
"once",
"per",
"month",
"were",
"considered",
"non-drinkers",
".",
"Four",
"items",
"from",
"the",
"questionnaire",
"-LRB-",
"red",
"wine",
",",
"white",
"wine",
",",
"sherry",
",",
"and",
"liqueur",
"-RRB-",
"were",
"combined",
"into",
"one",
"single",
"wine",
"variable",
"since",
"these",
"items",
"were",
"highly",
"correlated",
"and",
"separate",
"analysis",
"would",
"have",
"resulted",
"in",
"small",
"numbers",
"of",
"subjects",
"within",
"each",
"stratum",
".",
"Mean",
"daily",
"alcohol",
"consumption",
"was",
"calculated",
"using",
"the",
"Dutch",
"food",
"composition",
"table",
"-LSB-",
"36",
"-RSB-",
".",
"Based",
"on",
"data",
"from",
"a",
"pilot",
"study",
",",
"standard",
"glasses",
"were",
"defined",
"as",
"follows",
":",
"200",
"ml",
"for",
"beer",
",",
"105",
"ml",
"for",
"wine",
",",
"80",
"ml",
"for",
"sherry",
",",
"and",
"45",
"ml",
"for",
"both",
"liqueur",
"and",
"liquor",
",",
"corresponding",
"to",
"8",
"g",
",",
"10",
"g",
",",
"11",
"g",
",",
"7",
"g",
",",
"and",
"13",
"g",
"of",
"alcohol",
",",
"respectively",
".",
"Smoking",
"was",
"addressed",
"at",
"baseline",
"by",
"questions",
"on",
"age",
"at",
"first",
"exposure",
"to",
"smoking",
",",
"age",
"at",
"last",
"exposure",
"to",
"smoking",
",",
"smoking",
"frequency",
",",
"and",
"smoking",
"duration",
"of",
"cigarette",
",",
"cigar",
",",
"and",
"pipe",
"smokers",
".",
"As",
"the",
"vast",
"majority",
"of",
"smoking",
"subcohort",
"members",
"was",
"cigarette",
"smokers",
",",
"analyses",
"were",
"restricted",
"to",
"that",
"particular",
"group",
".",
"Based",
"on",
"the",
"questionnaire",
"data",
",",
"the",
"following",
"cigarette",
"smoking",
"variables",
"were",
"constructed",
":",
"cigarette",
"smoking",
"status",
"-LRB-",
"never",
"versus",
"ever",
"and",
"never",
"versus",
"former",
"or",
"current",
"-RRB-",
",",
"frequency",
"-LRB-",
"number",
"of",
"cigarettes",
"per",
"day",
"-RRB-",
",",
"duration",
"-LRB-",
"years",
"-RRB-",
",",
"age",
"at",
"first",
"exposure",
"-LRB-",
"years",
"-RRB-",
",",
"and",
"time",
"since",
"cessation",
"-LRB-",
"years",
"-RRB-",
".",
"Time",
"since",
"cessation",
"was",
"calculated",
"as",
"`",
"age",
"at",
"baseline",
"'",
"minus",
"`",
"age",
"at",
"smoking",
"cessation",
"'",
".",
"Concerning",
"the",
"use",
"of",
"HRT",
",",
"women",
"were",
"asked",
"whether",
"they",
"had",
"ever",
"used",
"HRT",
"because",
"of",
"complaints",
"related",
"to",
"the",
"menopause",
".",
"We",
"can",
"assume",
"that",
"all",
"members",
"of",
"our",
"cohort",
"were",
"postmenopausal",
"in",
"1986",
",",
"when",
"the",
"baseline",
"questionnaires",
"were",
"completed",
",",
"and",
"that",
"possible",
"treatment",
"with",
"HRT",
"took",
"place",
"prior",
"to",
"1986",
"in",
"most",
"women",
".",
"Based",
"on",
"information",
"regarding",
"HRT",
"prescription",
"in",
"the",
"Netherlands",
"in",
"the",
"past",
"-LSB-",
"37",
"--",
"39",
"-RSB-",
",",
"we",
"assume",
"that",
"all",
"HRT",
"users",
"enrolled",
"in",
"the",
"NLCS",
"were",
"treated",
"with",
"unopposed",
"oral",
"estrogens",
".",
"Data",
"analysis",
"A",
"variable",
"was",
"considered",
"a",
"confounder",
"if",
"-LRB-",
"I",
"-RRB-",
"it",
"was",
"associated",
"with",
"endometrial",
"cancer",
"risk",
",",
"if",
"-LRB-",
"II",
"-RRB-",
"it",
"was",
"associated",
"with",
"alcohol",
"consumption",
"or",
"cigarette",
"smoking",
",",
"and",
"if",
"-LRB-",
"III",
"-RRB-",
"age-adjusted",
"hazard",
"ratios",
"changed",
"by",
"more",
"than",
"10",
"%",
"after",
"adjustment",
"for",
"the",
"potentially",
"confounding",
"factor",
".",
"Based",
"on",
"the",
"literature",
"-LSB-",
"40",
"-RSB-",
"and",
"previous",
"analyses",
",",
"we",
"considered",
"the",
"following",
"variables",
"as",
"potential",
"confounders",
":",
"age",
"-LRB-",
"continuous",
"-RRB-",
",",
"age",
"at",
"menarche",
"-LRB-",
"continuous",
"-RRB-",
",",
"use",
"of",
"oral",
"contraceptives",
"-LRB-",
"ever",
"versus",
"never",
"-RRB-",
",",
"duration",
"of",
"oral",
"contraceptive",
"use",
"-LRB-",
"continuous",
"-RRB-",
",",
"age",
"at",
"first",
"child",
"birth",
"-LRB-",
"continuous",
"-RRB-",
",",
"parity",
"-LRB-",
"continuous",
"-RRB-",
",",
"age",
"at",
"menopause",
"-LRB-",
"continuous",
"-RRB-",
",",
"use",
"of",
"postmenopausal",
"hormones",
"-LRB-",
"ever",
"versus",
"never",
"-RRB-",
",",
"duration",
"of",
"postmenopausal",
"hormone",
"use",
"-LRB-",
"continuous",
"-RRB-",
",",
"non-occupational",
"physical",
"activity",
"-LRB-",
"categorized",
"-RRB-",
",",
"BMI",
"-LRB-",
"continuous",
"-RRB-",
",",
"height",
"-LRB-",
"continuous",
"-RRB-",
",",
"energy",
"intake",
"-LRB-",
"continuous",
"-RRB-",
",",
"total",
"fat",
"intake",
"-LRB-",
"continuous",
"-RRB-",
",",
"intake",
"of",
"saturated",
"fat",
"-LRB-",
"continuous",
"-RRB-",
",",
"intake",
"of",
"carbohydrates",
"-LRB-",
"continuous",
"-RRB-",
",",
"intake",
"of",
"dietary",
"fiber",
"-LRB-",
"continuous",
"-RRB-",
",",
"intake",
"of",
"vegetables",
"-LRB-",
"continuous",
"-RRB-",
",",
"intake",
"of",
"fruits",
"-LRB-",
"continuous",
"-RRB-",
",",
"coffee",
"consumption",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
",",
"education",
"-LRB-",
"categorized",
"-RRB-",
",",
"diagnosis",
"of",
"hypertension",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
",",
"diagnosis",
"of",
"diabetes",
"mellitus",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
",",
"family",
"history",
"of",
"endometrial",
"cancer",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
",",
"and",
"if",
"applicable",
":",
"total",
"alcohol",
"consumption",
"per",
"day",
"-LRB-",
"continuous",
"-RRB-",
",",
"type",
"of",
"alcoholic",
"beverage",
"-LRB-",
"categorized",
"-RRB-",
",",
"current",
"smoking",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
",",
"number",
"of",
"cigarettes",
"smoked",
"per",
"day",
"-LRB-",
"continuous",
"-RRB-",
",",
"and",
"duration",
"of",
"smoking",
"-LRB-",
"continuous",
"-RRB-",
".",
"Incidence",
"rate",
"ratios",
"-LRB-",
"RR",
"-RRB-",
"and",
"corresponding",
"95",
"percent",
"confidence",
"intervals",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"for",
"endometrial",
"cancer",
"were",
"estimated",
"in",
"the",
"age-adjusted",
"and",
"multivariate",
"case",
"--",
"cohort",
"analyses",
"with",
"categorized",
"and",
"continuous",
"alcohol",
"and",
"cigarette",
"smoking",
"variables",
",",
"using",
"the",
"Cox",
"proportional",
"hazards",
"model",
"-LSB-",
"41",
"-RSB-",
"processed",
"with",
"the",
"Stata",
"statistical",
"software",
"package",
"-LSB-",
"42",
"-RSB-",
".",
"Standard",
"errors",
"were",
"estimated",
"using",
"the",
"robust",
"Hubert",
"--",
"White",
"sandwich",
"estimator",
"to",
"account",
"for",
"additional",
"variance",
"introduced",
"by",
"sampling",
"from",
"the",
"cohort",
".",
"This",
"method",
"is",
"equivalent",
"to",
"the",
"variance",
"--",
"covariance",
"estimator",
"by",
"Barlow",
"-LSB-",
"43",
"-RSB-",
".",
"The",
"proportional",
"hazards",
"assumption",
"was",
"tested",
"using",
"the",
"scaled",
"Schoenfeld",
"residuals",
"-LSB-",
"44",
"-RSB-",
".",
"Tests",
"for",
"dose-response",
"trends",
"in",
"risk",
"of",
"endometrial",
"cancer",
"were",
"assessed",
"by",
"fitting",
"ordinal",
"exposure",
"variables",
"as",
"continuous",
"terms",
".",
"Tests",
"for",
"interaction",
"were",
"performed",
"by",
"using",
"the",
"Wald",
"test",
".",
"Two-sided",
"p",
"values",
"are",
"reported",
"throughout",
"the",
"paper",
".",
"Results",
"The",
"percentage",
"of",
"women",
"reporting",
"alcohol",
"consumption",
"was",
"similar",
"among",
"cases",
"and",
"subcohort",
"members",
"-LRB-",
"67.5",
"%",
"and",
"66.9",
"%",
",",
"respectively",
"-RRB-",
",",
"as",
"was",
"the",
"mean",
"alcohol",
"consumption",
"per",
"day",
"among",
"users",
"in",
"both",
"groups",
"-LRB-",
"7.7",
"g",
"with",
"standard",
"deviation",
"-LRB-",
"sd",
"-RRB-",
"=",
"10.8",
",",
"and",
"8.5",
"g",
"-LRB-",
"sd",
"=",
"10.4",
"-RRB-",
",",
"respectively",
"-RRB-",
".",
"Current",
"smoking",
"was",
"less",
"prevalent",
"among",
"cases",
"than",
"among",
"subcohort",
"members",
"-LRB-",
"15.4",
"%",
"vs.",
"21.8",
"%",
"-RRB-",
",",
"but",
"the",
"number",
"of",
"cigarettes",
"smoked",
"per",
"day",
"did",
"not",
"differ",
"considerably",
"between",
"smokers",
"in",
"both",
"groups",
"-LRB-",
"13.6",
"-LRB-",
"sd",
"=",
"8.4",
"-RRB-",
"and",
"13.2",
"-LRB-",
"sd",
"=",
"8.1",
"-RRB-",
",",
"respectively",
"-RRB-",
".",
"Drinkers",
"reported",
"a",
"slightly",
"higher",
"age",
"at",
"menopause",
"and",
"a",
"higher",
"prevalence",
"of",
"both",
"oral",
"contraceptive",
"use",
"and",
"current",
"cigarette",
"smoking",
"than",
"non-drinkers",
"-LRB-",
"see",
"Table",
"1",
"-RRB-",
".",
"With",
"regard",
"to",
"smoking",
"status",
",",
"former",
"and",
"current",
"smokers",
"were",
"slightly",
"leaner",
"and",
"had",
"fewer",
"children",
"than",
"never-smokers",
".",
"On",
"average",
",",
"current",
"smokers",
"reported",
"having",
"reached",
"menopause",
"1",
"year",
"earlier",
"than",
"former-smokers",
"and",
"never-smokers",
".",
"The",
"prevalence",
"of",
"both",
"oral",
"contraceptive",
"use",
"and",
"alcohol",
"use",
"was",
"higher",
"among",
"smokers",
"than",
"among",
"never-smokers",
".",
"Also",
",",
"average",
"alcohol",
"consumption",
"was",
"approximately",
"twice",
"as",
"high",
"among",
"smokers",
"as",
"among",
"never-smokers",
"-LRB-",
"see",
"Table",
"1",
"-RRB-",
".",
"Table",
"1Means",
"-LRB-",
"standard",
"deviation",
"-RRB-",
"and",
"distribution",
"-LRB-",
"n",
"-RRB-",
"of",
"potential",
"confounders",
"according",
"to",
"alcohol",
"consumption",
"and",
"cigarette",
"smoking",
"status",
"among",
"subcohort",
"members",
",",
"the",
"Netherlands",
"Cohort",
"Study",
"-LRB-",
"1986",
"--",
"1995",
"-RRB-",
"CharacteristicUnitAlcohol",
"consumption",
"statusCigarette",
"smoking",
"statusNo",
"-LRB-",
"n",
"=",
"630",
"-RRB-",
"Yes",
"-LRB-",
"n",
"=",
"1,271",
"-RRB-",
"Never",
"-LRB-",
"n",
"=",
"1,100",
"-RRB-",
"Former",
"-LRB-",
"n",
"=",
"387",
"-RRB-",
"Current",
"-LRB-",
"n",
"=",
"414",
"-RRB-",
"Mean",
"-LRB-",
"sd",
"-RRB-",
"Mean",
"-LRB-",
"sd",
"-RRB-",
"Mean",
"-LRB-",
"sd",
"-RRB-",
"Mean",
"-LRB-",
"sd",
"-RRB-",
"Mean",
"-LRB-",
"sd",
"-RRB-",
"AgeYears61",
".8",
"-LRB-",
"4.3",
"-RRB-",
"61.4",
"-LRB-",
"4.3",
"-RRB-",
"62.0",
"-LRB-",
"4.3",
"-RRB-",
"61.1",
"-LRB-",
"4.4",
"-RRB-",
"60.7",
"-LRB-",
"4.1",
"-RRB-",
"Body",
"Mass",
"Indexkg/m225",
".4",
"-LRB-",
"3.9",
"-RRB-",
"24.9",
"-LRB-",
"3.4",
"-RRB-",
"25.3",
"-LRB-",
"3.5",
"-RRB-",
"24.7",
"-LRB-",
"3.3",
"-RRB-",
"24.6",
"-LRB-",
"3.8",
"-RRB-",
"ParityNumber",
"of",
"children2",
".8",
"-LRB-",
"2.4",
"-RRB-",
"2.7",
"-LRB-",
"2.2",
"-RRB-",
"3.0",
"-LRB-",
"2.4",
"-RRB-",
"2.5",
"-LRB-",
"1.8",
"-RRB-",
"2.5",
"-LRB-",
"2.1",
"-RRB-",
"Age",
"at",
"1st",
"child",
"birthYears22",
".0",
"-LRB-",
"11.2",
"-RRB-",
"21.9",
"-LRB-",
"11.3",
"-RRB-",
"22.2",
"-LRB-",
"11.2",
"-RRB-",
"22.3",
"-LRB-",
"11.3",
"-RRB-",
"20.8",
"-LRB-",
"11.3",
"-RRB-",
"Age",
"at",
"menopauseYears48",
".3",
"-LRB-",
"4.8",
"-RRB-",
"49.2",
"-LRB-",
"4.3",
"-RRB-",
"49.1",
"-LRB-",
"4.4",
"-RRB-",
"49.2",
"-LRB-",
"4.1",
"-RRB-",
"48.1",
"-LRB-",
"4.8",
"-RRB-",
"Total",
"energy",
"intake",
"-LRB-",
"including",
"alcohol",
"-RRB-",
"kcal1",
",628",
"-LRB-",
"415",
"-RRB-",
"1,724",
"-LRB-",
"386",
"-RRB-",
"1,694",
"-LRB-",
"393",
"-RRB-",
"1,676",
"-LRB-",
"406",
"-RRB-",
"1,705",
"-LRB-",
"406",
"-RRB-",
"Alcohol",
"consumption",
"G/day0",
"-LRB-",
"0",
"-RRB-",
"8.5",
"-LRB-",
"10.4",
"-RRB-",
"5.7",
"-LRB-",
"7.8",
"-RRB-",
"10.4",
"-LRB-",
"11.2",
"-RRB-",
"12.5",
"-LRB-",
"12.8",
"-RRB-",
"CigarettesNo",
".",
"/",
"day13",
".0",
"-LRB-",
"8.8",
"-RRB-",
"11.1",
"-LRB-",
"8.1",
"-RRB-",
"0",
"-LRB-",
"0",
"-RRB-",
"9.8",
"-LRB-",
"8.0",
"-RRB-",
"13.2",
"-LRB-",
"8.1",
"-RRB-",
"n",
"-LRB-",
"%",
"-RRB-",
"an",
"-LRB-",
"%",
"-RRB-",
"an",
"-LRB-",
"%",
"-RRB-",
"an",
"-LRB-",
"%",
"-RRB-",
"an",
"-LRB-",
"%",
"-RRB-",
"aOral",
"contraceptive",
"useEver124",
"-LRB-",
"20.0",
"-RRB-",
"336",
"-LRB-",
"26.7",
"-RRB-",
"223",
"-LRB-",
"20.6",
"-RRB-",
"127",
"-LRB-",
"32.9",
"-RRB-",
"110",
"-LRB-",
"26.8",
"-RRB-",
"Physical",
"activity",
">",
"30",
"min/day425",
"-LRB-",
"69.1",
"-RRB-",
"975",
"-LRB-",
"77.8",
"-RRB-",
"796",
"-LRB-",
"74.1",
"-RRB-",
"306",
"-LRB-",
"79.5",
"-RRB-",
"298",
"-LRB-",
"72.9",
"-RRB-",
"Diagnosis",
"of",
"hypertensionYes198",
"-LRB-",
"31.4",
"-RRB-",
"351",
"-LRB-",
"27.6",
"-RRB-",
"339",
"-LRB-",
"30.8",
"-RRB-",
"107",
"-LRB-",
"27.7",
"-RRB-",
"103",
"-LRB-",
"24.9",
"-RRB-",
"Diagnosis",
"of",
"diabetesYes33",
"-LRB-",
"5.2",
"-RRB-",
"40",
"-LRB-",
"3.2",
"-RRB-",
"48",
"-LRB-",
"4.4",
"-RRB-",
"13",
"-LRB-",
"3.4",
"-RRB-",
"12",
"-LRB-",
"2.9",
"-RRB-",
"Hormone",
"replacement",
"therapyEver62",
"-LRB-",
"10.0",
"-RRB-",
"152",
"-LRB-",
"12.1",
"-RRB-",
"107",
"-LRB-",
"9.9",
"-RRB-",
"58",
"-LRB-",
"15.1",
"-RRB-",
"49",
"-LRB-",
"12.0",
"-RRB-",
"Family",
"history",
"of",
"endometrial",
"cancerYes20",
"-LRB-",
"3.2",
"-RRB-",
"32",
"-LRB-",
"2.5",
"-RRB-",
"23",
"-LRB-",
"2.1",
"-RRB-",
"16",
"-LRB-",
"4.1",
"-RRB-",
"13",
"-LRB-",
"3.1",
"-RRB-",
"Alcohol",
"usersYes",
"--",
"--",
"663",
"-LRB-",
"60.3",
"-RRB-",
"312",
"-LRB-",
"80.6",
"-RRB-",
"296",
"-LRB-",
"71.5",
"-RRB-",
"Currently",
"smoking",
"cigarettesYes118",
"-LRB-",
"18.7",
"-RRB-",
"296",
"-LRB-",
"23.3",
"-RRB-",
"--",
"--",
"--",
"a",
"The",
"percentage",
"reported",
"for",
"some",
"variables",
"does",
"sometimes",
"not",
"correspond",
"with",
"the",
"numbers",
"per",
"smoker",
"stratum",
"since",
"part",
"of",
"the",
"information",
"for",
"these",
"variables",
"was",
"missing",
"Based",
"on",
"the",
"literature",
"and",
"based",
"on",
"the",
"methodological",
"criteria",
"specified",
"above",
",",
"we",
"found",
"the",
"following",
"confounders",
":",
"age",
",",
"BMI",
",",
"parity",
",",
"oral",
"contraceptive",
"use",
",",
"non-occupational",
"physical",
"activity",
",",
"hypertension",
",",
"age",
"at",
"first",
"child",
"birth",
",",
"and",
"age",
"at",
"menopause",
".",
"Alcohol",
"consumption",
"and",
"cigarette",
"smoking",
"status",
"were",
"found",
"to",
"confound",
"each",
"other",
"'s",
"association",
"with",
"endometrial",
"cancer",
".",
"We",
"controlled",
"for",
"all",
"these",
"confounders",
"in",
"multivariate",
"analyses",
".",
"In",
"additional",
"analyses",
",",
"we",
"mutually",
"controlled",
"the",
"age-adjusted",
"risk",
"estimates",
"regarding",
"qualitative",
"smoking",
"measures",
"for",
"the",
"other",
"smoking",
"measures",
".",
"The",
"multivariate",
"risk",
"estimates",
"did",
"not",
"change",
"substantially",
"when",
"oral",
"contraceptive",
"use",
"-LRB-",
"ever/never",
"-RRB-",
"was",
"replaced",
"by",
"duration",
"of",
"oral",
"contraceptive",
"use",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Accordingly",
",",
"we",
"considered",
"it",
"sufficient",
"to",
"control",
"only",
"for",
"oral",
"contraceptive",
"use",
"-LRB-",
"ever/never",
"-RRB-",
".",
"Table",
"2",
"shows",
"the",
"results",
"for",
"the",
"association",
"between",
"alcohol",
"consumption",
"and",
"endometrial",
"cancer",
".",
"The",
"multivariate",
"adjusted",
"RR",
"associated",
"with",
"alcohol",
"consumption",
"was",
"1.06",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.78",
"--",
"1.43",
"-RRB-",
".",
"The",
"multivariate",
"RRs",
"of",
"endometrial",
"cancer",
"for",
"women",
"who",
"consumed",
"up",
"to",
"4",
",",
"5",
"--",
"14",
",",
"15",
"--",
"29",
",",
"and",
"30",
"or",
"more",
"gram",
"of",
"alcohol",
"per",
"day",
"versus",
"non-drinkers",
"were",
"1.09",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.78",
"--",
"1.52",
"-RRB-",
",",
"0.95",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.62",
"--",
"1.45",
"-RRB-",
",",
"0.94",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.52",
"--",
"1.69",
"-RRB-",
",",
"and",
"1.78",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.88",
"--",
"3.60",
"-RRB-",
",",
"respectively",
".",
"No",
"significant",
"trend",
"was",
"observed",
"-LRB-",
"ptrend",
"=",
"0.62",
"-RRB-",
".",
"Table",
"2Rate",
"ratios",
"of",
"endometrial",
"cancer",
"according",
"to",
"baseline",
"alcohol",
"consumption",
"in",
"the",
"Netherlands",
"Cohort",
"Study",
",",
"1986",
"--",
"1997Alcohol",
"consumption",
"-LRB-",
"g",
"/",
"day",
"-RRB-",
"Age",
"adjustedMultivariate",
"adjustedCategorical",
"medianCasesPerson-years",
"in",
"subcohortRR",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"aCasesPerson-years",
"in",
"subcohortRR",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"bTotal",
"alcohol",
"No0916",
",6411",
"-LRB-",
"ref",
".",
"-RRB-",
"825,8371",
"-LRB-",
"ref",
".",
"-RRB-",
"Yes4",
".018913,7461.01",
"-LRB-",
"0.77",
"--",
"1.32",
"-RRB-",
"17212,1371.06",
"-LRB-",
"0.78",
"--",
"1.43",
"-RRB-",
"0.1",
"--",
"41.61147,5991.10",
"-LRB-",
"0.82",
"--",
"1.48",
"-RRB-",
"1056,6431.09",
"-LRB-",
"0.78",
"--",
"1.52",
"-RRB-",
"5",
"--",
"149.1473,6400.94",
"-LRB-",
"0.65",
"--",
"1.37",
"-RRB-",
"393,2790.95",
"-LRB-",
"0.62",
"--",
"1.45",
"-RRB-",
"15",
"--",
"2920.9171,8220.69",
"-LRB-",
"0.40",
"--",
"1.18",
"-RRB-",
"171,5750.94",
"-LRB-",
"0.52",
"--",
"1.69",
"-RRB-",
"≥",
"3037.3116841.20",
"-LRB-",
"0.62",
"--",
"2.34",
"-RRB-",
"116391.78",
"-LRB-",
"0.88",
"--",
"3.60",
"-RRB-",
"p",
"trend0",
".490.62",
"Alcohol",
"from",
"wine",
"Yes3",
".218213,0091.06",
"-LRB-",
"0.81",
"--",
"1.37",
"-RRB-",
"16611,5071.13",
"-LRB-",
"0.84",
"--",
"1.52",
"-RRB-",
"0.1",
"--",
"41.51258,0721.17",
"-LRB-",
"0.88",
"--",
"1.55",
"-RRB-",
"1127,1131.16",
"-LRB-",
"0.84",
"--",
"1.59",
"-RRB-",
"5",
"--",
"148.9383,1460.91",
"-LRB-",
"0.61",
"--",
"1.36",
"-RRB-",
"352,7841.07",
"-LRB-",
"0.68",
"--",
"1.67",
"-RRB-",
"≥",
"1521.8191,7910.80",
"-LRB-",
"0.48",
"--",
"1.35",
"-RRB-",
"191,6111.11",
"-LRB-",
"0.64",
"--",
"1.93",
"-RRB-",
"p",
"trend0",
".430.64",
"Alcohol",
"from",
"beer",
"Yes1",
".14291,8731.15",
"-LRB-",
"0.76",
"--",
"1.74",
"-RRB-",
"261,6291.30",
"-LRB-",
"0.82",
"--",
"2.07",
"-RRB-",
"Alcohol",
"from",
"liquor",
"Yes3",
".7342,6480.93",
"-LRB-",
"0.64",
"--",
"1.37",
"-RRB-",
"312,3491.11",
"-LRB-",
"0.73",
"--",
"1.68",
"-RRB-",
"aRR",
"=",
"rate",
"ratios",
";",
"CI",
"=",
"confidence",
"interval",
";",
"n.a.",
"=",
"not",
"applicablebRate",
"ratios",
"adjusted",
"for",
"age",
"-LRB-",
"years",
"-RRB-",
",",
"body",
"mass",
"index",
"-LRB-",
"kg/m2",
"-RRB-",
",",
"parity",
"-LRB-",
"number",
"of",
"children",
"-RRB-",
",",
"use",
"of",
"oral",
"contraceptives",
"-LRB-",
"ever",
"versus",
"never",
"-RRB-",
",",
"non-occupational",
"physical",
"activity",
"-LRB-",
"low",
",",
"moderate",
",",
"active",
",",
"very",
"active",
"-RRB-",
",",
"hypertension",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
",",
"age",
"at",
"first",
"child",
"birth",
"-LRB-",
"years",
"-RRB-",
",",
"age",
"at",
"menopause",
"-LRB-",
"years",
"-RRB-",
",",
"and",
"current",
"cigarette",
"smoking",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
"The",
"multivariate",
"RR",
"of",
"endometrial",
"cancer",
"for",
"wine-consumers",
"versus",
"non-consumers",
"was",
"slightly",
",",
"but",
"non-significantly",
",",
"elevated",
"-LRB-",
"RR",
"=",
"1.13",
",",
"95",
"%",
"CI",
"=",
"0.84",
"--",
"1.52",
"-RRB-",
".",
"The",
"RRs",
"were",
"also",
"slightly",
",",
"but",
"non-significantly",
"elevated",
"when",
"calculated",
"according",
"to",
"different",
"levels",
"of",
"wine",
"consumption",
"and",
"no",
"significant",
"trend",
"was",
"observed",
"-LRB-",
"ptrend",
"=",
"0.64",
"-RRB-",
".",
"The",
"multivariate",
"RR",
"of",
"endometrial",
"cancer",
"associated",
"with",
"drinking",
"beer",
"equaled",
"1.30",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.82",
"--",
"2.07",
"-RRB-",
"and",
"the",
"RR",
"for",
"drinking",
"liquor",
"was",
"1.11",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.73",
"--",
"1.68",
"-RRB-",
".",
"Regarding",
"smoking",
",",
"age-adjusted",
"analysis",
"revealed",
"an",
"inverse",
"association",
"between",
"ever-smoking",
"and",
"endometrial",
"cancer",
"risk",
"-LRB-",
"RR",
"=",
"0.70",
",",
"95",
"%",
"CI",
"=",
"0.54",
"--",
"0.92",
",",
"see",
"Table",
"3",
"-RRB-",
".",
"We",
"observed",
"significant",
"inverse",
"trends",
"of",
"endometrial",
"cancer",
"risk",
"with",
"all",
"quantitative",
"smoking",
"measures",
".",
"However",
",",
"these",
"trends",
"became",
"non-significant",
"when",
"never-smokers",
"were",
"excluded",
".",
"Some",
"of",
"these",
"age-adjusted",
"risk",
"estimates",
"changed",
"substantially",
"after",
"additional",
"adjustment",
"for",
"current",
"smoking",
"status",
",",
"smoking",
"frequency",
"and",
"smoking",
"duration",
"-LRB-",
"see",
"Table",
"3",
"-RRB-",
".",
"Table",
"3Rate",
"ratios",
"of",
"endometrial",
"cancer",
"according",
"to",
"baseline",
"cigarette",
"smoking",
"features",
"in",
"the",
"Netherlands",
"Cohort",
"Study",
",",
"1986",
"--",
"1997Cigarette",
"smoking",
"featuresCategorical",
"medianAdjusted",
"for",
"ageAdjusted",
"for",
"age",
",",
"current",
"smoking",
"status",
",",
"frequency",
"and",
"duration",
"of",
"smokingAdjusted",
"for",
"all",
"confoundersCasesPerson-years",
"in",
"subcohortRR",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"aCasesPerson-years",
"in",
"subcohortRR",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"bCasesPerson-years",
"in",
"subcohortRR",
"-LRB-",
"95",
"%",
"CI",
"-RRB-",
"cSmoking",
"status",
"Neverdn.a",
".18711,8721",
"-LRB-",
"ref",
".",
"-RRB-",
"--",
"--",
"--",
"16910,3301",
"-LRB-",
"ref",
".",
"-RRB-",
"Ever",
"smokers938",
",5160.70",
"-LRB-",
"0.54",
"--",
"0.92",
"-RRB-",
"--",
"--",
"--",
"857,6440.71",
"-LRB-",
"0.53",
"--",
"0.95",
"-RRB-",
"Neverd18711",
",8721",
"-LRB-",
"ref",
".",
"-RRB-",
"--",
"--",
"--",
"16910,3301",
"-LRB-",
"ref",
".",
"-RRB-",
"Former",
"smokersn.a504",
",1810.77",
"-LRB-",
"0.55",
"--",
"1.07",
"-RRB-",
"--",
"--",
"--",
"473,7570.83",
"-LRB-",
"0.58",
"--",
"1.20",
"-RRB-",
"Current",
"smokersn.a434",
",3340.64",
"-LRB-",
"0.45",
"--",
"0.91",
"-RRB-",
"--",
"--",
"--",
"383,8880.59",
"-LRB-",
"0.40",
"--",
"0.88",
"-RRB-",
"p",
"trend0",
".010.01",
"Frequency",
"-LRB-",
"cigarettes/day",
"-RRB-",
"Neverd018711",
",8721",
"-LRB-",
"ref",
".",
"-RRB-",
"18711,8721",
"-LRB-",
"ref",
".",
"-RRB-",
"16910,3301",
"-LRB-",
"ref",
".",
"-RRB-",
"0.1",
"--",
"9",
"4383,7190.65",
"-LRB-",
"0.45",
"--",
"0.95",
"-RRB-",
"373,5690.86",
"-LRB-",
"0.49",
"--",
"1.50",
"-RRB-",
"333,2231.07",
"-LRB-",
"0.58",
"--",
"1.98",
"-RRB-",
"10",
"--",
"19",
"12282,4380.74",
"-LRB-",
"0.48",
"--",
"1.14",
"-RRB-",
"272,4151.02",
"-LRB-",
"0.54",
"--",
"1.92",
"-RRB-",
"252,2141.28",
"-LRB-",
"0.66",
"--",
"2.46",
"-RRB-",
"20",
"+20222,0140.70",
"-LRB-",
"0.44",
"--",
"1.12",
"-RRB-",
"222,0141.03",
"-LRB-",
"0.46",
"--",
"2.29",
"-RRB-",
"211,7981.31",
"-LRB-",
"0.56",
"--",
"3.03",
"-RRB-",
"p",
"trend0",
".040.750.43",
"Duration",
"-LRB-",
"years",
"-RRB-",
"Neverd018711",
",8721",
"-LRB-",
"ref",
".",
"-RRB-",
"18711,8721",
"-LRB-",
"ref",
".",
"-RRB-",
"16910,3301.0",
"-LRB-",
"ref",
".",
"-RRB-",
"0.1",
"--",
"19",
"10.5232,0090.74",
"-LRB-",
"0.47",
"--",
"1.17",
"-RRB-",
"221,9910.71",
"-LRB-",
"0.42",
"--",
"1.18",
"-RRB-",
"211,8480.77",
"-LRB-",
"0.43",
"--",
"1.39",
"-RRB-",
"20",
"--",
"3930524,2740.79",
"-LRB-",
"0.57",
"--",
"1.10",
"-RRB-",
"514,1200.80",
"-LRB-",
"0.47",
"--",
"1.34",
"-RRB-",
"473,6900.89",
"-LRB-",
"0.51",
"--",
"1.56",
"-RRB-",
"40",
"+411319700.42",
"-LRB-",
"0.23",
"--",
"0.75131,8870.44",
"-LRB-",
"0.19",
"--",
"1.02",
"-RRB-",
"111,6970.37",
"-LRB-",
"0.15",
"--",
"0.90",
"-RRB-",
"p",
"trend0",
".000.100.13",
"Age",
"at",
"first",
"exposure",
"-LRB-",
"years",
"-RRB-",
"Neverdn.a18711",
",8721",
"-LRB-",
"ref",
".",
"-RRB-",
"18711,8721",
"-LRB-",
"ref",
".",
"-RRB-",
"16910,3301",
"-LRB-",
"ref",
".",
"-RRB-",
"<",
"1917343,0980.71",
"-LRB-",
"0.48",
"--",
"1.05",
"-RRB-",
"322,9470.78",
"-LRB-",
"0.34",
"--",
"1.80",
"-RRB-",
"282,7240.91",
"-LRB-",
"0.37",
"--",
"2.23",
"-RRB-",
"19",
"--",
"2420212,5240.53",
"-LRB-",
"0.33",
"--",
"0.86",
"-RRB-",
"202,3710.60",
"-LRB-",
"0.29",
"--",
"1.27",
"-RRB-",
"202,1020.88",
"-LRB-",
"0.38",
"--",
"2.02",
"-RRB-",
"25",
"+30312,6910.73",
"-LRB-",
"0.49",
"--",
"1.09",
"-RRB-",
"312,5960.82",
"-LRB-",
"0.47",
"--",
"1.46",
"-RRB-",
"282,3251.00",
"-LRB-",
"0.53",
"--",
"1.87",
"-RRB-",
"p",
"trend0",
".010.470.94",
"Time",
"since",
"cessation",
"-LRB-",
"years",
"-RRB-",
"Neverdn.a18711",
",8721",
"-LRB-",
"ref",
".",
"-RRB-",
"18711,8721",
"-LRB-",
"ref",
".",
"-RRB-",
"16910,3301",
"-LRB-",
"ref",
".",
"-RRB-",
"20",
"+",
"e26",
".5201,1421.11",
"-LRB-",
"0.68",
"--",
"1.84",
"-RRB-",
"171,0410.80",
"-LRB-",
"0.41",
"--",
"1.57",
"-RRB-",
"179431.12",
"-LRB-",
"0.52",
"--",
"2.41",
"-RRB-",
"10",
"--",
"19e14141",
",4590.62",
"-LRB-",
"0.35",
"--",
"1.09",
"-RRB-",
"141,4160.38",
"-LRB-",
"0.14",
"--",
"1.03",
"-RRB-",
"131,2700.50",
"-LRB-",
"0.17",
"--",
"1.45",
"-RRB-",
"0.1",
"--",
"9e5131",
",3920.60",
"-LRB-",
"0.33",
"--",
"1.08",
"-RRB-",
"131,3470.32",
"-LRB-",
"0.10",
"--",
"1.06",
"-RRB-",
"121,2570.50",
"-LRB-",
"0.12",
"--",
"2.00",
"-RRB-",
"p",
"trend0",
".030.060.26",
"aRR",
"=",
"rate",
"ratios",
";",
"CI",
"=",
"confidence",
"interval",
";",
"n.a.",
"=",
"not",
"applicablebRRs",
"were",
"adjusted",
"for",
"age",
"-LRB-",
"years",
"-RRB-",
".",
"In",
"addition",
",",
"frequency",
"was",
"adjusted",
"for",
"current",
"smoking",
"status",
"-LRB-",
"yes/no",
"-RRB-",
"and",
"duration",
"-LRB-",
"years",
"-RRB-",
";",
"duration",
"was",
"adjusted",
"for",
"current",
"smoking",
"status",
"and",
"frequency",
"-LRB-",
"cigarettes/day",
"-RRB-",
";",
"age",
"at",
"first",
"exposure",
"was",
"adjusted",
"for",
"current",
"smoking",
"status",
",",
"frequency",
",",
"and",
"duration",
";",
"time",
"since",
"cessation",
"was",
"adjusted",
"for",
"frequency",
"and",
"durationcRRs",
"were",
"adjusted",
"as",
"mentioned",
"under",
"footnote",
"b",
"and",
"additionally",
"for",
"body",
"mass",
"index",
"-LRB-",
"kg/m2",
"-RRB-",
",",
"parity",
"-LRB-",
"number",
"of",
"children",
"-RRB-",
",",
"use",
"of",
"oral",
"contraceptives",
"-LRB-",
"ever",
"versus",
"never",
"-RRB-",
",",
"non-occupational",
"physical",
"activity",
"-LRB-",
"low",
",",
"moderate",
",",
"active",
",",
"very",
"active",
"-RRB-",
",",
"hypertension",
"-LRB-",
"yes",
"versus",
"no",
"-RRB-",
",",
"age",
"at",
"first",
"child",
"birth",
"-LRB-",
"years",
"-RRB-",
",",
"age",
"at",
"menopause",
"-LRB-",
"years",
"-RRB-",
",",
"and",
"alcohol",
"consumption",
"-LRB-",
"gram",
"/",
"day",
"-RRB-",
"dNever",
"smoked",
"cigars",
",",
"pipe",
",",
"or",
"cigaretteseEx-smokers",
"only",
"When",
"we",
"adjusted",
"for",
"all",
"confounders",
",",
"multivariate",
"analysis",
"showed",
"a",
"statistically",
"significant",
"29",
"%",
"reduced",
"risk",
"of",
"endometrial",
"cancer",
"for",
"ever-smokers",
"when",
"contrasted",
"with",
"never-smokers",
".",
"When",
"considered",
"separately",
",",
"the",
"risk",
"reduction",
"appeared",
"to",
"be",
"stronger",
"among",
"current",
"smokers",
"-LRB-",
"RR",
"=",
"0.59",
",",
"95",
"%",
"CI",
"=",
"0.40",
"--",
"0.88",
"-RRB-",
"than",
"among",
"former",
"smokers",
"-LRB-",
"RR",
"=",
"0.83",
",",
"95",
"%",
"CI",
"=",
"0.58",
"--",
"1.20",
"-RRB-",
".",
"Tests",
"for",
"trends",
"were",
"not",
"significant",
"for",
"any",
"of",
"the",
"quantitative",
"smoking",
"variables",
"when",
"these",
"were",
"adjusted",
"for",
"age",
"and",
"additional",
"confounders",
".",
"The",
"strongest",
"reduction",
"in",
"risk",
",",
"which",
"could",
"be",
"observed",
"in",
"both",
"univariate",
"and",
"multivariate",
"models",
",",
"was",
"associated",
"with",
"a",
"smoking",
"history",
"of",
"40",
"or",
"more",
"years",
"compared",
"with",
"having",
"never",
"smoked",
"-LRB-",
"RR",
"=",
"0.37",
",",
"95",
"%",
"CI",
"=",
"0.15",
"--",
"0.90",
"-RRB-",
".",
"Moreover",
",",
"we",
"observed",
"a",
"non-significant",
"50",
"%",
"reduction",
"in",
"risk",
"in",
"women",
"that",
"quit",
"smoking",
"either",
"nine",
"or",
"less",
"years",
"ago",
"or",
"that",
"quit",
"10",
"--",
"19",
"years",
"ago",
".",
"The",
"data",
"indicated",
"no",
"association",
"between",
"age",
"at",
"first",
"smoking",
"exposure",
"and",
"endometrial",
"cancer",
".",
"Omitting",
"age",
"at",
"menopause",
"and",
"BMI",
"from",
"the",
"multivariate",
"models",
"either",
"separately",
"or",
"simultaneously",
"did",
"not",
"cause",
"meaningful",
"changes",
"in",
"the",
"corresponding",
"estimates",
".",
"No",
"interactions",
"in",
"determining",
"endometrial",
"cancer",
"risk",
"could",
"be",
"observed",
"between",
"alcohol",
"consumption",
"and",
"HRT",
"use",
"-LRB-",
"p",
"=",
"0.43",
"-RRB-",
",",
"BMI",
"-LRB-",
"p",
"=",
"0.38",
"-RRB-",
",",
"age",
"at",
"menopause",
"-LRB-",
"p",
"=",
"0.39",
"-RRB-",
",",
"or",
"current",
"cigarette",
"smoking",
"-LRB-",
"p",
"=",
"0.83",
"-RRB-",
".",
"When",
"we",
"stratified",
"multivariate",
"alcohol",
"analyses",
"according",
"to",
"smoking",
"status",
",",
"we",
"observed",
"a",
"non-significantly",
"lower",
"risk",
"of",
"endometrial",
"cancer",
"among",
"alcohol",
"consumers",
"that",
"have",
"ever",
"smoked",
"-LRB-",
"RR",
"=",
"0.91",
",",
"95",
"%",
"CI",
"=",
"0.52",
"--",
"1.58",
"-RRB-",
"than",
"among",
"alcohol",
"consumers",
"that",
"have",
"never",
"smoked",
"-LRB-",
"RR",
"=",
"1.16",
",",
"95",
"%",
"CI",
"=",
"0.81",
"--",
"1.67",
"-RRB-",
".",
"Concerning",
"smoking",
"and",
"HRT",
"use",
",",
"the",
"interaction",
"term",
"was",
"not",
"statistically",
"significant",
"-LRB-",
"p",
"=",
"0.11",
"-RRB-",
".",
"In",
"this",
"subset",
"analysis",
",",
"current",
"smoking",
"was",
"associated",
"with",
"a",
"reduced",
"risk",
"of",
"endometrial",
"cancer",
"in",
"women",
"not",
"using",
"HRT",
"-LRB-",
"RR",
"=",
"0.54",
",",
"95",
"%",
"CI",
"=",
"0.35",
"--",
"0.84",
"-RRB-",
".",
"In",
"current",
"smokers",
"that",
"did",
"use",
"HRT",
",",
"the",
"RR",
"was",
"1.32",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.57",
"--",
"3.04",
"-RRB-",
".",
"Numbers",
"were",
"very",
"small",
"however",
":",
"only",
"28",
"women",
"were",
"current",
"smokers",
"and",
"used",
"HRT",
"and",
"only",
"eight",
"women",
"were",
"current",
"smokers",
"and",
"did",
"not",
"use",
"HRT",
".",
"Discussion",
"Our",
"results",
"do",
"not",
"suggest",
"a",
"meaningful",
"association",
"between",
"alcohol",
"consumption",
"and",
"endometrial",
"cancer",
"risk",
".",
"Current",
"smoking",
"is",
"associated",
"with",
"a",
"reduced",
"risk",
"of",
"endometrial",
"cancer",
".",
"This",
"inverse",
"relationship",
"is",
"neither",
"mediated",
"by",
"BMI",
"nor",
"by",
"age",
"at",
"menopause",
".",
"Regarding",
"the",
"biological",
"mechanism",
"underlying",
"endometrial",
"carcinogenesis",
",",
"the",
"so-called",
"``",
"unopposed",
"estrogen",
"hypothesis",
"''",
"is",
"widely",
"accepted",
"-LSB-",
"2",
"-RSB-",
".",
"According",
"to",
"this",
"hypothesis",
"endometrial",
"cancer",
"develops",
"when",
"the",
"endometrium",
"is",
"exposed",
"to",
"high",
"levels",
"of",
"unopposed",
"endogenous",
"or",
"exogenous",
"estrogens",
"for",
"a",
"long",
"period",
"of",
"time",
".",
"This",
"exposure",
"results",
"in",
"elevated",
"mitotic",
"proliferation",
"of",
"endometrial",
"cells",
"which",
",",
"in",
"turn",
",",
"increases",
"the",
"risk",
"of",
"DNA",
"replication",
"errors",
"and",
"DNA",
"mutations",
"which",
"can",
"lead",
"to",
"endometrial",
"cancer",
"-LSB-",
"2",
"-RSB-",
".",
"Although",
"female",
"alcohol",
"consumers",
"could",
"be",
"expected",
"to",
"be",
"at",
"increased",
"risk",
"of",
"endometrial",
"cancer",
"due",
"to",
"their",
"hormonal",
"profile",
",",
"we",
"have",
"not",
"detected",
"significant",
"associations",
"between",
"alcohol",
"consumption",
"and",
"endometrial",
"cancer",
"risk",
".",
"This",
"finding",
"is",
"consistent",
"with",
"the",
"vast",
"majority",
"of",
"previous",
"studies",
"-LSB-",
"13",
",",
"15",
"--",
"18",
"-RSB-",
".",
"However",
",",
"in",
"the",
"EPIC",
"study",
",",
"significantly",
"elevated",
"blood",
"estrone",
"levels",
"were",
"found",
"only",
"in",
"postmenopausal",
"women",
"who",
"consumed",
"more",
"than",
"25",
"g",
"of",
"alcohol",
"per",
"day",
"compared",
"to",
"non-drinkers",
"-LSB-",
"3",
"-RSB-",
".",
"Thus",
",",
"possibly",
",",
"a",
"marked",
"increase",
"in",
"estrone",
"concentrations",
",",
"and",
"ultimately",
"in",
"endometrial",
"cancer",
"risk",
",",
"can",
"only",
"be",
"observed",
"in",
"women",
"who",
"consume",
"more",
"than",
"moderate",
"amounts",
".",
"This",
"notion",
"might",
"be",
"supported",
"by",
"our",
"data",
"as",
"we",
"have",
"observed",
"an",
"-LRB-",
"non-significantly",
"-RRB-",
"elevated",
"risk",
"of",
"endometrial",
"cancer",
"in",
"women",
"who",
"reported",
"to",
"drink",
"more",
"than",
"30",
"g",
"of",
"alcohol",
"per",
"day",
".",
"Based",
"on",
"literature",
"reviews",
"-LSB-",
"7",
",",
"8",
"-RSB-",
",",
"we",
"hypothesized",
"that",
"we",
"might",
"find",
"a",
"positive",
"association",
"between",
"alcohol",
"consumption",
"and",
"endometrial",
"cancer",
"risk",
"in",
"particular",
"among",
"HRT",
"users",
".",
"However",
",",
"our",
"findings",
"do",
"not",
"support",
"the",
"hypothesis",
"of",
"an",
"effect-modification",
"by",
"HRT",
"use",
";",
"neither",
"did",
"most",
"of",
"the",
"previous",
"epidemiological",
"studies",
"-LSB-",
"13",
",",
"17",
",",
"18",
"-RSB-",
".",
"Concerning",
"smoking",
",",
"an",
"anti-estrogenic",
"effect",
"has",
"been",
"suggested",
"-LSB-",
"23",
"-RSB-",
",",
"which",
"should",
"lower",
"the",
"risk",
"of",
"endometrial",
"cancer",
"according",
"to",
"the",
"unopposed",
"estrogen",
"hypothesis",
".",
"Accordingly",
",",
"our",
"data",
"indicated",
"a",
"significant",
"risk",
"reduction",
"in",
"current",
"smokers",
",",
"just",
"like",
"the",
"Nurses",
"'",
"Health",
"Study",
"did",
",",
"which",
"has",
"reported",
"a",
"RR",
"of",
"0.72",
"-LRB-",
"95",
"%",
"CI",
"=",
"0.57",
"--",
"0.90",
"-RRB-",
"for",
"current",
"smokers",
"-LSB-",
"29",
"-RSB-",
".",
"In",
"contrast",
",",
"other",
"cohort",
"studies",
"have",
"observed",
"non-significant",
"associations",
"-LSB-",
"25",
",",
"26",
",",
"28",
"-RSB-",
".",
"We",
"found",
"that",
"the",
"inverse",
"association",
"between",
"smoking",
"and",
"endometrial",
"cancer",
"was",
"more",
"pronounced",
"among",
"current",
"smokers",
"than",
"among",
"former",
"smokers",
".",
"These",
"findings",
"are",
"in",
"line",
"with",
"the",
"evidence",
"from",
"several",
"case",
"--",
"control",
"-LSB-",
"17",
",",
"45",
"--",
"47",
"-RSB-",
"and",
"two",
"cohort",
"studies",
"-LSB-",
"26",
",",
"28",
"-RSB-",
"and",
"they",
"suggest",
"that",
"the",
"degree",
"of",
"protection",
"might",
"partly",
"depend",
"on",
"the",
"time",
"since",
"smoking",
"cessation",
".",
"Although",
"not",
"statistically",
"significant",
",",
"our",
"prospective",
"data",
"support",
"this",
"notion",
",",
"because",
"we",
"observed",
"that",
"endometrial",
"cancer",
"risk",
"is",
"possibly",
"higher",
"in",
"women",
"that",
"quit",
"smoking",
"20",
"or",
"more",
"years",
"ago",
"compared",
"to",
"the",
"risk",
"in",
"women",
"that",
"quit",
"19",
"years",
"ago",
"or",
"less",
".",
"In",
"the",
"epidemiological",
"literature",
",",
"a",
"few",
"studies",
"presented",
"data",
"on",
"time",
"since",
"cessation",
"-LSB-",
"17",
",",
"28",
",",
"29",
",",
"48",
"--",
"50",
"-RSB-",
",",
"but",
"only",
"one",
"of",
"them",
"found",
"a",
"significantly",
"lowered",
"risk",
"among",
"women",
"that",
"quit",
"smoking",
"less",
"than",
"10",
"years",
"ago",
"-LSB-",
"48",
"-RSB-",
".",
"Considering",
"the",
"risk",
"associated",
"with",
"duration",
"of",
"smoking",
",",
"we",
"have",
"observed",
"a",
"reduction",
"in",
"risk",
"with",
"a",
"long",
"smoking",
"history",
",",
"just",
"like",
"previous",
"studies",
"-LSB-",
"17",
",",
"29",
",",
"47",
",",
"48",
"-RSB-",
".",
"With",
"regard",
"to",
"smoking",
"intensity",
",",
"we",
"have",
"found",
"that",
"smoking",
"20",
"or",
"more",
"cigarettes",
"per",
"day",
"is",
"associated",
"with",
"a",
"non-significantly",
"elevated",
"risk",
"of",
"endometrial",
"cancer",
".",
"Though",
"one",
"needs",
"to",
"bear",
"in",
"mind",
"that",
"the",
"corresponding",
"confidence",
"intervals",
"were",
"large",
",",
"these",
"point",
"estimates",
"are",
"possibly",
"not",
"in",
"line",
"with",
"the",
"majority",
"of",
"previous",
"studies",
",",
"which",
"generally",
"indicated",
"that",
"a",
"high",
"smoking",
"intensity",
"-LRB-",
"e.g.",
",",
"smoking",
"20",
"or",
"more",
"cigarettes",
"per",
"day",
"-RRB-",
"is",
"associated",
"with",
"a",
"decreased",
"risk",
"of",
"endometrial",
"cancer",
"-LSB-",
"17",
",",
"22",
",",
"28",
",",
"29",
",",
"45",
",",
"47",
",",
"48",
",",
"51",
"-RSB-",
".",
"This",
"inconsistency",
"could",
"be",
"explained",
"by",
"the",
"lack",
"of",
"adjustment",
"for",
"other",
"smoking",
"variables",
"in",
"earlier",
"studies",
":",
"only",
"one",
"-LSB-",
"29",
"-RSB-",
"out",
"of",
"six",
"-LSB-",
"22",
",",
"25",
"--",
"29",
"-RSB-",
"prospective",
"cohort",
"studies",
"has",
"adjusted",
"its",
"smoking",
"frequency",
"estimates",
"for",
"the",
"potentially",
"confounding",
"effects",
"of",
"smoking",
"duration",
".",
"When",
"we",
"omitted",
"smoking",
"duration",
"from",
"our",
"multivariate",
"models",
",",
"the",
"RRs",
"for",
"smoking",
"frequency",
"also",
"suggested",
"an",
"inverse",
"association",
"with",
"endometrial",
"cancer",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Our",
"results",
"do",
"not",
"indicate",
"any",
"important",
"association",
"between",
"the",
"age",
"at",
"starting",
"smoking",
"and",
"endometrial",
"cancer",
"risk",
".",
"Four",
"previous",
"studies",
"-LSB-",
"26",
",",
"28",
",",
"47",
",",
"49",
"-RSB-",
"found",
"a",
"-LRB-",
"non-significant",
"-RRB-",
"risk",
"reduction",
"with",
"young",
"age",
"at",
"first",
"exposure",
",",
"that",
"is",
",",
"starting",
"to",
"smoke",
"between",
"age",
"15",
"-LSB-",
"28",
"-RSB-",
"or",
"age",
"20",
"or",
"earlier",
"-LSB-",
"49",
"-RSB-",
",",
"but",
"none",
"of",
"these",
"studies",
"has",
"reported",
"a",
"significant",
"trend",
".",
"It",
"has",
"been",
"hypothesized",
"that",
"smoking",
"might",
"lower",
"the",
"levels",
"of",
"estrogens",
"partly",
"by",
"reducing",
"the",
"amount",
"of",
"fat",
"tissue",
"or",
"by",
"decreasing",
"the",
"age",
"at",
"menopause",
"-LSB-",
"24",
"-RSB-",
".",
"In",
"our",
"cohort",
",",
"smokers",
"were",
"slightly",
"leaner",
"than",
"non-smokers",
"-LRB-",
"24.6",
"kg/m2",
"vs.",
"25.3",
"kg/m2",
"-RRB-",
".",
"Moreover",
",",
"on",
"average",
",",
"current",
"smokers",
"appeared",
"to",
"have",
"reached",
"menopause",
"1",
"year",
"earlier",
"than",
"never-smokers",
"and",
"former",
"smokers",
"-LRB-",
"48.1",
"years",
"vs.",
"49.1",
"years",
"-RRB-",
".",
"However",
",",
"in",
"conclusion",
",",
"our",
"analyses",
"indicated",
"that",
"BMI",
"and",
"age",
"at",
"menopause",
"are",
"no",
"mediating",
"factors",
".",
"In",
"contrast",
"to",
"smoking",
",",
"use",
"of",
"unopposed",
"HRT",
"increases",
"endometrial",
"cancer",
"risk",
"in",
"postmenopausal",
"women",
".",
"Although",
"an",
"interaction",
"between",
"smoking",
"and",
"HRT",
"use",
"seems",
"biologically",
"plausible",
",",
"the",
"small",
"numbers",
"in",
"our",
"analysis",
"did",
"not",
"allow",
"to",
"draw",
"firm",
"conclusions",
"regarding",
"a",
"possible",
"effect",
"modification",
"by",
"HRT",
"use",
".",
"Moreover",
",",
"we",
"had",
"no",
"precise",
"information",
"on",
"what",
"type",
"of",
"HRT",
"women",
"in",
"the",
"NLCS",
"have",
"used",
".",
"If",
"we",
"could",
"have",
"included",
"such",
"information",
"in",
"our",
"analysis",
",",
"results",
"might",
"differ",
"according",
"to",
"type",
"of",
"HRT",
"used",
".",
"Another",
"potential",
"drawback",
"of",
"our",
"study",
"might",
"be",
"misclassification",
"of",
"self-reported",
"alcohol",
"consumption",
"and/or",
"self-reported",
"cigarette",
"smoking",
".",
"However",
",",
"these",
"misclassifications",
"might",
"be",
"non-differential",
"owing",
"to",
"the",
"prospective",
"study",
"design",
".",
"Consequently",
",",
"the",
"risk",
"estimates",
"would",
"probably",
"be",
"biased",
"towards",
"no",
"effect",
".",
"Moreover",
",",
"the",
"correlation",
"between",
"the",
"alcohol",
"consumption",
"measured",
"by",
"the",
"NLCS",
"questionnaire",
"and",
"the",
"measurement",
"in",
"a",
"nine-day",
"record",
"was",
"high",
"due",
"to",
"the",
"large",
"variation",
"in",
"alcohol",
"consumption",
"-LSB-",
"34",
"-RSB-",
".",
"An",
"important",
"strength",
"of",
"our",
"study",
"is",
"that",
"the",
"exposures",
"were",
"assessed",
"prior",
"to",
"the",
"diagnosis",
"of",
"endometrial",
"cancer",
".",
"Therefore",
",",
"our",
"findings",
"can",
"not",
"be",
"influenced",
"by",
"recall",
"bias",
".",
"Moreover",
",",
"selection",
"bias",
"is",
"unlikely",
"as",
"the",
"follow-up",
"of",
"subcohort",
"members",
"and",
"cases",
"was",
"almost",
"complete",
"-LSB-",
"33",
",",
"52",
"-RSB-",
".",
"Another",
"strength",
"is",
"the",
"way",
"alcohol",
"consumption",
"and",
"cigarette",
"smoking",
"was",
"assessed",
"in",
"the",
"NLCS",
".",
"The",
"detailed",
"assessment",
"enabled",
"us",
"to",
"evaluate",
"associations",
"between",
"endometrial",
"cancer",
"and",
"various",
"measures",
"of",
"both",
"exposures",
".",
"Furthermore",
",",
"we",
"were",
"able",
"to",
"control",
"for",
"confounding",
"by",
"the",
"most",
"important",
"risk",
"factors",
"of",
"endometrial",
"cancer",
"-LSB-",
"40",
"-RSB-",
".",
"To",
"sum",
"up",
"our",
"major",
"findings",
",",
"we",
"found",
"that",
"alcohol",
"consumption",
"is",
"not",
"associated",
"with",
"endometrial",
"cancer",
".",
"Current",
"smoking",
"was",
"associated",
"with",
"a",
"reduced",
"risk",
"of",
"endometrial",
"cancer",
"in",
"postmenopausal",
"women",
".",
"This",
"association",
"was",
"probably",
"not",
"mediated",
"by",
"a",
"decreased",
"BMI",
"or",
"by",
"an",
"earlier",
"age",
"at",
"menopause",
".",
"Larger",
"prospective",
"studies",
"with",
"information",
"on",
"the",
"type",
"of",
"HRT",
"are",
"needed",
"in",
"order",
"to",
"investigate",
"possible",
"effect",
"modification",
"by",
"different",
"types",
"of",
"HRT",
".",
"Possibly",
",",
"the",
"incidence",
"of",
"endometrial",
"cancer",
"could",
"be",
"reduced",
"if",
"smoking",
"was",
"more",
"common",
"in",
"female",
"populations",
";",
"however",
",",
"such",
"a",
"reduction",
"would",
"be",
"overshadowed",
"by",
"a",
"dramatically",
"increasing",
"incidence",
"of",
"many",
"other",
"chronic",
"diseases",
".",
"Thus",
",",
"individuals",
"should",
"still",
"be",
"encouraged",
"to",
"quit",
"or",
"not",
"to",
"start",
"smoking",
"."
] | [
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O"
] |
Calcif_Tissue_Int-3-1-2039811 | [
"Effect",
"of",
"Raloxifene",
"Treatment",
"on",
"Osteocyte",
"Apoptosis",
"in",
"Postmenopausal",
"Women",
"Increased",
"osteocyte",
"apoptosis",
",",
"as",
"the",
"result",
"of",
"estrogen",
"deficiency",
",",
"could",
"play",
"a",
"role",
"in",
"the",
"decrease",
"of",
"bone",
"mass",
"and",
"bone",
"strength",
"seen",
"in",
"postmenopausal",
"osteoporosis",
".",
"We",
"investigated",
"whether",
"treatment",
"with",
"raloxifene",
"of",
"postmenopausal",
"women",
"with",
"osteoporosis",
"affects",
"osteocyte",
"apoptosis",
".",
"Transiliac",
"bone",
"biopsies",
"were",
"obtained",
"from",
"26",
"osteoporotic",
"women",
"at",
"baseline",
"and",
"after",
"2",
"years",
"of",
"treatment",
"with",
"placebo",
"or",
"raloxifene",
".",
"Immunohistochemical",
"detection",
"of",
"cleaved",
"caspase-3",
"was",
"performed",
"on",
"sections",
"from",
"nondecalcified",
"bone",
"biopsies",
"to",
"visualize",
"apoptosis",
".",
"In",
"the",
"trabecular",
"bone",
"total",
"osteocytes",
",",
"positively",
"stained",
"osteocytes",
"and",
"empty",
"lacunae",
"were",
"counted",
"and",
"percent",
"positive",
"cells",
"and",
"percent",
"empty",
"lacunae",
"determined",
".",
"Statistical",
"evaluation",
"was",
"performed",
"by",
"Wilcoxon",
"'s",
"paired",
"t-test",
"and",
"Spearman",
"'s",
"rank",
"correlations",
".",
"There",
"was",
"no",
"significant",
"difference",
"in",
"percentage",
"positive",
"osteocytes",
"between",
"baseline",
"and",
"follow-up",
"biopsies",
"in",
"both",
"the",
"placebo",
"and",
"the",
"raloxifene",
"groups",
".",
"The",
"percentage",
"empty",
"lacunae",
"increased",
"significantly",
"in",
"the",
"placebo",
"group",
"-LRB-",
"11.20",
"±",
"1.43",
"vs.",
"9.00",
"±",
"2.25",
",",
"P",
"=",
"0.014",
"-RRB-",
"but",
"not",
"in",
"the",
"raloxifene",
"group",
".",
"At",
"baseline",
"in",
"both",
"groups",
"combined",
",",
"there",
"was",
"a",
"negative",
"correlation",
"between",
"indices",
"of",
"bone",
"remodeling",
"and",
"the",
"percentage",
"positive",
"osteocytes",
"-LRB-",
"bone",
"formation",
"rate/bone",
"volume",
"r",
"=",
"−",
"0.67",
",",
"P",
"=",
"0.001",
"-RRB-",
".",
"We",
"found",
"no",
"direct",
"evidence",
"for",
"an",
"effect",
"of",
"raloxifene",
"treatment",
"on",
"osteocyte",
"apoptosis",
",",
"but",
"small",
"effects",
"of",
"raloxifene",
"treatment",
"can",
"not",
"be",
"excluded",
".",
"The",
"percent",
"of",
"apoptotic",
"osteocytes",
"was",
"dependent",
"on",
"the",
"level",
"of",
"bone",
"remodeling",
"in",
"an",
"individual",
".",
"Osteocytes",
"play",
"a",
"key",
"role",
"in",
"the",
"maintenance",
"of",
"bone",
"mass",
"and",
"structure",
".",
"The",
"main",
"function",
"of",
"osteocytes",
"is",
"to",
"sense",
"mechanical",
"stress",
"in",
"the",
"bone",
"-LSB-",
"1",
"-RSB-",
".",
"Osteocytes",
"respond",
"to",
"this",
"with",
"the",
"production",
"of",
"nitric",
"oxide",
",",
"prostaglandins",
",",
"and",
"other",
"factors",
"which",
"are",
"believed",
"to",
"restrain",
"osteoclastic",
"bone",
"resorption",
"or",
"promote",
"bone",
"formation",
"-LSB-",
"2",
",",
"3",
"-RSB-",
".",
"A",
"putative",
"second",
"role",
"of",
"osteocytes",
"is",
"to",
"direct",
"bone",
"remodeling",
"to",
"foci",
"of",
"microdamage",
".",
"Osteocyte",
"apoptosis",
"around",
"the",
"site",
"of",
"microdamage",
"attracts",
"bone",
"remodeling",
"cells",
",",
"which",
"resorb",
"the",
"damaged",
"bone",
"and",
"replace",
"it",
"with",
"new",
"mechanically",
"competent",
"bone",
"-LSB-",
"4",
",",
"5",
"-RSB-",
".",
"Postmenopausal",
"osteoporosis",
"generally",
"results",
"in",
"a",
"decrease",
"in",
"bone",
"mineral",
"density",
"-LRB-",
"BMD",
"-RRB-",
"and",
"a",
"higher",
"susceptibility",
"for",
"osteoporotic",
"fractures",
".",
"It",
"is",
"characterized",
"by",
"high",
"bone",
"remodeling",
",",
"with",
"bone",
"resorption",
"exceeding",
"bone",
"formation",
".",
"Estrogen",
"deficiency",
"results",
"in",
"an",
"increase",
"in",
"the",
"recruitment",
"and",
"activity",
"of",
"both",
"osteoblasts",
"and",
"osteoclasts",
".",
"It",
"also",
"leads",
"to",
"increased",
"osteoclast",
"survival",
",",
"while",
"the",
"life",
"span",
"of",
"the",
"osteoblast",
"is",
"decreased",
"-LSB-",
"6",
",",
"7",
"-RSB-",
".",
"Recently",
"it",
"has",
"been",
"shown",
"both",
"in",
"humans",
"and",
"in",
"rats",
"that",
"estrogen",
"deficiency",
"also",
"leads",
"to",
"increased",
"osteocyte",
"apoptosis",
"-LSB-",
"8",
",",
"9",
"-RSB-",
".",
"The",
"resulting",
"decrease",
"in",
"osteocyte",
"number",
"could",
",",
"in",
"time",
",",
"impair",
"the",
"response",
"of",
"bone",
"to",
"mechanical",
"stress",
"and",
"lead",
"to",
"an",
"accumulation",
"of",
"microdamage",
".",
"Therefore",
",",
"it",
"would",
"be",
"of",
"interest",
"to",
"know",
"whether",
"therapies",
"aimed",
"at",
"reducing",
"postmenopausal",
"bone",
"loss",
"affect",
"the",
"survival",
"of",
"osteocytes",
".",
"Raloxifene",
"is",
"a",
"selective",
"estrogen",
"receptor",
"modulator",
"-LRB-",
"SERM",
"-RRB-",
"that",
"can",
"bind",
"to",
"the",
"estrogen",
"receptors",
"ERα",
"and",
"ERβ",
".",
"It",
"has",
"been",
"shown",
"to",
"increase",
"BMD",
"and",
"reduce",
"vertebral",
"fracture",
"risk",
"in",
"women",
"with",
"postmenopausal",
"osteoporosis",
"-LSB-",
"10",
",",
"11",
"-RSB-",
".",
"In",
"vitro",
"studies",
"suggest",
"that",
"raloxifene",
"exerts",
"its",
"effect",
",",
"like",
"estrogen",
",",
"through",
"modulation",
"of",
"the",
"number",
"and",
"activity",
"of",
"both",
"osteoclasts",
"and",
"osteoblasts",
"-LSB-",
"12",
"-RSB-",
".",
"Kousteni",
"et",
"al.",
"-LSB-",
"13",
"-RSB-",
"have",
"recently",
"shown",
",",
"using",
"in",
"vitro",
"experiments",
",",
"that",
"raloxifene",
"does",
"not",
"inhibit",
"etoposide-induced",
"apoptosis",
"of",
"rat",
"calvarial",
"osteoblasts",
";",
"but",
"no",
"clinical",
"studies",
"have",
"examined",
"the",
"effect",
"of",
"raloxifene",
"on",
"osteocyte",
"apoptosis",
"in",
"postmenopausal",
"women",
".",
"In",
"this",
"study",
",",
"we",
"investigated",
"whether",
"treatment",
"of",
"postmenopausal",
"women",
"with",
"raloxifene",
"for",
"2",
"years",
"would",
"change",
"osteocyte",
"survival",
"in",
"trabecular",
"bone",
"and",
"whether",
"the",
"level",
"of",
"osteocyte",
"apoptosis",
"would",
"be",
"associated",
"with",
"the",
"level",
"of",
"bone",
"remodeling",
".",
"Materials",
"and",
"Methods",
"Study",
"Outline",
"All",
"women",
"in",
"the",
"study",
"were",
"participants",
"in",
"the",
"Multiple",
"Outcomes",
"of",
"Raloxifene",
"Evaluation",
"-LRB-",
"MORE",
"-RRB-",
"trial",
".",
"This",
"was",
"a",
"placebo-controlled",
",",
"double-blind",
",",
"multicenter",
"trial",
"to",
"test",
"the",
"efficacy",
"of",
"raloxifene",
".",
"Details",
"of",
"this",
"study",
"have",
"already",
"been",
"published",
"elsewhere",
"-LSB-",
"10",
"-RSB-",
".",
"Briefly",
",",
"7,705",
"women",
"were",
"at",
"least",
"2",
"years",
"postmenopausal",
"and",
"had",
"osteoporosis",
"as",
"defined",
"by",
"a",
"BMD",
"of",
"at",
"least",
"2.5",
"standard",
"deviations",
"-LRB-",
"SDs",
"-RRB-",
"below",
"the",
"young",
"adult",
"mean",
"and/or",
"one",
"or",
"more",
"vertebral",
"fractures",
".",
"They",
"were",
"randomly",
"assigned",
"to",
"one",
"of",
"the",
"following",
"three",
"treatment",
"groups",
":",
"placebo",
",",
"60",
"mg/day",
"raloxifene",
",",
"and",
"120",
"mg/day",
"raloxifene",
".",
"Additionally",
",",
"all",
"women",
"received",
"daily",
"vitamin",
"D",
"-LRB-",
"400",
"--",
"600",
"IU",
"-RRB-",
"and",
"calcium",
"-LRB-",
"500",
"mg",
"-RRB-",
".",
"Among",
"the",
"exclusion",
"criteria",
"for",
"this",
"study",
"were",
"the",
"use",
"of",
"androgen",
",",
"calcitonin",
",",
"or",
"bisphosphonates",
"within",
"the",
"previous",
"6",
"months",
";",
"oral",
"estrogen",
"within",
"the",
"previous",
"2",
"months",
";",
"fluoride",
"therapy",
"for",
"more",
"than",
"3",
"months",
"during",
"the",
"previous",
"2",
"years",
";",
"or",
"systemic",
"glucocorticoid",
"therapy",
"for",
"more",
"than",
"1",
"month",
"within",
"the",
"past",
"year",
".",
"During",
"the",
"study",
"the",
"women",
"received",
"no",
"therapy",
"with",
"respect",
"to",
"their",
"osteoporosis",
"other",
"than",
"the",
"study",
"drugs",
".",
"The",
"use",
"of",
"other",
"prescription",
"drugs",
"and",
"over-the-counter",
"drugs",
"such",
"as",
"sedatives",
",",
"antibiotics",
",",
"and",
"paracetamol",
"was",
"equally",
"distributed",
"in",
"the",
"placebo",
"and",
"raloxifene",
"groups",
".",
"In",
"this",
"study",
",",
"bone",
"biopsies",
"were",
"obtained",
"at",
"baseline",
"and",
"after",
"2",
"years",
"from",
"26",
"women",
"who",
"were",
"enrolled",
"in",
"the",
"European",
"centers",
"of",
"the",
"MORE",
"trial",
".",
"These",
"women",
"were",
"part",
"of",
"the",
"bone",
"histomorphometry",
"substudy",
"of",
"the",
"MORE",
"trial",
"that",
"included",
"65",
"women",
"from",
"two",
"centers",
"in",
"the",
"United",
"States",
"and",
"two",
"centers",
"in",
"Europe",
".",
"Bone",
"biopsies",
"from",
"the",
"other",
"39",
"women",
"were",
"not",
"available",
"for",
"sectioning",
".",
"All",
"women",
"had",
"given",
"their",
"informed",
"consent",
",",
"and",
"the",
"study",
"was",
"approved",
"by",
"the",
"institutional",
"ethics",
"review",
"boards",
".",
"Markers",
"of",
"bone",
"turnover",
"that",
"were",
"measured",
"were",
"serum",
"osteocalcin",
",",
"bone-specific",
"alkaline",
"phosphatase",
"-LRB-",
"BSAP",
"-RRB-",
",",
"and",
"urinary",
"type",
"1",
"collagen",
"C-telopeptide",
"corrected",
"for",
"creatinine",
"-LRB-",
"CTX-I",
"-RRB-",
".",
"Data",
"are",
"from",
"the",
"baseline",
"and",
"24-month",
"evaluations",
".",
"Bone",
"Biopsies",
"The",
"women",
"received",
"two",
"doses",
"of",
"tetracycline",
"with",
"a",
"12-day",
"interval",
".",
"Transverse",
"biopsy",
"specimens",
"were",
"taken",
"from",
"the",
"anterior",
"iliac",
"crest",
",",
"the",
"2-year",
"biopsy",
"being",
"on",
"the",
"opposite",
"side",
"from",
"the",
"baseline",
"biopsy",
".",
"The",
"bone",
"biopsies",
"were",
"immediately",
"fixed",
"in",
"cold",
"4",
"%",
"phosphate-buffered",
"formaldehyde",
",",
"dehydrated",
"in",
"graded",
"ethanol",
",",
"and",
"embedded",
"in",
"methylmethacrylate",
"-LRB-",
"MMA",
";",
"BDH",
"Chemicals",
",",
"Poole",
",",
"England",
"-RRB-",
"supplemented",
"with",
"20",
"%",
"plastoid-N",
"-LRB-",
"Röhm",
"und",
"Haas",
",",
"Darmstadt",
",",
"Germany",
"-RRB-",
",",
"2.0",
"g/L",
"benzoylperoxide",
"-LRB-",
"Merck",
",",
"Darmstadt",
",",
"Germany",
"-RRB-",
",",
"and",
"N,N-dimethylaniline",
"-LRB-",
"Merck",
"-RRB-",
"-LSB-",
"14",
"-RSB-",
".",
"Sections",
"of",
"5",
"μm",
"were",
"cut",
"with",
"a",
"Jung",
"-LRB-",
"Nussloch",
",",
"Germany",
"-RRB-",
"K",
"Polycut",
"microtome",
".",
"Sections",
"were",
"stained",
"with",
"Goldner",
"'s",
"trichrome",
"method",
".",
"Static",
"and",
"dynamic",
"histomorphometric",
"measurements",
"were",
"performed",
"as",
"previously",
"reported",
"-LSB-",
"15",
",",
"16",
"-RSB-",
".",
"Histomorphometric",
"indices",
"used",
"for",
"this",
"study",
"included",
"the",
"percentage",
"of",
"bone",
"surface",
"covered",
"by",
"osteoid",
"-LRB-",
"osteoid",
"surface",
",",
"OS/BS",
"-RRB-",
"and",
"the",
"amount",
"of",
"mineralized",
"bone",
"formed",
"per",
"year",
"on",
"a",
"given",
"bone",
"area",
"-LRB-",
"bone",
"formation",
"rate/bone",
"volume",
",",
"BFR/BV",
"-RRB-",
"as",
"bone",
"formation",
"indices",
"and",
"the",
"percentage",
"of",
"bone",
"surface",
"covered",
"by",
"osteoclasts",
"or",
"appearing",
"eroded",
"-LRB-",
"eroded",
"surface",
",",
"ES/BS",
"-RRB-",
"and",
"the",
"number",
"of",
"osteoclasts",
"per",
"bone",
"area",
"-LRB-",
"osteoclast",
"number",
",",
"Ocl.N",
"/",
"B.Ar",
"-RRB-",
"as",
"bone",
"resorption",
"indices",
"-LSB-",
"17",
",",
"18",
"-RSB-",
".",
"Histomorphometric",
"data",
"and",
"immunohistochemical",
"data",
"were",
"obtained",
"from",
"the",
"same",
"biopsies",
".",
"Immunohistochemistry",
"Apoptotic",
"cells",
"were",
"visualized",
"by",
"immunohistochemical",
"detection",
"of",
"activated",
"caspase-3",
".",
"The",
"antibody",
"against",
"cleaved",
"caspase-3",
"specifically",
"stains",
"apoptotic",
"cells",
".",
"Unlike",
"the",
"terminal",
"deoxynucleotidyl",
"transferase-mediated",
"deoxyuridine",
"triphosphate",
"nick",
"end",
"labeling",
"-LRB-",
"TUNEL",
"-RRB-",
"method",
",",
"there",
"is",
"no",
"staining",
"of",
"necrotic",
"cells",
"or",
"cells",
"with",
"DNA",
"damage",
".",
"For",
"optimal",
"accuracy",
"of",
"the",
"method",
",",
"immunohistochemistry",
"was",
"performed",
"on",
"four",
"5",
"μm",
"sections",
"of",
"each",
"biopsy",
",",
"which",
"were",
"obtained",
"with",
"an",
"interval",
"of",
"30",
"μm",
".",
"Sections",
"were",
"cut",
"and",
"transferred",
"to",
"poly-l-lysine-coated",
"slides",
".",
"After",
"deplastification",
"and",
"rehydration",
",",
"sections",
"were",
"decalcified",
"for",
"10",
"minutes",
"with",
"1",
"%",
"acetic",
"acid",
".",
"Antigen",
"retrieval",
"was",
"performed",
"by",
"30-minute",
"incubation",
"with",
"0.5",
"%",
"saponin",
"-LRB-",
"Sigma",
",",
"St.",
"Louis",
",",
"MO",
"-RRB-",
"in",
"phosphate-buffered",
"saline",
"-LRB-",
"PBS",
"-RRB-",
"and",
"10-minute",
"incubation",
"with",
"3.5",
"μg/mL",
"DNAse",
"II",
"-LRB-",
"Sigma",
"-RRB-",
"in",
"25",
"mM",
"Tris",
"+",
"10",
"mM",
"MgSO4",
".",
"Sections",
"were",
"incubated",
"with",
"3",
"%",
"H2O2",
"in",
"methanol",
"to",
"block",
"endogenous",
"peroxidase",
"and",
"with",
"5",
"%",
"normal",
"goat",
"serum",
"in",
"PBS",
"+",
"0.05",
"%",
"Tween",
"to",
"block",
"nonspecific",
"binding",
"sites",
".",
"Incubation",
"with",
"primary",
"antibody",
"was",
"performed",
"overnight",
"at",
"4",
"°C",
"with",
"1/100",
"rabbit-anticleaved",
"caspase-3",
"antibody",
"-LRB-",
"Cell",
"Signaling",
"Technology",
",",
"Beverly",
",",
"MA",
"-RRB-",
"in",
"PBS",
"+",
"0.05",
"%",
"Tween",
".",
"Sections",
"were",
"then",
"incubated",
"for",
"1",
"hour",
"with",
"1/100",
"biotin-labeled",
"goat-anti-rabbit",
"immunoglobulin",
"G",
"-LRB-",
"Vector",
"Labs",
",",
"Burlingame",
",",
"CA",
"-RRB-",
"in",
"PBS",
"+",
"0.05",
"%",
"Tween",
".",
"The",
"sections",
"were",
"incubated",
"for",
"30",
"minutes",
"with",
"the",
"ABC",
"kit",
"-LRB-",
"Vector",
"Labs",
"-RRB-",
"and",
"developed",
"for",
"10",
"minutes",
"with",
"3,3",
"′",
"-",
"diaminobenzidine",
"with",
"nickel",
"enhancement",
".",
"Sections",
"were",
"counterstained",
"with",
"0.025",
"%",
"toluidine",
"blue",
"in",
"H2O",
",",
"dehydrated",
",",
"and",
"sealed",
"in",
"DEPEX",
"mounting",
"medium",
"-LRB-",
"BDH",
"-RRB-",
".",
"Random",
"quality-control",
"sections",
"were",
"measured",
"in",
"each",
"assay",
".",
"Sections",
"of",
"human",
"ileum",
"were",
"tested",
"as",
"a",
"positive",
"control",
"for",
"apoptotic",
"cells",
".",
"Cell",
"Counting",
"The",
"identity",
"of",
"the",
"sections",
"was",
"blinded",
",",
"and",
"they",
"were",
"randomly",
"numbered",
".",
"In",
"each",
"section",
",",
"the",
"total",
"trabecular",
"bone",
"area",
"was",
"measured",
"using",
"Osteomeasure",
"software",
"-LRB-",
"Osteometrics",
",",
"Atlanta",
",",
"GA",
"-RRB-",
".",
"In",
"the",
"entire",
"trabecular",
"bone",
"area",
",",
"the",
"total",
"number",
"of",
"osteocytes",
",",
"the",
"number",
"of",
"cleaved",
"caspase-3-positive",
"osteocytes",
",",
"and",
"the",
"number",
"of",
"empty",
"lacunae",
"were",
"counted",
"with",
"x200",
"magnification",
".",
"Artefacts",
",",
"such",
"as",
"areas",
"where",
"bone",
"marrow",
"obscured",
"the",
"trabeculae",
"or",
"where",
"trabeculae",
"were",
"crossed",
",",
"were",
"avoided",
".",
"All",
"sections",
"were",
"analyzed",
"by",
"the",
"same",
"investigator",
".",
"From",
"these",
"data",
"we",
"calculated",
"the",
"following",
"parameters",
":",
"percentage",
"of",
"positive",
"osteocytes",
"per",
"total",
"osteocytes",
"-LRB-",
"Pos.Ot.N",
"/",
"Tt.Ot.N",
"-RRB-",
"percentage",
"of",
"empty",
"lacunae",
"per",
"total",
"lacunae",
"-LRB-",
"EL.N",
"/",
"Tt.L.N",
"-RRB-",
"empty",
"lacunae",
"per",
"bone",
"area",
"-LRB-",
"EL.N",
"/",
"B.Ar",
"-RRB-",
"total",
"lacunae",
"per",
"bone",
"area",
"-LRB-",
"Tt.L.N",
"/",
"B.Ar",
"-RRB-",
"Calculations",
"from",
"the",
"four",
"sections",
"per",
"biopsy",
"were",
"averaged",
".",
"The",
"variation",
"in",
"the",
"method",
"was",
"assessed",
"by",
"calculating",
"the",
"average",
"standard",
"deviation",
"from",
"all",
"the",
"quadruplicates",
"according",
"to",
"the",
"following",
"formula",
":",
"in",
"which",
"n",
"is",
"number",
"of",
"subjects",
",",
"k",
"is",
"number",
"of",
"measurements",
"per",
"subject",
",",
"nj",
"is",
"number",
"of",
"measurements",
"in",
"subject",
"j",
",",
"Xij",
"is",
"score",
"measurement",
"i",
"in",
"subject",
"j",
",",
"and",
"is",
"mean",
"score",
"in",
"subject",
"j.",
"Statistics",
"All",
"values",
"are",
"expressed",
"as",
"mean",
"±",
"SD",
".",
"Differences",
"in",
"the",
"calculated",
"parameters",
"between",
"the",
"2-year",
"biopsies",
"and",
"the",
"baseline",
"biopsies",
"within",
"groups",
"were",
"tested",
"using",
"a",
"nonparametric",
"paired",
"t-test",
"-LRB-",
"Wilcoxon",
"signed",
"rank",
"test",
"-RRB-",
".",
"Differences",
"between",
"the",
"treatment",
"groups",
"in",
"the",
"percent",
"change",
"after",
"2",
"years",
"of",
"treatment",
"were",
"tested",
"with",
"a",
"nonparametric",
"t-test",
"-LRB-",
"Mann-Whitney",
"signed",
"rank",
"test",
"-RRB-",
".",
"Correlations",
"between",
"the",
"calculated",
"parameters",
"and",
"histomorphometric",
"indices",
"or",
"biochemical",
"markers",
"were",
"assessed",
"with",
"Spearman",
"'s",
"rank",
"correlations",
".",
"Statistical",
"analysis",
"was",
"performed",
"using",
"SPSS",
"-LRB-",
"Chicago",
",",
"IL",
"-RRB-",
"12.0",
"software",
".",
"Results",
"The",
"data",
"presented",
"here",
"are",
"derived",
"from",
"26",
"patients",
"who",
"attended",
"the",
"European",
"centers",
"of",
"the",
"MORE",
"trial",
".",
"Therefore",
",",
"this",
"study",
"covers",
"only",
"part",
"of",
"the",
"group",
"of",
"patients",
"on",
"which",
"histomorphometry",
"data",
"were",
"published",
"earlier",
"-LSB-",
"16",
"-RSB-",
".",
"Of",
"the",
"26",
"women",
"in",
"this",
"study",
",",
"11",
"received",
"placebo",
",",
"ten",
"received",
"60",
"mg/day",
"raloxifene",
",",
"and",
"five",
"received",
"120",
"mg/day",
"raloxifene",
".",
"Because",
"the",
"number",
"of",
"women",
"in",
"the",
"120",
"mg/day",
"raloxifene",
"group",
"was",
"small",
"and",
"no",
"difference",
"in",
"results",
"between",
"the",
"two",
"raloxifene",
"treatment",
"groups",
"was",
"detected",
",",
"as",
"tested",
"using",
"the",
"Mann-Whitney",
"signed",
"rank",
"test",
",",
"data",
"from",
"the",
"two",
"raloxifene",
"groups",
"were",
"combined",
"for",
"further",
"analysis",
".",
"The",
"average",
"age",
"of",
"the",
"women",
"in",
"the",
"placebo",
"group",
"was",
"67.9",
"±",
"6.1",
"years",
";",
"in",
"the",
"raloxifene",
"group",
"the",
"average",
"age",
"was",
"67.1",
"±",
"6.7",
"years",
".",
"Staining",
"for",
"cleaved",
"caspase-3",
"clearly",
"identified",
"apoptotic",
"osteocytes",
"-LRB-",
"Fig.",
"1a",
"-RRB-",
";",
"in",
"the",
"negative",
"control",
"no",
"cells",
"showed",
"any",
"staining",
".",
"Figure",
"1b",
"shows",
"an",
"example",
"of",
"an",
"empty",
"lacuna",
".",
"In",
"the",
"human",
"ileum",
"sections",
",",
"clear",
"positive",
"staining",
"of",
"intestinal",
"epithelial",
"cells",
"was",
"seen",
"at",
"the",
"luminal",
"surface",
"of",
"the",
"villi",
"while",
"the",
"negative",
"control",
"showed",
"no",
"staining",
"-LRB-",
"Fig.",
"1c",
",",
"d",
"-RRB-",
".",
"Table",
"1",
"shows",
"the",
"baseline",
"and",
"follow-up",
"results",
"of",
"the",
"calculated",
"parameters",
"in",
"the",
"placebo",
"group",
"and",
"the",
"raloxifene",
"group",
"and",
"the",
"average",
"standard",
"deviation",
"of",
"the",
"parameters",
".",
"Direct",
"comparison",
"of",
"the",
"follow-up",
"biopsy",
"with",
"the",
"baseline",
"biopsy",
"revealed",
"no",
"difference",
"in",
"the",
"percentage",
"of",
"positive",
"osteocytes",
"-LRB-",
"Pos.Ot.N",
"/",
"Tl.Ot.N",
"-RRB-",
"in",
"either",
"the",
"placebo",
"group",
"or",
"the",
"raloxifene",
"group",
".",
"Fig.",
"1Immunohistochemical",
"staining",
"of",
"bone",
"biopsy",
"sections",
"and",
"human",
"ileum",
"sections",
"for",
"cleaved",
"caspase-3",
".",
"Human",
"bone",
"biopsy",
"sections",
"stained",
"with",
"cleaved",
"caspase-3",
"-LRB-",
"a",
",",
"b",
"-RRB-",
".",
"Arrows",
"indicate",
"apoptotic",
"osteocyte",
"-LRB-",
"a",
"-RRB-",
"or",
"empty",
"lacuna",
"-LRB-",
"b",
"-RRB-",
".",
"Human",
"ileum",
"sections",
"stained",
"with",
"cleaved",
"caspase-3",
"-LRB-",
"c",
"-RRB-",
"or",
"no",
"first",
"antibody",
"-LRB-",
"d",
"-RRB-",
".",
"Arrows",
"indicate",
"apoptotic",
"cellsTable",
"1Results",
"of",
"baseline",
"and",
"follow-up",
"biopsies",
"for",
"the",
"calculated",
"parametersParameter",
"-LRB-",
"average",
"standard",
"deviation",
"-RRB-",
"aTime",
"pointPlacebo",
"-LRB-",
"n",
"=",
"11",
",",
"mean",
"±",
"SD",
"-RRB-",
"Raloxifeneb",
"-LRB-",
"n",
"=",
"15",
",",
"mean",
"±",
"SD",
"-RRB-",
"Pos.Ot.N",
"/",
"Tt.Ot.N",
"-LRB-",
"%",
"-RRB-",
"-LRB-",
"1.28",
"-RRB-",
"Baseline6",
".66",
"±",
"5.285.30",
"±",
"3.51Follow-up6.82",
"±",
"5.274.99",
"±",
"2.29",
"EL.N",
"/",
"Tt.L.N",
"-LRB-",
"%",
"-RRB-",
"-LRB-",
"2.43",
"-RRB-",
"Baseline9",
".00",
"±",
"2.259.11",
"±",
"2.88Follow-up11.20",
"±",
"1.43",
"c9",
".74",
"±",
"1.91",
"EL.N",
"/",
"B.Ar",
"-LRB-",
"n/mm2",
"-RRB-",
"-LRB-",
"6.29",
"-RRB-",
"Baseline21",
".2",
"±",
"6.1321.0",
"±",
"6.49Follow-up24.5",
"±",
"3.6822.5",
"±",
"4.67",
"Tt.L.N",
"/",
"B.Ar",
".",
"-LRB-",
"n/mm2",
"-RRB-",
"-LRB-",
"22.34",
"-RRB-",
"Baseline233",
".9",
"±",
"28.2231.5",
"±",
"22.9Follow-up219.5",
"±",
"27.3231.1",
"±",
"19.6",
"a",
"Average",
"standard",
"deviation",
"calculated",
"from",
"all",
"quadruplicatesb",
"The",
"60",
"mg/day",
"and",
"120",
"mg/day",
"raloxifene",
"groups",
"were",
"combinedc",
"Statistically",
"significant",
"difference",
"-LRB-",
"P",
"=",
"0.014",
"-RRB-",
"from",
"baseline",
"value",
"As",
"empty",
"lacunae",
"are",
"the",
"result",
"of",
"osteocyte",
"apoptosis",
"and",
"are",
"only",
"removed",
"by",
"bone",
"remodeling",
",",
"changes",
"in",
"the",
"number",
"of",
"empty",
"lacunae",
"could",
"be",
"indicative",
"of",
"changes",
"in",
"osteocyte",
"apoptosis",
".",
"In",
"the",
"placebo",
"group",
",",
"the",
"percentage",
"of",
"empty",
"lacunae",
"-LRB-",
"EL.N",
"/",
"Tt.L.N",
"-RRB-",
"increased",
"significantly",
"after",
"2",
"years",
"-LRB-",
"also",
"shown",
"in",
"Fig.",
"2",
"-RRB-",
".",
"The",
"empty",
"lacunar",
"density",
"-LRB-",
"EL.N",
"/",
"B.Ar",
"-RRB-",
"showed",
"a",
"parallel",
"change",
",",
"but",
"this",
"was",
"not",
"significant",
".",
"In",
"the",
"raloxifene",
"group",
",",
"the",
"percentage",
"of",
"empty",
"lacunae",
"and",
"the",
"empty",
"lacunar",
"density",
"did",
"not",
"increase",
"significantly",
".",
"The",
"average",
"standard",
"deviation",
",",
"calculated",
"from",
"the",
"quadruplicate",
"analysis",
",",
"showed",
"that",
"the",
"variation",
"in",
"the",
"method",
"was",
"comparable",
"to",
"the",
"variation",
"between",
"individuals",
",",
"except",
"for",
"the",
"measurement",
"of",
"percent",
"positive",
"cells",
",",
"where",
"the",
"variation",
"between",
"the",
"individuals",
"was",
"much",
"higher",
".",
"Fig.",
"2Change",
"in",
"percentage",
"empty",
"lacunae",
"after",
"treatment",
"for",
"2",
"years",
"with",
"either",
"placebo",
"-LRB-",
"A",
"-RRB-",
"or",
"raloxifene",
"-LRB-",
"B",
"-RRB-",
".",
"Empty",
"lacunae",
"and",
"total",
"lacunae",
"were",
"counted",
"in",
"each",
"biopsy",
".",
"The",
"increase",
"in",
"the",
"placebo",
"group",
"was",
"significant",
"-LRB-",
"P",
"=",
"0.014",
"-RRB-",
"Associations",
"of",
"bone",
"remodeling",
"parameters",
"with",
"osteocyte",
"apoptosis",
"and",
"empty",
"lacunae",
"are",
"shown",
"in",
"Table",
"2",
".",
"At",
"baseline",
",",
"in",
"the",
"placebo",
"group",
"and",
"the",
"raloxifene",
"group",
"combined",
",",
"there",
"was",
"a",
"negative",
"correlation",
"of",
"the",
"histomorphometric",
"indices",
"-LRB-",
"BFR/BV",
",",
"OS/BS",
",",
"ES/BS",
",",
"and",
"Ocl.N",
"/",
"B.Ar",
"-RRB-",
"with",
"the",
"percent",
"positive",
"osteocytes",
"-LRB-",
"Pos.Ot.N",
"/",
"Tt.Ot.N",
"-RRB-",
".",
"Histomorphometric",
"indices",
"were",
"not",
"correlated",
"with",
"empty",
"lacunae",
".",
"The",
"regression",
"lines",
"for",
"BFR/BV",
"with",
"percent",
"apoptotic",
"osteocytes",
"and",
"percent",
"empty",
"lacunae",
"are",
"shown",
"in",
"Figure",
"3",
".",
"Correlations",
"between",
"biochemical",
"indices",
"-LRB-",
"BSAP",
",",
"osteocalcin",
",",
"and",
"CTX-1",
"-RRB-",
"and",
"percent",
"apoptotic",
"osteocytes",
"or",
"percent",
"empty",
"lacunae",
"were",
"not",
"found",
".",
"Table",
"2Association",
"of",
"histomorphometric",
"indices",
"and",
"biochemical",
"indices",
"of",
"bone",
"remodeling",
"with",
"osteocyte",
"apoptosis",
"-LRB-",
"Pos.Ot.N",
"/",
"Tt.Ot.N",
"-RRB-",
"and",
"empty",
"lacunae",
"-LRB-",
"E.L.N",
"/",
"Tt.L.N",
"-RRB-",
"Histomorphometric",
"indicesOS/BSBFR/BVES",
"/",
"BSOcl.N",
"/",
"B.Ar",
"%",
"Positive",
"osteocytes",
"-LRB-",
"Pos.Ot.N",
"/",
"Tt.Ot.N",
"-RRB-",
"r",
"=",
"−",
"0.64",
"r",
"=",
"−",
"0.67",
"r",
"=",
"−",
"0.48",
"r",
"=",
"−",
"0.43",
"P",
"=",
"0.0004",
"aP",
"=",
"0.001",
"aP",
"=",
"0.01",
"aP",
"=",
"0.03",
"a",
"%",
"Empty",
"lacunae",
"-LRB-",
"E.L.N",
"/",
"Tt.L.N",
"-RRB-",
"r",
"=",
"0.03",
"r",
"=",
"0.10",
"r",
"=",
"0.05",
"r",
"=",
"0.48",
"P",
"=",
"0.87",
"P",
"=",
"0.67",
"P",
"=",
"0.80",
"P",
"=",
"0.02",
"aBiochemical",
"indicesOsteocalcinBSAPCTX",
"%",
"Positive",
"osteocytes",
"-LRB-",
"Pos.Ot.N",
"/",
"Tt.Ot.N",
"-RRB-",
"r",
"=",
"−",
"0.35",
"r",
"=",
"−",
"0.43",
"r",
"=",
"−",
"0.40",
"P",
"=",
"0.13",
"P",
"=",
"0.05",
"P",
"=",
"0.09",
"%",
"Empty",
"lacunae",
"-LRB-",
"E.L.N",
"/",
"Tt.L.N",
"-RRB-",
"r",
"=",
"0.10",
"r",
"=",
"0.13",
"r",
"=",
"0.31",
"P",
"=",
"0.66",
"P",
"=",
"0.56",
"P",
"=",
"0.19",
"aStatistically",
"significant",
"-LRB-",
"P",
"<",
"0.05",
"-RRB-",
"Fig.",
"3Relationship",
"between",
"BFR/BV",
"and",
"osteocyte",
"apoptosis",
"at",
"baseline",
"in",
"the",
"placebo",
"and",
"raloxifene",
"groups",
"combined",
".",
"-LRB-",
"A",
"-RRB-",
"Association",
"between",
"BFR/BV",
"and",
"percent",
"positive",
"osteocytes",
".",
"Correlation",
"is",
"significant",
"for",
"placebo",
"and",
"raloxifene",
"groups",
"combined",
"-LRB-",
"P",
"=",
"0.001",
"-RRB-",
".",
"-LRB-",
"B",
"-RRB-",
"Association",
"between",
"BFR/BV",
"and",
"percentage",
"empty",
"lacunae",
".",
"No",
"significant",
"correlation",
"-LRB-",
"P",
"=",
"0.67",
"-RRB-",
".",
"●",
",",
"placebo",
"group",
";",
"▴",
",",
"raloxifene",
"group",
"No",
"changes",
"in",
"the",
"histomorphometric",
"indices",
"between",
"baseline",
"and",
"follow-up",
"were",
"found",
",",
"nor",
"were",
"there",
"any",
"differences",
"between",
"the",
"placebo",
"and",
"raloxifene",
"groups",
".",
"All",
"three",
"biochemical",
"markers",
"showed",
"a",
"significant",
"decrease",
"at",
"follow-up",
"compared",
"to",
"baseline",
"in",
"the",
"raloxifene",
"group",
"but",
"not",
"in",
"the",
"placebo",
"group",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"Table",
"3Results",
"of",
"baseline",
"and",
"follow-up",
"biopsies",
"for",
"histomorphometric",
"indices",
"and",
"biochemical",
"markers",
"of",
"bone",
"remodelingParameterTime",
"point",
"%",
"changePlacebo",
"-LRB-",
"n",
"=",
"11",
",",
"mean",
"±",
"SD",
"-RRB-",
"Raloxifenea",
"-LRB-",
"n",
"=",
"15",
",",
"mean",
"±",
"SD",
"-RRB-",
"OS/BS",
"-LRB-",
"%",
"-RRB-",
"Baseline10",
".2",
"±",
"6.89.9",
"±",
"5.4Follow-up7.5",
"±",
"3.211.6",
"±",
"4.6",
"BFR/BV",
"-LRB-",
"%",
"/",
"year",
"-RRB-",
"Baseline28",
".8",
"±",
"20.335.3",
"±",
"18.6Follow-up19.8",
"±",
"8.723.3",
"±",
"12.6",
"ES/BS",
"-LRB-",
"%",
"-RRB-",
"Baseline5",
".3",
"±",
"2.66.3",
"±",
"2.9Follow-up5.3",
"±",
"2.46.3",
"±",
"2.4",
"Ocl.N",
".",
"/",
"B.Ar",
"-LRB-",
"n/mm2",
"-RRB-",
"Baseline0",
".6",
"±",
"0.30.8",
"±",
"0.4Follow-up0.6",
"±",
"0.30.6",
"±",
"0.3",
"BSAP",
"-LRB-",
"μg/L",
"-RRB-",
"Baseline14",
".9",
"±",
"7.314.4",
"±",
"4.6Follow-up12.2",
"±",
"5.610.0",
"±",
"2.5",
"bOsteocalcin",
"-LRB-",
"ng/mL",
"-RRB-",
"Baseline22",
".9",
"±",
"10.625.5",
"±",
"9.1Follow-up18.2",
"±",
"3.816.1",
"±",
"3.1bCTX-1",
"-LRB-",
"μg/mmol",
"creatinine",
"-RRB-",
"Baseline283",
".9",
"±",
"267.0277.4",
"±",
"198.2Follow-up137.7",
"±",
"63.8132.3",
"±",
"53.0",
"baThe",
"60",
"mg/day",
"and",
"120",
"mg/day",
"groups",
"were",
"combinedbSignificantly",
"different",
"from",
"baseline",
"-LRB-",
"P",
"<",
"0.05",
"-RRB-",
"Discussion",
"We",
"investigated",
"the",
"effect",
"of",
"treatment",
"with",
"raloxifene",
"for",
"2",
"years",
"of",
"postmenopausal",
"osteoporotic",
"women",
"on",
"osteocyte",
"apoptosis",
"as",
"measured",
"by",
"activated",
"caspase-3",
"immunohistochemistry",
"in",
"iliac",
"crest",
"bone",
"biopsies",
".",
"Direct",
"comparison",
"of",
"follow-up",
"with",
"baseline",
"in",
"the",
"placebo",
"and",
"raloxifene",
"groups",
"did",
"not",
"show",
"differences",
"in",
"the",
"percent",
"positive",
"osteocytes",
".",
"This",
"suggests",
"that",
"raloxifene",
"has",
"little",
"or",
"no",
"influence",
"on",
"osteocyte",
"apoptosis",
".",
"We",
"did",
"find",
"a",
"significant",
"increase",
"in",
"the",
"percentage",
"of",
"empty",
"lacunae",
"at",
"2",
"years",
"in",
"the",
"placebo",
"group",
",",
"while",
"there",
"was",
"no",
"change",
"in",
"the",
"raloxifene",
"group",
".",
"This",
"lack",
"of",
"accumulation",
"of",
"empty",
"lacunae",
"in",
"the",
"raloxifene",
"group",
"could",
"be",
"the",
"consequence",
"of",
"an",
"inhibitory",
"effect",
"of",
"raloxifene",
"on",
"osteocyte",
"apoptosis",
".",
"At",
"baseline",
",",
"histomorphometric",
"indices",
"of",
"bone",
"remodeling",
"were",
"inversely",
"correlated",
"with",
"apoptotic",
"osteocytes",
"but",
"not",
"with",
"empty",
"lacunae",
".",
"Biochemical",
"markers",
"of",
"bone",
"remodeling",
"were",
"not",
"correlated",
"with",
"apoptotic",
"osteocytes",
"or",
"empty",
"lacunae",
".",
"This",
"is",
"the",
"first",
"study",
"to",
"investigate",
"the",
"effect",
"of",
"antiresorptive",
"treatment",
"on",
"osteocyte",
"apoptosis",
"in",
"human",
"bone",
"biopsies",
".",
"So",
"far",
",",
"the",
"effect",
"of",
"raloxifene",
"on",
"osteoblast",
"or",
"osteocyte",
"apoptosis",
"has",
"only",
"been",
"studied",
"in",
"in",
"vitro",
"studies",
".",
"Kousteni",
"et",
"al.",
"-LSB-",
"13",
"-RSB-",
"studied",
"the",
"effect",
"of",
"raloxifene",
"on",
"etoposide-induced",
"apoptosis",
"of",
"rat",
"calvarial",
"osteoblasts",
"and",
"did",
"not",
"find",
"protection",
"against",
"apoptosis",
".",
"On",
"the",
"other",
"hand",
",",
"Olivier",
"et",
"al.",
"-LSB-",
"19",
"-RSB-",
"found",
"that",
"raloxifene",
"protected",
"the",
"osteoblast-like",
"cell",
"line",
"MC3T3-E1",
"against",
"apoptosis",
"induced",
"by",
"a",
"high",
"concentration",
"of",
"nitric",
"oxide",
".",
"Comparable",
"clinical",
"studies",
"with",
"hormone",
"replacement",
"therapy",
"or",
"bisphosphonates",
"have",
"not",
"been",
"published",
",",
"but",
"in",
"vitro",
"studies",
"-LSB-",
"20",
",",
"21",
"-RSB-",
"and",
"studies",
"with",
"mice",
"-LSB-",
"22",
",",
"23",
"-RSB-",
"have",
"shown",
"that",
"both",
"these",
"treatments",
"have",
"an",
"inhibiting",
"effect",
"on",
"osteocyte",
"apoptosis",
"induced",
"by",
"glucocorticoids",
"or",
"etoposide",
".",
"The",
"difference",
"between",
"the",
"raloxifene",
"group",
"and",
"the",
"placebo",
"group",
"in",
"percent",
"empty",
"lacunae",
"provides",
"some",
"evidence",
"for",
"an",
"inhibitory",
"effect",
"of",
"raloxifene",
"on",
"osteocyte",
"apoptosis",
",",
"although",
"this",
"effect",
"was",
"not",
"reflected",
"in",
"the",
"empty",
"lacunar",
"density",
".",
"The",
"fact",
"that",
"apoptotic",
"osteocytes",
"and",
"empty",
"lacunae",
"change",
"differently",
"in",
"response",
"to",
"raloxifene",
"treatment",
"could",
"be",
"explained",
"by",
"the",
"comparatively",
"short",
"time",
"that",
"apoptosis",
"can",
"be",
"detected",
".",
"It",
"has",
"been",
"shown",
"that",
"nonviable",
"osteocytes",
"are",
"detectable",
"for",
"up",
"to",
"16",
"weeks",
"-LSB-",
"24",
"-RSB-",
",",
"although",
"remnants",
"of",
"apoptotic",
"cells",
",",
"such",
"as",
"apoptotic",
"bodies",
",",
"might",
"exist",
"a",
"little",
"longer",
".",
"Therefore",
",",
"the",
"cleaved",
"caspase-3-positive",
"osteocytes",
"that",
"were",
"detected",
"are",
"cells",
"that",
"became",
"apoptotic",
"in",
"the",
"last",
"16",
"weeks",
"of",
"the",
"treatment",
"period",
".",
"Moderate",
"changes",
"due",
"to",
"treatment",
"with",
"raloxifene",
"are",
"probably",
"not",
"detectable",
"in",
"such",
"a",
"short",
"period",
".",
"Empty",
"lacunae",
"remain",
"in",
"bone",
"until",
"bone",
"remodeling",
"will",
"remove",
"them",
",",
"and",
"this",
"period",
"is",
"longer",
"then",
"the",
"16",
"weeks",
"that",
"an",
"apoptotic",
"osteocyte",
"is",
"detectable",
".",
"Changes",
"in",
"bone",
"remodeling",
"could",
"have",
"influenced",
"the",
"percentage",
"of",
"apoptotic",
"osteocytes",
"and",
"empty",
"lacunae",
"that",
"we",
"found",
".",
"The",
"inverse",
"correlation",
"between",
"bone",
"remodeling",
"indices",
"and",
"osteocyte",
"apoptosis",
"at",
"baseline",
"indicates",
"that",
"the",
"level",
"of",
"osteocyte",
"apoptosis",
"is",
"indeed",
"associated",
"with",
"the",
"level",
"of",
"bone",
"remodeling",
".",
"In",
"our",
"opinion",
",",
"the",
"explanation",
"for",
"this",
"association",
"is",
"that",
"with",
"high",
"bone",
"remodeling",
"the",
"chance",
"that",
"apoptotic",
"osteocytes",
"are",
"removed",
"and",
"replaced",
"by",
"new",
"osteocytes",
"is",
"also",
"high",
"and",
",",
"therefore",
",",
"the",
"percentage",
"of",
"detected",
"apoptotic",
"osteocytes",
"is",
"low",
".",
"With",
"low",
"bone",
"remodeling",
"the",
"chance",
"that",
"apoptotic",
"osteocytes",
"are",
"removed",
"and",
"replaced",
"by",
"new",
"osteocytes",
"is",
"also",
"low",
"and",
",",
"therefore",
",",
"the",
"resulting",
"percentage",
"of",
"observed",
"apoptotic",
"osteocytes",
"is",
"high",
".",
"In",
"this",
"way",
",",
"bone",
"remodeling",
"partly",
"defines",
"the",
"percentage",
"of",
"apoptotic",
"osteocytes",
",",
"a",
"mechanism",
"which",
"has",
"already",
"been",
"suggested",
"by",
"Dunstan",
"et",
"al.",
"-LSB-",
"25",
"-RSB-",
".",
"This",
"dependence",
"of",
"the",
"level",
"of",
"osteocyte",
"apoptosis",
"on",
"the",
"level",
"of",
"bone",
"remodeling",
"complicates",
"the",
"detection",
"of",
"an",
"effect",
"of",
"a",
"treatment",
"on",
"osteocyte",
"apoptosis",
"if",
"that",
"treatment",
"also",
"has",
"an",
"effect",
"on",
"bone",
"remodeling",
".",
"In",
"this",
"study",
",",
"there",
"were",
"no",
"significant",
"effects",
"of",
"raloxifene",
"on",
"bone",
"remodeling",
"parameters",
"both",
"in",
"the",
"placebo",
"group",
"and",
"in",
"the",
"raloxifene",
"group",
";",
"however",
",",
"changes",
"in",
"individual",
"women",
"over",
"the",
"2-year",
"treatment",
"period",
"could",
"have",
"influenced",
"the",
"level",
"of",
"osteocyte",
"apoptosis",
"found",
"at",
"follow-up",
".",
"This",
"could",
"have",
"obscured",
"detection",
"of",
"a",
"possible",
"effect",
"of",
"raloxifene",
"on",
"osteocyte",
"apoptosis",
".",
"The",
"inverse",
"correlation",
"between",
"osteocyte",
"apoptosis",
"and",
"bone",
"remodeling",
"seems",
"to",
"be",
"in",
"contrast",
"with",
"the",
"hypothesis",
"put",
"forward",
"by",
"several",
"investigators",
"-LSB-",
"5",
",",
"26",
"-RSB-",
"that",
"viable",
"osteocytes",
"inhibit",
"bone",
"remodeling",
"and",
"that",
"lack",
"of",
"viable",
"osteocytes",
",",
"e.g.",
",",
"near",
"sites",
"of",
"microdamage",
",",
"attracts",
"bone",
"remodeling",
".",
"We",
"believe",
"that",
"our",
"results",
"do",
"not",
"contradict",
"this",
"hypothesis",
".",
"Attraction",
"of",
"osteoclasts",
"by",
"dead",
"osteocytes",
"or",
"by",
"lack",
"of",
"osteocytes",
"is",
"probably",
"a",
"local",
"process",
".",
"If",
"the",
"occurrence",
"of",
"dead",
"osteocytes",
"and",
"empty",
"lacunae",
"stimulates",
"bone",
"remodeling",
",",
"the",
"lacunae",
"are",
"more",
"quickly",
"removed",
"and",
"replaced",
"with",
"viable",
"osteocytes",
".",
"The",
"percent",
"empty",
"lacunae",
"was",
"not",
"correlated",
"to",
"histomorphometric",
"indices",
"of",
"bone",
"remodeling",
".",
"This",
"suggests",
"that",
"the",
"empty",
"lacunae",
"for",
"a",
"large",
"part",
"exist",
"and",
"increase",
"in",
"number",
"in",
"bone",
"that",
"is",
"not",
"participating",
"in",
"remodeling",
".",
"In",
"two",
"studies",
",",
"Qiu",
"et",
"al.",
"-LSB-",
"27",
",",
"28",
"-RSB-",
"have",
"made",
"the",
"distinction",
"between",
"superficial",
"bone",
"and",
"deep",
"bone",
",",
"i.e.",
",",
"bone",
"at",
"the",
"surface",
"of",
"trabeculae",
"and",
"bone",
"in",
"the",
"center",
"of",
"trabeculae",
".",
"They",
"postulated",
"that",
"deep",
"bone",
"is",
"remodeled",
"much",
"more",
"slowly",
"than",
"superficial",
"bone",
".",
"In",
"this",
"study",
",",
"we",
"did",
"not",
"make",
"a",
"distinction",
"between",
"superficial",
"bone",
"and",
"deep",
"bone",
",",
"but",
"it",
"is",
"possible",
"that",
"the",
"increase",
"in",
"empty",
"lacunae",
"that",
"we",
"found",
"primarily",
"occurred",
"in",
"deep",
"bone",
".",
"Biochemical",
"markers",
"of",
"bone",
"formation",
"and",
"resorption",
"were",
"not",
"correlated",
"with",
"osteocyte",
"apoptosis",
"or",
"with",
"empty",
"lacunae",
".",
"Biochemical",
"markers",
"reflect",
"bone",
"remodeling",
"in",
"the",
"whole",
"skeleton",
",",
"both",
"in",
"trabecular",
"bone",
"and",
"in",
"cortical",
"bone",
".",
"Correlations",
"between",
"such",
"general",
"markers",
"and",
"parameters",
"measured",
"locally",
"in",
"trabecular",
"bone",
"of",
"the",
"iliac",
"crest",
"are",
"possibly",
"more",
"difficult",
"to",
"find",
".",
"The",
"major",
"limitation",
"of",
"our",
"study",
"is",
"the",
"small",
"number",
"of",
"patients",
".",
"The",
"percentage",
"of",
"apoptotic",
"osteocytes",
"varied",
"considerably",
"between",
"individuals",
",",
"and",
"this",
"makes",
"it",
"difficult",
"to",
"find",
"significant",
"differences",
"between",
"such",
"small",
"groups",
".",
"The",
"variation",
"was",
"not",
"caused",
"by",
"variation",
"in",
"the",
"method",
",",
"as",
"shown",
"by",
"the",
"low",
"average",
"standard",
"deviation",
",",
"indicating",
"that",
"the",
"percentage",
"of",
"apoptotic",
"osteocytes",
"has",
"to",
"be",
"an",
"individual",
"characteristic",
".",
"Detection",
"of",
"cleaved",
"caspase-3",
",",
"a",
"key",
"protease",
"in",
"the",
"apoptotic",
"process",
",",
"is",
"an",
"established",
"method",
"for",
"measuring",
"apoptosis",
"-LSB-",
"29",
",",
"30",
"-RSB-",
";",
"and",
"it",
"has",
"recently",
"been",
"used",
"on",
"bone",
"tissue",
"-LSB-",
"31",
"-RSB-",
".",
"In",
"the",
"latter",
"study",
",",
"comparison",
"between",
"the",
"TUNEL",
"method",
"and",
"the",
"cleaved",
"caspase-3",
"method",
"showed",
"no",
"significant",
"differences",
".",
"We",
"confirmed",
"the",
"specificity",
"of",
"the",
"detection",
"of",
"cleaved",
"caspase-3",
"in",
"sections",
"of",
"human",
"ileum",
".",
"In",
"these",
"sections",
",",
"only",
"the",
"cells",
"which",
"are",
"expected",
"to",
"be",
"apoptotic",
"-LSB-",
"32",
"-RSB-",
"were",
"stained",
"by",
"our",
"method",
".",
"Necrotic",
"death",
"of",
"osteocytes",
"might",
"also",
"occur",
"in",
"bone",
";",
"however",
",",
"we",
"expect",
"that",
"necrotic",
"cell",
"death",
"is",
"low",
"and",
"not",
"responsive",
"to",
"interventions",
"such",
"as",
"estrogen",
",",
"glucocorticoids",
",",
"or",
"mechanical",
"loading",
".",
"The",
"average",
"percentage",
"apoptotic",
"osteocytes",
"we",
"found",
"was",
"somewhat",
"lower",
"than",
"what",
"Tomkinson",
"et",
"al.",
"-LSB-",
"8",
"-RSB-",
"found",
"in",
"their",
"study",
"in",
"young",
"women",
"who",
"had",
"received",
"gonadotropin-releasing",
"hormone",
"analogue",
"therapy",
".",
"This",
"could",
"reflect",
"differences",
"in",
"age",
"and",
"in",
"treatment",
"between",
"the",
"two",
"studies",
".",
"The",
"number",
"of",
"empty",
"lacunae",
"that",
"we",
"observed",
"could",
"be",
"an",
"overestimation",
"caused",
"by",
"sectioning",
"artefacts",
"or",
"the",
"decalcification",
"step",
"in",
"the",
"immunohistochemistry",
"method",
".",
"We",
"do",
"not",
"know",
"to",
"what",
"extent",
"this",
"occurs",
",",
"but",
"this",
"would",
"be",
"equal",
"in",
"all",
"biopsies",
".",
"Goldner-stained",
"sections",
"showed",
"more",
"sectioning",
"artefacts",
",",
"and",
"therefore",
",",
"empty",
"lacunae",
"in",
"these",
"sections",
"were",
"not",
"counted",
".",
"Inconsistency",
"between",
"the",
"change",
"in",
"percent",
"empty",
"lacunae",
"and",
"empty",
"lacunar",
"density",
"in",
"the",
"placebo",
"group",
"is",
"probably",
"also",
"related",
"to",
"the",
"small",
"number",
"of",
"patients",
"studied",
".",
"In",
"this",
"study",
",",
"we",
"did",
"not",
"find",
"clear",
"evidence",
"that",
"treatment",
"with",
"raloxifene",
"influences",
"osteocyte",
"apoptosis",
".",
"No",
"change",
"in",
"the",
"percentage",
"of",
"apoptotic",
"osteocytes",
"was",
"detected",
",",
"while",
"the",
"changes",
"in",
"the",
"empty",
"lacunae",
"were",
"inconclusive",
"and",
"at",
"best",
"indirect",
"evidence",
"that",
"osteocyte",
"apoptosis",
"had",
"been",
"changed",
"by",
"raloxifene",
".",
"Compared",
"to",
"estrogen",
",",
"raloxifene",
"treatment",
"shows",
"a",
"similar",
"reduction",
"of",
"vertebral",
"fractures",
"-LRB-",
"but",
"not",
"nonvertebral",
"fractures",
"-RRB-",
"-LSB-",
"10",
",",
"33",
"-RSB-",
"but",
"has",
"less",
"potent",
"positive",
"effects",
"on",
"bone",
"quality",
"assessed",
"by",
"BMD",
"measurement",
"and",
"bone",
"histomorphometry",
"-LSB-",
"34",
",",
"35",
"-RSB-",
".",
"It",
"is",
"conceivable",
"that",
"the",
"weaker",
"effect",
"of",
"raloxifene",
"on",
"bone",
"is",
"related",
"to",
"only",
"a",
"weak",
"antiapoptotic",
"effect",
"or",
"lack",
"of",
"antiapoptotic",
"action",
".",
"This",
"is",
",",
"however",
",",
"difficult",
"to",
"measure",
"in",
"a",
"study",
"with",
"such",
"a",
"small",
"number",
"of",
"subjects",
".",
"It",
"would",
"be",
"of",
"interest",
"to",
"compare",
"the",
"effects",
"of",
"different",
"antiresorptive",
"treatments",
"on",
"osteocyte",
"apoptosis",
"in",
"larger",
"clinical",
"studies",
"and",
"to",
"compare",
"the",
"mechanisms",
"by",
"which",
"they",
"exert",
"their",
"effect",
".",
"In",
"conclusion",
",",
"we",
"did",
"not",
"find",
"evidence",
"for",
"an",
"effect",
"of",
"raloxifene",
"treatment",
"on",
"osteocyte",
"apoptosis",
"in",
"postmenopausal",
"women",
",",
"but",
"small",
"effects",
"of",
"raloxifene",
"treatment",
"on",
"osteocyte",
"apoptosis",
"can",
"not",
"be",
"excluded",
".",
"The",
"percent",
"of",
"apoptotic",
"osteocytes",
"was",
"dependent",
"on",
"the",
"level",
"of",
"bone",
"remodeling",
"in",
"an",
"individual",
"."
] | [
"O",
"O",
"B",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Clin_Auton_Res-3-1-1914255 | [
"Leg",
"blood",
"flow",
"measurements",
"using",
"venous",
"occlusion",
"plethysmography",
"during",
"head-up",
"tilt",
"We",
"tested",
"whether",
"venous",
"occlusion",
"plethysmography",
"-LRB-",
"VOP",
"-RRB-",
"is",
"an",
"appropriate",
"method",
"to",
"measure",
"calf",
"blood",
"flow",
"-LRB-",
"CBF",
"-RRB-",
"during",
"head-up",
"tilt",
"-LRB-",
"HUT",
"-RRB-",
".",
"CBF",
"measured",
"with",
"VOP",
"was",
"compared",
"with",
"superficial",
"femoral",
"artery",
"blood",
"flow",
"as",
"measured",
"by",
"Doppler",
"ultrasound",
"during",
"incremental",
"tilt",
"angles",
".",
"Measurements",
"of",
"both",
"methods",
"correlated",
"well",
"-LRB-",
"r",
"=",
"0.86",
"-RRB-",
".",
"Reproducibility",
"of",
"VOP",
"was",
"fair",
"in",
"supine",
"position",
"and",
"30",
"°",
"HUT",
"-LRB-",
"CV",
":",
"11",
"%",
"--",
"15",
"%",
"-RRB-",
".",
"This",
"indicates",
"that",
"VOP",
"is",
"an",
"applicable",
"tool",
"to",
"measure",
"leg",
"blood",
"flow",
"during",
"HUT",
",",
"especially",
"up",
"to",
"30",
"°",
"HUT",
".",
"Introduction",
"The",
"main",
"mechanism",
"responsible",
"for",
"maintaining",
"blood",
"pressure",
"during",
"orthostatic",
"stress",
"is",
"arteriolar",
"vasoconstriction",
"-LSB-",
"6",
"-RSB-",
".",
"In",
"order",
"to",
"quantify",
"the",
"response",
"in",
"vascular",
"resistance",
"to",
"postural",
"stress",
",",
"in",
"particular",
"in",
"the",
"leg",
",",
"it",
"is",
"necessary",
"to",
"measure",
"leg",
"blood",
"flow",
"accurately",
".",
"Venous",
"occlusion",
"plethysmography",
"-LRB-",
"VOP",
"-RRB-",
"is",
"a",
"well-established",
"method",
"to",
"measure",
"calf",
"blood",
"flow",
",",
"which",
"has",
"been",
"used",
"in",
"a",
"variety",
"of",
"conditions",
",",
"i.e.",
"exercise",
"-LSB-",
"13",
"-RSB-",
"and",
"reactive",
"hyperaemia",
"-LSB-",
"17",
"-RSB-",
".",
"However",
",",
"its",
"use",
"for",
"measuring",
"leg",
"blood",
"flow",
"in",
"standing",
"or",
"head-up",
"tilt",
"-LRB-",
"HUT",
"-RRB-",
"position",
"remains",
"controversial",
",",
"since",
"an",
"empty",
"venous",
"system",
"has",
"been",
"suggested",
"to",
"be",
"requisite",
"for",
"this",
"method",
"-LSB-",
"3",
",",
"4",
",",
"12",
"-RSB-",
".",
"Since",
"in",
"the",
"upright",
"posture",
"veins",
"are",
"already",
"distended",
",",
"due",
"to",
"an",
"increase",
"in",
"hydrostatic",
"pressure",
",",
"further",
"collection",
"of",
"blood",
"may",
"be",
"defined",
"by",
"venous",
"compliance",
"rather",
"than",
"arterial",
"inflow",
".",
"This",
"may",
"question",
"the",
"validity",
"of",
"measuring",
"blood",
"flow",
"using",
"VOP",
"in",
"dependent",
"limbs",
"or",
"in",
"the",
"upright",
"posture",
".",
"Although",
"VOP",
"has",
"been",
"used",
"during",
"HUT",
",",
"accuracy",
"or",
"reproducibility",
"of",
"this",
"method",
"has",
"not",
"been",
"reported",
"-LSB-",
"22",
"--",
"24",
"-RSB-",
".",
"Therefore",
",",
"the",
"purpose",
"of",
"this",
"study",
"was",
"to",
"assess",
"the",
"applicability",
"and",
"reproducibility",
"of",
"VOP",
"for",
"blood",
"flow",
"measurements",
"in",
"the",
"calf",
"-LRB-",
"CBF",
"-RRB-",
"during",
"HUT",
"at",
"different",
"tilt",
"angles",
"-LRB-",
"0",
"°",
",",
"30",
"°",
",",
"45",
"°",
",",
"and",
"70",
"°",
"-RRB-",
".",
"In",
"a",
"subgroup",
"CBF",
"measurements",
"by",
"VOP",
"were",
"compared",
"with",
"blood",
"flow",
"measurements",
"using",
"Doppler",
"ultrasound",
".",
"To",
"assess",
"reproducibility",
"of",
"VOP",
",",
"measurements",
"were",
"performed",
"twice",
".",
"Materials",
"and",
"methods",
"Subjects",
"In",
"total",
"eighteen",
"healthy",
",",
"normotensive",
"subjects",
"aged",
"21",
"--",
"30",
"years",
"volunteered",
"to",
"participate",
"in",
"this",
"study",
".",
"In",
"eight",
"subjects",
"blood",
"flow",
"measurements",
"using",
"VOP",
"were",
"compared",
"with",
"blood",
"flow",
"measurements",
"using",
"Doppler",
"ultrasound",
"-LRB-",
"DU",
"-RRB-",
".",
"In",
"nine",
"other",
"subjects",
"the",
"VOP",
"measurements",
"were",
"repeated",
"within",
"two",
"weeks",
"to",
"assess",
"reproducibility",
".",
"Baseline",
"subject",
"characteristics",
"are",
"illustrated",
"in",
"Table",
"1",
".",
"None",
"of",
"the",
"subjects",
"used",
"cardiovascular",
"medication",
"or",
"suffered",
"from",
"cardiovascular",
"disease",
".",
"All",
"were",
"non-smokers",
"and",
"had",
"no",
"history",
"of",
"syncope",
".",
"All",
"volunteers",
"refrained",
"from",
"caffeine",
"and",
"alcohol",
"for",
"at",
"least",
"eighteen",
"hours",
"and",
"from",
"food",
"intake",
"for",
"three",
"hours",
"prior",
"to",
"testing",
".",
"The",
"local",
"medical",
"ethical",
"committee",
"approved",
"the",
"study",
".",
"All",
"subjects",
"gave",
"their",
"written",
"informed",
"consent",
".",
"Table",
"1Subject",
"characteristicsMean",
"±",
"SDAge",
",",
"years25",
"±",
"4Length",
",",
"cm187",
"±",
"9Body",
"mass",
",",
"kg80",
"±",
"11Calf",
"circumference",
",",
"cm38",
"±",
"2Systolic",
"blood",
"pressure",
",",
"mmHg125",
"±",
"12Diastolic",
"blood",
"pressure",
",",
"mmHg74",
"±",
"5Heart",
"rate",
",",
"bpm64",
"±",
"10",
"Measurements",
"The",
"subjects",
"lay",
"in",
"supine",
"position",
"on",
"a",
"manually",
"driven",
"tilt",
"table",
"and",
"were",
"supported",
"by",
"a",
"saddle",
".",
"The",
"venous",
"occlusion",
"cuff",
"was",
"placed",
"around",
"the",
"right",
"thigh",
"and",
"connected",
"to",
"a",
"rapid",
"cuff",
"inflator",
"-LRB-",
"Hokanson",
"Stopler",
"E-20",
",",
"Bellevue",
",",
"WA",
"98005",
",",
"USA",
"-RRB-",
".",
"The",
"mercury-in-silastic",
"strain",
"gauge",
"was",
"placed",
"around",
"the",
"thickest",
"part",
"of",
"the",
"calf",
"and",
"was",
"connected",
"to",
"the",
"plethysmograph",
".",
"Red",
"blood",
"cell",
"velocities",
"and",
"systolic",
"and",
"diastolic",
"vessel",
"diameter",
"of",
"the",
"right",
"superficial",
"femoral",
"artery",
"were",
"measured",
"with",
"a",
"pulsed-colour",
"Doppler",
"device",
",",
"which",
"is",
"described",
"in",
"detail",
"elsewhere",
"-LSB-",
"8",
"-RSB-",
".",
"Reproducibility",
"of",
"DU",
"in",
"the",
"superficial",
"femoral",
"artery",
"was",
"1.5",
"%",
"for",
"diameter",
",",
"14",
"%",
"for",
"blood",
"flow",
"-LSB-",
"9",
"-RSB-",
".",
"Protocol",
"Supine",
"blood",
"flow",
"measurements",
"using",
"DU",
"and",
"VOP",
"were",
"performed",
"after",
"subjects",
"were",
"30",
"minutes",
"quietly",
"in",
"supine",
"position",
".",
"When",
"the",
"subject",
"was",
"2",
"minutes",
"into",
"30",
"°",
"HUT",
",",
"DU",
"measurements",
"started",
"until",
"3.5",
"minutes",
"where",
"after",
"CBF",
"continued",
"for",
"another",
"3.5",
"minutes",
".",
"The",
"venous",
"occlusion",
"pressure",
"was",
"adjusted",
"to",
"the",
"hydrostatic",
"pressure",
"column",
",",
"which",
"is",
"derived",
"from",
"the",
"vertical",
"distance",
"heart",
"level",
"--",
"thigh",
"level",
"and",
"was",
"calculated",
"as",
"the",
"sinus",
"of",
"the",
"tilt",
"angle",
"*",
"actual",
"distance",
"heart",
"--",
"thigh",
",",
"and",
"was",
"75",
"mmHg",
"during",
"30",
"°",
"HUT",
".",
"The",
"same",
"procedure",
"was",
"repeated",
"for",
"45",
"°",
",",
"and",
"70",
"°",
"HUT",
"using",
"a",
"venous",
"occlusion",
"pressure",
"of",
"87",
",",
"and",
"105",
"mmHg",
",",
"respectively",
".",
"Data",
"analysis",
"CBF",
"in",
"ml",
"·",
"100",
"ml",
"−",
"1",
"·",
"minute",
"−",
"1",
"was",
"calculated",
"as",
"described",
"previously",
"-LSB-",
"25",
"-RSB-",
"and",
"values",
"from",
"minute",
"3.5",
"until",
"7",
"were",
"averaged",
"to",
"calculate",
"CBF",
"for",
"each",
"HUT",
"position",
".",
"Doppler",
"ultrasound",
"measurements",
"were",
"analyzed",
"as",
"described",
"before",
"-LSB-",
"8",
"-RSB-",
"to",
"obtain",
"superficial",
"femoral",
"artery",
"blood",
"flow",
".",
"To",
"compare",
"CBF",
"measurements",
"with",
"superficial",
"femoral",
"artery",
"blood",
"flow",
",",
"CBF",
"measurements",
"in",
"ml",
"·",
"100",
"ml",
"−",
"1",
"minutes",
"−",
"1",
"were",
"multiplied",
"by",
"lower",
"leg",
"volume",
"-LRB-",
"ml",
"-RRB-",
"as",
"measured",
"by",
"water",
"displacement",
".",
"Statistics",
"Data",
"are",
"expressed",
"as",
"mean",
"±",
"standard",
"deviation",
"-LRB-",
"SD",
"-RRB-",
".",
"The",
"results",
"of",
"each",
"method",
"were",
"correlated",
"and",
"agreement",
"evaluated",
"according",
"to",
"the",
"method",
"described",
"by",
"Bland",
"and",
"Altman",
"-LSB-",
"5",
"-RSB-",
".",
"The",
"limits",
"of",
"agreement",
"are",
"defined",
"as",
"the",
"mean",
"of",
"the",
"relative",
"differences",
"between",
"the",
"two",
"methods",
"±",
"2",
"SD",
".",
"Student",
"'s",
"t-test",
"was",
"used",
"to",
"test",
"for",
"systemic",
"differences",
"between",
"the",
"two",
"methods",
".",
"Reproducibility",
"of",
"the",
"CBF",
"was",
"assessed",
"by",
"calculating",
"the",
"coefficient",
"of",
"variance",
"-LRB-",
"CV",
"-RRB-",
"from",
"two",
"measurements",
"-LSB-",
"25",
"-RSB-",
".",
"To",
"determine",
"whether",
"hemodynamic",
"responses",
"were",
"dependent",
"on",
"the",
"angle",
"of",
"tilt",
"one-way",
"repeated",
"measures",
"ANOVA",
"'s",
"were",
"applied",
".",
"If",
"significant",
"effects",
"of",
"tilt",
"were",
"observed",
"post-hoc",
"paired",
"t-tests",
"with",
"Bonferroni",
"correction",
"for",
"multiple",
"testing",
"were",
"used",
".",
"A",
"P-value",
"of",
"<",
"0.05",
"was",
"considered",
"to",
"indicate",
"significance",
".",
"Results",
"In",
"five",
"volunteers",
",",
"CBF",
"could",
"not",
"be",
"measured",
"during",
"70",
"°",
"head-up",
"tilt",
"-LRB-",
"HUT",
"-RRB-",
",",
"due",
"to",
"a",
"poor",
"plethysmography",
"signal",
"or",
"near",
"fainting",
"of",
"the",
"subject",
".",
"Hemodynamic",
"responses",
"to",
"HUT",
"-LRB-",
"Figure",
"1",
"-RRB-",
"CBF",
"and",
"superficial",
"femoral",
"artery",
"blood",
"flow",
"-LRB-",
"BF",
"SFA",
"-RRB-",
"decreased",
"significantly",
"from",
"supine",
"to",
"30",
"°",
"with",
"no",
"further",
"decrease",
"with",
"increasing",
"tilt",
"angle",
"-LRB-",
"Figure",
"1",
"-RRB-",
".",
"The",
"relative",
"decrease",
"in",
"CBF",
"-LRB-",
"46",
"%",
"±",
"11",
"%",
"-RRB-",
"from",
"supine",
"to",
"30",
"°",
"was",
"significantly",
"larger",
"than",
"the",
"decrease",
"in",
"BF",
"SFA",
"-LRB-",
"40",
"%",
"±",
"12",
"%",
"-RRB-",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
".",
"Fig.",
"1Absolute",
"values",
"of",
"calf",
"blood",
"flow",
"-LRB-",
"CBF",
"-RRB-",
"measured",
"with",
"venous",
"occlusion",
"plethysmography",
"and",
"superficial",
"femoral",
"artery",
"blood",
"flow",
"-LRB-",
"BF",
"SFA",
"-RRB-",
",",
"heart",
"rate",
"-LRB-",
"HR",
"-RRB-",
"and",
"mean",
"arterial",
"pressure",
"-LRB-",
"MAP",
"-RRB-",
"during",
"supine",
"position",
",",
"30",
"°",
",",
"45",
"°",
",",
"and",
"70",
"°",
"HUT",
".",
"One-way",
"repeated",
"measures",
"ANOVA",
"showed",
"a",
"significant",
"effect",
"of",
"tilt",
"for",
"all",
"parameters",
".",
"*",
"P",
"<",
"0.05",
"and",
"indicates",
"significantly",
"different",
"from",
"the",
"position",
"before",
".",
"■",
"=",
"supine",
";",
"=",
"30",
"°",
"HUT",
";",
"=",
"45",
"°",
"HUT",
";",
"□",
"=",
"70",
"°",
"HUT",
"Agreement",
"VOP",
"and",
"DU",
"The",
"Pearson",
"correlation",
"between",
"the",
"two",
"methods",
"was",
"0.86",
"-LRB-",
"P",
"<",
"0.001",
"-RRB-",
"for",
"all",
"data",
"points",
"-LRB-",
"Figure",
"2",
"-RRB-",
".",
"The",
"agreement",
"between",
"the",
"two",
"methods",
"was",
"evaluated",
"by",
"plotting",
"the",
"relative",
"difference",
"in",
"each",
"measurement",
"against",
"the",
"mean",
"for",
"all",
"data",
"points",
"and",
"separated",
"for",
"the",
"different",
"tilt",
"angles",
"-LRB-",
"Figure",
"3",
"-RRB-",
".",
"The",
"relative",
"mean",
"difference",
"-LRB-",
"-LRB-",
"VOP",
"--",
"DU",
"-RRB-",
"/",
"DU",
"-RRB-",
"was",
"−",
"14",
"%",
"±",
"22",
"%",
"for",
"all",
"data",
"points",
"in",
"supine",
"position",
"and",
"HUT",
"indicating",
"that",
"overall",
"CBF",
"-LRB-",
"VOP",
"-RRB-",
"is",
"lower",
"than",
"BF",
"SFA",
"-LRB-",
"DU",
"-RRB-",
";",
"for",
"supine",
"position",
"the",
"relative",
"mean",
"difference",
"between",
"VOP",
"and",
"DU",
"was",
"1.5",
"%",
"±",
"24",
"%",
";",
"for",
"30",
"°",
":",
"−",
"13",
"%",
"±",
"23",
"%",
";",
"for",
"45",
"°",
":",
"−",
"23",
"%",
"±",
"19",
"%",
";",
"for",
"70",
"°",
":",
"−",
"23",
"%",
"±",
"15",
"%",
".",
"Limits",
"of",
"agreement",
"for",
"all",
"data",
"points",
"in",
"supine",
"position",
"and",
"during",
"HUT",
"were",
"−",
"58",
"%",
"to",
"31",
"%",
"and",
"became",
"smaller",
"during",
"HUT",
".",
"The",
"limits",
"of",
"agreement",
"are",
"reasonable",
",",
"although",
"CBF",
"during",
"HUT",
"is",
"lower",
"than",
"BF",
"SFA",
".",
"Fig.",
"2Blood",
"flow",
"in",
"the",
"superficial",
"femoral",
"artery",
"-LRB-",
"BF",
"SFA",
"-RRB-",
"measured",
"by",
"Doppler",
"ultraound",
"during",
"different",
"angles",
"of",
"head-up",
"tilt",
"versus",
"calf",
"blood",
"flow",
"-LRB-",
"CBF",
"-RRB-",
"measured",
"by",
"venous",
"occlusion",
"plethysmography",
"corrected",
"for",
"lower",
"leg",
"volume",
".",
"Pearson",
"correlation",
"coefficient",
"is",
"0.86",
"Fig.",
"3Relative",
"difference",
"between",
"the",
"blood",
"flow",
"measured",
"by",
"venous",
"occlusion",
"plethysmography",
"-LRB-",
"VOP",
"-RRB-",
"and",
"the",
"superficial",
"femoral",
"artery",
"blood",
"flow",
"measured",
"by",
"Doppler",
"ultrasound",
"-LRB-",
"DU",
"-RRB-",
"versus",
"the",
"mean",
"of",
"both",
"flow",
"for",
"each",
"individual",
"subject",
"at",
"different",
"tilt",
"angles",
"Reproducibility",
"of",
"VOP",
"during",
"head-up",
"tilt",
"The",
"coefficient",
"of",
"variation",
"-LRB-",
"CV",
"-RRB-",
"of",
"CBF",
"ranged",
"between",
"8.7",
"%",
"and",
"15.0",
"%",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"In",
"70",
"°",
"HUT",
",",
"the",
"CV",
"for",
"both",
"parameters",
"was",
"calculated",
"over",
"four",
"subjects",
"only",
".",
"Table",
"2Values",
"of",
"calf",
"blood",
"flow",
"-LRB-",
"n",
"=",
"9",
"-RRB-",
"SubjectSupine30",
"°",
"HUT45",
"°",
"HUT70",
"°",
"HUT",
"-LRB-",
"n",
"=",
"4",
"-RRB-",
"test",
"1test",
"2test",
"1test",
"2test",
"1test",
"2test",
"1test",
"2Mean",
"±",
"SD2",
".6",
"±",
"0.62.6",
"±",
"0.81.3",
"±",
"0.31.3",
"±",
"0.3",
"1.1",
"±",
"0.31.1",
"±",
"0.21.1",
"±",
"0.2",
"n",
"=",
"41.2",
"±",
"0.2",
"n",
"=",
"4",
"%",
"change",
"±",
"SD",
"−",
"45",
"±",
"11",
"−",
"49",
"±",
"12",
"−",
"54",
"±",
"11",
"−",
"57",
"±",
"13",
"−",
"44",
"±",
"17",
"−",
"44",
"±",
"14CV15",
".0",
"%",
"-LRB-",
"CI",
"10.1",
"--",
"29.1",
"-RRB-",
"11.0",
"%",
"-LRB-",
"CI",
"7.4",
"--",
"21.3",
"-RRB-",
"14.9",
"%",
"-LRB-",
"CI",
"10.0",
"--",
"28.9",
"-RRB-",
"8.7",
"%",
"-LRB-",
"CI",
"4.9",
"--",
"33.2",
"-RRB-",
"Values",
"of",
"calf",
"blood",
"flow",
"in",
"ml",
"·",
"100",
"ml",
"−",
"1",
"·",
"minute",
"−",
"1",
"and",
"mean",
"absolute",
"and",
"relative",
"data",
"±",
"SD",
"in",
"supine",
"position",
",",
"30",
"°",
",",
"45",
"°",
",",
"and",
"70",
"°",
"head-up",
"tilt",
"-LRB-",
"HUT",
"-RRB-",
"for",
"the",
"first",
"and",
"second",
"test",
".",
"Coefficients",
"of",
"Variation",
"-LRB-",
"CV",
"-RRB-",
".",
"Missing",
"data",
"in",
"70",
"°",
"HUT",
"are",
"due",
"to",
"near",
"fainting",
"or",
"a",
"poor",
"plethysmography",
"signal",
".",
"Discussion",
"Calf",
"blood",
"flow",
"-LRB-",
"CBF",
"-RRB-",
"measured",
"with",
"VOP",
"correlates",
"well",
"with",
"superficial",
"femoral",
"artery",
"blood",
"flow",
"-LRB-",
"BF",
"SFA",
"-RRB-",
"measured",
"with",
"DU",
",",
"and",
"can",
"be",
"measured",
"reproducibly",
"during",
"HUT",
".",
"Since",
"the",
"most",
"profound",
"changes",
"in",
"blood",
"flow",
"with",
"both",
"techniques",
"were",
"already",
"measured",
"in",
"30",
"°",
"HUT",
",",
"and",
"the",
"increase",
"in",
"hydrostatic",
"and",
"venous",
"pressure",
",",
"and",
"concomitant",
"technical",
"difficulties",
"are",
"smallest",
"from",
"supine",
"to",
"30",
"°",
"HUT",
"we",
"recommend",
"to",
"use",
"VOP",
"for",
"leg",
"blood",
"flow",
"measurements",
"during",
"HUT",
"up",
"to",
"30",
"°",
".",
"The",
"decrease",
"in",
"leg",
"blood",
"flow",
"assessed",
"with",
"VOP",
"and",
"DU",
",",
"is",
"comparable",
"to",
"tilt-induced",
"blood",
"flow",
"changes",
"in",
"other",
"studies",
"using",
"DU",
"-LRB-",
"33",
"%",
"--",
"59",
"%",
"-RRB-",
"-LSB-",
"2",
",",
"7",
",",
"10",
",",
"11",
"-RSB-",
".",
"The",
"strong",
"relationship",
"between",
"VOP",
"and",
"DU",
"blood",
"flow",
"measurements",
"in",
"the",
"present",
"study",
"is",
"in",
"line",
"with",
"previous",
"studies",
"reporting",
"correlation",
"coefficients",
"varying",
"from",
"0.57",
"to",
"0.99",
"at",
"rest",
"and",
"during",
"exercise",
"-LSB-",
"14",
",",
"16",
",",
"27",
"-RSB-",
".",
"Head-up",
"tilt",
"affects",
"muscle",
"blood",
"flow",
"more",
"than",
"skin",
"blood",
"flow",
"-LSB-",
"21",
",",
"28",
"-RSB-",
".",
"Since",
"skin",
"blood",
"flow",
"contributes",
"more",
"to",
"superficial",
"femoral",
"blood",
"flow",
"than",
"to",
"calf",
"blood",
"flow",
",",
"this",
"may",
"explain",
"the",
"observed",
"discrepancy",
"between",
"the",
"decrease",
"in",
"CBF",
"-LRB-",
"∼",
"48",
"%",
"-RRB-",
"versus",
"the",
"decrease",
"in",
"superficial",
"femoral",
"artery",
"blood",
"flow",
"-LRB-",
"∼",
"40",
"%",
"-RRB-",
"in",
"response",
"to",
"HUT",
".",
"Reproducibility",
"of",
"baseline",
"CBF",
"-LRB-",
"15.0",
"%",
"-RRB-",
"is",
"in",
"range",
"with",
"other",
"studies",
"using",
"similar",
"techniques",
"to",
"measure",
"leg",
"blood",
"flow",
"-LSB-",
"1",
",",
"18",
",",
"25",
"-RSB-",
".",
"The",
"coefficient",
"of",
"variation",
"of",
"CBF",
"during",
"HUT",
"was",
"even",
"better",
"-LRB-",
"11.0",
"%",
"--",
"17.9",
"%",
"-RRB-",
",",
"which",
"indicates",
"that",
"VOP",
"is",
"a",
"reproducible",
"tool",
"to",
"measure",
"tilt-induced",
"vasoconstriction",
"repetitively",
".",
"The",
"low",
"coefficients",
"of",
"variation",
"of",
"CBF",
"during",
"70",
"°",
"-LRB-",
"8.7",
"%",
"--",
"8.9",
"%",
"-RRB-",
"are",
"not",
"representative",
"since",
"these",
"coefficients",
"of",
"variation",
"were",
"calculated",
"over",
"no",
"more",
"than",
"4",
"subjects",
".",
"Not",
"all",
"subjects",
"were",
"able",
"to",
"abstain",
"from",
"moving",
"their",
"legs",
"in",
"70",
"°",
"HUT",
"position",
",",
"and",
"some",
"subjects",
"fainted",
"in",
"this",
"position",
".",
"Moreover",
",",
"the",
"quality",
"of",
"the",
"plethysmographic",
"tracing",
"became",
"worse",
"at",
"70",
"°",
"HUT",
"whereas",
"at",
"the",
"lower",
"tilt",
"angles",
"the",
"plethysmography",
"signal",
"is",
"of",
"good",
"quality",
"indicated",
"by",
"the",
"volume",
"pulsations",
"in",
"the",
"plethysmographic",
"tracing",
"for",
"the",
"period",
"of",
"venous",
"occlusion",
".",
"Our",
"data",
"and",
"previous",
"studies",
"-LSB-",
"15",
",",
"19",
",",
"20",
",",
"26",
"-RSB-",
"show",
"that",
"at",
"30",
"°",
"HUT",
"peripheral",
"vascular",
"responses",
"are",
"accomplished",
"to",
"a",
"large",
"extent",
".",
"The",
"increase",
"in",
"hydrostatic",
"pressure",
"and",
"concomitant",
"increase",
"in",
"venous",
"pressure",
"is",
"low",
"at",
"30",
"°",
".",
"From",
"Figure",
"4B",
"it",
"can",
"be",
"concluded",
"that",
"at",
"30",
"°",
"HUT",
"venous",
"compliance",
"is",
"still",
"at",
"the",
"steep",
"portion",
"of",
"the",
"venous",
"compliance",
"curve",
"whereas",
"during",
"45",
"°",
",",
"and",
"70",
"°",
"HUT",
"the",
"venous",
"compliance",
"has",
"shifted",
"to",
"the",
"non-linear",
"part",
".",
"At",
"30",
"°",
"HUT",
"increase",
"of",
"the",
"plethysmography",
"signal",
"during",
"venous",
"occlusion",
"is",
"linear",
"while",
"at",
"45",
"°",
"and",
"70",
"°",
"HUT",
",",
"venous",
"distensibility",
"is",
"reduced",
"and",
"consequently",
"results",
"in",
"a",
"non-linear",
"increase",
"in",
"leg",
"volume",
"during",
"inflation",
"of",
"the",
"venous",
"occlusion",
"cuffs",
",",
"which",
"is",
"illustrated",
"in",
"Figure",
"5",
".",
"We",
"therefore",
"recommend",
"using",
"VOP",
"at",
"30",
"°",
"HUT",
".",
"For",
"studies",
"focussing",
"on",
"syncope",
"at",
"the",
"endpoint",
"of",
"HUT",
",",
"which",
"requires",
"larger",
"tilt",
"angles",
",",
"other",
"techniques",
"to",
"measure",
"leg",
"blood",
"flow",
"should",
"be",
"used",
".",
"Fig.",
"4",
"-LRB-",
"A",
"-RRB-",
"Pressure-Volume",
"curve",
"and",
"-LRB-",
"B",
"-RRB-",
"Pressure",
"Compliance",
"curve",
"based",
"on",
"data",
"of",
"a",
"similar",
"group",
"of",
"volunteers",
"measured",
"by",
"venous",
"occlusion",
"plethysmography",
"at",
"different",
"cuff",
"occlusion",
"pressures",
"-LRB-",
"for",
"method",
"and",
"protocol",
"see",
"de",
"Groot",
"et",
"al.",
",",
"Journal",
"of",
"applied",
"Physiology",
",",
"2005",
"-RRB-",
".",
"The",
"increases",
"in",
"calf",
"volume",
"in",
"response",
"to",
"30",
"°",
",",
"45",
"°",
",",
"and",
"70",
"°",
"HUT",
"are",
"marked",
"by",
"the",
"dotted",
"lines",
"in",
"the",
"pressure",
"volume",
"curve",
"-LRB-",
"A",
"-RRB-",
".",
"The",
"different",
"tilting",
"angles",
"correspond",
"with",
"different",
"venous",
"pressures",
"-LRB-",
"x-axis",
"-RRB-",
".",
"Transferring",
"these",
"venous",
"pressures",
"into",
"the",
"pressure-compliance",
"curve",
"-LRB-",
"B",
"-RRB-",
"clearly",
"demonstrate",
"that",
"during",
"30",
"°",
"HUT",
"venous",
"compliance",
"is",
"still",
"on",
"the",
"steep",
"linear",
"part",
"of",
"the",
"curve",
",",
"whereas",
"during",
"45",
"°",
",",
"and",
"70",
"°",
"HUT",
"the",
"venous",
"compliance",
"is",
"compromisedFig",
".",
"5Typical",
"plethysmographic",
"tracing",
"of",
"one",
"individual",
"subject",
"during",
"a",
"complete",
"experiment",
".",
"Blood",
"flow",
"measurements",
"at",
"30",
"°",
"HUT",
"start",
"when",
"the",
"plethysmography",
"signal",
"does",
"not",
"change",
"anymore",
",",
"meaning",
"that",
"venous",
"volume",
"reached",
"a",
"steady",
"state",
"situation",
".",
"Besides",
",",
"looking",
"at",
"a",
"typical",
"VOP",
"tracing",
"at",
"30",
"°",
"HUT",
",",
"the",
"increase",
"in",
"venous",
"volume",
"is",
"linear",
"during",
"the",
"first",
"5",
"seconds",
"of",
"cuff",
"inflation",
",",
"indicating",
"that",
"blood",
"flow",
"measurements",
"using",
"VOP",
"during",
"30",
"°",
"HUT",
"are",
"not",
"compromised",
"by",
"a",
"decrease",
"in",
"venous",
"compliance",
"Limitation",
"Using",
"VOP",
",",
"blood",
"flow",
"is",
"defined",
"as",
"limb",
"volume",
"changes",
"over",
"time",
".",
"During",
"HUT",
",",
"when",
"the",
"leg",
"is",
"below",
"heart",
"level",
",",
"volume",
"changes",
"can",
"still",
"be",
"measured",
"using",
"VOP",
",",
"however",
",",
"the",
"physiological",
"determinants",
"of",
"these",
"volume",
"changes",
"are",
"complex",
"and",
"it",
"is",
"no",
"longer",
"possible",
"to",
"say",
"with",
"reasonable",
"certainty",
"that",
"a",
"change",
"in",
"volume",
"over",
"time",
",",
"which",
"most",
"likely",
"reflects",
"flow",
",",
"is",
"determined",
"by",
"resistance",
"vessel",
"tone",
".",
"For",
"example",
",",
"limb",
"blood",
"flow",
"measured",
"using",
"VOP",
"in",
"HUT",
"position",
"can",
"decrease",
"due",
"to",
"an",
"increase",
"in",
"venous",
"pressure",
",",
"as",
"a",
"result",
"of",
"venous",
"congestion",
"and",
"the",
"associated",
"fall",
"in",
"arterio-venous",
"pressure",
"gradient",
",",
"without",
"any",
"increase",
"in",
"resistance",
"at",
"the",
"arteriolar",
"level",
".",
"In",
"conclusion",
",",
"this",
"study",
"demonstrates",
"that",
"CBF",
"measured",
"by",
"VOP",
"during",
"HUT",
"is",
"suitable",
"and",
"reproducible",
".",
"The",
"method",
"is",
"easy",
"applicable",
"and",
"recommended",
"in",
"tilt",
"angles",
"equal",
"to",
"30",
"°",
"to",
"avoid",
"high",
"hydrostatic",
"and",
"leg",
"venous",
"pressures",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Diabetologia-3-1-1781097 | [
"Pten",
"-LRB-",
"phosphatase",
"and",
"tensin",
"homologue",
"gene",
"-RRB-",
"haploinsufficiency",
"promotes",
"insulin",
"hypersensitivity",
"Aims/hypothesis",
"Insulin",
"controls",
"glucose",
"metabolism",
"via",
"multiple",
"signalling",
"pathways",
",",
"including",
"the",
"phosphatidylinositol",
"3-kinase",
"-LRB-",
"PI3K",
"-RRB-",
"pathway",
"in",
"muscle",
"and",
"adipose",
"tissue",
".",
"The",
"protein/lipid",
"phosphatase",
"Pten",
"-LRB-",
"phosphatase",
"and",
"tensin",
"homologue",
"deleted",
"on",
"chromosome",
"10",
"-RRB-",
"attenuates",
"PI3K",
"signalling",
"by",
"dephosphorylating",
"the",
"phosphatidylinositol",
"3,4,5-trisphosphate",
"generated",
"by",
"PI3K",
".",
"The",
"current",
"study",
"was",
"aimed",
"at",
"investigating",
"the",
"effect",
"of",
"haploinsufficiency",
"for",
"Pten",
"on",
"insulin-stimulated",
"glucose",
"uptake",
".",
"Introduction",
"Type",
"2",
"diabetes",
"mellitus",
"is",
"a",
"multifactorial",
"disease",
"with",
"a",
"complex",
"pathophysiology",
"that",
"includes",
"defects",
"in",
"insulin",
"production",
"and",
"a",
"failure",
"in",
"peripheral",
"tissues",
"to",
"take",
"up",
"glucose",
"in",
"response",
"to",
"insulin",
".",
"Signalling",
"via",
"phosphatidylinositol",
"3-kinase",
"-LRB-",
"PI3K",
"-RRB-",
"is",
"a",
"key",
"pathway",
"in",
"the",
"regulation",
"of",
"glucose",
"uptake",
"by",
"insulin",
"-LSB-",
"1",
"-RSB-",
".",
"Activation",
"of",
"PI3K",
"via",
"insulin",
"receptor",
"substrate-1",
"causes",
"PI3K",
"to",
"phosphorylate",
"inositol-containing",
"phospholipids",
"at",
"the",
"3",
"′",
"-",
"position",
"of",
"the",
"inositol",
"ring",
",",
"increasing",
"the",
"levels",
"of",
"the",
"lipid",
"messenger",
"phosphatidylinositol",
"3,4,5-trisphosphate",
"-LRB-",
"PIP3",
"-RRB-",
",",
"among",
"others",
".",
"PIP3",
"activate",
"a",
"phosphoinositide",
"kinases",
",",
"which",
"in",
"turn",
"phosphorylate",
"and",
"activate",
"protein",
"kinase",
"B",
"-LRB-",
"PKB",
"-RRB-",
",",
"also",
"known",
"as",
"Akt",
",",
"a",
"key",
"effector",
"kinase",
"for",
"many",
"of",
"the",
"downstream",
"metabolic",
"effects",
"initiated",
"by",
"insulin",
"via",
"PI3K",
".",
"The",
"phosphatase",
"and",
"tensin",
"homologue",
"-LRB-",
"PTEN",
"-RRB-",
"is",
"a",
"phosphatase",
"which",
"recognises",
"both",
"protein",
"and",
"lipid",
"substrates",
".",
"As",
"a",
"lipid",
"phosphatase",
",",
"PTEN",
"dephosphorylates",
"PIP3",
"at",
"the",
"3",
"′",
"-",
"position",
"of",
"the",
"inositol",
"ring",
",",
"thereby",
"acting",
"as",
"an",
"antagonist",
"to",
"PI3K",
"signalling",
"-LSB-",
"2",
",",
"3",
"-RSB-",
".",
"PTEN",
"was",
"originally",
"identified",
"as",
"a",
"tumour",
"suppressor",
"gene",
",",
"and",
"is",
"one",
"of",
"the",
"most",
"commonly",
"mutated",
"genes",
"in",
"human",
"cancer",
"-LSB-",
"4",
"--",
"6",
"-RSB-",
".",
"Mutation",
"or",
"deletion",
"of",
"PTEN",
"has",
"been",
"identified",
"in",
"many",
"cancers",
"including",
"prostate",
",",
"brain",
",",
"breast",
",",
"endometrium",
"and",
"skin",
"-LSB-",
"4",
"--",
"8",
"-RSB-",
".",
"As",
"many",
"of",
"the",
"metabolic",
"outcomes",
"of",
"insulin",
"are",
"achieved",
"through",
"recruitment",
"of",
"PI3K",
"and",
"the",
"subsequent",
"rise",
"in",
"PIP3",
"levels",
",",
"PTEN",
"may",
"have",
"a",
"critical",
"role",
"in",
"modulating",
"sensitivity",
"to",
"insulin-stimulated",
"glucose",
"uptake",
".",
"Recent",
"studies",
"in",
"which",
"Pten",
"was",
"ablated",
"specifically",
"in",
"liver",
",",
"adipose",
"tissue",
"and",
"muscle",
"in",
"mice",
"by",
"Cre",
"recombinase-based",
"strategies",
"have",
"shown",
"a",
"role",
"for",
"Pten",
"in",
"the",
"regulation",
"of",
"insulin",
"sensitivity",
"in",
"those",
"organs",
",",
"and",
"highlighted",
"the",
"contributions",
"of",
"those",
"organs",
"to",
"glucose",
"homeostasis",
"of",
"the",
"whole",
"animal",
"-LSB-",
"9",
"--",
"11",
"-RSB-",
".",
"However",
",",
"the",
"effect",
"of",
"global",
"reduction",
"of",
"Pten",
"levels",
"on",
"glucose",
"uptake",
"and",
"metabolism",
"has",
"not",
"yet",
"been",
"shown",
"in",
"an",
"in",
"vivo",
"mouse",
"model",
".",
"Unfortunately",
",",
"experimental",
"genetic",
"inactivation",
"of",
"both",
"Pten",
"alleles",
"-LRB-",
"Pten",
"−",
"/",
"−",
"-RRB-",
"results",
"in",
"early",
"embryonic",
"lethality",
"-LSB-",
"6",
",",
"12",
"-RSB-",
".",
"Thus",
"mice",
"harbouring",
"inactivation",
"of",
"one",
"Pten",
"allele",
"-LRB-",
"haploinsufficiency",
",",
"Pten",
"+",
"/",
"−",
"-RRB-",
"are",
"an",
"important",
"experimental",
"model",
"for",
"studying",
"the",
"role",
"of",
"Pten",
"in",
"vivo",
".",
"Haploinsufficiency",
"for",
"Pten",
"has",
"important",
"consequences",
"for",
"cell",
"proliferation",
"and",
"tumorigenesis",
"in",
"mice",
"-LSB-",
"6",
",",
"12",
"--",
"14",
"-RSB-",
".",
"Pten",
"+",
"/",
"−",
"mice",
"exhibit",
"defective",
"apoptosis",
"in",
"T",
"cells",
",",
"B",
"cells",
"and",
"macrophages",
"and",
"spontaneous",
"neoplasms",
"in",
"various",
"tissues",
"including",
"prostate",
",",
"liver",
",",
"endometrium",
"and",
"others",
"-LSB-",
"12",
"--",
"14",
"-RSB-",
".",
"Here",
"we",
"show",
"that",
"Pten",
"haploinsufficiency",
"results",
"in",
"insulin",
"hypersensitivity",
"and",
"enhanced",
"insulin-mediated",
"glucose",
"uptake",
".",
"Materials",
"and",
"methods",
"Experimental",
"animals",
"All",
"laboratory",
"animals",
"were",
"cared",
"for",
"and",
"used",
"according",
"to",
"guidelines",
"of",
"the",
"Canadian",
"Council",
"on",
"Animal",
"Care",
".",
"Pten",
"+",
"/",
"−",
"mice",
"were",
"generated",
"by",
"R.",
"Parsons",
"-LSB-",
"12",
"-RSB-",
".",
"These",
"mice",
"were",
"backcrossed",
"with",
"C57BL6",
"mice",
"for",
"more",
"than",
"ten",
"generations",
".",
"The",
"genotypes",
"of",
"the",
"mice",
"were",
"determined",
"as",
"described",
"-LSB-",
"12",
"-RSB-",
".",
"Blood",
"glucose",
"determination",
"For",
"determination",
"of",
"blood",
"glucose",
"levels",
",",
"glucose",
"levels",
"in",
"blood",
"samples",
"taken",
"from",
"tail",
"vein",
"were",
"determined",
"using",
"a",
"One",
"Touch",
"Ultra",
"blood",
"glucose",
"monitor",
"-LRB-",
"LifeScan",
"Inc.",
",",
"Milpitas",
",",
"CA",
",",
"USA",
"-RRB-",
".",
"For",
"the",
"glucose",
"tolerance",
"test",
",",
"mice",
"were",
"fasted",
"overnight",
"-LRB-",
"15",
"h",
"-RRB-",
"prior",
"to",
"i.p.",
"injection",
"of",
"glucose",
"-LRB-",
"2",
"mg/g",
"body",
"weight",
"-RRB-",
".",
"Blood",
"glucose",
"levels",
"were",
"then",
"determined",
"at",
"the",
"indicated",
"time-points",
"following",
"glucose",
"injection",
".",
"For",
"the",
"insulin",
"challenge",
"test",
",",
"mice",
"were",
"fasted",
"for",
"15",
"h",
"prior",
"to",
"i.p.",
"injection",
"of",
"0.6",
"mU",
"insulin/g",
"body",
"weight",
".",
"Blood",
"glucose",
"levels",
"were",
"then",
"determined",
"at",
"the",
"indicated",
"time-points",
"following",
"insulin",
"injection",
".",
"Determination",
"of",
"insulin",
"in",
"plasma",
"Mice",
"were",
"fasted",
"for",
"15",
"h",
",",
"then",
"approximately",
"100",
"μl",
"of",
"blood",
"was",
"collected",
"from",
"the",
"tail",
"vein",
"using",
"pipette",
"tips",
"precoated",
"with",
"heparin",
".",
"The",
"mice",
"were",
"then",
"injected",
"i.p.",
"with",
"2",
"mg",
"glucose/g",
"body",
"weight",
",",
"and",
"a",
"second",
"blood",
"sample",
"was",
"obtained",
"15",
"min",
"following",
"injection",
".",
"The",
"blood",
"samples",
"were",
"centrifuged",
"at",
"805",
"g",
"in",
"a",
"table-top",
"centrifuge",
",",
"and",
"insulin",
"in",
"the",
"plasma",
"fraction",
"was",
"determined",
"using",
"an",
"insulin",
"ELISA",
"system",
"-LRB-",
"ALPCO",
"Diagnostics",
",",
"Salem",
",",
"NH",
",",
"USA",
"-RRB-",
"according",
"to",
"the",
"manufacturer",
"'s",
"instructions",
".",
"Isolation",
"of",
"pancreatic",
"islets",
"and",
"glucose-stimulated",
"insulin",
"release",
"Islets",
"were",
"isolated",
"from",
"pancreata",
"of",
"mice",
"as",
"described",
"-LSB-",
"15",
"-RSB-",
".",
"Pancreata",
"from",
"three",
"mice",
"were",
"pooled",
".",
"After",
"24",
"h",
"in",
"culture",
",",
"islets",
"were",
"preincubated",
"in",
"Krebs",
"--",
"Ringer",
"bicarbonate",
"buffer",
"plus",
"0.1",
"%",
"BSA",
"-LRB-",
"KRBB-BSA",
"-RRB-",
"and",
"1.67",
"mmol/l",
"glucose",
".",
"The",
"islet",
"cells",
"were",
"incubated",
"for",
"1",
"h",
"in",
"1",
"ml",
"KRBB-BSA",
"containing",
"the",
"desired",
"concentration",
"of",
"glucose",
"-LRB-",
"1.67",
"or",
"16.7",
"mmol/l",
"-RRB-",
".",
"The",
"incubation",
"medium",
"was",
"then",
"collected",
",",
"and",
"centrifuged",
"and",
"the",
"supernatant",
"fractions",
"were",
"used",
"for",
"assay",
"of",
"insulin",
"content",
"by",
"ELISA",
".",
"Total",
"extractable",
"insulin",
"in",
"islets",
"was",
"determined",
"by",
"adding",
"0.5",
"ml",
"lysis",
"buffer",
"-LRB-",
"1",
"mol/l",
"acetic",
"acid",
"with",
"0.1",
"%",
"BSA",
"-RRB-",
"to",
"the",
"islet",
"pellet",
".",
"Cell",
"debris",
"was",
"pelleted",
"by",
"centrifugation",
",",
"and",
"the",
"supernatant",
"fraction",
"was",
"used",
"for",
"insulin",
"assay",
".",
"Fluorescent",
"immunohistochemistry",
"of",
"pancreatic",
"islets",
"Immunocytochemistry",
"has",
"been",
"described",
"-LSB-",
"16",
"-RSB-",
".",
"Pancreata",
"from",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"were",
"embedded",
"in",
"paraffin",
".",
"Five-micron",
"sections",
"were",
"incubated",
"for",
"1",
"h",
"at",
"room",
"temperature",
"with",
"guinea-pig",
"anti-insulin",
"antibody",
"-LRB-",
"1:100",
"dilution",
";",
"Dako",
",",
"Mississagua",
",",
"ON",
",",
"Canada",
"-RRB-",
"and",
"rabbit",
"anti-glucagon",
"antibody",
"-LRB-",
"Dako",
";",
"1:75",
"dilution",
"-RRB-",
".",
"Sections",
"were",
"visualised",
"by",
"incubation",
"with",
"Alexa",
"--",
"Fluor",
"488",
"goat",
"anti-guinea-pig",
"-LRB-",
"Invitrogen",
",",
"Molecular",
"Probes",
",",
"Burlington",
",",
"ON",
",",
"Canada",
";",
"1:100",
"dilution",
"-RRB-",
"and",
"Texas",
"Red",
"donkey",
"anti-rabbit",
"antibodies",
"-LRB-",
"Jackson",
"ImmunoResearch",
"Laboratories",
",",
"West",
"Grove",
",",
"PA",
",",
"USA",
";",
"1:100",
"dilution",
"-RRB-",
".",
"Sections",
"were",
"examined",
"by",
"fluorescence",
"microscopy",
".",
"Beta",
"cell",
"mass",
"calculation",
"Following",
"insulin",
"immunostaining",
",",
"pancreatic",
"sections",
"were",
"captured",
"under",
"an",
"FITC",
"filter",
"using",
"a",
"Zeiss",
"Axioplan",
"2",
"microscope",
"equipped",
"for",
"epifluorescence",
"and",
"Pathvysion",
"imaging",
"software",
".",
"The",
"insulin",
"immunopositive",
"area",
"-LRB-",
"as",
"a",
"proportion",
"of",
"pancreatic",
"area",
"-RRB-",
"was",
"determined",
"in",
"at",
"least",
"six",
"fields",
"per",
"section",
"using",
"Zeiss",
"AxioVision",
"software",
",",
"performed",
"on",
"eight",
"pancreatic",
"sections",
"per",
"mouse",
".",
"Beta",
"cell",
"mass",
"was",
"calculated",
"as",
"pancreatic",
"mass",
"times",
"the",
"percent",
"beta",
"cell",
"area",
"for",
"each",
"mouse",
".",
"2",
"-",
"-LSB-",
"18F",
"-RSB-",
"fluoro-2-deoxyglucose",
"uptake",
"and",
"microPET",
"scanning",
"Mice",
"were",
"fasted",
"for",
"15",
"h",
"prior",
"to",
"i.p.",
"injection",
"with",
"0.6",
"mU",
"insulin/g",
"body",
"weight",
".",
"Twenty",
"minutes",
"after",
"insulin",
"injection",
",",
"mice",
"were",
"injected",
"with",
"2",
"-",
"-LSB-",
"18F",
"-RSB-",
"fluoro-2-deoxyglucose",
"-LRB-",
"18FDG",
"-RRB-",
"-LRB-",
"4.1",
"MBq",
"-RRB-",
"via",
"the",
"tail",
"vein",
",",
"and",
"whole-body",
"distribution",
"of",
"18FDG",
"was",
"monitored",
"by",
"positron",
"emission",
"tomography",
"-LRB-",
"PET",
"-RRB-",
"using",
"a",
"microPET",
"R4",
"tomograph",
"-LRB-",
"Concorde",
"Microsystems",
",",
"Knoxville",
",",
"TN",
",",
"USA",
"-RRB-",
".",
"The",
"image",
"data",
"were",
"attenuation-corrected",
"using",
"a",
"68Ge",
"rod",
"source",
".",
"Wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"were",
"positioned",
"side-by-side",
"and",
"scanned",
"simultaneously",
"for",
"60",
"min",
"after",
"18FDG",
"injection",
".",
"Data",
"were",
"analysed",
"using",
"the",
"manufacturer",
"'s",
"software",
",",
"ASIPro",
"VM",
"5.0.1.0",
".",
"For",
"data",
"analysis",
",",
"regions",
"of",
"interest",
"-LRB-",
"ROIs",
"-RRB-",
"were",
"specified",
"in",
"the",
"coronal",
"section",
"of",
"a",
"hindlimb",
"for",
"each",
"mouse",
".",
"The",
"18FDG",
"activities",
"in",
"each",
"ROI",
"were",
"summed",
"across",
"all",
"coronal",
"planes",
",",
"and",
"expressed",
"as",
"a",
"proportion",
"of",
"18FDG",
"in",
"the",
"whole",
"mouse",
"-LRB-",
"total",
"18FDG",
"activity",
"was",
"also",
"taken",
"as",
"the",
"sum",
"of",
"activity",
"across",
"coronal",
"planes",
"-RRB-",
".",
"Primary",
"myocyte",
"culture",
"Primary",
"myocytes",
"were",
"cultured",
"from",
"fore",
"-",
"and",
"hindlimbs",
"from",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"according",
"to",
"a",
"protocol",
"adapted",
"from",
"Springer",
"et",
"al.",
"-LSB-",
"17",
"-RSB-",
".",
"Skeletal",
"muscle",
"was",
"excised",
"and",
"minced",
"and",
"then",
"incubated",
"at",
"37",
"°C",
"for",
"2",
"h",
"with",
"2.4",
"units/ml",
"dispase",
"II",
".",
"Dispase",
"digestion",
"was",
"halted",
"by",
"addition",
"of",
"10",
"ml",
"F-10-based",
"myocyte",
"medium",
"-LRB-",
"400",
"ml",
"F-10",
"nutrient",
"mixture",
",",
"100",
"ml",
"fetal",
"bovine",
"serum",
",",
"25",
"μg",
"basic",
"fibroblast",
"growth",
"factor",
",",
"penicillin/streptomycin",
"-RRB-",
".",
"The",
"tissue",
"slurry",
"was",
"then",
"strained",
"through",
"a",
"fine",
"metal",
"mesh",
"and",
"centrifuged",
"at",
"500",
"g",
"for",
"5",
"min",
".",
"The",
"supernatant",
"fraction",
"was",
"removed",
"to",
"a",
"fresh",
"centrifuge",
"tube",
"and",
"the",
"pellet",
"was",
"resuspended",
"and",
"plated",
"to",
"a",
"5-cm",
"collagen-coated",
"culture",
"dish",
"in",
"a",
"total",
"of",
"4",
"ml",
"F-10-based",
"medium",
".",
"The",
"supernatant",
"fraction",
"was",
"re-centrifuged",
"and",
"the",
"pellet",
"was",
"pooled",
"with",
"the",
"first",
".",
"The",
"cells",
"were",
"passaged",
"when",
"they",
"reached",
"70",
"--",
"80",
"%",
"confluence",
".",
"To",
"enrich",
"for",
"myocytes",
",",
"the",
"old",
"medium",
"was",
"removed",
"by",
"aspiration",
",",
"the",
"cells",
"washed",
"with",
"PBS",
",",
"then",
"incubated",
"in",
"a",
"film",
"of",
"this",
"buffer",
"for",
"15",
"min",
".",
"Myocytes",
"were",
"loosened",
"from",
"the",
"dish",
"by",
"striking",
"the",
"dish",
"several",
"times",
"sharply",
"on",
"the",
"bench",
"top",
".",
"Cells",
"were",
"washed",
"from",
"the",
"dish",
"with",
"PBS",
".",
"The",
"PBS",
"incubation",
"was",
"repeated",
"and",
"the",
"cells",
"were",
"pooled",
".",
"Cells",
"kept",
"in",
"culture",
"for",
"more",
"than",
"5",
"--",
"6",
"days",
"began",
"to",
"exhibit",
"the",
"elongated",
"morphology",
"typical",
"of",
"myotubes",
"-LSB-",
"18",
"-RSB-",
".",
"Cells",
"in",
"these",
"older",
"cultures",
"also",
"exhibited",
"spontaneous",
"twitching",
".",
"All",
"experiments",
"were",
"performed",
"with",
"cells",
"on",
"days",
"2",
"--",
"3",
"of",
"culture",
".",
"2-Deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"uptake",
"Experiments",
"were",
"performed",
"on",
"wild-type",
"or",
"Pten",
"+",
"/",
"−",
"cells",
"from",
"passage",
"two",
"to",
"eight",
",",
"grown",
"on",
"24-well",
"-LRB-",
"1-cm",
"diameter",
"wells",
"-RRB-",
"plates",
".",
"Cells",
"were",
"preincubated",
"in",
"serum-free",
"medium",
"for",
"12",
"h",
"prior",
"to",
"experiments",
".",
"The",
"cells",
"were",
"washed",
"twice",
"with",
"HEPES-buffered",
"saline",
"-LRB-",
"140",
"mmol/l",
"NaCl",
",",
"20",
"mmol/l",
"HEPES",
",",
"2.5",
"mmol/l",
"MgSO4",
",",
"1",
"mmol/l",
"CaCl2",
",",
"5",
"mmol/l",
"KCl",
",",
"pH",
"7.4",
"-RRB-",
",",
"then",
"incubated",
"with",
"10",
"μmol/l",
"2-deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"-LRB-",
"0.037",
"MBq/ml",
"-RRB-",
"for",
"5",
",",
"10",
",",
"20",
"or",
"30",
"min",
",",
"in",
"the",
"absence",
"or",
"presence",
"of",
"0.1",
"μmol/l",
"insulin",
".",
"At",
"the",
"end",
"of",
"the",
"incubation",
"period",
",",
"the",
"radioactive",
"substrate",
"was",
"removed",
",",
"and",
"the",
"cells",
"were",
"washed",
"three",
"times",
"with",
"ice-cold",
"20",
"mmol/l",
"glucose",
".",
"Cells",
"were",
"lysed",
"with",
"0.2",
"ml",
"2",
"%",
"SDS",
",",
"and",
"the",
"lysates",
"were",
"used",
"for",
"scintillation",
"counting",
".",
"Non-specific",
"diffusion",
"of",
"2-deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"was",
"determined",
"by",
"incubating",
"cells",
"in",
"the",
"presence",
"of",
"2-deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"and",
"10",
"μmol/l",
"cytochalasin",
"B",
",",
"a",
"specific",
"inhibitor",
"of",
"glucose",
"uptake",
"-LSB-",
"19",
"-RSB-",
".",
"Determination",
"of",
"cell-surface",
"GLUT1",
"and",
"GLUT4",
"levels",
"Primary",
"myocytes",
"were",
"grown",
"in",
"10-cm",
"culture",
"dishes",
".",
"The",
"cells",
"were",
"rinsed",
"with",
"PBS",
",",
"and",
"incubated",
"with",
"0.5",
"mg/ml",
"sulpho-NHS-LC-biotin",
"-LRB-",
"Pierce",
"Biotechnology",
",",
"Rockford",
",",
"IL",
",",
"USA",
"-RRB-",
"in",
"PBS",
"for",
"20",
"min",
".",
"Cells",
"are",
"impermeable",
"to",
"this",
"reagent",
"and",
"it",
"labels",
"the",
"amine",
"groups",
"of",
"cell-surface",
"proteins",
".",
"Following",
"the",
"incubation",
",",
"the",
"cells",
"were",
"washed",
"three",
"times",
"with",
"PBS",
",",
"then",
"lysed",
"with",
"0.5",
"ml",
"lysis",
"buffer",
"-LRB-",
"1",
"%",
"NP-40",
",",
"150",
"mmol/l",
"NaCl",
",",
"50",
"mmol/l",
"Tris",
"pH",
"7.5",
",",
"including",
"protease",
"and",
"phosphatase",
"inhibitors",
"-RRB-",
".",
"Protein",
"was",
"quantified",
"with",
"a",
"BCA",
"protein",
"assay",
"kit",
"-LRB-",
"Pierce",
"-RRB-",
".",
"Streptavidin-agarose",
"beads",
"-LRB-",
"Pierce",
"-RRB-",
"were",
"pre-blocked",
"by",
"incubation",
"with",
"2",
"%",
"BSA",
"in",
"lysis",
"buffer",
".",
"Each",
"sample",
"-LRB-",
"1.2",
"mg",
"protein",
"-RRB-",
"was",
"incubated",
"with",
"the",
"streptavidin",
"beads",
"-LRB-",
"100",
"μl",
",",
"50",
"%",
"bead",
"slurry",
"-RRB-",
"for",
"1",
"h",
"at",
"room",
"temperature",
".",
"The",
"beads",
"were",
"washed",
"five",
"times",
",",
"for",
"30",
"--",
"60",
"min",
"each",
"wash",
",",
"using",
"lysis",
"buffer",
"containing",
"0.1",
"%",
"SDS",
".",
"After",
"the",
"final",
"wash",
",",
"50",
"μl",
"SDS",
"sample-loading",
"buffer",
"were",
"added",
",",
"and",
"heated",
"at",
"95",
"°C",
"for",
"10",
"min",
",",
"then",
"vortexed",
"to",
"elute",
"the",
"biotinylated",
"proteins",
".",
"The",
"proteins",
"in",
"the",
"supernatant",
"fractions",
"were",
"analysed",
"by",
"SDS-PAGE",
",",
"then",
"transferred",
"to",
"nitrocellulose",
".",
"Proteins",
"were",
"probed",
"using",
"polyclonal",
"antibodies",
"against",
"GLUT1",
"and",
"GLUT4",
"-LRB-",
"also",
"known",
"as",
"SCLA2A1",
"and",
"SCLA2A4",
",",
"respectively",
"-RRB-",
".",
"Western",
"immunoblotting",
"for",
"PKB",
",",
"phospho-PKB",
"and",
"phospho-glycogen",
"synthase",
"kinase",
"3",
"-LRB-",
"GSK3",
"-RRB-",
"-",
"α/β",
"Total",
"protein",
"extracts",
"of",
"primary",
"myocytes",
"were",
"prepared",
"by",
"lysing",
"cells",
"in",
"NP-40-based",
"lysis",
"buffer",
".",
"Thirty",
"to",
"fifty",
"micrograms",
"of",
"protein",
"per",
"sample",
"were",
"analysed",
"by",
"SDS-PAGE",
",",
"then",
"transferred",
"to",
"nitrocellulose",
".",
"Rabbit",
"polyclonal",
"anti-PKB",
",",
"anti-phospho-PKB",
"-LRB-",
"Ser473",
"-RRB-",
"and",
"anti-phospho-GSK3-α",
"/",
"β",
"-LRB-",
"Ser21/9",
"-RRB-",
"antibodies",
"were",
"obtained",
"from",
"Cell",
"Signaling",
"Technology",
"-LRB-",
"Beverly",
",",
"MA",
",",
"USA",
"-RRB-",
".",
"Mouse",
"monoclonal",
"anti-vinculin",
"antibody",
"was",
"obtained",
"from",
"Sigma",
"-LRB-",
"St",
"Louis",
",",
"MO",
",",
"USA",
"-RRB-",
".",
"Horseradish",
"peroxidase-conjugated",
"secondary",
"antibodies",
"were",
"obtained",
"from",
"Dako",
".",
"Protein",
"bands",
"were",
"visualised",
"using",
"an",
"enhanced",
"chemiluminescence",
"system",
"and",
"autoradiography",
"by",
"exposure",
"to",
"X-ray",
"film",
".",
"Statistical",
"analysis",
"Statistical",
"analysis",
"was",
"performed",
"using",
"Student",
"'s",
"t",
"test",
".",
"Significance",
"was",
"assessed",
"at",
"the",
"95",
"%",
"confidence",
"level",
".",
"Results",
"As",
"glucose",
"metabolism",
"may",
"be",
"altered",
"due",
"to",
"a",
"change",
"in",
"insulin",
"sensitivity",
"in",
"Pten",
"+",
"/",
"−",
"mice",
",",
"blood",
"glucose",
"levels",
"in",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"were",
"determined",
".",
"Slight",
"but",
"statistically",
"significant",
"hypoglycaemia",
"was",
"observed",
"in",
"Pten",
"+",
"/",
"−",
"mice",
"during",
"ad",
"libitum",
"feeding",
"-LRB-",
"11.3",
"%",
"lower",
"blood",
"glucose",
"in",
"Pten",
"+",
"/",
"−",
"mice",
"-RRB-",
"-LRB-",
"Table",
"1",
"-RRB-",
".",
"Fasting",
"caused",
"a",
"drop",
"in",
"glucose",
"levels",
"in",
"both",
"groups",
",",
"with",
"slight",
"but",
"significant",
"hypoglycaemia",
"in",
"the",
"Pten",
"+",
"/",
"−",
"group",
"-LRB-",
"10.8",
"%",
"lower",
"blood",
"glucose",
"-RRB-",
"relative",
"to",
"wild-type",
"mice",
".",
"An",
"insulin",
"challenge",
"test",
"revealed",
"hypersensitivity",
"to",
"insulin",
"in",
"Pten",
"+",
"/",
"−",
"mice",
"-LRB-",
"Fig.",
"1a",
"-RRB-",
".",
"Following",
"i.p.",
"insulin",
"injection",
"-LRB-",
"0.6",
"mU/g",
"body",
"weight",
"-RRB-",
",",
"blood",
"glucose",
"levels",
"in",
"Pten",
"+",
"/",
"−",
"mice",
"remained",
"depressed",
"at",
"all",
"time-points",
"measured",
"-LRB-",
"up",
"to",
"120",
"min",
"-RRB-",
".",
"In",
"contrast",
",",
"wild-type",
"mice",
"started",
"to",
"recover",
"after",
"30",
"min",
",",
"and",
"glucose",
"levels",
"returned",
"to",
"fasting",
"levels",
"120",
"min",
"after",
"injection",
".",
"A",
"glucose",
"tolerance",
"test",
"showed",
"that",
"Pten",
"+",
"/",
"−",
"mice",
"had",
"greater",
"glucose",
"tolerance",
"than",
"wild-type",
"mice",
"-LRB-",
"Fig.",
"1b",
"-RRB-",
".",
"After",
"i.p.",
"glucose",
"injection",
",",
"blood",
"glucose",
"levels",
"in",
"Pten",
"+",
"/",
"−",
"mice",
"returned",
"to",
"fasting",
"levels",
"in",
"less",
"than",
"60",
"min",
",",
"approximately",
"twice",
"as",
"rapidly",
"as",
"in",
"wild-type",
"mice",
".",
"Table",
"1Blood",
"glucose",
"levels",
"in",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"during",
"ad",
"libitum",
"feeding",
"and",
"after",
"a",
"15-h",
"fast",
"Mean",
"blood",
"glucose",
"±",
"SD",
"-LRB-",
"mmol/l",
"-RRB-",
"p",
"value",
"-LRB-",
"independent",
"Student",
"'s",
"t",
"test",
"-RRB-",
"Wild-typePten",
"+",
"/",
"−",
"Ad",
"libitum",
"feeding7",
".1",
"±",
"0.4",
"-LRB-",
"n",
"=",
"5",
"-RRB-",
"6.3",
"±",
"0.2",
"-LRB-",
"n",
"=",
"4",
"-RRB-",
"0.006",
"Fasting6",
".5",
"±",
"0.3",
"-LRB-",
"n",
"=",
"5",
"-RRB-",
"5.8",
"±",
"0.3",
"-LRB-",
"n",
"=",
"5",
"-RRB-",
"0.008",
"Fig.",
"1Insulin",
"hypersensitivity",
"in",
"Pten",
"+",
"/",
"−",
"mice",
".",
"a",
"Insulin",
"challenge",
"test",
".",
"Mice",
"were",
"fasted",
"for",
"15",
"h",
"prior",
"to",
"i.p.",
"injection",
"of",
"insulin",
"-LRB-",
"0.6",
"mU/g",
"body",
"weight",
"-RRB-",
".",
"Blood",
"glucose",
"levels",
"were",
"determined",
"at",
"the",
"indicated",
"times",
".",
"Means",
"±",
"SEM",
"for",
"six",
"wild-type",
"mice",
"-LRB-",
"white",
"circles",
"-RRB-",
"and",
"six",
"Pten",
"+",
"/",
"−",
"mice",
"-LRB-",
"black",
"circles",
"-RRB-",
".",
"b",
"Glucose",
"tolerance",
"test",
".",
"Mice",
"were",
"fasted",
"for",
"15",
"h",
"prior",
"to",
"i.p.",
"injection",
"of",
"glucose",
"at",
"2",
"mg/g",
"body",
"weight",
".",
"Means",
"±",
"SEM",
"for",
"six",
"wild-type",
"mice",
"-LRB-",
"white",
"circles",
"-RRB-",
"and",
"seven",
"Pten",
"+",
"/",
"−",
"mice",
"-LRB-",
"black",
"circles",
"-RRB-",
"The",
"observed",
"difference",
"in",
"ability",
"to",
"normalise",
"blood",
"glucose",
"levels",
"could",
"be",
"due",
"to",
"differences",
"in",
"insulin",
"sensitivity",
"or",
"islet",
"function",
"and",
"insulin",
"production",
".",
"We",
"therefore",
"investigated",
"insulin",
"levels",
"in",
"the",
"mice",
",",
"as",
"well",
"as",
"properties",
"of",
"pancreatic",
"cell",
"morphology",
"and",
"function",
".",
"Fasting",
"plasma",
"insulin",
"levels",
"were",
"slightly",
"but",
"significantly",
"lower",
"in",
"Pten",
"+",
"/",
"−",
"mice",
"-LRB-",
"Table",
"2",
"-RRB-",
",",
"which",
"is",
"consistent",
"with",
"increased",
"peripheral",
"insulin",
"sensitivity",
".",
"Fifteen",
"minutes",
"after",
"i.p.",
"glucose",
"administration",
"-LRB-",
"2",
"mg",
"glucose/g",
"body",
"weight",
"-RRB-",
",",
"similar",
"increases",
"in",
"plasma",
"insulin",
"were",
"observed",
"in",
"the",
"two",
"groups",
"-LRB-",
"Table",
"2",
"-RRB-",
",",
"suggesting",
"that",
"there",
"is",
"no",
"marked",
"difference",
"in",
"insulin",
"production",
"in",
"the",
"Pten",
"+",
"/",
"−",
"mice",
".",
"Insulin",
"released",
"from",
"islets",
"isolated",
"from",
"Pten",
"+",
"/",
"+",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"was",
"also",
"examined",
".",
"Islets",
"were",
"cultured",
"as",
"described",
"in",
"Materials",
"and",
"methods",
",",
"and",
"incubated",
"in",
"the",
"presence",
"of",
"low",
"-LRB-",
"1.67",
"mmol/l",
"-RRB-",
"or",
"high",
"-LRB-",
"16.7",
"mmol/l",
"-RRB-",
"glucose",
".",
"Insulin",
"released",
"into",
"the",
"medium",
"was",
"determined",
"by",
"ELISA",
"and",
"calculated",
"as",
"percentage",
"of",
"total",
"insulin",
"content",
"in",
"the",
"islets",
".",
"Per",
"cent",
"of",
"total",
"insulin",
"release",
"-LRB-",
"presented",
"as",
"mean",
"value",
"±",
"SD",
"-RRB-",
"was",
"similar",
"under",
"conditions",
"of",
"low",
"glucose",
"-LRB-",
"Pten",
"+",
"/",
"+",
",",
"3.3",
"±",
"0.4",
"%",
"vs",
"Pten",
"+",
"/",
"−",
",",
"2.8",
"±",
"0.3",
"%",
";",
"p",
">",
"0.05",
"no",
"significant",
"difference",
",",
"n",
"=",
"3",
"per",
"group",
"-RRB-",
"and",
"high",
"glucose",
"-LRB-",
"Pten",
"+",
"/",
"+",
",",
"4.2",
"±",
"0.7",
"%",
"vs",
"Pten",
"+",
"/",
"−",
",",
"3.7",
"±",
"0.2",
"%",
";",
"p",
">",
"0.05",
"no",
"significant",
"difference",
",",
"n",
"=",
"3",
"per",
"group",
"-RRB-",
".",
"Table",
"2Plasma",
"insulin",
"levels",
"in",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"after",
"fasting",
",",
"and",
"15",
"min",
"after",
"i.p.",
"glucose",
"administration",
"-LRB-",
"2",
"mg",
"glucose/g",
"body",
"weight",
"-RRB-",
"Mean",
"plasma",
"insulin",
"±",
"SD",
"-LRB-",
"ng/ml",
"-RRB-",
"p",
"value",
"-LRB-",
"independent",
"Student",
"'s",
"t",
"test",
"-RRB-",
"Wild-type",
"-LRB-",
"n",
"=",
"7",
"-RRB-",
"Pten",
"+",
"/",
"−",
"-LRB-",
"n",
"=",
"6",
"-RRB-",
"Fasting0",
".50",
"±",
"0.040.36",
"±",
"0.100.05Post-glucose",
"challenge1",
".8",
"±",
"0.52.4",
"±",
"0.4",
">",
"0.05",
"-LRB-",
"not",
"significant",
"-RRB-",
"Immunofluorescence",
"of",
"pancreatic",
"sections",
"revealed",
"similar",
"morphology",
"of",
"islets",
"of",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"-LRB-",
"Fig.",
"2",
"-RRB-",
",",
"suggesting",
"Pten",
"haploinsufficiency",
"has",
"no",
"marked",
"effect",
"on",
"islet",
"morphology",
".",
"Accordingly",
",",
"beta",
"cell",
"mass",
"was",
"not",
"found",
"to",
"be",
"significantly",
"different",
"between",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"Fig.",
"2Pancreatic",
"islet",
"morphology",
"and",
"immunohistochemistry",
"for",
"insulin",
"-LRB-",
"green",
"-RRB-",
"and",
"glucagon",
"-LRB-",
"red",
"-RRB-",
"in",
"wild-type",
"-LRB-",
"a",
"-RRB-",
"and",
"Pten",
"+",
"/",
"−",
"-LRB-",
"b",
"-RRB-",
"mice",
".",
"Pancreatic",
"sections",
"were",
"immunostained",
"as",
"described",
"in",
"Materials",
"and",
"methods",
"and",
"visualised",
"by",
"fluorescence",
"microscopy",
".",
"Original",
"magnification",
"×",
"40Table",
"3Pancreatic",
"beta",
"cell",
"mass",
"of",
"Pten",
"+",
"/",
"+",
"and",
"Pten",
"+",
"/",
"−",
"littermates",
"Mean",
"beta",
"cell",
"mass",
"±",
"SE",
"-LRB-",
"mg",
"-RRB-",
"Pten",
"+",
"/",
"+1.24",
"±",
"0.30",
"-LRB-",
"n",
"=",
"3",
"-RRB-",
"Pten",
"+",
"/",
"−",
"1.29",
"±",
"0.15",
"-LRB-",
"n",
"=",
"3",
"-RRB-",
"Skeletal",
"muscle",
"is",
"an",
"important",
"tissue",
"involved",
"in",
"insulin-stimulated",
"glucose",
"uptake",
"-LSB-",
"10",
",",
"20",
"-RSB-",
".",
"In",
"vivo",
"glucose",
"uptake",
"was",
"assessed",
"by",
"monitoring",
"distribution",
"of",
"18FDG",
"into",
"muscles",
"in",
"real-time",
"by",
"PET",
".",
"18FDG",
"is",
"transported",
"into",
"cells",
"by",
"glucose",
"transporters",
"and",
"is",
"phosphorylated",
"by",
"hexokinase",
",",
"but",
"is",
"not",
"a",
"substrate",
"for",
"further",
"metabolism",
"in",
"the",
"glycolytic",
"pathway",
"-LSB-",
"21",
"-RSB-",
".",
"To",
"compare",
"insulin-stimulated",
"glucose",
"uptake",
"in",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
",",
"the",
"mice",
"were",
"fasted",
"for",
"15",
"h",
",",
"then",
"injected",
"i.p.",
"with",
"insulin",
"-LRB-",
"0.6",
"mU/g",
"body",
"weight",
"-RRB-",
"20",
"min",
"prior",
"to",
"injection",
"with",
"18FDG",
"via",
"the",
"tail",
"vein",
".",
"Mice",
"were",
"imaged",
"for",
"18FDG",
"uptake",
"into",
"the",
"hindlimb",
"for",
"60",
"min",
"-LRB-",
"Fig.",
"3a",
"-RRB-",
".",
"18FDG",
"activity",
"in",
"hindlimbs",
"was",
"analysed",
"as",
"a",
"proportion",
"of",
"total",
"body",
"activity",
",",
"and",
"was",
"found",
"to",
"be",
"higher",
"in",
"Pten",
"+",
"/",
"−",
"than",
"in",
"wild-type",
"mice",
"at",
"all",
"time-points",
"-LRB-",
"Fig.",
"3b",
"-RRB-",
".",
"Fig.",
"3Insulin-stimulated",
"uptake",
"of",
"18FDG",
"in",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
".",
"Mice",
"were",
"fasted",
"for",
"15",
"h",
"prior",
"to",
"i.p.",
"injection",
"of",
"0.6",
"mU",
"insulin/g",
"body",
"weight",
".",
"Twenty",
"minutes",
"after",
"insulin",
"injection",
",",
"mice",
"were",
"injected",
"with",
"18FDG",
"via",
"a",
"tail",
"vein",
",",
"and",
"whole-body",
"distribution",
"of",
"18FDG",
"was",
"monitored",
"by",
"microPET",
"for",
"60",
"min",
".",
"The",
"experiment",
"was",
"repeated",
"three",
"times",
"with",
"similar",
"results",
".",
"Typical",
"results",
"are",
"shown",
".",
"a",
"--",
"f",
"Imaging",
"of",
"18FDG",
"distribution",
"in",
"coronal",
"section",
";",
"wild-type",
"mouse",
"is",
"on",
"the",
"left",
"and",
"Pten",
"+",
"/",
"−",
"mouse",
"is",
"on",
"the",
"right",
"-LRB-",
"a",
"5",
"min",
";",
"b",
"15",
"min",
";",
"c",
"25",
"min",
";",
"d",
"35",
"min",
";",
"e",
"45",
"min",
";",
"f",
"55",
"min",
"-RRB-",
".",
"Hindlimb",
"muscles",
"were",
"highlighted",
"as",
"regions",
"of",
"interest",
",",
"and",
"18FDG",
"activity",
"in",
"each",
"region",
"of",
"interest",
"quantified",
"across",
"coronal",
"planes",
"at",
"each",
"time-point",
",",
"as",
"described",
"in",
"Materials",
"and",
"methods",
".",
"g",
"Graphical",
"representation",
"of",
"relative",
"18FDG",
"activity",
".",
"Data",
"are",
"shown",
"as",
"proportion",
"of",
"18FDG",
"activity",
"in",
"hindlimbs",
"relative",
"to",
"activity",
"in",
"whole",
"body",
"for",
"wild-type",
"mice",
"-LRB-",
"circles",
"-RRB-",
"and",
"Pten",
"+",
"/",
"−",
"mice",
"-LRB-",
"triangles",
"-RRB-",
"-LRB-",
"mean",
"±",
"SD",
";",
"n",
"=",
"3",
"per",
"point",
"-RRB-",
"Tissues",
"from",
"Pten",
"+",
"/",
"−",
"mice",
"exhibited",
"slightly",
"reduced",
"levels",
"of",
"Pten",
"protein",
"relative",
"to",
"wild-type",
"mice",
"-LSB-",
"14",
",",
"22",
"--",
"24",
"-RSB-",
".",
"In",
"order",
"to",
"examine",
"cellular",
"glucose",
"uptake",
"and",
"intracellular",
"signalling",
"events",
",",
"primary",
"myocytes",
"were",
"cultured",
"from",
"hindlimb",
"muscle",
"of",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"mice",
".",
"In",
"the",
"absence",
"of",
"insulin",
",",
"cells",
"from",
"Pten",
"+",
"/",
"−",
"mice",
"showed",
"increased",
"2-deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"uptake",
"at",
"all",
"time-points",
"measured",
",",
"to",
"a",
"maximum",
"increase",
"of",
"twofold",
"relative",
"to",
"wild-type",
"cells",
"at",
"the",
"3",
"h",
"time-point",
"-LRB-",
"Fig.",
"4a",
"-RRB-",
".",
"This",
"result",
",",
"together",
"with",
"the",
"lower",
"fasting",
"glucose",
"level",
"of",
"Pten",
"+",
"/",
"−",
"mice",
",",
"suggest",
"that",
"the",
"PI3K/PKB",
"pathway",
"was",
"chronically",
"activated",
"in",
"Pten",
"+",
"/",
"−",
"animals",
".",
"In",
"the",
"presence",
"of",
"insulin",
",",
"Pten",
"+",
"/",
"−",
"cells",
"exhibited",
"a",
"further",
"increase",
"in",
"glucose",
"uptake",
",",
"up",
"to",
"threefold",
"greater",
"than",
"wild-type",
"cells",
".",
"This",
"observation",
"is",
"consistent",
"with",
"the",
"above",
"results",
"of",
"the",
"insulin",
"and",
"glucose",
"challenge",
"tests",
"and",
"18FDG",
"uptake",
"experiment",
"in",
"showing",
"a",
"hypersensitivity",
"to",
"insulin",
"due",
"to",
"Pten",
"haploinsufficiency",
".",
"Fig.",
"4a",
"2-Deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"uptake",
"in",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"myocytes",
".",
"Myocytes",
"were",
"serum-starved",
"for",
"12",
"h",
"prior",
"to",
"incubation",
"with",
"10",
"μmol/l",
"2-deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"-LRB-",
"0.037",
"MBq/μmol/l",
"-RRB-",
"for",
"the",
"indicated",
"times",
"with",
"0",
"or",
"1",
"μmol/l",
"insulin",
".",
"Following",
"incubation",
"cells",
"were",
"lysed",
"and",
"aliquots",
"of",
"lysates",
"were",
"taken",
"for",
"determination",
"of",
"radioactivity",
"by",
"scintillation",
"counting",
".",
"Means",
"±",
"SD",
"for",
"three",
"separate",
"determinations",
".",
"White",
"circles",
",",
"wild-type",
"cells",
"0",
"μmol/l",
"insulin",
";",
"black",
"circles",
",",
"wild-type",
"cells",
"1",
"μmol/l",
"insulin",
";",
"white",
"triangles",
",",
"Pten",
"+",
"/",
"−",
"cells",
"0",
"μmol/l",
"insulin",
";",
"black",
"triangles",
",",
"Pten",
"+",
"/",
"−",
"cells",
"1",
"μmol/l",
"insulin",
".",
"b",
"Cell-surface",
"GLUT1",
"and",
"GLUT4",
"levels",
".",
"Levels",
"of",
"cell-surface",
"GLUT1",
"and",
"GLUT4",
"proteins",
"in",
"wild-type",
"-LRB-",
"WT",
"-RRB-",
"and",
"Pten",
"+",
"/",
"−",
"cells",
"were",
"determined",
"as",
"described",
"in",
"Materials",
"and",
"methods",
"Glucose",
"transport",
"into",
"skeletal",
"muscle",
"occurs",
"by",
"a",
"facilitated",
"diffusion",
"process",
"mediated",
"primarily",
"by",
"the",
"glucose",
"transporter",
"proteins",
",",
"GLUT1",
"and",
"GLUT4",
".",
"The",
"level",
"of",
"GLUT4",
"at",
"the",
"plasma",
"membrane",
"is",
"tightly",
"regulated",
"by",
"insulin",
",",
"whereas",
"GLUT1",
"is",
"found",
"constitutively",
"on",
"the",
"cell",
"surface",
"-LSB-",
"25",
"-RSB-",
".",
"Since",
"2-deoxy",
"-LSB-",
"3H",
"-RSB-",
"glucose",
"uptake",
"was",
"elevated",
"in",
"Pten",
"+",
"/",
"−",
"cells",
"even",
"in",
"the",
"absence",
"of",
"insulin",
"-LRB-",
"Fig.",
"4a",
"-RRB-",
",",
"we",
"analysed",
"cell-surface",
"GLUT4",
"and",
"GLUT1",
"by",
"western",
"immunoblot",
"as",
"described",
"in",
"Materials",
"and",
"methods",
"-LRB-",
"Fig.",
"4b",
"-RRB-",
".",
"This",
"analysis",
"showed",
"increased",
"GLUT4",
"at",
"the",
"cell",
"surface",
"in",
"Pten",
"+",
"/",
"−",
"cells",
",",
"while",
"similar",
"GLUT1",
"levels",
"were",
"observed",
"in",
"the",
"two",
"cell",
"types",
".",
"As",
"PKB",
"is",
"a",
"key",
"effector",
"kinase",
"that",
"mediates",
"many",
"of",
"the",
"downstream",
"cellular",
"events",
"induced",
"by",
"the",
"PI3K",
"signalling",
"pathway",
",",
"including",
"insulin-stimulated",
"glucose",
"uptake",
"-LSB-",
"26",
",",
"27",
"-RSB-",
",",
"we",
"determined",
"the",
"phosphorylation",
"status",
"of",
"PKB",
"in",
"wild-type",
"and",
"Pten",
"+",
"/",
"−",
"myocytes",
".",
"Little",
"to",
"no",
"phosphorylation",
"was",
"observed",
"in",
"the",
"absence",
"of",
"insulin",
",",
"and",
"phosphorylation",
"at",
"Ser473",
"was",
"observed",
"upon",
"addition",
"of",
"insulin",
"-LRB-",
"Fig.",
"5",
"-RRB-",
".",
"Whereas",
"PKB",
"phosphorylation",
"started",
"to",
"decrease",
"after",
"4",
"h",
"in",
"wild-type",
"cells",
"in",
"the",
"presence",
"of",
"insulin",
",",
"phosphorylation",
"was",
"sustained",
"in",
"Pten",
"+",
"/",
"−",
"cells",
"during",
"the",
"course",
"of",
"the",
"experiment",
"-LRB-",
"up",
"to",
"6",
"h",
"-RRB-",
".",
"Immunoblotting",
"for",
"total",
"PKB",
"protein",
"showed",
"that",
"PKB",
"levels",
"were",
"consistent",
"in",
"Pten",
"+",
"/",
"−",
"and",
"Pten",
"+",
"/",
"+",
"cells",
"-LRB-",
"Fig.",
"5",
"-RRB-",
".",
"Immunoblotting",
"for",
"vinculin",
"was",
"included",
"as",
"a",
"protein-loading",
"control",
".",
"An",
"immediate",
"downstream",
"substrate",
"of",
"PKB",
"is",
"GSK3β",
".",
"This",
"enzyme",
"becomes",
"inactivated",
"upon",
"phosphorylation",
"by",
"PKB",
",",
"in",
"turn",
"allowing",
"its",
"substrate",
",",
"glycogen",
"synthase",
",",
"to",
"mediate",
"glycogen",
"synthesis",
"and",
"thus",
"promote",
"glucose",
"storage",
".",
"Consistent",
"with",
"the",
"observed",
"enhancement",
"of",
"PKB",
"phosphorylation",
"in",
"Pten",
"+",
"/",
"−",
"cells",
",",
"these",
"cells",
"also",
"exhibited",
"a",
"higher",
"degree",
"of",
"GSK3β",
"phosphorylation",
"in",
"comparison",
"with",
"Pten",
"+",
"/",
"+",
"cells",
"-LRB-",
"Fig.",
"5",
"-RRB-",
".",
"Fig.",
"5Phosphorylation",
"of",
"PKB",
"and",
"GSK3β",
".",
"Myocytes",
"were",
"serum-starved",
"for",
"12",
"h",
"prior",
"to",
"incubation",
"with",
"1",
"μmol/l",
"insulin",
"for",
"the",
"indicated",
"times",
".",
"Cell",
"lysates",
"were",
"prepared",
",",
"and",
"proteins",
"were",
"separated",
"by",
"PAGE",
"followed",
"by",
"western",
"immunoblot",
"analysis",
"for",
"vinculin",
",",
"total",
"PKB",
",",
"phospho-PKB",
"-LRB-",
"p-PKB",
"S473",
"-RRB-",
"and",
"phospho-GSK3β",
"-LRB-",
"p-GSK3β",
"-RRB-",
"as",
"indicated",
".",
"This",
"experiment",
"was",
"repeated",
"three",
"times",
"with",
"typical",
"results",
"shown",
".",
"WT",
",",
"wild-type",
"Discussion",
"Recent",
"studies",
"utilising",
"tissue-specific",
"deletion",
"of",
"Pten",
"in",
"liver",
",",
"adipose",
"and",
"muscle",
"have",
"shown",
"that",
"these",
"organs",
"make",
"important",
"contributions",
"to",
"the",
"glucose",
"homeostasis",
"of",
"the",
"animal",
"and",
"clearly",
"establish",
"Pten",
"as",
"a",
"negative",
"regulator",
"of",
"insulin",
"signalling",
"in",
"vivo",
"-LSB-",
"9",
"--",
"11",
"-RSB-",
".",
"In",
"a",
"separate",
"report",
",",
"in",
"vivo",
"antisense",
"treatment",
"resulted",
"in",
"90",
"%",
"reduction",
"of",
"Pten",
"levels",
"in",
"the",
"liver",
"of",
"diabetic",
"mice",
",",
"normalising",
"blood",
"glucose",
"levels",
"and",
"improving",
"performance",
"in",
"an",
"insulin",
"tolerance",
"test",
"-LSB-",
"28",
"-RSB-",
".",
"While",
"the",
"above",
"studies",
"focused",
"on",
"the",
"role",
"of",
"Pten",
"in",
"specific",
"tissues",
",",
"the",
"current",
"work",
"defines",
"the",
"effects",
"of",
"partial",
"systemic",
"reduction",
"of",
"Pten",
"on",
"the",
"regulation",
"of",
"insulin",
"sensitivity",
"in",
"the",
"context",
"of",
"the",
"whole",
"animal",
".",
"PTEN",
"expression/activity",
"is",
"tightly",
"regulated",
"by",
"a",
"complex",
"mechanism",
"that",
"is",
"currently",
"poorly",
"understood",
".",
"PTEN",
"is",
"transcriptionally",
"regulated",
"by",
"transcription",
"factors",
"such",
"as",
"p53",
",",
"Egr-1",
",",
"NFκB",
"and",
"SMADs",
",",
"while",
"protein",
"levels",
"and",
"activity",
"are",
"modulated",
"by",
"phosphorylation",
",",
"oxidation",
",",
"subcellular",
"localisation",
",",
"phospholipid",
"binding",
"and",
"protein",
"stability",
"-LSB-",
"29",
"-RSB-",
".",
"Previous",
"studies",
"showed",
"that",
"Pten",
"haploinsufficiency",
"results",
"in",
"only",
"a",
"15",
"--",
"50",
"%",
"reduction",
"in",
"Pten",
"protein",
",",
"leaving",
"a",
"substantial",
"amount",
"of",
"Pten",
"protein",
"remaining",
"in",
"the",
"tissues",
"examined",
"-LSB-",
"14",
",",
"22",
"--",
"24",
",",
"30",
"-RSB-",
".",
"In",
"our",
"hands",
",",
"western",
"blot",
"analysis",
"indicated",
"similar",
"decreases",
"in",
"tissue",
"Pten",
"levels",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"The",
"present",
"study",
"provides",
"the",
"first",
"evidence",
"that",
"Pten",
"haploinsufficiency",
"leads",
"to",
"insulin",
"hypersensitivity",
"in",
"vivo",
",",
"suggesting",
"that",
"even",
"small",
"changes",
"in",
"Pten",
"levels",
"or",
"activity",
"can",
"lead",
"to",
"dramatic",
"effects",
"on",
"insulin",
"responses",
".",
"Thus",
"partial",
"systemic",
"inhibition",
"of",
"PTEN",
"activity",
"may",
"represent",
"a",
"novel",
"strategy",
"to",
"ameliorate",
"the",
"pathology",
"of",
"type",
"2",
"diabetes",
".",
"The",
"PI3K/PKB",
"signalling",
"axis",
"is",
"central",
"to",
"maintenance",
"of",
"normal",
"glucose",
"homeostasis",
"-LSB-",
"1",
"-RSB-",
".",
"Pten-deficient",
"cells",
"typically",
"have",
"elevated",
"levels",
"of",
"intracellular",
"PIP3",
"-LSB-",
"31",
",",
"32",
"-RSB-",
".",
"The",
"sustained",
"phosphorylation",
"of",
"PKB/Akt",
"and",
"a",
"downstream",
"effector",
",",
"GSK3β",
",",
"observed",
"in",
"the",
"current",
"study",
"is",
"consistent",
"with",
"previous",
"reports",
"of",
"elevated",
"PKB/Akt",
"activation",
"as",
"a",
"result",
"of",
"impaired",
"desensitisation",
"of",
"PI3K-dependent",
"signals",
"under",
"conditions",
"of",
"Pten",
"inactivation",
"or",
"inhibition",
"-LSB-",
"9",
"--",
"11",
",",
"28",
"-RSB-",
".",
"A",
"subtle",
"reduction",
"of",
"Pten",
"in",
"the",
"Pten",
"+",
"/",
"−",
"mice",
"appears",
"sufficient",
"to",
"achieve",
"a",
"prolonged",
"and",
"robust",
"insulin",
"signal",
".",
"The",
"roles",
"of",
"PIP3",
"and",
"PKB/Akt",
"in",
"insulin-mediated",
"glucose",
"uptake",
"have",
"been",
"well-established",
";",
"therefore",
",",
"our",
"data",
"collectively",
"suggest",
"that",
"sustained",
"PI3K/PKB/Akt",
"/",
"GSK3",
"signalling",
"may",
",",
"in",
"part",
",",
"contribute",
"to",
"insulin",
"hypersensitivity",
"in",
"Pten",
"+",
"/",
"−",
"mice",
".",
"However",
",",
"other",
"PKB/Akt-independent",
"signalling",
"pathways",
",",
"as",
"well",
"as",
"additional",
"signals",
"delivered",
"by",
"the",
"protein",
"phosphatase",
"and/or",
"adaptor",
"functions",
"of",
"Pten",
"may",
"also",
"contribute",
"to",
"the",
"insulin",
"hypersensitivity",
"phenotype",
"manifested",
"by",
"Pten",
"haploinsufficiency",
".",
"GLUT1",
"glucose",
"transporters",
"are",
"constitutively",
"present",
"at",
"the",
"cell",
"surface",
",",
"while",
"GLUT4",
"cycles",
"between",
"intracellular",
"vesicles",
"and",
"the",
"cell",
"surface",
"in",
"a",
"manner",
"controlled",
"by",
"insulin-mediated",
"signalling",
"mechanisms",
"-LSB-",
"25",
"-RSB-",
".",
"In",
"unstimulated",
"fat",
"and",
"muscle",
"cells",
",",
"the",
"majority",
"of",
"GLUT4",
"exists",
"in",
"intracellular",
"compartments",
",",
"while",
"the",
"insulin",
"signal",
"stimulates",
"the",
"exocytosis",
"of",
"GLUT4",
"to",
"the",
"cell",
"surface",
".",
"Studies",
"involving",
"PKB/Akt-null",
"animals",
"and",
"silencing",
"of",
"PKB/Akt",
"by",
"RNA",
"interference",
"have",
"demonstrated",
"that",
"PKB/Akt",
"is",
"of",
"primary",
"importance",
"in",
"GLUT4",
"translocation",
"-LSB-",
"33",
"--",
"36",
"-RSB-",
".",
"In",
"the",
"current",
"study",
",",
"we",
"observed",
"an",
"enhancement",
"of",
"2-deoxyglucose",
"uptake",
"in",
"Pten",
"+",
"/",
"−",
"cells",
"even",
"in",
"the",
"absence",
"of",
"insulin",
"stimulation",
",",
"which",
"was",
"consistent",
"with",
"our",
"observation",
"of",
"increased",
"biotinylation",
"of",
"GLUT4",
"at",
"the",
"cell",
"surface",
",",
"while",
"GLUT1",
"levels",
"were",
"unaffected",
".",
"However",
",",
"we",
"detected",
"no",
"increase",
"in",
"phosphorylation",
"of",
"PKB/Akt",
"in",
"the",
"absence",
"of",
"insulin",
"in",
"Pten",
"+",
"/",
"−",
"cells",
".",
"Consistent",
"with",
"these",
"observations",
",",
"a",
"recent",
"study",
"in",
"which",
"Pten",
"was",
"specifically",
"knocked",
"down",
"by",
"RNA",
"interference",
"reported",
"slight",
"but",
"significant",
"enhancement",
"of",
"deoxyglucose",
"uptake",
"in",
"adipocytes",
",",
"but",
"no",
"apparent",
"increase",
"in",
"phosphorylation",
"of",
"PKB/Akt",
"-LSB-",
"37",
"-RSB-",
".",
"These",
"results",
"could",
"reflect",
"a",
"mechanism",
"-LRB-",
"s",
"-RRB-",
"affecting",
"glucose",
"transport",
"involving",
"Pten/PIP3",
"but",
"independent",
"of",
"PKB/Akt",
".",
"Such",
"a",
"mechanism",
"could",
"involve",
"the",
"atypical",
"protein",
"kinases",
"C-λ",
"and",
"-",
"ζ",
"-LRB-",
"PKC-λ",
"and",
"PKC-ζ",
"-RRB-",
",",
"which",
",",
"like",
"PKB/Akt",
",",
"are",
"subject",
"to",
"control",
"by",
"PI3K",
"via",
"PIP3",
"and",
"3-phosphoinositide-dependent",
"protein",
"kinase-1",
"-LRB-",
"PDK-1",
"-RRB-",
"-LSB-",
"38",
"--",
"40",
"-RSB-",
".",
"A",
"number",
"of",
"studies",
"have",
"implicated",
"PKC-λ/ζ",
"in",
"insulin-stimulated",
"glucose",
"transport",
"and",
"GLUT4",
"translocation",
"-LSB-",
"38",
",",
"41",
"--",
"43",
"-RSB-",
".",
"These",
"studies",
"indicate",
"a",
"role",
"for",
"PKC-λ/ζ",
"which",
"appears",
"to",
"be",
"complementary",
"or",
"parallel",
"to",
"that",
"of",
"PKB/Akt",
".",
"The",
"importance",
"of",
"the",
"PI3K",
"pathway",
"in",
"insulin",
"signalling",
"has",
"raised",
"interest",
"in",
"developing",
"pharmaceutical",
"antagonists",
"targeting",
"PIP3",
"phosphatases",
"such",
"as",
"PTEN",
"or",
"Sh2-containing",
"inositol",
"5",
"′",
"-",
"phosphatase",
"2",
"-LRB-",
"SHIP2",
";",
"also",
"known",
"as",
"Inppl1",
"-RRB-",
"in",
"an",
"effort",
"to",
"enhance",
"insulin",
"responsiveness",
"in",
"type",
"2",
"diabetes",
"-LSB-",
"44",
"-RSB-",
".",
"While",
"a",
"study",
"on",
"Ship2-null",
"mice",
"initially",
"implicated",
"Ship2",
"as",
"a",
"key",
"regulator",
"of",
"glucose",
"uptake",
"-LSB-",
"45",
"-RSB-",
",",
"it",
"was",
"subsequently",
"recognised",
"that",
"these",
"mice",
"also",
"had",
"deleted",
"a",
"neighbouring",
"gene",
",",
"Phox2a",
",",
"which",
"may",
"have",
"contributed",
"to",
"the",
"observed",
"phenotype",
"-LRB-",
"corrigendum",
"appears",
"in",
"Nature",
"vol",
".",
"431",
",",
"p.",
"878",
"-RRB-",
".",
"A",
"new",
"gene-targeted",
"mouse",
"has",
"since",
"been",
"generated",
"in",
"which",
"only",
"the",
"gene",
"encoding",
"Ship2",
"is",
"deleted",
"-LSB-",
"46",
"-RSB-",
".",
"Interestingly",
",",
"this",
"mouse",
"does",
"not",
"exhibit",
"insulin",
"hypersensitivity",
"but",
"is",
"protected",
"against",
"diet-induced",
"obesity",
",",
"-LSB-",
"46",
",",
"47",
"-RSB-",
".",
"In",
"the",
"light",
"of",
"these",
"new",
"findings",
",",
"our",
"observations",
"of",
"dramatic",
"enhancement",
"of",
"insulin",
"sensitivity",
"and",
"glucose",
"uptake",
"resulting",
"from",
"Pten",
"haploinsufficiency",
"suggests",
"that",
"PTEN",
"plays",
"a",
"role",
"in",
"the",
"desensitisation",
"of",
"insulin",
"signalling",
",",
"and",
"strengthens",
"the",
"hypothesis",
"that",
"PTEN",
"is",
"a",
"key",
"regulator",
"of",
"insulin-stimulated",
"glucose",
"uptake",
".",
"Type",
"2",
"diabetes",
"is",
"associated",
"with",
"insulin",
"deficiency",
"and",
"resistance",
"to",
"insulin",
"signalling",
"-LSB-",
"48",
",",
"49",
"-RSB-",
".",
"The",
"current",
"study",
"provides",
"further",
"support",
"for",
"PTEN",
"as",
"a",
"candidate",
"for",
"drug",
"intervention",
"in",
"treating",
"type",
"2",
"diabetes",
".",
"However",
",",
"enthusiasm",
"for",
"systemic",
"PTEN",
"inhibitors",
"as",
"a",
"therapeutic",
"approach",
"for",
"treating",
"type",
"2",
"diabetes",
"is",
"tempered",
"by",
"the",
"potential",
"side-effects",
"of",
"such",
"agents",
".",
"Most",
"notably",
",",
"a",
"modest",
"reduction",
"of",
"Pten",
"in",
"Pten",
"+",
"/",
"−",
"mice",
"promotes",
"tumour",
"formation",
"in",
"a",
"wide",
"variety",
"of",
"tissue",
",",
"suggesting",
"that",
"long-term",
"chronic",
"administration",
"of",
"systemic",
"PTEN",
"inhibitors",
"may",
"lead",
"to",
"enhanced",
"cancer",
"development",
"and",
"progression",
".",
"Furthermore",
",",
"the",
"PI3K",
"pathway",
"is",
"an",
"important",
"regulator",
"of",
"numerous",
"normal",
"cellular",
"processes",
"and",
"systemic",
"PTEN",
"inhibition",
"may",
"cause",
"dysfunction",
"of",
"many",
"cells",
"and",
"tissues",
",",
"leading",
"to",
"alterations",
"in",
"liver",
",",
"kidney",
",",
"brain",
"function",
",",
"etc.",
".",
"For",
"example",
",",
"hepatocyte-specific",
"Pten-deficient",
"mice",
"exhibit",
"hepatomegaly",
"and",
"liver",
"steatosis",
"-LSB-",
"9",
"-RSB-",
".",
"Systemic",
"inhibition",
"of",
"PTEN",
"may",
"therefore",
"be",
"unacceptable",
"clinically",
"because",
"of",
"these",
"inherent",
"potential",
"toxicities",
"-LSB-",
"44",
"-RSB-",
".",
"However",
",",
"targeted",
"delivery",
"of",
"PTEN",
"antagonists",
"to",
"muscle",
"cells",
"or",
"adipocytes",
"may",
"overcome",
"these",
"limitations",
"and",
"they",
"hold",
"promise",
"as",
"clinically",
"viable",
"agents",
"in",
"treatment",
"of",
"type",
"2",
"diabetes",
"-LSB-",
"44",
"-RSB-",
".",
"This",
"study",
"shows",
"that",
"partial",
"inhibition",
"of",
"Pten",
"is",
"sufficient",
"to",
"enhance",
"insulin",
"sensitivity",
".",
"This",
"observation",
"is",
"important",
"from",
"a",
"therapeutic",
"standpoint",
",",
"as",
"most",
"drugs",
"are",
"unlikely",
"to",
"completely",
"inhibit",
"enzyme",
"activity",
"in",
"vivo",
",",
"nor",
"would",
"complete",
"inhibition",
"be",
"desirable",
"given",
"the",
"potential",
"for",
"cancer",
"development",
"resulting",
"from",
"chronic",
"or",
"overactivation",
"of",
"the",
"PI3K/PKB",
"pathway",
"-LSB-",
"12",
",",
"14",
",",
"23",
"-RSB-",
".",
"In",
"conclusion",
",",
"Pten",
"haploinsufficiency",
"results",
"in",
"insulin",
"hypersensitivity",
",",
"which",
"underscores",
"the",
"importance",
"of",
"PTEN",
"in",
"attenuating",
"insulin",
"signals",
",",
"and",
"suggests",
"that",
"small-molecule",
"drugs",
"that",
"antagonise",
"PTEN",
"activity",
"may",
"represent",
"a",
"novel",
"class",
"of",
"insulin-sensitising",
"agents",
"and",
"targeted",
"delivery",
"of",
"these",
"agents",
"to",
"muscle",
"cells",
"or",
"adipocytes",
"may",
"have",
"potential",
"clinical",
"utility",
"in",
"treating",
"insulin",
"resistance",
"observed",
"in",
"type",
"2",
"diabetes",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"I",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Dev_Biol-2-1-2279743 | [
"Redundancy",
"and",
"evolution",
"of",
"GATA",
"factor",
"requirements",
"in",
"development",
"of",
"the",
"myocardium",
"The",
"transcription",
"factors",
",",
"GATA4",
",",
"5",
"and",
"6",
",",
"recognize",
"the",
"same",
"DNA",
"sequence",
"and",
"are",
"all",
"expressed",
"in",
"the",
"developing",
"myocardium",
".",
"However",
",",
"knockout",
"studies",
"in",
"the",
"mouse",
"have",
"indicated",
"that",
"none",
"of",
"them",
"are",
"absolutely",
"required",
"for",
"the",
"specification",
"of",
"the",
"myocardium",
".",
"Here",
"we",
"present",
"evidence",
"for",
"redundancy",
"in",
"this",
"family",
"for",
"the",
"first",
"time",
".",
"Using",
"morpholinos",
"in",
"both",
"Xenopus",
"and",
"zebrafish",
"embryos",
",",
"we",
"show",
"that",
"GATA4",
"knockdown",
",",
"for",
"example",
",",
"only",
"affects",
"cardiac",
"marker",
"expression",
"in",
"the",
"absence",
"of",
"either",
"GATA5",
"or",
"GATA6",
".",
"A",
"similar",
"situation",
"pertains",
"for",
"GATA5",
"in",
"Xenopus",
"whereas",
",",
"in",
"zebrafish",
",",
"GATA5",
"-LRB-",
"faust",
"-RRB-",
"plays",
"a",
"major",
"role",
"in",
"driving",
"the",
"myocardial",
"programme",
".",
"This",
"requirement",
"for",
"GATA5",
"in",
"zebrafish",
"is",
"for",
"induction",
"of",
"the",
"myocardium",
",",
"in",
"contrast",
"to",
"the",
"GATA6",
"requirement",
"in",
"both",
"species",
",",
"which",
"is",
"for",
"differentiation",
".",
"This",
"early",
"role",
"for",
"GATA5",
"in",
"zebrafish",
"correlates",
"with",
"its",
"earlier",
"expression",
"and",
"with",
"an",
"earlier",
"requirement",
"for",
"BMP",
"signalling",
",",
"suggesting",
"that",
"a",
"mutual",
"maintenance",
"loop",
"for",
"GATA",
",",
"BMP",
"and",
"Nkx",
"expression",
"is",
"the",
"evolutionarily",
"conserved",
"entity",
".",
"Introduction",
"The",
"GATA",
"factors",
"are",
"zinc",
"finger",
"transcriptional",
"activators",
"that",
"bind",
"to",
"the",
"consensus",
"DNA",
"sequence",
"-LRB-",
"A/T",
"-RRB-",
"GATA",
"-LRB-",
"A/G",
"-RRB-",
".",
"They",
"have",
"been",
"identified",
"throughout",
"eukaryotes",
"and",
"been",
"shown",
"to",
"play",
"critical",
"roles",
"in",
"both",
"haematopoiesis",
"and",
"cardiogenesis",
"in",
"vertebrates",
"and",
"Drosophila",
"-LRB-",
"Fossett",
"and",
"Schulz",
",",
"2001",
";",
"Nemer",
"and",
"Nemer",
",",
"2001",
"-RRB-",
".",
"Of",
"the",
"six",
"evolutionarily",
"conserved",
"GATA",
"genes",
"in",
"vertebrates",
",",
"GATA4",
",",
"5",
"and",
"6",
"are",
"expressed",
"in",
"the",
"heart",
"as",
"it",
"develops",
".",
"Loss",
"and",
"gain",
"of",
"function",
"studies",
"in",
"P19",
"embryonal",
"carcinoma",
"cells",
"indicated",
"a",
"requirement",
"for",
"GATA4",
"in",
"the",
"differentiation",
"of",
"cardiac",
"restricted",
"cells",
"to",
"beating",
"cardiomyocytes",
"-LRB-",
"Grepin",
"et",
"al.",
",",
"1997",
",",
"1995",
"-RRB-",
".",
"In",
"addition",
",",
"overexpression",
"of",
"GATA4",
"in",
"Xenopus",
"embryos",
"and",
"explants",
"resulted",
"in",
"expression",
"of",
"cardiac",
"differentiation",
"markers",
"and",
"in",
"some",
"cases",
"spontaneously",
"beating",
"tissue",
"-LRB-",
"Jiang",
"and",
"Evans",
",",
"1996",
";",
"Latinkic",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"However",
",",
"in",
"the",
"GATA4",
"null",
"mouse",
",",
"normal",
"amounts",
"of",
"myocardial",
"tissue",
"appeared",
"to",
"be",
"formed",
"-LRB-",
"Holtzinger",
"and",
"Evans",
",",
"2005",
";",
"Kuo",
"et",
"al.",
",",
"1997",
";",
"Molkentin",
"et",
"al.",
",",
"1997",
";",
"Narita",
"et",
"al.",
",",
"1996",
"-RRB-",
".",
"Thus",
",",
"even",
"though",
"cardia",
"bifida",
"and",
"defects",
"in",
"looping",
"morphogenesis",
"were",
"observed",
"in",
"the",
"null",
"mouse",
"embryos",
",",
"specification",
"of",
"the",
"myocardium",
"appeared",
"to",
"take",
"place",
"normally",
".",
"A",
"suggested",
"explanation",
"for",
"this",
"was",
"the",
"elevated",
"expression",
"of",
"GATA6",
"-LRB-",
"Holtzinger",
"and",
"Evans",
",",
"2005",
";",
"Kuo",
"et",
"al.",
",",
"1997",
";",
"Molkentin",
"et",
"al.",
",",
"1997",
";",
"Narita",
"et",
"al.",
",",
"1996",
";",
"Pu",
"et",
"al.",
",",
"2004",
"-RRB-",
".",
"Consistent",
"with",
"this",
"proposed",
"redundancy",
"of",
"function",
"within",
"the",
"family",
",",
"GATA5",
"and",
"6",
"are",
"also",
"active",
"in",
"the",
"P19",
"cell",
"line",
"and",
"Xenopus",
"explant",
"assays",
"described",
"above",
".",
"Thus",
",",
"it",
"appears",
"that",
"each",
"of",
"these",
"three",
"GATA",
"family",
"members",
"possesses",
"the",
"capability",
"of",
"inducing",
"cardiac",
"differentiation",
"in",
"gain-of-function",
"assays",
",",
"however",
"demonstration",
"that",
"they",
"exhibit",
"such",
"redundancy",
"in",
"vivo",
"awaits",
"combinatorial",
"loss-of-function",
"assays",
".",
"The",
"GATA5",
"null",
"mouse",
"shows",
"no",
"cardiac",
"phenotype",
",",
"however",
"it",
"may",
"not",
"be",
"a",
"true",
"knockout",
"due",
"to",
"the",
"potential",
"formation",
"of",
"a",
"truncated",
"protein",
"containing",
"the",
"DNA",
"binding",
"domain",
"-LRB-",
"Nemer",
"and",
"Nemer",
",",
"2002",
"-RRB-",
".",
"In",
"the",
"zebrafish",
",",
"a",
"critical",
"role",
"for",
"GATA5",
"in",
"specification",
"of",
"the",
"myocardium",
"has",
"been",
"demonstrated",
"by",
"loss",
"and",
"gain",
"of",
"function",
"assays",
"-LRB-",
"Reiter",
"et",
"al.",
",",
"1999",
"-RRB-",
".",
"The",
"fausttm236",
"mutant",
"shows",
"a",
"severe",
"reduction",
"in",
"expression",
"of",
"cardiac",
"markers",
"and",
"injection",
"of",
"GATA5",
"RNA",
"induces",
"ectopic",
"expression",
"of",
"the",
"same",
"markers",
".",
"However",
",",
"GATA4",
"expression",
"in",
"the",
"zebrafish",
"fausttm23",
"mutant",
"is",
"significantly",
"reduced",
"and",
"overexpression",
"of",
"GATA5",
"results",
"in",
"ectopic",
"expression",
"of",
"GATA4",
".",
"Thus",
",",
"these",
"studies",
"raise",
"the",
"possibility",
"that",
"the",
"GATA5",
"knockdown",
"phenotype",
"is",
"due",
"to",
"the",
"combined",
"loss",
"of",
"GATA4",
"and",
"5",
".",
"The",
"GATA6",
"null",
"mouse",
"is",
"an",
"embryonic",
"lethal",
"due",
"to",
"an",
"extra-embryonic",
"defect",
"and",
"chimeras",
"have",
"indicated",
"that",
"GATA6",
"is",
"not",
"required",
"for",
"specification",
"of",
"the",
"myocardium",
"-LRB-",
"Kabrun",
"et",
"al.",
",",
"1997",
";",
"Koutsourakis",
"et",
"al.",
",",
"1999",
";",
"Kuo",
"et",
"al.",
",",
"1997",
";",
"Molkentin",
",",
"2000",
";",
"Molkentin",
"et",
"al.",
",",
"1997",
";",
"Morrisey",
"et",
"al.",
",",
"1997",
"-RRB-",
".",
"However",
",",
"we",
"have",
"presented",
"evidence",
"that",
"GATA6",
"is",
"required",
"for",
"the",
"maintenance",
"and",
"differentiation",
"of",
"cardiac",
"progenitors",
"in",
"zebrafish",
"and",
"Xenopus",
"embryos",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"The",
"likely",
"resolution",
"of",
"these",
"apparently",
"contradictory",
"data",
"is",
"that",
"the",
"major",
"consequence",
"of",
"lost",
"GATA6",
"function",
"is",
"non-cell",
"autonomous",
"and",
"can",
"therefore",
"be",
"rescued",
"by",
"surrounding",
"wild",
"type",
"cells",
"in",
"mouse",
"chimeras",
".",
"The",
"likely",
"non-cell",
"autonomous",
"target",
"for",
"GATA6",
"is",
"BMP",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"However",
",",
"this",
"requirement",
"for",
"GATA6",
"is",
"for",
"differentiation",
"of",
"cardiac",
"progenitors",
"and",
"not",
"for",
"their",
"initial",
"specification",
".",
"In",
"this",
"study",
"we",
"use",
"antisense",
"morpholinos",
"in",
"Xenopus",
"and",
"zebrafish",
"embryos",
"to",
"deplete",
"combinations",
"of",
"GATA4",
",",
"5",
"and",
"6",
"for",
"the",
"first",
"time",
".",
"This",
"has",
"allowed",
"us",
"to",
"provide",
"the",
"first",
"experimental",
"support",
"for",
"redundancy",
"in",
"vivo",
".",
"In",
"addition",
",",
"we",
"show",
"that",
"the",
"strong",
"dependence",
"of",
"zebrafish",
"on",
"GATA5",
"is",
"not",
"mirrored",
"in",
"Xenopus",
",",
"where",
"this",
"GATA",
"factor",
"plays",
"only",
"a",
"redundant",
"role",
",",
"like",
"GATA4",
"in",
"both",
"species",
".",
"The",
"requirement",
"for",
"GATA5",
"in",
"the",
"zebrafish",
"is",
"for",
"the",
"induction",
"of",
"the",
"myocardial",
"programme",
",",
"whereas",
"in",
"Xenopus",
",",
"GATA",
"activity",
"is",
"only",
"required",
"for",
"differentiation",
".",
"We",
"propose",
"that",
"the",
"primary",
"function",
"for",
"GATA",
"factors",
"in",
"development",
"of",
"the",
"myocardium",
"is",
"in",
"creating",
"a",
"sub-circuit",
"of",
"the",
"regulatory",
"network",
",",
"involving",
"another",
"critical",
"transcription",
"factor",
",",
"Nkx",
",",
"and",
"a",
"crucial",
"signalling",
"pathway",
",",
"BMP",
".",
"This",
"mutually",
"supportive",
"sub-network",
"is",
"evolutionarily",
"stable",
",",
"even",
"though",
"where",
"the",
"network",
"is",
"initiated",
"appears",
"to",
"be",
"more",
"flexible",
".",
"Materials",
"and",
"methods",
"In",
"situ",
"hybridisation",
"of",
"whole-mounted",
"and",
"sectioned",
"embryos",
"Xenopus",
"and",
"zebrafish",
"were",
"maintained",
"and",
"embryos",
"were",
"raised",
"and",
"staged",
"using",
"standard",
"conditions",
"-LRB-",
"Nieuwkoop",
"and",
"Faber",
",",
"1967",
";",
"Westerfield",
",",
"1993",
"-RRB-",
".",
"In",
"situ",
"hybridisations",
"on",
"whole-mounted",
"and",
"sectioned",
"embryos",
"were",
"carried",
"out",
"as",
"previously",
"described",
"-LRB-",
"Ciau-Uitz",
"et",
"al.",
",",
"2000",
";",
"Jowett",
",",
"2001",
";",
"Walmsley",
"et",
"al.",
",",
"1994",
"-RRB-",
".",
"All",
"RNA",
"probes",
"used",
"were",
"labelled",
"with",
"digoxigenin",
"-LRB-",
"DIG",
"-RRB-",
"except",
"for",
"MyoD",
"and",
"Krox20",
"which",
"were",
"used",
"in",
"double",
"in",
"situ",
"hybridisations",
"and",
"labelled",
"with",
"fluorescein",
".",
"Detection",
"of",
"the",
"antibody",
"--",
"alkaline",
"phosphatase",
"was",
"done",
"using",
"BM",
"purple",
"-LRB-",
"Roche",
"-RRB-",
"or",
"Fast",
"red",
"-LRB-",
"Sigma",
"-RRB-",
".",
"After",
"in",
"situ",
"hybridisation",
",",
"embryos",
"were",
"re-fixed",
"in",
"4",
"%",
"paraformaldehyde",
",",
"zebrafish",
"embryos",
"were",
"transferred",
"into",
"75",
"%",
"glycerol",
"to",
"be",
"photographed",
".",
"Cryostat",
"sections",
"were",
"performed",
"after",
"in",
"situ",
"hybridisation",
",",
"embryos",
"were",
"fixed",
"as",
"above",
"and",
"washed",
"in",
"30",
"%",
"sucrose",
".",
"Embryos",
"were",
"transferred",
"into",
"embedding",
"chambers",
"in",
"O.C.T",
"Compound",
"-LRB-",
"Tissue-Tek",
"-RRB-",
"and",
"30",
"μm",
"sections",
"were",
"cut",
"on",
"a",
"Leica",
"CM3050S",
".",
"Morpholino",
"-LRB-",
"MO",
"-RRB-",
"injection",
"The",
"GATA4/5/6",
"antisense",
"morpholinos",
"were",
"designed",
"and",
"manufactured",
"by",
"Genetools",
".",
"Morpholino",
"sequences",
":",
"Xenopus",
"GATA4",
"MO",
"5",
"′",
"ctggcaactcaatccacaaaatcca3",
"′",
"-LRB-",
"data",
"shown",
"here",
"-RRB-",
",",
"a",
"second",
"morpholino",
"designed",
"against",
"the",
"same",
"pseudo-allele",
"as",
"described",
"by",
"Afouda",
"et",
"al.",
"-LRB-",
"2005",
"-RRB-",
"-LRB-",
"data",
"not",
"shown",
",",
"5",
"′",
"agctatactctgatacatcctgatc3",
"′",
"-RRB-",
",",
"and",
"a",
"third",
"GATA4",
"MO",
"designed",
"to",
"block",
"both",
"pseudo-alleles",
"-LRB-",
"a",
"kind",
"gift",
"from",
"Todd",
"Evans",
"-RRB-",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
"gave",
"the",
"same",
"results",
".",
"Zebrafish",
"GATA4",
"MO",
"5",
"′",
"gccatcgttacaccttgatacatat3",
"′",
"or",
"a",
"second",
"splice",
"morpholino",
"as",
"described",
"by",
"Holtzinger",
"and",
"Evans",
"-LRB-",
"2005",
"-RRB-",
".",
"For",
"Xenopus",
"GATA5",
"MO",
"5",
"′",
"gctacaaacctcacagctcc3",
"′",
"see",
"Afouda",
"et",
"al.",
"-LRB-",
"2005",
"-RRB-",
".",
"Zebrafish",
"splice",
"GATA5",
"MO",
"5",
"′",
"tgttaagatttttacctatactgga3",
"′",
".",
"For",
"Xenopus",
"and",
"zebrafish",
"GATA6",
"MOs",
"see",
"Peterkin",
"et",
"al.",
"-LRB-",
"2003",
"-RRB-",
".",
"MOs",
"were",
"diluted",
"in",
"deionised",
"water",
"and",
"injected",
"as",
"described",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"For",
"zebrafish",
",",
"25",
"ng",
"GATA4",
"MO",
",",
"25",
"ng",
"GATA5",
"MO",
"and/or",
"5",
"ng",
"GATA6",
"MO",
"were",
"injected",
"into",
"single-cell",
"embryos",
"individually",
"and",
"in",
"combination",
".",
"For",
"Xenopus",
"embryos",
",",
"a",
"total",
"of",
"20",
"ng",
"of",
"GATA4",
"MO",
"or",
"GATA5",
"MO",
"and",
"10",
"ng",
"of",
"GATA6",
"MO",
"were",
"injected",
"individually",
"or",
"in",
"combination",
".",
"Results",
"GATA6",
"is",
"the",
"only",
"essential",
"GATA",
"activity",
"in",
"Xenopus",
"myocardium",
"We",
"have",
"reported",
"previously",
"that",
"GATA6",
"is",
"required",
"for",
"the",
"maintenance",
"and",
"maturation",
"of",
"cardiomyocytes",
"in",
"Xenopus",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"The",
"phenotypes",
"consequential",
"upon",
"depletion",
"of",
"GATA4",
"or",
"5",
"in",
"Xenopus",
",",
"however",
",",
"have",
"not",
"been",
"previously",
"reported",
".",
"In",
"the",
"case",
"of",
"GATA5",
",",
"the",
"need",
"to",
"know",
"is",
"made",
"greater",
"because",
"of",
"its",
"major",
"contribution",
"in",
"zebrafish",
",",
"and",
"the",
"inability",
"to",
"determine",
"if",
"this",
"is",
"a",
"general",
"requirement",
"in",
"vertebrates",
"by",
"comparison",
"with",
"the",
"mouse",
"knockout",
",",
"because",
"the",
"reported",
"mutation",
"in",
"the",
"mouse",
"appears",
"not",
"to",
"be",
"a",
"null",
"-LRB-",
"Nemer",
"et",
"al.",
",",
"1999",
"-RRB-",
".",
"Therefore",
",",
"before",
"examining",
"depletion",
"of",
"combinations",
"of",
"GATA",
"factors",
",",
"we",
"examined",
"the",
"individual",
"loss",
"of",
"GATA4",
"and",
"5",
"in",
"comparison",
"to",
"the",
"already",
"known",
"GATA6",
"phenotype",
".",
"The",
"design",
"and",
"quality",
"control",
"of",
"MOs",
"against",
"Xenopus",
"GATA4",
",",
"5",
"and",
"6",
"have",
"been",
"reported",
"previously",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
";",
"Afouda",
"et",
"al.",
",",
"2005",
"-RRB-",
".",
"For",
"GATA4",
",",
"as",
"well",
"as",
"the",
"MO",
"reported",
"previously",
",",
"two",
"other",
"MOs",
",",
"one",
"against",
"both",
"pseudo-alleles",
"-LRB-",
"Todd",
"Evans",
",",
"personal",
"communication",
"-RRB-",
",",
"were",
"tested",
"and",
"gave",
"the",
"same",
"results",
".",
"For",
"GATA5",
"and",
"6",
",",
"MOs",
"were",
"designed",
"to",
"target",
"both",
"pseudo-alleles",
"of",
"the",
"Xenopus",
"laevis",
"genes",
".",
"The",
"optimal",
"amount",
"of",
"each",
"MO",
"injected",
"was",
"determined",
"by",
"titration",
"to",
"ensure",
"that",
"the",
"maximum",
"dose",
"without",
"non-specific",
"effects",
"was",
"used",
".",
"The",
"extent",
"of",
"knockdown",
"by",
"these",
"ATG",
"MOs",
"was",
"determined",
"by",
"co-injection",
"of",
"tagged",
"reporter",
"RNAs",
"followed",
"by",
"Western",
"blotting",
"-LRB-",
"Afouda",
"et",
"al.",
",",
"2005",
";",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"Very",
"little",
"residual",
"protein",
"was",
"detected",
"in",
"each",
"case",
".",
"When",
"MOs",
"against",
"individual",
"GATA",
"factors",
"were",
"injected",
"separately",
"into",
"the",
"presumptive",
"heart",
"field",
",",
"the",
"dorsolateral",
"marginal",
"zone",
",",
"of",
"4-cell",
"Xenopus",
"embryos",
",",
"cardia",
"bifida",
"was",
"induced",
"in",
"each",
"case",
"-LRB-",
"Fig.",
"1A",
",",
"visualised",
"by",
"staining",
"the",
"cells",
"for",
"expression",
"of",
"Myosin",
"Light",
"Chain",
"2",
"-LRB-",
"MLC",
"-RRB-",
"-RRB-",
".",
"Cardia",
"bifida",
"has",
"been",
"reported",
"previously",
"for",
"the",
"GATA4",
"knockout",
"mouse",
"-LRB-",
"Kuo",
"et",
"al.",
",",
"1997",
";",
"Molkentin",
"et",
"al.",
",",
"1997",
"-RRB-",
",",
"the",
"GATA5",
"mutant",
"zebrafish",
",",
"faust",
"-LRB-",
"Reiter",
"et",
"al.",
",",
"1999",
"-RRB-",
",",
"and",
"GATA6",
"morphant",
"Xenopus",
"and",
"zebrafish",
"embryos",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
",",
"but",
"this",
"is",
"the",
"first",
"direct",
"comparison",
"in",
"a",
"single",
"species",
"showing",
"that",
"all",
"three",
"GATA",
"factors",
"are",
"required",
"for",
"the",
"timely",
"migration",
"of",
"cardiac",
"precursors",
"to",
"the",
"midline",
"for",
"fusion",
"of",
"the",
"heart",
"tube",
".",
"This",
"is",
"in",
"contrast",
"to",
"requirements",
"in",
"the",
"differentiation",
"of",
"the",
"myocardium",
"-LRB-",
"see",
"below",
"-RRB-",
",",
"where",
"only",
"one",
"member",
"of",
"the",
"family",
"is",
"essential",
".",
"It",
"seems",
"likely",
"that",
"the",
"requirement",
"for",
"GATA4",
",",
"5",
"and",
"6",
"in",
"midline",
"migration",
"of",
"myocardial",
"precursors",
"is",
"actually",
"in",
"the",
"underlying",
"endoderm",
",",
"where",
"they",
"are",
"all",
"expressed",
"and",
"which",
"has",
"been",
"shown",
"to",
"be",
"essential",
"in",
"mouse",
"and",
"zebrafish",
"for",
"heart",
"tube",
"fusion",
"-LRB-",
"Afouda",
"et",
"al.",
",",
"2005",
";",
"Alexander",
"et",
"al.",
",",
"1999",
";",
"Molkentin",
"et",
"al.",
",",
"1997",
";",
"Narita",
"et",
"al.",
",",
"1997",
";",
"Reiter",
"et",
"al.",
",",
"1999",
";",
"Weber",
"et",
"al.",
",",
"2000",
"-RRB-",
".",
"To",
"determine",
"the",
"effects",
"of",
"the",
"GATA",
"MOs",
"on",
"programming",
"of",
"the",
"myocardial",
"cells",
",",
"as",
"opposed",
"to",
"their",
"morphological",
"movements",
",",
"the",
"levels",
"of",
"expression",
"of",
"the",
"transcription",
"factors",
",",
"Nkx2",
".5",
"and",
"Tbx5",
",",
"and",
"of",
"the",
"contractile",
"machinery",
"genes",
",",
"cardiac",
"actin",
"-LRB-",
"CA",
"-RRB-",
",",
"and",
"MLC",
",",
"were",
"monitored",
"by",
"whole",
"mount",
"in",
"situ",
"hybridisation",
".",
"In",
"contrast",
"to",
"the",
"GATA6",
"MO",
",",
"which",
"causes",
"a",
"profound",
"reduction",
"in",
"the",
"expression",
"of",
"these",
"genes",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
"-LRB-",
"Fig.",
"1D",
"-RRB-",
",",
"GATA4",
"and",
"GATA5",
"MOs",
"had",
"minimal",
"effects",
"-LRB-",
"Figs.",
"1B",
",",
"C",
";",
"for",
"all",
"three",
"MOs",
"and",
"for",
"each",
"marker",
"n",
"was",
"30",
"--",
"50",
"-RRB-",
".",
"Despite",
"the",
"cardia",
"bifida",
"at",
"tailbud",
"stages",
"-LRB-",
"stages",
"28",
"--",
"32",
"-RRB-",
"-LRB-",
"Fig.",
"1A",
"-RRB-",
",",
"the",
"gross",
"morphology",
"of",
"the",
"hearts",
"at",
"later",
"stages",
"-LRB-",
"stage",
"43",
"-RRB-",
"in",
"GATA4",
"and",
"GATA5",
"morphants",
"looked",
"similar",
"to",
"those",
"in",
"wild",
"type",
"embryos",
",",
"i.e.",
"the",
"cardia",
"bifida",
"was",
"only",
"transient",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"In",
"contrast",
",",
"as",
"previously",
"described",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
",",
"little",
"or",
"no",
"cardiac",
"tissue",
"was",
"observed",
"in",
"embryos",
"depleted",
"of",
"GATA6",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Thus",
",",
"it",
"would",
"appear",
"that",
",",
"apart",
"from",
"the",
"transient",
"bifida",
",",
"the",
"loss",
"of",
"GATA4",
"or",
"GATA5",
"has",
"little",
"effect",
"on",
"cardiogenesis",
"in",
"Xenopus",
".",
"To",
"ensure",
"that",
"the",
"GATA4",
"and",
"5",
"morpholinos",
"were",
"properly",
"functional",
",",
"they",
"were",
"injected",
"vegetally",
"at",
"the",
"single-cell",
"stage",
",",
"and",
"were",
"shown",
"to",
"reduce",
"the",
"expression",
"of",
"Sox17α",
"during",
"gastrulation",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
"-LRB-",
"Afouda",
"et",
"al.",
",",
"2005",
"-RRB-",
".",
"Furthermore",
",",
"the",
"gut",
"of",
"GATA5",
"morphants",
"failed",
"to",
"coil",
"properly",
",",
"as",
"previously",
"reported",
"-LRB-",
"Afouda",
"et",
"al.",
",",
"2005",
"-RRB-",
".",
"In",
"addition",
",",
"for",
"these",
"and",
"several",
"of",
"the",
"combination",
"experiments",
"described",
"below",
",",
"all",
"three",
"GATA4",
"MOs",
"gave",
"the",
"same",
"results",
".",
"We",
"therefore",
"conclude",
"that",
"for",
"development",
"of",
"the",
"myocardium",
"in",
"Xenopus",
"embryos",
",",
"GATA6",
"is",
"the",
"only",
"essential",
"GATA",
"factor",
".",
"GATA",
"factor",
"redundancy",
"in",
"Xenopus",
"myocardium",
"On",
"the",
"basis",
"of",
"slightly",
"increased",
"expression",
"of",
"GATA6",
"in",
"GATA4",
"knockout",
"mice",
",",
"redundant",
"roles",
"for",
"the",
"GATA",
"factors",
"in",
"the",
"myocardium",
"have",
"been",
"suggested",
"-LRB-",
"Kuo",
"et",
"al.",
",",
"1997",
";",
"Molkentin",
"et",
"al.",
",",
"1997",
";",
"Narita",
"et",
"al.",
",",
"1996",
";",
"Watt",
"et",
"al.",
",",
"2004",
"-RRB-",
".",
"In",
"Xenopus",
",",
"expression",
"of",
"neither",
"GATA5",
"nor",
"GATA6",
"was",
"significantly",
"increased",
"in",
"GATA4",
"MO",
"injected",
"embryos",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Similarly",
",",
"in",
"GATA5",
"and",
"GATA6",
"MO",
"injected",
"embryos",
":",
"in",
"neither",
"case",
"was",
"an",
"increase",
"in",
"expression",
"of",
"the",
"other",
"two",
"GATA",
"factors",
"observed",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"However",
",",
"redundancy",
"does",
"not",
"necessarily",
"depend",
"on",
"an",
"increase",
"in",
"expression",
"of",
"the",
"redundant",
"family",
"member",
":",
"continued",
"expression",
"could",
"suffice",
",",
"and",
"that",
"is",
"what",
"we",
"see",
"in",
"all",
"three",
"cases",
".",
"Therefore",
"to",
"formally",
"test",
"redundancy",
"within",
"the",
"GATA",
"family",
",",
"we",
"injected",
"combinations",
"of",
"MOs",
"into",
"the",
"presumptive",
"heart",
"field",
"of",
"4-cell",
"Xenopus",
"embryos",
",",
"and",
"monitored",
"MLC",
"and",
"Nkx2",
".5",
"expression",
"by",
"whole",
"mount",
"in",
"situ",
"hybridisation",
"-LRB-",
"Fig.",
"2",
"-RRB-",
".",
"Embryos",
"were",
"classified",
"as",
"unaffected",
"-LRB-",
"wild",
"type",
",",
"+",
"-RRB-",
",",
"mildly",
"-LRB-",
"−",
"-RRB-",
"or",
"strongly",
"-LRB-",
"−",
"−",
"-RRB-",
"down",
"regulated",
",",
"or",
"displaying",
"no",
"expression",
"at",
"all",
"-LRB-",
"−",
"−",
"−",
"-RRB-",
"-LRB-",
"Fig.",
"2A",
"-RRB-",
".",
"Numbers",
"of",
"embryos",
"in",
"each",
"category",
"were",
"scored",
"and",
"the",
"results",
"displayed",
"in",
"histograms",
"-LRB-",
"n",
"=",
"31",
"--",
"94",
"-RRB-",
"-LRB-",
"Figs.",
"2B",
",",
"C",
"-RRB-",
".",
"The",
"greater",
"effects",
"of",
"the",
"GATA6",
"MO",
"are",
"immediately",
"apparent",
",",
"with",
"clear",
"increases",
"in",
"the",
"affected",
"categories",
"at",
"the",
"expense",
"of",
"the",
"wild",
"type",
"category",
"compared",
"to",
"both",
"control",
"embryos",
"and",
"also",
"to",
"GATA4",
"or",
"GATA5",
"MO",
"injected",
"embryos",
".",
"When",
"combinations",
"of",
"two",
"MOs",
"were",
"injected",
",",
"evidence",
"for",
"redundancy",
"was",
"revealed",
"-LRB-",
"Figs.",
"2B",
",",
"C",
"-RRB-",
".",
"Despite",
"having",
"little",
"effect",
"on",
"their",
"own",
",",
"both",
"GATA4",
"and",
"GATA5",
"MOs",
"made",
"the",
"phenotype",
"of",
"GATA6",
"MO",
"injected",
"embryos",
"more",
"severe",
"when",
"injected",
"with",
"it",
".",
"Furthermore",
",",
"the",
"phenotype",
"observed",
"when",
"GATA4",
"and",
"5",
"MOs",
"were",
"injected",
"in",
"combination",
"was",
"significantly",
"worse",
"than",
"either",
"alone",
",",
"suggesting",
"that",
"the",
"minimal",
"phenotype",
"for",
"the",
"single",
"injections",
"relied",
"on",
"the",
"continued",
"presence",
"of",
"the",
"other",
"GATA",
"factor",
".",
"When",
"all",
"three",
"MOs",
"were",
"injected",
"together",
",",
"the",
"phenotype",
"was",
"the",
"most",
"extreme",
"of",
"all",
"with",
"the",
"vast",
"majority",
"of",
"embryos",
"having",
"no",
"expression",
"of",
"MLC",
"at",
"all",
".",
"We",
"therefore",
"conclude",
"that",
",",
"while",
"GATA6",
"is",
"the",
"only",
"individually",
"essential",
"player",
"in",
"driving",
"the",
"myocardial",
"programme",
"in",
"Xenopus",
",",
"the",
"other",
"two",
"GATA",
"factors",
"are",
"responsible",
"for",
"the",
"residual",
"expression",
"of",
"cardiac",
"genes",
".",
"Furthermore",
",",
"in",
"the",
"absence",
"of",
"GATA6",
",",
"their",
"roles",
"are",
"increased",
".",
"This",
"is",
"evident",
"from",
"their",
"significantly",
"greater",
"effects",
"on",
"embryo",
"phenotypes",
"when",
"combined",
"with",
"GATA6",
"MO",
"compared",
"to",
"on",
"their",
"own",
".",
"GATA",
"activity",
"is",
"required",
"for",
"differentiation",
"but",
"not",
"induction",
"of",
"the",
"myocardium",
"in",
"Xenopus",
"We",
"have",
"shown",
"previously",
"that",
"GATA6",
"is",
"required",
"for",
"the",
"maintenance/maturation",
"of",
"the",
"myocardium",
"rather",
"than",
"its",
"induction",
"in",
"both",
"Xenopus",
"and",
"zebrafish",
"embryos",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"As",
"expected",
",",
"based",
"on",
"the",
"absence",
"of",
"a",
"late",
"phenotype",
",",
"embryos",
"injected",
"with",
"GATA4",
"or",
"GATA5",
"MOs",
"had",
"no",
"effect",
"on",
"early",
"Nkx2",
".5",
"expression",
",",
"as",
"seen",
"for",
"GATA6",
"MO",
"-LRB-",
"n",
"=",
"60",
",",
"72",
",",
"and",
"89",
",",
"respectively",
"-RRB-",
"-LRB-",
"Fig.",
"3A",
"-RRB-",
".",
"In",
"order",
"to",
"determine",
"if",
"the",
"lack",
"of",
"an",
"early",
"effect",
",",
"even",
"for",
"GATA6",
"which",
"has",
"a",
"strong",
"late",
"phenotype",
",",
"was",
"the",
"result",
"of",
"redundancy",
"within",
"the",
"GATA",
"family",
",",
"we",
"examined",
"Nkx2",
".5",
"expression",
"at",
"neurula",
"stages",
"in",
"embryos",
"injected",
"with",
"all",
"three",
"MOs",
"-LRB-",
"n",
"=",
"102",
"-RRB-",
"-LRB-",
"Fig.",
"3A",
"-RRB-",
".",
"Expression",
"was",
"unaffected",
",",
"as",
"seen",
"with",
"each",
"of",
"the",
"MOs",
"on",
"their",
"own",
".",
"Although",
"Nkx2",
".5",
"is",
"also",
"expressed",
"in",
"the",
"underlying",
"endoderm",
"at",
"this",
"time",
",",
"we",
"showed",
"by",
"examining",
"sections",
"that",
"the",
"signal",
"in",
"the",
"cardiac",
"mesoderm",
"is",
"unaffected",
"-LRB-",
"Fig.",
"3B",
",",
"territory",
"delineated",
"by",
"dashed",
"lines",
"-RRB-",
".",
"Furthermore",
",",
"a",
"similar",
"result",
"was",
"obtained",
"for",
"Nkx2",
".3",
"-LRB-",
"n",
"=",
"55",
"-RRB-",
"-LRB-",
"Fig.",
"3C",
"-RRB-",
",",
"which",
"is",
"not",
"expressed",
"or",
"is",
"very",
"weak",
"in",
"the",
"endoderm",
"at",
"this",
"time",
"-LRB-",
"Fig.",
"3D",
"-RRB-",
".",
"The",
"expression",
"of",
"eHAND",
"was",
"also",
"unaffected",
"at",
"this",
"stage",
"-LRB-",
"Fig.",
"3E",
",",
"territory",
"delineated",
"by",
"dashed",
"lines",
"-RRB-",
".",
"We",
"therefore",
"conclude",
"that",
",",
"despite",
"their",
"earlier",
"expression",
",",
"GATA",
"factors",
"are",
"not",
"required",
"for",
"induction",
"of",
"the",
"myocardial",
"programme",
"in",
"Xenopus",
",",
"as",
"seen",
"by",
"the",
"continued",
"expression",
"of",
"the",
"other",
"early",
"regulators",
",",
"Nkx2",
".5",
",",
"Nkx2",
".3",
"and",
"eHAND",
",",
"and",
"their",
"own",
"continued",
"expression",
",",
"but",
"rather",
"for",
"its",
"maintenance/maturation",
".",
"GATA4",
"is",
"not",
"essential",
"for",
"induction",
"or",
"differentiation",
"of",
"zebrafish",
"myocardium",
"GATA5",
"-LRB-",
"faust",
"-RRB-",
"mutant",
"zebrafish",
"have",
"profound",
"defects",
"in",
"the",
"myocardium",
",",
"displaying",
"reduced",
"expression",
"of",
"several",
"myocardial",
"genes",
"-LRB-",
"Reiter",
"et",
"al.",
",",
"1999",
"-RRB-",
".",
"In",
"addition",
",",
"GATA6",
"has",
"been",
"shown",
"to",
"be",
"required",
"for",
"maintenance/maturation",
"of",
"the",
"myocardial",
"programme",
"in",
"zebrafish",
"as",
"seen",
"in",
"Xenopus",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"In",
"order",
"to",
"determine",
"the",
"relative",
"effects",
"of",
"these",
"two",
"GATA",
"factors",
",",
"and",
"to",
"determine",
"the",
"contribution",
"of",
"GATA4",
",",
"we",
"separately",
"injected",
"into",
"zebrafish",
"embryos",
"MOs",
"against",
"each",
"of",
"these",
"GATA",
"factors",
".",
"The",
"GATA4",
"MO",
"was",
"shown",
"to",
"specifically",
"block",
"translation",
"of",
"a",
"co-injected",
"GATA4",
"RNA",
"and",
"not",
"GATA5",
"or",
"GATA6",
"RNAs",
"-LRB-",
"Supplementary",
"Figs.",
"1A",
",",
"B",
",",
"C",
"-RRB-",
".",
"The",
"GATA5",
"MO",
"was",
"designed",
"to",
"block",
"splicing",
"between",
"exons",
"1",
"and",
"2",
"of",
"the",
"GATA5",
"gene",
",",
"which",
"was",
"confirmed",
"in",
"injected",
"embryos",
"by",
"RT",
"--",
"PCR",
"-LRB-",
"Supplementary",
"Figs.",
"1D",
",",
"E",
"-RRB-",
".",
"This",
"splice",
"blocking",
"morpholino",
"was",
"designed",
"upstream",
"of",
"the",
"exons",
"encoding",
"the",
"zinc",
"fingers",
"to",
"prevent",
"any",
"protein",
"produced",
"binding",
"DNA",
".",
"However",
",",
"the",
"creation",
"of",
"a",
"dominant",
"negative",
"GATA5",
"via",
"splicing",
"from",
"an",
"upstream",
"cryptic",
"site",
"is",
"formally",
"possible",
"-LRB-",
"see",
"Supplementary",
"Fig.",
"1D",
"-RRB-",
"but",
"the",
"ability",
"of",
"GATA4",
"and",
"6",
"morpholinos",
"to",
"enhance",
"the",
"cardiac",
"phenotype",
"in",
"combinations",
"-LRB-",
"see",
"below",
"-RRB-",
"makes",
"this",
"unlikely",
".",
"Furthermore",
",",
"the",
"GATA5",
"morphant",
"heart",
"phenotype",
"was",
"indistinguishable",
"from",
"that",
"seen",
"in",
"the",
"faust",
"mutant",
",",
"both",
"in",
"single",
"and",
"combination",
"experiments",
"-LRB-",
"Supplementary",
"Fig.",
"1F",
"and",
"see",
"below",
"-RRB-",
".",
"The",
"GATA6",
"MO",
"has",
"been",
"reported",
"previously",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"The",
"effects",
"of",
"the",
"three",
"MOs",
"injected",
"separately",
"into",
"zebrafish",
"embryos",
"were",
"determined",
"by",
"monitoring",
"expression",
"of",
"the",
"transcription",
"factor",
",",
"nkx2",
".5",
",",
"and",
"the",
"contractile",
"machinery",
"genes",
",",
"ventricular",
"myosin",
"heavy",
"chain",
"-LRB-",
"vmhc",
"-RRB-",
"and",
"cardiac",
"myosin",
"light",
"chain",
"2",
"-LRB-",
"cmlc2",
"-RRB-",
"-LRB-",
"Fig.",
"4",
"-RRB-",
".",
"GATA5",
"and",
"6",
"MOs",
"induced",
"cardia",
"bifida",
"as",
"described",
"previously",
"for",
"the",
"faust",
"mutant",
"and",
"the",
"GATA6",
"MO",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
";",
"Reiter",
"et",
"al.",
",",
"1999",
"-RRB-",
".",
"In",
"contrast",
",",
"in",
"GATA4",
"MO",
"injected",
"embryos",
",",
"the",
"myocardial",
"cells",
"appeared",
"to",
"have",
"migrated",
"and",
"fused",
"normally",
"at",
"the",
"midline",
".",
"We",
"therefore",
"conclude",
"that",
",",
"in",
"zebrafish",
",",
"only",
"GATA5",
"and",
"6",
"are",
"required",
"for",
"the",
"proper",
"migration",
"of",
"cardiac",
"precursors",
".",
"In",
"contrast",
"to",
"mice",
"and",
"Xenopus",
",",
"GATA4",
"appears",
"to",
"be",
"uninvolved",
"in",
"this",
"process",
".",
"The",
"previously",
"reported",
"effects",
"on",
"myocardial",
"gene",
"expression",
"of",
"GATA5",
"or",
"GATA6",
"knockdown",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
";",
"Reiter",
"et",
"al.",
",",
"1999",
"-RRB-",
"were",
"immediately",
"evident",
"in",
"these",
"MO",
"injected",
"embryos",
"-LRB-",
"Fig.",
"4",
"-RRB-",
".",
"GATA5",
"MO",
"injection",
"led",
"to",
"substantially",
"reduced",
"expression",
"of",
"nkx2",
".5",
"-LRB-",
"19/19",
"-RRB-",
",",
"vmhc",
"-LRB-",
"42/43",
"-RRB-",
"and",
"cmlc2",
"-LRB-",
"40/41",
"-RRB-",
",",
"as",
"seen",
"for",
"the",
"faust",
"mutant",
".",
"GATA6",
"MO",
"injection",
"also",
"resulted",
"in",
"reduced",
"expression",
"of",
"these",
"markers",
"-LRB-",
"6/6",
",",
"60/60",
"and",
"42/44",
"-RRB-",
"but",
"to",
"a",
"lesser",
"extent",
".",
"In",
"contrast",
",",
"GATA4",
"MO",
"injection",
"had",
"little",
"or",
"no",
"effect",
"on",
"cardiac",
"marker",
"gene",
"expression",
"levels",
"-LRB-",
"n",
"=",
"28",
",",
"69",
"and",
"53",
"-RRB-",
".",
"Spatially",
"the",
"expression",
"of",
"the",
"markers",
"in",
"the",
"GATA4",
"morphants",
"looks",
"altered",
"compared",
"with",
"the",
"controls",
"due",
"to",
"defects",
"in",
"late",
"cardiac",
"morphogenesis",
",",
"consistent",
"with",
"those",
"described",
"by",
"Holtzinger",
"and",
"Evans",
"-LRB-",
"2005",
"-RRB-",
".",
"We",
"therefore",
"conclude",
"that",
"for",
"laying",
"down",
"the",
"myocardial",
"programme",
"in",
"zebrafish",
",",
"GATA5",
"has",
"the",
"greatest",
"effect",
"with",
"a",
"significant",
"contribution",
"from",
"GATA6",
".",
"In",
"contrast",
",",
"GATA4",
"makes",
"little",
"or",
"no",
"contribution",
",",
"at",
"least",
"to",
"the",
"expression",
"of",
"the",
"markers",
"tested",
".",
"GATA",
"factor",
"redundancy",
"in",
"zebrafish",
"myocardium",
"To",
"determine",
"if",
",",
"as",
"in",
"Xenopus",
",",
"there",
"is",
"redundancy",
"within",
"the",
"GATA",
"family",
"in",
"zebrafish",
",",
"we",
"injected",
"the",
"MOs",
"in",
"combinations",
"-LRB-",
"Fig.",
"4",
"-RRB-",
".",
"Morphant",
"embryos",
"were",
"classified",
"into",
"three",
"types",
",",
"unaffected",
"-LRB-",
"type",
"+",
"-RRB-",
",",
"down",
"regulated",
"-LRB-",
"type",
"−",
"-RRB-",
"or",
"absent",
"-LRB-",
"type",
"−",
"−",
"-RRB-",
".",
"Both",
"the",
"GATA5",
"and",
"the",
"GATA6",
"MO",
"phenotypes",
"were",
"made",
"worse",
"by",
"the",
"co-injection",
"of",
"the",
"GATA4",
"MO",
"-LRB-",
"Figs.",
"4B",
",",
"D",
"and",
"F",
"-RRB-",
",",
"as",
"seen",
"in",
"Xenopus",
",",
"and",
"despite",
"the",
"fact",
"that",
"the",
"GATA4",
"MO",
"had",
"little",
"or",
"no",
"effect",
"when",
"injected",
"on",
"its",
"own",
"-LRB-",
"n",
"=",
"18",
"--",
"39",
"-RRB-",
".",
"We",
"therefore",
"conclude",
"that",
"a",
"significant",
"proportion",
"of",
"the",
"residual",
"cardiac",
"gene",
"expression",
"in",
"GATA5",
"or",
"GATA6",
"MO",
"injected",
"embryos",
"is",
"driven",
"by",
"GATA4",
",",
"even",
"though",
"the",
"consequences",
"of",
"its",
"loss",
"in",
"the",
"presence",
"of",
"GATA5",
"or",
"GATA6",
"are",
"minimal",
".",
"Thus",
",",
"redundancy",
"within",
"the",
"GATA",
"family",
"is",
"apparent",
"in",
"the",
"zebrafish",
"myocardium",
"as",
"in",
"Xenopus",
".",
"The",
"level",
"of",
"residual",
"cardiac",
"marker",
"expression",
"in",
"the",
"GATA4",
"and",
"5",
"MO",
"combination",
"or",
"the",
"GATA4",
"and",
"6",
"MO",
"combination",
"at",
"26",
"hpf",
"was",
"very",
"low",
"-LRB-",
"Fig.",
"4",
"-RRB-",
".",
"The",
"level",
"for",
"the",
"GATA5",
"and",
"GATA6",
"MO",
"combination",
"was",
"undetectable",
"with",
"100",
"%",
"of",
"the",
"embryos",
"losing",
"expression",
",",
"suggesting",
"that",
",",
"while",
"GATA4",
"can",
"cover",
"for",
"the",
"absence",
"of",
"either",
"GATA5",
"or",
"GATA6",
",",
"it",
"can",
"not",
"cover",
"for",
"the",
"absence",
"of",
"both",
",",
"which",
"seems",
"unlikely",
".",
"We",
"therefore",
"monitored",
"the",
"expression",
"of",
"GATA4",
"in",
"flat-mounted",
"-LRB-",
"Fig.",
"5A",
"-RRB-",
"MO",
"injected",
"10-somite",
"embryos",
"to",
"determine",
"if",
"it",
"was",
"still",
"expressed",
"-LRB-",
"Fig.",
"5C",
"-RRB-",
".",
"We",
"found",
"that",
"GATA5",
"MO",
"on",
"its",
"own",
"caused",
"a",
"reduction",
"in",
"GATA4",
"expression",
"-LRB-",
"22/36",
"embryos",
"-RRB-",
",",
"and",
"residual",
"expression",
"was",
"removed",
"completely",
"by",
"the",
"addition",
"of",
"the",
"GATA6",
"MO",
"-LRB-",
"n",
"=",
"35",
"-RRB-",
"-LRB-",
"Fig.",
"5C",
"-RRB-",
".",
"The",
"GATA4",
"expression",
"seen",
"in",
"GATA4",
"morphants",
"reflects",
"the",
"use",
"of",
"a",
"translation-blocking",
"morpholino",
"rather",
"than",
"a",
"splice-blocker",
".",
"In",
"the",
"same",
"experiment",
"the",
"expression",
"of",
"nkx2",
".5",
"was",
"affected",
"in",
"the",
"same",
"way",
"as",
"already",
"described",
"-LRB-",
"Fig.",
"5B",
"-RRB-",
".",
"We",
"therefore",
"conclude",
"that",
"the",
"complete",
"absence",
"of",
"cardiac",
"marker",
"expression",
"in",
"GATA5",
"plus",
"GATA6",
"MO",
"injected",
"embryos",
"results",
"from",
"the",
"simultaneous",
"absence",
"of",
"GATA4",
"expression",
".",
"Thus",
",",
"as",
"seen",
"for",
"Xenopus",
"embryos",
",",
"the",
"absence",
"of",
"all",
"three",
"GATA",
"factors",
"completely",
"abolished",
"cardiac",
"marker",
"expression",
".",
"GATA",
"activity",
"is",
"required",
"for",
"induction",
"of",
"the",
"myocardial",
"programme",
"in",
"zebrafish",
"We",
"have",
"shown",
"that",
"GATA",
"activity",
"is",
"only",
"required",
"for",
"the",
"maintenance/maturation",
"of",
"the",
"myocardial",
"programme",
"in",
"Xenopus",
".",
"While",
"we",
"have",
"shown",
"that",
"the",
"GATA6",
"requirement",
"in",
"zebrafish",
"is",
"also",
"late",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
",",
"nkx2",
".5",
"expression",
"at",
"6",
"somites",
"has",
"been",
"shown",
"to",
"be",
"affected",
"in",
"zebrafish",
"faust",
"mutants",
"-LRB-",
"Reiter",
"et",
"al.",
",",
"1999",
"-RRB-",
",",
"suggesting",
"that",
"an",
"additional",
"difference",
"between",
"the",
"species",
"might",
"be",
"the",
"timing",
"of",
"requirements",
"for",
"GATA",
"activity",
".",
"We",
"therefore",
"tested",
"this",
"earlier",
"requirement",
"with",
"more",
"markers",
"and",
"to",
"determine",
"if",
"it",
"is",
"subject",
"to",
"redundancy",
".",
"Firstly",
",",
"we",
"examined",
"nkx2",
".5",
"expression",
"in",
"MO",
"injected",
"embryos",
"at",
"5",
"somites",
"when",
"it",
"is",
"first",
"expressed",
"-LRB-",
"Fig.",
"6A",
"-RRB-",
".",
"For",
"the",
"GATA5",
"MO",
",",
"we",
"found",
"a",
"major",
"reduction",
"in",
"expression",
"totally",
"consistent",
"with",
"the",
"reductions",
"seen",
"later",
"and",
"with",
"those",
"reported",
"for",
"the",
"faust",
"mutant",
"-LRB-",
"Reiter",
"et",
"al.",
",",
"1999",
"-RRB-",
".",
"We",
"also",
"observed",
"very",
"little",
"effect",
"for",
"the",
"GATA4",
"or",
"6",
"MOs",
"on",
"their",
"own",
",",
"but",
"both",
"made",
"the",
"GATA5",
"MO",
"phenotype",
"more",
"severe",
",",
"consistent",
"with",
"their",
"back-up",
"roles",
"being",
"active",
"at",
"this",
"early",
"stage",
".",
"Similar",
"observations",
"were",
"made",
"for",
"GATA4",
"and",
"hrt",
"expression",
"in",
"5-somite",
"embryos",
"and",
"for",
"tbx5",
"expression",
"in",
"10-somite",
"embryos",
"-LRB-",
"tbx5",
"expression",
"is",
"first",
"detected",
"at",
"∼",
"7",
"somites",
"-RRB-",
"-LRB-",
"Figs.",
"6B",
",",
"C",
",",
"D",
"-RRB-",
".",
"In",
"contrast",
",",
"nkx2",
".7",
"expression",
"was",
"unaffected",
"even",
"by",
"triple",
"knockdown",
"-LRB-",
"Fig.",
"6E",
"-RRB-",
".",
"We",
"therefore",
"conclude",
"that",
",",
"for",
"the",
"markers",
"studied",
"and",
"in",
"contrast",
"to",
"Xenopus",
",",
"establishing",
"the",
"full",
"early",
"myocardial",
"programme",
"in",
"zebrafish",
"depends",
"on",
"GATA",
"activity",
".",
"The",
"continued",
"presence",
"of",
"cells",
"expressing",
"nkx2",
".7",
"suggested",
"that",
"apoptosis",
"had",
"not",
"yet",
"occurred",
",",
"and",
"this",
"was",
"confirmed",
"by",
"TUNEL",
"and",
"acridine",
"orange",
"assays",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Furthermore",
",",
"re-specification",
"to",
"more",
"anterior",
"or",
"more",
"posterior",
"mesodermal",
"fates",
"was",
"not",
"observed",
",",
"as",
"judged",
"by",
"the",
"domains",
"of",
"expression",
"of",
"anterior",
"lateral",
"plate",
"and",
"pronephric",
"markers",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"We",
"therefore",
"conclude",
"that",
"in",
"the",
"absence",
"of",
"GATA",
"activity",
",",
"the",
"cells",
"remain",
"undifferentiated",
"at",
"least",
"up",
"to",
"the",
"10-somite",
"stage",
".",
"Discussion",
"Redundancy",
"GATA4",
",",
"5",
"and",
"6",
"are",
"an",
"example",
"of",
"a",
"gene",
"family",
"co-expressed",
"in",
"a",
"specific",
"tissue",
",",
"in",
"this",
"case",
"the",
"myocardium",
".",
"Although",
"some",
"differences",
"in",
"their",
"binding",
"site",
"preferences",
"have",
"been",
"detected",
"-LRB-",
"Sakai",
"et",
"al.",
",",
"1998",
"-RRB-",
",",
"all",
"three",
"bind",
"to",
"canonical",
"GATA",
"sites",
"with",
"high",
"affinity",
".",
"Because",
"of",
"this",
"and",
"the",
"relatively",
"mild",
"phenotypes",
"generated",
"in",
"loss",
"of",
"function",
"experiments",
",",
"they",
"have",
"been",
"suggested",
"to",
"act",
"redundantly",
"-LRB-",
"Jiang",
"et",
"al.",
",",
"1998",
";",
"Kuo",
"et",
"al.",
",",
"1997",
";",
"Molkentin",
"et",
"al.",
",",
"1997",
";",
"Narita",
"et",
"al.",
",",
"1996",
";",
"Watt",
"et",
"al.",
",",
"2004",
"-RRB-",
".",
"Here",
"for",
"the",
"first",
"time",
"we",
"present",
"evidence",
"in",
"support",
"of",
"this",
"with",
"respect",
"to",
"laying",
"down",
"the",
"genetic",
"programme",
"of",
"the",
"myocardium",
".",
"The",
"redundancy",
"is",
"particularly",
"striking",
"for",
"GATA4",
",",
"whose",
"individual",
"loss",
"has",
"essentially",
"no",
"effect",
"on",
"induction",
"or",
"maturation",
"of",
"the",
"myocardium",
"in",
"either",
"zebrafish",
"or",
"Xenopus",
",",
"in",
"contrast",
"to",
"assumptions",
"of",
"its",
"importance",
"in",
"much",
"of",
"the",
"literature",
".",
"For",
"this",
"member",
"of",
"the",
"family",
",",
"its",
"contribution",
"is",
"only",
"revealed",
"in",
"the",
"absence",
"of",
"GATA5",
"or",
"6",
",",
"thereby",
"constituting",
"a",
"formal",
"demonstration",
"of",
"redundancy",
".",
"Similar",
"demonstrations",
"are",
"evident",
"for",
"both",
"Xenopus",
"GATA5",
"and",
"in",
"early",
"heart",
"induction",
"for",
"zebrafish",
"GATA6",
",",
"where",
"they",
"are",
"not",
"the",
"essential",
"players",
".",
"These",
"redundant",
"GATA",
"activities",
"thus",
"most",
"likely",
"account",
"for",
"the",
"residual",
"expression",
"of",
"cardiac",
"markers",
"in",
"the",
"absence",
"of",
"the",
"essential",
"GATA",
"factor",
".",
"Indeed",
"little",
"change",
"was",
"observed",
"in",
"expression",
"of",
"the",
"remaining",
"GATA",
"factor",
"in",
"double",
"morphant",
"embryos",
"compared",
"to",
"wild",
"type",
"siblings",
"in",
"either",
"zebrafish",
"or",
"Xenopus",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"The",
"one",
"exception",
"was",
"GATA5",
"and",
"6",
"double",
"morphant",
"zebrafish",
"embryos",
"where",
"the",
"complete",
"loss",
"of",
"GATA4",
"was",
"used",
"to",
"effect",
"a",
"triple",
"knockout",
"-LRB-",
"Fig.",
"5C",
"-RRB-",
".",
"GATA",
"factors",
"are",
"an",
"ancient",
"family",
"and",
"in",
"vertebrates",
"have",
"existed",
"with",
"three",
"family",
"members",
"in",
"the",
"heart",
"at",
"least",
"since",
"fish",
"-LRB-",
"Patient",
"and",
"McGhee",
",",
"2002",
"-RRB-",
".",
"Thus",
",",
"the",
"redundancy",
"reported",
"here",
"would",
"appear",
"to",
"be",
"evolutionarily",
"very",
"stable",
".",
"Maynard",
"Smith",
"and",
"colleagues",
"have",
"developed",
"simple",
"genetic",
"models",
"to",
"analyse",
"selection",
"pressures",
"on",
"redundant",
"genes",
"and",
"have",
"concluded",
"that",
"evolutionary",
"stability",
"can",
"be",
"achieved",
"if",
"the",
"two",
"-LRB-",
"or",
"more",
"-RRB-",
"genes",
"perform",
"the",
"same",
"function",
",",
"but",
"with",
"slightly",
"different",
"efficacies",
",",
"as",
"seen",
"here",
"-LRB-",
"Nowak",
"et",
"al.",
",",
"1997",
"-RRB-",
".",
"The",
"less",
"efficient",
"family",
"member",
"comes",
"into",
"its",
"own",
"when",
"paired",
"with",
"a",
"mutant",
"form",
"of",
"the",
"more",
"efficient",
"family",
"member",
".",
"Another",
"evolutionarily",
"stable",
"model",
"can",
"be",
"achieved",
"where",
"two",
"-LRB-",
"or",
"more",
"-RRB-",
"genes",
"perform",
"more",
"than",
"one",
"function",
":",
"the",
"redundancy",
"occurring",
"only",
"with",
"respect",
"to",
"one",
"specific",
"function",
".",
"GATA4",
",",
"5",
"and",
"6",
"have",
"an",
"ever-growing",
"list",
"of",
"functions",
"in",
"other",
"tissues",
",",
"so",
"this",
"scenario",
"is",
"more",
"than",
"adequately",
"satisfied",
"as",
"well",
"-LRB-",
"Afouda",
"et",
"al.",
",",
"2005",
";",
"Capo-Chichi",
"et",
"al.",
",",
"2005",
";",
"Ketola",
"et",
"al.",
",",
"2004",
";",
"Molkentin",
",",
"2000",
";",
"Yang",
"et",
"al.",
",",
"2002",
"-RRB-",
".",
"The",
"evolutionary",
"stability",
"of",
"this",
"model",
"depends",
"on",
"random",
"mutations",
"being",
"more",
"likely",
"to",
"render",
"the",
"genes",
"inactive",
"for",
"all",
"functions",
"rather",
"than",
"just",
"for",
"one",
"of",
"their",
"functions",
".",
"Finally",
",",
"yet",
"another",
"model",
"suggests",
"that",
"redundancy",
"should",
"be",
"more",
"common",
"in",
"genes",
"displaying",
"specific",
"spatio-temporal",
"expression",
"patterns",
"during",
"development",
",",
"as",
"is",
"the",
"case",
"for",
"GATA4",
",",
"5",
"and",
"6",
".",
"For",
"this",
"model",
",",
"the",
"developmental",
"error",
"rates",
"applicable",
"to",
"these",
"genes",
"need",
"to",
"be",
"higher",
"than",
"their",
"germ",
"line",
"mutation",
"rates",
":",
"a",
"requirement",
"that",
"is",
"currently",
"unknown",
".",
"The",
"primary",
"GATA",
"factor",
"An",
"unexpected",
"finding",
"was",
"that",
"the",
"member",
"of",
"the",
"family",
"whose",
"loss",
"has",
"the",
"biggest",
"effect",
"differs",
"between",
"Xenopus",
"and",
"zebrafish",
".",
"For",
"single",
"knock",
"downs",
",",
"GATA6",
"has",
"the",
"strongest",
"effect",
"on",
"myocardial",
"gene",
"expression",
"in",
"Xenopus",
"whereas",
"GATA5",
"does",
"so",
"in",
"zebrafish",
".",
"Although",
"at",
"first",
"glance",
"this",
"might",
"suggest",
"a",
"switch",
"in",
"roles",
"for",
"GATA5",
"and",
"6",
",",
"a",
"consideration",
"of",
"the",
"timing",
"of",
"their",
"actions",
"suggests",
"an",
"alternative",
"view",
".",
"The",
"action",
"of",
"GATA6",
"in",
"Xenopus",
"is",
"after",
"the",
"initial",
"expression",
"of",
"other",
"early",
"markers",
"such",
"as",
"Nkx2",
".5",
",",
"suggesting",
"a",
"role",
"in",
"differentiation",
"of",
"the",
"myocardium",
"-LRB-",
"Peterkin",
"et",
"al.",
",",
"2003",
"-RRB-",
".",
"GATA6",
"knockdown",
"in",
"zebrafish",
"has",
"a",
"very",
"similar",
"effect",
".",
"Thus",
",",
"in",
"both",
"organisms",
",",
"knockdown",
"of",
"GATA6",
"leaves",
"early",
"marker",
"expression",
"initially",
"intact",
"but",
"decaying",
"with",
"time",
",",
"whereas",
"when",
"GATA5",
"was",
"knocked",
"down",
"in",
"zebrafish",
",",
"expression",
"of",
"Nkx2",
".5",
"and",
"other",
"early",
"markers",
"was",
"compromised",
"from",
"the",
"outset",
"-LRB-",
"Reiter",
"et",
"al.",
",",
"1999",
";",
"this",
"study",
"-RRB-",
".",
"The",
"difference",
"between",
"the",
"two",
"organisms",
"therefore",
"can",
"be",
"characterised",
"as",
"the",
"gain",
"or",
"loss",
"of",
"an",
"early",
"function",
"for",
"GATA5",
".",
"The",
"early",
"role",
"for",
"GATA",
"activity",
"in",
"zebrafish",
"appears",
"not",
"to",
"be",
"masked",
"by",
"redundancy",
"in",
"Xenopus",
"because",
"even",
"triple",
"knockdown",
"of",
"GATA4",
",",
"5",
"and",
"6",
"leaves",
"early",
"expression",
"of",
"myocardial",
"markers",
"intact",
".",
"The",
"role",
"of",
"GATA5",
"in",
"myocardial",
"induction",
"in",
"mouse",
"and",
"chick",
"embryos",
"is",
"currently",
"unclear",
".",
"Although",
"in",
"P19",
"embryonal",
"carcinoma",
"cells",
"induced",
"to",
"differentiate",
"into",
"cardiomyocytes",
",",
"GATA5",
"up-regulation",
"occurs",
"after",
"Nkx2",
".5",
",",
"precluding",
"an",
"early",
"function",
"during",
"induction",
"-LRB-",
"Alexandrovich",
"et",
"al.",
",",
"2006",
"-RRB-",
",",
"the",
"mouse",
"knockout",
"of",
"GATA5",
"retained",
"the",
"capacity",
"to",
"synthesise",
"a",
"truncated",
"form",
"of",
"the",
"protein",
"containing",
"both",
"zinc",
"fingers",
",",
"which",
"would",
"likely",
"have",
"significant",
"activity",
",",
"preventing",
"a",
"definitive",
"conclusion",
"-LRB-",
"Nemer",
"and",
"Nemer",
",",
"2002",
"-RRB-",
".",
"Likewise",
",",
"the",
"attempts",
"to",
"date",
"to",
"knock",
"down",
"GATA5",
"activity",
"in",
"the",
"chick",
"were",
"only",
"partial",
"and",
",",
"in",
"addition",
",",
"attempted",
"after",
"induction",
"of",
"the",
"myocardium",
"-LRB-",
"Jiang",
"et",
"al.",
",",
"1998",
"-RRB-",
".",
"It",
"is",
"therefore",
"not",
"yet",
"clear",
"if",
"the",
"early",
"role",
"for",
"GATA5",
"has",
"been",
"acquired",
"by",
"zebrafish",
"or",
"lost",
"by",
"Xenopus",
".",
"In",
"Drosophila",
",",
"the",
"GATA",
"factor",
",",
"pannier",
",",
"is",
"required",
"both",
"upstream",
"and",
"downstream",
"of",
"the",
"Nkx2",
".5",
"homologue",
",",
"tinman",
"-LRB-",
"Gajewski",
"et",
"al.",
",",
"2001",
";",
"Klinedinst",
"and",
"Bodmer",
",",
"2003",
"-RRB-",
".",
"In",
"the",
"nematode",
",",
"the",
"GATA",
"factors",
",",
"Med1",
"and",
"2",
",",
"are",
"expressed",
"in",
"the",
"mesendodermal",
"precursor",
"to",
"the",
"mesoderm",
"giving",
"rise",
"to",
"part",
"of",
"the",
"pharynx",
",",
"an",
"organ",
"that",
"has",
"homologies",
"to",
"the",
"heart",
",",
"and",
"upstream",
"of",
"the",
"Nkx2",
".5",
"homologue",
",",
"ceh22",
",",
"suggesting",
"that",
"an",
"early",
"role",
"for",
"GATA",
"factors",
"may",
"be",
"ancestral",
"-LRB-",
"Broitman-Maduro",
"et",
"al.",
",",
"2006",
";",
"Maduro",
"et",
"al.",
",",
"2001",
";",
"Rodaway",
"and",
"Patient",
",",
"2001",
"-RRB-",
".",
"Mesendodermal",
"expression",
"is",
"seen",
"for",
"both",
"GATA5",
"and",
"GATA6",
"in",
"zebrafish",
",",
"while",
"in",
"Xenopus",
",",
"mesendodermal",
"expression",
"is",
"seen",
"for",
"GATA4",
"and",
"6",
"-LRB-",
"Fletcher",
"et",
"al.",
",",
"in",
"press",
";",
"Rodaway",
"et",
"al.",
",",
"1999",
";",
"J.",
"Broadbent",
",",
"A.",
"Gibson",
"and",
"R.",
"Patient",
",",
"unpublished",
"observations",
"-RRB-",
".",
"Thus",
",",
"the",
"early",
"role",
"for",
"GATA5",
"in",
"zebrafish",
"may",
"reflect",
"its",
"early",
"expression",
"in",
"the",
"lineage",
"of",
"cells",
"leading",
"to",
"the",
"myocardium",
"whereas",
",",
"in",
"Xenopus",
",",
"early",
"expression",
"of",
"GATA5",
"is",
"restricted",
"to",
"the",
"endoderm",
",",
"appearing",
"in",
"the",
"cardiac",
"mesoderm",
"at",
"a",
"later",
"stage",
"-LRB-",
"Weber",
"et",
"al.",
",",
"2000",
"-RRB-",
".",
"That",
"GATA6",
"is",
"also",
"expressed",
"early",
"in",
"this",
"lineage",
"in",
"both",
"species",
",",
"and",
"GATA4",
"likewise",
"in",
"Xenopus",
",",
"and",
"yet",
"neither",
"plays",
"a",
"role",
"in",
"induction",
"of",
"the",
"myocardium",
",",
"suggests",
"that",
"GATA5",
",",
"at",
"least",
"in",
"zebrafish",
",",
"is",
"alone",
"in",
"containing",
"the",
"requisite",
"amino",
"acid",
"sequence",
"for",
"this",
"function",
".",
"All",
"three",
"GATA",
"factors",
"recognise",
"the",
"same",
"DNA",
"sequence",
"therefore",
",",
"in",
"the",
"absence",
"of",
"known",
"binding",
"site",
"preferences",
"for",
"GATA5",
",",
"activities",
"specific",
"to",
"GATA5",
"are",
"likely",
"to",
"include",
"protein",
"--",
"protein",
"interactions",
".",
"Thus",
",",
"GATA5",
"may",
"be",
"more",
"suited",
"to",
"the",
"necessary",
"interactions",
"in",
"the",
"early",
"mesendoderm",
"than",
"either",
"GATA4",
"or",
"6",
".",
"Feedback",
"loops",
"and",
"timing",
"Genetic",
"regulatory",
"networks",
"-LRB-",
"GRNs",
"-RRB-",
"consist",
"of",
"functionally",
"linked",
"regulatory",
"genes",
"encoding",
"transcription",
"factors",
"and",
"their",
"controlling",
"extra-cellular",
"signals",
"-LRB-",
"Davidson",
"et",
"al.",
",",
"2002",
"-RRB-",
".",
"They",
"contain",
"motifs",
",",
"or",
"recurring",
"wiring",
"patterns",
",",
"which",
"occur",
"with",
"frequencies",
"far",
"greater",
"than",
"in",
"randomised",
"networks",
"-LRB-",
"Lee",
"et",
"al.",
",",
"2002",
";",
"Milo",
"et",
"al.",
",",
"2002",
";",
"Shen-Orr",
"et",
"al.",
",",
"2002",
"-RRB-",
".",
"One",
"such",
"motif",
"is",
"a",
"feedback",
"loop",
".",
"Mathematical",
"modelling",
"of",
"positive",
"feedback",
"loops",
"indicate",
"that",
"they",
"promote",
"the",
"persistence",
"of",
"signals",
"and",
"have",
"the",
"potential",
"to",
"store",
"information",
",",
"such",
"that",
",",
"for",
"example",
",",
"signalling",
"can",
"readily",
"flip",
"the",
"system",
"from",
"one",
"state",
"to",
"another",
"-LRB-",
"Bhalla",
"and",
"Iyengar",
",",
"1999",
"-RRB-",
".",
"The",
"observation",
"in",
"Drosophila",
"that",
"pannier",
"is",
"both",
"upstream",
"and",
"downstream",
"of",
"tinman",
",",
"raises",
"the",
"possibility",
"that",
"the",
"establishment",
"of",
"a",
"mutual",
"regulatory",
"loop",
"for",
"these",
"two",
"key",
"regulators",
"is",
"critical",
"evolutionarily",
"-LRB-",
"Gajewski",
"et",
"al.",
",",
"2001",
";",
"Klinedinst",
"and",
"Bodmer",
",",
"2003",
"-RRB-",
".",
"Evidence",
"for",
"a",
"similar",
"feedback",
"loop",
"exists",
"in",
"mice",
",",
"where",
"a",
"cardiac",
"GATA",
"gene",
"has",
"been",
"shown",
"to",
"be",
"Nkx",
"dependent",
"and",
"vice",
"versa",
"-LRB-",
"Brewer",
"et",
"al.",
",",
"2005",
";",
"Davis",
"et",
"al.",
",",
"2000",
";",
"Lien",
"et",
"al.",
",",
"1999",
";",
"Molkentin",
"et",
"al.",
",",
"2000",
"-RRB-",
".",
"Davidson",
"and",
"Erwin",
"have",
"recently",
"proposed",
"that",
"regulatory",
"motifs",
"of",
"this",
"type",
"are",
"evolutionarily",
"stable",
"components",
"of",
"GRNs",
",",
"which",
"they",
"called",
"kernels",
"-LRB-",
"Davidson",
"and",
"Erwin",
",",
"2006",
"-RRB-",
".",
"They",
"highlight",
"a",
"heart-field",
"specification",
"kernel",
",",
"which",
"is",
"conserved",
"from",
"Drosophila",
"to",
"vertebrates",
".",
"Strikingly",
"the",
"Nkx2",
".5",
"/",
"tinman",
"GATA/pannier",
"feedback",
"loop",
"is",
"central",
"to",
"this",
"kernel",
".",
"Our",
"work",
"supports",
"this",
"hypothesis",
"and",
"further",
"suggests",
"that",
"the",
"establishment",
"of",
"this",
"kernel",
"is",
"more",
"critical",
"in",
"evolution",
"than",
"where",
"the",
"loop",
"is",
"initiated",
".",
"Thus",
",",
"GATA",
"activity",
"is",
"required",
"to",
"initiate",
"Nkx2",
".5",
"expression",
"in",
"zebrafish",
"but",
"not",
"in",
"Xenopus",
",",
"nevertheless",
"both",
"establish",
"the",
"loop",
"-LRB-",
"Fig.",
"7A",
"-RRB-",
".",
"Interestingly",
",",
"as",
"seen",
"for",
"GATA",
"activity",
",",
"the",
"requirement",
"for",
"BMP",
"signalling",
"differs",
"between",
"zebrafish",
"and",
"Xenopus",
".",
"Thus",
",",
"in",
"zebrafish",
",",
"BMP",
"signalling",
"is",
"required",
"to",
"initiate",
"expression",
"of",
"cardiac",
"markers",
"including",
"GATA5",
"-LRB-",
"Reiter",
"et",
"al.",
",",
"2001",
"-RRB-",
",",
"whereas",
"in",
"Xenopus",
",",
"it",
"is",
"only",
"required",
"for",
"their",
"maintenance",
"-LRB-",
"Walters",
"et",
"al.",
",",
"2001",
"-RRB-",
".",
"In",
"view",
"of",
"the",
"links",
"between",
"BMP",
"and",
"GATA",
"factors",
"in",
"several",
"different",
"tissues",
",",
"including",
"the",
"myocardium",
",",
"it",
"seems",
"likely",
"that",
"the",
"early",
"requirement",
"for",
"GATA",
"activity",
"in",
"zebrafish",
"is",
"linked",
"to",
"the",
"early",
"requirement",
"for",
"BMP",
",",
"and",
"likewise",
"the",
"later",
"requirement",
"in",
"Xenopus",
"-LRB-",
"Fig.",
"7B",
"-RRB-",
"-LRB-",
"Peterkin",
",",
"2003",
"-RRB-",
".",
"The",
"cascade",
"of",
"events",
"in",
"Drosophila",
"predicts",
"that",
"the",
"Drosophila",
"BMP",
"signal",
",",
"Decapentaplegic",
"-LRB-",
"Dpp",
"-RRB-",
",",
"activates",
"tinman",
",",
"and",
"they",
"then",
"act",
"in",
"concert",
"to",
"initiate",
"the",
"expression",
"of",
"pannier",
".",
"Subsequently",
"tinman",
"and",
"pannier",
"maintain",
"each",
"other",
"'s",
"expression",
",",
"whilst",
"pannier",
"-LRB-",
"in",
"the",
"ectoderm",
"-RRB-",
"maintains",
"Dpp",
"expression",
".",
"Dpp",
"signalling",
"feeds",
"back",
"to",
"maintain",
"expression",
"of",
"tinman",
"and",
"pannier",
"thus",
"completing",
"the",
"loop",
"-LRB-",
"Fig.",
"7C",
";",
"for",
"review",
"see",
"Sorrentino",
"et",
"al.",
",",
"2005",
"-RRB-",
".",
"Thus",
",",
"in",
"summary",
",",
"the",
"data",
"imply",
"that",
"the",
"initiating",
"factor",
"and",
"the",
"direction",
"in",
"which",
"the",
"loop",
"flows",
"are",
"not",
"important",
".",
"Ultimately",
"it",
"is",
"the",
"establishment",
"of",
"the",
"loop",
"that",
"is",
"essential",
"and",
"failure",
"to",
"do",
"so",
"leads",
"to",
"the",
"loss",
"of",
"differentiated",
"myocardium",
"."
] | [
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Dev_Genes_Evol-4-1-2292473 | [
"Analysis",
"of",
"the",
"Tribolium",
"homeotic",
"complex",
":",
"insights",
"into",
"mechanisms",
"constraining",
"insect",
"Hox",
"clusters",
"The",
"remarkable",
"conservation",
"of",
"Hox",
"clusters",
"is",
"an",
"accepted",
"but",
"little",
"understood",
"principle",
"of",
"biology",
".",
"Some",
"organizational",
"constraints",
"have",
"been",
"identified",
"for",
"vertebrate",
"Hox",
"clusters",
",",
"but",
"most",
"of",
"these",
"are",
"thought",
"to",
"be",
"recent",
"innovations",
"that",
"may",
"not",
"apply",
"to",
"other",
"organisms",
".",
"Ironically",
",",
"many",
"model",
"organisms",
"have",
"disrupted",
"Hox",
"clusters",
"and",
"may",
"not",
"be",
"well-suited",
"for",
"studies",
"of",
"structural",
"constraints",
".",
"In",
"contrast",
",",
"the",
"red",
"flour",
"beetle",
",",
"Tribolium",
"castaneum",
",",
"which",
"has",
"a",
"long",
"history",
"in",
"Hox",
"gene",
"research",
",",
"is",
"thought",
"to",
"have",
"a",
"more",
"ancestral-type",
"Hox",
"cluster",
"organization",
".",
"Here",
",",
"we",
"demonstrate",
"that",
"the",
"Tribolium",
"homeotic",
"complex",
"-LRB-",
"HOMC",
"-RRB-",
"is",
"indeed",
"intact",
",",
"with",
"the",
"individual",
"Hox",
"genes",
"in",
"the",
"expected",
"colinear",
"arrangement",
"and",
"transcribed",
"from",
"the",
"same",
"strand",
".",
"There",
"is",
"no",
"evidence",
"that",
"the",
"cluster",
"has",
"been",
"invaded",
"by",
"non-Hox",
"protein-coding",
"genes",
",",
"although",
"expressed",
"sequence",
"tag",
"and",
"genome",
"tiling",
"data",
"suggest",
"that",
"noncoding",
"transcripts",
"are",
"prevalent",
".",
"Finally",
",",
"our",
"analysis",
"of",
"several",
"mutations",
"affecting",
"the",
"Tribolium",
"HOMC",
"suggests",
"that",
"intermingling",
"of",
"enhancer",
"elements",
"with",
"neighboring",
"transcription",
"units",
"may",
"constrain",
"the",
"structure",
"of",
"at",
"least",
"one",
"region",
"of",
"the",
"Tribolium",
"cluster",
".",
"This",
"work",
"lays",
"a",
"foundation",
"for",
"future",
"studies",
"of",
"the",
"Tribolium",
"HOMC",
"that",
"may",
"provide",
"insights",
"into",
"the",
"reasons",
"for",
"Hox",
"cluster",
"conservation",
".",
"Introduction",
"Hox",
"clusters",
"arose",
"near",
"the",
"origins",
"of",
"the",
"animal",
"kingdom",
"-LRB-",
"Larroux",
"et",
"al.",
"2007",
";",
"Ryan",
"et",
"al.",
"2007",
"-RRB-",
".",
"The",
"last",
"common",
"ancestor",
"of",
"the",
"protostomes",
"and",
"deuterostomes",
"is",
"thought",
"to",
"have",
"had",
"a",
"cluster",
"of",
"at",
"least",
"seven",
"genes",
"characterized",
"by",
"a",
"common",
"transcriptional",
"orientation",
"and",
"by",
"colinearity",
"in",
"the",
"order",
"of",
"the",
"genes",
"and",
"their",
"expression",
"domains",
"along",
"the",
"anterior",
"--",
"posterior",
"axis",
"-LRB-",
"reviewed",
"in",
"Garcia-Fernandez",
"2005",
"-RRB-",
".",
"In",
"various",
"metazoan",
"lineages",
",",
"Hox",
"clusters",
"have",
"gained",
"or",
"lost",
"genes",
"by",
"duplication",
"and",
"deletion",
"but",
"often",
"have",
"maintained",
"their",
"chromosomal",
"order",
",",
"transcriptional",
"orientation",
",",
"and",
"both",
"spatial",
"and",
"temporal",
"colinearity",
"of",
"expression",
"patterns",
"-LRB-",
"reviewed",
"in",
"Ferrier",
"and",
"Minguillon",
"2003",
"-RRB-",
",",
"suggesting",
"that",
"Hox",
"cluster",
"organization",
"has",
"been",
"subject",
"to",
"strong",
"constraints",
"during",
"evolution",
".",
"Classical",
"model",
"systems",
",",
"such",
"as",
"Drosophila",
"and",
"Caenorhabditis",
"elegans",
",",
"have",
"provided",
"many",
"important",
"insights",
"into",
"the",
"developmental",
"functions",
"of",
"Hox",
"genes",
"but",
"do",
"not",
"provide",
"particularly",
"good",
"examples",
"of",
"Hox",
"cluster",
"conservation",
".",
"The",
"Hox",
"cluster",
"of",
"Drosophila",
"melanogaster",
"is",
"split",
"into",
"two",
"parts",
"-LRB-",
"the",
"Antennapedia",
"-LRB-",
"ANTC",
"-RRB-",
"and",
"bithorax",
"-LRB-",
"BXC",
"-RRB-",
"complexes",
"-RRB-",
",",
"shows",
"changes",
"in",
"transcriptional",
"orientation",
"of",
"some",
"genes",
",",
"and",
"includes",
"interspersed",
"genes",
"of",
"independent",
"origin",
"as",
"well",
"as",
"Hox-derived",
"genes",
"that",
"have",
"evolved",
"novel",
"developmental",
"roles",
"-LRB-",
"reviewed",
"in",
"Ferrier",
"and",
"Minguillon",
"2003",
"-RRB-",
".",
"These",
"alterations",
"suggest",
"that",
"the",
"constraints",
"keeping",
"the",
"Hox",
"cluster",
"intact",
"may",
"have",
"been",
"lost",
"in",
"the",
"lineage",
"leading",
"to",
"Drosophila",
".",
"Additional",
"Hox",
"cluster",
"rearrangements",
"-LRB-",
"breaks",
",",
"microinversions",
",",
"and",
"gene",
"transpositions",
"-RRB-",
"have",
"been",
"found",
"in",
"other",
"Drosophila",
"species",
"-LRB-",
"Negre",
"et",
"al.",
"2003",
";",
"Negre",
"and",
"Ruiz",
"2007",
";",
"Von",
"Allmen",
"et",
"al.",
"1996",
"-RRB-",
"as",
"well",
"as",
"in",
"the",
"silk",
"moth",
"Bombyx",
"mori",
"-LRB-",
"Yasukochi",
"et",
"al.",
"2004",
"-RRB-",
".",
"The",
"Hox",
"genes",
"of",
"C.",
"elegans",
"-LRB-",
"reviewed",
"in",
"Aboobaker",
"and",
"Blaxter",
"2003",
"-RRB-",
"and",
"the",
"tunicate",
"Oikopleura",
"dioica",
"-LRB-",
"Seo",
"et",
"al.",
"2004",
"-RRB-",
"have",
"undergone",
"even",
"more",
"extreme",
"loss",
"and",
"rearrangement",
"such",
"that",
"none",
"of",
"their",
"remaining",
"Hox",
"genes",
"are",
"clustered",
".",
"In",
"most",
"cases",
",",
"the",
"Hox",
"genes",
"of",
"these",
"organisms",
"still",
"show",
"spatial",
"but",
"not",
"temporal",
"colinearity",
".",
"Rapid",
"development",
"seems",
"to",
"be",
"the",
"common",
"denominator",
"among",
"most",
"of",
"these",
"organisms",
",",
"perhaps",
"making",
"temporal",
"colinearity",
"of",
"Hox",
"genes",
"unnecessary",
",",
"or",
"even",
"undesirable",
"-LRB-",
"Ferrier",
"and",
"Holland",
"2002",
";",
"Ferrier",
"and",
"Minguillon",
"2003",
";",
"Negre",
"et",
"al.",
"2005",
"-RRB-",
".",
"While",
"studies",
"of",
"disrupted",
"Hox",
"clusters",
"have",
"provided",
"some",
"insights",
"into",
"Hox",
"cluster",
"maintenance",
",",
"a",
"more",
"complete",
"understanding",
"will",
"require",
"analysis",
"of",
"organisms",
"where",
"they",
"are",
"still",
"intact",
".",
"Studies",
"of",
"vertebrate",
"Hox",
"clusters",
"have",
"uncovered",
"several",
"potential",
"mechanisms",
"that",
"may",
"promote",
"temporal",
"colinearity",
"and",
"therefore",
"constrain",
"the",
"organization",
"of",
"these",
"clusters",
"-LRB-",
"reviewed",
"in",
"Kmita",
"and",
"Duboule",
"2003",
"-RRB-",
".",
"These",
"include",
"progressive",
"changes",
"in",
"chromatin",
"state",
"along",
"the",
"length",
"of",
"the",
"cluster",
",",
"varying",
"affinity",
"of",
"regulatory",
"elements",
"to",
"a",
"gradient",
"of",
"signal",
",",
"and",
"the",
"presence",
"of",
"global",
"enhancer",
"elements",
"outside",
"the",
"cluster",
"that",
"regulate",
"multiple",
"genes",
"within",
"the",
"cluster",
".",
"However",
",",
"it",
"is",
"not",
"clear",
"whether",
"these",
"mechanisms",
"apply",
"to",
"other",
"organisms",
".",
"Duboule",
"-LRB-",
"2007",
"-RRB-",
"has",
"suggested",
"that",
"the",
"modern",
"vertebrate",
"Hox",
"clusters",
"are",
"actually",
"more",
"organized",
"than",
"the",
"ancestral",
"cluster",
".",
"Some",
"of",
"the",
"mechanisms",
"constraining",
"the",
"organization",
"of",
"vertebrate",
"Hox",
"clusters",
"likely",
"evolved",
"concomitant",
"with",
"the",
"co-option",
"of",
"Hox",
"genes",
"for",
"functions",
"such",
"as",
"limb",
"development",
"-LRB-",
"Duboule",
"2007",
";",
"Kmita",
"and",
"Duboule",
"2003",
"-RRB-",
"and",
",",
"therefore",
",",
"may",
"not",
"be",
"applicable",
"to",
"other",
"lineages",
".",
"Based",
"on",
"this",
"model",
",",
"we",
"might",
"expect",
"to",
"gain",
"a",
"better",
"understanding",
"of",
"the",
"ancestral",
"constraints",
"on",
"Hox",
"clusters",
"by",
"studying",
"a",
"less",
"organized",
"but",
"still",
"intact",
"cluster",
".",
"Such",
"clusters",
"have",
"been",
"described",
"in",
"organisms",
"as",
"diverse",
"as",
"the",
"cephalochordate",
"amphioxus",
"-LRB-",
"Garcia-Fernandez",
"and",
"Holland",
"1994",
";",
"Minguillon",
"et",
"al.",
"2005",
"-RRB-",
",",
"sea",
"urchins",
"-LRB-",
"Cameron",
"et",
"al.",
"2006",
"-RRB-",
",",
"and",
"the",
"insects",
"Apis",
"-LRB-",
"Honey",
"Bee",
"Genome",
"Sequencing",
"Consortium",
"2006",
";",
"Dearden",
"et",
"al.",
"2006",
"-RRB-",
"and",
"Anopheles",
"-LRB-",
"Holt",
"et",
"al.",
"2002",
";",
"Negre",
"and",
"Ruiz",
"2007",
"-RRB-",
".",
"Evidence",
"also",
"suggests",
"that",
"the",
"red",
"flour",
"beetle",
",",
"Tribolium",
"castaneum",
",",
"has",
"an",
"intact",
"Hox",
"cluster",
".",
"Conventional",
"cloning",
"and",
"sequencing",
"of",
"the",
"portion",
"of",
"the",
"cluster",
"corresponding",
"to",
"the",
"Drosophila",
"Antennapedia",
"complex",
"has",
"shown",
"that",
"this",
"region",
"of",
"the",
"homeotic",
"complex",
"-LRB-",
"HOMC",
"-RRB-",
"is",
"intact",
"in",
"Tribolium",
"-LRB-",
"Brown",
"et",
"al.",
"2002",
"-RRB-",
".",
"Genetic",
"mapping",
"also",
"suggests",
"that",
"the",
"integrity",
"of",
"the",
"Tribolium",
"Hox",
"cluster",
"has",
"been",
"maintained",
"-LRB-",
"Beeman",
"1987",
"-RRB-",
".",
"Moreover",
",",
"the",
"genetic",
"methodologies",
"possible",
"with",
"Tribolium",
",",
"as",
"well",
"as",
"the",
"application",
"of",
"RNAi",
",",
"have",
"provided",
"a",
"comprehensive",
"description",
"of",
"the",
"full",
"repertoire",
"of",
"Hox",
"genes",
"and",
"their",
"functions",
"-LRB-",
"e.g.",
",",
"Beeman",
"et",
"al.",
"1993",
";",
"Beeman",
"et",
"al.",
"1989",
";",
"Brown",
"et",
"al.",
"2000",
";",
"Shippy",
"et",
"al.",
"2000",
";",
"Shippy",
"et",
"al.",
"2006",
";",
"Stuart",
"et",
"al.",
"1991",
";",
"Stuart",
"et",
"al.",
"1993",
";",
"Tomoyasu",
"et",
"al.",
"2005",
"-RRB-",
".",
"The",
"Tribolium",
"genome",
"has",
"recently",
"been",
"sequenced",
",",
"giving",
"us",
"the",
"opportunity",
"to",
"explore",
"the",
"structure",
"of",
"its",
"Hox",
"cluster",
"in",
"detail",
".",
"Here",
",",
"we",
"present",
"an",
"analysis",
"of",
"several",
"Hox",
"mutations",
"along",
"with",
"the",
"transcriptional",
"profile",
"of",
"the",
"cluster",
"during",
"embryonic",
"development",
".",
"We",
"discuss",
"these",
"results",
"with",
"respect",
"to",
"potential",
"mechanisms",
"of",
"Hox",
"cluster",
"organization",
"and",
"constraint",
".",
"Materials",
"and",
"methods",
"Sequence",
"and",
"transposable",
"element",
"analysis",
"Sequence",
"analysis",
"was",
"performed",
"using",
"Vector",
"NTI",
"Advance",
"10",
"-LRB-",
"Invitrogen",
"-RRB-",
".",
"Basic",
"Local",
"Alignment",
"Search",
"Tools",
"-LRB-",
"BLASTs",
"-RRB-",
"against",
"Tribolium",
"genome",
"sequence",
"-LRB-",
"Tcas_2.0",
"-RRB-",
"were",
"performed",
"at",
"http://www.hgsc.bcm.tmc.edu/blast/blast.cgi?organism=",
"Tcastaneum",
"or",
"http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=",
"7070",
",",
"and",
"subsequent",
"analysis",
"was",
"performed",
"using",
"Genboree",
"-LRB-",
"http://www.genboree.org/java-bin/login.jsp",
"-RRB-",
"or",
"NCBI",
"Map",
"Viewer",
"-LRB-",
"http://www.ncbi.nlm.nih.gov/mapview/",
"-RRB-",
".",
"The",
"entire",
"HOMC",
"sequence",
"was",
"used",
"as",
"a",
"BLASTn",
"query",
"against",
"a",
"collection",
"of",
"expressed",
"sequence",
"tags",
"-LRB-",
"ESTs",
"-RRB-",
"provided",
"by",
"Dr.",
"Yoonseong",
"Park",
"-LRB-",
"Department",
"of",
"Entomology",
",",
"Kansas",
"State",
"University",
",",
"Manhattan",
",",
"KS",
",",
"USA",
"-RRB-",
".",
"Transposable",
"elements",
"were",
"identified",
"and",
"classified",
"using",
"Censor",
"to",
"search",
"the",
"arthropod",
"subset",
"of",
"Repbase",
"-LRB-",
"Kohany",
"et",
"al.",
"2006",
"-RRB-",
".",
"Array",
"design",
"and",
"probe",
"synthesis",
"Sequence",
"for",
"the",
"Tribolium",
"HOMC",
"was",
"taken",
"from",
"the",
"Tcas_2.0",
"Baylor",
"HSGC",
"assembly",
".",
"The",
"tiled",
"region",
"consists",
"of",
"∼",
"810,000",
"bases",
"from",
"LG2",
"-LRB-",
"2,290,000",
"to",
"301,000",
"-RRB-",
"stretching",
"between",
"the",
"two",
"non-Hox",
"genes",
"flanking",
"the",
"complex",
".",
"NimbelGen",
"designed",
"∼",
"50",
"mer",
"oligos",
"covering",
"this",
"region",
"at",
"two",
"densities",
":",
"-LRB-",
"1",
"-RRB-",
"one",
"feature",
"per",
"91",
"bp",
"and",
"-LRB-",
"2",
"-RRB-",
"one",
"feature",
"per",
"70",
"bp",
".",
"An",
"additional",
"region",
"spanning",
"5",
"kb",
"on",
"either",
"side",
"of",
"the",
"putative",
"homolog",
"of",
"dme-miR-iab-4",
"was",
"tiled",
"at",
"a",
"higher",
"density",
"of",
"one",
"feature",
"every",
"10",
"bp",
".",
"Visualization",
"and",
"scaling",
"of",
"tiling",
"data",
"was",
"performed",
"using",
"Integrated",
"Genome",
"Browser",
"-LRB-",
"Affymetrix",
",",
"http://www.affymetrix.com/support/developer/tools/download_igb.affx",
"-RRB-",
".",
"Tribolium",
"0",
"--",
"72-h-old",
"embryos",
",",
"grown",
"at",
"30",
"°C",
"in",
"standard",
"media",
",",
"were",
"collected",
"by",
"sieving",
",",
"dechorionated",
"for",
"2",
"min",
"in",
"100",
"%",
"bleach",
",",
"and",
"homogenized",
"in",
"200",
"μl",
"of",
"Trizol",
"using",
"a",
"teflon",
"pestle",
".",
"Total",
"RNA",
"was",
"then",
"extracted",
"using",
"the",
"standard",
"Trizol",
"protocol",
"-LRB-",
"Invitrogen",
"-RRB-",
".",
"dsDNA",
"was",
"prepared",
"from",
"∼",
"10",
"μg",
"of",
"total",
"RNA",
"with",
"random",
"hexamers",
"according",
"to",
"Kapranov",
"et",
"al.",
"-LRB-",
"2002",
"-RRB-",
",",
"with",
"the",
"following",
"modifications",
".",
"Primers",
"were",
"annealed",
"using",
"a",
"20-min",
"ramp",
"to",
"15",
"°C",
",",
"and",
"the",
"first",
"strand",
"reaction",
"was",
"not",
"subdivided",
"for",
"second",
"strand",
"synthesis",
".",
"The",
"resulting",
"cDNA",
"was",
"used",
"as",
"template",
"by",
"NimbelGen",
"for",
"labeling",
"and",
"hybridization",
"-LRB-",
"Squazzo",
"et",
"al.",
"2006",
"-RRB-",
".",
"Fluorescent",
"in",
"situ",
"hybridization",
"Probe",
"labeling",
",",
"embryo",
"fixation",
",",
"and",
"RNA",
"FISH",
"were",
"performed",
"according",
"to",
"Kosman",
"et",
"al.",
"-LRB-",
"2004",
"-RRB-",
"with",
"the",
"following",
"modifications",
".",
"Tribolium",
"embryos",
"were",
"dechorionated",
"in",
"100",
"%",
"bleach",
"for",
"2",
"min",
"and",
"agitated",
"for",
"45",
"min",
"to",
"1",
"h.",
"Embryos",
"were",
"devitellinized",
"by",
"alternating",
"1",
"min",
"vortexing",
"with",
"1",
"min",
"shaking",
"for",
"5",
"min",
"after",
"the",
"addition",
"of",
"cold",
"methanol",
",",
"followed",
"by",
"passage",
"through",
"an",
"18-gauge",
"syringe",
"three",
"to",
"five",
"times",
".",
"Primers",
"used",
"for",
"making",
"the",
"TcNC-1",
"and",
"iab-4",
"probes",
"are",
"as",
"follows",
":",
"TcNC5",
"′",
":",
"AGATAAGATATAATGAGGTGTAGAGTTG",
",",
"TcNC3",
"′",
":",
"TGATTAACATGGACGGCTTCATTAG",
",",
"iab-45",
"′",
":",
"CATCCTATGCACATGCGTTC",
",",
"iab-43",
"′",
":",
"CGTTTTAATGGGTGCATCGT",
".",
"Dig-labeled",
"RNA",
"probes",
"were",
"detected",
"using",
"sheepαDIG",
"-LRB-",
"Roche",
"-RRB-",
"primary",
"and",
"donkeyαsheep",
"Alexa",
"Fluor",
"555",
"-LRB-",
"Molecular",
"Probes",
"-RRB-",
"secondary",
"antibodies",
".",
"Genetics",
"Beetles",
"were",
"cultured",
"at",
"30",
"°C",
"on",
"whole",
"wheat",
"flour",
"supplemented",
"with",
"5",
"%",
"brewer",
"'s",
"yeast",
"as",
"described",
"by",
"Beeman",
"et",
"al.",
"-LRB-",
"1989",
"-RRB-",
".",
"Strains",
"used",
"were",
":",
"Ga-1",
"and",
"Ga-2",
"-LRB-",
"wild",
"type",
"-RRB-",
";",
"mxpDch-3",
"/",
"Ey",
";",
"Cx6/AEs",
";",
"ptlKT76",
"/",
"+",
";",
"Cx61/AEs",
";",
"ptlD60/Ey",
"and",
"Dfd1/AEs",
".",
"Eyeless",
"-LRB-",
"Ey",
";",
"Beeman",
"et",
"al.",
"1996",
"-RRB-",
"and",
"AbdominalExtra",
"sclerite",
"-LRB-",
"AEs",
";",
"Beeman",
"et",
"al.",
"1989",
"-RRB-",
"are",
"dominantly",
"marked",
"balancer",
"chromosomes",
"that",
"suppress",
"crossing",
"over",
"within",
"the",
"HOMC",
".",
"Cuticle",
"preparations",
"were",
"performed",
"as",
"described",
"by",
"Shippy",
"et",
"al.",
"-LRB-",
"2000",
"-RRB-",
".",
"For",
"documentation",
",",
"cuticles",
"were",
"placed",
"in",
"9:1",
"lactic",
"acid/ethanol",
"on",
"a",
"depression",
"slide",
"and",
"covered",
"with",
"a",
"coverslip",
".",
"Images",
"were",
"captured",
"at",
"several",
"focal",
"planes",
"using",
"a",
"Nikon",
"DXM1200F",
"digital",
"camera",
"and",
"combined",
"into",
"a",
"single",
"image",
"using",
"Auto-Montage",
"software",
"-LRB-",
"Syncrosopy",
"-RRB-",
".",
"RNAi",
"Parental",
"RNAi",
"for",
"ptl/Tc-Antp",
"was",
"performed",
"by",
"injection",
"of",
"dsRNA",
"into",
"the",
"abdomens",
"of",
"female",
"pupae",
".",
"Eggs",
"were",
"collected",
"from",
"injected",
"females",
"at",
"3-day",
"intervals",
",",
"aged",
"to",
"hatching",
",",
"and",
"subjected",
"to",
"cuticle",
"preparation",
".",
"Analysis",
"of",
"ptlD60",
"breakpoints",
"Eggs",
"were",
"collected",
"after",
"overnight",
"incubation",
"at",
"30",
"°C",
"and",
"allowed",
"to",
"develop",
"for",
"3",
"days",
".",
"Genomic",
"DNA",
"was",
"isolated",
"from",
"individual",
"ptlD60",
"homozygous",
"larvae",
"as",
"described",
"by",
"Gloor",
"et",
"al.",
"-LRB-",
"1993",
"-RRB-",
".",
"Polymerase",
"chain",
"reaction",
"-LRB-",
"PCR",
"-RRB-",
"surveys",
"of",
"the",
"HOMC",
"were",
"used",
"to",
"identify",
"likely",
"breakpoint",
"positions",
",",
"and",
"fragments",
"spanning",
"these",
"putative",
"breakpoints",
"were",
"amplified",
"using",
"universal",
"PCR",
"-LRB-",
"Beeman",
"and",
"Stauth",
"1997",
";",
"Sarkar",
"et",
"al.",
"1993",
"-RRB-",
".",
"PCR",
"products",
"were",
"cloned",
"and",
"sequenced",
"at",
"the",
"Kansas",
"State",
"University",
"DNA",
"Sequencing",
"Center",
".",
"The",
"resulting",
"sequences",
"were",
"compared",
"to",
"the",
"Tribolium",
"genome",
"sequence",
"to",
"characterize",
"the",
"breakpoints",
".",
"GenBank",
"accession",
"numbers",
"for",
"these",
"sequences",
"are",
"as",
"follows",
":",
"ptlD60",
"A",
"-LRB-",
"EF591668",
"-RRB-",
"and",
"ptlD60",
"B",
"-LRB-",
"EF591669",
"-RRB-",
".",
"Analysis",
"of",
"mxpDch-3",
"breakpoints",
"Tribolium",
"genomic",
"DNA",
"was",
"isolated",
"from",
"mxpDch-3",
"/",
"Ey",
",",
"AEs/Ey",
",",
"and",
"Ga-1",
"pupae",
"as",
"described",
"by",
"Brown",
"et",
"al.",
"-LRB-",
"1990",
"-RRB-",
",",
"with",
"the",
"exception",
"that",
"DNA",
"was",
"not",
"purified",
"on",
"a",
"CsCl",
"gradient",
".",
"Digested",
"DNAs",
"were",
"separated",
"on",
"a",
"0.7",
"%",
"agarose",
"gel",
"by",
"field",
"inversion",
"gel",
"electrophoresis",
"and",
"transferred",
"to",
"GeneScreen",
"nylon",
"membrane",
"-LRB-",
"NEN",
"Life",
"Sciences",
"-RRB-",
".",
"To",
"look",
"for",
"restriction",
"fragment",
"length",
"polymorphisms",
"associated",
"with",
"mxpDch-3",
",",
"the",
"blot",
"was",
"probed",
"with",
"pBmxp2",
".1",
",",
"a",
"5.2",
"kb",
"HindIII",
"fragment",
"containing",
"the",
"5",
"′",
"end",
"of",
"the",
"mxp/Tc-pb",
"coding",
"region",
".",
"Inverse",
"PCR",
"-LRB-",
"Ochman",
"et",
"al.",
"1988",
"-RRB-",
"was",
"used",
"to",
"clone",
"breakpoints",
"associated",
"with",
"mxpDch-3",
".",
"mxpDch-3",
"/",
"Ey",
"genomic",
"DNA",
"was",
"digested",
"with",
"a",
"restriction",
"enzyme",
"-LRB-",
"EcoRI",
",",
"HindIII",
",",
"and",
"RsaI",
"for",
"breakpoint",
"fragments",
"A",
",",
"B",
",",
"and",
"C",
",",
"respectively",
"-RRB-",
".",
"After",
"circularization",
"of",
"the",
"fragments",
",",
"two",
"rounds",
"of",
"PCR",
"were",
"performed",
"with",
"primers",
"designed",
"from",
"known",
"sequence",
".",
"Resulting",
"fragments",
"were",
"cloned",
"using",
"the",
"TOPO-TA",
"Cloning",
"Kit",
"-LRB-",
"Invitrogen",
"-RRB-",
",",
"sequenced",
",",
"and",
"submitted",
"to",
"GenBank",
"under",
"the",
"following",
"accession",
"numbers",
":",
"Dch3",
"A",
"-LRB-",
"EF591670",
"-RRB-",
",",
"Dch3",
"B",
"-LRB-",
"EF591671",
"-RRB-",
",",
"Dch3",
"C",
"-LRB-",
"EF591672",
"-RRB-",
".",
"Sequences",
"were",
"compared",
"to",
"the",
"Tribolium",
"genome",
"sequence",
"to",
"determine",
"the",
"location",
"of",
"breakpoints",
".",
"Analysis",
"of",
"ptlKT76",
"transposon",
"insertion",
"site",
"The",
"ptlKT76",
"piggyBac-insertion",
"site",
"was",
"amplified",
"by",
"vectorette",
"PCR",
"as",
"described",
"by",
"Lorenzen",
"et",
"al.",
"-LRB-",
"2007",
"-RRB-",
".",
"The",
"resulting",
"product",
"was",
"sequenced",
"by",
"Elim",
"Biopharmaceuticals",
",",
"Inc.",
"-LRB-",
"Hayward",
",",
"CA",
",",
"USA",
"-RRB-",
"and",
"the",
"sequence",
"was",
"submitted",
"to",
"GenBank",
"as",
"accession",
"number",
"EU056827",
".",
"Results",
"The",
"Tribolium",
"Hox",
"cluster",
"has",
"retained",
"an",
"ancestral",
"organization",
"Several",
"bacterial",
"artificial",
"chromosome",
"-LRB-",
"BAC",
"-RRB-",
"clones",
"encompassing",
"the",
"ANTC-like",
"region",
"of",
"the",
"Tribolium",
"Hox",
"cluster",
"were",
"previously",
"sequenced",
"and",
"annotated",
"-LRB-",
"Brown",
"et",
"al.",
"2002",
"-RRB-",
".",
"Using",
"the",
"newly",
"assembled",
"Tribolium",
"genome",
"sequence",
",",
"we",
"have",
"performed",
"a",
"similar",
"analysis",
"of",
"the",
"BXC-like",
"portion",
"of",
"the",
"cluster",
"and",
"find",
"that",
"this",
"region",
"contains",
"the",
"Tribolium",
"orthologs",
"of",
"Ultrabithorax",
"-LRB-",
"Ubx",
";",
"Bennett",
"et",
"al.",
"1999",
"-RRB-",
",",
"abdominal-A",
"-LRB-",
"abd-A",
";",
"Shippy",
"et",
"al.",
"1998",
"-RRB-",
"and",
"Abdominal-B",
"-LRB-",
"Abd-B",
"-RRB-",
".",
"As",
"in",
"Drosophila",
",",
"the",
"transcription",
"units",
"in",
"this",
"part",
"of",
"the",
"complex",
"are",
"larger",
"than",
"those",
"of",
"the",
"ANTC-like",
"portion",
"due",
"to",
"the",
"presence",
"of",
"longer",
"introns",
".",
"As",
"expected",
"from",
"previous",
"molecular",
"and",
"genetic",
"studies",
"-LRB-",
"Beeman",
"1987",
";",
"Brown",
"et",
"al.",
"2002",
"-RRB-",
",",
"all",
"of",
"the",
"Tribolium",
"Hox",
"genes",
"map",
"to",
"a",
"single",
"cluster",
"on",
"LG2",
".",
"This",
"cluster",
"spans",
"approximately",
"756",
"Kb",
"within",
"a",
"single",
"scaffold",
"of",
"the",
"assembled",
"genome",
"sequence",
".",
"A",
"few",
"small",
"sequencing",
"gaps",
"are",
"present",
"in",
"the",
"assembly",
",",
"but",
"more",
"than",
"half",
"can",
"be",
"filled",
"by",
"other",
"available",
"sequences",
"-LRB-",
"i.e.",
",",
"the",
"three",
"BAC",
"clones",
"previously",
"sequenced",
"for",
"the",
"ANTC-like",
"portion",
"of",
"the",
"cluster",
"and",
"four",
"BACs",
"from",
"the",
"BXC-like",
"region",
"sequenced",
"for",
"verification",
"of",
"the",
"shotgun",
"genome",
"assembly",
";",
"Tribolium",
"Genome",
"Consortium",
"2008",
"-RRB-",
".",
"The",
"total",
"length",
"of",
"the",
"filled",
"gaps",
"is",
"approximately",
"2,635",
"bp",
"-LRB-",
"mismatches",
"in",
"the",
"sequence",
"flanking",
"the",
"gaps",
"lead",
"to",
"some",
"ambiguity",
"-RRB-",
",",
"which",
"is",
"only",
"slightly",
"longer",
"than",
"the",
"estimated",
"total",
"length",
"of",
"these",
"gaps",
"-LRB-",
"1,938",
"bp",
"-RRB-",
".",
"Thus",
",",
"estimation",
"of",
"sequencing",
"gaps",
"in",
"the",
"HOMC",
"region",
"appears",
"to",
"be",
"quite",
"accurate",
".",
"Two",
"of",
"these",
"gaps",
"are",
"immediately",
"adjacent",
"to",
"transposable",
"element",
"insertion",
"sites",
"and",
"may",
"result",
"from",
"difficulties",
"in",
"assembling",
"repetitive",
"DNA",
".",
"These",
"two",
"sites",
"account",
"for",
"about",
"1,300",
"bp",
"of",
"the",
"total",
"gaps",
"in",
"the",
"HOMC",
".",
"In",
"two",
"other",
"cases",
",",
"gaps",
"in",
"the",
"genome",
"assembly",
"are",
"associated",
"with",
"tandem",
"duplications",
"that",
"are",
"not",
"present",
"in",
"the",
"BAC",
"assemblies",
":",
"an",
"approximately",
"160-bp",
"duplication",
"between",
"Tc-Deformed",
"-LRB-",
"Tc-Dfd",
"-RRB-",
"and",
"Tc-zen1",
"and",
"an",
"approximately",
"8.5-kb",
"duplication",
"between",
"prothoraxless/Tc-Antennapedia",
"-LRB-",
"ptl/Tc-Antp",
"-RRB-",
"and",
"Tc-fushi",
"tarazu",
"-LRB-",
"Tc-ftz",
"-RRB-",
".",
"We",
"designed",
"primers",
"to",
"amplify",
"across",
"the",
"regions",
"in",
"question",
"using",
"Ga-2",
"genomic",
"DNA",
"-LRB-",
"the",
"same",
"inbred",
"strain",
"that",
"was",
"used",
"for",
"the",
"Tribolium",
"genome",
"sequence",
"-RRB-",
".",
"In",
"both",
"cases",
",",
"the",
"size",
"of",
"the",
"resulting",
"fragment",
"is",
"consistent",
"with",
"that",
"predicted",
"from",
"the",
"BAC",
"sequence",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
",",
"suggesting",
"that",
"these",
"gaps",
"and",
"duplications",
"are",
"artifacts",
"of",
"the",
"genome",
"assembly",
"process",
".",
"It",
"is",
"important",
"to",
"note",
"that",
"these",
"artifacts",
"affect",
"only",
"a",
"small",
"fraction",
"of",
"the",
"HOMC",
"sequence",
",",
"but",
"they",
"underscore",
"the",
"increased",
"quality",
"of",
"finished",
"versus",
"draft",
"sequences",
".",
"The",
"single",
"Tribolium",
"Hox",
"cluster",
"contains",
"orthologs",
"of",
"all",
"eight",
"Drosophila",
"Hox",
"genes",
",",
"as",
"well",
"as",
"orthologs",
"of",
"the",
"Hox-derived",
"genes",
",",
"fushi",
"tarazu",
"and",
"zerknüllt",
"-LRB-",
"zen",
";",
"Tribolium",
"Genome",
"Consortium",
"2008",
"and",
"Fig.",
"1",
"-RRB-",
".",
"-LRB-",
"In",
"the",
"case",
"of",
"zen",
",",
"Tribolium",
"has",
"two",
"paralogs",
"apparently",
"resulting",
"from",
"a",
"recent",
"duplication",
"in",
"the",
"beetle",
"lineage",
",",
"independent",
"of",
"the",
"zen",
"duplication",
"that",
"occurred",
"in",
"the",
"Drosophila",
"lineage",
"-LRB-",
"Brown",
"et",
"al.",
"2002",
"-RRB-",
"-RRB-",
".",
"These",
"genes",
"are",
"arranged",
"in",
"the",
"same",
"order",
"on",
"the",
"chromosome",
"as",
"their",
"counterparts",
"in",
"other",
"insects",
".",
"As",
"in",
"Apis",
"-LRB-",
"Dearden",
"et",
"al.",
"2006",
";",
"Negre",
"and",
"Ruiz",
"2007",
"-RRB-",
",",
"but",
"in",
"contrast",
"to",
"Drosophila",
"and",
"Anopheles",
"-LRB-",
"Negre",
"and",
"Ruiz",
"2007",
"-RRB-",
",",
"the",
"Hox",
"and",
"Hox-derived",
"genes",
"in",
"the",
"Tribolium",
"cluster",
"are",
"all",
"oriented",
"in",
"the",
"same",
"direction",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"In",
"addition",
",",
"the",
"two",
"miRNA",
"genes",
"-LRB-",
"miR-10",
"and",
"miR-iab-4",
"-RRB-",
"that",
"have",
"been",
"described",
"in",
"other",
"insect",
"Hox",
"clusters",
"are",
"found",
"at",
"conserved",
"positions",
"in",
"the",
"Tribolium",
"HOMC",
"-LRB-",
"Tanzer",
"et",
"al.",
"2005",
"and",
"Fig.",
"1",
"-RRB-",
".",
"Fig.",
"1Embryonic",
"transcription",
"across",
"the",
"complete",
"Tribolium",
"Hox",
"complex",
".",
"The",
"tiling",
"array",
"consists",
"of",
"∼",
"50,000",
"50",
"bp",
"probes",
"that",
"estimate",
"degree",
"of",
"transcription",
".",
"Relative",
"intensities",
"for",
"each",
"probe",
"are",
"represented",
"as",
"peaks",
"correlated",
"with",
"a",
"consensus",
"annotation",
"of",
"the",
"Tribolium",
"Hox",
"complex",
"-LRB-",
"below",
"-RRB-",
".",
"Peak",
"height",
",",
"shown",
"as",
"Percentile",
"Probe",
"Intensity",
"-LRB-",
"PPI",
"-RRB-",
",",
"corresponds",
"to",
"the",
"level",
"of",
"transcription",
"for",
"a",
"particular",
"probe",
".",
"The",
"nucleotide",
"position",
"for",
"each",
"segment",
"is",
"displayed",
"in",
"the",
"upper",
"left",
"and",
"right",
"corners",
"of",
"the",
"panel",
"-LRB-",
"numbers",
"correspond",
"with",
"linkage",
"group",
"2",
",",
"release",
"Tcas_2.0",
"-RRB-",
".",
"New",
"ESTs",
"-LRB-",
"cyan",
"-RRB-",
"are",
"displayed",
"in",
"the",
"annotation",
"track",
"along",
"with",
"transposable",
"elements",
"-LRB-",
"gray",
"-RRB-",
".",
"For",
"annotated",
"genes",
"and",
"ESTs",
",",
"the",
"arrow",
"indicates",
"the",
"direction",
"of",
"transcription",
".",
"Red",
"arrows",
"indicate",
"the",
"location",
"of",
"two",
"RNA-FISH",
"probes",
"The",
"ANTC",
"and",
"BXC",
"clusters",
"of",
"Drosophila",
"melanogaster",
"contain",
"a",
"number",
"of",
"non-Hox",
",",
"protein-coding",
"genes",
".",
"In",
"contrast",
",",
"there",
"is",
"no",
"evidence",
"for",
"non-Hox",
",",
"protein-coding",
"genes",
"in",
"the",
"Tribolium",
"HOMC",
"-LRB-",
"The",
"Tribolium",
"Genome",
"Consortium",
"2008",
"-RRB-",
".",
"Here",
",",
"we",
"corroborate",
"those",
"findings",
"by",
"using",
"several",
"methods",
"to",
"address",
"whether",
"unrelated",
"genes",
"might",
"be",
"interspersed",
"among",
"the",
"Tribolium",
"Hox",
"genes",
".",
"First",
",",
"we",
"searched",
"the",
"Tribolium",
"genome",
"for",
"orthologs",
"of",
"genes",
"that",
"are",
"located",
"within",
"the",
"D.",
"melanogaster",
"clusters",
"and",
"determined",
"that",
"none",
"of",
"these",
"genes",
"are",
"located",
"within",
"the",
"Tribolium",
"HOMC",
".",
"Second",
",",
"we",
"analyzed",
"predicted",
"proteins",
"within",
"the",
"region",
"to",
"determine",
"whether",
"any",
"of",
"them",
"have",
"recognizable",
"orthologs",
"in",
"other",
"species",
".",
"Other",
"than",
"the",
"Hox",
"and",
"Hox-derived",
"genes",
",",
"we",
"found",
"no",
"evolutionarily",
"conserved",
"proteins",
"among",
"either",
"the",
"GLEAN",
"predictions",
"or",
"the",
"GNOMON",
"ab",
"initio",
"predictions",
"that",
"map",
"to",
"the",
"Hox",
"cluster",
".",
"Third",
",",
"we",
"searched",
"a",
"collection",
"of",
"Tribolium",
"ESTs",
"for",
"expressed",
"sequences",
"within",
"the",
"HOMC",
".",
"By",
"this",
"approach",
",",
"we",
"identified",
"three",
"non-Hox",
"EST",
"clusters",
"that",
"appear",
"to",
"represent",
"noncoding",
"transcripts",
"as",
"well",
"as",
"evidence",
"for",
"a",
"mariner",
"transposase",
"gene",
"-LRB-",
"see",
"below",
"-RRB-",
",",
"but",
"no",
"other",
"protein-coding",
"genes",
"were",
"found",
".",
"Finally",
",",
"we",
"analyzed",
"the",
"embryonically",
"transcribed",
"sequences",
"identified",
"by",
"a",
"tiling",
"array",
"to",
"determine",
"if",
"any",
"were",
"likely",
"to",
"encode",
"proteins",
".",
"Again",
",",
"we",
"found",
"no",
"evidence",
"of",
"non-Hox-related",
"protein-coding",
"genes",
"other",
"than",
"those",
"within",
"transposable",
"elements",
".",
"Although",
"there",
"are",
"caveats",
"to",
"these",
"analyses",
"-LRB-",
"e.g.",
",",
"gene",
"prediction",
"methods",
"are",
"imperfect",
",",
"the",
"tiling",
"array",
"represents",
"only",
"the",
"embryonic",
"transcriptome",
"and",
"EST",
"coverage",
"is",
"incomplete",
"-RRB-",
",",
"our",
"results",
"strongly",
"suggest",
"that",
"the",
"protein-coding",
"genes",
"in",
"the",
"Tribolium",
"Hox",
"complex",
"-LRB-",
"excluding",
"genes",
"within",
"transposable",
"elements",
"-RRB-",
"are",
"all",
"either",
"Hox",
"or",
"Hox-derived",
"genes",
".",
"Comparison",
"of",
"transposable",
"element",
"density",
"in",
"the",
"Hox",
"complexes",
"of",
"various",
"animals",
"has",
"led",
"to",
"the",
"suggestion",
"that",
"higher",
"abundance",
"of",
"transposable",
"elements",
"in",
"Hox",
"clusters",
"is",
"correlated",
"with",
"loss",
"of",
"structural",
"integrity",
".",
"Mammalian",
"Hox",
"complexes",
"have",
"a",
"reduced",
"number",
"of",
"transposons",
"compared",
"to",
"other",
"regions",
"of",
"the",
"genome",
"-LRB-",
"Ferrier",
"and",
"Minguillon",
"2003",
"-RRB-",
".",
"Moreover",
",",
"when",
"transposons",
"are",
"present",
",",
"they",
"seem",
"to",
"be",
"preferentially",
"inserted",
"into",
"nontranscribed",
"regions",
"of",
"the",
"clusters",
"-LRB-",
"Mainguy",
"et",
"al.",
"2007",
"-RRB-",
".",
"In",
"contrast",
",",
"transposons",
"occur",
"fairly",
"frequently",
"in",
"the",
"split",
"Drosophila",
"clusters",
"-LRB-",
"Fried",
"et",
"al.",
"2004",
"-RRB-",
".",
"Though",
"the",
"prediction",
"of",
"three",
"transposable",
"elements",
"in",
"the",
"Tribolium",
"Hox",
"complex",
"-LRB-",
"Fig.",
"1",
"-RRB-",
"may",
"be",
"an",
"underestimate",
",",
"the",
"same",
"method",
"predicts",
"fivefold",
"more",
"in",
"the",
"Drosophila",
"Hox",
"clusters",
".",
"Additionally",
",",
"only",
"three",
"transposable",
"elements",
"-LRB-",
"all",
"mariners",
"-RRB-",
"have",
"been",
"found",
"in",
"the",
"larger",
"but",
"intact",
"Apis",
"Hox",
"complex",
"-LRB-",
"Dearden",
"et",
"al.",
"2006",
"-RRB-",
".",
"These",
"numbers",
"are",
"consistent",
"with",
"the",
"apparent",
"inverse",
"correlation",
"between",
"transposon",
"number",
"and",
"the",
"level",
"of",
"Hox",
"cluster",
"organization",
".",
"Taken",
"together",
",",
"these",
"observations",
"suggest",
"that",
"with",
"respect",
"to",
"gene",
"content",
",",
"order",
",",
"and",
"orientation",
",",
"the",
"Tribolium",
"Hox",
"cluster",
"closely",
"resembles",
"the",
"putative",
"ancestral",
"Hox",
"cluster",
"-LRB-",
"Garcia-Fernandez",
"2005",
"-RRB-",
".",
"Thus",
",",
"the",
"constraints",
"preserving",
"the",
"integrity",
"of",
"the",
"Hox",
"cluster",
"may",
"still",
"be",
"in",
"force",
"in",
"Tribolium",
".",
"To",
"determine",
"whether",
"these",
"constraints",
"extend",
"outside",
"the",
"Tribolium",
"Hox",
"cluster",
",",
"we",
"examined",
"synteny",
"beyond",
"the",
"cluster",
"itself",
".",
"As",
"previously",
"described",
",",
"Tc-chaoptic",
"partially",
"overlaps",
"the",
"3",
"′",
"UTR",
"of",
"Tc-labial",
"-LRB-",
"Tc-lab",
"-RRB-",
"on",
"the",
"opposite",
"strand",
"-LRB-",
"Nie",
"et",
"al.",
"2001",
"-RRB-",
".",
"Working",
"outward",
",",
"the",
"first",
"gene",
"on",
"the",
"same",
"strand",
"as",
"the",
"Hox",
"genes",
"is",
"Tc_00927",
",",
"a",
"dolichyl",
"glycosyltransferase",
"orthologous",
"to",
"D.",
"melanogaster",
"CG4542",
".",
"Beyond",
"the",
"Tc-Abd-B",
"locus",
"is",
"a",
"cluster",
"of",
"putative",
"serine",
"carboxypeptidase",
"genes",
"-LRB-",
"Tc_00887",
",",
"Tc_00664",
",",
"Tc_00665",
",",
"and",
"Tc_00666",
"-RRB-",
"and",
"the",
"ortholog",
"of",
"D.",
"melanogaster",
"CG3909",
"-LRB-",
"Tc_00886",
"-RRB-",
".",
"We",
"identified",
"the",
"orthologs",
"of",
"these",
"genes",
"in",
"D.",
"melanogaster",
",",
"Anopheles",
"gambiae",
",",
"and",
"Apis",
"mellifera",
"and",
"determined",
"their",
"map",
"positions",
".",
"None",
"of",
"these",
"genes",
"map",
"near",
"the",
"Hox",
"cluster",
"in",
"any",
"of",
"the",
"other",
"insects",
".",
"Likewise",
",",
"orthologs",
"of",
"the",
"genes",
"adjacent",
"to",
"lab",
"and",
"Abd-B",
"in",
"D.",
"melanogaster",
"do",
"not",
"map",
"near",
"the",
"Hox",
"clusters",
"of",
"the",
"other",
"three",
"insects",
".",
"These",
"results",
"suggest",
"that",
"the",
"constraints",
"preserving",
"the",
"Hox",
"cluster",
"act",
"only",
"on",
"the",
"Hox",
"genes",
"themselves",
"and",
"not",
"the",
"surrounding",
"region",
".",
"The",
"Tribolium",
"Hox",
"cluster",
"produces",
"numerous",
"noncoding",
"transcripts",
"We",
"developed",
"a",
"tiling",
"microarray",
"covering",
"the",
"Tribolium",
"Hox",
"complex",
"to",
"identify",
"the",
"transcription",
"units",
"active",
"during",
"a",
"broad",
"window",
"of",
"Tribolium",
"embryonic",
"development",
".",
"Tiling",
"array",
"signal",
"intensity",
"profiles",
"were",
"compared",
"with",
"previously",
"described",
"Hox",
"cDNA",
"structures",
".",
"Though",
"the",
"tiling",
"density",
"is",
"not",
"fine-scaled",
"enough",
"to",
"effectively",
"resolve",
"intron",
"--",
"exon",
"boundaries",
",",
"there",
"is",
"a",
"near-perfect",
"correlation",
"between",
"tiling",
"array-predicted",
"transcription",
"and",
"the",
"position",
"of",
"exons",
"in",
"the",
"well-characterized",
"Hox",
"genes",
".",
"The",
"only",
"caveat",
"is",
"that",
"the",
"5",
"′",
"exons",
"of",
"maxillopedia/Tc-proboscipedia",
"-LRB-",
"mxp/Tc-pb",
"-RRB-",
"and",
"Tc-Abd-B",
"exhibit",
"weaker",
"signals",
"than",
"the",
"other",
"exons",
"of",
"these",
"genes",
".",
"The",
"most",
"likely",
"explanation",
"is",
"that",
"the",
"5",
"′",
"exon",
"is",
"present",
"only",
"in",
"a",
"small",
"subset",
"of",
"the",
"transcripts",
"derived",
"from",
"the",
"gene",
"-LRB-",
"i.e.",
",",
"a",
"minor",
"spliceoform",
"-RRB-",
".",
"During",
"the",
"first",
"3",
"days",
"of",
"development",
",",
"numerous",
"regions",
"of",
"the",
"Hox",
"complex",
",",
"including",
"intergenic",
"and",
"intronic",
"noncoding",
"regions",
",",
"are",
"actively",
"transcribed",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"Interestingly",
",",
"neither",
"of",
"the",
"two",
"most",
"likely",
"noncoding",
"candidates",
",",
"the",
"previously",
"described",
"miRNAs",
",",
"is",
"robustly",
"identified",
"on",
"the",
"tiling",
"array",
".",
"Transcription",
"at",
"the",
"tca-miR-10",
"locus",
"is",
"not",
"detected",
",",
"and",
"transcription",
"at",
"the",
"tca-miR-iab-4",
"locus",
"is",
"weak",
".",
"It",
"may",
"be",
"that",
"tca-miR-10",
"is",
"not",
"expressed",
"during",
"the",
"stages",
"examined",
",",
"whereas",
"in",
"situ",
"hybridization",
"assays",
"show",
"that",
"tca-miR-iab-4",
"is",
"strongly",
"expressed",
"during",
"part",
"of",
"the",
"developmental",
"window",
"examined",
"-LRB-",
"Fig.",
"2b",
"-RRB-",
".",
"Fig.",
"2Expression",
"pattern",
"of",
"two",
"HOMC",
"noncoding",
"transcripts",
"in",
"Tribolium",
"embryos",
".",
"Probe",
"positions",
"are",
"shown",
"in",
"Fig.",
"1",
".",
"a",
"Expression",
"pattern",
"from",
"a",
"1-kb",
"probe",
"located",
"∼",
"86",
"kb",
"5",
"′",
"of",
"the",
"start",
"of",
"ptl/Tc-Antp",
".",
"b",
"The",
"expression",
"pattern",
"of",
"the",
"Tribolium",
"homolog",
"of",
"the",
"iab-4",
"miRNA",
"-LRB-",
"tca-miR-iab-4",
"-RRB-",
"The",
"most",
"intense",
"hybridization",
"signals",
"are",
"detected",
"in",
"the",
"central",
"250",
"kb",
"of",
"the",
"Hox",
"complex",
",",
"encompassing",
"the",
"ptl/Tc-Antp",
"and",
"Ultrathorax/Tc-Ultrabithorax",
"-LRB-",
"Utx/Tc-Ubx",
"-RRB-",
"genes",
".",
"Strikingly",
",",
"transcription",
"in",
"this",
"region",
"is",
"almost",
"equally",
"intense",
"for",
"coding",
"and",
"noncoding",
"loci",
",",
"and",
"for",
"both",
"the",
"introns",
"and",
"exons",
"of",
"the",
"protein-coding",
"genes",
".",
"There",
"are",
"hundreds",
"of",
"discrete",
"regions",
"-LRB-",
"500",
"bp",
"or",
"longer",
"-RRB-",
"where",
"signal",
"intensity",
"is",
"many",
"times",
"greater",
"than",
"for",
"verified",
"Hox",
"gene",
"exons",
".",
"It",
"is",
"not",
"possible",
"to",
"determine",
"from",
"the",
"single",
"time",
"point",
"we",
"have",
"analyzed",
"if",
"any",
"of",
"these",
"discrete",
"regions",
"are",
"part",
"of",
"larger",
"transcripts",
".",
"To",
"verify",
"that",
"the",
"observed",
"signals",
"in",
"the",
"tiling",
"array",
"represent",
"authentic",
"transcription",
",",
"RNA",
"fluorescent",
"in",
"situ",
"hybridization",
"-LRB-",
"FISH",
"-RRB-",
"was",
"performed",
"with",
"a",
"representative",
"1-kb",
"region",
"between",
"ptl/Tc-Antp",
"and",
"Utx/Tc-Ubx",
"-LRB-",
"TcNC-1",
"in",
"Fig.",
"1",
"-RRB-",
".",
"This",
"region",
"is",
"expressed",
"in",
"a",
"Hox-like",
"pattern",
"with",
"distinct",
"anterior",
"and",
"posterior",
"borders",
"in",
"the",
"posterior",
"region",
"of",
"the",
"elongating",
"germ",
"band",
"-LRB-",
"Fig.",
"2a",
"-RRB-",
".",
"Interestingly",
",",
"signal",
"is",
"detected",
"primarily",
"in",
"two",
"spots",
"per",
"nucleus",
",",
"presumably",
"at",
"the",
"sites",
"of",
"nascent",
"transcription",
".",
"This",
"suggests",
"either",
"rapid",
"degradation",
"or",
"processing",
"of",
"a",
"primary",
"transcript",
"as",
"would",
"be",
"seen",
"for",
"a",
"pri-miRNA",
"or",
"an",
"intron",
".",
"In",
"our",
"search",
"for",
"additional",
"genes",
"within",
"the",
"Tribolium",
"Hox",
"cluster",
",",
"we",
"identified",
"three",
"ESTs",
"that",
"appear",
"to",
"represent",
"noncoding",
"transcripts",
".",
"One",
"seems",
"to",
"be",
"a",
"chimeric",
"artifact",
",",
"arising",
"from",
"the",
"fusion",
"of",
"a",
"tca-miR-10",
"precursor",
"and",
"part",
"of",
"a",
"28s",
"rRNA",
"gene",
".",
"The",
"second",
",",
"represented",
"by",
"two",
"independent",
"cDNAs",
",",
"maps",
"between",
"ptl/Tc-Antp",
"and",
"Utx/Tc-Ubx",
"while",
"the",
"third",
"is",
"located",
"within",
"the",
"first",
"intron",
"of",
"Utx/Tc-Ubx",
".",
"The",
"last",
"two",
"are",
"transcribed",
"from",
"the",
"strand",
"opposite",
"the",
"Hox",
"genes",
"and",
"are",
"correlated",
"with",
"regions",
"of",
"strong",
"signal",
"in",
"the",
"tiling",
"array",
"analysis",
".",
"The",
"mxpDch-3",
"mutation",
"affects",
"regulation",
"of",
"both",
"mxp/Tc-pb",
"and",
"Cx/Tc-Scr",
"Because",
"complex",
"regulatory",
"regions",
"may",
"act",
"as",
"a",
"constraining",
"force",
"keeping",
"Hox",
"clusters",
"intact",
",",
"we",
"analyzed",
"the",
"mxpDch-3",
"mutation",
",",
"which",
"was",
"shown",
"to",
"have",
"unusual",
"effects",
"on",
"the",
"expression",
"of",
"mxp/Tc-pb",
"-LRB-",
"Shippy",
"et",
"al.",
"2000",
"-RRB-",
";",
"mxpDch-3",
"homozygotes",
"lack",
"most",
",",
"if",
"not",
"all",
",",
"normal",
"mxp/Tc-pb",
"expression",
",",
"but",
"both",
"heterozygotes",
"and",
"homozygotes",
"display",
"strong",
"ectopic",
"mxp/Tc-pb",
"expression",
"in",
"a",
"pattern",
"reminiscent",
"of",
"Cephalothorax/Tc-Sex",
"combs",
"reduced",
"-LRB-",
"Cx/Tc-Scr",
"-RRB-",
"expression",
"-LRB-",
"albeit",
"with",
"an",
"apparent",
"posterior",
"shift",
"of",
"some",
"domains",
"-RRB-",
".",
"This",
"ectopic",
"expression",
"is",
"sufficient",
"to",
"rescue",
"some",
"aspects",
"of",
"mxp/Tc-pb",
"function",
"so",
"mxpDch-3",
"is",
"not",
"an",
"mxp/Tc-pb",
"null",
"-LRB-",
"Shippy",
"et",
"al.",
"2000",
"-RRB-",
".",
"Interestingly",
",",
"we",
"find",
"that",
"mxpDch-3",
"fails",
"to",
"complement",
"a",
"null",
"allele",
"of",
"Cx/Tc-Scr",
"-LRB-",
"and",
",",
"in",
"fact",
",",
"appears",
"to",
"be",
"null",
"for",
"Cx/Tc-Scr",
"-RRB-",
"but",
"complements",
"null",
"alleles",
"of",
"Tc-Dfd",
"and",
"ptl/Tc-Antp",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"To",
"better",
"understand",
"this",
"complex",
"mutation",
",",
"we",
"characterized",
"the",
"breakpoints",
"associated",
"with",
"mxpDch-3",
".",
"mxpDch-3",
"is",
"associated",
"with",
"a",
"chromosomal",
"rearrangement",
"involving",
"at",
"least",
"four",
"breakpoints",
".",
"Although",
"we",
"have",
"not",
"ruled",
"out",
"the",
"presence",
"of",
"additional",
"breakpoints",
",",
"the",
"simplest",
"interpretation",
"of",
"our",
"data",
"is",
"that",
"a",
"fragment",
"of",
"the",
"HOMC",
"-LRB-",
"including",
"Tc-zen1",
",",
"Tc-zen2",
",",
"Tc-Dfd",
",",
"Cx/Tc-Scr",
",",
"and",
"Tc-ftz",
"-RRB-",
"has",
"been",
"removed",
"from",
"the",
"HOMC",
"and",
"inserted",
"between",
"a",
"fragment",
"of",
"LG9",
"and",
"a",
"non-HOMC",
"fragment",
"of",
"LG2",
"-LRB-",
"Fig.",
"3a",
"-RRB-",
".",
"This",
"scenario",
"is",
"consistent",
"with",
"previously",
"reported",
"pseudo-linkage",
"of",
"LG2",
"and",
"LG9",
"associated",
"with",
"mxpDch-3",
"-LRB-",
"Beeman",
"et",
"al.",
"1996",
"-RRB-",
"and",
"provides",
"an",
"explanation",
"for",
"the",
"mid-embryonic",
"lethality",
"of",
"the",
"mxpDch-3",
"homozygotes",
"-LRB-",
"Shippy",
"et",
"al.",
"2000",
"-RRB-",
".",
"That",
"is",
",",
"non-HOMC",
"breakpoints",
"interrupt",
"both",
"the",
"TFIIA-L",
"ortholog",
",",
"which",
"is",
"a",
"component",
"of",
"the",
"transcriptional",
"machinery",
"-LRB-",
"Yokomori",
"et",
"al.",
"1993",
"-RRB-",
",",
"and",
"a",
"homolog",
"of",
"groucho",
",",
"which",
"is",
"an",
"important",
"transcriptional",
"corepressor",
"in",
"Drosophila",
"-LRB-",
"Jimenez",
"et",
"al.",
"1997",
";",
"Paroush",
"et",
"al.",
"1994",
"-RRB-",
".",
"We",
"conclude",
"that",
"the",
"breakpoint",
"between",
"Tc-ftz",
"and",
"ptl/Tc-Antp",
"is",
"likely",
"to",
"account",
"for",
"the",
"loss",
"of",
"Cx/Tc-Scr",
"function",
"associated",
"with",
"mxpDch-3",
",",
"probably",
"by",
"separating",
"the",
"Cx/Tc-Scr",
"transcription",
"unit",
"from",
"some",
"or",
"all",
"of",
"its",
"regulatory",
"units",
".",
"The",
"rearrangement",
"probably",
"juxtaposes",
"these",
"regulatory",
"elements",
"with",
"the",
"mxp/Tc-pb",
"transcription",
"unit",
",",
"providing",
"a",
"likely",
"explanation",
"for",
"the",
"Cx/Tc-Scr-like",
"expression",
"of",
"mxp/Tc-pb",
"in",
"mxpDch-3",
"embryos",
".",
"Fig.",
"3Rearrangements",
"of",
"the",
"HOMC",
".",
"In",
"these",
"schematic",
"diagrams",
",",
"the",
"positions",
"of",
"cloned",
"breakpoint",
"fragments",
"are",
"underlined",
".",
"Wild-type",
"chromosomal",
"position",
"-LRB-",
"not",
"to",
"scale",
"-RRB-",
"on",
"LG2",
"-LRB-",
"purple",
"-RRB-",
"is",
"indicated",
"by",
"a",
"gradient",
"of",
"color",
"to",
"illustrate",
"the",
"effects",
"of",
"inversions",
".",
"a",
"In",
"the",
"mxpDch-3",
"rearrangement",
",",
"an",
"approximately",
"150-kb",
"fragment",
"of",
"the",
"HOMC",
"has",
"been",
"transposed",
"between",
"fragments",
"of",
"LG9",
"and",
"LG2",
".",
"b",
"The",
"ptlD60",
"mutation",
"is",
"a",
"large",
"inversion",
"that",
"splits",
"the",
"Hox",
"cluster",
"into",
"two",
"parts",
".",
"Small",
"fragments",
"at",
"each",
"end",
"of",
"the",
"inversion",
"appear",
"to",
"have",
"been",
"deleted",
",",
"including",
"part",
"of",
"the",
"ptl/Tc-Antp",
"locus",
"Cx/Tc-Scr",
"regulatory",
"elements",
"map",
"near",
"or",
"within",
"ptl/Tc-Antp",
"Beeman",
"et",
"al.",
"-LRB-",
"1993",
"-RRB-",
"observed",
"that",
"mutations",
"in",
"Cx/Tc-Scr",
"and",
"ptl/Tc-Antp",
"often",
"partially",
"fail",
"to",
"complement",
"one",
"another",
".",
"Because",
"this",
"is",
"precisely",
"the",
"type",
"of",
"genetic",
"interaction",
"that",
"would",
"be",
"predicted",
"if",
"the",
"separation",
"of",
"Hox",
"genes",
"has",
"deleterious",
"effects",
",",
"we",
"decided",
"to",
"analyze",
"ptlD60",
",",
"an",
"allele",
"of",
"ptl/Tc-Antp",
"that",
"shows",
"such",
"effects",
".",
"The",
"ptlD60",
"mutation",
",",
"which",
"results",
"in",
"transformation",
"of",
"the",
"larval",
"legs",
"toward",
"antennae",
"as",
"well",
"as",
"reductions",
"of",
"some",
"labial",
"and",
"thoracic",
"tissue",
",",
"has",
"been",
"proposed",
"to",
"be",
"a",
"null",
"allele",
"of",
"ptl/Tc-Antp",
"-LRB-",
"Beeman",
"et",
"al.",
"1993",
"-RRB-",
".",
"However",
",",
"adults",
"transheterozygous",
"for",
"ptlD60/ptlD2",
"have",
"a",
"very",
"different",
"phenotype",
"from",
"that",
"produced",
"by",
"larval",
"ptl/Tc-Antp",
"RNAi",
"-LRB-",
"Tomoyasu",
"et",
"al.",
"2005",
"-RRB-",
"and",
",",
"instead",
",",
"resemble",
"adults",
"in",
"which",
"both",
"ptl/Tc-Antp",
"and",
"Cx/Tc-Scr",
"have",
"been",
"knocked",
"down",
"-LRB-",
"Tomoyasu",
",",
"personal",
"communication",
"-RRB-",
".",
"This",
"result",
"raises",
"the",
"possibility",
"that",
"the",
"ptlD60",
"mutation",
"affects",
"the",
"function",
"of",
"both",
"genes",
".",
"To",
"address",
"this",
"issue",
",",
"we",
"performed",
"parental",
"RNAi",
"with",
"ptl/Tc-Antp",
"and",
"found",
"that",
"the",
"resulting",
"larvae",
"-LRB-",
"Fig.",
"4b",
"-RRB-",
"show",
"a",
"phenotype",
"almost",
"identical",
"to",
"that",
"of",
"ptlD60",
"homozygotes",
"-LRB-",
"Fig.",
"4c",
"-RRB-",
",",
"suggesting",
"that",
"the",
"ptlD60",
"mutation",
"primarily",
"affects",
"the",
"function",
"of",
"ptl/Tc-Antp",
"during",
"embryonic",
"development",
".",
"However",
",",
"there",
"is",
"a",
"subtle",
"difference",
"between",
"the",
"ptlD60",
"and",
"ptl/Tc-Antp",
"RNAi",
"phenotypes",
"in",
"the",
"positioning",
"of",
"the",
"T1",
"appendages",
",",
"which",
"are",
"located",
"near",
"the",
"ventral",
"midline",
"in",
"the",
"RNAi",
"larvae",
"but",
"more",
"laterally",
"in",
"the",
"mutants",
".",
"This",
"difference",
"is",
"likely",
"attributable",
"to",
"partial",
"loss",
"of",
"Cx/Tc-Scr",
"function",
"in",
"ptlD60",
"because",
"Cx/Scr",
"is",
"responsible",
"for",
"the",
"midline",
"position",
"of",
"the",
"labial",
"appendages",
"in",
"Tribolium",
"-LRB-",
"Shippy",
"et",
"al.",
"2006",
"-RRB-",
"and",
"other",
"insects",
"-LRB-",
"Hughes",
"and",
"Kaufman",
"2000",
";",
"Pattatucci",
"et",
"al.",
"1991",
";",
"Rogers",
"et",
"al.",
"1997",
"-RRB-",
".",
"Thus",
",",
"ptlD60",
"appears",
"to",
"be",
"not",
"only",
"a",
"null",
"allele",
"of",
"ptl/Tc-Antp",
"but",
"also",
"a",
"hypomorphic",
"allele",
"of",
"Cx/Tc-Scr",
".",
"Fig.",
"4Cuticle",
"and",
"enhancer",
"trap",
"phenotypes",
"of",
"ptl/Tc-Antp",
"mutations",
".",
"The",
"antennae",
"-LRB-",
"ant",
"-RRB-",
"and",
"the",
"labial",
"-LRB-",
"lab",
"-RRB-",
"and",
"thoracic",
"-LRB-",
"T1",
"--",
"T3",
"-RRB-",
"segments",
"are",
"denoted",
"where",
"relevant",
".",
"a",
"--",
"e",
"Cuticle",
"preps",
"displaying",
"the",
"phenotypes",
"of",
"wild-type",
"-LRB-",
"Ga-1",
";",
"a",
"-RRB-",
",",
"ptl/Tc-Antp",
"RNAi",
"-LRB-",
"b",
"-RRB-",
",",
"ptlD60/ptlD60",
"-LRB-",
"c",
"-RRB-",
",",
"ptlKT76/ptlKT76",
"-LRB-",
"d",
"-RRB-",
",",
"and",
"ptlKT76/ptlD60",
"-LRB-",
"e",
"-RRB-",
"first",
"instar",
"larvae",
".",
"Enhancer",
"trap-driven",
"EGFP",
"expression",
"in",
"a",
"ptlKT76",
"embryo",
"-LRB-",
"f",
"-RRB-",
"appears",
"in",
"a",
"very",
"similar",
"pattern",
"to",
"Cx/Tc-Scr",
"expression",
"-LRB-",
"purple",
"-RRB-",
"in",
"a",
"wild-type",
"embryo",
"-LRB-",
"g",
"-RRB-",
".",
"A",
"ptlKT76",
"larva",
"-LRB-",
"h",
"-RRB-",
"and",
"pupa",
"-LRB-",
"i",
"-RRB-",
"also",
"display",
"EGFP",
"enhancer",
"trap",
"expression",
"in",
"parts",
"of",
"the",
"labial",
"and",
"first",
"thoracic",
"segments",
"To",
"understand",
"why",
"the",
"ptlD60",
"mutation",
"affects",
"both",
"ptl/Tc-Antp",
"and",
"Cx/Tc-Scr",
",",
"we",
"characterized",
"its",
"mutant",
"lesion",
"-LRB-",
"s",
"-RRB-",
".",
"We",
"found",
"that",
"ptlD60",
"is",
"associated",
"with",
"an",
"inversion",
"of",
"about",
"6.6",
"Mb",
",",
"with",
"breakpoints",
"in",
"ptl/Tc-Antp",
"and",
"a",
"distant",
"region",
"of",
"LG2",
"-LRB-",
"Fig.",
"3b",
"-RRB-",
".",
"In",
"addition",
",",
"there",
"are",
"small",
"deletions",
"at",
"each",
"end",
"of",
"the",
"inversion",
"-LRB-",
"approximately",
"3.1",
"kb",
"of",
"the",
"ptl/Tc-Antp",
"transcription",
"unit",
"including",
"all",
"of",
"exon",
"2",
"and",
"approximately",
"1.5",
"kb",
"at",
"the",
"other",
"end",
"-RRB-",
".",
"Consistent",
"with",
"this",
"conclusion",
",",
"we",
"find",
"that",
"ptlD60",
"can",
"act",
"as",
"a",
"crossover",
"suppressor",
"for",
"LG2",
",",
"reducing",
"recombination",
"between",
"Reindeer",
"-LRB-",
"a",
"mutation",
"near",
"one",
"end",
"of",
"LG2",
"-RRB-",
"and",
"the",
"HOMC",
"from",
"its",
"normal",
"value",
"of",
"35",
"--",
"40",
"cM",
"-LRB-",
"Beeman",
"et",
"al.",
"1996",
"-RRB-",
"to",
"approximately",
"20",
"cM",
".",
"These",
"results",
"suggest",
"that",
"breakpoints",
"within",
"the",
"ptl/Tc-Antp",
"gene",
"affect",
"the",
"function",
"of",
"both",
"ptl/Tc-Antp",
"and",
"Cx/Tc-Scr",
",",
"probably",
"by",
"disrupting",
"the",
"function",
"of",
"Cx/Tc-Scr",
"regulatory",
"elements",
"-LRB-",
"see",
"``",
"Discussion",
"''",
"-RRB-",
".",
"Additional",
"evidence",
"for",
"the",
"presence",
"of",
"Cx/Tc-Scr",
"regulatory",
"elements",
"in",
"the",
"vicinity",
"of",
"ptl/Tc-Antp",
"comes",
"from",
"a",
"piggyBac-insertion",
"line",
"recovered",
"during",
"an",
"insertional",
"mutagenesis",
"project",
".",
"The",
"KT076",
"line",
"carries",
"a",
"homozygous",
"lethal",
"insertion",
"in",
"the",
"last",
"intron",
"of",
"ptl",
"-LRB-",
"Fig.",
"5",
"-RRB-",
".",
"Crosses",
"between",
"KT076",
"heterozygotes",
"produce",
"a",
"class",
"of",
"embryos",
"-LRB-",
"putative",
"homozygotes",
"-RRB-",
"with",
"the",
"T1",
"and",
"T2",
"legs",
"partially",
"transformed",
"toward",
"antennae",
"-LRB-",
"Fig.",
"4d",
"-RRB-",
",",
"a",
"phenotype",
"consistent",
"with",
"partial",
"loss",
"of",
"Ptl/Tc-Antp",
"function",
".",
"However",
",",
"individuals",
"carrying",
"the",
"insertion",
"display",
"an",
"embryonic",
"enhancer",
"trap",
"expression",
"pattern",
"-LRB-",
"Fig.",
"4f",
"-RRB-",
"very",
"similar",
"to",
"the",
"expression",
"pattern",
"of",
"Cx/Tc-Scr",
"-LRB-",
"Curtis",
"et",
"al.",
"2001",
";",
"Fig.",
"4g",
"-RRB-",
",",
"despite",
"the",
"fact",
"that",
"the",
"insertion",
"site",
"is",
"about",
"87",
"kb",
"upstream",
"of",
"Cx/Tc-Scr",
".",
"KT076",
"larvae",
"and",
"pupae",
"also",
"show",
"weak",
"enhancer",
"trap",
"patterns",
"consistent",
"with",
"predicted",
"Cx/Tc-Scr",
"domains",
"-LRB-",
"Fig.",
"4h",
"--",
"i",
"-RRB-",
".",
"As",
"expected",
"from",
"the",
"phenotype",
"of",
"homozygotes",
",",
"KT076",
"fails",
"to",
"complement",
"ptlD60",
"as",
"assayed",
"by",
"adult",
"viability",
",",
"and",
"crosses",
"of",
"KT076",
"to",
"ptlD60",
"heterozygotes",
"produce",
"embryos",
"with",
"a",
"phenotype",
"similar",
"to",
",",
"but",
"slightly",
"weaker",
"than",
",",
"that",
"of",
"ptlD60",
"homozygotes",
"-LRB-",
"Fig.",
"4e",
"-RRB-",
".",
"In",
"contrast",
",",
"KT076",
"fully",
"complements",
"both",
"the",
"embryonic",
"phenotype",
"and",
"the",
"adult",
"viability",
"of",
"Cx61",
",",
"a",
"null",
"allele",
"of",
"Cx/Tc-Scr",
"-LRB-",
"Shippy",
"et",
"al.",
"2006",
"-RRB-",
",",
"indicating",
"that",
"Cx/Tc-Scr",
"function",
"is",
"not",
"compromised",
"by",
"the",
"insertion",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"These",
"results",
"suggest",
"that",
"KT076",
"is",
"a",
"hypomorphic",
"allele",
"of",
"ptl/Tc-Antp",
",",
"and",
"it",
"will",
",",
"hereafter",
",",
"be",
"referred",
"to",
"as",
"ptlKT76",
".",
"Together",
"with",
"the",
"data",
"from",
"the",
"mxpDch-3",
"and",
"ptlD60",
"mutations",
",",
"the",
"Cx/Tc-Scr-like",
"enhancer",
"trap",
"phenotype",
"of",
"ptlKT76",
"provides",
"strong",
"evidence",
"that",
"Cx/Tc-Scr",
"regulatory",
"elements",
"are",
"located",
"near",
",",
"and",
"probably",
"within",
",",
"ptl/Tc-Antp",
".",
"Although",
"additional",
"experiments",
"will",
"be",
"necessary",
"to",
"pinpoint",
"the",
"location",
"of",
"regulatory",
"elements",
"and",
"verify",
"this",
"conclusion",
",",
"it",
"is",
"intriguing",
"to",
"think",
"that",
"overlap",
"of",
"regulatory",
"elements",
"of",
"one",
"Hox",
"gene",
"with",
"the",
"transcription",
"unit",
"of",
"another",
"Hox",
"gene",
"might",
"be",
"an",
"important",
"mechanism",
"of",
"Hox",
"cluster",
"constraint",
".",
"Fig.",
"5Overlap",
"of",
"Cx/Tc-Scr",
"regulatory",
"elements",
"with",
"the",
"ptl/Tc-Antp",
"locus",
".",
"The",
"gene",
"structure",
"of",
"ptl/Tc-Antp",
"-LRB-",
"coding",
"sequence",
"is",
"shaded",
"gray",
"-RRB-",
"and",
"the",
"positions",
"of",
"mutant",
"lesions",
"are",
"shown",
"in",
"the",
"diagram",
".",
"The",
"inferred",
"positions",
"of",
"Cx/Tc-Scr",
"regulatory",
"elements",
"in",
"the",
"ptl/Tc-Antp",
"region",
"are",
"indicated",
"below",
"the",
"diagram",
"Discussion",
"The",
"Hox",
"clusters",
"of",
"several",
"insects",
"have",
"now",
"been",
"completely",
"sequenced",
".",
"While",
"breaks",
"in",
"the",
"cluster",
"seem",
"to",
"have",
"occurred",
"several",
"times",
"in",
"the",
"Drosophila",
"lineage",
",",
"the",
"clusters",
"of",
"Apis",
",",
"Anopheles",
",",
"and",
"Tribolium",
"are",
"intact",
".",
"This",
"suggests",
"that",
"many",
"insect",
"clusters",
"are",
"still",
"subject",
"to",
"constraints",
"to",
"maintain",
"their",
"organization",
".",
"Of",
"the",
"insects",
"with",
"intact",
"clusters",
",",
"Tribolium",
"is",
",",
"by",
"far",
",",
"the",
"most",
"genetically",
"tractable",
"and",
"has",
"a",
"strong",
"history",
"of",
"Hox",
"gene",
"studies",
",",
"thus",
"offering",
"the",
"best",
"system",
"for",
"understanding",
"the",
"constraints",
"acting",
"on",
"an",
"intact",
"insect",
"Hox",
"cluster",
".",
"Below",
",",
"we",
"discuss",
"insights",
"provided",
"by",
"our",
"analysis",
"of",
"the",
"Tribolium",
"HOMC",
"into",
"mechanisms",
"that",
"might",
"be",
"responsible",
"for",
"Hox",
"cluster",
"integrity",
".",
"Temporal",
"colinearity",
"Among",
"organisms",
"for",
"which",
"both",
"Hox",
"cluster",
"sequence",
"and",
"expression",
"data",
"are",
"available",
",",
"the",
"presence",
"of",
"an",
"intact",
"cluster",
"appears",
"to",
"be",
"correlated",
"with",
"temporal",
"colinearity",
"of",
"Hox",
"gene",
"expression",
",",
"while",
"disrupted",
"clusters",
"are",
"associated",
"with",
"lack",
"of",
"temporal",
"colinearity",
"-LRB-",
"Monteiro",
"and",
"Ferrier",
"2006",
"-RRB-",
".",
"This",
"observation",
"has",
"pushed",
"temporal",
"colinearity",
"to",
"the",
"forefront",
"of",
"discussions",
"about",
"Hox",
"cluster",
"maintenance",
".",
"However",
",",
"several",
"questions",
"remain",
"to",
"be",
"answered",
".",
"Does",
"temporal",
"colinearity",
"really",
"require",
"an",
"intact",
"Hox",
"cluster",
"?",
"Is",
"temporal",
"colinearity",
"required",
"for",
"proper",
"Hox",
"gene",
"function",
"in",
"organisms",
"with",
"intact",
"clusters",
"?",
"If",
"temporal",
"colinearity",
"is",
"a",
"key",
"constraint",
"on",
"Tribolium",
"Hox",
"cluster",
"integrity",
",",
"we",
"might",
"expect",
"rearrangements",
"to",
"affect",
"the",
"function",
"of",
"most",
"or",
"all",
"Hox",
"genes",
".",
"However",
",",
"our",
"analysis",
"of",
"Tribolium",
"Hox",
"cluster",
"mutations",
"provides",
"no",
"evidence",
"for",
"such",
"global",
"effects",
".",
"The",
"ptlD60",
"inversion",
"splits",
"the",
"complex",
"into",
"two",
"parts",
"but",
"all",
"of",
"the",
"Hox",
"genes",
"except",
"ptl/Tc-Antp",
"and",
"Cx/Tc-Scr",
"appear",
"to",
"function",
"normally",
".",
"In",
"addition",
",",
"the",
"mxpDch-3",
"rearrangement",
"results",
"in",
"the",
"translocation",
"of",
"several",
"HOMC",
"genes",
"-LRB-",
"Tc-zen",
",",
"Tc-Dfd",
",",
"Cx/Tc-Scr",
",",
"and",
"Tc-ftz",
"-RRB-",
"to",
"a",
"new",
"chromosomal",
"location",
".",
"At",
"least",
"one",
"of",
"these",
"genes",
",",
"Tc-Dfd",
",",
"is",
"functional",
"because",
"mxpDch-3",
"fully",
"complements",
"a",
"Tc-Dfd",
"null",
"allele",
".",
"Likewise",
",",
"the",
"genes",
"remaining",
"in",
"the",
"HOMC",
"-LRB-",
"with",
"the",
"exception",
"of",
"mxp/Tc-pb",
"-RRB-",
"apparently",
"function",
"normally",
".",
"These",
"limited",
"effects",
"of",
"Hox",
"cluster",
"rearrangements",
"are",
"similar",
"to",
"what",
"has",
"been",
"reported",
"for",
"Drosophila",
"-LRB-",
"e.g.",
",",
"Abbott",
"and",
"Kaufman",
"1986",
";",
"Pultz",
"et",
"al",
"1988",
"-RRB-",
".",
"Although",
"additional",
"experiments",
"will",
"be",
"required",
"to",
"determine",
"whether",
"Tribolium",
"Hox",
"genes",
"exhibit",
"temporal",
"colinearity",
",",
"our",
"results",
"suggest",
"that",
"constraints",
"on",
"the",
"Tribolium",
"HOMC",
"are",
"more",
"likely",
"to",
"act",
"locally",
".",
"Regulatory",
"elements",
"The",
"reported",
"breaks",
"and",
"transposition",
"sites",
"in",
"the",
"Hox",
"clusters",
"of",
"Drosophila",
"species",
"are",
"all",
"located",
"in",
"intergenic",
"regions",
"near",
"the",
"3",
"′",
"end",
"of",
"a",
"gene",
"-LRB-",
"Negre",
"et",
"al.",
"2005",
";",
"Negre",
"and",
"Ruiz",
"2007",
"-RRB-",
"and",
",",
"thus",
",",
"are",
"presumably",
"less",
"likely",
"to",
"separate",
"a",
"gene",
"from",
"its",
"regulatory",
"elements",
",",
"which",
"are",
"predominantly",
"located",
"5",
"′",
"of",
"each",
"Drosophila",
"Hox",
"gene",
".",
"Interestingly",
",",
"the",
"one",
"exception",
"to",
"this",
"rule",
"is",
"the",
"region",
"between",
"abd-A",
"and",
"Abd-B",
",",
"which",
"contains",
"regulatory",
"regions",
"for",
"both",
"genes",
"and",
"is",
"not",
"split",
"in",
"any",
"of",
"the",
"Drosophila",
"species",
"examined",
"so",
"far",
"-LRB-",
"Negre",
"and",
"Ruiz",
"2007",
"-RRB-",
".",
"These",
"observations",
"led",
"to",
"the",
"conclusion",
"that",
"Drosophila",
"Hox",
"clusters",
"have",
"a",
"modular",
"organization",
"-LRB-",
"with",
"each",
"gene",
"and",
"its",
"regulatory",
"elements",
"representing",
"a",
"separate",
"module",
"-RRB-",
"and",
"that",
"Drosophila",
"Hox",
"genes",
"are",
"still",
"partially",
"clustered",
"simply",
"because",
"the",
"regulatory",
"regions",
"are",
"so",
"large",
"that",
"there",
"are",
"relatively",
"few",
"positions",
"where",
"breaks",
"can",
"occur",
"without",
"disturbing",
"a",
"module",
".",
"That",
"is",
",",
"most",
"of",
"the",
"remaining",
"linkage",
"in",
"Drosophila",
"Hox",
"clusters",
"-LRB-",
"with",
"the",
"possible",
"exception",
"of",
"abd-A",
"and",
"Abd-B",
"-RRB-",
"is",
"due",
"to",
"``",
"phylogenetic",
"inertia",
",",
"''",
"and",
",",
"given",
"enough",
"time",
",",
"the",
"clusters",
"will",
"completely",
"disperse",
"-LRB-",
"Negre",
"and",
"Ruiz",
"2007",
"-RRB-",
".",
"The",
"question",
"naturally",
"arises",
"whether",
"phylogenetic",
"inertia",
"could",
"also",
"be",
"the",
"reason",
"for",
"the",
"intact",
"Hox",
"clusters",
"of",
"insects",
"like",
"Tribolium",
".",
"Lewis",
"et",
"al.",
"-LRB-",
"2003",
"-RRB-",
"suggested",
"that",
"unusual",
"features",
"of",
"recombination",
"-LRB-",
"Ranz",
"et",
"al.",
"2001",
"-RRB-",
"may",
"make",
"drosophilids",
"more",
"tolerant",
"of",
"Hox",
"cluster",
"rearrangements",
"than",
"are",
"most",
"insects",
".",
"If",
"this",
"is",
"the",
"case",
",",
"intact",
"clusters",
"may",
"just",
"be",
"the",
"consequence",
"of",
"slower",
"rates",
"of",
"chromosomal",
"rearrangement",
"-LRB-",
"Negre",
"and",
"Ruiz",
"2007",
"-RRB-",
".",
"Alternatively",
",",
"constraints",
"on",
"Hox",
"cluster",
"maintenance",
"may",
"still",
"be",
"functional",
"in",
"Tribolium",
".",
"Our",
"analysis",
"of",
"mutant",
"breakpoints",
"in",
"the",
"ptl/Tc-Antp",
"region",
"indicates",
"that",
",",
"in",
"at",
"least",
"one",
"case",
",",
"Tribolium",
"Hox",
"genes",
"are",
"not",
"modular",
".",
"That",
"is",
",",
"at",
"least",
"some",
"of",
"the",
"regulatory",
"elements",
"controlling",
"Cx/Tc-Scr",
"expression",
"are",
"apparently",
"located",
"within",
"the",
"pt/Tc-Antp",
"gene",
"-LRB-",
"Fig.",
"5",
"-RRB-",
".",
"Most",
"embryonic",
"enhancers",
"of",
"Cx/Tc-Scr",
"are",
"predicted",
"to",
"lie",
"between",
"the",
"mxpDch-3",
"and",
"ptlD60",
"breakpoints",
"because",
"the",
"mxpDch-3",
"allele",
"appears",
"to",
"lack",
"all",
"Cx/Tc-Scr",
"function",
",",
"while",
"ptlD60",
"has",
"almost",
"normal",
"embryonic",
"Cx/Tc-Scr",
"function",
".",
"This",
"conclusion",
"is",
"further",
"supported",
"by",
"the",
"expression",
"of",
"mxp/Tc-pb",
"in",
"a",
"Cx/Tc-Scr-like",
"pattern",
"in",
"mxpDch-3",
"mutants",
",",
"presumably",
"due",
"to",
"juxtaposition",
"of",
"the",
"mxp/Tc-pb",
"transcription",
"unit",
"with",
"sequence",
"between",
"Tc-ftz",
"and",
"ptl/Tc-Antp",
".",
"Adult",
"Cx/Tc-Scr",
"regulatory",
"elements",
"are",
"likely",
"located",
"within",
",",
"or",
"5",
"′",
"of",
",",
"ptl/Tc-Antp",
"because",
"the",
"ptlD60",
"rearrangement",
"seems",
"to",
"have",
"a",
"stronger",
"effect",
"on",
"the",
"adult",
"functions",
"of",
"Cx/Tc-Scr",
".",
"The",
"presence",
"of",
"Cx/Tc-Scr",
"regulatory",
"elements",
"near",
",",
"or",
"within",
",",
"ptl/Tc-Antp",
"is",
"supported",
"by",
"the",
"observation",
"that",
"a",
"piggyBac",
"insertion",
"within",
"the",
"ptl/Tc-Antp",
"transcription",
"unit",
"-LRB-",
"ptlK76",
"-RRB-",
"shows",
"an",
"enhancer",
"trap",
"phenotype",
"that",
"appears",
"to",
"be",
"driven",
"by",
"Cx/Tc-Scr",
"regulatory",
"elements",
".",
"In",
"Drosophila",
",",
"elements",
"which",
"drive",
"Scr-like",
"expression",
"patterns",
"have",
"been",
"found",
"in",
"the",
"region",
"between",
"ftz",
"and",
"Antp",
"-LRB-",
"Gorman",
"and",
"Kaufman",
"1995",
"-RRB-",
".",
"However",
",",
"these",
"elements",
"are",
"apparently",
"redundant",
"because",
"breakpoints",
"in",
"this",
"region",
"only",
"slightly",
"reduce",
"Scr",
"expression",
"levels",
"within",
"its",
"normal",
"domain",
".",
"Moreover",
",",
"a",
"deficiency",
"which",
"removes",
"most",
",",
"if",
"not",
"all",
",",
"of",
"the",
"Antp",
"transcription",
"unit",
"has",
"no",
"effect",
"on",
"embryonic",
"Scr",
"expression",
".",
"Thus",
",",
"it",
"is",
"possible",
"that",
"the",
"modularity",
"of",
"the",
"Drosophila",
"Hox",
"cluster",
"is",
"a",
"recent",
"innovation",
"resulting",
"from",
"changes",
"in",
"the",
"position",
"of",
"cis-regulatory",
"elements",
".",
"This",
"newly",
"acquired",
"modularity",
"might",
"have",
"allowed",
"breaks",
"in",
"the",
"Hox",
"cluster",
"in",
"the",
"Drosophila",
"lineage",
".",
"In",
"contrast",
",",
"overlap",
"of",
"regulatory",
"elements",
"with",
"neighboring",
"genes",
"might",
"still",
"act",
"as",
"a",
"constraint",
"on",
"the",
"integrity",
"of",
"the",
"Hox",
"cluster",
"in",
"Tribolium",
".",
"Noncoding",
"transcripts",
"Although",
"noncoding",
"transcripts",
"within",
"Hox",
"clusters",
"have",
"been",
"recognized",
"for",
"many",
"years",
"-LRB-",
"Cumberledge",
"et",
"al.",
"1990",
";",
"Lipshitz",
"et",
"al.",
"1987",
";",
"Sanchez-Herrero",
"and",
"Akam",
"1989",
"-RRB-",
",",
"there",
"has",
"recently",
"been",
"renewed",
"interest",
"in",
"these",
"enigmatic",
"RNAs",
".",
"At",
"least",
"two",
"of",
"these",
"ncRNAs",
",",
"miR-196",
"and",
"miR-iab-4",
",",
"can",
"have",
"homeotic",
"function",
"and",
"attenuate",
"the",
"actions",
"of",
"protein-coding",
"Hox",
"genes",
"-LRB-",
"Hornstein",
"et",
"al.",
"2005",
";",
"Ronshaugen",
"et",
"al.",
"2005",
"-RRB-",
".",
"In",
"addition",
"to",
"the",
"miRNAs",
",",
"numerous",
"long",
"noncoding",
"RNAs",
"have",
"been",
"identified",
"within",
"the",
"Hox",
"clusters",
"of",
"both",
"flies",
"and",
"mammals",
"-LRB-",
"Bae",
"et",
"al.",
"2002",
";",
"Rinn",
"et",
"al.",
"2007",
"-RRB-",
".",
"ncRNAs",
"are",
"implicated",
"in",
"a",
"vast",
"array",
"of",
"processes",
",",
"including",
"regulation",
"of",
"transcription",
",",
"translation",
",",
"epigenetic",
"control",
"of",
"chromatin",
",",
"mono-allelic",
"expression",
",",
"dosage",
"compensation",
",",
"and",
"silencing",
"-LRB-",
"reviewed",
"in",
"Mattick",
"and",
"Makunin",
"2006",
"-RRB-",
".",
"In",
"the",
"Drosophila",
"BXC",
",",
"these",
"transcripts",
"have",
"been",
"implicated",
"in",
"the",
"control",
"of",
"Hox",
"gene",
"expression",
",",
"although",
"there",
"is",
"some",
"controversy",
"as",
"to",
"whether",
"they",
"promote",
"-LRB-",
"Sanchez-Elsner",
"et",
"al.",
"2006",
"-RRB-",
"or",
"repress",
"-LRB-",
"Petruk",
"et",
"al.",
"2006",
"-RRB-",
"Hox",
"gene",
"transcription",
".",
"Mainguy",
"et",
"al.",
"-LRB-",
"2007",
"-RRB-",
"found",
"evidence",
"for",
"extensive",
"noncoding",
"transcription",
"in",
"the",
"mammalian",
"Hox",
"clusters",
"and",
"proposed",
"that",
"polycistronic",
"and",
"antisense",
"transcription",
"might",
"play",
"a",
"role",
"in",
"keeping",
"Hox",
"genes",
"clustered",
".",
"Our",
"transcriptional",
"profiling",
"data",
"demonstrates",
"that",
"Tribolium",
"also",
"shows",
"considerable",
"noncoding",
"transcription",
"in",
"the",
"Hox",
"complex",
".",
"While",
"the",
"tiling",
"array",
"has",
"provided",
"a",
"revealing",
"snapshot",
"of",
"transcription",
"levels",
"during",
"embryonic",
"development",
",",
"much",
"additional",
"work",
"will",
"be",
"necessary",
"to",
"characterize",
"the",
"actual",
"transcripts",
".",
"For",
"example",
",",
"the",
"high",
"levels",
"of",
"transcription",
"in",
"the",
"ptl/Tc-Antp",
"and",
"Utx/Tc-Ubx",
"regions",
"could",
"be",
"the",
"result",
"of",
"several",
"individual",
"transcripts",
"or",
"one",
"long",
"transcript",
".",
"Interestingly",
",",
"dicistronic",
"transcripts",
"spanning",
"the",
"Antp",
"and",
"Ubx",
"orthologs",
"have",
"been",
"reported",
"in",
"crustaceans",
"-LRB-",
"Shiga",
"et",
"al.",
"2006",
"-RRB-",
"and",
"centipedes",
"-LRB-",
"Brena",
"et",
"al.",
"2006",
"-RRB-",
".",
"If",
"such",
"transcripts",
"have",
"an",
"important",
"function",
",",
"they",
"might",
"constrain",
"linkage",
"in",
"at",
"least",
"some",
"parts",
"of",
"the",
"Hox",
"cluster",
".",
"The",
"data",
"available",
"thus",
"far",
"indicate",
"that",
"noncoding",
"transcripts",
"are",
"prevalent",
"in",
"both",
"intact",
"and",
"broken",
"Hox",
"clusters",
".",
"However",
",",
"it",
"is",
"not",
"clear",
"whether",
"these",
"transcripts",
"perform",
"the",
"same",
"functions",
"in",
"all",
"organisms",
".",
"Perhaps",
",",
"noncoding",
"RNAs",
"play",
"a",
"different",
"or",
"more",
"critical",
"role",
"in",
"organisms",
"with",
"intact",
"clusters",
".",
"Future",
"studies",
"in",
"this",
"area",
"are",
"likely",
"to",
"provide",
"important",
"insights",
"into",
"Hox",
"gene",
"function",
"and",
"possibly",
"into",
"Hox",
"cluster",
"conservation",
".",
"Conclusions",
"The",
"results",
"presented",
"here",
"provide",
"a",
"foundation",
"for",
"further",
"studies",
"of",
"the",
"constraints",
"acting",
"on",
"Hox",
"clusters",
".",
"While",
"it",
"is",
"important",
"to",
"keep",
"in",
"mind",
"that",
"multiple",
"factors",
"may",
"have",
"contributed",
"to",
"the",
"maintenance",
"of",
"Hox",
"clusters",
"during",
"evolution",
"-LRB-",
"Kmita",
"and",
"Duboule",
",",
"2003",
"-RRB-",
",",
"the",
"intact",
"structure",
"of",
"the",
"Tribolium",
"Hox",
"cluster",
"and",
"the",
"suite",
"of",
"tools",
"now",
"available",
"for",
"this",
"insect",
"makes",
"it",
"an",
"ideal",
"candidate",
"for",
"such",
"research",
"."
] | [
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Biotechnol_Lett-3-1-1914260 | [
"Expression",
"of",
"alternansucrase",
"in",
"potato",
"plants",
"Alternan",
",",
"which",
"consists",
"of",
"alternating",
"α",
"-",
"-LRB-",
"1",
"→",
"3",
"-RRB-",
"/",
"α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"-",
"linked",
"glucosyl",
"residues",
",",
"was",
"produced",
"in",
"potato",
"tubers",
"by",
"expressing",
"a",
"mature",
"alternansucrase",
"-LRB-",
"Asr",
"-RRB-",
"gene",
"from",
"Leuconostoc",
"mesenteroides",
"NRRL",
"B-1355",
"in",
"potato",
".",
"Detection",
"of",
"alternan",
"was",
"performed",
"by",
"enzyme-linked",
"immunosorbent",
"assay",
"in",
"tuber",
"juices",
",",
"revealing",
"a",
"concentration",
"between",
"0.3",
"and",
"1.2",
"mg",
"g-1",
"fresh",
"wt",
".",
"The",
"Asr",
"transcript",
"levels",
"correlated",
"well",
"with",
"alternan",
"accumulation",
"in",
"tuber",
"juices",
".",
"It",
"appeared",
"that",
"the",
"expression",
"of",
"sucrose-regulated",
"starch-synthesizing",
"genes",
"-LRB-",
"ADP-glucose",
"pyrophosphorylase",
"subunit",
"S",
"and",
"granule-bound",
"starch",
"synthase",
"I",
"-RRB-",
"was",
"down-regulated",
".",
"Despite",
"this",
",",
"the",
"physico-chemical",
"properties",
"of",
"the",
"transgenic",
"starches",
"were",
"unaltered",
".",
"These",
"results",
"are",
"compared",
"to",
"those",
"obtained",
"with",
"other",
"transgenic",
"potato",
"plants",
"producing",
"mutan",
"-LSB-",
"α",
"-",
"-LRB-",
"1",
"→",
"3",
"-RRB-",
"-",
"linked",
"glucosyl",
"residues",
"-RSB-",
"and",
"dextran",
"-LSB-",
"α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"-",
"linked",
"glucosyl",
"residues",
"-RSB-",
".",
"Introduction",
"Production",
"of",
"novel",
"polymers",
"in",
"plants",
"by",
"genetic",
"modification",
"is",
"a",
"great",
"opportunity",
"to",
"obtain",
"plants",
"with",
"unique",
"properties",
"that",
"can",
"not",
"be",
"generated",
"by",
"conventional",
"breeding",
"-LRB-",
"Kok-Jacon",
"et",
"al.",
"2003",
"-RRB-",
".",
"In",
"addition",
",",
"modifications",
"of",
"native",
"polymers",
"in",
"planta",
"could",
"also",
"generate",
"crops",
"with",
"added",
"nutritional",
",",
"environmental",
"or",
"commercial",
"value",
".",
"For",
"instance",
",",
"production",
"of",
"biodegradable",
"plastics",
"in",
"crops",
"such",
"as",
"flax",
"offers",
"new",
"perspectives",
"for",
"the",
"replacement",
"of",
"oil-derived",
"plastics",
"-LRB-",
"Wróbel",
"et",
"al.",
"2004",
"-RRB-",
".",
"Another",
"example",
"is",
"the",
"production",
"of",
"a",
"freeze-thaw-stable",
"potato",
"starch",
"exhibiting",
"novel",
"physicochemical",
"properties",
",",
"thereby",
"increasing",
"the",
"number",
"of",
"industrial",
"applications",
"-LRB-",
"Jobling",
"et",
"al.",
"2002",
"-RRB-",
".",
"Alternan",
"is",
"a",
"unique",
"polymer",
"which",
"is",
"produced",
"by",
"three",
"Leuconostoc",
"mesenteroides",
"strains",
":",
"NRRL",
"B-1355",
",",
"NRRL",
"B-1498",
"and",
"NRRL",
"B-1501",
"-LRB-",
"Jeanes",
"et",
"al.",
"1954",
"-RRB-",
".",
"Alternan",
"synthesized",
"by",
"L.",
"mesenteroides",
"NRRL",
"B-1355",
"is",
"mediated",
"by",
"the",
"alternansucrase",
"ASR",
"-LRB-",
"EC",
"2.4.1.140",
"-RRB-",
"which",
"is",
"a",
"large",
"glucansucrase",
"of",
"2,057",
"amino-acids",
"-LRB-",
"Argüello-Morales",
"et",
"al.",
"2000",
"-RRB-",
".",
"Its",
"C-terminal",
"domain",
"-LRB-",
"also",
"referred",
"to",
"as",
"glucan-binding",
"domain",
"or",
"GBD",
"-RRB-",
"exhibits",
"short",
"repeats",
"specific",
"for",
"ASR",
",",
"which",
"could",
"contribute",
"to",
"its",
"distinct",
"features",
"-LRB-",
"Janeček",
"et",
"al.",
"2000",
"-RRB-",
".",
"The",
"resulting",
"polymer",
"has",
"a",
"unique",
"structure",
"with",
"alternating",
"α",
"-",
"-LRB-",
"1",
"→",
"3",
"-RRB-",
"/",
"α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"-",
"linked",
"glucose",
"residues",
",",
"present",
"for",
"46",
"%",
"and",
"54",
"%",
",",
"respectively",
".",
"Due",
"to",
"this",
"structure",
",",
"alternan",
"is",
"a",
"highly",
"soluble",
"and",
"low",
"viscous",
"polymer",
",",
"which",
"is",
"resistant",
"to",
"microbial",
"and",
"mammalian",
"enzymes",
"making",
"it",
"suitable",
"for",
"the",
"production",
"of",
"ingredients",
"for",
"functional",
"foods",
"such",
"as",
"prebiotics",
"-LRB-",
"Côté",
"1992",
"-RRB-",
".",
"Also",
",",
"novel",
"industrial",
"applications",
"were",
"investigated",
"by",
"hydrolyzing",
"native",
"alternan",
"polymers",
"with",
"isolates",
"of",
"Penicillium",
"bacterial",
"strains",
",",
"creating",
"potential",
"replacers",
"of",
"commercial",
"gum",
"arabic",
"-LRB-",
"Leathers",
"et",
"al.",
"2002",
";",
"2003",
"-RRB-",
".",
"Furthermore",
",",
"ASR",
"is",
"an",
"attractive",
"enzyme",
"because",
"of",
"its",
"efficiency",
"in",
"bond",
"formation",
",",
"which",
"is",
"higher",
"than",
"that",
"of",
"the",
"dextransucrase",
"-LRB-",
"DSRS",
"-RRB-",
"-LRB-",
"Richard",
"et",
"al.",
"2003",
"-RRB-",
".",
"In",
"addition",
",",
"mutated",
"ASR",
"enzymes",
"showed",
"a",
"high",
"efficiency",
"in",
"glucosylating",
"acceptor",
"molecules",
"-LRB-",
"cellobiose",
",",
"α-alkylglucosides",
"-RRB-",
"in",
"comparison",
"to",
"native",
"ASR",
"and",
"DSRS",
"enzymes",
",",
"which",
"might",
"enable",
"novel",
"industrial",
"applications",
"-LRB-",
"Argüello-Morales",
"et",
"al.",
"2001",
";",
"Richard",
"et",
"al.",
"2003",
";",
"Luz",
"Sanz",
"et",
"al.",
"2006",
"-RRB-",
".",
"In",
"this",
"work",
",",
"we",
"describe",
"the",
"production",
"of",
"alternan",
"in",
"potato",
"tubers",
"by",
"expressing",
"ASR",
".",
"Modification",
"of",
"starch",
"structure",
"was",
"envisaged",
"with",
"ASR",
",",
"because",
"of",
"its",
"high",
"acceptor",
"reaction",
"efficiency",
".",
"The",
"effect",
"of",
"ASR",
"on",
"starch",
"biosynthesis",
"was",
"studied",
"at",
"the",
"microscopical",
",",
"molecular",
"and",
"biochemical",
"level",
",",
"and",
"compared",
"to",
"the",
"effects",
"of",
"the",
"dextransucrase",
"-LRB-",
"DSRS",
"-RRB-",
"and",
"mutansucrase",
"-LRB-",
"GTFI",
"-RRB-",
",",
"producing",
"less",
"soluble",
"polymers",
",",
"such",
"as",
"dextran",
"and",
"mutan",
"that",
"are",
"mainly",
"composed",
"of",
"α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"and",
"α",
"-",
"-LRB-",
"1",
"→",
"3",
"-RRB-",
"-",
"linked",
"glucose",
"residues",
",",
"respectively",
"-LRB-",
"Kok-Jacon",
"et",
"al.",
"2005a",
",",
"b",
"-RRB-",
".",
"Materials",
"and",
"methods",
"Construction",
"of",
"binary",
"plant",
"expression",
"vector",
"containing",
"the",
"Asr",
"gene",
"An",
"expression",
"cassette",
"containing",
"the",
"patatin",
"promoter",
"-LRB-",
"Wenzler",
"et",
"al.",
"1989",
"-RRB-",
",",
"the",
"chloroplastic",
"ferredoxin",
"signal",
"peptide",
"-LRB-",
"FD",
"-RRB-",
"from",
"Silene",
"pratensis",
"-LRB-",
"Pilon",
"et",
"al.",
"1995",
"-RRB-",
"fused",
"to",
"the",
"NOS",
"terminator",
"was",
"cloned",
"into",
"the",
"pBluescript",
"SK",
"-LRB-",
"pBS",
"SK",
"-RRB-",
"plasmid",
",",
"resulting",
"in",
"pPF",
"that",
"was",
"used",
"as",
"starting",
"material",
"for",
"cloning",
"the",
"alternansucrase",
"-LRB-",
"Asr",
"-RRB-",
"gene",
".",
"A",
"mature",
"Asr",
"gene",
"from",
"L.",
"mesenteroides",
"NRRL",
"B-1355",
"-LRB-",
"Argüello-Morales",
"et",
"al.",
"2000",
";",
"AJ250173",
"-RRB-",
"was",
"ligated",
"in",
"frame",
"between",
"the",
"signal",
"peptide",
"FD",
"and",
"the",
"NOS",
"terminator",
".",
"The",
"mature",
"Asr",
"gene",
"was",
"amplified",
"by",
"PCR",
",",
"with",
"a",
"forward",
"primer",
"containing",
"a",
"SmaI",
"restriction",
"site",
"-LRB-",
"5",
"′",
"-",
"CATCAGGGCCCCGGGGATACAAAT-3",
"′",
"-RRB-",
"and",
"a",
"reverse",
"primer",
"containing",
"a",
"NruI",
"restriction",
"site",
"-LRB-",
"5",
"′",
"-",
"CTCCTTTCGCGAATCCTTCCCTTA-3",
"′",
"-RRB-",
"using",
"the",
"proofreading",
"Pfu",
"turbo",
"DNA",
"polymerase",
"-LRB-",
"2.5",
"units/μl",
";",
"Stratagene",
",",
"UK",
"-RRB-",
"and",
"cloned",
"into",
"the",
"SmaI/NruI",
"restriction",
"sites",
"of",
"pPF",
",",
"resulting",
"in",
"pPFAsr",
".",
"FD",
"and",
"the",
"fused",
"Asr",
"gene",
"were",
"completely",
"sequenced",
"in",
"one",
"direction",
"by",
"Baseclear",
"-LRB-",
"The",
"Netherlands",
"-RRB-",
"to",
"verify",
"the",
"correctness",
"of",
"the",
"construct",
".",
"pPFAsr",
"was",
"digested",
"with",
"SacI",
"and",
"SalI",
"and",
"subsequently",
"ligated",
"into",
"a",
"pBIN20",
"binary",
"vector",
"-LRB-",
"Hennegan",
"and",
"Danna",
"1998",
"-RRB-",
",",
"resulting",
"in",
"pPFA",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"Fig.",
"1Schematic",
"representation",
"of",
"pPFA",
"binary",
"vector",
"used",
"for",
"potato",
"plant",
"transformation",
"Transformation",
"and",
"regeneration",
"of",
"potato",
"plants",
"pPFA",
"was",
"transformed",
"into",
"Agrobacterium",
"tumefaciens",
"strain",
"LBA",
"4404",
"using",
"electroporation",
"-LRB-",
"Takken",
"et",
"al.",
"2000",
"-RRB-",
".",
"Internodal",
"stem",
"segments",
"from",
"the",
"tetraploid",
"potato",
"genotype",
"-LRB-",
"cv",
".",
"Kardal",
"-LRB-",
"KD",
"-RRB-",
"-RRB-",
"were",
"used",
"for",
"Agrobacterium-mediated",
"transformation",
",",
"which",
"was",
"performed",
"as",
"described",
"by",
"Kok-Jacon",
"et",
"al.",
"-LRB-",
"2005a",
"-RRB-",
".",
"Starch",
"isolation",
"Potato",
"tubers",
"were",
"peeled",
"and",
"homogenized",
"in",
"a",
"Sanamat",
"Rotor",
"-LRB-",
"Spangenberg",
",",
"The",
"Netherlands",
"-RRB-",
".",
"The",
"resulting",
"homogenate",
"was",
"allowed",
"to",
"settle",
"overnight",
"at",
"4",
"°C",
"and",
"the",
"potato",
"juice",
"was",
"decanted",
"and",
"stored",
"at",
"−",
"20",
"°C",
"for",
"characterization",
"of",
"soluble",
"alternan",
".",
"The",
"starch",
"pellet",
"was",
"washed",
"three",
"times",
"with",
"water",
",",
"air-dried",
"at",
"room",
"temperature",
"for",
"at",
"least",
"three",
"days",
"and",
"stored",
"at",
"room",
"temperature",
".",
"Immunological",
"detection",
"of",
"alternans",
"in",
"tuber",
"juices",
"and",
"gelatinized",
"starches",
"Presence",
"of",
"alternans",
"was",
"investigated",
"with",
"enzyme-linked",
"immunosorbent",
"assay",
"-LRB-",
"ELISA",
"-RRB-",
"as",
"described",
"by",
"Kok-Jacon",
"et",
"al.",
"-LRB-",
"2005a",
"-RRB-",
",",
"using",
"monoclonal",
"anti-α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"dextran",
"antibodies",
"-LRB-",
"45.21.1",
"-LRB-",
"groove-type",
";",
"IgA/Kappa",
"-RRB-",
"and",
"16.4.12",
"EBI",
"-LRB-",
"cavity-type",
";",
"IgA/Kappa",
"-RRB-",
"-RRB-",
"-LRB-",
"Wang",
"et",
"al.",
"2002",
"-RRB-",
"with",
"tuber",
"juices",
"and",
"gelatinized",
"starches",
".",
"The",
"monoclonal",
"anti-α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"dextran",
"antibodies",
"detect",
"structures",
"containing",
"both",
"internal",
"and",
"terminal",
"epitopes",
"of",
"α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"dextran",
"which",
"can",
"be",
"applicable",
"for",
"the",
"detection",
"of",
"α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"linked",
"glucose",
"residues",
"present",
"in",
"alternan",
"-LRB-",
"Sharon",
"et",
"al.",
"1982",
";",
"Dr",
"Denong",
"Wang",
",",
"personal",
"communication",
"-RRB-",
".",
"Expression",
"analysis",
"of",
"Asr",
"and",
"genes",
"involved",
"in",
"starch",
"biosynthesis",
"using",
"semi-quantitative",
"and",
"real-time",
"quantitative",
"RT-PCR",
"analysis",
"RNA",
"was",
"isolated",
"from",
"3",
"g",
"-LRB-",
"fresh",
"weight",
"-RRB-",
"of",
"potato",
"tuber",
"material",
"from",
"selected",
"transgenic",
"lines",
"according",
"to",
"Kuipers",
"et",
"al.",
"-LRB-",
"1994",
"-RRB-",
".",
"Semi-quantitative",
"and",
"real-time",
"quantitative",
"RT-PCR",
"'s",
"were",
"performed",
"as",
"described",
"by",
"Kok-Jacon",
"et",
"al.",
"-LRB-",
"2005a",
"-RRB-",
".",
"AsrRT",
"primers",
",",
"5",
"′",
"-",
"ACCGGTTCCATCAACTAATAAT-3",
"′",
"and",
"5",
"′",
"-",
"GACATCTCGGAAGGATCCC-3",
"′",
"-LRB-",
"Tm",
"=",
"55",
"°C",
",",
"35",
"cycles",
"-RRB-",
"were",
"based",
"on",
"the",
"Asr",
"gene",
"sequence",
"-LRB-",
"Argüello-Morales",
"et",
"al.",
"2000",
"-RRB-",
".",
"RNA",
"sample",
"from",
"Karnico",
"potato",
"tubers",
"expressing",
"a",
"sense/antisense",
"GBSSI",
"cDNA",
"inverted-repeat",
"construct",
"referred",
"to",
"as",
"RVT34-77",
"-LRB-",
"Heilersig",
"2005",
"-RRB-",
"was",
"used",
"as",
"a",
"positive",
"control",
",",
"because",
"its",
"GBSSI",
"expression",
"level",
"was",
"completely",
"down-regulated",
".",
"Determination",
"of",
"morphological",
"and",
"physicochemical",
"starch",
"properties",
"Analysis",
"of",
"starch",
"granule",
"morphology",
"was",
"performed",
"by",
"light",
"microscopy",
"and",
"scanning",
"electron",
"microscopy",
"-LRB-",
"SEM",
"-RRB-",
"as",
"described",
"by",
"Kok-Jacon",
"et",
"al.",
"-LRB-",
"2005a",
"-RRB-",
".",
"Median",
"values",
"of",
"the",
"granule",
"size",
"distribution",
"-LRB-",
"d50",
"-RRB-",
",",
"gelatinization",
"analysis",
",",
"amylose",
"content",
",",
"starch",
"content",
",",
"chain",
"length",
"distributions",
"-LRB-",
"HPSEC",
",",
"HPAEC",
"-RRB-",
"were",
"determined",
"as",
"described",
"by",
"Kok-Jacon",
"et",
"al.",
"-LRB-",
"2005a",
"-RRB-",
".",
"Results",
"Detection",
"of",
"alternan",
"in",
"transgenic",
"potato",
"juices",
"To",
"enable",
"plastidic",
"protein",
"targeting",
",",
"the",
"mature",
"Asr",
"gene",
"was",
"fused",
"to",
"the",
"ferredoxin",
"-LRB-",
"FD",
"-RRB-",
"signal",
"peptide",
"-LRB-",
"Gerrits",
"et",
"al.",
"2001",
"-RRB-",
".",
"The",
"resulting",
"gene",
"fusion",
"was",
"inserted",
"between",
"the",
"patatin",
"promoter",
"-LRB-",
"Fig.",
"1",
"-RRB-",
"allowing",
"high-tuber",
"expression",
"-LRB-",
"Wenzler",
"et",
"al.",
"1989",
"-RRB-",
"and",
"the",
"Nos",
"terminator",
"sequence",
".",
"At",
"the",
"FD",
"▲",
"Asr",
"fusion",
",",
"two",
"mutations",
"were",
"present",
"because",
"a",
"SmaI",
"restriction",
"site",
"was",
"engineered",
"at",
"this",
"position",
"-LRB-",
"VTAM",
"↓",
"ATYKVTLITK",
"▲",
"ADT",
"became",
"VTAM",
"↓",
"ATYKVTLITP",
"▲",
"GDT",
",",
"in",
"which",
"↓",
"represents",
"the",
"splice",
"site",
"for",
"amyloplast",
"entry",
"and",
"▲",
"the",
"gene",
"fusion",
"-RRB-",
".",
"Furthermore",
",",
"differences",
"from",
"the",
"published",
"ASR",
"sequence",
"-LRB-",
"Argüello-Morales",
"et",
"al.",
"2000",
"-RRB-",
"were",
"found",
"at",
"three",
"positions",
"-LRB-",
"Y208H",
",",
"D221G",
"and",
"G1092S",
"-RRB-",
",",
"but",
"these",
"did",
"not",
"affect",
"conserved",
"residues",
".",
"After",
"Agrobacterium-mediated",
"plant",
"transformation",
",",
"thirty",
"independent",
"transgenic",
"potato",
"clones",
"were",
"obtained",
"using",
"the",
"Kardal",
"-LRB-",
"KD",
"-RRB-",
"genotype",
".",
"Five",
"plants",
"of",
"each",
"transgenic",
"clone",
"were",
"grown",
"in",
"the",
"greenhouse",
"from",
"which",
"the",
"tubers",
"were",
"pooled",
"for",
"further",
"characterization",
".",
"KDAxx",
"referred",
"to",
"the",
"transformed",
"potato",
"plant",
"serie",
"in",
"which",
"A",
"represents",
"the",
"Asr",
"gene",
"and",
"xx",
"the",
"clone",
"number",
".",
"The",
"untransformed",
"genotype",
"is",
"referred",
"to",
"as",
"KD-UT",
".",
"Detection",
"of",
"alternan",
"was",
"performed",
"by",
"analyzing",
"tuber",
"juices",
"of",
"the",
"transformants",
"with",
"ELISA",
"using",
"anti-dextran",
"antibodies",
"-LRB-",
"Wang",
"et",
"al.",
"2002",
"-RRB-",
".",
"Alternan",
"was",
"detected",
"in",
"4",
"out",
"of",
"29",
"tubers",
"-LRB-",
"about",
"14",
"%",
"-RRB-",
"in",
"a",
"concentration",
"ranging",
"from",
"0.3",
"to",
"1.2",
"mg",
"g",
"−",
"1",
"fresh",
"wt",
"-LRB-",
"Fig.",
"2",
"-RRB-",
"in",
"the",
"transformants",
"KDA16",
",",
"KDA19",
",",
"KDA27",
"and",
"KDA13",
".",
"As",
"expected",
",",
"no",
"alternan",
"was",
"found",
"in",
"KD-UT",
"plants",
".",
"According",
"to",
"the",
"tuber",
"juice",
"results",
",",
"the",
"KDA",
"transformants",
"were",
"divided",
"in",
"three",
"classes",
":",
"-LRB-",
"−",
"-RRB-",
",",
"-LRB-",
"+",
"-RRB-",
"and",
"-LRB-",
"+",
"+",
"-RRB-",
",",
"representing",
"no",
",",
"intermediate",
"-LRB-",
"≤",
"1",
"mg",
"g",
"−",
"1",
"FW",
"-RRB-",
"and",
"high",
"-LRB-",
">",
"1",
"mg",
"g",
"−",
"1",
"FW",
"-RRB-",
"levels",
"of",
"alternan",
",",
"respectively",
".",
"All",
"the",
"transformants",
"containing",
"alternan",
"and",
"two",
"from",
"the",
"-LRB-",
"−",
"-RRB-",
"class",
"were",
"selected",
"for",
"further",
"characterization",
":",
"KDA13",
"-LRB-",
"+",
"+",
"-RRB-",
",",
"KDA16",
"-LRB-",
"+",
"-RRB-",
",",
"KDA19",
"-LRB-",
"+",
"-RRB-",
",",
"KDA27",
"-LRB-",
"+",
"-RRB-",
",",
"KDA1",
"-LRB-",
"−",
"-RRB-",
"and",
"KDA24",
"-LRB-",
"−",
"-RRB-",
".",
"RNA",
"was",
"isolated",
"from",
"potato",
"tubers",
"and",
"subjected",
"to",
"RT-PCR",
"analysis",
".",
"The",
"expression",
"levels",
"were",
"determined",
"for",
"the",
"Asr",
"and",
"Ubi3",
"genes",
",",
"of",
"which",
"the",
"latter",
"is",
"used",
"as",
"a",
"control",
"because",
"of",
"its",
"constitutive",
"expression",
"-LRB-",
"Garbarino",
"and",
"Belknap",
"1994",
"-RRB-",
"-LRB-",
"Fig.",
"3",
"-RRB-",
".",
"Heterologous",
"Asr",
"gene",
"expression",
"was",
"detected",
"in",
"the",
"expressers",
"KDA13",
",",
"KDA16",
",",
"KDA19",
",",
"KDA27",
".",
"No",
"Asr",
"mRNA",
"was",
"detected",
"in",
"the",
"-LRB-",
"−",
"-RRB-",
"class",
"transformants",
"and",
"in",
"the",
"KD-UT",
"plants",
".",
"The",
"Asr",
"expression",
"levels",
"correlated",
"well",
"with",
"the",
"ELISA",
"results",
"described",
"above",
".",
"Fig.",
"2Detection",
"of",
"alternans",
"accumulated",
"in",
"potato",
"juices",
"by",
"ELISA",
"using",
"anti-dextrans",
"antibodies",
".",
"Based",
"on",
"the",
"alternan",
"concentration",
"-LSB-",
"in",
"mg",
"g",
"−",
"1",
"fresh",
"wt",
"-LRB-",
"FW",
"-RRB-",
"-RSB-",
",",
"three",
"categories",
"of",
"transformants",
"were",
"made",
",",
"where",
"-LRB-",
"−",
"-RRB-",
",",
"-LRB-",
"+",
"-RRB-",
"and",
"-LRB-",
"+",
"+",
"-RRB-",
"represent",
"no",
",",
"intermediate",
"and",
"high",
"alternan",
"accumulation",
",",
"respectively",
".",
"Transgenic",
"clones",
"indicated",
"with",
"grey",
"bars",
"were",
"selected",
"for",
"further",
"characterizationFig",
".",
"3RT-PCR",
"analysis",
"of",
"the",
"selected",
"KDA",
"transformants",
"and",
"KD-UT",
"tuber",
"RNA",
".",
"The",
"upper",
"panel",
"shows",
"the",
"PCR",
"products",
"using",
"the",
"primers",
"designed",
"on",
"the",
"Asr",
"sequence",
".",
"The",
"lower",
"panel",
"shows",
"the",
"PCR",
"products",
"using",
"the",
"primers",
"designed",
"on",
"the",
"Ubi3",
"sequence",
"that",
"served",
"as",
"an",
"internal",
"control",
".",
"pPFAsr",
"plasmid",
":",
"positive",
"control",
"Alternan",
"accumulation",
"does",
"not",
"interfere",
"with",
"plant",
",",
"tuber",
"and",
"starch",
"morphologies",
"Asr",
"expressing",
"plants",
"-LRB-",
"green",
"parts",
"and",
"tubers",
"-RRB-",
"did",
"not",
"exhibit",
"any",
"morphological",
"changes",
"in",
"comparison",
"to",
"KD-UT",
"plants",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"In",
"addition",
",",
"starch",
"morphology",
"of",
"Asr",
"expressing",
"plants",
"was",
"quite",
"similar",
"to",
"that",
"of",
"KD-UT",
".",
"With",
"SEM",
",",
"a",
"rough",
"surface",
"was",
"present",
"on",
"some",
"of",
"the",
"-LRB-",
"+",
"+",
"-RRB-",
"class",
"transformant",
"granules",
"-LRB-",
"Fig.",
"4B",
",",
"F",
"-RRB-",
",",
"but",
"was",
"considered",
"as",
"not",
"significant",
"when",
"compared",
"to",
"dextran",
"-",
"-LRB-",
"Fig.",
"4C",
",",
"G",
"-RRB-",
"and",
"mutan",
"-",
"-LRB-",
"Fig.",
"4D",
",",
"H",
"-RRB-",
"accumulating",
"plants",
".",
"In",
"general",
",",
"starch",
"granules",
"from",
"the",
"-LRB-",
"+",
"-RRB-",
"and",
"-LRB-",
"−",
"-RRB-",
"class",
"transformants",
"were",
"similar",
"to",
"those",
"of",
"the",
"KD-UT",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Starch",
"granules",
"comparable",
"to",
"those",
"illustrated",
"in",
"Fig.",
"4",
"-LRB-",
"F",
"-RRB-",
"were",
"scored",
"by",
"analyzing",
"a",
"population",
"of",
"100",
"granules",
"in",
"triplicate",
"for",
"each",
"selected",
"transformant",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"KDA13",
",",
"belonging",
"to",
"the",
"-LRB-",
"+",
"+",
"-RRB-",
"class",
"transformant",
",",
"exhibited",
"-LRB-",
"12",
"%",
"±",
"1.0",
"-RRB-",
"of",
"altered",
"starch",
"granules",
",",
"followed",
"by",
"the",
"-LRB-",
"+",
"-RRB-",
"class",
"transformant",
"-LSB-",
"KDA19",
"-LRB-",
"9.3",
"%",
"±",
"0.6",
"-RRB-",
";",
"KDA27",
"-LRB-",
"8.3",
"%",
"±",
"0.6",
"-RRB-",
"-RSB-",
".",
"For",
"the",
"-LRB-",
"−",
"-RRB-",
"class",
"transformant",
"and",
"KD-UT",
",",
"the",
"frequency",
"of",
"altered",
"granules",
"was",
"lower",
",",
"which",
"was",
"around",
"the",
"7",
"%",
".",
"Fig.",
"4SEM",
"analysis",
"of",
"starch",
"granules",
"-LRB-",
"×",
"350",
":",
"upper",
"panel",
"-RRB-",
"and",
"-LRB-",
"×",
"1,000",
":",
"lower",
"panel",
"-RRB-",
"from",
"KD-UT",
"-LRB-",
"A",
",",
"E",
"-RRB-",
"compared",
"to",
"that",
"of",
"selected",
"transformants",
"producing",
"foreign",
"polymers",
"with",
"decreasing",
"water-solubility",
"-LRB-",
"KDA13",
"that",
"produces",
"alternan",
"-LRB-",
"B",
"and",
"F",
";",
"+",
"+",
":",
"highly",
"soluble",
"-LRB-",
"S",
"-RRB-",
"-RRB-",
",",
"KDD30",
"that",
"produces",
"dextran",
"-LRB-",
"C",
"and",
"G",
";",
"+",
":",
"soluble",
"-LRB-",
"L",
"-RRB-",
"-RRB-",
"and",
"KDIC15",
"that",
"produces",
"mutan",
"-LRB-",
"D",
"and",
"H",
";",
"−",
":",
"insoluble",
"-LRB-",
"I",
"-RRB-",
"-RRB-",
".",
"Degrees",
"of",
"polymer",
"solubility",
"were",
"defined",
"according",
"to",
"Robyt",
"-LRB-",
"1996",
"-RRB-",
"in",
"which",
"class",
"S",
"=",
"more",
"soluble",
"referring",
"to",
"glucans",
"precipitated",
"by",
"40",
"--",
"44",
"%",
"-LRB-",
"v/v",
"-RRB-",
"ethanol",
",",
"L",
"=",
"less",
"soluble",
"referring",
"to",
"glucans",
"precipitated",
"by",
"34",
"--",
"37",
"%",
"ethanol",
"and",
"I",
"=",
"water-insoluble",
"The",
"physicochemical",
"properties",
"and",
"starch",
"content",
"of",
"KDA",
"transformants",
"remain",
"unchanged",
"Median",
"granule",
"size",
"-LRB-",
"d50",
"-RRB-",
",",
"gelatinization",
"characteristics",
"-LRB-",
"T0",
"and",
"ΔH",
"-RRB-",
",",
"amylose",
"and",
"starch",
"content",
"measurements",
"were",
"performed",
"on",
"selected",
"transformants",
"-LRB-",
"Table",
"1",
"-RRB-",
".",
"From",
"these",
"results",
",",
"it",
"can",
"be",
"seen",
"that",
"no",
"consistent",
"changes",
"were",
"detected",
"for",
"the",
"different",
"classes",
"of",
"transformants",
".",
"Furthermore",
",",
"chain",
"length",
"distribution",
"experiments",
"-LRB-",
"HPSEC",
"and",
"HPAEC",
"-RRB-",
"were",
"also",
"done",
",",
"particularly",
"because",
"ASR",
"exhibits",
"a",
"high",
"acceptor",
"reaction",
"efficiency",
".",
"After",
"complete",
"debranching",
"of",
"starch",
"with",
"isoamylase",
",",
"no",
"consistent",
"changes",
"were",
"found",
"with",
"HPSEC",
"and",
"HPAEC",
"in",
"comparison",
"to",
"KD-UT",
"starches",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"In",
"addition",
",",
"debranched",
"starches",
",",
"which",
"were",
"further",
"treated",
"with",
"α-amylase",
",",
"were",
"analyzed",
"with",
"HPAEC",
"in",
"order",
"to",
"detect",
"the",
"presence",
"of",
"novel",
"structural",
"elements",
"on",
"starch",
"molecules",
"such",
"as",
"alternating",
"α",
"-",
"-LRB-",
"1",
"→",
"3",
"-RRB-",
"/",
"α",
"-",
"-LRB-",
"1",
"→",
"6",
"-RRB-",
"linkages",
".",
"Again",
",",
"no",
"consistent",
"changes",
"were",
"detected",
"with",
"HPAEC",
"in",
"comparison",
"to",
"KD-UT",
"starches",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Table",
"1Summary",
"of",
"granule",
"size",
"-LRB-",
"d50",
"-RRB-",
",",
"gelatinization",
"characteristics",
"-LRB-",
"To",
",",
"ΔH",
"-RRB-",
",",
"amylose",
"and",
"starch",
"content",
"measurements",
"of",
"starches",
"from",
"the",
"selected",
"transformants",
"and",
"KD-UT",
".",
"Data",
"-LRB-",
"±",
"SD",
"-RRB-",
"are",
"the",
"average",
"of",
"two",
"or",
"three",
"independent",
"measurementsTransformantsd50",
"-LRB-",
"μm",
"-RRB-",
"*",
"T0",
"-LRB-",
"°C",
"-RRB-",
"†",
"ΔH",
"-LRB-",
"kJ/g",
"-RRB-",
"‡",
"Amylose",
"content",
"-LRB-",
"%",
"-RRB-",
"Starch",
"content",
"-LRB-",
"mg/g",
"FW",
"-RRB-",
"KD-UT26.5",
"-LRB-",
"±",
"0.3",
"-RRB-",
"67.9",
"-LRB-",
"±",
"0.1",
"-RRB-",
"14.5",
"-LRB-",
"±",
"0.1",
"-RRB-",
"22.3",
"-LRB-",
"±",
"0.2",
"-RRB-",
"214.8",
"-LRB-",
"±",
"117.5",
"-RRB-",
"KDA1",
"-LRB-",
"−",
"-RRB-",
"24.4",
"-LRB-",
"±",
"0.2",
"-RRB-",
"68.1",
"-LRB-",
"±",
"0.1",
"-RRB-",
"17.0",
"-LRB-",
"±",
"0.1",
"-RRB-",
"22.2",
"-LRB-",
"±",
"0.2",
"-RRB-",
"103.4",
"-LRB-",
"±",
"66.3",
"-RRB-",
"KDA24",
"-LRB-",
"−",
"-RRB-",
"25.0",
"-LRB-",
"±",
"0.2",
"-RRB-",
"68.0",
"-LRB-",
"±",
"0.1",
"-RRB-",
"16.3",
"-LRB-",
"±",
"1.2",
"-RRB-",
"21.3",
"-LRB-",
"±",
"0.4",
"-RRB-",
"86.7",
"-LRB-",
"±",
"41.9",
"-RRB-",
"KDA16",
"-LRB-",
"+",
"-RRB-",
"24.9",
"-LRB-",
"±",
"0.3",
"-RRB-",
"67.9",
"-LRB-",
"±",
"0.2",
"-RRB-",
"16.4",
"-LRB-",
"±",
"1.3",
"-RRB-",
"22.2",
"-LRB-",
"±",
"0.1",
"-RRB-",
"140.0",
"-LRB-",
"±",
"88.2",
"-RRB-",
"KDA19",
"-LRB-",
"+",
"-RRB-",
"27.9",
"-LRB-",
"±",
"0.2",
"-RRB-",
"67.7",
"-LRB-",
"±",
"0.0",
"-RRB-",
"15.2",
"-LRB-",
"±",
"0.1",
"-RRB-",
"23.0",
"-LRB-",
"±",
"0.2",
"-RRB-",
"137.1",
"-LRB-",
"±",
"38.2",
"-RRB-",
"KDA27",
"-LRB-",
"+",
"-RRB-",
"22.8",
"-LRB-",
"±",
"0.7",
"-RRB-",
"67.7",
"-LRB-",
"±",
"0.2",
"-RRB-",
"16.2",
"-LRB-",
"±",
"0.5",
"-RRB-",
"22.2",
"-LRB-",
"±",
"0.4",
"-RRB-",
"289.3",
"-LRB-",
"±",
"39.7",
"-RRB-",
"KDA13",
"-LRB-",
"+",
"+",
"-RRB-",
"24.0",
"-LRB-",
"±",
"0.1",
"-RRB-",
"67.8",
"-LRB-",
"±",
"0.1",
"-RRB-",
"16.0",
"-LRB-",
"±",
"0.7",
"-RRB-",
"22.2",
"-LRB-",
"±",
"0.5",
"-RRB-",
"107.2",
"-LRB-",
"±",
"49.4",
"-RRB-",
"*",
"Median",
"value",
"of",
"the",
"granule",
"size",
"distribution",
"†",
"Temperature",
"of",
"onset",
"of",
"starch",
"gelatinization",
"‡",
"Enthalpy",
"released",
"Expression",
"levels",
"of",
"AGPase",
"and",
"GBSSI",
"genes",
"are",
"down-regulated",
"in",
"the",
"-LRB-",
"+",
"-RRB-",
"and",
"-LRB-",
"+",
"+",
"-RRB-",
"KDA",
"class",
"The",
"expression",
"levels",
"of",
"key",
"genes",
"involved",
"in",
"starch",
"biosynthesis",
"such",
"as",
"sucrose",
"synthase",
"-LRB-",
"SuSy",
"-RRB-",
",",
"ADP-glucose",
"pyrophosphorylase",
"subunit",
"S",
"-LRB-",
"AGPase",
"-RRB-",
",",
"starch",
"synthase",
"III",
"-LRB-",
"SSIII",
"-RRB-",
",",
"starch",
"branching",
"enzyme",
"I",
"-LRB-",
"SBEI",
"-RRB-",
"and",
"granule-bound",
"starch",
"synthase",
"I",
"-LRB-",
"GBSSI",
"-RRB-",
"were",
"monitored",
"by",
"real-time",
"quantitative",
"RT-PCR",
"-LRB-",
"Fig.",
"5",
"-RRB-",
".",
"All",
"these",
"genes",
"seemed",
"to",
"be",
"down-regulated",
",",
"particularly",
"the",
"AGPase",
"and",
"GBSSI",
"genes",
".",
"In",
"most",
"cases",
",",
"the",
"extent",
"of",
"AGPase",
"and",
"GBSSI",
"down-regulation",
"corresponded",
"well",
"with",
"the",
"amount",
"of",
"alternan",
"that",
"was",
"accumulated",
"in",
"the",
"potato",
"tubers",
".",
"However",
",",
"AGPase",
"down-regulation",
"did",
"not",
"correlate",
"with",
"a",
"reduction",
"in",
"starch",
"content",
"for",
"the",
"-LRB-",
"+",
"+",
"-RRB-",
"transformants",
"-LRB-",
"107.2",
"±",
"49.4",
"mg",
"g",
"−",
"1",
"FW",
"-RRB-",
"when",
"compared",
"to",
"KD-UT",
"-LRB-",
"214.8",
"±",
"117.5",
"mg",
"g",
"−",
"1",
"FW",
"-RRB-",
".",
"Concerning",
"GBSSI",
",",
"the",
"down-regulation",
"was",
"about",
"20",
"times",
"less",
"than",
"for",
"the",
"transformant",
"RVT34-77",
"in",
"which",
"GBSSI",
"is",
"completely",
"inhibited",
".",
"Typically",
",",
"no",
"reduction",
"in",
"amylose",
"content",
"was",
"observed",
"for",
"the",
"KDA",
"transformants",
"-LRB-",
"Table",
"1",
"-RRB-",
",",
"irrespective",
"of",
"their",
"GBSSI",
"messenger",
"RNA",
"level",
".",
"Thus",
",",
"the",
"observed",
"reduction",
"in",
"GBSSI",
"expression",
"for",
"the",
"-LRB-",
"+",
"-RRB-",
"and",
"-LRB-",
"+",
"+",
"-RRB-",
"KDA",
"classes",
"were",
"significant",
"within",
"the",
"selected",
"transformants",
",",
"but",
"relatively",
"small",
"with",
"respect",
"to",
"the",
"RVT34-77",
"transformant",
".",
"Fig.",
"5Real-time",
"quantitative",
"RT-PCR",
"analysis",
"of",
"KDA24",
"-LRB-",
"−",
"-RRB-",
",",
"KDA27",
"-LRB-",
"+",
"-RRB-",
"and",
"KDA13",
"-LRB-",
"+",
"+",
"-RRB-",
"transformants",
"and",
"KD-UT",
"tuber",
"RNA",
"using",
"the",
"following",
"specific",
"primers",
":",
"SuSy",
",",
"sucrose",
"synthase",
";",
"AGPase",
",",
"ADP-glucose",
"pyrophosphorylase",
"subunit",
"S",
";",
"SSIII",
",",
"starch",
"synthase",
"III",
";",
"SBEI",
",",
"starch",
"branching",
"enzyme",
"I",
";",
"GBSSI",
",",
"granule-bound",
"starch",
"synthase",
"I.",
"RNA",
"levels",
"for",
"each",
"gene",
"were",
"expressed",
"relative",
"to",
"the",
"amount",
"of",
"Ubi3",
"RNA",
",",
"as",
"described",
"in",
"materials",
"and",
"methods",
".",
"RNA",
"sample",
"from",
"Karnico",
"potato",
"tubers",
"expressing",
"a",
"sense/antisense",
"GBSSI",
"cDNA",
"construct",
"exhibiting",
"a",
"complete",
"GBSSI",
"down-regulation",
"-LRB-",
"RVT34-77",
"-RRB-",
",",
"was",
"used",
"as",
"a",
"positive",
"control",
"Discussion",
"This",
"report",
"is",
"the",
"first",
"study",
"on",
"the",
"production",
"of",
"alternan",
"in",
"potato",
"tubers",
".",
"Their",
"presence",
"in",
"potato",
"juices",
"was",
"demonstrated",
"by",
"ELISA",
"using",
"anti-dextran",
"antibodies",
".",
"Expression",
"of",
"ASR",
"did",
"not",
"interfere",
"with",
"plant",
"growth",
"and",
"development",
",",
"and",
"tuber",
"and",
"starch",
"yield",
"penalties",
"were",
"not",
"observed",
".",
"These",
"results",
"were",
"similar",
"to",
"those",
"obtained",
"with",
"the",
"dextransucrase",
"-LRB-",
"DSRS",
"-RRB-",
"expression",
"-LRB-",
"Kok-Jacon",
"et",
"al.",
"2005a",
"-RRB-",
",",
"but",
"not",
"to",
"those",
"obtained",
"with",
"the",
"mutansucrase",
"-LRB-",
"GTFI",
"-RRB-",
"expression",
"in",
"which",
"the",
"tuber",
"phenotype",
"was",
"significantly",
"affected",
"-LRB-",
"Kok-Jacon",
"et",
"al.",
"2005b",
"-RRB-",
".",
"The",
"amount",
"of",
"alternan",
"accumulated",
"in",
"potato",
"tubers",
"-LRB-",
"1.2",
"mg",
"g",
"−",
"1",
"fresh",
"wt",
"-RRB-",
"was",
"lower",
"than",
"that",
"of",
"dextran",
"-LRB-",
"1.7",
"mg",
"g",
"−",
"1",
"fresh",
"wt",
"-RRB-",
"-LRB-",
"Kok-Jacon",
"et",
"al.",
"2005a",
"-RRB-",
".",
"It",
"might",
"be",
"possible",
"that",
"the",
"large",
"size",
"of",
"the",
"mature",
"ASR",
"-LRB-",
"2,057",
"amino-acids",
"-LRB-",
"a.a",
"-RRB-",
"when",
"compared",
"to",
"DSRS",
"with",
"only",
"1,527",
"a.a.",
"-RRB-",
"might",
"reduce",
"the",
"efficiency",
"with",
"which",
"the",
"enzyme",
"is",
"transported",
"through",
"the",
"amyloplast",
"membrane",
".",
"However",
",",
"such",
"explanation",
"needs",
"to",
"be",
"approached",
"with",
"caution",
"because",
"the",
"presence",
"of",
"alternansucrase",
"in",
"the",
"amyloplast",
"was",
"not",
"directly",
"evidenced",
",",
"as",
"no",
"ASR",
"antibodies",
"were",
"available",
"to",
"us",
".",
"Interestingly",
",",
"it",
"has",
"been",
"shown",
"that",
"the",
"size",
"of",
"ASR",
"can",
"be",
"reduced",
"-LRB-",
"by",
"removal",
"82",
"%",
"-LRB-",
"632/767",
"a.a.",
"-RRB-",
"of",
"the",
"C-terminal",
"GBD",
"-RRB-",
"without",
"compromising",
"its",
"activity",
"-LRB-",
"Joucla",
"et",
"al.",
"2006",
"-RRB-",
".",
"If",
"the",
"size",
"of",
"the",
"protein",
"is",
"indeed",
"a",
"critical",
"factor",
",",
"than",
"this",
"truncated",
"variant",
"may",
"be",
"a",
"useful",
"tool",
"to",
"enhance",
"alternan",
"synthesis",
"in",
"the",
"amyloplast",
".",
"Such",
"an",
"approach",
"was",
"already",
"employed",
"successfully",
"for",
"the",
"Streptococcus",
"downei",
"mutansucrase",
"GTFI",
"-LRB-",
"Kok-Jacon",
"et",
"al.",
"2005b",
"-RRB-",
".",
"We",
"have",
"directed",
"a",
"mature",
"and",
"a",
"GBD-truncated",
"GTFI",
"protein",
"to",
"potato",
"amyloplasts",
",",
"and",
"found",
"that",
"the",
"truncated",
"form",
"synthesized",
"a",
"larger",
"amount",
"of",
"mutan",
",",
"with",
"much",
"more",
"pronounced",
"effect",
"on",
"starch",
"granule",
"morphology",
".",
"Although",
"ASR",
"is",
"known",
"to",
"be",
"efficient",
"in",
"catalyzing",
"acceptor",
"reactions",
"-LRB-",
"Richard",
"et",
"al.",
"2003",
";",
"Côté",
"and",
"Sheng",
"2006",
"-RRB-",
",",
"no",
"evidence",
"was",
"found",
"for",
"the",
"covalent",
"attachment",
"of",
"novel",
",",
"alternan-based",
"structural",
"elements",
"to",
"starch",
"molecules",
".",
"Also",
"with",
"dextransucrase",
"and",
"mutansucrase",
"we",
"have",
"not",
"been",
"able",
"to",
"introduce",
"different",
"glycosyl",
"linkage",
"patterns",
"in",
"starch",
"-LRB-",
"Kok-Jacon",
"et",
"al.",
"2005a",
",",
"b",
"-RRB-",
".",
"To",
"this",
"end",
",",
"acceptor",
"reactions",
"of",
"glucansucrases",
"with",
"starch",
"or",
"maltodextrins",
"are",
"not",
"studied",
"in",
"much",
"detail",
".",
"It",
"has",
"been",
"observed",
"that",
"the",
"efficiency",
"of",
"acceptor",
"reaction",
"decreases",
"with",
"increasing",
"length",
"of",
"maltodextrins",
"-LRB-",
"reviewed",
"in",
"Kok-Jacon",
"et",
"al.",
"2003",
"-RRB-",
".",
"We",
"had",
"anticipated",
"that",
"the",
"nascent",
"starch",
"polymers",
"would",
"be",
"poor",
"acceptors",
"for",
"the",
"glucansucrases",
".",
"However",
",",
"during",
"starch",
"biosynthesis",
"potential",
"acceptors",
"-LRB-",
"small",
"maltodextrins",
"-RRB-",
"are",
"thought",
"to",
"be",
"generated",
"through",
"the",
"action",
"of",
",",
"for",
"instance",
",",
"debranching",
"enzymes",
"-LRB-",
"or",
"isoamylases",
"-RRB-",
".",
"If",
"such",
"a",
"small",
"acceptor",
"is",
"mutanylated",
",",
"alternanylated",
",",
"or",
"dextranylated",
"at",
"the",
"non-reducing",
"end",
",",
"then",
"these",
"novel",
"structures",
"might",
"be",
"incorporated",
"into",
"starch",
"polymers",
"through",
"the",
"action",
"of",
"certain",
"transferases",
"such",
"as",
",",
"for",
"instance",
",",
"branching",
"enzyme",
".",
"Apparently",
",",
"this",
"does",
"not",
"happen",
",",
"or",
"at",
"a",
"very",
"low",
"-LRB-",
"undetectable",
"-RRB-",
"frequency",
",",
"but",
"the",
"reason",
"for",
"this",
"is",
"unclear",
".",
"Starch",
"morphology",
"in",
"the",
"ASR",
"transformants",
"was",
"not",
"significantly",
"altered",
"in",
"comparison",
"to",
"that",
"of",
"dextran",
"and",
"mutan-accumulating",
"plants",
"-LRB-",
"Fig.",
"4",
"-RRB-",
".",
"This",
"might",
"be",
"related",
"to",
"the",
"fact",
"that",
"alternan",
"is",
"more",
"water-soluble",
"than",
"dextran",
"and",
"mutan",
".",
"An",
"indication",
"of",
"the",
"water-solubility",
"of",
"the",
"three",
"polysaccharides",
"is",
"given",
"in",
"Fig.",
"4",
";",
"the",
"more",
"ethanol",
"is",
"required",
"for",
"precipitation",
",",
"the",
"higher",
"the",
"water-solubility",
".",
"The",
"water-solubility",
"decreases",
"in",
"the",
"order",
"of",
"alternan",
",",
"dextran",
"and",
"mutan",
".",
"We",
"hypothesize",
"that",
"the",
"co-synthesis",
"of",
"water-insoluble",
"mutan",
"and",
"starch",
"leads",
"to",
"co-crystallization",
"of",
"the",
"two",
"polymers",
",",
"as",
"a",
"result",
"of",
"which",
"the",
"granule",
"is",
"packed",
"in",
"a",
"less",
"orderly",
"fashion",
".",
"This",
"comparison",
"should",
"be",
"approached",
"with",
"caution",
".",
"For",
"alternan",
"and",
"dextran",
",",
"the",
"observed",
"differences",
"in",
"starch",
"morphology",
"may",
"also",
"be",
"related",
"to",
"the",
"fact",
"that",
"more",
"dextran",
"than",
"alternan",
"was",
"accumulated",
"in",
"the",
"potato",
"tubers",
";",
"for",
"mutan",
",",
"we",
"have",
"not",
"been",
"able",
"to",
"quantify",
"the",
"amount",
"accumulated",
"in",
"the",
"tubers",
".",
"Therefore",
",",
"it",
"can",
"not",
"be",
"excluded",
"that",
"the",
"observed",
"effects",
"are",
"related",
"to",
"the",
"amount",
"of",
"foreign",
"polymer",
"produced",
".",
"Interestingly",
",",
"co-synthesis",
"of",
"levan",
",",
"a",
"water-soluble",
"fructosyl-based",
"polymer",
",",
"and",
"starch",
"resulted",
"in",
"a",
"dramatically",
"altered",
"starch",
"granule",
"morphology",
"-LRB-",
"Gerrits",
"2000",
"-RRB-",
".",
"However",
",",
"it",
"should",
"be",
"noted",
"that",
"much",
"higher",
"levels",
"of",
"levan",
",",
"which",
"were",
"estimated",
"to",
"be",
"66",
"mg",
"g",
"−",
"1",
"fresh",
"wt",
"-LRB-",
"Gerrits",
"et",
"al.",
"2001",
";",
"Cairns",
"2003",
"-RRB-",
",",
"were",
"produced",
"in",
"comparison",
"with",
"alternan",
"-LRB-",
"1.2",
"mg",
"g",
"−",
"1",
"fresh",
"wt",
"-RRB-",
"or",
"dextran",
"-LRB-",
"1.7",
"mg",
"g",
"−",
"1",
"fresh",
"wt",
"-RRB-",
",",
"and",
"that",
"the",
"starch",
"granules",
"contained",
"approximately",
"5",
"%",
"of",
"levan",
".",
"This",
"result",
"contrasts",
"with",
"that",
"of",
"alternan",
"-",
"and",
"dextran-accumulating",
"plants",
"in",
"which",
"foreign",
"polymers",
"were",
"only",
"found",
"in",
"the",
"stroma",
".",
"Taking",
"together",
"the",
"results",
"of",
"potato",
"transformants",
"expressing",
"glucan",
"-",
"or",
"levansucrases",
"in",
"amyloplasts",
",",
"it",
"seems",
"that",
"the",
"site",
"of",
"accumulation",
"of",
"the",
"foreign",
"polymer",
"-LRB-",
"granule",
"or",
"stroma",
"-RRB-",
",",
"the",
"solubility",
"of",
"the",
"foreign",
"polymer",
",",
"and",
"the",
"amount",
"of",
"foreign",
"polymer",
"that",
"is",
"actually",
"produced",
"are",
"important",
"factors",
"in",
"determining",
"starch",
"granule",
"morphology",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Breast_Cancer_Res_Treat-3-1-2092407 | [
"Nuclear",
"morphometric",
"features",
"in",
"benign",
"breast",
"tissue",
"and",
"risk",
"of",
"subsequent",
"breast",
"cancer",
"Certain",
"nuclear",
"morphometric",
"features",
"measured",
"in",
"breast",
"tumor",
"tissue",
"have",
"been",
"shown",
"to",
"predict",
"the",
"prognosis",
"of",
"breast",
"cancer",
"patients",
".",
"However",
",",
"the",
"application",
"of",
"these",
"features",
"to",
"predicting",
"risk",
"of",
"breast",
"cancer",
"development",
"has",
"received",
"little",
"attention",
".",
"We",
"conducted",
"a",
"case-control",
"study",
"to",
"evaluate",
"nuclear",
"morphometric",
"features",
"in",
"benign",
"breast",
"tissue",
"in",
"association",
"with",
"subsequent",
"breast",
"cancer",
"risk",
".",
"The",
"study",
"was",
"nested",
"within",
"a",
"cohort",
"of",
"4,888",
"women",
"with",
"a",
"histopathologic",
"diagnosis",
"of",
"benign",
"breast",
"disease",
"-LRB-",
"BBD",
"-RRB-",
"and",
"involved",
"61",
"cases",
"and",
"71",
"controls",
",",
"amongst",
"whom",
"there",
"were",
"53",
"matched",
"case-control",
"sets",
".",
"Conditional",
"logistic",
"regression",
"models",
"were",
"fitted",
"to",
"assess",
"various",
"measurements",
"of",
"nuclear",
"size",
"and",
"nuclear",
"shape",
"factors",
"in",
"relation",
"to",
"subsequent",
"breast",
"cancer",
"risk",
".",
"In",
"multivariate",
"analysis",
",",
"subsequent",
"breast",
"cancer",
"risk",
"was",
"positively",
"associated",
"with",
"a",
"nuclear",
"shape",
"factor",
"that",
"takes",
"the",
"shortest",
"nuclear",
"axis",
"and",
"the",
"longest",
"nuclear",
"axis",
"into",
"consideration",
"simultaneously",
"-LRB-",
"highest",
"quartile",
"versus",
"lowest",
"3",
"quartiles",
":",
"odds",
"ratio",
"=",
"3.07",
",",
"95",
"%",
"confidence",
"limits",
"=",
"1.61",
",",
"5.84",
"-RRB-",
".",
"In",
"contrast",
",",
"there",
"was",
"no",
"alteration",
"in",
"subsequent",
"breast",
"cancer",
"risk",
"in",
"association",
"with",
"nuclear",
"size",
"features",
"and",
"other",
"shape",
"factors",
".",
"In",
"conclusion",
",",
"our",
"study",
"results",
"suggest",
"that",
"the",
"shape",
"factor",
"that",
"takes",
"both",
"the",
"shortest",
"nuclear",
"axis",
"and",
"the",
"longest",
"nuclear",
"axis",
"into",
"consideration",
"might",
"be",
"of",
"value",
"to",
"predict",
"subsequent",
"development",
"of",
"breast",
"cancer",
"among",
"women",
"with",
"BBD",
".",
"Introduction",
"Benign",
"breast",
"disease",
"-LRB-",
"BBD",
"-RRB-",
",",
"in",
"addition",
"to",
"certain",
"hormonal",
",",
"anthropometric",
",",
"and",
"lifestyle",
"factors",
",",
"is",
"a",
"well-established",
"risk",
"factor",
"for",
"breast",
"cancer",
"-LSB-",
"1",
",",
"2",
"-RSB-",
".",
"However",
",",
"BBD",
"comprises",
"a",
"broad",
"spectrum",
"of",
"histological",
"entities",
"-LSB-",
"3",
"-RSB-",
".",
"Both",
"epidemiologic",
"and",
"experimental",
"studies",
"suggest",
"that",
"non-atypical",
"and",
"atypical",
"proliferative",
"changes",
"represent",
"successive",
"steps",
"preceding",
"the",
"development",
"of",
"in",
"situ",
"cancer",
"and",
"then",
"invasive",
"carcinoma",
"of",
"the",
"breast",
"-LSB-",
"4",
"-RSB-",
".",
"However",
",",
"only",
"a",
"small",
"fraction",
"of",
"women",
"will",
"eventually",
"develop",
"breast",
"cancer",
"after",
"their",
"diagnosis",
"of",
"BBD",
"-LSB-",
"5",
"-RSB-",
".",
"Therefore",
",",
"it",
"is",
"important",
"to",
"differentiate",
"BBD",
"patients",
"with",
"a",
"high",
"risk",
"of",
"subsequent",
"development",
"of",
"breast",
"cancer",
"from",
"those",
"with",
"a",
"low",
"risk",
".",
"Our",
"understanding",
"regarding",
"this",
"issue",
",",
"however",
",",
"is",
"rather",
"limited",
",",
"although",
"previous",
"studies",
"have",
"suggested",
"that",
"factors",
"such",
"as",
"type",
"of",
"histological",
"subtype",
"-LRB-",
"e.g.",
",",
"atypical",
"hyperplasia",
"-RRB-",
",",
"menopausal",
"status",
",",
"and",
"family",
"history",
"of",
"breast",
"cancer",
",",
"might",
"modify",
"breast",
"cancer",
"risk",
"among",
"women",
"with",
"BBD",
"-LSB-",
"6",
"-RSB-",
".",
"Computerized",
"image",
"analysis",
"and",
"morphometry",
"can",
"quantify",
"a",
"number",
"of",
"nuclear",
"morphometric",
"features",
"such",
"as",
"nuclear",
"size",
",",
"nuclear",
"shape",
",",
"and",
"chromatin",
"texture",
"-LSB-",
"7",
"-RSB-",
".",
"The",
"evaluation",
"of",
"these",
"features",
"may",
"facilitate",
"the",
"diagnosis",
"and",
"management",
"of",
"breast",
"cancer",
"patients",
"-LSB-",
"8",
"--",
"10",
"-RSB-",
".",
"Indeed",
",",
"certain",
"nuclear",
"morphometric",
"features",
"measured",
"in",
"breast",
"tumor",
"tissue",
"have",
"been",
"shown",
"to",
"predict",
"the",
"prognosis",
"of",
"breast",
"cancer",
"patients",
"-LSB-",
"11",
"--",
"15",
"-RSB-",
".",
"Furthermore",
",",
"a",
"study",
"by",
"Mommers",
"et",
"al.",
"-LSB-",
"16",
"-RSB-",
"observed",
"that",
"normal",
"breast",
"tissue",
"or",
"usual",
"ductal",
"hyperplasia",
"harbored",
"nuclear",
"morphometric",
"changes",
"that",
"might",
"be",
"used",
"to",
"predict",
"subsequent",
"development",
"of",
"breast",
"cancer",
".",
"In",
"the",
"study",
"reported",
"here",
",",
"we",
"conducted",
"a",
"nested",
"case-control",
"study",
"to",
"evaluate",
"whether",
"nuclear",
"morphometric",
"features",
"as",
"evaluated",
"in",
"tissue",
"sections",
"of",
"BBD",
"may",
"be",
"related",
"to",
"the",
"risk",
"of",
"subsequent",
"breast",
"cancer",
"among",
"patients",
"with",
"BBD",
".",
"Methods",
"Study",
"population",
"The",
"present",
"investigation",
"was",
"undertaken",
"using",
"histological",
"sections",
"from",
"a",
"previous",
"case-control",
"study",
"nested",
"within",
"the",
"cohort",
"of",
"4,888",
"women",
"in",
"the",
"Canadian",
"National",
"Breast",
"Screening",
"Study",
"-LRB-",
"NBSS",
"-RRB-",
"who",
"were",
"diagnosed",
"histopathologically",
"with",
"BBD",
"during",
"the",
"active",
"follow-up",
"phase",
"of",
"the",
"NBSS",
"-LSB-",
"17",
"-RSB-",
".",
"The",
"NBSS",
"is",
"a",
"multi-center",
"randomized",
",",
"controlled",
"trial",
"of",
"screening",
"for",
"breast",
"cancer",
"among",
"89,835",
"women",
"aged",
"40",
"--",
"59",
"years",
"at",
"recruitment",
".",
"The",
"design",
"of",
"the",
"NBSS",
"and",
"population",
"characteristics",
"have",
"been",
"described",
"in",
"detail",
"elsewhere",
"-LSB-",
"18",
",",
"19",
"-RSB-",
".",
"Recruitment",
"took",
"place",
"between",
"1980",
"and",
"1985",
",",
"and",
"study",
"subjects",
"were",
"followed",
"actively",
"until",
"1988",
".",
"Eligibility",
"for",
"the",
"study",
"was",
"restricted",
"to",
"women",
"with",
"no",
"history",
"of",
"breast",
"cancer",
"-LRB-",
"in",
"situ",
"or",
"invasive",
"-RRB-",
".",
"The",
"NBSS",
"was",
"approved",
"by",
"the",
"appropriate",
"Institutional",
"Review",
"Boards",
",",
"and",
"the",
"study",
"described",
"here",
"involved",
"the",
"analysis",
"of",
"material",
"and",
"data",
"from",
"that",
"study",
"in",
"accordance",
"with",
"the",
"approved",
"study",
"design",
".",
"Informed",
"consent",
"was",
"obtained",
"from",
"all",
"study",
"participants",
".",
"Diagnosis",
"of",
"BBD",
"In",
"the",
"NBSS",
",",
"women",
"who",
"had",
"clinical",
"or",
"radiologic",
"evidence",
"of",
"breast",
"lesion",
"underwent",
"either",
"a",
"needle",
"aspiration",
"or",
"a",
"biopsy",
".",
"Diagnosis",
"of",
"BBD",
"was",
"performed",
"by",
"a",
"reference",
"pathologist",
".",
"Our",
"study",
"was",
"restricted",
"to",
"women",
"who",
"had",
"no",
"evidence",
"of",
"either",
"in",
"situ",
"or",
"invasive",
"breast",
"cancer",
"on",
"their",
"initial",
"surgical",
"biopsy",
".",
"Women",
"with",
"a",
"history",
"of",
"BBD",
"were",
"not",
"excluded",
"from",
"the",
"analyses",
".",
"During",
"the",
"follow-up",
"period",
",",
"we",
"identified",
"4,888",
"women",
"with",
"a",
"histopathologic",
"diagnosis",
"of",
"BBD",
",",
"who",
"were",
"followed",
"up",
"for",
"the",
"subsequent",
"development",
"of",
"breast",
"cancer",
".",
"Selection",
"of",
"cases",
"and",
"controls",
"Incident",
"cases",
"of",
"breast",
"cancer",
"were",
"ascertained",
"by",
"record",
"linkage",
"with",
"the",
"provincial",
"cancer",
"registries",
",",
"and",
"death",
"clearance",
"was",
"performed",
"by",
"linkage",
"to",
"the",
"Canadian",
"National",
"Mortality",
"Database",
"-LSB-",
"18",
",",
"19",
"-RSB-",
".",
"The",
"dates",
"of",
"the",
"linkages",
"varied",
"by",
"province",
",",
"ranging",
"from",
"late",
"1988",
"to",
"early",
"1991",
".",
"A",
"total",
"of",
"16",
"subjects",
"with",
"ductal",
"carcinoma",
"in",
"situ",
"and",
"76",
"subjects",
"with",
"invasive",
"carcinoma",
"were",
"ascertained",
"among",
"the",
"cohort",
"of",
"women",
"with",
"BBD",
".",
"Potential",
"control",
"subjects",
"were",
"women",
"with",
"BBD",
"who",
"had",
"not",
"developed",
"breast",
"cancer",
"-LRB-",
"but",
"were",
"alive",
"at",
"-RRB-",
"by",
"the",
"date",
"of",
"diagnosis",
"of",
"the",
"corresponding",
"case",
"subject",
".",
"Five",
"controls",
"were",
"selected",
"randomly",
"-LRB-",
"with",
"replacement",
"-RRB-",
"for",
"each",
"case",
"from",
"those",
"non-cases",
"available",
"within",
"strata",
"defined",
"by",
"screening",
"center",
",",
"NBSS",
"study",
"arm",
",",
"year",
"of",
"birth",
"-LRB-",
"if",
"possible",
"to",
"the",
"nearest",
"year",
",",
"and",
"mostly",
"within",
"2",
"years",
"-RRB-",
",",
"and",
"age",
"at",
"diagnosis",
"of",
"BBD",
".",
"For",
"the",
"study",
"reported",
"here",
",",
"61",
"case",
"subjects",
"and",
"71",
"control",
"subjects",
"-LRB-",
"including",
"53",
"matched",
"case-control",
"sets",
"-RRB-",
"were",
"included",
".",
"Questionnaire",
"Upon",
"enrollment",
"in",
"the",
"NBSS",
",",
"all",
"participants",
"completed",
"a",
"questionnaire",
"that",
"sought",
"information",
"on",
"demographic",
"characteristics",
"and",
"risk",
"factors",
"for",
"breast",
"cancer",
",",
"including",
"menstrual",
"and",
"reproductive",
"histories",
"and",
"family",
"history",
"of",
"breast",
"cancer",
".",
"Morphometry",
"Morphometric",
"measurements",
"were",
"performed",
"on",
"H&E",
"stained",
"slides",
",",
"using",
"the",
"QPRODIT",
"interactive",
"video-overlay",
"system",
"-LRB-",
"Leica",
",",
"Cambridge",
",",
"UK",
"-RRB-",
".",
"About",
"50",
"nuclei",
"were",
"selected",
"in",
"the",
"most",
"representative",
"areas",
"of",
"the",
"slide",
"-LRB-",
"selected",
"by",
"a",
"breast",
"pathologist",
"-RRB-",
",",
"and",
"their",
"contours",
"were",
"traced",
"manually",
"using",
"a",
"100",
"×",
"objective",
"-LRB-",
"final",
"magnification",
"about",
"3,000",
"×",
"-RRB-",
"-LSB-",
"20",
"-RSB-",
".",
"Mean",
"and",
"standard",
"deviation",
"of",
"nuclear",
"area",
",",
"perimeter",
",",
"diameter",
",",
"shortest",
"axis",
",",
"longest",
"axis",
",",
"and",
"axis",
"ratio",
"were",
"calculated",
",",
"as",
"well",
"as",
"different",
"shape",
"factors",
".",
"The",
"shape",
"factors",
"were",
"calculated",
"by",
"the",
"following",
"formulas",
":",
"Form_AR",
"=",
"-LRB-",
"1/4",
"-RRB-",
"*",
"pi",
"*",
"longest",
"axis",
"*",
"shortest",
"axis",
";",
"Form_PE",
"=",
"4",
"*",
"pi",
"*",
"area",
"/",
"-LRB-",
"perimeter",
"squared",
"-RRB-",
";",
"Form_NCI",
"=",
"perimeter/sqrt",
"-LRB-",
"area",
"-RRB-",
";",
"Contour",
"ratio",
"=",
"perimeter",
"squared/4",
"*",
"pi",
"*",
"area",
";",
"and",
"Roundness",
"=",
"perimeter",
"/",
"-LRB-",
"2",
"*",
"sqrt",
"-LRB-",
"pi",
"*",
"area",
"-RRB-",
"-RRB-",
".",
"All",
"morphometric",
"assessments",
"were",
"performed",
"by",
"one",
"observer",
"without",
"knowledge",
"of",
"patient",
"outcome",
".",
"Statistical",
"analysis",
"Morphometric",
"measurements",
"were",
"first",
"compared",
"between",
"cases",
"and",
"controls",
"using",
"Student",
"'s",
"t-test",
".",
"Subsequently",
",",
"the",
"measurements",
"were",
"categorized",
"by",
"quartiles",
"and",
"then",
"odds",
"ratios",
"-LRB-",
"OR",
"-RRB-",
"and",
"95",
"%",
"confidence",
"limits",
"-LRB-",
"CLs",
"-RRB-",
"were",
"calculated",
"for",
"the",
"risk",
"of",
"breast",
"cancer",
"for",
"those",
"in",
"the",
"highest",
"quartile",
"level",
"compared",
"to",
"that",
"for",
"those",
"in",
"the",
"lowest",
"3",
"quartile",
"levels",
"using",
"conditional",
"logistic",
"regression",
".",
"In",
"multivariate",
"analyses",
",",
"we",
"controlled",
"for",
"age",
"at",
"menarche",
"-LRB-",
"<",
"13",
",",
"13",
",",
"14",
"+",
"-RRB-",
",",
"age",
"at",
"first",
"live",
"birth",
"-LRB-",
"nulliparous",
",",
"<",
"23",
",",
"23",
"--",
"26",
",",
"27",
"+",
"-RRB-",
",",
"menopausal",
"status",
"-LRB-",
"pre",
"-",
",",
"peri",
"-",
",",
"post",
"-",
"-RRB-",
",",
"oral",
"contraceptive",
"use",
"-LRB-",
"ever",
"versus",
"never",
"-RRB-",
",",
"postmenopausal",
"estrogen",
"use",
"-LRB-",
"ever",
"vs.",
"never",
"-RRB-",
",",
"body",
"mass",
"index",
"-LRB-",
"<",
"25",
",",
"25",
"+",
"-RRB-",
",",
"family",
"history",
"of",
"breast",
"cancer",
",",
"and",
"the",
"presence",
"of",
"hyperplasia",
"in",
"the",
"benign",
"tissue",
".",
"All",
"statistical",
"analyses",
"were",
"performed",
"in",
"SAS",
"9.1",
"-LRB-",
"SAS",
"Institute",
",",
"Cary",
",",
"NC",
"-RRB-",
".",
"P-values",
"were",
"two-sided",
".",
"Results",
"Table",
"1",
"summarizes",
"the",
"distribution",
"of",
"selected",
"characteristics",
"among",
"the",
"cases",
"and",
"controls",
".",
"Overall",
",",
"few",
"differences",
"between",
"the",
"cases",
"and",
"controls",
"were",
"observed",
"for",
"age",
"at",
"menarche",
",",
"age",
"at",
"first",
"live",
"birth",
",",
"menopausal",
"status",
",",
"oral",
"contraceptive",
"use",
",",
"postmenopausal",
"estrogen",
"use",
",",
"body",
"mass",
"index",
",",
"family",
"history",
"of",
"breast",
"cancer",
",",
"and",
"the",
"presence",
"of",
"hyperplasia",
"in",
"benign",
"tissue",
".",
"Table",
"1",
".",
"Distribution",
"of",
"selected",
"characteristics",
"among",
"breast",
"cancer",
"cases",
"and",
"non-cases",
"N",
"-LRB-",
"%",
"-RRB-",
"P-valueCasesControlsAge",
"at",
"menarche",
"<",
"1330",
"-LRB-",
"49",
"-RRB-",
"26",
"-LRB-",
"37",
"-RRB-",
"0.291313",
"-LRB-",
"21",
"-RRB-",
"22",
"-LRB-",
"31",
"-RRB-",
"14",
"+18",
"-LRB-",
"30",
"-RRB-",
"23",
"-LRB-",
"32",
"-RRB-",
"Age",
"at",
"first",
"live",
"birthNulliparous11",
"-LRB-",
"18",
"-RRB-",
"9",
"-LRB-",
"13",
"-RRB-",
"0.84",
"<",
"2322",
"-LRB-",
"36",
"-RRB-",
"29",
"-LRB-",
"41",
"-RRB-",
"23",
"--",
"2619",
"-LRB-",
"31",
"-RRB-",
"23",
"-LRB-",
"32",
"-RRB-",
"27",
"+9",
"-LRB-",
"15",
"-RRB-",
"10",
"-LRB-",
"14",
"-RRB-",
"Menopausal",
"statusPre-30",
"-LRB-",
"49",
"-RRB-",
"31",
"-LRB-",
"44",
"-RRB-",
"0.71Peri-9",
"-LRB-",
"15",
"-RRB-",
"14",
"-LRB-",
"20",
"-RRB-",
"Post-22",
"-LRB-",
"36",
"-RRB-",
"26",
"-LRB-",
"36",
"-RRB-",
"Ever",
"used",
"oral",
"contraceptivesYes35",
"-LRB-",
"57",
"-RRB-",
"42",
"-LRB-",
"60",
"-RRB-",
"0.76",
"No26",
"-LRB-",
"43",
"-RRB-",
"28",
"-LRB-",
"40",
"-RRB-",
"Missing01Ever",
"used",
"postmenopausal",
"estrogensYes15",
"-LRB-",
"25",
"-RRB-",
"15",
"-LRB-",
"22",
"-RRB-",
"0.70",
"No46",
"-LRB-",
"75",
"-RRB-",
"54",
"-LRB-",
"78",
"-RRB-",
"Missing02Body",
"mass",
"index",
"-LRB-",
"kg/m2",
"-RRB-",
"<",
"2532",
"-LRB-",
"53",
"-RRB-",
"41",
"-LRB-",
"58",
"-RRB-",
"0.4225",
"--",
"<",
"3027",
"-LRB-",
"44",
"-RRB-",
"25",
"-LRB-",
"35",
"-RRB-",
"30",
"+2",
"-LRB-",
"3",
"-RRB-",
"5",
"-LRB-",
"7",
"-RRB-",
"Family",
"history",
"of",
"breast",
"cancerYes23",
"-LRB-",
"38",
"-RRB-",
"28",
"-LRB-",
"39",
"-RRB-",
"0.84",
"No38",
"-LRB-",
"62",
"-RRB-",
"43",
"-LRB-",
"61",
"-RRB-",
"Hyperplasia",
"in",
"benign",
"tissueAbsent34",
"-LRB-",
"59",
"-RRB-",
"47",
"-LRB-",
"68",
"-RRB-",
"0.27",
"Present24",
"-LRB-",
"41",
"-RRB-",
"22",
"-LRB-",
"32",
"-RRB-",
"Missing32",
"There",
"was",
"little",
"difference",
"between",
"the",
"cases",
"and",
"controls",
"with",
"respect",
"to",
"nuclear",
"morphometric",
"features",
"including",
"mean",
"area",
",",
"standard",
"deviation",
"-LRB-",
"SD",
"-RRB-",
"of",
"area",
",",
"perimeter",
",",
"diameter",
",",
"shortest",
"axis",
",",
"and",
"longest",
"axis",
",",
"as",
"well",
"as",
"such",
"shape",
"factors",
"as",
"Form_PE",
",",
"Form_NCI",
",",
"contour",
",",
"and",
"roundness",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"In",
"contrast",
",",
"the",
"shape",
"factor",
"Form_AR",
"was",
"greater",
"among",
"cases",
"than",
"among",
"controls",
".",
"Furthermore",
",",
"subjects",
"with",
"hyperplasia",
"had",
"greater",
"measures",
"of",
"some",
"nuclear",
"size",
"features",
"including",
"mean",
"area",
",",
"SD",
"of",
"area",
",",
"perimeter",
",",
"diameter",
",",
"and",
"longest",
"axis",
",",
"and",
"the",
"shape",
"factor",
"Form_AR",
"than",
"did",
"subjects",
"without",
"hyperplasia",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"Table",
"2",
".",
"Comparison",
"of",
"nuclear",
"morphometric",
"features",
"in",
"benign",
"breast",
"tissue",
"between",
"breast",
"cancer",
"cases",
"and",
"non-casesMorphometric",
"measurementsMean",
"-LRB-",
"standard",
"deviation",
"-RRB-",
"P-valueCases",
"-LRB-",
"n",
"=",
"61",
"-RRB-",
"Controls",
"-LRB-",
"n",
"=",
"71",
"-RRB-",
"Mean",
"nuclear",
"area",
"-LRB-",
"μm2",
"-RRB-",
"26.8",
"-LRB-",
"7.5",
"-RRB-",
"25.3",
"-LRB-",
"7.2",
"-RRB-",
"0.25",
"SD",
"of",
"nuclear",
"area",
"-LRB-",
"μm2",
"-RRB-",
"5.2",
"-LRB-",
"1.8",
"-RRB-",
"5.0",
"-LRB-",
"1.6",
"-RRB-",
"0.43",
"Nuclear",
"perimeter",
"-LRB-",
"μm",
"-RRB-",
"19.7",
"-LRB-",
"2.7",
"-RRB-",
"19.3",
"-LRB-",
"2.7",
"-RRB-",
"0.37",
"Nuclear",
"diameter",
"-LRB-",
"μm",
"-RRB-",
"5.8",
"-LRB-",
"0.8",
"-RRB-",
"5.6",
"-LRB-",
"0.8",
"-RRB-",
"0.23",
"Shortest",
"nuclear",
"axis",
"-LRB-",
"μm",
"-RRB-",
"4.8",
"-LRB-",
"0.7",
"-RRB-",
"4.6",
"-LRB-",
"0.7",
"-RRB-",
"0.16",
"Longest",
"nuclear",
"axis",
"-LRB-",
"μm",
"-RRB-",
"7.1",
"-LRB-",
"1.0",
"-RRB-",
"7.0",
"-LRB-",
"1.0",
"-RRB-",
"0.53",
"Axis",
"ratio1",
".5",
"-LRB-",
"0.1",
"-RRB-",
"1.6",
"-LRB-",
"0.2",
"-RRB-",
"0.15",
"Form_AR0",
".984",
"-LRB-",
"0.005",
"-RRB-",
"0.981",
"-LRB-",
"0.007",
"-RRB-",
"0.0089",
"Form_PE0",
".844",
"-LRB-",
"0.037",
"-RRB-",
"0.831",
"-LRB-",
"0.045",
"-RRB-",
"0.083",
"Form_NCI3",
".874",
"-LRB-",
"0.095",
"-RRB-",
"3.909",
"-LRB-",
"0.122",
"-RRB-",
"0.071",
"Contour1",
".198",
"-LRB-",
"0.061",
"-RRB-",
"1.221",
"-LRB-",
"0.080",
"-RRB-",
"0.068",
"Roundness1",
".093",
"-LRB-",
"0.027",
"-RRB-",
"1.103",
"-LRB-",
"0.034",
"-RRB-",
"0.071",
"Quartile",
"analyses",
"revealed",
"that",
"subsequent",
"breast",
"cancer",
"risk",
"was",
"increased",
"in",
"association",
"with",
"the",
"shape",
"factor",
"Form_AR",
",",
"but",
"not",
"with",
"the",
"other",
"nuclear",
"morphometric",
"measurements",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"Compared",
"to",
"BBD",
"subjects",
"with",
"Form_AR",
"equal",
"to",
"or",
"less",
"than",
"0.986",
",",
"subjects",
"with",
"Form_AR",
"greater",
"than",
"0.986",
"had",
"a",
"more",
"than",
"three-fold",
"increased",
"risk",
"of",
"developing",
"breast",
"cancer",
"subsequently",
"-LRB-",
"OR",
"=",
"3.07",
",",
"95",
"%",
"CL",
"=",
"1.61",
",",
"5.84",
"-RRB-",
".",
"When",
"the",
"analyses",
"were",
"repeated",
"using",
"unconditional",
"logistic",
"regression",
",",
"which",
"enabled",
"all",
"the",
"available",
"cases",
"and",
"controls",
"to",
"be",
"included",
",",
"the",
"results",
"did",
"not",
"change",
"substantially",
".",
"Table",
"3",
".",
"Risk",
"of",
"Subsequent",
"development",
"of",
"breast",
"cancer",
"in",
"association",
"with",
"nuclear",
"morphometric",
"featuresaMorphometric",
"measurementsCut-off",
"valueOR",
"-LRB-",
"95",
"%",
"CL",
"-RRB-",
"Model",
"1bModel",
"2cMean",
"nuclear",
"area",
"-LRB-",
"μm2",
"-RRB-",
"31.21.28",
"-LRB-",
"0.73",
",",
"2.25",
"-RRB-",
"0.94",
"-LRB-",
"0.50",
",",
"1.78",
"-RRB-",
"SD",
"of",
"nuclear",
"area",
"-LRB-",
"μm2",
"-RRB-",
"6.11.33",
"-LRB-",
"0.76",
",",
"2.31",
"-RRB-",
"1.11",
"-LRB-",
"0.59",
",",
"2.07",
"-RRB-",
"Nuclear",
"perimeter",
"-LRB-",
"μm",
"-RRB-",
"21.41.14",
"-LRB-",
"0.70",
",",
"1.93",
"-RRB-",
"0.85",
"-LRB-",
"0.47",
",",
"1.55",
"-RRB-",
"Nuclear",
"diameter",
"-LRB-",
"μm",
"-RRB-",
"6.31.29",
"-LRB-",
"0.73",
",",
"2.27",
"-RRB-",
"0.95",
"-LRB-",
"0.50",
",",
"1.79",
"-RRB-",
"Shortest",
"nuclear",
"axis",
"-LRB-",
"μm",
"-RRB-",
"5.21.62",
"-LRB-",
"0.92",
",",
"2.86",
"-RRB-",
"1.18",
"-LRB-",
"0.62",
",",
"2.26",
"-RRB-",
"Longest",
"nuclear",
"axis",
"-LRB-",
"μm",
"-RRB-",
"8.01.34",
"-LRB-",
"0.75",
",",
"2.39",
"-RRB-",
"0.95",
"-LRB-",
"0.50",
",",
"1.81",
"-RRB-",
"Axis",
"ratio1",
".60.59",
"-LRB-",
"0.30",
",",
"1.17",
"-RRB-",
"0.71",
"-LRB-",
"0.33",
",",
"1.54",
"-RRB-",
"Form_AR0",
".9862.45",
"-LRB-",
"1.42",
",",
"4.22",
"-RRB-",
"3.07",
"-LRB-",
"1.61",
",",
"5.84",
"-RRB-",
"Form_PE0",
".8671.22",
"-LRB-",
"0.71",
",",
"2.08",
"-RRB-",
"1.57",
"-LRB-",
"0.83",
",",
"2.97",
"-RRB-",
"Form_NCI3",
".9351.07",
"-LRB-",
"0.58",
",",
"1.98",
"-RRB-",
"1.18",
"-LRB-",
"0.61",
",",
"2.27",
"-RRB-",
"Contour1",
".2361.13",
"-LRB-",
"0.61",
",",
"2.10",
"-RRB-",
"1.22",
"-LRB-",
"0.63",
",",
"2.35",
"-RRB-",
"Roundness1",
".1101.07",
"-LRB-",
"0.58",
",",
"1.98",
"-RRB-",
"1.18",
"-LRB-",
"0.61",
",",
"2.27",
"-RRB-",
"a",
"Analyses",
"were",
"conducted",
"among",
"53",
"matched",
"case-control",
"sets",
"by",
"comparing",
"the",
"highest",
"quartile",
"versus",
"the",
"lowest",
"3",
"quartiles",
"in",
"conditional",
"logistic",
"regression",
"modelsb",
"Adjusted",
"for",
"matching",
"variablesc",
"Adjusted",
"for",
"matching",
"variables",
",",
"age",
"at",
"menarche",
"-LRB-",
"<",
"13",
",",
"13",
",",
"14",
"+",
"-RRB-",
",",
"age",
"at",
"first",
"live",
"birth",
"-LRB-",
"nulliparous",
",",
"<",
"23",
",",
"23",
"--",
"26",
",",
"27",
"+",
"-RRB-",
",",
"menopausal",
"status",
"-LRB-",
"pre",
"-",
",",
"peri",
"-",
",",
"post",
"-",
"-RRB-",
",",
"oral",
"contraceptive",
"use",
"-LRB-",
"ever",
"vs.",
"never",
"-RRB-",
",",
"postmenopausal",
"estrogen",
"use",
"-LRB-",
"ever",
"versus",
"never",
"-RRB-",
",",
"body",
"mass",
"index",
"-LRB-",
"<",
"25",
",",
"25",
"+",
"-RRB-",
",",
"family",
"history",
"of",
"breast",
"cancer",
",",
"and",
"the",
"presence",
"of",
"hyperplasia",
"in",
"the",
"benign",
"tissue",
"Discussion",
"We",
"found",
"that",
"breast",
"cancer",
"risk",
"in",
"women",
"with",
"BBD",
"was",
"positively",
"associated",
"with",
"the",
"shape",
"factor",
"Form_AR",
",",
"a",
"measurement",
"that",
"takes",
"the",
"shortest",
"nuclear",
"axis",
"and",
"the",
"longest",
"nuclear",
"axis",
"into",
"consideration",
"simultaneously",
".",
"In",
"contrast",
",",
"there",
"was",
"no",
"alteration",
"in",
"risk",
"in",
"association",
"with",
"nuclear",
"area",
",",
"SD",
"of",
"nuclear",
"area",
",",
"nuclear",
"perimeter",
",",
"nuclear",
"diameter",
",",
"shortest",
"nuclear",
"axis",
",",
"longest",
"nuclear",
"axis",
",",
"and",
"other",
"shape",
"factors",
".",
"Although",
"subjects",
"with",
"hyperplasia",
"had",
"greater",
"measures",
"of",
"Form_AR",
"than",
"did",
"subjects",
"without",
"hyperplasia",
",",
"we",
"adjusted",
"for",
"hyperplasia",
",",
"suggesting",
"that",
"the",
"association",
"with",
"Form_AR",
"is",
"independent",
"of",
"that",
"due",
"to",
"the",
"presence",
"of",
"hyperplasia",
".",
"Shape",
"is",
"one",
"of",
"the",
"factors",
"that",
"pathologists",
"use",
"in",
"assessing",
"nuclear",
"atypicality",
".",
"Shape",
"factors",
"have",
"been",
"shown",
"to",
"have",
"prognostic",
"value",
"in",
"breast",
"cancer",
"-LSB-",
"21",
"--",
"23",
"-RSB-",
",",
"renal",
"cell",
"cancer",
"-LSB-",
"24",
"-RSB-",
",",
"colorectal",
"cancer",
"-LSB-",
"25",
"-RSB-",
",",
"squamous",
"cell",
"carcinoma",
"of",
"the",
"larynx",
"-LSB-",
"26",
"-RSB-",
",",
"melanoma",
"-LSB-",
"27",
"-RSB-",
",",
"and",
"rhabdomyosarcoma",
"-LSB-",
"28",
"-RSB-",
".",
"Apparently",
",",
"alterations",
"in",
"nuclear",
"shape",
"can",
"already",
"be",
"present",
"at",
"the",
"earliest",
"stages",
"of",
"carcinogenesis",
".",
"This",
"has",
"in",
"the",
"breast",
"also",
"been",
"shown",
"for",
"nuclear",
"chromatin",
"patterns",
"-LSB-",
"29",
"-RSB-",
".",
"To",
"date",
",",
"only",
"one",
"study",
"has",
"been",
"published",
"that",
"assessed",
"morphometric",
"features",
"in",
"association",
"with",
"subsequent",
"development",
"of",
"breast",
"cancer",
"among",
"women",
"with",
"BBD",
"-LSB-",
"16",
"-RSB-",
".",
"That",
"study",
"found",
"positive",
"associations",
"for",
"mean",
"nuclear",
"area",
",",
"nuclear",
"diameter",
",",
"nuclear",
"perimeter",
",",
"and",
"the",
"longest",
"nuclear",
"axis",
",",
"but",
"no",
"associations",
"for",
"SD",
"of",
"the",
"nuclear",
"area",
"and",
"the",
"shortest",
"nuclear",
"axis",
";",
"shape",
"factors",
"were",
"not",
"evaluated",
".",
"However",
",",
"potential",
"confounding",
"factors",
"were",
"not",
"controlled",
"for",
".",
"In",
"contrast",
"to",
"these",
"findings",
",",
"nuclear",
"size",
"features",
"were",
"not",
"associated",
"with",
"risk",
"in",
"the",
"present",
"study",
",",
"which",
"may",
"perhaps",
"be",
"explained",
"by",
"differences",
"in",
"tissue",
"processing",
"procedures",
".",
"Our",
"case-control",
"study",
"was",
"nested",
"in",
"a",
"cohort",
"of",
"patients",
"with",
"histopathologically",
"confirmed",
"BBD",
"and",
"our",
"findings",
"are",
"likely",
"to",
"be",
"internally",
"valid",
".",
"Biased",
"measurement",
"of",
"the",
"study",
"exposures",
"was",
"not",
"likely",
"a",
"source",
"of",
"error",
",",
"given",
"that",
"the",
"morphometric",
"features",
"were",
"assessed",
"without",
"knowledge",
"of",
"the",
"patient",
"outcome",
"status",
".",
"Our",
"study",
"power",
",",
"however",
",",
"was",
"limited",
"by",
"the",
"relatively",
"small",
"sample",
"size",
",",
"due",
"to",
"which",
"we",
"were",
"not",
"able",
"to",
"evaluate",
"modifying",
"effects",
"by",
"well-documented",
"risk",
"factors",
"of",
"breast",
"cancer",
".",
"Moreover",
",",
"residual",
"confounding",
"might",
"still",
"exist",
",",
"although",
"to",
"minimize",
"confounding",
"we",
"controlled",
"for",
"menstrual",
"and",
"reproductive",
"history",
",",
"exogenous",
"estrogen",
"use",
",",
"body",
"mass",
"index",
",",
"and",
"family",
"history",
"of",
"breast",
"cancer",
"in",
"multivariate",
"analyses",
".",
"In",
"conclusion",
",",
"our",
"study",
"results",
"suggest",
"that",
"the",
"shape",
"factor",
"that",
"takes",
"both",
"shortest",
"nuclear",
"axis",
"and",
"longest",
"nuclear",
"axis",
"into",
"consideration",
"might",
"be",
"of",
"value",
"to",
"predict",
"subsequent",
"development",
"of",
"breast",
"cancer",
"among",
"patients",
"with",
"BBD",
".",
"Given",
"the",
"limitations",
"of",
"our",
"study",
",",
"larger",
"studies",
"are",
"warranted",
"to",
"confirm",
"our",
"study",
"results",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Cancer_Metastasis_Rev-4-1-2362138 | [
"The",
"type",
"2C",
"phosphatase",
"Wip1",
":",
"An",
"oncogenic",
"regulator",
"of",
"tumor",
"suppressor",
"and",
"DNA",
"damage",
"response",
"pathways",
"The",
"Wild-type",
"p53-induced",
"phosphatase",
"1",
",",
"Wip1",
"-LRB-",
"or",
"PPM1D",
"-RRB-",
",",
"is",
"unusual",
"in",
"that",
"it",
"is",
"a",
"serine/threonine",
"phosphatase",
"with",
"oncogenic",
"activity",
".",
"A",
"member",
"of",
"the",
"type",
"2C",
"phosphatases",
"-LRB-",
"PP2Cδ",
"-RRB-",
",",
"Wip1",
"has",
"been",
"shown",
"to",
"be",
"amplified",
"and",
"overexpressed",
"in",
"multiple",
"human",
"cancer",
"types",
",",
"including",
"breast",
"and",
"ovarian",
"carcinomas",
".",
"In",
"rodent",
"primary",
"fibroblast",
"transformation",
"assays",
",",
"Wip1",
"cooperates",
"with",
"known",
"oncogenes",
"to",
"induce",
"transformed",
"foci",
".",
"The",
"recent",
"identification",
"of",
"target",
"proteins",
"that",
"are",
"dephosphorylated",
"by",
"Wip1",
"has",
"provided",
"mechanistic",
"insights",
"into",
"its",
"oncogenic",
"functions",
".",
"Wip1",
"acts",
"as",
"a",
"homeostatic",
"regulator",
"of",
"the",
"DNA",
"damage",
"response",
"by",
"dephosphorylating",
"proteins",
"that",
"are",
"substrates",
"of",
"both",
"ATM",
"and",
"ATR",
",",
"important",
"DNA",
"damage",
"sensor",
"kinases",
".",
"Wip1",
"also",
"suppresses",
"the",
"activity",
"of",
"multiple",
"tumor",
"suppressors",
",",
"including",
"p53",
",",
"ATM",
",",
"p16INK4a",
"and",
"ARF",
".",
"We",
"present",
"evidence",
"that",
"the",
"suppression",
"of",
"p53",
",",
"p38",
"MAP",
"kinase",
",",
"and",
"ATM/ATR",
"signaling",
"pathways",
"by",
"Wip1",
"are",
"important",
"components",
"of",
"its",
"oncogenicity",
"when",
"it",
"is",
"amplified",
"and",
"overexpressed",
"in",
"human",
"cancers",
".",
"Introduction",
"Cellular",
"DNA",
"is",
"constantly",
"exposed",
"to",
"various",
"environmental",
"and",
"endogenous",
"mutagenic",
"insults",
".",
"To",
"maintain",
"genomic",
"integrity",
"and",
"prevent",
"cancer",
"in",
"the",
"face",
"of",
"these",
"potentially",
"mutagenic",
"events",
",",
"cells",
"have",
"evolved",
"a",
"sophisticated",
"array",
"of",
"damage",
"sensors",
",",
"signaling",
"molecules",
",",
"and",
"repair",
"functions",
".",
"Among",
"the",
"key",
"sensors",
"of",
"DNA",
"damage",
"are",
"the",
"phosphoinositide-3-kinase-related",
"kinase",
"-LRB-",
"PIKK",
"-RRB-",
"family",
",",
"that",
"include",
"ATM",
"-LRB-",
"ataxia-telangiectasia",
"mutated",
"-RRB-",
",",
"ATR",
"-LRB-",
"ataxia-telangiectasia",
"and",
"Rad3-related",
"-RRB-",
",",
"and",
"DNA-PKcs",
"-LRB-",
"DNA",
"dependent",
"protein",
"kinase",
"catalytic",
"subunit",
"-RRB-",
"-LSB-",
"1",
",",
"2",
"-RSB-",
".",
"Most",
"PIKKs",
"are",
"serine/threonine",
"kinases",
"that",
"are",
"conserved",
"from",
"yeast",
"to",
"humans",
"and",
"phosphorylate",
"key",
"target",
"proteins",
"in",
"various",
"DNA",
"damage",
"response",
"pathways",
"-LSB-",
"3",
",",
"4",
"-RSB-",
".",
"The",
"direct",
"importance",
"of",
"the",
"ATM/ATR-initiated",
"damage",
"response",
"pathways",
"in",
"cancer",
"prevention",
"has",
"recently",
"been",
"demonstrated",
"by",
"two",
"groups",
"-LSB-",
"5",
",",
"6",
"-RSB-",
".",
"Human",
"pre-neoplastic",
"lesions",
"from",
"a",
"variety",
"of",
"different",
"human",
"cancers",
"were",
"shown",
"to",
"express",
"markers",
"of",
"an",
"activated",
"DNA",
"damage",
"response",
",",
"including",
"activated",
"and",
"phosphorylated",
"ATM",
",",
"Chk2",
",",
"p53",
",",
"and",
"H2AX",
"-LSB-",
"5",
",",
"6",
"-RSB-",
".",
"Interestingly",
",",
"late",
"stage",
"tumors",
"often",
"showed",
"loss",
"of",
"these",
"DNA",
"damage",
"response",
"markers",
",",
"suggesting",
"that",
"the",
"disabling",
"of",
"DNA",
"damage",
"response",
"pathways",
"is",
"an",
"important",
"prerequisite",
"for",
"cancer",
"progression",
"-LSB-",
"5",
",",
"6",
"-RSB-",
".",
"In",
"studies",
"of",
"the",
"DNA",
"damage",
"response",
",",
"most",
"attention",
"has",
"been",
"focused",
"on",
"the",
"activation",
"and",
"execution",
"of",
"that",
"response",
".",
"Less",
"attention",
"has",
"been",
"given",
"to",
"the",
"reversal",
"of",
"the",
"response",
".",
"Once",
"cell",
"division",
"has",
"been",
"halted",
"and",
"the",
"DNA",
"damage",
"has",
"been",
"repaired",
",",
"how",
"does",
"the",
"cell",
"return",
"to",
"its",
"normal",
"pre-stress",
"state",
"and",
"re-enter",
"cell",
"division",
"?",
"Since",
"activation",
"of",
"the",
"damage",
"response",
"often",
"occurs",
"through",
"phosphorylation",
"of",
"key",
"downstream",
"targets",
"of",
"ATM/ATR",
",",
"phosphatases",
"are",
"obvious",
"candidates",
"as",
"homeostatic",
"regulators",
"of",
"the",
"DNA",
"damage",
"response",
".",
"In",
"this",
"review",
"we",
"will",
"discuss",
"the",
"evidence",
"that",
"the",
"Wild-type",
"p53-induced",
"phosphatase",
"1",
",",
"or",
"Wip1",
",",
"is",
"a",
"major",
"homeostatic",
"regulator",
"of",
"the",
"ATM/ATR-initiated",
"DNA",
"damage",
"response",
".",
"In",
"addition",
"to",
"its",
"homeostatic",
"role",
"in",
"the",
"DNA",
"damage",
"response",
",",
"we",
"will",
"also",
"describe",
"how",
"Wip1",
"downregulates",
"important",
"tumor",
"suppressor",
"molecules",
".",
"Wip1",
"has",
"been",
"shown",
"to",
"inhibit",
"p53",
"by",
"multiple",
"mechanisms",
"and",
"to",
"downregulate",
"p38",
"MAP",
"kinase",
"through",
"dephosphorylation",
"-LSB-",
"5",
",",
"7",
"--",
"11",
"-RSB-",
".",
"Expression",
"of",
"p16INK4a",
"and",
"p14ARF",
"have",
"also",
"been",
"shown",
"to",
"be",
"suppressed",
"in",
"some",
"contexts",
"by",
"Wip1",
"-LSB-",
"12",
"-RSB-",
".",
"The",
"inhibition",
"of",
"these",
"tumor",
"suppressors",
"is",
"likely",
"to",
"be",
"a",
"major",
"component",
"of",
"the",
"oncogenic",
"activity",
"of",
"this",
"phosphatase",
".",
"Discovery",
"and",
"initial",
"characterization",
"of",
"Wip1",
"Appella",
"and",
"colleagues",
"originally",
"identified",
"the",
"human",
"Wip1",
"gene",
"by",
"screening",
"for",
"genes",
"induced",
"in",
"a",
"p53-dependent",
"manner",
"in",
"response",
"to",
"ionizing",
"radiation",
"-LRB-",
"IR",
"-RRB-",
"in",
"WMN",
"Burkitt",
"lymphoma",
"cells",
"-LSB-",
"13",
"-RSB-",
".",
"Using",
"mRNA",
"differential",
"display",
"methodology",
",",
"they",
"identified",
"a",
"novel",
"p53-induced",
"gene",
".",
"The",
"Wip1",
"transcript",
"was",
"induced",
"by",
"ultraviolet",
"-LRB-",
"UV",
"-RRB-",
"and",
"IR",
"in",
"a",
"p53-dependent",
"manner",
"-LSB-",
"13",
"-RSB-",
".",
"Tumor",
"cell",
"lines",
"with",
"wild-type",
"p53",
"consistently",
"showed",
"IR-induced",
"increases",
"in",
"Wip1",
"mRNA",
"while",
"p53-deficient",
"cell",
"lines",
"showed",
"little",
"or",
"no",
"induction",
"of",
"Wip1",
"expression",
"following",
"radiation",
"treatment",
".",
"Cellular",
"fractionation",
"and",
"indirect",
"immunofluorescence",
"indicated",
"that",
"the",
"61",
"kDa",
"Wip1",
"protein",
"localizes",
"to",
"the",
"nucleus",
"-LSB-",
"13",
"-RSB-",
".",
"The",
"605",
"amino",
"acid",
"human",
"Wip1",
"protein",
"sequence",
"can",
"be",
"subdivided",
"into",
"two",
"major",
"domains",
",",
"a",
"highly",
"conserved",
"N-terminal",
"phosphatase",
"domain",
"from",
"amino",
"acids",
"1",
"--",
"375",
",",
"and",
"a",
"less",
"conserved",
"non-catalytic",
"domain",
"extending",
"from",
"amino",
"acids",
"376",
"--",
"605",
".",
"This",
"C-terminal",
"domain",
"of",
"Wip1",
"may",
"facilitate",
"nuclear",
"localization",
".",
"However",
",",
"although",
"this",
"domain",
"contains",
"two",
"putative",
"nuclear",
"localization",
"signals",
",",
"mutation",
"of",
"these",
"motifs",
"failed",
"to",
"prevent",
"nuclear",
"localization",
"-LSB-",
"14",
"-RSB-",
".",
"In",
"addition",
",",
"the",
"C-terminal",
"domain",
"shows",
"high",
"conservation",
"among",
"mammalian",
"Wip1s",
"and",
"limited",
"conservation",
"with",
"non-mammalian",
"Wip1",
"molecules",
",",
"but",
"little",
"or",
"no",
"similarity",
"with",
"other",
"phosphatases",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"The",
"phosphatase",
"domain",
"of",
"Wip1",
"shows",
"the",
"highest",
"levels",
"of",
"similarity",
"to",
"the",
"type",
"2C",
"family",
"of",
"serine/threonine",
"protein",
"phosphatases",
"-LRB-",
"PP2C",
"-RRB-",
",",
"consistent",
"with",
"its",
"observed",
"biochemical",
"activities",
"-LRB-",
"Fig.",
"1",
"-LRB-",
"b",
"-RRB-",
"-RRB-",
"-LSB-",
"13",
",",
"15",
"-RSB-",
".",
"Fig.",
"1Protein",
"sequence",
"alignment",
"of",
"human",
"Wip1",
"and",
"human",
"PP2Cα",
".",
"-LRB-",
"a",
"-RRB-",
"The",
"overall",
"structures",
"of",
"Wip1",
"-LRB-",
"top",
"-RRB-",
"and",
"PP2Cα",
"-LRB-",
"bottom",
"-RRB-",
"show",
"significant",
"similarity",
".",
"The",
"conserved",
"type",
"2C",
"phosphatase",
"domain",
"is",
"shaded",
"in",
"Wip1",
".",
"The",
"regions",
"of",
"more",
"highly",
"conserved",
"sequences",
"labeled",
"I",
",",
"II",
",",
"and",
"III",
"are",
"shown",
"as",
"black",
"blocks",
".",
"The",
"C-terminal",
"non-catalytic",
"domain",
"that",
"is",
"present",
"only",
"in",
"Wip1",
"molecules",
"-LRB-",
"and",
"is",
"also",
"well",
"conserved",
"among",
"mammalian",
"Wip1",
"orthologues",
"-RRB-",
"is",
"indicated",
"by",
"the",
"white",
"block",
".",
"A",
"putative",
"nuclear",
"localization",
"signal",
"-LRB-",
"NLS",
"-RRB-",
"is",
"also",
"indicated",
"near",
"the",
"C-terminus",
"of",
"Wip1",
".",
"-LRB-",
"b",
"-RRB-",
"Primary",
"amino",
"acid",
"sequence",
"alignment",
"between",
"human",
"Wip1",
"and",
"human",
"PP2Cα",
"phosphatase",
"domains",
"is",
"shown",
".",
"Identical",
"amino",
"acids",
"are",
"highlighted",
"with",
"a",
"black",
"background",
"while",
"conservative",
"amino",
"acid",
"substitutions",
"are",
"indicated",
"with",
"a",
"gray",
"background",
".",
"The",
"phosphatase",
"domains",
"of",
"the",
"two",
"molecules",
"show",
"30",
"%",
"identity",
"and",
"45",
"%",
"similarity",
"Using",
"the",
"human",
"Wip1",
"cDNA",
"as",
"a",
"probe",
",",
"our",
"laboratory",
"isolated",
"the",
"murine",
"Wip1",
"gene",
"and",
"mapped",
"it",
"to",
"mouse",
"chromosome",
"11",
"-LSB-",
"16",
"-RSB-",
".",
"The",
"human",
"Wip1",
"gene",
"is",
"located",
"on",
"chromosome",
"17q22/q23",
"-LSB-",
"17",
"-RSB-",
".",
"The",
"murine",
"Wip1",
"protein",
"contains",
"598",
"amino",
"acids",
"and",
"migrates",
"at",
"approximately",
"66",
"kDa",
"on",
"a",
"SDS-PAGE",
"gel",
"-LSB-",
"16",
"-RSB-",
".",
"The",
"murine",
"and",
"human",
"Wip1",
"protein",
"sequences",
"have",
"an",
"overall",
"identity",
"of",
"83",
"%",
"and",
"an",
"overall",
"similarity",
"of",
"86",
"%",
".",
"RT-PCR",
"and",
"Northern",
"blot",
"analyses",
"revealed",
"that",
"the",
"Wip1",
"mRNA",
"is",
"ubiquitously",
"expressed",
"in",
"all",
"mouse",
"embryonic",
"and",
"adult",
"tissues",
",",
"with",
"a",
"very",
"high",
"level",
"of",
"expression",
"in",
"the",
"testis",
".",
"Wip1",
"mRNA",
"levels",
"fluctuate",
"during",
"development",
"-LSB-",
"16",
"-RSB-",
".",
"Wip1",
"is",
"a",
"type",
"2C",
"phosphatase",
"Wip1",
"is",
"a",
"member",
"of",
"the",
"magnesium-dependent",
"serine/threonine",
"protein",
"phosphatase",
"-LRB-",
"PPM",
"-RRB-",
"family",
"-LSB-",
"18",
",",
"19",
"-RSB-",
".",
"This",
"is",
"a",
"large",
"and",
"varied",
"family",
"of",
"protein",
"phosphatases",
"present",
"in",
"both",
"prokaryotes",
"and",
"eukaryotes",
",",
"whose",
"defining",
"member",
"is",
"PP2Cα",
"-LSB-",
"20",
",",
"21",
"-RSB-",
".",
"To",
"date",
",",
"18",
"human",
"PPM/PP2C",
"genes",
"have",
"been",
"identified",
"-LSB-",
"19",
"-RSB-",
".",
"In",
"prokaryotes",
"and",
"eukaryotes",
",",
"the",
"PPM/PP2C",
"family",
"of",
"phosphatases",
"plays",
"a",
"role",
"in",
"regulating",
"stress",
"response",
"pathways",
"-LSB-",
"18",
",",
"20",
",",
"21",
"-RSB-",
".",
"Like",
"other",
"PPM/PP2C",
"family",
"members",
",",
"Wip1",
"is",
"a",
"monomeric",
"enzyme",
"that",
"requires",
"divalent",
"cations",
",",
"mainly",
"Mg2",
"+",
"or",
"Mn2",
"+",
",",
"for",
"catalytic",
"efficacy",
"and",
"is",
"insensitive",
"to",
"okadaic",
"acid",
",",
"a",
"potent",
"inhibitor",
"of",
"the",
"PP1",
"and",
"PP2A",
"phosphatases",
"-LSB-",
"18",
",",
"20",
",",
"21",
"-RSB-",
".",
"Using",
"a",
"BLAST",
"search",
"of",
"the",
"sequence",
"database",
",",
"human",
"Wip1",
"shows",
"an",
"overall",
"identity",
"of",
"30",
"%",
"and",
"an",
"overall",
"similarity",
"of",
"45",
"%",
"to",
"human",
"PP2Cα",
"and",
"PP2Cβ",
"-LRB-",
"Fig.",
"1",
"-LRB-",
"b",
"-RRB-",
"-RRB-",
".",
"Like",
"PP2Cα",
"and",
"PP2Cβ",
",",
"Wip1",
"also",
"negatively",
"regulates",
"the",
"stress",
"responsive",
"p38",
"mitogen-activated",
"protein",
"kinase",
"-LRB-",
"MAPK",
"-RRB-",
"pathway",
"by",
"directly",
"inactivating",
"p38",
"through",
"dephosphorylation",
"of",
"phosphothreonine",
"180",
"of",
"the",
"regulatory",
"pTXpY",
"motif",
"found",
"in",
"the",
"activation",
"loop",
"of",
"the",
"kinase",
"-LSB-",
"11",
",",
"22",
",",
"23",
"-RSB-",
".",
"Based",
"on",
"the",
"sequence",
"homology",
"between",
"Wip1",
"and",
"PP2Cα",
",",
"β",
",",
"and",
"γ",
",",
"Yamaguchi",
"et",
"al.",
"-LSB-",
"15",
"-RSB-",
"developed",
"a",
"structural",
"model",
"for",
"the",
"catalytic",
"domain",
"of",
"Wip1",
".",
"From",
"these",
"studies",
",",
"Arg76",
"of",
"human",
"Wip1",
"-LRB-",
"Arg69",
"of",
"mouse",
"Wip1",
"-RRB-",
"aligned",
"with",
"Arg33",
"of",
"PP2Cα",
",",
"suggesting",
"that",
"Arg76",
"of",
"human",
"Wip1",
"performs",
"the",
"same",
"role",
"as",
"the",
"catalytic",
"Arg33",
"of",
"PP2Cα",
".",
"Substrate",
"specificity",
"studies",
"indicated",
"that",
"peptides",
"containing",
"pSXpY",
"inhibit",
"Wip1",
",",
"while",
"pTXpY",
"peptides",
"are",
"Wip1",
"substrates",
"-LSB-",
"24",
"-RSB-",
".",
"Sequences",
"on",
"either",
"side",
"of",
"the",
"pTXpY",
"motif",
"did",
"not",
"greatly",
"affect",
"Wip1",
"activity",
",",
"but",
"the",
"residue",
"-LRB-",
"X",
"-RRB-",
"lying",
"between",
"the",
"two",
"conserved",
"phospho-acceptors",
"affected",
"Wip1",
"affinity",
"and",
"correlated",
"with",
"selectivity",
"for",
"MAP",
"kinases",
".",
"From",
"these",
"studies",
"a",
"specific",
"Wip1",
"inhibitor",
"was",
"developed",
",",
"and",
"using",
"simulations",
"with",
"the",
"proposed",
"structural",
"model",
"of",
"Wip1",
",",
"the",
"phospho-Ser",
"of",
"the",
"inhibitor",
"was",
"shown",
"to",
"be",
"in",
"contact",
"with",
"the",
"proposed",
"catalytic",
"Arg76",
",",
"thus",
"blocking",
"its",
"interaction",
"with",
"potential",
"targets",
"-LSB-",
"24",
"-RSB-",
".",
"While",
"the",
"specificity",
"of",
"Wip1",
"for",
"pTXpY",
"motifs",
"is",
"clear",
"from",
"biochemical",
"and",
"cell",
"biology",
"studies",
"-LSB-",
"11",
",",
"15",
",",
"24",
",",
"25",
"-RSB-",
",",
"the",
"recent",
"identification",
"of",
"targets",
"in",
"which",
"Wip1",
"dephosphorylates",
"sites",
"modified",
"by",
"ATM/ATR",
"indicates",
"an",
"additional",
"specificity",
".",
"ATM",
"and",
"ATR",
"phosphorylate",
"pS/pTQ",
"sites",
"in",
"over",
"700",
"proteins",
"in",
"the",
"cell",
"-LSB-",
"4",
"-RSB-",
"and",
"Wip1",
"has",
"been",
"shown",
"to",
"dephosphorylate",
"pS/pTQ",
"sites",
"in",
"vitro",
"and",
"in",
"vivo",
"on",
"at",
"least",
"five",
"proteins",
",",
"ATM",
",",
"Chk1",
",",
"Chk2",
",",
"p53",
",",
"and",
"Mdm2",
"-LRB-",
"see",
"Fig.",
"2",
"-RRB-",
"-LSB-",
"7",
"--",
"9",
",",
"26",
"-RSB-",
".",
"Identification",
"of",
"Wip1",
"targets",
"reveals",
"it",
"to",
"be",
"a",
"homeostatic",
"regulator",
"of",
"the",
"DNA",
"damage",
"response",
"Wip1",
"dephosphorylates",
"DNA",
"damage",
"response/repair",
"proteins",
"at",
"TXY",
"motifs",
"Once",
"Wip1",
"was",
"shown",
"to",
"be",
"a",
"serine/threonine",
"phosphatase",
",",
"it",
"was",
"clear",
"that",
"its",
"functional",
"roles",
"might",
"best",
"be",
"understood",
"by",
"identifying",
"Wip1",
"target",
"proteins",
"and",
"dephosphorylation",
"sites",
".",
"Since",
"the",
"discovery",
"of",
"Wip1",
",",
"at",
"least",
"seven",
"Wip1",
"dephosphorylation",
"targets",
"have",
"been",
"definitively",
"identified",
".",
"These",
"are",
"listed",
"in",
"Table",
"1",
".",
"Note",
"that",
"on",
"the",
"seven",
"target",
"proteins",
",",
"two",
"distinct",
"motifs",
"appear",
"to",
"be",
"dephosphorylated",
"by",
"Wip1",
",",
"pTXpY",
"and",
"pS/pTQ",
".",
"One",
"key",
"commonality",
"is",
"their",
"importance",
"in",
"the",
"cellular",
"DNA",
"damage/repair",
"response",
".",
"Wip1",
"acts",
"as",
"an",
"inhibitor",
"or",
"homeostatic",
"regulator",
"of",
"the",
"DNA",
"damage",
"response",
",",
"facilitating",
"the",
"return",
"of",
"the",
"cell",
"to",
"a",
"normal",
"pre-stress",
"state",
"following",
"repair",
"of",
"the",
"DNA",
"damage",
".",
"As",
"indicated",
"in",
"Table",
"1",
",",
"five",
"of",
"the",
"seven",
"identified",
"dephosphorylation",
"targets",
"are",
"phosphorylated",
"by",
"the",
"PIKKs",
"ATM",
"and",
"ATR",
",",
"which",
"are",
"key",
"sensor",
"proteins",
"that",
"activate",
"numerous",
"components",
"of",
"the",
"DNA",
"damage",
"response",
"pathways",
"in",
"the",
"cell",
".",
"We",
"hypothesize",
"that",
"Wip1",
"serves",
"as",
"a",
"major",
"off",
"switch",
"for",
"the",
"ATM/ATR-initiated",
"DNA",
"damage",
"signaling",
"cascade",
"-LSB-",
"7",
",",
"26",
"-RSB-",
".",
"Note",
"also",
"that",
"six",
"of",
"the",
"seven",
"Wip1",
"targets",
"are",
"important",
"regulators",
"of",
"p53",
"function",
".",
"The",
"four",
"kinases",
"p38",
",",
"Chk1",
",",
"Chk2",
",",
"and",
"ATM",
"all",
"phosphorylate",
"p53",
"and",
"promote",
"its",
"activation",
"-LSB-",
"27",
"--",
"30",
"-RSB-",
".",
"Wip1",
"dephosphorylation",
"of",
"these",
"p53",
"kinases",
"decreases",
"their",
"intrinsic",
"activity",
".",
"Dephosphorylation",
"of",
"p53",
"at",
"serine",
"15",
"by",
"Wip1",
"also",
"contributes",
"to",
"p53",
"degradation",
",",
"as",
"does",
"dephosphorylation",
"of",
"Mdm2",
",",
"which",
"stabilizes",
"Mdm2",
",",
"an",
"E3",
"ubiquitin",
"ligase",
"specific",
"for",
"p53",
"-LSB-",
"31",
"-RSB-",
".",
"Thus",
",",
"Wip1",
"appears",
"to",
"be",
"a",
"critical",
"inhibitor",
"of",
"p53",
"function",
"and",
"such",
"effects",
"are",
"likely",
"to",
"play",
"a",
"major",
"role",
"in",
"Wip1",
"oncogenicity",
"-LRB-",
"see",
"below",
"-RRB-",
".",
"In",
"this",
"section",
",",
"we",
"will",
"describe",
"the",
"proteins",
",",
"which",
"have",
"been",
"identified",
"as",
"targets",
"for",
"dephosphorylation",
"by",
"Wip1",
"and",
"how",
"Wip1",
"regulates",
"the",
"function",
"-LRB-",
"s",
"-RRB-",
"of",
"these",
"proteins",
".",
"Table",
"1Identified",
"Wip1",
"dephosphorylation",
"targetsProteinSiteaMotifKinaseProtein",
"functionWip1",
"effectsp53",
"effect?Referencep38",
"MAPKT180TXYMKK3/6Stress",
"responseDec",
".",
"kinase",
"activityYes",
"-LRB-",
"dec.",
"-RRB-",
"Takekawa",
"et",
"al.",
"-LSB-",
"11",
"-RSB-",
"UNG2T6TXY?Base",
"excision",
"repairDec",
".",
"uracil",
"excisionNoLu",
"et",
"al.",
"-LSB-",
"25",
"-RSB-",
"Chk1S345S/TQATRDNA",
"damage",
"responseDec",
".",
"kinase",
"activityYes",
"-LRB-",
"dec.",
"-RRB-",
"Lu",
"et",
"al.",
"-LSB-",
"10",
"-RSB-",
"p53S15S/TQATMDNA",
"damage",
"responseDec",
".",
"apoptosisYes",
"-LRB-",
"dec.",
"-RRB-",
"Lu",
"et",
"al.",
"-LSB-",
"10",
"-RSB-",
"Chk2T68bS/T/QATMDNA",
"damage",
"responseDec",
".",
"kinase",
"activityYes",
"-LRB-",
"dec.",
"-RRB-",
"Fujimoto",
"et",
"al.",
"-LSB-",
"9",
"-RSB-",
"ATMS1981S/TQATMcDNA",
"damage",
"responseDec",
".",
"kinase",
"activityYes",
"-LRB-",
"dec.",
"-RRB-",
"Shreeram",
"et",
"al.",
"-LSB-",
"7",
"-RSB-",
"Mdm2S395S/TQATMp53",
"regulationDec",
".",
"p53",
"levelsYes",
"-LRB-",
"dec.",
"-RRB-",
"Lu",
"et",
"al.",
"-LSB-",
"8",
"-RSB-",
"aListed",
"sites",
"are",
"from",
"the",
"human",
"proteins",
";",
"mouse",
"sites",
"-LRB-",
"e.g.",
"p53",
"S18",
"or",
"ATM",
"S1987",
"-RRB-",
"may",
"be",
"at",
"different",
"amino",
"acid",
"codonsbAlso",
"sites",
"Ser19",
",",
"Ser33/35",
",",
"Thr68",
",",
"and",
"Thr432cActivated",
"ATM",
"autophosphorylates",
"itself",
"at",
"S1981",
";",
"S367",
"also",
"dephosphorylated",
"by",
"Wip1",
"TXY",
"motif",
":",
"p38",
"The",
"first",
"identified",
"target",
"of",
"Wip1",
"was",
"the",
"p38",
"mitogen-activated",
"protein",
"kinase",
"-LRB-",
"p38",
"MAP",
"kinase",
"-RRB-",
"-LSB-",
"11",
"-RSB-",
".",
"Genotoxic",
"stress",
"such",
"as",
"UV",
"radiation",
"causes",
"activation",
"of",
"p38",
"MAP",
"kinase",
"by",
"dual",
"phosphorylation",
"on",
"Thr180",
"and",
"Tyr182",
"-LSB-",
"32",
",",
"33",
"-RSB-",
".",
"The",
"phosphorylated",
"p38",
",",
"in",
"turn",
",",
"phosphorylates",
"p53",
"on",
"Ser15",
",",
"Ser33",
",",
"Ser46",
"and",
"Ser392",
"and",
"increases",
"p53",
"activities",
",",
"including",
"gene",
"transcription",
"and",
"apoptosis",
"-LSB-",
"28",
",",
"34",
",",
"35",
"-RSB-",
".",
"p38",
"was",
"shown",
"to",
"interact",
"with",
"Wip1",
"and",
"to",
"be",
"dephosphorylated",
"by",
"Wip1",
"on",
"its",
"Thr180",
"residue",
"-LSB-",
"11",
"-RSB-",
".",
"Wip1",
"dephosphorylation",
"of",
"p38",
"was",
"associated",
"with",
"reduced",
"nuclear",
"localization",
"of",
"p38",
"and",
"reduced",
"kinase",
"activity",
"towards",
"Ser33",
"and",
"Ser46",
"of",
"p53",
"-LSB-",
"11",
"-RSB-",
".",
"Dephosphorylation",
"of",
"Ser33",
"and",
"Ser46",
"on",
"p53",
"was",
"accompanied",
"by",
"reduced",
"p53",
"transcriptional",
"activation",
"activity",
"and",
"reduced",
"p53-mediated",
"apoptotic",
"function",
"following",
"UV",
"irradiation",
".",
"Thus",
",",
"Wip1",
"inhibits",
"UV-induced",
"phosphorylation",
"of",
"p53",
"on",
"Ser33",
"and",
"Ser46",
"via",
"p38",
"downregulation",
",",
"functioning",
"as",
"a",
"mediator",
"in",
"a",
"p53",
"negative",
"feedback",
"regulatory",
"loop",
".",
"TXY",
"motif",
":",
"UNG2",
"Uracil",
"is",
"a",
"common",
"DNA",
"lesion",
"formed",
"by",
"deamination",
"of",
"cytosine",
"or",
"misincorporation",
"of",
"dUMP",
",",
"leading",
"to",
"transition",
"mutations",
"or",
"generation",
"of",
"AP",
"sites",
"-LRB-",
"apurinic/apyrimidinic",
"sites",
"-RRB-",
"in",
"the",
"genome",
".",
"Such",
"lesions",
"are",
"repaired",
"by",
"base",
"excision",
"repair",
"-LRB-",
"BER",
"-RRB-",
"that",
"is",
"initiated",
"by",
"a",
"uracil",
"DNA",
"glycosylase",
"-LSB-",
"36",
"-RSB-",
".",
"At",
"least",
"four",
"different",
"mammalian",
"uracil",
"DNA",
"glycosylases",
"have",
"been",
"identified",
".",
"Of",
"these",
",",
"the",
"nuclear",
"UNG2",
"encoded",
"by",
"the",
"UNG",
"gene",
"is",
"the",
"major",
"enzyme",
"responsible",
"for",
"removing",
"uracil",
"and",
"creating",
"an",
"apyrimidinic",
"site",
"for",
"further",
"repair",
"processing",
"-LSB-",
"36",
"-RSB-",
".",
"To",
"identify",
"Wip1",
"interacting",
"proteins",
",",
"our",
"laboratory",
"performed",
"bacterial",
"two-hybrid",
"assays",
"with",
"Wip1",
"bait",
"constructs",
"and",
"we",
"repeatedly",
"pulled",
"down",
"UNG2",
"as",
"a",
"major",
"interactor",
".",
"In",
"vitro",
"and",
"in",
"vivo",
"interaction",
"studies",
"by",
"us",
"and",
"global",
"human",
"interactome",
"screens",
"by",
"others",
"confirmed",
"that",
"UNG2",
"is",
"a",
"Wip1",
"interacting",
"protein",
"-LSB-",
"25",
",",
"37",
"-RSB-",
".",
"Analysis",
"of",
"the",
"UNG2",
"sequence",
"revealed",
"two",
"TXY",
"motifs",
"at",
"Thr6",
"and",
"Thr126",
",",
"which",
"show",
"similarities",
"to",
"the",
"Wip1",
"target",
"site",
"on",
"p38",
"MAP",
"kinase",
".",
"We",
"utilized",
"UNG2",
"phosphothreonine",
"6",
"and",
"126",
"specific",
"antibodies",
"generated",
"by",
"the",
"Appella",
"laboratory",
"to",
"show",
"that",
"UV",
"irradiation",
"induced",
"UNG2",
"phosphorylation",
"at",
"both",
"Thr",
"residues",
"and",
"that",
"this",
"enhances",
"UNG2",
"enzymatic",
"activity",
".",
"Of",
"these",
"two",
"target",
"residues",
",",
"only",
"Thr6",
"was",
"dephosphorylated",
"by",
"Wip1",
"in",
"cells",
".",
"Dephosphorylation",
"of",
"UNG2",
"by",
"Wip1",
"resulted",
"in",
"reduced",
"uracil-associated",
"DNA",
"incision",
"activity",
",",
"a",
"critical",
"step",
"in",
"BER",
"-LSB-",
"25",
"-RSB-",
".",
"Moreover",
",",
"we",
"were",
"able",
"to",
"show",
"that",
"human",
"cell",
"lines",
"overexpressing",
"a",
"Wip1",
"expression",
"construct",
"exhibited",
"reduced",
"global",
"BER",
"activity",
",",
"while",
"the",
"same",
"cells",
"transfected",
"with",
"Wip1",
"siRNA",
"exhibited",
"enhanced",
"global",
"BER",
"activity",
",",
"indicating",
"Wip1",
"inhibits",
"base",
"excision",
"repair",
",",
"in",
"part",
"by",
"dephosphorylating",
"UNG2",
"-LSB-",
"25",
",",
"38",
"-RSB-",
".",
"Wip1",
"dephosphorylates",
"DNA",
"damage",
"response",
"proteins",
"at",
"S/TQ",
"motifs",
"S/TQ",
"motif",
":",
"Chk1",
",",
"Chk2",
"The",
"checkpoint",
"kinases",
"Chk1",
"and",
"Chk2",
"are",
"evolutionarily",
"conserved",
"kinases",
"which",
"play",
"a",
"crucial",
"role",
"in",
"regulating",
"DNA",
"damage",
"responses",
"-LSB-",
"39",
"-RSB-",
".",
"In",
"response",
"to",
"DNA",
"damage",
"or",
"replicative",
"stress",
",",
"Chk1",
"is",
"phosphorylated",
"on",
"Ser317",
"and",
"Ser345",
"mainly",
"by",
"the",
"ATR",
"kinase",
"-LSB-",
"40",
"-RSB-",
".",
"The",
"phosphorylation",
"on",
"these",
"two",
"serine",
"residues",
"is",
"a",
"critical",
"event",
"for",
"Chk1",
"activation",
"in",
"that",
"mutants",
"of",
"Chk1",
"in",
"which",
"Ser317",
"and",
"Ser345",
"residues",
"were",
"replaced",
"with",
"alanine",
"showed",
"poor",
"kinase",
"activity",
".",
"Following",
"activation",
",",
"Chk1",
"phosphorylates",
"and",
"inactivates",
"Cdc25",
"phosphatase",
"family",
"members",
"to",
"facilitate",
"cell",
"cycle",
"arrest",
"-LSB-",
"41",
"-RSB-",
".",
"Chk2",
"activation",
"is",
"a",
"multistep",
"process",
"initiated",
"by",
"phosphorylation",
"on",
"Thr68",
"mainly",
"by",
"ATM",
"in",
"response",
"to",
"DNA",
"damage",
"-LSB-",
"42",
",",
"43",
"-RSB-",
".",
"Although",
"Thr68",
"phosphorylation",
"is",
"not",
"the",
"only",
"requirement",
"for",
"full",
"activation",
"of",
"Chk2",
",",
"the",
"T68A",
"mutation",
"significantly",
"reduced",
"Chk2",
"kinase",
"activity",
"-LSB-",
"44",
"-RSB-",
".",
"Activated",
"Chk2",
"targets",
"a",
"variety",
"of",
"proteins",
"involved",
"in",
"cell",
"cycle",
"control",
",",
"DNA",
"repair",
"and",
"apoptosis",
",",
"including",
"p53",
",",
"BRCA1",
",",
"PML",
",",
"E2F-1",
",",
"and",
"the",
"Cdc25",
"phosphatase",
"family",
".",
"Notably",
",",
"ATR-Chk1",
"and",
"ATM-Chk2",
"pathways",
"are",
"not",
"strictly",
"separated",
"but",
"rather",
"highly",
"connected",
"and",
"coordinated",
"as",
"evidenced",
"by",
"ATM-dependent",
"phosphorylation",
"of",
"Chk1",
"in",
"response",
"to",
"ionizing",
"radiation",
"-LSB-",
"45",
"-RSB-",
",",
"ATM-independent",
"activation",
"of",
"Chk2",
"-LSB-",
"46",
"-RSB-",
",",
"and",
"ATR",
"activation",
"regulated",
"by",
"ATM",
"-LSB-",
"47",
",",
"48",
"-RSB-",
".",
"The",
"identification",
"of",
"Chk1",
"as",
"a",
"Wip1",
"target",
"followed",
"co-immunoprecipitation",
"experiments",
"in",
"our",
"laboratory",
"that",
"showed",
"that",
"Wip1",
"consistently",
"bound",
"Chk1",
"in",
"cells",
"-LSB-",
"10",
"-RSB-",
".",
"In",
"vitro",
"phosphatase",
"assays",
"showed",
"that",
"Wip1",
"dephosphorylated",
"Chk1",
"at",
"Ser345",
",",
"but",
"not",
"Ser317",
".",
"In",
"vivo",
"assays",
"demonstrated",
"that",
"overexpressed",
"Wip1",
"suppressed",
"UV-induced",
"phosphorylation",
"of",
"Chk1",
"Ser345",
"while",
"Wip1",
"siRNA",
"enhanced",
"Chk1",
"Ser345",
"phosphorylation",
"compared",
"to",
"controls",
".",
"Importantly",
",",
"dephosphorylation",
"of",
"Chk1",
"at",
"Ser345",
"resulted",
"in",
"reduced",
"Chk1",
"kinase",
"ability",
"on",
"Chk1",
"targets",
"such",
"as",
"Cdc25C",
".",
"Since",
"Chk1",
"is",
"an",
"important",
"cell",
"cycle",
"checkpoint",
"protein",
",",
"we",
"also",
"assessed",
"the",
"effects",
"of",
"either",
"increasing",
"or",
"decreasing",
"Wip1",
"expression",
"on",
"G2/M",
"and",
"intra-S",
"phase",
"checkpoints",
".",
"As",
"expected",
",",
"increased",
"levels",
"of",
"Wip1",
"abrogated",
"G2/M",
"and",
"intra-S",
"phase",
"checkpoints",
",",
"while",
"decreased",
"levels",
"of",
"Wip1",
"enhanced",
"G2/M",
"and",
"intra-S",
"phase",
"checkpoints",
"induced",
"by",
"both",
"UV",
"and",
"IR",
"treatment",
"of",
"cells",
"-LSB-",
"10",
"-RSB-",
".",
"Because",
"Chk1",
"phosphorylates",
"and",
"activates",
"p53",
",",
"the",
"inhibition",
"of",
"Chk1",
"by",
"Wip1",
"also",
"places",
"Wip1",
"in",
"a",
"negative",
"feedback",
"regulatory",
"loop",
"for",
"p53",
"-LRB-",
"Fig.",
"2",
"-RRB-",
"-LSB-",
"26",
"-RSB-",
".",
"Fig.",
"2Wip1",
"inhibits",
"p53",
"activity",
"by",
"multiple",
"mechanisms",
".",
"When",
"a",
"cell",
"is",
"stressed",
"by",
"DNA",
"damage",
",",
"ATM",
",",
"ATR",
",",
"and",
"p38",
"MAP",
"kinase",
"can",
"phosphorylate",
"p53",
"directly",
"or",
"through",
"intermediary",
"proteins",
"such",
"as",
"Chk1",
"and",
"Chk2",
".",
"Phosphorylated",
"p53",
"localizes",
"to",
"the",
"nucleus",
"and",
"transactivates",
"a",
"battery",
"of",
"anti-proliferative",
"genes",
".",
"In",
"addition",
",",
"two",
"p53",
"autoregulatory",
"genes",
"are",
"activated",
",",
"Mdm2",
"and",
"Wip1",
".",
"Mdm2",
"is",
"an",
"E3",
"ubiquitin",
"ligase",
"that",
"promotes",
"p53",
"degradation",
".",
"However",
",",
"early",
"after",
"the",
"DNA",
"damage",
"response",
"ATM",
"-LRB-",
"and",
"possibly",
"ATR",
"-RRB-",
"phosphorylate",
"Mdm2",
"and",
"this",
"promotes",
"Mdm2",
"degradation",
"and",
"prevents",
"Mdm2",
"mediated",
"p53",
"degradation",
".",
"Activated",
"p53",
"also",
"upregulates",
"Wip1",
"expression",
"and",
"after",
"DNA",
"damage",
"is",
"repaired",
",",
"the",
"accumulated",
"Wip1",
"phosphatase",
"inhibits",
"a",
"battery",
"of",
"proteins",
"that",
"activate",
"p53",
".",
"Wip1",
"dephosphorylates",
"the",
"upstream",
"kinases",
"that",
"phosphorylate",
"p53",
"-LRB-",
"ATM",
",",
"p38",
",",
"Chk1",
",",
"Chk2",
"-RRB-",
"and",
"p53",
"itself",
"-LRB-",
"at",
"Ser15",
"-RRB-",
".",
"In",
"addition",
",",
"Wip1",
"dephosphorylates",
"Mdm2",
"at",
"Ser395",
"and",
"this",
"results",
"in",
"Mdm2",
"stabilization",
"and",
"Mdm2",
"mediated",
"p53",
"degradation",
".",
"Finally",
",",
"increased",
"Wip1",
"levels",
"suppresses",
"ARF",
"which",
"in",
"turn",
"results",
"in",
"increased",
"Mdm2",
"activity",
"and",
"p53",
"proteolysis",
".",
"The",
"resulting",
"destabilization",
"of",
"p53",
"helps",
"return",
"the",
"normal",
"cell",
"to",
"a",
"pre-stress",
"state",
"after",
"cellular",
"damage",
"is",
"repaired",
".",
"However",
",",
"if",
"Wip1",
"becomes",
"amplified",
"or",
"overexpressed",
"during",
"tumor",
"cell",
"progression",
",",
"this",
"could",
"result",
"in",
"chronic",
"suppression",
"of",
"p53",
"activity",
"and",
"promote",
"tumorigenesis",
".",
"In",
"the",
"figure",
",",
"proteins",
"are",
"indicated",
"by",
"circles",
"or",
"octagons",
"and",
"genes",
"are",
"indicated",
"by",
"rectangles",
".",
"Small",
"circles",
"marked",
"with",
"P",
"indicate",
"phosphorylation",
"sites",
".",
"Black",
"lines",
"indicate",
"early",
"events",
"in",
"the",
"DNA",
"damage",
"response",
"and",
"gray",
"lines",
"show",
"later",
"homeostatic",
"events",
"in",
"the",
"damage",
"response",
"Chk2",
"was",
"also",
"shown",
"to",
"directly",
"interact",
"with",
"Wip1",
"in",
"vitro",
"and",
"in",
"vivo",
"by",
"Fujimoto",
"et",
"al.",
"-LSB-",
"9",
"-RSB-",
".",
"These",
"investigators",
"showed",
"that",
"Thr68",
",",
"which",
"is",
"phosphorylated",
"by",
"ATM",
"after",
"IR",
"treatment",
",",
"is",
"dephosphorylated",
"efficiently",
"by",
"Wip1",
".",
"Moreover",
",",
"Wip1",
"also",
"dephosphorylated",
"several",
"other",
"S/TQ",
"sites",
"within",
"Chk2",
".",
"Overexpression",
"of",
"Wip1",
"was",
"shown",
"to",
"suppress",
"Chk2",
"kinase",
"activity",
"towards",
"its",
"substrate",
"Cdc25C",
",",
"while",
"inhibition",
"of",
"Wip1",
"resulted",
"in",
"both",
"increased",
"and",
"prolonged",
"Chk2",
"kinase",
"activity",
"following",
"IR",
".",
"Interestingly",
",",
"treatment",
"of",
"gamma-irradiated",
"cells",
"with",
"Wip1",
"siRNA",
"enhanced",
"IR-induced",
"apoptosis",
",",
"suggesting",
"that",
"Wip1",
"negatively",
"regulates",
"irradiation-induced",
"apoptosis",
"by",
"dephosphorylating",
"and",
"inactivating",
"Chk2",
".",
"Several",
"laboratories",
"have",
"corroborated",
"the",
"inhibition",
"of",
"Chk2",
"activity",
"by",
"Wip1",
"and",
"have",
"shown",
"that",
"cancer",
"cells",
"with",
"amplified",
"Wip1",
"show",
"reduced",
"Chk2",
"activity",
"-LSB-",
"14",
",",
"49",
"--",
"51",
"-RSB-",
".",
"S/TQ",
"motif",
":",
"p53",
"The",
"tumor",
"suppressor",
"p53",
"is",
"a",
"central",
"node",
"in",
"the",
"DNA",
"damage",
"response",
"and",
"mediates",
"an",
"array",
"of",
"responses",
",",
"including",
"the",
"activation",
"of",
"multiple",
"cell",
"cycle",
"checkpoints",
",",
"DNA",
"repair",
"and",
"apoptosis",
"-LSB-",
"52",
"-RSB-",
".",
"The",
"importance",
"of",
"p53",
"in",
"cancer",
"prevention",
"is",
"supported",
"by",
"the",
"observation",
"that",
"about",
"half",
"of",
"all",
"human",
"cancer",
"patients",
"harbor",
"p53",
"mutations",
"-LSB-",
"53",
"-RSB-",
".",
"Moreover",
",",
"p53",
"deficient",
"mice",
"are",
"highly",
"susceptible",
"to",
"early",
"onset",
"spontaneous",
"tumors",
"-LSB-",
"54",
"-RSB-",
".",
"In",
"unstressed",
"cells",
",",
"p53",
"is",
"maintained",
"at",
"low",
"levels",
"as",
"a",
"result",
"of",
"Mdm2-mediated",
"ubiquitination",
"and",
"degradation",
"-LSB-",
"55",
"-RSB-",
".",
"When",
"cells",
"are",
"confronted",
"by",
"genotoxic",
"stress",
",",
"ATM",
",",
"ATR",
"and",
"Chk1/2",
"kinases",
"phosphorylate",
"p53",
".",
"This",
"phosphorylation",
",",
"along",
"with",
"modifications",
"of",
"other",
"residues",
",",
"blocks",
"the",
"p53-Mdm2",
"interaction",
",",
"leading",
"to",
"p53",
"stabilization",
"and",
"an",
"increase",
"in",
"p53",
"activity",
"-LSB-",
"56",
"-RSB-",
".",
"We",
"investigated",
"whether",
"Wip1",
"dephosphorylated",
"p53",
"at",
"Ser15",
".",
"In",
"fact",
",",
"both",
"p53",
"phosphopeptides",
"containing",
"phosphoserine",
"15",
"and",
"intact",
"immunopurified",
"p53",
"were",
"efficiently",
"dephosphorylated",
"at",
"Ser15",
"by",
"purified",
"Wip1",
"in",
"vitro",
"-LSB-",
"10",
"-RSB-",
".",
"UV-irradiated",
"cells",
"exhibited",
"reduced",
"p53",
"Ser15",
"phosphorylation",
"in",
"the",
"presence",
"of",
"overexpressed",
"Wip1",
"and",
"greatly",
"augmented",
"and",
"sustained",
"p53",
"Ser15",
"phosphorylation",
"in",
"the",
"presence",
"of",
"Wip1",
"siRNA",
".",
"As",
"expected",
",",
"increased",
"Ser15",
"phosphorylation",
"correlated",
"with",
"increased",
"p53",
"protein",
"levels",
"in",
"irradiated",
"Wip1",
"siRNA",
"treated",
"cells",
".",
"S/TQ",
"motif",
":",
"Mdm2",
"The",
"decreased",
"stability",
"of",
"p53",
"in",
"the",
"presence",
"of",
"high",
"Wip1",
"levels",
"led",
"us",
"to",
"investigate",
"whether",
"or",
"not",
"the",
"effects",
"of",
"Wip1",
"on",
"p53",
"stability",
"are",
"mediated",
"by",
"Mdm2",
".",
"Mdm2",
"is",
"an",
"E3",
"ubiquitin",
"ligase",
"that",
"specifically",
"targets",
"p53",
"for",
"destruction",
"-LSB-",
"55",
"-RSB-",
".",
"Mdm2",
"binds",
"to",
"p53",
"and",
"mediates",
"its",
"polyubiquitination",
"as",
"a",
"prelude",
"to",
"its",
"transport",
"to",
"the",
"26S",
"proteosome",
"and",
"proteolytic",
"degradation",
".",
"Importantly",
",",
"DNA",
"damage",
"results",
"in",
"ATM",
"phosphorylation",
"of",
"Mdm2",
"at",
"Ser395",
"and",
"this",
"phosphorylation",
"is",
"associated",
"with",
"Mdm2",
"destabilization",
"-LSB-",
"31",
"-RSB-",
".",
"Phosphorylation",
"at",
"this",
"site",
"also",
"inhibits",
"Mdm2",
"interactions",
"with",
"p53",
".",
"Thus",
",",
"p53",
"is",
"stabilized",
".",
"We",
"had",
"noted",
"that",
"reduction",
"of",
"Wip1",
"levels",
"corresponded",
"with",
"increased",
"sustained",
"p53",
"protein",
"levels",
"and",
"increased",
"p53",
"transcriptional",
"activity",
"after",
"IR-induced",
"DNA",
"damage",
"-LSB-",
"8",
",",
"49",
"-RSB-",
".",
"One",
"explanation",
"for",
"these",
"observations",
"was",
"that",
"Wip1",
"was",
"affecting",
"p53",
"stability",
"through",
"effects",
"on",
"Mdm2",
".",
"To",
"assess",
"this",
"possibility",
",",
"we",
"examined",
"Wip1",
"interactions",
"with",
"Mdm2",
"and",
"found",
"that",
"endogenous",
"Wip1",
"and",
"endogenous",
"Mdm2",
"could",
"form",
"protein-protein",
"interactions",
"-LSB-",
"8",
"-RSB-",
".",
"Moreover",
",",
"Wip1",
"was",
"shown",
"to",
"dephosphorylate",
"Mdm2",
"at",
"Ser395",
"both",
"in",
"vitro",
"and",
"in",
"vivo",
".",
"Dephosphorylation",
"of",
"Mdm2",
"by",
"Wip1",
"was",
"associated",
"with",
"decreased",
"Mdm2",
"self-polyubiquitination",
"and",
"increased",
"Mdm2",
"stability",
".",
"Prevention",
"of",
"Mdm2",
"Ser395",
"dephosphorylation",
"by",
"Wip1",
"siRNA",
"treatment",
"destabilized",
"Mdm2",
"following",
"irradiation",
"-LSB-",
"8",
"-RSB-",
".",
"As",
"expected",
",",
"Wip1",
"overexpression",
"increased",
"Mdm2",
"interaction",
"with",
"p53",
"and",
"increased",
"p53",
"polyubiquitination",
",",
"facilitating",
"p53",
"proteolytic",
"degradation",
".",
"Thus",
",",
"a",
"primary",
"role",
"of",
"Wip1",
"is",
"to",
"inhibit",
"p53",
"stability",
"in",
"part",
"through",
"augmenting",
"Mdm2",
"stability",
"as",
"a",
"consequence",
"of",
"Mdm2",
"Ser395",
"dephosphorylation",
"-LRB-",
"Fig.",
"2",
"-RRB-",
".",
"S/TQ",
"motif",
":",
"ATM",
"ATM",
"is",
"a",
"sensor",
"kinase",
"that",
"is",
"rapidly",
"activated",
"by",
"DNA",
"double",
"strand",
"breaks",
"in",
"part",
"through",
"autophosphorylation",
"at",
"Ser1981",
"-LRB-",
"or",
"Ser1987",
"in",
"the",
"mouse",
"-RRB-",
".",
"Activated",
"ATM",
"then",
"phosphorylates",
"a",
"diverse",
"array",
"of",
"effector",
"molecules",
"that",
"induce",
"cell",
"cycle",
"arrest",
",",
"DNA",
"repair",
",",
"DNA",
"replication",
",",
"and",
"apoptosis",
".",
"Activated",
"ATM",
"phosphorylates",
"its",
"targets",
"at",
"S/TQ",
"sites",
"and",
"it",
"has",
"recently",
"been",
"shown",
"by",
"Elledge",
"and",
"colleagues",
"in",
"a",
"global",
"proteomic",
"screen",
"that",
"ATM/ATR",
"phosphorylates",
"over",
"700",
"protein",
"targets",
"with",
"widely",
"different",
"functions",
"-LSB-",
"4",
"-RSB-",
".",
"Bulavin",
"and",
"colleagues",
"have",
"demonstrated",
"that",
"Wip1",
"null",
"mouse",
"embryo",
"fibroblasts",
"-LRB-",
"MEFs",
"-RRB-",
"treated",
"with",
"IR",
"exhibit",
"higher",
"levels",
"of",
"Ser1987",
"phosphorylation",
",",
"indicating",
"higher",
"levels",
"of",
"ATM",
"activity",
"-LSB-",
"7",
"-RSB-",
".",
"Wip1",
"was",
"shown",
"to",
"directly",
"interact",
"with",
"ATM",
"and",
"its",
"overexpression",
"resulted",
"in",
"decreased",
"levels",
"of",
"Ser1981",
"phosphorylation",
"following",
"IR",
"treatment",
".",
"Conversely",
",",
"downregulation",
"of",
"Wip1",
"using",
"siRNA",
"resulted",
"in",
"increased",
"Ser1981",
"phosphorylation",
".",
"Moreover",
",",
"immunopurified",
"ATM",
"was",
"efficiently",
"dephosphorylated",
"at",
"Ser1987",
"by",
"purified",
"Wip1",
",",
"as",
"was",
"a",
"phosphopeptide",
"derived",
"from",
"this",
"part",
"of",
"ATM",
".",
"More",
"recently",
",",
"Shreeram",
"et",
"al.",
"-LSB-",
"57",
"-RSB-",
"have",
"also",
"shown",
"that",
"Wip1",
"dephosphorylates",
"human",
"ATM",
"at",
"Ser367",
"as",
"well",
"as",
"Ser1981",
".",
"The",
"authors",
"concluded",
"that",
"Wip1",
"was",
"important",
"in",
"resetting",
"ATM",
"phosphorylation",
"after",
"repair",
"of",
"DNA",
"damage",
".",
"Wip1",
"is",
"an",
"oncogene",
"While",
"a",
"significant",
"number",
"of",
"tyrosine",
"phosphatases",
"are",
"associated",
"with",
"cancer",
"initiation",
"or",
"development",
"-LSB-",
"58",
"-RSB-",
",",
"few",
"serine/threonine",
"phosphatases",
"have",
"been",
"directly",
"associated",
"with",
"oncogenesis",
".",
"The",
"only",
"well",
"characterized",
"serine/threonine",
"phosphatase",
"involved",
"in",
"oncogenic",
"signaling",
"is",
"the",
"phosphatase",
"PP2A",
".",
"PP2A",
"has",
"tumor",
"suppressor",
"activity",
"and",
"its",
"inactivation",
"has",
"been",
"associated",
"with",
"transformation",
"of",
"human",
"primary",
"cells",
"-LSB-",
"59",
"-RSB-",
".",
"It",
"has",
"also",
"been",
"shown",
"to",
"be",
"either",
"mutated",
"or",
"downregulated",
"in",
"some",
"human",
"cancers",
".",
"Among",
"the",
"type",
"2C",
"phosphatases",
",",
"Wip1",
"appears",
"to",
"be",
"the",
"only",
"one",
"described",
"so",
"far",
"with",
"bona",
"fide",
"oncogenic",
"function",
".",
"The",
"regulatory",
"functions",
"of",
"Wip1",
"in",
"the",
"ATM-CHK1",
"/",
"2-p53",
"and",
"p38",
"MAPK-ARF/p16INK4A",
"signaling",
"pathways",
"would",
"argue",
"that",
"this",
"protein",
"may",
"possess",
"major",
"oncogenic",
"potential",
".",
"The",
"first",
"evidence",
"of",
"an",
"oncogenic",
"role",
"for",
"Wip1",
"was",
"published",
"in",
"a",
"pair",
"of",
"papers",
"by",
"Bulavin",
"et",
"al.",
"-LSB-",
"17",
"-RSB-",
"and",
"Li",
"et",
"al.",
"-LSB-",
"60",
"-RSB-",
".",
"Bulavin",
"et",
"al.",
"used",
"tissue",
"microarray",
"profiling",
"to",
"show",
"that",
"37",
"of",
"326",
"primary",
"breast",
"tumors",
"-LRB-",
"11.3",
"%",
"-RRB-",
"had",
"Wip1",
"gene",
"amplification",
".",
"Similarly",
",",
"Li",
"et",
"al.",
",",
"using",
"DNA",
"microarray",
"analysis",
",",
"showed",
"that",
"Wip1",
"was",
"amplified",
"at",
"least",
"2.5",
"fold",
"in",
"27",
"of",
"164",
"-LRB-",
"16",
"%",
"-RRB-",
"primary",
"breast",
"cancers",
".",
"Both",
"laboratories",
"demonstrated",
"that",
"overexpression",
"of",
"Wip1",
"mRNA",
"correlated",
"well",
"with",
"Wip1",
"gene",
"amplification",
".",
"Interestingly",
",",
"only",
"one",
"of",
"eight",
"tumors",
"with",
"Wip1",
"amplification",
"examined",
"by",
"Bulavin",
"et",
"al.",
"had",
"a",
"p53",
"mutation",
".",
"The",
"infrequent",
"nature",
"of",
"p53",
"mutations",
"in",
"tumors",
"with",
"Wip1",
"amplification",
"suggests",
"that",
"Wip1",
"may",
"promote",
"human",
"tumors",
"through",
"its",
"ability",
"to",
"inhibit",
"p53",
",",
"circumventing",
"selective",
"pressure",
"to",
"mutate",
"p53",
"during",
"tumor",
"progression",
".",
"Wip1",
"amplification",
"in",
"this",
"context",
"is",
"reminiscent",
"of",
"tumors",
"with",
"Mdm2",
"amplification",
",",
"where",
"Mdm2",
"promotes",
"degradation",
"of",
"p53",
"and",
"few",
"of",
"these",
"tumors",
"exhibit",
"p53",
"mutations",
"-LSB-",
"61",
"-RSB-",
".",
"Since",
"these",
"initial",
"reports",
",",
"other",
"groups",
"have",
"confirmed",
"amplification",
"and",
"overexpression",
"of",
"the",
"Wip1",
"gene",
"in",
"breast",
"cancers",
"-LSB-",
"62",
",",
"63",
"-RSB-",
".",
"Rauta",
"et",
"al.",
"-LSB-",
"62",
"-RSB-",
"showed",
"Wip1",
"gene",
"was",
"amplified",
"in",
"11",
"%",
"of",
"breast",
"cancers",
"and",
"this",
"amplification",
"was",
"highly",
"associated",
"with",
"ErbB2",
"amplification",
".",
"Moreover",
",",
"these",
"investigators",
"observed",
"that",
"breast",
"cancers",
"with",
"Wip1",
"amplification",
"had",
"a",
"significantly",
"poorer",
"prognosis",
"than",
"those",
"without",
"Wip1",
"amplification",
",",
"though",
"a",
"breast",
"cancer",
"study",
"by",
"Yu",
"et",
"al.",
"-LSB-",
"63",
"-RSB-",
"failed",
"to",
"detect",
"an",
"effect",
"of",
"Wip1",
"overexpression",
"on",
"prognosis",
".",
"In",
"addition",
"to",
"breast",
"cancers",
",",
"Wip1",
"amplification",
"and",
"overexpression",
"have",
"been",
"observed",
"in",
"ovarian",
"clear",
"cell",
"adenocarcinomas",
"-LSB-",
"64",
"-RSB-",
",",
"neuroblastomas",
"-LSB-",
"65",
"-RSB-",
",",
"pancreatic",
"adenocarcinomas",
"-LSB-",
"66",
"-RSB-",
",",
"gastric",
"carcinomas",
"-LSB-",
"51",
"-RSB-",
",",
"and",
"medulloblastomas",
"-LSB-",
"67",
"--",
"69",
"-RSB-",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"As",
"shown",
"in",
"Table",
"2",
",",
"where",
"it",
"was",
"examined",
",",
"tumors",
"with",
"Wip1",
"amplification",
"rarely",
"contained",
"p53",
"mutations",
"and",
"often",
"exhibited",
"poorer",
"prognosis",
"than",
"their",
"counterparts",
"with",
"normal",
"Wip1",
".",
"Since",
"only",
"a",
"handful",
"of",
"tumor",
"types",
"have",
"been",
"reported",
",",
"it",
"remains",
"to",
"be",
"seen",
"whether",
"Wip1",
"amplification",
"and",
"overexpression",
"occurs",
"in",
"most",
"tumor",
"types",
"or",
"only",
"in",
"a",
"subset",
".",
"Certainly",
",",
"tumors",
"with",
"a",
"low",
"frequency",
"of",
"p53",
"mutations",
"might",
"circumvent",
"p53",
"mutation",
"or",
"loss",
"by",
"Wip1",
"functional",
"inactivation",
"of",
"p53",
"and",
"these",
"tumors",
"would",
"be",
"good",
"candidates",
"for",
"further",
"investigation",
".",
"Table",
"2Human",
"tumors",
"with",
"Wip1",
"gene",
"amplification",
"and/or",
"overexpressionOrgan/TypeDNA/RNA",
"increasep53",
"mutationPrognosisaReferenceBreast",
"adenocarcinoma",
"-LRB-",
"11",
"%",
"CNGb",
";",
"ECGc",
"-RRB-",
"1/8",
"Bulavin",
"et",
"al.",
"-LSB-",
"17",
"-RSB-",
"-LRB-",
"16",
"%",
"CNG",
";",
"ECG",
"-RRB-",
"Li",
"et",
"al.",
"-LSB-",
"62",
"-RSB-",
"-LRB-",
"11",
"%",
"CNG",
";",
"ECG",
"-RRB-",
"1/10PoorerRauta",
"et",
"al.",
"-LSB-",
"64",
"-RSB-",
"-LRB-",
"35",
"%",
"Od",
"-RRB-",
"Yu",
"et",
"al.",
"-LSB-",
"65",
"-RSB-",
"Ovarian",
"clear",
"cell",
"adenocarcinoma",
"-LRB-",
"40",
"%",
"CNG",
";",
"ECG",
"-RRB-",
"PoorerHirasawa",
"et",
"al.",
"-LSB-",
"66",
"-RSB-",
"Neuroblastoma",
"-LRB-",
"92",
"%",
"CNG",
";",
"28",
"%",
"O",
"-RRB-",
"2/32PoorerSaito-Ohara",
"et",
"al.",
"-LSB-",
"67",
"-RSB-",
"Medulloblastoma",
"-LRB-",
"51",
"%",
"CNG",
";",
"88",
"%",
"O",
"-RRB-",
"PoorerMendrzyk",
"et",
"al.",
"-LSB-",
"70",
"-RSB-",
"-LRB-",
"37",
"%",
"CNG",
";",
"27",
"%",
"O",
"-RRB-",
"Ehrbrecht",
"et",
"al.",
"-LSB-",
"69",
"-RSB-",
"Gastric",
"carcinoma",
"-LRB-",
"74",
"%",
"O",
"-RRB-",
"Fuku",
"et",
"al.",
"-LSB-",
"53",
"-RSB-",
"Pancreatic",
"adenocarcinoma",
"-LRB-",
"36",
"%",
"CNG",
"-RRB-",
"PoorerLoukopoulos",
"et",
"al.",
"-LSB-",
"68",
"-RSB-",
"aPrognosis",
":",
"``",
"Poorer",
"''",
"indicates",
"individuals",
"with",
"tumors",
"with",
"increased",
"Wip1",
"copy",
"number",
"and/or",
"expression",
"have",
"significantly",
"poorer",
"prognosis",
"than",
"all",
"individuals",
"with",
"that",
"type",
"of",
"tumorbCNG",
":",
"Wip1",
"DNA",
"copy",
"number",
"gain",
"-LRB-",
"compared",
"to",
"DNA",
"in",
"normal",
"tissues",
"-RRB-",
"cECG",
":",
"increased",
"Wip1",
"RNA",
"expression",
"significantly",
"correlates",
"with",
"copy",
"number",
"gaindO",
":",
"percentage",
"of",
"tumors",
"with",
"Wip1",
"RNA",
"overexpression",
"In",
"their",
"papers",
"describing",
"the",
"initial",
"discovery",
"of",
"Wip1",
"amplification",
"and",
"overexpression",
"in",
"breast",
"cancers",
",",
"Bulavin",
"et",
"al.",
"-LSB-",
"17",
"-RSB-",
"and",
"Li",
"et",
"al.",
"-LSB-",
"60",
"-RSB-",
"were",
"also",
"able",
"to",
"show",
"that",
"Wip1",
"can",
"collaborate",
"with",
"known",
"oncogenes",
"such",
"as",
"Ras",
",",
"Myc",
"and",
"Neu",
"to",
"transform",
"rodent",
"wild",
"type",
"primary",
"fibroblasts",
"and",
"induce",
"anchorage-independent",
"growth",
"in",
"soft",
"agar",
".",
"It",
"was",
"also",
"shown",
"by",
"both",
"groups",
"that",
"overexpression",
"of",
"Wip1",
"could",
"abrogate",
"Ras-induced",
"senescence",
"of",
"primary",
"cells",
"and",
"could",
"prevent",
"apoptosis",
"induced",
"by",
"serum",
"starvation",
".",
"Interestingly",
",",
"transformation",
"assays",
"on",
"p53",
"null",
"MEFs",
"showed",
"that",
"while",
"Ras",
",",
"Neu",
"and",
"Myc",
"oncogenes",
"could",
"individually",
"transform",
"these",
"cells",
",",
"Wip1",
"could",
"not",
"-LSB-",
"17",
"-RSB-",
".",
"These",
"results",
"argued",
"that",
"Wip1",
"is",
"primarily",
"oncogenic",
"as",
"a",
"result",
"of",
"its",
"ability",
"to",
"inhibit",
"p53",
"signaling",
".",
"In",
"later",
"studies",
",",
"our",
"laboratory",
"was",
"able",
"to",
"show",
"that",
"Wip1",
"transformation",
"of",
"primary",
"rat",
"embryo",
"fibroblasts",
",",
"in",
"conjunction",
"with",
"the",
"adenoviral",
"E1A",
"oncogene",
",",
"was",
"dependent",
"on",
"the",
"phosphatase",
"activity",
"of",
"Wip1",
"-LSB-",
"49",
"-RSB-",
".",
"In",
"contrast",
"to",
"wild-type",
"Wip1",
",",
"the",
"phosphatase-dead",
"mutant",
"Wip1",
"-LRB-",
"D307A",
"-RRB-",
"failed",
"to",
"transform",
"primary",
"fibroblasts",
".",
"To",
"further",
"demonstrate",
"that",
"Wip1",
"is",
"oncogenic",
"in",
"an",
"in",
"vivo",
"context",
",",
"Demidov",
"et",
"al.",
"-LSB-",
"70",
"-RSB-",
"overexpressed",
"Wip1",
"as",
"a",
"transgene",
"in",
"the",
"mouse",
"mammary",
"gland",
".",
"While",
"the",
"Wip1",
"transgenic",
"mice",
"did",
"not",
"develop",
"spontaneous",
"mammary",
"tumors",
",",
"the",
"appearance",
"of",
"mammary",
"tumors",
"was",
"accelerated",
"when",
"these",
"animals",
"were",
"crossed",
"with",
"mammary",
"tumor",
"susceptible",
"ErbB2",
"transgenic",
"mice",
".",
"Interestingly",
",",
"the",
"tumor",
"promoting",
"effects",
"of",
"the",
"Wip1",
"transgene",
"in",
"the",
"ErbB2",
"transgenics",
"could",
"be",
"lost",
"by",
"further",
"crossing",
"in",
"a",
"constitutively",
"activated",
"MKK6",
"transgene",
"-LSB-",
"70",
"-RSB-",
".",
"MKK6",
"activates",
"p38",
"MAP",
"kinase",
"and",
"thus",
"nullifies",
"the",
"effects",
"of",
"Wip1",
"dephosphorylation",
"of",
"p38",
",",
"demonstrating",
"the",
"importance",
"of",
"Wip1",
"in",
"regulating",
"p38",
"signaling",
"as",
"well",
"as",
"p53",
"signaling",
"in",
"this",
"particular",
"model",
".",
"Mechanisms",
"of",
"Wip1",
"oncogenicity",
"Wip1",
"overexpression",
"in",
"MEFs",
"and",
"in",
"transgenic",
"mice",
"promotes",
"cell",
"transformation",
"and",
"accelerated",
"cancer",
"progression",
"-LSB-",
"17",
",",
"49",
",",
"60",
",",
"70",
"-RSB-",
".",
"Moreover",
",",
"a",
"number",
"of",
"human",
"cancers",
"contain",
"amplified",
"and",
"overexpressed",
"Wip1",
"-LRB-",
"Table",
"2",
"-RRB-",
".",
"Generally",
",",
"these",
"tumors",
"do",
"not",
"contain",
"p53",
"mutations",
",",
"suggesting",
"that",
"overexpressed",
"Wip1",
"inhibits",
"p53",
"during",
"tumor",
"progression",
",",
"consistent",
"with",
"the",
"fact",
"that",
"Wip1",
"suppresses",
"p53",
"activity",
"in",
"the",
"normal",
"cellular",
"context",
"-LRB-",
"Fig.",
"2",
"-RRB-",
".",
"As",
"an",
"alternative",
"approach",
"to",
"assess",
"Wip1",
"function",
"in",
"promoting",
"tumorigenesis",
",",
"Wip1-deficient",
"mice",
"were",
"generated",
"in",
"our",
"laboratory",
".",
"Wip1",
"null",
"mice",
"are",
"viable",
"but",
"show",
"some",
"postnatal",
"abnormalities",
",",
"including",
"variable",
"male",
"runting",
",",
"male",
"reproductive",
"organ",
"atrophy",
",",
"reduced",
"male",
"fertility",
",",
"and",
"reduced",
"male",
"longevity",
"-LSB-",
"71",
"-RSB-",
".",
"The",
"Wip1",
"null",
"mice",
"also",
"showed",
"increased",
"susceptibility",
"to",
"pathogens",
"and",
"diminished",
"T",
"-",
"and",
"B-cell",
"function",
".",
"Fibroblasts",
"derived",
"from",
"Wip1",
"null",
"embryos",
"showed",
"reduced",
"growth",
"rates",
",",
"reduced",
"colony",
"forming",
"ability",
",",
"and",
"premature",
"senescence",
"compared",
"to",
"their",
"wild-type",
"counterparts",
"-LSB-",
"12",
",",
"71",
"-RSB-",
".",
"In",
"addition",
",",
"Wip1",
"null",
"MEFs",
"exhibited",
"an",
"enhanced",
"G1",
"checkpoint",
"response",
"to",
"ionizing",
"radiation",
".",
"Bulavin",
"et",
"al.",
"-LSB-",
"12",
"-RSB-",
"showed",
"that",
"Wip1",
"null",
"fibroblasts",
"were",
"significantly",
"more",
"resistant",
"to",
"transformation",
"by",
"various",
"combinations",
"of",
"oncogenes",
"compared",
"to",
"wild-type",
"MEFs",
".",
"Hras1",
"plus",
"the",
"adenoviral",
"E1A",
"oncogene",
"transformed",
"Wip1",
"−",
"/",
"−",
"MEFs",
"displayed",
"increased",
"expression",
"of",
"p53",
"and",
"cyclin",
"dependent",
"kinase",
"inhibitors",
"p21",
",",
"p16INK4A",
",",
"and",
"p19ARF",
"compared",
"to",
"Wip1",
"+",
"/",
"+",
"MEFs",
".",
"In",
"addition",
",",
"the",
"p38",
"MAP",
"kinase",
"showed",
"increased",
"phosphorylation",
"in",
"Wip1",
"−",
"/",
"−",
"MEFs",
"-LSB-",
"12",
"-RSB-",
".",
"Increases",
"in",
"p53",
",",
"p21",
",",
"and",
"phosphorylated",
"p38",
"MAP",
"kinase",
"in",
"Wip1",
"null",
"MEFs",
"are",
"supported",
"by",
"the",
"fact",
"that",
"Wip1",
"directly",
"dephosphorylates",
"p38",
"and",
"p53",
"and",
"regulators",
"of",
"p53",
"-LRB-",
"ATM",
",",
"Chk1",
",",
"Chk2",
"-RRB-",
".",
"Since",
"p21",
"is",
"transcriptionally",
"upregulated",
"by",
"p53",
",",
"the",
"increase",
"in",
"its",
"levels",
"is",
"attributable",
"to",
"p53",
"activation",
".",
"One",
"interesting",
"result",
"in",
"these",
"transformed",
"Wip1",
"null",
"MEF",
"studies",
"was",
"the",
"increase",
"in",
"p19ARF",
"and",
"p16INK4a",
"levels",
".",
"Wip1",
"regulation",
"of",
"these",
"cyclin",
"dependent",
"kinase",
"inhibitors",
"appears",
"to",
"be",
"at",
"the",
"transcriptional",
"level",
",",
"as",
"transformed",
"Wip1",
"null",
"MEFs",
"showed",
"a",
"three",
"-",
"to",
"fourfold",
"enhancement",
"of",
"transfected",
"p16",
"promoter",
"driven",
"luciferase",
"expression",
"and",
"p19",
"promoter",
"driven",
"CAT",
"expression",
"when",
"compared",
"to",
"wild-type",
"MEFs",
".",
"Bulavin",
"et",
"al.",
"-LSB-",
"12",
"-RSB-",
"further",
"showed",
"that",
"oncogene",
"transformed",
"p53",
"null",
"MEFs",
"produce",
"tumors",
"when",
"transplanted",
"into",
"nude",
"mice",
",",
"while",
"transformed",
"doubly",
"null",
"p53",
"and",
"Wip1",
"MEFs",
"were",
"resistant",
"to",
"tumors",
".",
"Thus",
",",
"Wip1",
"must",
"regulate",
"other",
"pathways",
"in",
"addition",
"to",
"p53",
"to",
"promote",
"tumorigenesis",
",",
"at",
"least",
"in",
"this",
"MEF",
"model",
"system",
".",
"In",
"contrast",
"to",
"p53",
"−",
"/",
"−",
"Wip1",
"−",
"/",
"−",
"MEFs",
",",
"MEFs",
"from",
"Cdkn2a",
"−",
"/",
"−",
"-LRB-",
"null",
"for",
"both",
"p16",
"and",
"p19",
",",
"encoded",
"from",
"the",
"same",
"locus",
"-RRB-",
"Wip1",
"−",
"/",
"−",
"mice",
"readily",
"formed",
"nude",
"mouse",
"tumors",
"after",
"oncogene",
"transformation",
".",
"This",
"indicated",
"that",
"p16",
"or",
"p19",
"or",
"both",
"genes",
"were",
"responsible",
"for",
"the",
"Wip1",
"null",
"MEF",
"resistance",
"to",
"tumors",
".",
"Subsequent",
"experiments",
"showed",
"that",
"much",
"-LRB-",
"though",
"not",
"all",
"-RRB-",
"of",
"the",
"transformation",
"resistance",
"was",
"provided",
"by",
"p19ARF",
"-LSB-",
"12",
"-RSB-",
".",
"Bulavin",
"et",
"al.",
"-LSB-",
"12",
"-RSB-",
"also",
"tested",
"the",
"effects",
"of",
"Wip1",
"deficiency",
"on",
"tumorigenesis",
"in",
"an",
"in",
"vivo",
"context",
".",
"Three",
"mammary",
"tumor",
"susceptible",
"models",
",",
"MMTV",
"promoter",
"driven",
"ErbB2",
",",
"Hras1",
",",
"and",
"Wnt1",
"transgenic",
"mice",
"were",
"crossed",
"to",
"Wip1",
"deficient",
"mice",
"and",
"oncogene",
"driven",
"mammary",
"tumorigenesis",
"was",
"examined",
"in",
"the",
"presence",
"and",
"absence",
"of",
"Wip1",
".",
"Wip1",
"female",
"null",
"mice",
"were",
"considerably",
"more",
"resistant",
"to",
"mammary",
"tumors",
"in",
"the",
"presence",
"of",
"the",
"MMTV-HRas1",
"and",
"MMTV-ErbB2",
"transgenes",
"than",
"were",
"their",
"Wip1",
"wild-type",
"counterparts",
".",
"However",
",",
"Wip1",
"female",
"null",
"mice",
"with",
"the",
"MMTV-Wnt1",
"transgene",
"developed",
"mammary",
"cancers",
"at",
"the",
"same",
"rate",
"as",
"transgenic",
"Wip1",
"wild-type",
"females",
".",
"Interestingly",
",",
"the",
"Wip1",
"null",
"MMTV-ErbB2",
"tumors",
"displayed",
"a",
"reduced",
"mitotic",
"index",
"and",
"an",
"increased",
"apoptotic",
"cell",
"index",
"compared",
"to",
"the",
"Wip1",
"wild-type",
"MMTV-ErbB2",
"tumors",
".",
"Moreover",
",",
"p16INK4a",
"protein",
"levels",
"in",
"the",
"Wip1",
"null",
"tumors",
"were",
"low",
"or",
"absent",
",",
"suggesting",
"that",
"loss",
"or",
"inactivation",
"of",
"high",
"p16",
"expression",
"-LRB-",
"probably",
"by",
"p16",
"promoter",
"methylation",
"-RRB-",
"is",
"a",
"likely",
"prerequisite",
"for",
"tumor",
"progression",
"in",
"this",
"model",
".",
"It",
"was",
"also",
"observed",
"that",
"these",
"Wip1",
"null",
"mammary",
"tumors",
"also",
"contained",
"high",
"levels",
"of",
"activated",
"p38",
"MAP",
"kinase",
"-LRB-",
"as",
"indicated",
"by",
"increased",
"levels",
"of",
"phosphorylated",
"p38",
"-RRB-",
".",
"Inhibition",
"of",
"p38",
"in",
"the",
"MMTV-ErbB2",
"Wip1",
"null",
"mice",
"by",
"repeated",
"injection",
"of",
"the",
"inhibitor",
"SB203580",
"resulted",
"in",
"the",
"accelerated",
"development",
"of",
"mammary",
"tumors",
"compared",
"to",
"water",
"injected",
"mice",
"of",
"the",
"same",
"genotype",
".",
"Thus",
",",
"constitutive",
"activation",
"of",
"p38",
"MAP",
"kinase",
"in",
"the",
"absence",
"of",
"Wip1",
"may",
"contribute",
"to",
"tumor",
"resistance",
"in",
"the",
"Wip1",
"−",
"/",
"−",
"MMTV-ErbB2",
"mice",
".",
"In",
"another",
"transgenic",
"mouse",
"model",
"Shreeram",
"et",
"al.",
"-LSB-",
"57",
"-RSB-",
"examined",
"lymphoma",
"incidence",
"in",
"Wip1",
"+",
"/",
"+",
",",
"Wip1",
"+",
"/",
"−",
"and",
"Wip1",
"−",
"/",
"−",
"mice",
"bearing",
"the",
"Eμ-myc",
"transgene",
"in",
"which",
"Myc",
"overexpression",
"is",
"restricted",
"to",
"B",
"lymphocytes",
".",
"Wip1",
"+",
"/",
"−",
"and",
"Wip1",
"−",
"/",
"−",
"mice",
"exhibited",
"a",
"significant",
"delay",
"in",
"Eμ-Myc-induced",
"B",
"cell",
"lymphoma",
"incidence",
".",
"The",
"median",
"lifespan",
"of",
"Wip1",
"+",
"/",
"+",
"Eμ-Myc",
"mice",
"was",
"77",
"days",
"compared",
"to",
"107",
"days",
"for",
"Wip1",
"+",
"/",
"−",
"Eμ-Myc",
"mice",
"and",
"138",
"days",
"for",
"Wip1",
"−",
"/",
"−",
"Eμ-Myc",
"mice",
"-LSB-",
"14",
"-RSB-",
".",
"Subsequent",
"crosses",
"of",
"the",
"Wip1-deficient",
"Eμ-Myc",
"transgenic",
"mice",
"to",
"p53",
",",
"p19ARF",
",",
"and",
"ATM-deficient",
"mice",
"showed",
"that",
"Wip1",
"deficiency",
"suppressed",
"Eμ-Myc-induced",
"lymphomagenesis",
"in",
"an",
"ATM",
"and",
"p53-dependent",
",",
"but",
"ARF-independent",
"manner",
"-LSB-",
"57",
"-RSB-",
".",
"Thus",
",",
"overexpression",
"of",
"Wip1",
"in",
"an",
"oncogenic",
"context",
"could",
"contribute",
"to",
"tumor",
"promotion",
"by",
"inhibiting",
"both",
"p53",
"and",
"ATM",
"functions",
".",
"In",
"addition",
"to",
"delaying",
"oncogene-induced",
"tumors",
",",
"we",
"found",
"that",
"Wip1",
"absence",
"also",
"resulted",
"in",
"far",
"fewer",
"spontaneous",
"cancers",
"than",
"in",
"mice",
"with",
"normal",
"levels",
"of",
"Wip1",
"-LSB-",
"49",
"-RSB-",
".",
"Lifelong",
"monitoring",
"of",
"Wip1",
"+",
"/",
"+",
"mice",
"recorded",
"a",
"45",
"%",
"incidence",
"of",
"spontaneous",
"cancers",
",",
"while",
"Wip1",
"+",
"/",
"−",
"and",
"Wip1",
"−",
"/",
"−",
"mice",
"had",
"a",
"cancer",
"incidence",
"of",
"25",
"%",
"and",
"10",
"%",
",",
"respectively",
".",
"These",
"differences",
"in",
"tumor",
"incidence",
"between",
"the",
"Wip1",
"+",
"/",
"+",
"and",
"Wip1",
"−",
"/",
"−",
"mice",
"were",
"significant",
"-LRB-",
"P",
"=",
"0.016",
"-RRB-",
".",
"These",
"results",
"suggest",
"that",
"the",
"absence",
"of",
"Wip1",
"confers",
"a",
"significant",
"degree",
"of",
"resistance",
"to",
"cancer",
"development",
"over",
"the",
"lifespan",
"of",
"the",
"mouse",
".",
"Part",
"of",
"the",
"cancer",
"resistance",
"phenotypes",
"of",
"the",
"Wip1",
"null",
"mice",
"may",
"have",
"been",
"due",
"to",
"an",
"enhanced",
"DNA",
"damage",
"response",
"in",
"Wip1",
"−",
"/",
"−",
"tissues",
".",
"Following",
"whole",
"body",
"irradiation",
"with",
"5",
"Gy",
",",
"Wip1",
"−",
"/",
"−",
"tissues",
"often",
"exhibited",
"increased",
"phosphorylation",
"of",
"the",
"DNA",
"damage",
"response",
"proteins",
"p53",
"-LRB-",
"Ser15",
"-RRB-",
",",
"Chk1",
"-LRB-",
"Ser345",
"-RRB-",
",",
"Chk2",
"-LRB-",
"Thr68",
"-RRB-",
",",
"and",
"p38",
"-LRB-",
"Thr180",
"-RRB-",
"compared",
"to",
"similar",
"Wip1",
"+",
"/",
"+",
"tissues",
"-LSB-",
"49",
"-RSB-",
".",
"These",
"results",
"suggested",
"that",
"an",
"enhanced",
"DNA",
"damage",
"response",
"might",
"be",
"one",
"mechanism",
"for",
"the",
"cancer",
"resistance",
"of",
"Wip1",
"null",
"mice",
",",
"consistent",
"with",
"recent",
"findings",
"that",
"the",
"DNA",
"damage",
"response",
"may",
"be",
"an",
"important",
"early",
"failsafe",
"system",
"in",
"preventing",
"cancer",
"progression",
"-LSB-",
"5",
",",
"6",
"-RSB-",
".",
"In",
"summary",
",",
"the",
"studies",
"described",
"in",
"this",
"section",
"and",
"the",
"previous",
"section",
"provide",
"compelling",
"evidence",
"that",
"Wip1",
"is",
"a",
"human",
"oncogene",
".",
"Table",
"3",
"recapitulates",
"some",
"of",
"the",
"evidence",
"provided",
"above",
"in",
"support",
"of",
"Wip1",
"oncogenic",
"function",
".",
"Its",
"amplification",
"and",
"overexpression",
"in",
"human",
"tumors",
",",
"its",
"clear",
"effects",
"on",
"transformation",
"of",
"cells",
"in",
"culture",
"and",
"effects",
"on",
"tumorigenesis",
"in",
"animal",
"models",
",",
"and",
"its",
"ability",
"to",
"inhibit",
"the",
"activity",
"of",
"multiple",
"tumor",
"suppressors",
"clearly",
"define",
"it",
"as",
"an",
"oncogene",
".",
"Perhaps",
"the",
"most",
"important",
"tumor",
"suppressor",
"modulated",
"by",
"Wip1",
"is",
"the",
"p53",
"protein",
".",
"As",
"shown",
"in",
"Fig.",
"2",
",",
"Wip1",
"inhibits",
"upstream",
"kinase",
"activators",
"of",
"p53",
"-LRB-",
"ATM",
",",
"p38",
",",
"Chk1",
",",
"Chk2",
"-RRB-",
",",
"dephosphorylates",
"p53",
"itself",
"at",
"Ser15",
",",
"stabilizes",
"a",
"key",
"mediator",
"of",
"p53",
"degradation",
",",
"Mdm2",
",",
"and",
"inhibits",
"the",
"ARF",
"upstream",
"activator",
"of",
"p53",
".",
"Its",
"inhibition",
"of",
"p16INK4a",
"levels",
"also",
"suggests",
"Wip1",
"activity",
"in",
"suppressing",
"retinoblastoma",
"-LRB-",
"Rb",
"-RRB-",
"tumor",
"suppressor",
"regulated",
"pathways",
".",
"Table",
"3Evidence",
"that",
"the",
"Wip1",
"gene",
"is",
"an",
"oncogeneEvidenceReferences1",
".",
"Wip1",
"specifically",
"inhibits",
"p53",
"signaling",
"by",
"multiple",
"mechanisms",
"-LSB-",
"8",
"--",
"12",
",",
"17",
"-RSB-",
"2",
".",
"Wip1",
"inhibits",
"the",
"activity",
"of",
"other",
"tumor",
"suppressors",
"-LRB-",
"ARF",
",",
"p16INK4A",
"-RRB-",
"-LSB-",
"12",
"-RSB-",
"3",
".",
"Wip1",
"abrogates",
"DNA",
"damage",
"response",
"pathways",
"and",
"cell",
"cycle",
"checkpoints",
"-LSB-",
"10",
",",
"25",
",",
"51",
"-RSB-",
"4",
".",
"Wip1",
"can",
"transform",
"primary",
"rodent",
"fibroblasts",
"in",
"conjunction",
"with",
"other",
"oncogenes",
"-LSB-",
"17",
",",
"51",
",",
"62",
"-RSB-",
"5",
".",
"Wip1",
"accelerates",
"tumorigenesis",
"in",
"a",
"mammary",
"tumor",
"susceptible",
"model",
"-LSB-",
"72",
"-RSB-",
"6",
".",
"Wip1",
"is",
"amplified",
"and",
"overexpressed",
"in",
"multiple",
"types",
"of",
"human",
"tumors",
"-LSB-",
"17",
",",
"62",
",",
"64",
"--",
"71",
"-RSB-",
"7",
".",
"Wip1",
"amplification",
"and",
"overexpression",
"is",
"often",
"associated",
"with",
"poorer",
"prognosis",
"-LSB-",
"64",
",",
"66",
",",
"67",
",",
"68",
",",
"70",
"-RSB-",
"8",
".",
"Wip1",
"null",
"primary",
"embryo",
"fibroblasts",
"are",
"resistant",
"to",
"transformation",
"by",
"oncogenes",
"-LSB-",
"12",
"-RSB-",
"9",
".",
"Wip1",
"null",
"mice",
"are",
"resistant",
"to",
"spontaneous",
"and",
"oncogene-induced",
"tumors",
"-LSB-",
"12",
",",
"51",
",",
"59",
"-RSB-",
"Wip1",
"as",
"a",
"target",
"for",
"cancer",
"chemotherapeutic",
"approaches",
"Because",
"Wip1",
"inhibits",
"so",
"many",
"tumor",
"suppressor",
"molecules",
"-LRB-",
"p53",
",",
"ATM",
",",
"p16INK4A",
",",
"p14/p19ARF",
"-RRB-",
",",
"targeting",
"Wip1",
"function",
"in",
"cancer",
"cells",
"may",
"be",
"an",
"effective",
"way",
"to",
"enhance",
"tumor",
"suppressor",
"function",
",",
"resulting",
"in",
"enhanced",
"cancer",
"cell",
"arrest",
"and/or",
"apoptosis",
".",
"A",
"number",
"of",
"laboratories",
"have",
"begun",
"to",
"experiment",
"with",
"this",
"approach",
"by",
"developing",
"and",
"characterizing",
"inhibitors",
"of",
"Wip1",
"phosphatase",
"activity",
".",
"Yamaguchi",
"et",
"al.",
"-LSB-",
"24",
"-RSB-",
"have",
"developed",
"a",
"series",
"of",
"substituted",
"linear",
"and",
"circular",
"phosphopeptides",
"that",
"variably",
"inhibited",
"Wip1",
"activity",
".",
"Optimization",
"experiments",
"resulted",
"in",
"two",
"thioether",
"cyclic",
"phosphopeptides",
"with",
"a",
"pSIpY",
"core",
"motif",
"with",
"essentially",
"100",
"%",
"inhibition",
"of",
"recombinant",
"Wip1",
"phosphatase",
"activity",
".",
"Molecular",
"modeling",
"experiments",
"indicated",
"close",
"interaction",
"of",
"the",
"cyclic",
"inhibitor",
"with",
"the",
"key",
"postulated",
"catalytic",
"residues",
"-LRB-",
"R76",
"and",
"K238",
"-RRB-",
"in",
"Wip1",
".",
"Moreover",
",",
"the",
"inhibitor",
"was",
"specific",
"for",
"Wip1",
"and",
"did",
"not",
"inhibit",
"PP2A",
"or",
"PP2Cα",
"-LSB-",
"24",
"-RSB-",
".",
"Another",
"approach",
"was",
"taken",
"by",
"Bulavin",
"and",
"colleagues",
"who",
"screened",
"a",
"diversity",
"set",
"library",
"of",
"1990",
"compounds",
"and",
"identified",
"14",
"that",
"could",
"completely",
"inhibit",
"Wip1",
"phosphatase",
"activity",
"-LSB-",
"72",
"-RSB-",
".",
"Two",
"of",
"these",
"compounds",
"were",
"highly",
"effective",
"at",
"concentrations",
"as",
"low",
"as",
"0.5",
"μM",
"and",
"most",
"of",
"these",
"hits",
"did",
"not",
"inhibit",
"PP2Cα",
"and",
"PP2A",
".",
"When",
"transformed",
"MEFs",
"were",
"incubated",
"with",
"each",
"of",
"the",
"14",
"Wip1",
"inhibitors",
"and",
"tested",
"for",
"p38",
"MAPK",
"phosphorylation",
"-LRB-",
"the",
"prototype",
"Wip1",
"target",
"-RRB-",
",",
"only",
"5",
"of",
"the",
"compounds",
"increased",
"phosphorylation",
"of",
"p38",
".",
"The",
"most",
"effective",
"of",
"these",
"-LRB-",
"compound",
"M",
"-RRB-",
"was",
"tested",
"on",
"various",
"breast",
"cancer",
"cell",
"lines",
"and",
"found",
"to",
"reduce",
"cell",
"viability",
"by",
"30",
"--",
"50",
"%",
"in",
"some",
"lines",
"and",
"could",
"also",
"potentiate",
"the",
"anti-proliferative",
"effects",
"of",
"the",
"anti-cancer",
"drug",
"doxorubicin",
".",
"Finally",
",",
"compound",
"M",
"was",
"injected",
"into",
"both",
"mammary",
"tumor",
"susceptible",
"MMTV-Neu",
"mice",
"and",
"mouse",
"xenograft",
"models",
"and",
"was",
"effective",
"in",
"reducing",
"both",
"tumor",
"cell",
"proliferation",
"and",
"tumor",
"volume",
"-LSB-",
"72",
"-RSB-",
".",
"Another",
"large",
"high",
"throughput",
"screen",
"of",
"65,500",
"compounds",
"by",
"Rayter",
"et",
"al.",
"-LSB-",
"73",
"-RSB-",
"identified",
"six",
"compounds",
"that",
"demonstrated",
"strong",
"inhibition",
"of",
"Wip1",
"phosphatase",
"activity",
".",
"However",
",",
"only",
"two",
"of",
"these",
"compounds",
"showed",
"growth",
"inhibitory",
"activity",
"on",
"cancer",
"cell",
"lines",
".",
"Of",
"these",
",",
"one",
"specifically",
"inhibited",
"the",
"growth",
"of",
"cells",
"overexpressing",
"Wip1",
",",
"an",
"effect",
"that",
"was",
"lost",
"in",
"the",
"presence",
"of",
"the",
"p38",
"MAP",
"kinase",
"inhibitor",
"SB203580",
".",
"This",
"indicated",
"that",
"suppression",
"of",
"p38",
"signaling",
"by",
"Wip1",
"is",
"likely",
"to",
"be",
"an",
"important",
"component",
"of",
"tumor",
"promotion",
"in",
"some",
"Wip1",
"overexpressing",
"human",
"cancer",
"cells",
".",
"The",
"identification",
"of",
"novel",
"Wip1",
"small",
"molecule",
"inhibitors",
"is",
"an",
"encouraging",
"advance",
"and",
"suggests",
"that",
"this",
"approach",
"merits",
"further",
"consideration",
"for",
"testing",
"in",
"human",
"cancer",
"patients",
".",
"Other",
"Wip1",
"biological",
"functions",
"Aside",
"from",
"its",
"clear",
"importance",
"in",
"DNA",
"damage",
"response",
"signaling",
"and",
"oncogenesis",
",",
"the",
"phenotypes",
"observed",
"in",
"Wip1",
"knockout",
"mice",
"revealed",
"other",
"key",
"physiological",
"roles",
"for",
"Wip1",
".",
"The",
"Wip1",
"knockout",
"mice",
"display",
"a",
"range",
"of",
"abnormalities",
",",
"including",
"variable",
"male",
"runting",
",",
"male",
"reproductive",
"organ",
"atrophy",
"with",
"reduced",
"male",
"fertility",
"as",
"well",
"as",
"modestly",
"diminished",
"male",
"longevity",
"-LSB-",
"71",
"-RSB-",
".",
"The",
"reproductive",
"defects",
"of",
"the",
"Wip1",
"−",
"/",
"−",
"mice",
"are",
"only",
"seen",
"in",
"older",
"males",
"and",
"are",
"presumably",
"related",
"to",
"the",
"abnormal",
"seminiferous",
"tubules",
"and",
"epididymi",
"with",
"a",
"small",
"number",
"of",
"mature",
"spermatozoa",
"that",
"arise",
"in",
"these",
"animals",
".",
"The",
"mechanisms",
"of",
"runting",
"and",
"reduced",
"longevity",
"seen",
"in",
"the",
"null",
"males",
"may",
"be",
"a",
"result",
"of",
"hormone",
"level",
"imbalance",
"or",
"deficient",
"steroid",
"receptor",
"activation",
".",
"Proia",
"et",
"al.",
"-LSB-",
"74",
"-RSB-",
"did",
"demonstrate",
"a",
"rather",
"unexpected",
"regulatory",
"effect",
"of",
"Wip1",
"on",
"the",
"progesterone",
"receptor",
".",
"This",
"study",
"showed",
"that",
"overexpression",
"of",
"Wip1",
"stimulates",
"steroid",
"receptor",
"activity",
",",
"by",
"enhancing",
"the",
"intrinsic",
"activity",
"of",
"p160",
"coactivators",
"such",
"as",
"steroid",
"receptor",
"coactivator-1",
".",
"One",
"result",
"of",
"this",
"activation",
"is",
"that",
"Wip1",
"positively",
"regulates",
"the",
"activity",
"of",
"estrogen",
",",
"progesterone",
",",
"and",
"androgen",
"receptors",
".",
"This",
"function",
"appears",
"to",
"be",
"independent",
"of",
"p38",
"MAPK",
"because",
"SB202190",
"-LRB-",
"a",
"potent",
"p38MAPK",
"inhibitor",
"-RRB-",
"is",
"unable",
"to",
"reverse",
"the",
"inhibition",
"of",
"the",
"progesterone",
"receptor",
"activity",
"elicited",
"by",
"reducing",
"Wip1",
"expression",
"in",
"MCF-7",
"cells",
".",
"Mice",
"lacking",
"Wip1",
"also",
"showed",
"immunological",
"defects",
".",
"The",
"Wip1",
"null",
"mice",
"occasionally",
"exhibited",
"ulcerated",
"skin",
"lesions",
",",
"disorganized",
"and",
"hyperplastic",
"lymphoid",
"organs",
",",
"and",
"increased",
"inflammation",
"in",
"normal",
"organs",
".",
"B",
"and",
"T",
"lymphocytes",
"from",
"Wip1",
"−",
"/",
"−",
"mice",
"displayed",
"a",
"variety",
"of",
"unbalanced",
"and",
"ineffective",
"responses",
"to",
"antigenic",
"and",
"mitogenic",
"stimulation",
"-LSB-",
"71",
"-RSB-",
".",
"Moreover",
",",
"Wip1",
"null",
"mice",
"were",
"more",
"likely",
"to",
"die",
"from",
"influenza",
"virus",
"infection",
"than",
"their",
"normal",
"counterparts",
".",
"Schito",
"et",
"al.",
"-LSB-",
"75",
"-RSB-",
"in",
"a",
"more",
"extended",
"analysis",
"of",
"immune",
"defects",
"in",
"the",
"Wip1",
"null",
"mice",
",",
"showed",
"that",
"Wip1",
"is",
"vital",
"during",
"the",
"double",
"negative",
"to",
"double",
"positive",
"T",
"cell",
"transition",
".",
"Young",
"Wip1",
"null",
"mice",
"had",
"fewer",
"splenic",
"T",
"cells",
"and",
"their",
"thymi",
"were",
"smaller",
"with",
"fewer",
"double",
"positive",
"-LRB-",
"DP",
"-RRB-",
"and",
"single",
"positive",
"-LRB-",
"SP",
"-RRB-",
"CD4",
"+",
"and",
"CD8",
"+",
"T",
"cells",
".",
"A",
"partial",
"block",
"in",
"transition",
"from",
"double",
"negative",
"-LRB-",
"DN",
"-RRB-",
"to",
"double",
"positive",
"T",
"cells",
"was",
"noted",
"and",
"this",
"correlates",
"with",
"a",
"peak",
"in",
"Wip1",
"mRNA",
"expression",
"in",
"the",
"late",
"DN",
"stages",
"of",
"T",
"cell",
"maturation",
".",
"DP",
"T",
"cells",
"that",
"did",
"mature",
"were",
"found",
"to",
"have",
"cell",
"cycle",
"abnormalities",
"and",
"increased",
"apoptotic",
"rates",
".",
"Importantly",
",",
"when",
"the",
"Wip1",
"null",
"mice",
"were",
"crossed",
"into",
"a",
"p53",
"null",
"strain",
",",
"many",
"of",
"the",
"thymic",
"and",
"T",
"cell",
"deficiencies",
"were",
"rescued",
",",
"indicating",
"that",
"a",
"major",
"component",
"of",
"the",
"Wip1",
"−",
"/",
"−",
"T",
"cell",
"phenotypes",
"were",
"likely",
"to",
"be",
"due",
"to",
"increased",
"p53",
"activity",
".",
"Conclusions",
",",
"future",
"prospects",
"Since",
"the",
"discovery",
"of",
"Wip1",
"by",
"the",
"Appella",
"laboratory",
"in",
"1997",
"there",
"have",
"been",
"many",
"advances",
"in",
"our",
"understanding",
"of",
"how",
"this",
"p53-induced",
"phosphatase",
"functions",
".",
"Yet",
"in",
"the",
"decade",
"or",
"so",
"since",
"its",
"discovery",
",",
"there",
"have",
"been",
"fewer",
"than",
"50",
"papers",
"associated",
"with",
"the",
"study",
"of",
"Wip1",
",",
"indicating",
"that",
"we",
"have",
"only",
"scratched",
"the",
"surface",
"in",
"terms",
"of",
"gaining",
"a",
"complete",
"understanding",
"of",
"the",
"biological",
"role",
"of",
"this",
"protein",
".",
"We",
"have",
"learned",
"that",
"Wip1/PPM1D",
"is",
"an",
"oncogene",
"that",
"functions",
"in",
"part",
"by",
"suppressing",
"major",
"tumor",
"suppressors",
"that",
"include",
"p53",
".",
"It",
"also",
"plays",
"a",
"homeostatic",
"role",
"in",
"reversing",
"the",
"effects",
"of",
"the",
"ATM/ATR-initiated",
"DNA",
"damage",
"response",
"pathway",
".",
"This",
"homeostatic",
"role",
"is",
"generally",
"benign",
"until",
"somehow",
"the",
"Wip1",
"gene",
"becomes",
"amplified",
"and",
"upregulated",
".",
"Why",
"and",
"how",
"this",
"abnormal",
"Wip1",
"alteration",
"occurs",
"in",
"tumors",
"is",
"unclear",
",",
"but",
"should",
"be",
"of",
"much",
"interest",
"in",
"future",
"studies",
".",
"Many",
"important",
"questions",
"remain",
"to",
"be",
"answered",
".",
"The",
"structure",
",",
"catalytic",
"activities",
"and",
"functional",
"domains",
"of",
"Wip1",
"are",
"still",
"poorly",
"understood",
".",
"What",
"does",
"the",
"C-terminal",
"non-catalytic",
"domain",
"do",
"?",
"Are",
"pTXpY",
"and",
"pS/pTQ",
"the",
"only",
"target",
"motifs",
"recognized",
"by",
"Wip1",
"or",
"are",
"there",
"others",
"?",
"And",
"what",
"are",
"the",
"other",
"target",
"proteins",
"?",
"The",
"best",
"guess",
"is",
"that",
"there",
"are",
"likely",
"to",
"be",
"hundreds",
"of",
"targets",
",",
"if",
"not",
"more",
".",
"Does",
"Wip1",
"have",
"other",
"undiscovered",
"functions",
"?",
"And",
"perhaps",
"most",
"importantly",
",",
"from",
"a",
"disease",
"perspective",
",",
"how",
"many",
"human",
"cancers",
"exhibit",
"Wip1",
"overexpression",
",",
"what",
"are",
"the",
"mechanisms",
"for",
"Wip1-mediated",
"oncogenesis",
",",
"and",
"how",
"can",
"our",
"knowledge",
"of",
"these",
"mechanisms",
"assist",
"us",
"in",
"designing",
"novel",
"therapies",
"to",
"fight",
"cancer",
"?",
"The",
"answers",
"to",
"these",
"questions",
"in",
"the",
"coming",
"years",
"should",
"result",
"in",
"increased",
"interest",
"in",
"this",
"heretofore",
"little",
"studied",
"protein",
"."
] | [
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Cancer_Immunol_Immunother-3-1-2150627 | [
"The",
"CIMT-monitoring",
"panel",
":",
"a",
"two-step",
"approach",
"to",
"harmonize",
"the",
"enumeration",
"of",
"antigen-specific",
"CD8",
"+",
"T",
"lymphocytes",
"by",
"structural",
"and",
"functional",
"assays",
"The",
"interpretation",
"of",
"the",
"results",
"obtained",
"from",
"immunomonitoring",
"of",
"clinical",
"trials",
"is",
"a",
"difficult",
"task",
"due",
"to",
"the",
"variety",
"of",
"methods",
"and",
"protocols",
"available",
"to",
"detect",
"vaccine-specific",
"T-cell",
"responses",
".",
"This",
"heterogeneity",
"as",
"well",
"as",
"the",
"lack",
"of",
"standards",
"has",
"led",
"to",
"significant",
"scepticism",
"towards",
"published",
"results",
".",
"In",
"February",
"2005",
",",
"a",
"working",
"group",
"was",
"therefore",
"founded",
"under",
"the",
"aegis",
"of",
"the",
"Association",
"for",
"Immunotherapy",
"of",
"Cancer",
"-LRB-",
"``",
"CIMT",
"''",
"-RRB-",
"in",
"order",
"to",
"compare",
"techniques",
"and",
"protocols",
"applied",
"for",
"the",
"enumeration",
"of",
"antigen-specific",
"T-cell",
"responses",
".",
"Here",
"we",
"present",
"the",
"results",
"from",
"two",
"consecutive",
"phases",
"of",
"an",
"international",
"inter-laboratory",
"testing",
"project",
"referred",
"to",
"as",
"the",
"``",
"CIMT",
"monitoring",
"panel",
"''",
".",
"A",
"total",
"of",
"13",
"centers",
"from",
"six",
"European",
"countries",
"participated",
"in",
"the",
"study",
"in",
"which",
"pre-tested",
"PBMC",
"samples",
",",
"synthetic",
"peptides",
"and",
"PE-conjugated",
"HLA-tetramers",
"were",
"prepared",
"centrally",
"and",
"distributed",
"to",
"participants",
".",
"All",
"were",
"asked",
"to",
"determine",
"the",
"number",
"of",
"antigen-specific",
"T-cells",
"in",
"each",
"sample",
"using",
"tetramer",
"staining",
"and",
"one",
"functional",
"assay",
".",
"The",
"results",
"of",
"the",
"first",
"testing",
"round",
"revealed",
"that",
"the",
"total",
"number",
"of",
"cells",
"analyzed",
"was",
"the",
"most",
"important",
"determinant",
"for",
"the",
"sensitive",
"detection",
"of",
"antigen-specific",
"CD8",
"+",
"T-cells",
"by",
"tetramer",
"staining",
".",
"Analysis",
"by",
"ELISPOT",
"was",
"influenced",
"by",
"a",
"combination",
"of",
"cell",
"number",
"and",
"a",
"resting",
"phase",
"after",
"thawing",
"of",
"peripheral",
"blood",
"mononuclear",
"cells",
".",
"Therefore",
",",
"the",
"experiments",
"were",
"repeated",
"in",
"a",
"second",
"phase",
"but",
"now",
"the",
"participants",
"were",
"asked",
"to",
"change",
"their",
"protocols",
"according",
"to",
"the",
"new",
"guidelines",
"distilled",
"from",
"the",
"results",
"of",
"the",
"first",
"phase",
".",
"The",
"recommendations",
"improved",
"the",
"number",
"of",
"antigen-specific",
"T-cell",
"responses",
"that",
"were",
"detected",
"and",
"decreased",
"the",
"variability",
"between",
"the",
"laboratories",
".",
"We",
"conclude",
"that",
"a",
"two-step",
"approach",
"in",
"inter-laboratory",
"testing",
"allows",
"the",
"identification",
"of",
"distinct",
"variables",
"that",
"influence",
"the",
"sensitivity",
"of",
"different",
"T-cell",
"assays",
"and",
"to",
"formally",
"show",
"that",
"a",
"defined",
"correction",
"to",
"the",
"protocols",
"successfully",
"increases",
"the",
"sensitivity",
"and",
"reduces",
"the",
"inter-center",
"variability",
".",
"Such",
"``",
"two-step",
"''",
"inter-laboratory",
"projects",
"could",
"define",
"rational",
"bases",
"for",
"accepted",
"international",
"guidelines",
"and",
"thereby",
"lead",
"to",
"the",
"harmonization",
"of",
"the",
"techniques",
"used",
"for",
"immune",
"monitoring",
".",
"Introduction",
"In",
"the",
"last",
"two",
"decades",
",",
"more",
"than",
"200",
"clinical",
"trials",
"of",
"different",
"anti-tumor",
"vaccines",
"aiming",
"to",
"induce",
"tumor-specific",
"immunity",
"in",
"cancer",
"patients",
"have",
"been",
"described",
"-LSB-",
"1",
"-RSB-",
".",
"Most",
"of",
"these",
"trials",
"primarily",
"assessed",
"safety",
"and",
"immunogenicity",
"while",
"reporting",
"partial",
"or",
"complete",
"clinical",
"responses",
"in",
"a",
"minority",
"of",
"patients",
"-LSB-",
"2",
",",
"3",
"-RSB-",
".",
"Despite",
"the",
"fact",
"that",
"the",
"low",
"fraction",
"of",
"clinical",
"responders",
"still",
"precludes",
"the",
"establishment",
"of",
"a",
"direct",
"correlation",
"between",
"clinical",
"efficacy",
"and",
"T-cell",
"reactivity",
",",
"it",
"has",
"become",
"clear",
"from",
"animal",
"models",
"and",
"clinical",
"observations",
"that",
"naturally-occurring",
"or",
"vaccine-induced",
"CD8",
"+",
"or",
"CD4",
"+",
"T-cells",
"play",
"an",
"important",
"role",
"in",
"the",
"control",
"and",
"regression",
"of",
"tumors",
"-LSB-",
"4",
"--",
"9",
"-RSB-",
".",
"Therefore",
",",
"the",
"number",
"of",
"subjects",
"that",
"mount",
"a",
"vaccine-induced",
"T-cell",
"response",
"as",
"well",
"as",
"the",
"strength",
"of",
"a",
"detected",
"T-cell",
"response",
"represent",
"important",
"surrogate",
"markers",
"for",
"vaccine",
"efficacy",
".",
"The",
"enzyme-linked",
"immunospot",
"-LRB-",
"ELISPOT",
"-RRB-",
"assay",
"-LSB-",
"10",
",",
"11",
"-RSB-",
",",
"staining",
"with",
"HLA-peptide",
"multimers",
"-LSB-",
"12",
"-RSB-",
"and",
"intracellular",
"cytokine",
"staining",
"-LRB-",
"ICS",
"-RRB-",
"-LSB-",
"13",
",",
"14",
"-RSB-",
"are",
"technologies",
"used",
"commonly",
"for",
"the",
"monitoring",
"of",
"antigen-specific",
"immune",
"responses",
".",
"For",
"these",
"three",
"assays",
",",
"a",
"huge",
"variety",
"of",
"different",
"protocols",
"are",
"available",
"worldwide",
".",
"This",
"heterogeneity",
",",
"together",
"with",
"the",
"fact",
"that",
"the",
"sensitivity",
"of",
"the",
"individual",
"protocols",
"can",
"vary",
"significantly",
",",
"makes",
"a",
"comparison",
"of",
"the",
"results",
"obtained",
"in",
"different",
"trials",
"a",
"difficult",
"task",
".",
"Moreover",
",",
"an",
"increasing",
"number",
"of",
"new",
"technologies",
"are",
"constantly",
"being",
"introduced",
"to",
"the",
"field",
",",
"which",
"makes",
"interpretations",
"even",
"more",
"complex",
"-LSB-",
"15",
"--",
"25",
"-RSB-",
".",
"Current",
"data",
"and",
"opinion",
"support",
"the",
"use",
"of",
"a",
"functional",
"assay",
"like",
"the",
"ELISPOT",
"or",
"ICS",
"in",
"combination",
"with",
"a",
"phenotyping",
"assay",
"like",
"HLA-multimers",
"-LSB-",
"26",
",",
"27",
"-RSB-",
",",
"but",
"recognized",
"international",
"standards",
"for",
"all",
"these",
"methodologies",
"are",
"still",
"lacking",
".",
"The",
"main",
"aim",
"of",
"the",
"``",
"CIMT",
"monitoring",
"panel",
"''",
"is",
"to",
"harmonize",
"and",
"optimize",
"the",
"monitoring",
"of",
"antigen-specific",
"T-cells",
"among",
"the",
"participating",
"laboratories",
",",
"based",
"on",
"objective",
"rationales",
"with",
"respect",
"to",
"the",
"testing",
"procedure",
",",
"the",
"analysis",
"and",
"the",
"interpretation",
"of",
"results",
".",
"Important",
"requirements",
"for",
"an",
"immunological",
"test",
"are",
"sensitivity",
",",
"applicability",
"to",
"large",
"amounts",
"of",
"clinical",
"material",
"and",
"feasibility",
"at",
"reasonable",
"cost",
".",
"The",
"results",
"generated",
"by",
"the",
"tests",
"should",
"be",
"reproducible",
"and",
"sensitive",
",",
"independently",
"of",
"the",
"place",
"where",
"they",
"have",
"been",
"performed",
".",
"After",
"the",
"first",
"meeting",
"of",
"the",
"working",
"group",
",",
"a",
"series",
"of",
"inter-laboratory",
"testing",
"projects",
"was",
"initiated",
",",
"in",
"which",
"individual",
"laboratories",
"could",
"compare",
"their",
"performance",
",",
"express",
"their",
"needs",
"and",
"exchange",
"experience",
"in",
"order",
"to",
"improve",
"their",
"local",
"assays",
".",
"Here",
"we",
"report",
"the",
"results",
"of",
"the",
"first",
"two",
"phases",
"of",
"the",
"CIMT",
"monitoring",
"panel",
",",
"with",
"13",
"participating",
"centers",
"from",
"six",
"European",
"countries",
".",
"Materials",
"and",
"methods",
"Preparation",
"and",
"screening",
"of",
"PBMC",
"samples",
"Buffy",
"coats",
"from",
"HLA-typed",
"healthy",
"volunteers",
"were",
"kindly",
"provided",
"from",
"the",
"Blood",
"Bank",
"of",
"the",
"University",
"Mainz",
".",
"HCMV",
"sero-status",
"was",
"known",
".",
"PBMC",
"were",
"isolated",
"by",
"Ficoll",
"density",
"gradient",
"separation",
"-LRB-",
"Pharmacia",
",",
"Uppsala",
",",
"Sweden",
"-RRB-",
",",
"washed",
"two",
"times",
"in",
"RPMI",
"1640",
"-LRB-",
"GIBCO",
"BRL",
",",
"Grand",
"Island",
",",
"NY",
",",
"USA",
"-RRB-",
"containing",
"10",
"mM",
"Hepes",
"buffer",
",",
"l-arginine",
"-LRB-",
"116",
"mg/ml",
"-RRB-",
",",
"l-glutamine",
"-LRB-",
"216",
"mg/ml",
"-RRB-",
",",
"penicillin",
"-LRB-",
"10",
"IU/ml",
"-RRB-",
",",
"streptomycin",
"-LRB-",
"100",
"mg/ml",
"-RRB-",
"and",
"10",
"%",
"FCS",
"-LRB-",
"GIBCO",
"BRL",
"-RRB-",
",",
"counted",
"and",
"frozen",
"at",
"10",
"to",
"20",
"×",
"106",
"cells",
"per",
"cryovial",
"in",
"1",
"ml",
"of",
"FCS",
"90",
"%",
"+",
"DMSO",
"10",
"%",
"at",
"−",
"80",
"°C",
"in",
"freezing-boxes",
"filled",
"with",
"iso-propanol",
".",
"After",
"20",
"h",
",",
"all",
"cryovials",
"were",
"transferred",
"to",
"liquid",
"nitrogen",
"and",
"stored",
"until",
"distribution",
"to",
"the",
"participating",
"laboratories",
".",
"Pre-screening",
"and",
"selection",
"of",
"the",
"PBMC",
"donors",
"for",
"influenza",
"-",
"and",
"CMV",
"-",
"T-cell",
"reactivities",
"were",
"performed",
"by",
"a",
"central",
"lab",
"using",
"the",
"IFNγ",
"ELISPOT",
"assay",
"following",
"a",
"local",
"protocol",
"as",
"described",
"previously",
"-LSB-",
"38",
"-RSB-",
".",
"Five",
"donors",
"were",
"selected",
"for",
"the",
"first",
"phase",
"of",
"the",
"panel",
"and",
"eight",
"for",
"the",
"second",
"phase",
".",
"One",
"HLA-A",
"*",
"0201-negative",
"donor",
"was",
"included",
"in",
"each",
"phase",
"-LRB-",
"negative",
"control",
"-RRB-",
",",
"all",
"other",
"samples",
"were",
"HLA-A",
"*",
"0201-positive",
".",
"Synthetic",
"peptides",
"and",
"HLA-tetramers",
"Peptides",
"were",
"synthesized",
"using",
"standard",
"Fmoc",
"chemistry",
",",
"dissolved",
"at",
"10",
"mg/ml",
"in",
"DMSO",
",",
"aliquotted",
"and",
"stored",
"at",
"−",
"80",
"°C",
".",
"The",
"purity",
"was",
"checked",
"by",
"reverse-phase",
"HPLC",
"and",
"was",
"found",
"to",
"be",
">",
"80",
"%",
".",
"Two",
"known",
"HLA-A",
"*",
"0201",
"T-cell",
"epitopes",
"were",
"used",
":",
"influenza",
"MP",
"58",
"--",
"66",
"GILGFVFTL",
"and",
"HCMV",
"pp65",
"495",
"--",
"503",
"NLVPMVATV",
"-LRB-",
"http://www.syfpeithi.de",
"-RRB-",
".",
"Biotinylated",
"recombinant",
"HLA-A",
"*",
"0201",
"monomers",
"folded",
"with",
"the",
"influenza",
"MP",
"58",
"--",
"66",
"or",
"the",
"HMCV",
"pp65",
"peptides",
"were",
"produced",
"essentially",
"as",
"described",
",",
"purified",
"by",
"gel",
"filtration",
"and",
"stored",
"as",
"aliquots",
"at",
"−",
"80",
"°C",
"-LSB-",
"12",
"-RSB-",
".",
"Fluorescent",
"multimers",
"were",
"obtained",
"by",
"incubation",
"with",
"streptavidin-PE",
"-LRB-",
"Molecular",
"Probes",
",",
"Leiden",
",",
"The",
"Netherlands",
"-RRB-",
",",
"then",
"frozen",
"as",
"aliquots",
"after",
"addition",
"of",
"0.5",
"%",
"BSA",
"and",
"16",
"%",
"glycerol",
".",
"HLA-concentrations",
"of",
"influenza-tetramer",
"and",
"HCMV-tetramers",
"were",
"700",
"and",
"350",
"μg/ml",
",",
"respectively",
".",
"Both",
"tetramers",
"were",
"checked",
"by",
"HPLC",
"and/or",
"validated",
"by",
"staining",
"of",
"a",
"specific",
"CD8",
"+",
"T-cell",
"line",
"-LRB-",
"Influenza",
"-RRB-",
"or",
"PBMC",
"from",
"HLA-A2-negative",
"and",
"HLA-A2-positive",
"CMV",
"seronegative",
"donors",
"-LRB-",
"CMV",
"-RRB-",
".",
"Such",
"tetramers",
"are",
"stable",
"at",
"4",
"°C",
"for",
"at",
"least",
"1",
"month",
"-LRB-",
"personal",
"observation",
"-RRB-",
"and",
"participants",
"were",
"asked",
"to",
"perform",
"all",
"tests",
"within",
"this",
"time",
"period",
".",
"Participating",
"centers",
"Twelve",
"centers",
"from",
"five",
"European",
"countries",
"participated",
"in",
"the",
"first",
"phase",
"of",
"the",
"monitoring",
"panel",
".",
"As",
"one",
"of",
"the",
"investigators",
"moved",
"to",
"another",
"institution",
"during",
"the",
"study",
"a",
"13th",
"center",
"from",
"a",
"6th",
"European",
"country",
"was",
"added",
"to",
"the",
"group",
"in",
"the",
"second",
"phase",
"of",
"the",
"panel",
".",
"Participation",
"in",
"the",
"panel",
"was",
"open",
"to",
"all",
"interested",
"laboratories",
"with",
"a",
"focus",
"on",
"T-cell",
"monitoring",
",",
"independently",
"of",
"membership",
"in",
"the",
"Association",
"for",
"Immunotherapy",
"of",
"Cancer",
".",
"Reagent",
"distribution",
"and",
"assay",
"guidelines",
"Coded",
"PBMC",
"samples",
",",
"synthetic",
"peptides",
"and",
"HLA-A",
"*",
"0201",
"tetramers",
"were",
"shipped",
"on",
"dry",
"ice",
"to",
"the",
"participants",
".",
"Additionally",
",",
"guidelines",
"for",
"the",
"two",
"T-cell",
"assays",
"were",
"distributed",
"for",
"each",
"phase",
":",
"Phase",
"I/2005",
".",
"A",
"protocol",
"for",
"tetramer",
"staining",
"was",
"included",
".",
"Briefly",
",",
"1",
"×",
"106",
"PBMC",
"per",
"test",
"were",
"transferred",
"directly",
"after",
"thawing",
"into",
"one",
"well",
"of",
"a",
"96",
"well",
"u-bottom",
"plate",
"and",
"washed",
"in",
"FACS",
"buffer",
"consisting",
"of",
"PBS",
",",
"2",
"%",
"FCS",
",",
"2",
"mM",
"EDTA",
",",
"0.02",
"%",
"azide",
".",
"Incubation",
"with",
"5",
"μg/ml",
"HLA-tetramer",
"was",
"then",
"performed",
"in",
"FACS",
"buffer",
"with",
"50",
"%",
"FCS",
"for",
"30",
"min",
"at",
"room",
"temperature",
"in",
"the",
"dark",
".",
"After",
"one",
"wash",
"in",
"FACS",
"buffer",
",",
"mAb",
"for",
"T-cell",
"staining",
"were",
"added",
"for",
"20",
"min",
"at",
"4",
"°C",
".",
"Finally",
",",
"cells",
"were",
"washed",
"twice",
"before",
"fixing",
"in",
"FACS",
"buffer",
"containing",
"1",
"%",
"formaldehyde",
"solution",
".",
"Three",
"mAb",
"combinations",
"were",
"proposed",
",",
"CD8",
"alone",
",",
"CD3",
"plus",
"CD8",
",",
"or",
"CD4",
"plus",
"CD8",
".",
"Each",
"lab",
"could",
"choose",
"here",
"the",
"antibody",
"clones",
",",
"fluorescent",
"dye",
"and",
"concentrations",
"used",
".",
"Stainings",
"were",
"performed",
"in",
"duplicate",
".",
"For",
"the",
"functional",
"assays",
",",
"synthetic",
"peptides",
"were",
"diluted",
"at",
"1",
"mg/ml",
"in",
"PBS",
"as",
"a",
"stock",
"solution",
".",
"Concentrations",
"in",
"further",
"tests",
"were",
"1",
"--",
"10",
"μg/ml",
",",
"left",
"to",
"the",
"choice",
"of",
"the",
"participants",
".",
"There",
"were",
"no",
"recommendation",
"which",
"functional",
"test",
"should",
"be",
"performed",
",",
"so",
"that",
"each",
"group",
"could",
"choose",
"the",
"test",
"either",
"routinely",
"used",
",",
"or",
"to",
"be",
"implemented",
"for",
"its",
"own",
"needs",
".",
"In",
"this",
"first",
"phase",
",",
"11/12",
"laboratories",
"chose",
"the",
"IFNγ",
"ELISPOT",
"assay",
",",
"one",
"lab",
"-LRB-",
"Z10",
"-RRB-",
"a",
"FACS-based",
"intracellular",
"IFNγ",
"staining",
"and",
"one",
"lab",
"performed",
"both",
"assays",
"-LRB-",
"Z7",
"-RRB-",
".",
"Spot",
"counting",
"was",
"performed",
"locally",
".",
"Phase",
"II/2006",
".",
"Following",
"the",
"results",
"obtained",
"in",
"the",
"first",
"testing",
"phase",
",",
"requirements",
"were",
"introduced",
"and",
"participants",
"were",
"asked",
"to",
"apply",
"exactly",
"these",
"new",
"criteria",
"-LRB-",
"two",
"for",
"the",
"tetramer",
"staining",
",",
"and",
"four",
"for",
"the",
"ELISPOT",
",",
"see",
"``",
"Results",
"''",
"section",
"-RRB-",
".",
"The",
"assay",
"guidelines",
"were",
"modified",
"accordingly",
".",
"However",
",",
"in",
"order",
"to",
"reduce",
"the",
"variability",
"in",
"the",
"FACS",
"analysis",
"of",
"the",
"13",
"laboratories",
",",
"a",
"figure",
"showing",
"exemplary",
"dot-plots",
",",
"settings",
"of",
"gates",
"and",
"quadrants",
",",
"and",
"statistical",
"analysis",
"was",
"provided",
".",
"All",
"laboratories",
"were",
"now",
"required",
"to",
"perform",
"an",
"IFNγ",
"ELISPOT",
"as",
"the",
"functional",
"test",
",",
"with",
"a",
"fixed",
"peptide",
"concentration",
"of",
"1",
"μg/ml",
".",
"Participants",
"were",
"encouraged",
"to",
"use",
"a",
"distributed",
"model",
"protocol",
"but",
"were",
"allowed",
"to",
"use",
"their",
"local",
"protocol",
",",
"provided",
"that",
"they",
"applied",
"the",
"four",
"new",
"requirements",
"introduced",
"in",
"the",
"second",
"phase",
".",
"Collection",
"and",
"analysis",
"of",
"results",
"After",
"performing",
"the",
"required",
"tests",
"in",
"each",
"phase",
",",
"participants",
"returned",
"a",
"completed",
"report",
"form",
"containing",
"all",
"relevant",
"information",
".",
"Number",
"of",
"cells",
"recovered",
"after",
"thawing",
"was",
"included",
"to",
"assess",
"viability",
"after",
"transport",
".",
"For",
"the",
"tetramer",
"staining",
"experiments",
",",
"mAb",
"clone",
",",
"manufacturer",
",",
"amount",
",",
"cytometer",
"type",
"and",
"number",
"of",
"lymphocytes",
"and/or",
"CD8",
"+",
"cells",
"analyzed",
"were",
"noted",
".",
"Results",
"were",
"expressed",
"as",
"percentage",
"of",
"tetramer-positive",
"cells",
"among",
"CD8",
"+",
",",
"CD3",
"+",
"CD8",
"+",
",",
"or",
"CD4",
"−",
"lymphocytes",
",",
"depending",
"on",
"which",
"mAb",
"combination",
"was",
"used",
"for",
"the",
"staining",
".",
"Additionally",
",",
"FACS",
"dot-plots",
"containing",
"all",
"gates",
",",
"quadrants",
"and",
"deduced",
"statistical",
"analysis",
"were",
"collected",
".",
"For",
"the",
"functional",
"test",
",",
"medium",
"and",
"thawing",
"procedure",
"-LRB-",
"e.g.",
"addition",
"of",
"DNAse",
",",
"of",
"a",
"resting",
"phase",
",",
"etc.",
"-RRB-",
"had",
"to",
"be",
"described",
",",
"as",
"well",
"as",
"the",
"number",
"of",
"cells",
"per",
"test",
",",
"the",
"antibodies",
"used",
"-LRB-",
"clone",
",",
"manufacturer",
",",
"concentration",
"-RRB-",
",",
"the",
"final",
"peptide",
"concentration",
"and",
"the",
"incubation",
"times",
".",
"For",
"the",
"ELISPOT",
"assay",
",",
"the",
"type",
"of",
"plate",
",",
"the",
"enzymatic",
"visualization",
"system",
"and",
"the",
"spot",
"reader",
"were",
"also",
"noted",
".",
"Absolute",
"spot",
"numbers",
"were",
"given",
"by",
"each",
"participant",
",",
"and",
"filter",
"plates",
"were",
"kept",
"for",
"possible",
"second",
"analysis",
".",
"All",
"results",
"from",
"both",
"phases",
"were",
"collected",
"and",
"centrally",
"analyzed",
".",
"For",
"the",
"tetramer",
"stainings",
",",
"the",
"number",
"of",
"lymphocytes",
",",
"number",
"of",
"CD8",
"+",
"T-cells",
"and",
"frequencies",
"of",
"tetramer-positive",
"cells",
"were",
"calculated",
"on",
"the",
"basis",
"of",
"the",
"stainings",
"and",
"statistics",
"provided",
"by",
"the",
"participants",
".",
"Apart",
"from",
"these",
"calculated",
"frequencies",
",",
"a",
"``",
"visual",
"evaluation",
"''",
"was",
"necessary",
"-LRB-",
"see",
"``",
"Results",
"''",
"-RRB-",
".",
"For",
"the",
"ELISPOT",
",",
"analysis",
"was",
"performed",
"based",
"on",
"the",
"spot",
"numbers",
"reported",
"by",
"the",
"participants",
",",
"followed",
"by",
"a",
"student",
"t",
"test",
".",
"Results",
"were",
"accepted",
"as",
"positive",
"reaction",
"only",
"when",
"the",
"numbers",
"of",
"antigen-specific",
"spots",
"exceeded",
"the",
"number",
"of",
"spots",
"in",
"the",
"background",
"wells",
"by",
"atleast",
"a",
"factor",
"two",
".",
"The",
"coefficients",
"of",
"variation",
"-LRB-",
"CV",
"-RRB-",
"were",
"calculated",
"for",
"all",
"results",
"-LRB-",
"CV",
"=",
"SD/mean",
"×",
"100",
"-RRB-",
"and",
"are",
"shown",
"in",
"supplementary",
"Tables",
"S1a",
",",
"b",
".",
"The",
"raw",
"data",
"from",
"both",
"panel",
"phases",
"will",
"be",
"provided",
"to",
"interested",
"readers",
"upon",
"request",
".",
"Results",
"Phase",
"I/2005",
"of",
"the",
"interlaboratory",
"testing",
"project",
"--",
"general",
"aspects",
"Coded",
"PBMC",
"samples",
"from",
"four",
"HLA-A",
"*",
"0201-positive",
"and",
"one",
"HLA-A",
"*",
"0201-negative",
"healthy",
"donor",
"-LRB-",
"D1",
"--",
"D5",
"-RRB-",
"were",
"included",
"in",
"this",
"first",
"testing",
"phase",
".",
"The",
"thawing",
"procedure",
"for",
"PBMC",
"samples",
"in",
"the",
"test",
"centers",
"was",
"not",
"standardized",
"and",
"the",
"recovery",
"of",
"viable",
"cells",
"varied",
"greatly",
"between",
"45",
"and",
"102",
"%",
"-LRB-",
"mean",
"73",
"%",
"-RRB-",
"in",
"the",
"12",
"labs",
".",
"However",
",",
"the",
"number",
"of",
"cells",
"recovered",
"was",
"in",
"all",
"cases",
"sufficient",
"to",
"perform",
"the",
"required",
"analyses",
".",
"When",
"all",
"the",
"data",
"from",
"the",
"tetramer",
"staining",
"and",
"functional",
"tests",
"were",
"combined",
"it",
"became",
"clear",
"that",
"subjects",
"D1",
"and",
"D5",
"had",
"responded",
"to",
"the",
"HLA-A",
"*",
"0201",
"restricted",
"CMV-derived",
"peptide",
",",
"consistent",
"with",
"their",
"CMV",
"seropositive-status",
",",
"and",
"that",
"subjects",
"D1",
",",
"D2",
",",
"D3",
",",
"and",
"D5",
"had",
"responded",
"to",
"influenza",
".",
"In",
"total",
",",
"each",
"laboratory",
"should",
"in",
"theory",
"have",
"been",
"able",
"to",
"measure",
"six",
"positive",
"-LRB-",
"2",
"×",
"CMV",
"and",
"4",
"×",
"influenza",
"-RRB-",
"responses",
".",
"Detection",
"of",
"antigen-specific",
"T-cells",
"by",
"tetramer",
"staining",
"and",
"IFNγ",
"ELISPOT",
"The",
"protocol",
"required",
"that",
"all",
"PBMC",
"samples",
"should",
"be",
"analyzed",
"by",
"the",
"12",
"participants",
"for",
"the",
"presence",
"of",
"HLA-A",
"*",
"0201-restricted",
"CMV-specific",
"and",
"influenza-specific",
"CD8",
"+",
"T-cells",
"using",
"centrally-prepared",
"tetramers",
".",
"The",
"indicated",
"frequencies",
"of",
"antigen-specific",
"CD8",
"+",
"cells",
"generally",
"represent",
"the",
"mean",
"of",
"two",
"separate",
"stainings",
"with",
"CD3",
"Ab/CD8",
"Ab/tetramer",
",",
"except",
"for",
"centers",
"Z1",
"-LRB-",
"CD8/tetramer",
"-RRB-",
",",
"Z7",
"-LRB-",
"CD3/CD4/CD8",
"/",
"tetramer",
"-RRB-",
",",
"Z5",
"and",
"Z10",
"-LRB-",
"one",
"staining",
"CD3/CD8/tetramer",
"and",
"one",
"staining",
"CD3/CD4/tetramer",
"-RRB-",
"and",
"are",
"based",
"on",
"the",
"analysis",
"and",
"dot",
"plots",
"provided",
"by",
"each",
"participant",
".",
"As",
"illustrated",
"in",
"Fig.",
"1",
",",
"the",
"absolute",
"numbers",
"of",
"tetramer-positive",
"T-cells",
"were",
"influenced",
"by",
"the",
"individual",
"decision",
"of",
"where",
"to",
"set",
"the",
"gates",
"and",
"quadrant",
"markers",
"for",
"the",
"analysis",
".",
"For",
"example",
",",
"the",
"inclusion",
"of",
"the",
"subset",
"of",
"T",
"lymphocytes",
"expressing",
"CD8",
"at",
"a",
"low",
"density",
"influenced",
"the",
"number",
"of",
"CD8",
"+",
"and",
"consequently",
"the",
"frequency",
"of",
"tetramer",
"+",
"cells",
".",
"Moreover",
",",
"non-specific",
"binding",
"of",
"the",
"tetramer",
"-LRB-",
"as",
"seen",
"on",
"the",
"CD8-negative",
"subset",
"-RRB-",
"also",
"varied",
"between",
"the",
"different",
"laboratories",
".",
"For",
"these",
"reasons",
",",
"not",
"only",
"the",
"frequencies",
",",
"but",
"also",
"the",
"appearance",
"of",
"the",
"tetramer-positive",
"populations",
"was",
"carefully",
"examined",
".",
"Two",
"parameters",
"were",
"chosen",
"for",
"validation",
"of",
"``",
"positive",
"''",
"results",
":",
"-LRB-",
"1",
"-RRB-",
"a",
"clustered",
",",
"but",
"not",
"diffuse",
",",
"tetramer",
"binding-population",
",",
"and",
"-LRB-",
"2",
"-RRB-",
"strong",
"intensity",
"of",
"tetramer",
"staining",
",",
"especially",
"marked",
"for",
"the",
"CMV-tetramer-binding",
"population",
"-LRB-",
"Fig.",
"1",
"-RRB-",
".",
"Table",
"1",
"shows",
":",
"-LRB-",
"I",
"-RRB-",
"the",
"minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"CD8",
"+",
"T-cells",
",",
"-LRB-",
"II",
"-RRB-",
"the",
"results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z12",
",",
"and",
"-LRB-",
"III",
"-RRB-",
"the",
"number",
"and",
"percentage",
"of",
"centers",
"that",
"detected",
"a",
"response",
".",
"The",
"high",
"frequencies",
"of",
"CMV-specific",
"CD8",
"+",
"T-cells",
"in",
"donors",
"D1",
"and",
"D5",
"were",
"readily",
"detected",
"by",
"all",
"participants",
"-LRB-",
"mean",
"of",
"1",
"per",
"141",
"CD8",
"±",
"113",
"in",
"D1",
"and",
"mean",
"of",
"1",
"per",
"80",
"CD8",
"±",
"24",
"in",
"D5",
",",
"respectively",
"-RRB-",
".",
"For",
"influenza-specific",
"CD8",
"+",
"T-cells",
",",
"the",
"results",
"were",
"more",
"variable",
".",
"Influenza-tetramer",
"+",
"cells",
"in",
"donor",
"D3",
"were",
"detected",
"by",
"all",
"participants",
"with",
"a",
"mean",
"frequency",
"of",
"one",
"cell",
"in",
"1014",
"CD8",
"+",
"T-cells",
"±",
"355",
".",
"In",
"Donor",
"D5",
",",
"11",
"of",
"12",
"laboratories",
"detected",
"a",
"mean",
"of",
"one",
"tetramer",
"binding",
"cell",
"per",
"1106",
"CD8",
"+",
"T-cells",
"±",
"508",
".",
"Influenza-specific",
"cells",
"were",
"less",
"numerous",
"in",
"healthy",
"subjects",
"D1",
"and",
"D2",
"and",
"were",
"only",
"detected",
"by",
"five",
"and",
"eight",
"laboratories",
",",
"respectively",
".",
"No",
"false",
"positive",
"reactivity",
"was",
"reported",
"by",
"any",
"of",
"the",
"participants",
".",
"Fig.",
"1Example",
"of",
"tetramer",
"staining",
"results",
"as",
"provided",
"by",
"four",
"selected",
"participating",
"centers",
"Z5",
",",
"Z12",
",",
"Z8",
"and",
"Z1",
".",
"All",
"stainings",
"were",
"performed",
"on",
"donor",
"D1",
"from",
"phase",
"I/2005",
"who",
"showed",
"reactivity",
"with",
"both",
"of",
"the",
"tested",
"tetramers",
".",
"Cells",
"were",
"gated",
"either",
"on",
"the",
"lymphocyte",
"population",
"-LRB-",
"Z1",
"-RRB-",
",",
"or",
"the",
"subsets",
"of",
"CD3",
"+",
"CD8",
"+",
"-LRB-",
"Z5",
"-RRB-",
"or",
"CD3",
"+",
"-LRB-",
"Z8",
",",
"Z12",
"-RRB-",
",",
"according",
"to",
"the",
"Ab",
"combination",
"used",
"by",
"each",
"lab",
".",
"The",
"upper",
"panel",
"shows",
"results",
"for",
"tests",
"with",
"the",
"CMV-tetramer",
",",
"the",
"lower",
"panel",
"shows",
"results",
"for",
"tests",
"with",
"the",
"influenza-tetramer",
".",
"In",
"all",
"dot-plots",
",",
"the",
"tetramer",
"staining",
"is",
"displayed",
"on",
"the",
"y-axis",
"and",
"anti-CD8-staining",
"on",
"the",
"x-axis",
".",
"Number",
"of",
"counted",
"CD8",
"+",
"T-cells",
"and",
"percentage",
"of",
"tetramer-positive",
"cells",
"among",
"the",
"CD8",
"subset",
"are",
"indicatedTable",
"1Overview",
"of",
"the",
"tetramer",
"results",
"from",
"phase",
"I/2005",
"of",
"the",
"CIMT",
"monitoring",
"panelD1",
"CMVD1",
"FluD2",
"FluD3",
"FluD5",
"CMVD5",
"FluMin44820",
",0006,6671,8181061,786",
"-LRB-",
"I",
"-RRB-",
"Mean1418",
",0951,9091,014801,106",
"Max353",
",77452659526588",
"Z11293",
",774635870106758",
"-LRB-",
"II",
"-RRB-",
"Z2112",
"--",
"--",
"1,818701,770",
"Z3n.d",
"--",
"--",
"701n",
".",
"d",
"--",
"Z497",
"--",
"--",
"8541061,342",
"Z5161",
"--",
"--",
"90988606Z61396",
",8961,3161,00091651",
"Z744820",
",0006,6671,266821,724",
"Z81005",
",12854559587877",
"Z9n.d",
"--",
"1,3161,274",
"n.d1",
",786",
"Z1094",
"--",
"2,5971,360861,439",
"Z11994",
",6751,66787758588",
"Z1235",
"--",
"52664526625Detected",
"by10/105/128",
"/",
"1212/1210/1011",
"/",
"12",
"-LRB-",
"III",
"-RRB-",
"Detected",
"%",
"100426710010092",
"-LRB-",
"I",
"-RRB-",
"Minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"T-cells",
"-LRB-",
"II",
"-RRB-",
"Results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z12",
".",
"All",
"frequencies",
"are",
"indicated",
"as",
"1",
"per",
"x",
"counted",
"CD8",
"+",
"T-cells",
"-LRB-",
"III",
"-RRB-",
"Number",
"and",
"percentage",
"of",
"centers",
"which",
"detected",
"a",
"given",
"reactivity",
"in",
"donors",
"D1",
",",
"D2",
",",
"D3",
"and",
"D5",
"Eleven",
"laboratories",
"analyzed",
"the",
"five",
"PBMC",
"samples",
"for",
"the",
"presence",
"of",
"HLA-A",
"*",
"0201-restricted",
"CMV-specific",
"and",
"influenza-specific",
"IFNγ-producing",
"T-cells",
"by",
"ELISPOT",
"assay",
".",
"Only",
"one",
"group",
"-LRB-",
"Z10",
"-RRB-",
"used",
"an",
"intracellular",
"cytokine",
"staining",
"as",
"a",
"functional",
"test",
"-LRB-",
"data",
"not",
"shown",
"because",
"no",
"comparison",
"with",
"other",
"groups",
"possible",
"-RRB-",
".",
"Table",
"2",
"shows",
"-LRB-",
"I",
"-RRB-",
"the",
"minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"cells",
",",
"-LRB-",
"II",
"-RRB-",
"the",
"results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z12",
",",
"and",
"-LRB-",
"III",
"-RRB-",
"the",
"number",
"and",
"percentage",
"of",
"centers",
"that",
"detected",
"each",
"reactivity",
".",
"As",
"described",
"in",
"the",
"``",
"Materials",
"and",
"methods",
"''",
",",
"results",
"of",
"spot-forming",
"cells",
"per",
"seeded",
"PBMC",
"were",
"accepted",
"as",
"a",
"positive",
"reaction",
"only",
"when",
"passing",
"statistical",
"testing",
"and",
"when",
"the",
"number",
"of",
"antigen-specific",
"spots",
"exceeded",
"the",
"number",
"of",
"spots",
"in",
"the",
"background",
"wells",
"by",
"at",
"least",
"a",
"factor",
"of",
"two",
".",
"IFNγ-producing",
"cells",
"reactive",
"against",
"CMV",
"were",
"detected",
"by",
"10",
"of",
"the",
"11",
"laboratories",
"in",
"donor",
"D1",
"-LRB-",
"mean",
"reactivity",
"was",
"1",
"per",
"1,855",
"PBMC",
"±",
"825",
"-RRB-",
"but",
"only",
"by",
"8",
"of",
"11",
"in",
"donor",
"D5",
"-LRB-",
"mean",
"reactivity",
"was",
"1",
"per",
"4,405",
"PBMC",
"±",
"3,762",
"-RRB-",
".",
"The",
"influenza-specific",
"T-cells",
"present",
"in",
"subject",
"D3",
"were",
"detected",
"by",
"six",
"laboratories",
",",
"while",
"the",
"responses",
"in",
"the",
"healthy",
"subjects",
"with",
"markedly",
"lower",
"numbers",
"of",
"peripheral",
"specific",
"T-cells",
"-LRB-",
"D1",
",",
"D2",
"and",
"D5",
"-RRB-",
"were",
"detected",
"by",
"three",
"laboratories",
"only",
".",
"Table",
"2Overview",
"of",
"the",
"IFNγ",
"ELISPOT",
"results",
"from",
"phase",
"I/2005",
"of",
"the",
"CIMT",
"monitoring",
"panelD1",
"CMVD1",
"FluD2",
"FluD3",
"FluD5",
"CMVD5",
"FluMin3",
",06162,50055,55533,33311,42850,000",
"-LRB-",
"I",
"-RRB-",
"Mean1",
",85538,14143,58917,5474,40530,811",
"Max88810",
",25630,7698,5711,03914,705",
"Z11",
",006",
"--",
"--",
"8,571",
"--",
"--",
"-LRB-",
"II",
"-RRB-",
"Z22",
",439",
"--",
"--",
"--",
"2,816",
"--",
"Z31",
",29562,500",
"--",
"22,7271,41227,727",
"Z41",
",312",
"--",
"--",
"10,9091,980",
"--",
"Z5",
"--",
"--",
"--",
"--",
"--",
"--",
"Z6233",
"*",
"--",
"--",
"1,960",
"*",
"253",
"*",
"--",
"Z71",
",89510,25644,44433,33311,42850,000",
"Z83",
",061",
"--",
"--",
"--",
"6,896",
"--",
"Z988841",
",66655,55512,1951,03914,705",
"Z10NDNDNDNDNDNDZ111",
",769",
"--",
"30,769",
"--",
"--",
"--",
"Z123",
",030",
"--",
"--",
"--",
"5,263",
"--",
"Detected",
"by10/113/113",
"/",
"116/118/113",
"/",
"11",
"-LRB-",
"III",
"-RRB-",
"Detected",
"%",
"912727557327",
"-LRB-",
"I",
"-RRB-",
"Minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"cells",
"-LRB-",
"II",
"-RRB-",
"Results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z12",
".",
"All",
"frequencies",
"are",
"indicated",
"as",
"1",
"per",
"x",
"seeded",
"PBMC",
"except",
"for",
"Z6",
"*",
"where",
"it",
"is",
"indicated",
"as",
"1",
"per",
"x",
"seeded",
"CD8",
"+",
"T-cellsResults",
"from",
"Z6",
"were",
"not",
"included",
"for",
"calculation",
"of",
"the",
"mean",
"frequency",
"of",
"antigen-specific",
"T-cells",
"in",
"D1",
",",
"D3",
"and",
"D5",
"-LRB-",
"III",
"-RRB-",
"Number",
"and",
"percentage",
"of",
"centers",
"that",
"detected",
"a",
"given",
"response",
"in",
"donors",
"D1",
",",
"D2",
",",
"D3",
"and",
"D5ND",
"not",
"determined",
"Subgroup",
"analysis",
"reveals",
"that",
"the",
"number",
"of",
"CD8",
"+",
"T-lymphocytes",
"analyzed",
"affects",
"the",
"sensitivity",
"of",
"the",
"tetramer",
"staining",
"Although",
"the",
"tetramer",
"stainings",
"were",
"performed",
"with",
"centrally",
"prepared",
"reagents",
"following",
"set",
"guidelines",
",",
"centers",
"were",
"left",
"free",
"to",
"select",
"several",
"parameters",
"according",
"to",
"their",
"own",
"protocols",
",",
"and",
"this",
"could",
"have",
"influenced",
"the",
"test",
"results",
"-LRB-",
"see",
"``",
"Materials",
"and",
"methods",
"''",
"-RRB-",
".",
"Most",
"of",
"the",
"participants",
"used",
"monoclonal",
"antibodies",
"specific",
"for",
"CD3",
"and",
"CD8",
"to",
"co-stain",
"the",
"cells",
".",
"There",
"were",
"no",
"obvious",
"differences",
"in",
"the",
"performance",
"of",
"the",
"centers",
"depending",
"on",
"which",
"antibody",
"clones",
",",
"antibody",
"combinations",
"or",
"cytometer",
"were",
"used",
"-LRB-",
"data",
"not",
"shown",
"-RRB-",
".",
"There",
"was",
"a",
"high",
"degree",
"of",
"variability",
"in",
"the",
"number",
"of",
"CD8",
"+",
"cells",
"which",
"were",
"analyzed",
"per",
"staining",
",",
"ranging",
"from",
"only",
"0.5",
"×",
"104",
"to",
"about",
"19",
"×",
"104",
"-LRB-",
"inter-center",
"variation",
"-RRB-",
".",
"In",
"addition",
",",
"a",
"non-negligible",
"intra-center",
"variation",
"was",
"observed",
"for",
"the",
"number",
"of",
"counted",
"CD8",
"+",
".",
"We",
"therefore",
"analyzed",
"each",
"individual",
"staining",
"independently",
"of",
"the",
"center",
"that",
"performed",
"it",
"and",
"focused",
"on",
"the",
"number",
"of",
"CD8",
"+",
"T-cells",
"that",
"had",
"been",
"counted",
".",
"For",
"the",
"six",
"different",
"antigen-specific",
"populations",
"detectable",
",",
"a",
"total",
"of",
"68",
"tests",
"was",
"performed",
"by",
"the",
"group",
"-LRB-",
"see",
"Table",
"1",
"-RRB-",
".",
"Overall",
",",
"antigen-specific",
"T-cell",
"reactivities",
"were",
"reported",
"in",
"82",
"%",
"of",
"the",
"tests",
"-LRB-",
"56/68",
",",
"mean",
"of",
"duplicate",
"stainings",
"-RRB-",
".",
"When",
"less",
"than",
"30,000",
"CD8",
"+",
"T-cells",
"were",
"counted",
",",
"only",
"70",
"%",
"of",
"all",
"responses",
"were",
"found",
".",
"In",
"contrast",
",",
"89",
"%",
"of",
"all",
"responses",
"were",
"manifest",
"when",
"more",
"than",
"30,000",
"CD8",
"+",
"T-cells",
"were",
"counted",
"-LRB-",
"Fig.",
"2a",
"-RRB-",
".",
"When",
"antigen-specific",
"T-cells",
"were",
"present",
"at",
"high",
"frequency",
",",
"the",
"number",
"of",
"cells",
"counted",
"did",
"not",
"influence",
"the",
"result",
",",
"because",
"CMV-specific",
"T-cells",
"from",
"donors",
"D1",
"and",
"D5",
"were",
"detected",
"irrespective",
"of",
"the",
"number",
"of",
"CD8",
"+",
"T-cells",
"in",
"the",
"test",
".",
"However",
",",
"for",
"the",
"influenza-specific",
"cells",
",",
"positivity",
"was",
"registered",
"in",
"only",
"75",
"%",
"of",
"all",
"tests",
"performed",
"-LRB-",
"36",
"of",
"48",
"tests",
"-RRB-",
".",
"Strikingly",
",",
"we",
"observed",
"a",
"marked",
"difference",
"for",
"the",
"results",
"derived",
"from",
"those",
"tests",
"involving",
"less",
"than",
"30,000",
"CD8",
"+",
"T-cells",
"-LRB-",
"56",
"%",
"success",
"in",
"detection",
"-RRB-",
"as",
"compared",
"to",
"tests",
"performed",
"with",
"more",
"than",
"30,000",
"CD8",
"+",
"T-cells",
"-LRB-",
"84",
"%",
"-RRB-",
".",
"Fig.",
"2a",
"Subgroup",
"analysis",
"of",
"tetramer",
"results",
"from",
"phase",
"I/2005",
".",
"Bars",
"indicate",
"the",
"percentage",
"of",
"positives",
"that",
"could",
"be",
"detected",
"by",
"tetramer",
"staining",
".",
"The",
"first",
"group",
"of",
"bars",
"shows",
"the",
"results",
"for",
"all",
"of",
"the",
"six",
"detectable",
"positives",
",",
"the",
"second",
"group",
"shows",
"results",
"from",
"stainings",
"with",
"the",
"CMV-tetramer",
"and",
"the",
"third",
"group",
"of",
"columns",
"shows",
"results",
"from",
"stainings",
"with",
"the",
"influenza-tetramer",
".",
"The",
"open",
"bars",
"in",
"each",
"group",
"represent",
"all",
"tests",
"performed",
",",
"grey",
"bars",
"represent",
"results",
"obtained",
"in",
"tests",
"that",
"were",
"performed",
"on",
"more",
"than",
"3",
"×",
"104",
"CD8",
"+",
"T-cells",
"and",
"black",
"bars",
"represent",
"results",
"obtained",
"in",
"tests",
"that",
"were",
"performed",
"on",
"less",
"than",
"3",
"×",
"104",
"CD8",
"+",
"T-cells",
".",
"The",
"boxes",
"within",
"each",
"bar",
"indicate",
"the",
"fraction",
"of",
"tests",
"with",
"a",
"positive",
"result",
".",
"The",
"asterisk",
"indicates",
"a",
"P-value",
"<",
"0.05",
"by",
"Chi-square",
"analysis",
".",
"b",
"Subgroup",
"analysis",
"of",
"ELISPOT",
"results",
"from",
"phase",
"I/2005",
".",
"The",
"bars",
"indicate",
"the",
"percentage",
"of",
"positive",
"reactivities",
"detected",
"by",
"IFNγ",
"ELISPOT",
"assays",
".",
"The",
"open",
"bar",
"shows",
"the",
"percentage",
"of",
"all",
"reactivities",
"detected",
"by",
"all",
"11",
"centers",
"that",
"performed",
"the",
"ELISPOT",
"assay",
"as",
"the",
"functional",
"test",
".",
"Criteria",
"for",
"division",
"of",
"centers",
"into",
"two",
"subgroups",
"were",
"based",
"on",
"the",
"following",
"requirements",
":",
"do",
"not",
"use",
"allo-APC",
"-LRB-",
"first",
"subgroup",
"analysis",
"-RRB-",
",",
"use",
"a",
"resting",
"time",
"-LRB-",
"second",
"subgroup",
"analysis",
"-RRB-",
"or",
"use",
"equal",
"or",
"more",
"than",
"400,000",
"PBMC",
"per",
"well",
"-LRB-",
"third",
"subgroup",
"analysis",
"-RRB-",
".",
"Grey",
"bars",
"always",
"represent",
"centers",
"that",
"were",
"in",
"conformity",
"with",
"the",
"indicated",
"minimum",
"requirement",
",",
"black",
"bars",
"show",
"results",
"from",
"centers",
"that",
"did",
"not",
"fulfil",
"that",
"requirement",
".",
"The",
"boxes",
"within",
"each",
"column",
"indicate",
"the",
"fraction",
"of",
"centers",
"in",
"each",
"category",
".",
"The",
"asterisks",
"indicate",
"a",
"P-value",
"<",
"0.05",
"in",
"Chi-square",
"analysis",
"In",
"conclusion",
",",
"the",
"ability",
"to",
"detect",
"antigen-specific",
"T-cell",
"reactivities",
"by",
"tetramer",
"staining",
"was",
"mainly",
"affected",
"by",
"the",
"number",
"of",
"CD8",
"+",
"T-cells",
"stained",
"and",
"analyzed",
",",
"especially",
"when",
"the",
"antigen-specific",
"T-cells",
"were",
"present",
"at",
"low",
"or",
"moderate",
"frequencies",
".",
"We",
"therefore",
"modified",
"our",
"guidelines",
"for",
"the",
"tetramer",
"assay",
"and",
"recommended",
"staining",
"at",
"least",
"1",
"×",
"106",
"PBMC",
"and",
"analyzing",
"all",
"cells",
"in",
"the",
"tube",
".",
"In",
"addition",
",",
"we",
"provided",
"an",
"example",
"of",
"how",
"optimal",
"cell",
"gates",
"and",
"dot-plot",
"quadrants",
"could",
"be",
"selected",
".",
"ELISPOT",
"assays",
"are",
"heterogeneous",
"and",
"require",
"standardization",
"The",
"ELISPOT",
"analyses",
"were",
"performed",
"according",
"to",
"11",
"more",
"or",
"less",
"different",
"protocols",
".",
"The",
"most",
"discernible",
"differences",
"that",
"were",
"observed",
"in",
"these",
"protocols",
"concerned",
"-LRB-",
"1",
"-RRB-",
"the",
"different",
"types",
"of",
"multi-screen",
"plates",
",",
"-LRB-",
"2",
"-RRB-",
"the",
"serum",
"origin",
",",
"-LRB-",
"3",
"-RRB-",
"the",
"use",
"of",
"duplicates",
",",
"triplicates",
"or",
"quadruplicates",
",",
"-LRB-",
"4",
"-RRB-",
"the",
"use",
"of",
"allogeneic",
"APC",
",",
"-LRB-",
"5",
"-RRB-",
"the",
"inclusion",
"of",
"a",
"resting",
"phase",
"after",
"thawing",
"the",
"PBMC",
",",
"-LRB-",
"6",
"-RRB-",
"the",
"number",
"of",
"PBMC",
"per",
"well",
",",
"-LRB-",
"7",
"-RRB-",
"the",
"type",
"of",
"antibodies",
"used",
",",
"-LRB-",
"8",
"-RRB-",
"the",
"type",
"of",
"spot-reader",
",",
"and",
"the",
"-LRB-",
"9",
"-RRB-",
"enzyme",
"and",
"substrate",
"for",
"staining",
"of",
"the",
"spots",
".",
"Each",
"center",
"also",
"used",
"a",
"different",
"plate",
"protocol",
"-LRB-",
"distribution",
"of",
"the",
"wells",
",",
"number",
"of",
"replicates",
",",
"control",
"tests",
"-RRB-",
".",
"The",
"influence",
"of",
"each",
"of",
"these",
"parameters",
"on",
"the",
"number",
"of",
"positive",
"responses",
"was",
"studied",
"by",
"further",
"analysis",
"in",
"which",
"the",
"laboratories",
"were",
"divided",
"into",
"two",
"subgroups",
".",
"As",
"a",
"result",
",",
"several",
"criteria",
"were",
"identified",
"which",
"could",
"help",
"to",
"improve",
"the",
"sensitivity",
"and",
"comparability",
"of",
"detection",
".",
"All",
"data",
"sets",
"-LRB-",
"duplicates",
",",
"triplicates",
"or",
"quadruplicates",
"-RRB-",
"were",
"first",
"analyzed",
"by",
"Student",
"t",
"test",
"for",
"unpaired",
"samples",
"-LRB-",
"``",
"Materials",
"and",
"methods",
"''",
"-RRB-",
".",
"In",
"our",
"panel",
",",
"one",
"center",
"used",
"quadruplicates",
",",
"nine",
"centers",
"used",
"triplicates",
"and",
"one",
"center",
"performed",
"the",
"ELISPOT",
"analysis",
"in",
"duplicates",
".",
"Due",
"to",
"the",
"variety",
"in",
"the",
"replicates",
",",
"responses",
"measured",
"by",
"duplicate",
"wells",
"failed",
"to",
"pass",
"the",
"Student",
"t",
"test",
"more",
"often",
"as",
"compared",
"to",
"triplicates",
".",
"Overall",
",",
"the",
"11",
"centers",
"were",
"able",
"to",
"detect",
"50",
"%",
"of",
"all",
"possible",
"reactivities",
"in",
"this",
"panel",
"phase",
"-LRB-",
"Table",
"2",
";",
"Fig.",
"2b",
"-RRB-",
".",
"In",
"a",
"subgroup",
"of",
"three",
"laboratories",
"-LRB-",
"Z5",
",",
"Z6",
"and",
"Z8",
"-RRB-",
",",
"an",
"allogeneic",
"APC",
"population",
"-LRB-",
"T2",
"or",
"K562-A",
"*",
"0201",
"cells",
"-RRB-",
"was",
"added",
"for",
"binding",
"and",
"presentation",
"of",
"the",
"synthetic",
"peptides",
".",
"The",
"three",
"centers",
"that",
"used",
"allo-APC",
"detected",
"only",
"28",
"%",
"of",
"all",
"responses",
",",
"while",
"the",
"other",
"centers",
"detected",
"58",
"%",
"of",
"all",
"responses",
".",
"In",
"five",
"laboratories",
"-LRB-",
"Z3",
",",
"Z4",
",",
"Z7",
",",
"Z8",
",",
"and",
"Z9",
"-RRB-",
"PBMC",
"were",
"thawed",
",",
"and",
"then",
"incubated",
"in",
"culture",
"medium",
"at",
"37",
"°C",
".",
"After",
"this",
"resting",
"phase",
"of",
"2",
"--",
"20",
"h",
",",
"living",
"cells",
"were",
"washed",
",",
"counted",
"and",
"seeded",
"into",
"ELISPOT",
"plates",
".",
"Laboratories",
"using",
"a",
"resting",
"phase",
"detected",
"73",
"%",
"of",
"the",
"positive",
"reactivities",
"-LRB-",
"22",
"out",
"of",
"30",
"potentially",
"positive",
"tests",
"-RRB-",
".",
"No",
"significant",
"difference",
"in",
"the",
"ability",
"to",
"detect",
"antigen-specific",
"T",
"cells",
"was",
"found",
"using",
"shorter",
"or",
"longer",
"resting-times",
".",
"In",
"contrast",
",",
"the",
"laboratories",
"that",
"did",
"not",
"use",
"a",
"resting",
"procedure",
"detected",
"only",
"30",
"%",
"of",
"all",
"positives",
"-LRB-",
"Fig.",
"2b",
"-RRB-",
".",
"Finally",
",",
"the",
"number",
"of",
"cells",
"seeded",
"per",
"well",
"differed",
"considerably",
"between",
"all",
"participants",
"and",
"ranged",
"from",
"1",
"to",
"6",
"×",
"105",
"PBMC",
".",
"We",
"divided",
"the",
"laboratories",
"arbitrarily",
"into",
"two",
"groups",
",",
"those",
"using",
"either",
"more",
"than",
"4",
"×",
"105",
"PBMC",
"-LRB-",
"Z4",
",",
"Z7",
",",
"Z8",
",",
"and",
"Z9",
"-RRB-",
"or",
"less",
"than",
"4",
"×",
"105",
"PBMC",
"-LRB-",
"Z1",
",",
"Z2",
",",
"Z3",
",",
"Z11",
"and",
"Z12",
"-RRB-",
".",
"The",
"first",
"group",
"detected",
"71",
"%",
"of",
"all",
"positive",
"samples",
",",
"whereas",
"the",
"second",
"group",
"was",
"able",
"to",
"detect",
"only",
"43",
"%",
"of",
"all",
"positives",
"-LRB-",
"Fig.",
"2b",
"-RRB-",
".",
"Centers",
"Z5",
"and",
"Z6",
"used",
"a",
"defined",
"number",
"of",
"separated",
"CD8",
"+",
"T-cells",
"in",
"the",
"ELISPOT",
"and",
"were",
"therefore",
"not",
"included",
"in",
"this",
"subgroup",
"analysis",
".",
"None",
"other",
"of",
"the",
"nine",
"depicted",
"protocol",
"variables",
"had",
"any",
"obvious",
"impact",
"on",
"the",
"detection",
"of",
"specific",
"T-cells",
".",
"As",
"a",
"conclusion",
"from",
"these",
"results",
",",
"four",
"minimum",
"requirements",
"were",
"formulated",
"for",
"the",
"ELISPOT",
"protocol",
":",
"-LRB-",
"1",
"-RRB-",
"perform",
"triplicates",
"for",
"each",
"test",
"antigen",
"-LRB-",
"2",
"-RRB-",
"do",
"not",
"use",
"allo-APC",
"-LRB-",
"3",
"-RRB-",
"add",
"a",
"resting",
"time",
"to",
"increase",
"the",
"proportion",
"of",
"living",
"cells",
"seeded",
"and",
"-LRB-",
"4",
"-RRB-",
"use",
"a",
"minimum",
"number",
"of",
"4",
"×",
"105",
"PBMC",
"per",
"well",
".",
"Phase",
"II/2006",
"of",
"the",
"interlaboratory",
"testing",
"project",
"--",
"general",
"aspects",
"To",
"formally",
"prove",
"that",
"the",
"requirements",
"formulated",
"for",
"tetramer",
"staining",
"and",
"ELISPOT",
"analysis",
"increase",
"the",
"ability",
"of",
"the",
"participants",
"to",
"detect",
"antigen-specific",
"CD8",
"+",
"T-cells",
"and",
"reduce",
"the",
"inter-center",
"variability",
",",
"we",
"decided",
"to",
"repeat",
"the",
"analysis",
"in",
"a",
"second",
"phase",
"of",
"the",
"panel",
",",
"with",
"the",
"same",
"participants",
"-LRB-",
"phase",
"II/2006",
"-RRB-",
".",
"In",
"this",
"round",
",",
"all",
"groups",
"were",
"asked",
"to",
"follow",
"our",
"modified",
"guidelines",
"for",
"the",
"tetramer",
"-",
"and",
"the",
"ELISPOT-assays",
".",
"Again",
",",
"all",
"PBMC",
"samples",
"were",
"prepared",
"and",
"pre-tested",
"in",
"one",
"central",
"lab",
"and",
"peptide",
"antigens",
"and",
"PE-conjugated",
"tetramers",
"were",
"also",
"provided",
"from",
"one",
"source",
".",
"As",
"one",
"investigator",
"had",
"meanwhile",
"moved",
"to",
"another",
"lab",
",",
"we",
"added",
"a",
"13th",
"center",
"to",
"the",
"group",
".",
"PBMC",
"from",
"seven",
"selected",
"healthy",
"HLA-A",
"*",
"0201-positive",
"donors",
"and",
"1",
"HLA-A",
"*",
"0201-negative",
"donor",
"-LRB-",
"D3",
"-RRB-",
"were",
"required",
"to",
"be",
"analyzed",
"for",
"the",
"presence",
"of",
"HLA-A",
"*",
"0201-restricted",
"CMV-specific",
"T",
"cells",
"and",
"for",
"influenza-specific",
"T-cells",
".",
"The",
"mean",
"number",
"of",
"recovered",
"cells",
"after",
"thawing",
"was",
"sufficient",
"to",
"perform",
"the",
"tests",
".",
"When",
"all",
"the",
"data",
"were",
"combined",
",",
"it",
"became",
"clear",
"that",
"subjects",
"D2",
",",
"D5",
"and",
"D8",
"possessed",
"CMV-specific",
"CD8",
"+",
"T-cell",
"subsets",
",",
"and",
"D1",
",",
"D2",
",",
"D4",
",",
"D6",
"and",
"D7",
"possessed",
"influenza-specific",
"CD8",
"+",
"T-cells",
".",
"Therefore",
",",
"each",
"laboratory",
"could",
"theoretically",
"have",
"measured",
"eight",
"positives",
"-LRB-",
"3",
"×",
"CMV",
"and",
"5",
"×",
"Influenza",
"-RRB-",
"in",
"this",
"second",
"phase",
".",
"Analysis",
"of",
"CD8",
"+",
"T-cell",
"tetramer",
"binding",
"using",
"the",
"new",
"guidelines",
"In",
"the",
"second",
"phase",
",",
"a",
"total",
"of",
"104",
"tests",
"were",
"performed",
"to",
"detect",
"the",
"eight",
"possible",
"tetramer",
"reactivities",
".",
"Following",
"the",
"modified",
"guidelines",
"for",
"tetramer",
"staining",
",",
"the",
"mean",
"number",
"of",
"CD8",
"+",
"T-cells",
"that",
"were",
"counted",
"in",
"each",
"separate",
"test",
"increased",
"markedly",
"-LRB-",
"+36",
"%",
"-RRB-",
":",
"a",
"mean",
"of",
"about",
"49,000",
"CD8",
"+",
"cells",
"were",
"analyzed",
"in",
"the",
"phase",
"I",
"-LRB-",
"n",
"=",
"68",
"tests",
"-RRB-",
"and",
"a",
"mean",
"of",
"67,000",
"CD8",
"+",
"T-cells",
"in",
"phase",
"II",
"-LRB-",
"n",
"=",
"104",
"tests",
"-RRB-",
".",
"The",
"number",
"of",
"cells",
"per",
"test",
"ranged",
"from",
"12,000",
"to",
"467,000",
"CD8",
"+",
".",
"In",
"81",
"%",
"-LRB-",
"84",
"of",
"104",
"-RRB-",
"of",
"the",
"tests",
">",
"30,000",
"CD8",
"+",
"were",
"counted",
"-LRB-",
"compared",
"to",
"66",
"%",
"of",
"all",
"relevant",
"tests",
"in",
"the",
"first",
"phase",
"-RRB-",
".",
"Table",
"3",
"shows",
"-LRB-",
"I",
"-RRB-",
"the",
"minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"T-cells",
",",
"-LRB-",
"II",
"-RRB-",
"the",
"results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z13",
",",
"and",
"-LRB-",
"III",
"-RRB-",
"the",
"number",
"and",
"percentage",
"of",
"centers",
"that",
"detected",
"each",
"T-cell",
"specificity",
".",
"Donors",
"D2",
",",
"D5",
"and",
"D8",
"showed",
"very",
"strong",
"reactivities",
"with",
"the",
"CMV-tetramer",
",",
"with",
"mean",
"frequencies",
"of",
"1/45",
"CD8",
"+",
"T-cells",
",",
"1/37",
"CD8",
"+",
"T-cells",
",",
"and",
"1/19",
"CD8",
"+",
"T-cells",
",",
"respectively",
".",
"All",
"13",
"laboratories",
"were",
"able",
"to",
"detect",
"these",
"populations",
"-LRB-",
"Table",
"3",
"-RRB-",
".",
"All",
"but",
"one",
"center",
"detected",
"the",
"influenza-specific",
"cells",
"present",
"at",
"high",
"frequencies",
"in",
"donors",
"D6",
"-LRB-",
"1/1116",
"CD8",
"+",
"T-cells",
"-RRB-",
"and",
"D7",
"-LRB-",
"1/347",
"CD8",
"+",
"T-cells",
"-RRB-",
".",
"Donors",
"D1",
",",
"D2",
"and",
"D4",
"possessed",
"fewer",
"specific",
"cells",
"-LRB-",
"1/3",
",739",
",",
"1/3",
",573",
"and",
"1/5",
",278",
"CD8",
"+",
"T-cells",
"-RRB-",
"which",
"were",
"found",
"by",
"12",
",",
"9",
"and",
"9",
"centers",
",",
"respectively",
".",
"Three",
"laboratories",
"also",
"reported",
"influenza",
"tetramer-binding",
"CD8",
"+",
"cells",
"in",
"D5",
"or",
"D8",
".",
"According",
"to",
"the",
"results",
"of",
"the",
"other",
"centers",
"as",
"well",
"as",
"from",
"the",
"ELISPOT",
"-LRB-",
"see",
"below",
"-RRB-",
",",
"these",
"stainings",
"were",
"considered",
"as",
"false",
"positive",
"-LRB-",
"not",
"shown",
"-RRB-",
".",
"One",
"center",
"-LRB-",
"Z13",
"-RRB-",
"was",
"not",
"able",
"to",
"detect",
"any",
"of",
"the",
"influenza-specific",
"CD8",
"+",
"T-cell",
"reactivities",
".",
"Finally",
",",
"no",
"tetramer",
"+",
"cells",
"were",
"described",
"in",
"the",
"HLA-A",
"*",
"0201-negative",
"donor",
"-LRB-",
"D3",
"-RRB-",
".",
"Table",
"3Overview",
"of",
"tetramer",
"results",
"from",
"phase",
"II/2006",
"of",
"the",
"CIMT",
"monitoring",
"panelD1",
"FluD2",
"CMVD2",
"FluD4",
"FluD5",
"CMVD6",
"FluD7",
"FluD8",
"CMVMin7",
",1437710,00010,000603,33386942",
"-LRB-",
"I",
"-RRB-",
"Medium3",
",739453,5735,278371,11634719",
"Max1",
",538281,2502,500305712028",
"Z13",
",333",
"453,3335,0003976929410",
"-LRB-",
"II",
"-RRB-",
"Z24",
",000303,3335,000301,10025021",
"Z34",
",00047",
"--",
"5,0004558827020",
"Z41",
",538712,8576,6663376926342",
"Z56",
",666542,500",
"--",
"431,42837724",
"Z65",
",00077",
"--",
"10,000601,66686927",
"Z72",
",857473,3336,6663883329022",
"Z82",
",000353,3333,333316662448",
"Z93",
",3333110,0003,333323,33362520",
"Z103",
",333282,222",
"--",
"3095220213Z111",
",666361,2502,5003257121515",
"Z127",
",41337",
"--",
"--",
"357142608Z13",
"--",
"53",
"--",
"--",
"34",
"--",
"--",
"20Detected",
"by12/1313/139",
"/",
"139/1313/1312",
"/",
"1312/1313/13",
"-LRB-",
"III",
"-RRB-",
"Detected",
"%",
"9210069691009292100",
"-LRB-",
"I",
"-RRB-",
"Minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"T-cells",
"-LRB-",
"II",
"-RRB-",
"Results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z13",
".",
"All",
"frequencies",
"are",
"indicated",
"as",
"1",
"per",
"x",
"counted",
"CD8",
"+",
"T-cells",
"-LRB-",
"III",
"-RRB-",
"Number",
"and",
"percentage",
"of",
"centers",
"that",
"detected",
"each",
"of",
"the",
"eight",
"possible",
"responses",
"Analysis",
"of",
"CD8",
"+",
"T-cell",
"responses",
"by",
"ELISPOT",
"following",
"the",
"introduction",
"of",
"a",
"set",
"of",
"four",
"rules",
"In",
"this",
"second",
"phase",
",",
"all",
"laboratories",
"performed",
"ELISPOT",
"analysis",
"following",
"local",
"protocols",
",",
"all",
"of",
"which",
"conformed",
"to",
"the",
"newly",
"introduced",
"minimum",
"requirements",
".",
"Table",
"4",
"shows",
"-LRB-",
"I",
"-RRB-",
"the",
"minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"cells",
",",
"-LRB-",
"II",
"-RRB-",
"the",
"results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z13",
",",
"and",
"-LRB-",
"III",
"-RRB-",
"the",
"number",
"and",
"percentage",
"of",
"centers",
"that",
"detected",
"the",
"response",
".",
"High",
"frequency",
"T-cell",
"responses",
"against",
"CMV",
"could",
"readily",
"be",
"detected",
"by",
"all",
"13",
"centers",
"in",
"donors",
"D5",
"and",
"D8",
"and",
"by",
"12",
"of",
"13",
"in",
"donor",
"D2",
".",
"Failure",
"of",
"center",
"Z4",
"to",
"detect",
"the",
"CMV",
"reactivity",
"in",
"donor",
"D2",
"was",
"due",
"to",
"a",
"very",
"high",
"background",
"of",
"the",
"medium",
"control",
".",
"The",
"number",
"of",
"spots",
"representing",
"IFNγ-producing",
"cells",
"after",
"influenza-peptide",
"stimulation",
"was",
"generally",
"lower",
",",
"and",
"consequently",
",",
"the",
"influenza-specific",
"T-cell",
"responses",
"in",
"subjects",
"D1",
",",
"D2",
",",
"D4",
"and",
"D6",
"were",
"detected",
"by",
"fewer",
"laboratories",
"-LRB-",
"four",
"centers",
"for",
"D1",
",",
"three",
"centers",
"for",
"D2",
",",
"two",
"centers",
"for",
"D4",
"and",
"ten",
"centers",
"for",
"D6",
"-RRB-",
".",
"The",
"high",
"numbers",
"of",
"influenza-specific",
"T-cells",
"present",
"in",
"D7",
"were",
"detected",
"by",
"all",
"13",
"laboratories",
"-LRB-",
"Table",
"4",
"-RRB-",
".",
"Table",
"4Overview",
"of",
"IFNγ",
"ELISPOT",
"results",
"from",
"phase",
"II/2006",
"of",
"the",
"CIMT",
"monitoring",
"panelD1",
"FluD2",
"CMVD2",
"FluD4",
"FluD5",
"CMVD6",
"FluD7",
"FluD8",
"CMVMin44",
",1181,79133,80358,8241,74548,38714,7201,698",
"-LRB-",
"I",
"-RRB-",
"Medium28",
",8231,08816,39549,96099914,2654,6691,023",
"Max10",
",3453961,23141,0963914,4581,706269",
"Z144",
",118596",
"--",
"--",
"59648,38714,720318",
"-LRB-",
"II",
"-RRB-",
"Z2",
"--",
"1,732",
"--",
"--",
"1,7454,7392,2221,698",
"Z3",
"--",
"1,333",
"--",
"--",
"1,117",
"--",
"2,9821,292",
"Z4",
"--",
"--",
"--",
"--",
"774",
"--",
"2,273447",
"Z5",
"--",
"997",
"--",
"--",
"1,15717,6473,8271,209",
"Z610",
",3451,03114,151",
"--",
"1,006",
"--",
"1,7061,005",
"Z7",
"--",
"1,317",
"--",
"--",
"1,06110,0006,0001,661",
"Z832",
",258396",
"--",
"58,8243914,4583,623269",
"Z928",
",571966",
"--",
"41,09691214,4238,9551,081",
"Z10",
"--",
"8471,231",
"--",
"8067,4263,052696",
"Z11",
"--",
"1,04433,803",
"--",
"1,08720,3393,6701,273",
"Z12",
"--",
"1,791",
"--",
"--",
"1,38710,6193,0571,583",
"Z13",
"--",
"1,008",
"--",
"--",
"9494,6154,615770",
"Detected",
"by4/1312/133",
"/",
"132/1313/1310",
"/",
"1313/1313/13",
"-LRB-",
"III",
"-RRB-",
"Detected",
"%",
"3192231510077100100",
"-LRB-",
"I",
"-RRB-",
"Minimum",
",",
"mean",
"and",
"maximum",
"frequencies",
"of",
"antigen-specific",
"cells",
"-LRB-",
"II",
"-RRB-",
"Results",
"obtained",
"from",
"the",
"individual",
"centers",
"Z1",
"--",
"Z13",
".",
"All",
"frequencies",
"are",
"indicated",
"as",
"1",
"per",
"x",
"seeded",
"PBMC",
"-LRB-",
"III",
"-RRB-",
"Number",
"and",
"percentage",
"of",
"centers",
"that",
"detected",
"each",
"of",
"the",
"eight",
"possible",
"responses",
"Comparison",
"of",
"the",
"results",
"obtained",
"in",
"both",
"phases",
"When",
"the",
"mean",
"frequencies",
"of",
"all",
"T-cell",
"responses",
"in",
"both",
"testing",
"rounds",
"were",
"compared",
",",
"it",
"became",
"clear",
"that",
"there",
"was",
"a",
"difference",
"in",
"the",
"distribution",
"of",
"reactivities",
"-LRB-",
"Fig.",
"3",
"-RRB-",
".",
"In",
"the",
"tetramer",
"assay",
",",
"the",
"mean",
"T-cell",
"frequency",
"of",
"the",
"six",
"possible",
"positives",
"in",
"the",
"first",
"phase",
"was",
"1",
"per",
"2,083",
"CD8",
"+",
"T-cells",
".",
"This",
"value",
"was",
"1",
"per",
"1,769",
"CD8",
"+",
"T-cells",
"for",
"the",
"eight",
"possible",
"positives",
"in",
"the",
"second",
"phase",
".",
"Similarly",
",",
"the",
"mean",
"T-cell",
"frequency",
"of",
"the",
"responses",
"detected",
"in",
"IFNγ",
"ELISPOT",
"was",
"1",
"per",
"22,369",
"PBMC",
"for",
"Phase",
"I/2005",
"but",
"1",
"per",
"14,653",
"PBMC",
"for",
"Phase",
"II/2006",
".",
"To",
"allow",
"a",
"comparison",
"of",
"the",
"overall",
"performance",
"in",
"both",
"phases",
"of",
"the",
"panel",
",",
"we",
"therefore",
"decided",
"to",
"define",
"theoretical",
"thresholds",
"for",
"high",
",",
"moderate",
"and",
"low",
"T-cell",
"responses",
"and",
"then",
"to",
"compare",
"data",
"of",
"the",
"participating",
"laboratories",
"within",
"these",
"groups",
".",
"Fig.",
"3Distribution",
"of",
"antigen-specific",
"T-cell",
"frequencies",
"in",
"the",
"two",
"testing",
"phases",
"as",
"obtained",
"by",
"tetramer",
"staining",
"-LRB-",
"a",
"-RRB-",
"and",
"IFNγ",
"ELISPOT",
"assays",
"-LRB-",
"b",
"-RRB-",
".",
"The",
"figure",
"shows",
"the",
"six",
"reactivities",
"-LRB-",
"filled",
"circle",
"-RRB-",
"and",
"the",
"calculated",
"mean",
"of",
"all",
"reactivities",
"from",
"phase",
"I/2005",
"-LRB-",
"filled",
"line",
"-RRB-",
"as",
"well",
"as",
"the",
"eight",
"reactivities",
"-LRB-",
"open",
"circle",
"-RRB-",
"and",
"calculated",
"mean",
"of",
"all",
"reactivities",
"from",
"phase",
"II/2006",
"-LRB-",
"open",
"line",
"-RRB-",
".",
"The",
"frequency",
"of",
"antigen-specific",
"T-cells",
"is",
"indicated",
"on",
"the",
"y-axis",
"as",
"1",
"per",
"x",
"counted",
"CD8",
"+",
"T-cells",
"for",
"the",
"tetramer",
"test",
"and",
"as",
"1",
"per",
"x",
"seeded",
"PBMC",
"for",
"the",
"ELISPOT",
"assay",
"In",
"order",
"to",
"define",
"such",
"thresholds",
"for",
"low",
",",
"medium",
"and",
"high",
"T-cell",
"responses",
",",
"we",
"first",
"displayed",
"the",
"probability",
"of",
"detecting",
"each",
"of",
"the",
"14",
"different",
"reactivities",
"as",
"a",
"value",
"in",
"a",
"coordinate",
"system",
"and",
"inserted",
"a",
"trendline",
".",
"For",
"both",
"the",
"tetramer",
"assay",
"and",
"the",
"ELISPOT",
"assay",
",",
"we",
"observed",
"a",
"clear",
"correlation",
"between",
"the",
"frequencies",
"of",
"antigen-specific",
"T-cells",
"and",
"the",
"number",
"of",
"participating",
"centers",
"that",
"were",
"able",
"to",
"detect",
"these",
"populations",
".",
"We",
"then",
"calculated",
"the",
"theoretical",
"frequencies",
"at",
"which",
"90",
"%",
"-LRB-",
"y",
"=",
"90",
"-RRB-",
"and",
"50",
"%",
"-LRB-",
"y",
"=",
"50",
"-RRB-",
"of",
"all",
"participants",
"could",
"detect",
"a",
"given",
"response",
"-LRB-",
"Fig.",
"4a",
",",
"b",
"-RRB-",
"and",
"used",
"these",
"two",
"thresholds",
"to",
"divide",
"all",
"reactivities",
"into",
"three",
"distinct",
"classes",
"of",
"T-cell",
"responses",
"-LRB-",
"``",
"high",
"''",
",",
"``",
"moderate",
"''",
"and",
"``",
"low",
"''",
"-RRB-",
".",
"Fig.",
"4Probability",
"of",
"detecting",
"a",
"reactivity",
"by",
"a",
"tetramer",
"staining",
",",
"or",
"b",
"IFNγ",
"ELISPOT",
"assay",
".",
"A",
"trendline",
"was",
"inserted",
"on",
"the",
"basis",
"of",
"results",
"from",
"all",
"14",
"reactivities",
"from",
"both",
"phases",
"of",
"the",
"panel",
".",
"The",
"figure",
"shows",
"the",
"six",
"reactivities",
"from",
"phase",
"I/2005",
"-LRB-",
"filled",
"squares",
"-RRB-",
"and",
"the",
"eight",
"reactivities",
"from",
"phase",
"II/2006",
"-LRB-",
"open",
"squares",
"-RRB-",
".",
"The",
"frequency",
"of",
"antigen-specific",
"T-cells",
"is",
"shown",
"on",
"the",
"x-axis",
"in",
"1",
"per",
"x",
"counted",
"CD8",
"+",
"T-cells",
"for",
"the",
"tetramer",
"assay",
"-LRB-",
"a",
"-RRB-",
"or",
"1",
"per",
"x",
"seeded",
"PBMC",
"for",
"the",
"ELISPOT",
"assay",
"-LRB-",
"b",
"-RRB-",
".",
"X-values",
"for",
"y",
"=",
"90",
"%",
"and",
"y",
"=",
"50",
"%",
"are",
"indicated",
"by",
"the",
"broken",
"lines",
"For",
"the",
"tetramer",
"assay",
",",
"T-cell",
"frequencies",
"exceeding",
"1",
"per",
"1,200",
"CD8",
"+",
"T-cells",
"were",
"therefore",
"classified",
"as",
"``",
"high",
"''",
",",
"whereas",
"frequencies",
"of",
"less",
"than",
"1",
"per",
"7,650",
"CD8",
"+",
"were",
"classified",
"as",
"``",
"low",
"''",
"-LRB-",
"Fig.",
"4a",
"-RRB-",
".",
"Following",
"the",
"same",
"rules",
"for",
"the",
"ELISPOT",
"assay",
",",
"T-cell",
"responses",
"of",
"at",
"least",
"one",
"IFNγ",
"spot",
"per",
"2,850",
"PBMC",
"can",
"be",
"considered",
"as",
"``",
"high",
"''",
"and",
"T-cell",
"responses",
"of",
"less",
"than",
"one",
"spot",
"per",
"19,000",
"PBMC",
"as",
"``",
"low",
"''",
"-LRB-",
"Fig.",
"4b",
"-RRB-",
".",
"With",
"these",
"calculated",
"assay-specific",
"thresholds",
"for",
"high",
",",
"moderate",
"and",
"low",
"T-cell",
"responses",
",",
"we",
"compared",
"the",
"results",
"obtained",
"in",
"the",
"two",
"phases",
".",
"For",
"the",
"tetramer",
"assay",
",",
"the",
"ability",
"to",
"detect",
"high",
"frequency",
"T-cells",
"-LRB-",
">",
"1",
"per",
"1,200",
"CD8",
"+",
"-RRB-",
"did",
"not",
"differ",
"in",
"the",
"two",
"phases",
",",
"and",
"was",
"not",
"influenced",
"by",
"the",
"number",
"of",
"CD8",
"+",
"analyzed",
",",
"as",
"previously",
"seen",
"for",
"each",
"of",
"the",
"two",
"phases",
"separately",
"-LRB-",
"Fig.",
"5a",
"-RRB-",
".",
"However",
",",
"for",
"moderate",
"and",
"low",
"T-cell",
"frequencies",
",",
"we",
"found",
"that",
"they",
"could",
"be",
"successfully",
"detected",
"in",
"only",
"54",
"%",
"of",
"cases",
"in",
"the",
"first",
"phase",
"but",
"this",
"improved",
"to",
"77",
"%",
"in",
"the",
"second",
"phase",
".",
"Moreover",
",",
"here",
",",
"the",
"number",
"of",
"cells",
"counted",
"did",
"have",
"an",
"impact",
"on",
"the",
"ability",
"to",
"detect",
"low",
"frequency",
"T-cells",
".",
"In",
"the",
"first",
"phase",
",",
"only",
"14",
"%",
"were",
"detected",
"when",
"less",
"than",
"30,000",
"CD8",
"+",
"were",
"counted",
",",
"as",
"compared",
"to",
"71",
"%",
"when",
"more",
"than",
"30,000",
"CD8",
"+",
"T-cells",
"were",
"counted",
".",
"The",
"same",
"trend",
"was",
"observed",
"in",
"phase",
"II/2006",
",",
"but",
"in",
"this",
"case",
"40",
"%",
"of",
"assays",
"with",
"less",
"than",
"30,000",
"CD8",
"+",
"successfully",
"detected",
"the",
"moderate",
"to",
"low",
"T-cell",
"frequencies",
"compared",
"to",
"83",
"%",
"counting",
"more",
"than",
"30,000",
"CD8",
"+",
"-LRB-",
"Fig.",
"5a",
"-RRB-",
".",
"Fig.",
"5a",
"Percentage",
"of",
"reactivities",
"actually",
"detected",
"by",
"tetramer",
"staining",
".",
"The",
"first",
"two",
"groups",
"of",
"bars",
"show",
"the",
"detection",
"rate",
"for",
"the",
"nine",
"high",
"reactivities",
"-LRB-",
">",
"1",
"per",
"1,200",
"CD8",
"+",
"T-cells",
"-RRB-",
"in",
"phase",
"I/2005",
"and",
"phase",
"II/2006",
".",
"The",
"next",
"two",
"groups",
"of",
"bars",
"show",
"the",
"detection",
"rate",
"for",
"five",
"moderate",
"to",
"low",
"reactivities",
"-LRB-",
"<",
"1",
"per",
"1,200",
"CD8",
"+",
"-RRB-",
"in",
"phase",
"I/2005",
"-LRB-",
"third",
"group",
"-RRB-",
"or",
"phase",
"II/2006",
"-LRB-",
"fourth",
"group",
"-RRB-",
".",
"The",
"open",
"bars",
"represent",
"all",
"tests",
"performed",
",",
"grey",
"bars",
"represent",
"results",
"obtained",
"in",
"tests",
"that",
"were",
"performed",
"on",
"more",
"than",
"3",
"×",
"104",
"CD8",
"+",
"T-cells",
"and",
"filled",
"bars",
"represent",
"results",
"obtained",
"in",
"tests",
"that",
"were",
"performed",
"on",
"less",
"than",
"3",
"×",
"104",
"CD8",
"+",
"T-cells",
".",
"b",
"Percentage",
"of",
"reactivities",
"detected",
"in",
"IFNγ",
"ELISPOT",
"assays",
".",
"The",
"first",
"two",
"groups",
"of",
"bars",
"show",
"the",
"rate",
"of",
"detection",
"of",
"the",
"four",
"high",
"reactivities",
"-LRB-",
">",
"1",
"per",
"2,850",
"PBMC",
"in",
"phase",
"I/2005",
"and",
"phase",
"II/2006",
".",
"The",
"next",
"two",
"groups",
"of",
"columns",
"show",
"the",
"rate",
"of",
"detection",
"for",
"the",
"ten",
"moderate",
"to",
"low",
"reactivities",
"-LRB-",
"<",
"1",
"per",
"2,850",
"PBMC",
"-RRB-",
"in",
"phase",
"I/2005",
"and",
"phase",
"II/2006",
".",
"The",
"open",
"bars",
"represent",
"the",
"performances",
"of",
"all",
"centers",
"in",
"the",
"respective",
"panel",
"phase",
",",
"grey",
"bars",
"represent",
"results",
"obtained",
"from",
"the",
"five",
"centers",
"that",
"already",
"fulfilled",
"at",
"least",
"three",
"of",
"the",
"four",
"minimum",
"criteria",
"in",
"phase",
"I/2005",
"and",
"filled",
"bars",
"represent",
"results",
"obtained",
"from",
"centers",
"that",
"fulfilled",
"less",
"than",
"three",
"of",
"the",
"four",
"minimum",
"criteria",
"in",
"phase",
"I/2005",
"We",
"then",
"analyzed",
"the",
"capacity",
"of",
"the",
"laboratories",
"to",
"measure",
"either",
"high",
"T-cell",
"responses",
"-LRB-",
">",
"1",
"per",
"2,850",
"PBMC",
"-RRB-",
"or",
"low",
"to",
"moderate",
"T-cell",
"responses",
"-LRB-",
"<",
"1",
"per",
"2,850",
"PBMC",
"-RRB-",
"in",
"the",
"ELISPOT",
"assay",
".",
"This",
"analysis",
"was",
"performed",
"for",
"two",
"defined",
"subgroups",
"of",
"participants",
".",
"The",
"first",
"subgroup",
"included",
"those",
"five",
"centers",
"-LRB-",
"Z3",
",",
"Z4",
",",
"Z7",
",",
"Z8",
"and",
"Z9",
"-RRB-",
"that",
"already",
"fulfilled",
"three",
"or",
"four",
"of",
"the",
"requirements",
"in",
"the",
"first",
"phase",
"of",
"the",
"panel",
".",
"These",
"five",
"centers",
"did",
"not",
"have",
"to",
"introduce",
"any",
"change",
"or",
"at",
"least",
"no",
"major",
"changes",
"to",
"their",
"protocol",
"for",
"the",
"repetition",
"of",
"the",
"experiments",
"in",
"phase",
"II",
".",
"The",
"second",
"subgroup",
"included",
"the",
"new",
"center",
"Z13",
"-LRB-",
"led",
"by",
"a",
"colleague",
"that",
"had",
"been",
"in",
"a",
"laboratory",
"that",
"only",
"fulfilled",
"one",
"of",
"four",
"requirements",
"in",
"phase",
"I",
"-RRB-",
"and",
"all",
"others",
"that",
"had",
"fulfilled",
"only",
"one",
"or",
"two",
"of",
"the",
"four",
"requirements",
"in",
"the",
"first",
"phase",
".",
"All",
"laboratories",
"in",
"this",
"second",
"group",
"had",
"to",
"introduce",
"marked",
"changes",
"to",
"their",
"locally",
"established",
"protocols",
".",
"Similar",
"to",
"the",
"tetramer",
"analysis",
",",
"the",
"new",
"requirements",
"were",
"not",
"necessary",
"to",
"detect",
"antigen-specific",
"responses",
"among",
"the",
"category",
"of",
"high",
"T-cell",
"frequencies",
"in",
"either",
"the",
"first",
"or",
"second",
"phases",
"-LRB-",
"Fig.",
"5b",
"-RRB-",
".",
"However",
",",
"applying",
"the",
"set",
"of",
"rules",
"defined",
"in",
"phase",
"I",
"markedly",
"improved",
"the",
"capacity",
"of",
"centers",
"to",
"detect",
"the",
"low",
"to",
"moderate",
"T-cell",
"responses",
".",
"The",
"first",
"subgroup",
"detected",
"a",
"total",
"of",
"68",
"%",
"of",
"the",
"low",
"to",
"moderate",
"reactivities",
"in",
"phase",
"I",
",",
"whereas",
"the",
"second",
"subgroup",
"detected",
"only",
"20",
"%",
"-LRB-",
"Fig.",
"5b",
"-RRB-",
".",
"After",
"harmonization",
"of",
"the",
"protocols",
",",
"both",
"subgroups",
"performed",
"equally",
"well",
".",
"In",
"addition",
",",
"the",
"inter-group",
"variability",
"in",
"detecting",
"positive",
"responses",
"was",
"reduced",
"in",
"phase",
"II",
"-LRB-",
"percentage",
"of",
"detected",
"responses",
"ranged",
"from",
"38",
"to",
"88",
"%",
"with",
"a",
"mean",
"of",
"67",
"±",
"16",
"%",
"-RRB-",
"as",
"compared",
"to",
"phase",
"I",
"-LRB-",
"percentage",
"of",
"detected",
"responses",
"ranged",
"from",
"0",
"to",
"100",
"%",
"with",
"a",
"mean",
"of",
"55",
"±",
"33",
"%",
"-RRB-",
".",
"Experience",
"does",
"not",
"equal",
"performance",
"Among",
"the",
"13",
"centers",
"that",
"had",
"participated",
"in",
"phase",
"II",
",",
"tetramer",
"stainings",
"had",
"been",
"performed",
"for",
"1",
"--",
"8",
"years",
".",
"Similarly",
",",
"the",
"experience",
"in",
"the",
"ELISPOT",
"technology",
"varied",
"between",
"1",
"and",
"10",
"years",
".",
"For",
"both",
"techniques",
",",
"we",
"could",
"not",
"find",
"any",
"correlation",
"between",
"the",
"years",
"of",
"experience",
"and",
"the",
"ability",
"to",
"detect",
"T-cell",
"responses",
",",
"not",
"even",
"among",
"the",
"subgroups",
"of",
"moderate",
"or",
"low",
"T-cell",
"responses",
"-LRB-",
"not",
"shown",
"-RRB-",
".",
"Discussion",
"Whenever",
"new",
"techniques",
"are",
"introduced",
"to",
"the",
"scientific",
"community",
",",
"they",
"are",
"first",
"only",
"available",
"to",
"a",
"small",
"group",
"of",
"expert",
"laboratories",
".",
"If",
"these",
"assays",
"are",
"robust",
"and",
"applicable",
"for",
"specific",
"research",
"or",
"routine",
"applications",
",",
"they",
"spread",
"to",
"the",
"international",
"community",
".",
"In",
"general",
",",
"the",
"``",
"original",
"''",
"protocol",
"then",
"undergoes",
"several",
"adaptations",
"in",
"order",
"to",
"meet",
"specific",
"needs",
".",
"On",
"the",
"one",
"hand",
",",
"changes",
"can",
"be",
"beneficial",
"and",
"result",
"in",
"the",
"improvement",
"of",
"protocols",
".",
"On",
"the",
"other",
",",
"this",
"evolutionary",
"process",
"leads",
"to",
"employment",
"of",
"many",
"different",
"protocol",
"variants",
",",
"limiting",
"comparison",
"of",
"the",
"study",
"results",
"obtained",
"by",
"different",
"laboratories",
".",
"Thus",
",",
"standardization",
"approaches",
"should",
"be",
"omitted",
"during",
"the",
"initial",
"development",
"but",
"are",
"absolutely",
"required",
"when",
"assays",
"have",
"become",
"firmly",
"established",
".",
"In",
"recent",
"years",
",",
"several",
"activities",
"aiming",
"at",
"the",
"harmonization",
"of",
"techniques",
"used",
"to",
"monitor",
"the",
"presence",
"of",
"antigen-specific",
"T-cells",
"have",
"been",
"initiated",
"for",
"ELISPOT",
"-LSB-",
"28",
"--",
"31",
"-RSB-",
",",
"tetramer",
"staining",
"-LSB-",
"32",
"-RSB-",
"and",
"ICS",
"-LSB-",
"33",
"--",
"36",
"-RSB-",
".",
"While",
"these",
"studies",
"showed",
"the",
"feasibility",
",",
"general",
"applicability",
"and",
"the",
"diversity",
"of",
"performance",
"among",
"participants",
",",
"they",
"were",
"not",
"designed",
"to",
"either",
"systematically",
"investigate",
"the",
"influence",
"of",
"distinct",
"protocol",
"variables",
"nor",
"to",
"test",
"whether",
"changes",
"to",
"these",
"parameters",
"can",
"lead",
"to",
"a",
"global",
"improvement",
"of",
"the",
"group",
".",
"The",
"CIMT",
"monitoring",
"panel",
"is",
"the",
"first",
"initiative",
"that",
"has",
"now",
"introduced",
"the",
"two-step",
"approach",
"proposing",
"a",
"strategy",
"where",
"technical",
"variables",
"that",
"influence",
"the",
"performance",
"of",
"a",
"defined",
"assay",
"are",
"first",
"systematically",
"identified",
"-LRB-",
"``",
"first",
"step",
"''",
"-RRB-",
"followed",
"by",
"a",
"new",
"testing",
"phase",
"where",
"resultant",
"protocol",
"changes",
"are",
"validated",
"under",
"controlled",
"conditions",
"within",
"the",
"same",
"group",
"of",
"investigators",
"-LRB-",
"``",
"second",
"step",
"''",
"-RRB-",
".",
"As",
"soon",
"as",
"a",
"number",
"of",
"protocol",
"variables",
"that",
"might",
"have",
"influenced",
"the",
"sensitivity",
"and",
"the",
"quality",
"of",
"the",
"tests",
"were",
"identified",
"in",
"the",
"first",
"phase",
"of",
"our",
"study",
",",
"it",
"was",
"decided",
"to",
"validate",
"this",
"finding",
"in",
"a",
"second",
"phase",
".",
"Because",
"this",
"two-step",
"approach",
"was",
"not",
"initially",
"foreseen",
",",
"the",
"second",
"phase",
"was",
"performed",
"with",
"PBMC",
"samples",
"obtained",
"from",
"different",
"donors",
"than",
"those",
"used",
"in",
"the",
"first",
"round",
".",
"The",
"distribution",
"and",
"the",
"frequencies",
"of",
"detectable",
"T-cell",
"responses",
"directed",
"against",
"the",
"chosen",
"model",
"antigens",
"were",
"different",
"in",
"the",
"first",
"and",
"second",
"group",
"of",
"donors",
"-LRB-",
"Fig.",
"3",
"-RRB-",
"precluding",
"a",
"direct",
"comparison",
"of",
"the",
"results",
"obtained",
"in",
"both",
"phases",
"of",
"the",
"panel",
".",
"To",
"circumvent",
"this",
"problem",
",",
"two",
"assay-specific",
"frequency",
"thresholds",
"were",
"introduced",
"that",
"allowed",
"us",
"to",
"distinguish",
"classes",
"of",
"T-cell",
"responses",
"-LRB-",
"low",
",",
"moderate",
"and",
"high",
"-RRB-",
"-LRB-",
"Fig.",
"4a",
",",
"b",
"-RRB-",
".",
"Clearly",
",",
"high-frequency",
"T-cell",
"responses",
"were",
"detected",
"irrespective",
"of",
"the",
"protocol",
"used",
"and",
"as",
"such",
"did",
"not",
"allow",
"the",
"identification",
"of",
"factors",
"that",
"exert",
"a",
"strong",
"influence",
"on",
"the",
"sensitivity",
"and",
"variability",
"of",
"the",
"protocols",
"used",
".",
"Relevant",
"parameters",
"could",
"only",
"be",
"detected",
"when",
"the",
"comparison",
"was",
"focused",
"on",
"the",
"detection",
"of",
"T-cells",
"that",
"are",
"present",
"at",
"low",
"to",
"moderate",
"frequencies",
"in",
"PBMC",
".",
"This",
"finding",
"should",
"be",
"taken",
"into",
"account",
"when",
"selecting",
"model",
"antigens",
"for",
"use",
"in",
"monitoring",
"panels",
"-LSB-",
"37",
"-RSB-",
",",
"in",
"particular",
"by",
"laboratories",
"that",
"are",
"interested",
"in",
"the",
"detection",
"of",
"peripheral",
"tumor-specific",
"T-cells",
",",
"which",
"are",
"often",
"present",
"at",
"low",
"frequencies",
",",
"even",
"after",
"vaccination",
".",
"Although",
"our",
"experiments",
"do",
"not",
"specifically",
"address",
"the",
"question",
"of",
"detection",
"limits",
"for",
"the",
"ELISPOT",
"and",
"tetramer",
"assays",
",",
"we",
"could",
"detect",
"a",
"high",
"variability",
"in",
"the",
"sensitivity",
"of",
"protocols",
"used",
"by",
"the",
"different",
"participants",
".",
"The",
"majority",
"of",
"labs",
"-LRB-",
"y",
"=",
"90",
"%",
"-RRB-",
"is",
"able",
"to",
"detect",
"responses",
"with",
"a",
"frequency",
"above",
"1",
"per",
"1,200",
"CD8",
"+",
"T",
"cells",
"in",
"the",
"tetramer",
"assay",
"or",
"responses",
"with",
"a",
"frequency",
"above",
"1",
"per",
"2,859",
"PBMC",
"in",
"the",
"ELISPOT",
".",
"Note",
"that",
"some",
"of",
"the",
"centers",
"could",
"reliably",
"detect",
"a",
"response",
"with",
"a",
"frequency",
"of",
"about",
"1",
"per",
"8,000",
"CD8",
"+",
"T",
"cells",
"in",
"the",
"tetramer",
"assay",
"and",
"about",
"1",
"per",
"40,000",
"PBMC",
"in",
"the",
"ELISPOT",
"assay",
".",
"These",
"low",
"frequencies",
"are",
"in",
"the",
"range",
"of",
"that",
"is",
"commonly",
"reported",
"as",
"the",
"detection",
"limit",
"for",
"internally",
"validated",
"protocols",
"for",
"both",
"technologies",
"-LSB-",
"39",
",",
"40",
",",
"own",
"unpublished",
"observations",
"-RSB-",
".",
"Another",
"important",
"task",
"of",
"standardization",
"efforts",
"should",
"be",
"to",
"decrease",
"the",
"variation",
"of",
"results",
"obtained",
"in",
"a",
"group",
"of",
"several",
"laboratories",
"down",
"to",
"the",
"stable",
"and",
"low",
"values",
"-LRB-",
"15",
"--",
"30",
"%",
"-RRB-",
"that",
"can",
"be",
"reproducibly",
"found",
"within",
"single",
"labs",
".",
"In",
"order",
"to",
"quantify",
"the",
"variation",
"of",
"results",
"among",
"laboratories",
"we",
"calculated",
"the",
"coefficient",
"of",
"variation",
"for",
"all",
"14",
"reactivities",
"of",
"the",
"two",
"panel",
"phases",
".",
"The",
"CVs",
"were",
"determined",
"on",
"the",
"base",
"of",
"centers",
"that",
"were",
"able",
"to",
"detect",
"the",
"respective",
"T",
"cell",
"response",
"and",
"the",
"results",
"are",
"shown",
"in",
"supplementary",
"Tables",
"S1a",
",",
"b",
".",
"As",
"expected",
",",
"the",
"CVs",
"we",
"found",
"in",
"our",
"inter-laboratory",
"testing",
"project",
"were",
"higher",
"than",
"those",
"reported",
"from",
"intra-center",
"analysis",
"-LSB-",
"39",
",",
"40",
"-RSB-",
".",
"In",
"the",
"ELISPOT",
"assay",
",",
"the",
"background",
"spot",
"numbers",
"obtained",
"by",
"the",
"different",
"participants",
"varied",
"greatly",
",",
"but",
"we",
"were",
"unable",
"to",
"correlate",
"this",
"finding",
"to",
"a",
"distinct",
"variable",
".",
"Since",
"the",
"spontaneous",
"cytokine",
"secretion",
"impacts",
"significantly",
"on",
"the",
"sensitivity",
"of",
"this",
"assay",
",",
"factors",
"that",
"especially",
"influence",
"the",
"non-specific",
"spot",
"production",
",",
"possibly",
"the",
"medium",
"type",
"or",
"serum",
"source",
",",
"will",
"need",
"to",
"be",
"systematically",
"analyzed",
"in",
"a",
"separate",
"study",
".",
"The",
"main",
"conclusions",
"from",
"our",
"study",
"have",
"been",
"drawn",
"on",
"the",
"basis",
"of",
"subgroup",
"analyses",
".",
"Although",
"the",
"CIMT",
"panel",
"in",
"general",
"-LRB-",
"13",
"centers",
"in",
"this",
"initial",
"action",
"-RRB-",
",",
"and",
"consequently",
"the",
"subgroups",
"formed",
"during",
"the",
"analysis",
"were",
"rather",
"small",
",",
"we",
"could",
"already",
"identify",
"statistically",
"significant",
"differences",
"in",
"the",
"ability",
"to",
"detect",
"positive",
"responses",
".",
"We",
"concluded",
"that",
"the",
"number",
"of",
"counted",
"CD8",
"+",
"T-cells",
"is",
"the",
"most",
"influential",
"crucial",
"factor",
"for",
"the",
"tetramer",
"assay",
"and",
"that",
"the",
"combination",
"of",
"a",
"resting-time",
"and",
"a",
"high",
"number",
"of",
"PBMC",
"leads",
"to",
"increased",
"sensitivity",
"in",
"the",
"ELISPOT",
"assay",
".",
"This",
"suggests",
"that",
"the",
"impact",
"of",
"the",
"identified",
"technical",
"variables",
"on",
"the",
"quality",
"of",
"the",
"assays",
"is",
"high",
".",
"In",
"order",
"to",
"identify",
"those",
"protocol",
"variables",
"that",
"lead",
"to",
"more",
"subtle",
"differences",
",",
"a",
"larger",
"group",
"of",
"participants",
"would",
"be",
"needed",
".",
"In",
"addition",
"to",
"the",
"systematic",
"identification",
"of",
"variables",
"that",
"correlate",
"with",
"sensitivity/insensitivity",
"of",
"various",
"assays",
",",
"inter-laboratory",
"testing",
"projects",
"also",
"allow",
"the",
"rapid",
"evaluation",
"of",
"individual",
"performance",
"among",
"a",
"group",
".",
"Interestingly",
",",
"the",
"finding",
"that",
"experienced",
"laboratories",
"did",
"not",
"perform",
"better",
"than",
"laboratories",
"which",
"recently",
"applied",
"these",
"techniques",
"strongly",
"suggests",
"that",
"non-optimal",
"protocols",
",",
"once",
"established",
"in",
"a",
"lab",
",",
"can",
"commonly",
"be",
"maintained",
"for",
"several",
"years",
".",
"Periodic",
"comparison",
"of",
"local",
"protocols",
"with",
"those",
"of",
"other",
"centers",
"is",
"recommended",
".",
"Even",
"if",
"a",
"new",
"staff",
"member",
"uses",
"an",
"established",
"protocol",
",",
"it",
"is",
"recommended",
"to",
"have",
"them",
"participate",
"in",
"inter-laboratory",
"testing/teaching",
"exercise",
".",
"Regular",
"participation",
"in",
"multi-center",
"comparisons",
"could",
"thereby",
"help",
"to",
"optimize",
"and",
"validate",
"participants",
"'",
"performance",
"over",
"time",
"and",
"to",
"maintain",
"sensitive",
"protocols",
"or",
"minimal",
"standards",
".",
"This",
"is",
"of",
"great",
"importance",
"when",
"material",
"from",
"expensive",
"clinical",
"trials",
"has",
"to",
"be",
"analyzed",
".",
"All",
"data",
"from",
"the",
"CMV-serology",
",",
"from",
"the",
"pre-testing",
"experiments",
"and",
"from",
"the",
"results",
"generated",
"by",
"the",
"participating",
"laboratories",
"in",
"ELISPOT",
"and",
"tetramer",
"staining",
"were",
"taken",
"together",
"for",
"each",
"donor",
"in",
"order",
"to",
"qualitatively",
"validate",
"the",
"presence",
"of",
"CMV",
"-",
"and",
"influenza-specific",
"T-cells",
".",
"To",
"estimate",
"the",
"quantity",
",",
"i.e.",
"the",
"frequency",
"of",
"specific",
"T-cells",
"in",
"each",
"donor",
",",
"we",
"calculated",
"the",
"average",
"of",
"all",
"qualitatively",
"positive",
"results",
",",
"as",
"well",
"as",
"the",
"standard",
"deviations",
".",
"This",
"procedure",
"constitutes",
"only",
"an",
"approximation",
"of",
"the",
"real",
"number",
"of",
"antigen-specific",
"cells",
"present",
"in",
"a",
"given",
"sample",
",",
"and",
"can",
"not",
"be",
"taken",
"as",
"a",
"method",
"for",
"determining",
"absolute",
"T-cell",
"frequencies",
".",
"Cell",
"samples",
"that",
"contain",
"pre-defined",
"numbers",
"of",
"antigen-specific",
"T-cells",
"-LRB-",
"e.g.",
"spiked",
"T-cell",
"clones",
"-RRB-",
",",
"especially",
"tumor-reactive",
"T-cells",
",",
"are",
"not",
"easily",
"available",
"for",
"use",
"in",
"multi-center",
"comparisons",
",",
"although",
"such",
"standard",
"samples",
"are",
"urgently",
"needed",
".",
"We",
"see",
"this",
"as",
"one",
"major",
"bottle-neck",
"for",
"the",
"optimization",
"and",
"standardization",
"of",
"immunomonitoring",
"techniques",
".",
"Methods",
"to",
"generate",
"such",
"standard",
"samples",
"for",
"broader",
"use",
"will",
"therefore",
"be",
"elucidated",
"with",
"high",
"priority",
"in",
"the",
"near",
"future",
"for",
"the",
"next",
"phases",
"of",
"this",
"international",
"collaboration",
".",
"Another",
"big",
"challenge",
"will",
"be",
"to",
"define",
"accepted",
"rules",
"for",
"the",
"settings",
"of",
"the",
"equipment",
"used",
"in",
"these",
"analyses",
"-LRB-",
"flow",
"cytometer",
"or",
"ELISPOT",
"reader",
"-RRB-",
"in",
"order",
"to",
"uniformly",
"process",
"and",
"analyze",
"the",
"raw",
"data",
".",
"Ten",
"from",
"eleven",
"laboratories",
"that",
"performed",
"the",
"ELISPOT",
"assay",
"in",
"the",
"first",
"phase",
"used",
"an",
"ELISPOT",
"reader",
"for",
"spot",
"counting",
".",
"It",
"is",
"known",
"that",
"spot",
"counts",
"between",
"centers",
"can",
"differ",
"significantly",
"and",
"this",
"may",
"be",
"explained",
"by",
"the",
"use",
"of",
"different",
"reading",
"machines",
",",
"different",
"settings",
"for",
"the",
"same",
"type",
"of",
"machine",
"or",
"by",
"the",
"experience",
"of",
"the",
"operator",
".",
"Within",
"this",
"group",
",",
"four",
"different",
"commercially",
"available",
"reading",
"systems",
"were",
"used",
"-LRB-",
"supplementary",
"Table",
"S2",
"-RRB-",
".",
"We",
"were",
"not",
"able",
"to",
"identify",
"differences",
"between",
"the",
"types",
"of",
"ELISPOT",
"readers",
".",
"A",
"new",
"ELISPOT",
"panel",
"phase",
"is",
"currently",
"in",
"preparation",
",",
"that",
"will",
"specifically",
"focus",
"on",
"the",
"performances",
"of",
"different",
"ELISPOT",
"readers",
"and",
"try",
"to",
"introduce",
"tools",
"to",
"control",
"inter",
"center",
"variation",
".",
"In",
"addition",
",",
"none",
"of",
"the",
"participant",
"reported",
"on",
"the",
"use",
"of",
"live/dead",
"cell",
"discrimination",
"on",
"thawed",
"PBMC",
"samples",
"for",
"the",
"FACS-based",
"experiments",
".",
"Whether",
"the",
"combination",
"of",
"staining",
"with",
"Ab/HLA-tetramers",
"and",
"vital",
"dyes",
"or",
"with",
"a",
"resting",
"phase",
"is",
"beneficial",
"for",
"increasing",
"the",
"sensitivity",
"of",
"the",
"tetramer",
"staining",
"assay",
"could",
"be",
"addressed",
"in",
"future",
"testing",
"actions",
".",
"Results",
"from",
"a",
"proficiency",
"panel",
"of",
"36",
"laboratories",
"from",
"nine",
"different",
"countries",
"in",
"which",
"the",
"ELISPOT",
"assay",
"was",
"validated",
"are",
"now",
"also",
"being",
"reported",
"-LSB-",
"41",
"-RSB-",
".",
"This",
"initiative",
",",
"conducted",
"under",
"the",
"aegis",
"of",
"the",
"Cancer",
"Vaccine",
"Consortium",
"-LRB-",
"CVC",
"-RRB-",
",",
"was",
"mainly",
"designed",
"to",
"offer",
"an",
"external",
"validation",
"to",
"the",
"participating",
"laboratories",
"but",
"the",
"in",
"depth",
"analysis",
"of",
"the",
"obtained",
"data",
"sets",
"lead",
"to",
"similar",
"findings",
"and",
"recommendations",
"as",
"the",
"CIMT",
"monitoring",
"panel",
".",
"It",
"confirmed",
"that",
"a",
"resting",
"phase",
"of",
"cells",
"prior",
"to",
"addition",
"to",
"the",
"ELISPOT",
"plates",
"is",
"advantageous",
"and",
"should",
"therefore",
"be",
"generally",
"recommended",
".",
"Furthermore",
",",
"a",
"long",
"year",
"experience",
"in",
"a",
"technology",
"did",
"not",
"guarantee",
"for",
"a",
"sensitive",
"test",
"and",
"failure",
"to",
"detect",
"specific",
"T",
"cell",
"responses",
"concentrated",
"on",
"the",
"weak",
"responses",
".",
"The",
"fact",
"that",
"two",
"independent",
"initiatives",
"come",
"to",
"similar",
"findings",
"is",
"surely",
"notable",
"and",
"shows",
"the",
"necessity",
"to",
"carry",
"on",
"running",
"proficiency",
"panels",
".",
"Last",
"but",
"not",
"least",
",",
"we",
"would",
"like",
"to",
"stress",
"that",
"even",
"the",
"best",
"guidelines",
"and",
"protocols",
"alone",
"can",
"not",
"guarantee",
"good",
"performance",
".",
"Monitoring",
"of",
"antigen-specific",
"T-cell",
"responses",
"requires",
"skills",
"as",
"well",
"as",
"experience",
".",
"Participation",
"in",
"immunomonitoring",
"panels",
"can",
"not",
"compensate",
"for",
"the",
"need",
"to",
"constantly",
"educate",
"and",
"train",
"staff",
"and",
"to",
"develop",
"specific",
"expertise",
"for",
"covering",
"individual",
"needs",
".",
"Nevertheless",
",",
"we",
"strongly",
"believe",
"that",
"by",
"organizing",
"further",
"two-step",
"inter-laboratory",
"testing",
"projects",
",",
"the",
"CIMT",
"monitoring",
"panel",
"will",
"be",
"able",
"to",
"improve",
"the",
"sensitivity",
"of",
"the",
"assays",
"used",
"for",
"immunomonitoring",
"as",
"well",
"as",
"to",
"actively",
"participate",
"in",
"the",
"harmonization",
"of",
"these",
"assays",
",",
"which",
"is",
"required",
"to",
"enable",
"the",
"comparison",
"of",
"immunotherapeutic",
"trials",
"performed",
"in",
"different",
"centers",
".",
"Electronic",
"supplementary",
"material",
"Below",
"is",
"the",
"link",
"to",
"the",
"electronic",
"supplementary",
"material",
".",
"ESM",
"-LRB-",
"PPT",
"82",
"kB",
"-RRB-"
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
] |
Clin_Rev_Allergy_Immunol-3-1-2071970 | [
"The",
"Future",
"of",
"Biologic",
"Agents",
"in",
"the",
"Treatment",
"of",
"Sjögren",
"'s",
"Syndrome",
"The",
"gain",
"in",
"knowledge",
"regarding",
"the",
"cellular",
"mechanisms",
"of",
"T",
"and",
"B",
"lymphocyte",
"activity",
"in",
"the",
"pathogenesis",
"of",
"Sjögren",
"'s",
"syndrome",
"-LRB-",
"SS",
"-RRB-",
"and",
"the",
"current",
"availability",
"of",
"various",
"biological",
"agents",
"-LRB-",
"anti-TNF-α",
",",
"IFN",
"-",
"α",
",",
"anti-CD20",
",",
"and",
"anti-CD22",
"-RRB-",
"have",
"resulted",
"in",
"new",
"strategies",
"for",
"therapeutic",
"intervention",
".",
"In",
"SS",
",",
"various",
"phase",
"I",
"and",
"II",
"studies",
"have",
"been",
"performed",
"to",
"evaluate",
"these",
"new",
"strategies",
".",
"Currently",
",",
"B",
"cell-directed",
"therapies",
"seem",
"to",
"be",
"more",
"promising",
"than",
"T",
"cell-related",
"therapies",
".",
"However",
",",
"large",
",",
"randomized",
",",
"placebo-controlled",
"clinical",
"trials",
"are",
"needed",
"to",
"confirm",
"the",
"promising",
"results",
"of",
"these",
"early",
"studies",
".",
"When",
"performing",
"these",
"trials",
",",
"special",
"attention",
"has",
"to",
"be",
"paid",
"to",
"prevent",
"the",
"occasional",
"occurrence",
"of",
"the",
"severe",
"side",
"effects",
".",
"Introduction",
"Sjögren",
"'s",
"syndrome",
"-LRB-",
"SS",
"-RRB-",
"is",
"a",
"chronic",
"lymphoproliferative",
"autoimmune",
"disease",
"with",
"disturbances",
"of",
"T",
"lymphocytes",
",",
"B",
"lymphocytes",
",",
"and",
"exocrine",
"glandular",
"cells",
"-LSB-",
"1",
"-RSB-",
".",
"SS",
"can",
"be",
"primary",
"-LRB-",
"pSS",
"-RRB-",
"or",
"secondary",
"SS",
"-LRB-",
"sSS",
"-RRB-",
",",
"the",
"latter",
"being",
"associated",
"with",
"another",
"autoimmune",
"disease",
"-LSB-",
"e.g.",
",",
"rheumatoid",
"arthritis",
",",
"systemic",
"lupus",
"erythematosus",
"-LRB-",
"SLE",
"-RRB-",
"-RSB-",
".",
"Lymphocytic",
"infiltrates",
"are",
"a",
"characteristic",
"histopathological",
"finding",
"in",
"SS",
".",
"These",
"infiltrates",
"consist",
"of",
"T",
"and",
"B",
"cells",
".",
"The",
"expression",
"of",
"different",
"cytokines",
",",
"such",
"as",
"tumor",
"necrosis",
"factor-α",
"-LRB-",
"TNF-α",
"-RRB-",
"and",
"interferon-α",
"-LRB-",
"IFN-α",
"-RRB-",
",",
"during",
"the",
"formation",
"and",
"proliferation",
"of",
"these",
"infiltrates",
"has",
"been",
"investigated",
".",
"There",
"is",
"an",
"overexpression",
"of",
"TNF-α",
",",
"which",
"is",
"secreted",
"by",
"CD4",
"+",
"T",
"lymphocytes",
",",
"mononuclear",
"cells",
",",
"and",
"epithelial",
"cells",
"-LSB-",
"2",
"-RSB-",
".",
"The",
"intraglandular",
"synthesis",
"of",
"TNF-α",
"causes",
"destruction",
"of",
"acini",
"by",
"up-regulation",
"of",
"Fas",
"at",
"the",
"surface",
"of",
"the",
"glandular",
"epithelial",
"cells",
",",
"stimulation",
"of",
"secretion",
"of",
"type",
"2",
"and",
"9",
"matrix",
"metalloproteases",
"by",
"epithelial",
"cells",
",",
"and",
"overexpression",
"of",
"different",
"chemokines",
"-LSB-",
"3",
"--",
"5",
"-RSB-",
".",
"IFN-α",
"is",
"produced",
"by",
"activated",
"plasmacytoid",
"dendritic",
"cells",
"in",
"primary",
"SS",
"-LRB-",
"pSS",
"-RRB-",
",",
"and",
"numerous",
"IFN-α-producing",
"cells",
"have",
"been",
"detected",
"in",
"labial",
"salivary",
"glands",
"-LSB-",
"6",
"-RSB-",
".",
"IFN-α",
"promotes",
"the",
"autoimmune",
"process",
"by",
"increasing",
"autoantibody",
"production",
"and",
"through",
"the",
"formation",
"of",
"endogenous",
"IFN-á",
"inducers",
".",
"IFNs",
"have",
"potent",
"immunomodulating",
"properties",
"and",
"are",
"thought",
"to",
"trigger",
"a",
"systemic",
"biological",
"response",
"-LSB-",
"7",
"-RSB-",
".",
"Besides",
"the",
"presence",
"of",
"proinflammatory",
"cytokines",
",",
"described",
"in",
"the",
"previous",
"paragraph",
",",
"recent",
"studies",
"have",
"shown",
"an",
"important",
"role",
"for",
"B",
"cells",
"in",
"the",
"pathogenesis",
"of",
"SS",
".",
"Presence",
"of",
"autoantibodies",
"and",
"hypergammaglobulinemia",
"are",
"both",
"considered",
"to",
"reflect",
"B",
"cell",
"hyperactivity",
".",
"Systemic",
"complications",
"of",
"SS",
"are",
"associated",
"with",
"this",
"B",
"cell",
"hyperactivity",
"-LSB-",
"8",
"-RSB-",
".",
"Moreover",
",",
"about",
"5",
"%",
"of",
"SS",
"patients",
"develop",
"malignant",
"B",
"cell",
"lymphoma",
"-LSB-",
"9",
"-RSB-",
".",
"B",
"cell",
"activating",
"factor",
"-LRB-",
"BAFF",
"-RRB-",
",",
"also",
"known",
"as",
"B",
"lymphocyte",
"stimulator",
"-LRB-",
"BLyS",
"-RRB-",
",",
"is",
"an",
"important",
"factor",
"in",
"local",
"and",
"systemic",
"autoimmunity",
"-LSB-",
"1",
"-RSB-",
".",
"Dysregulated",
"BAFF",
"expression",
"is",
"implicated",
"in",
"disease",
"progression",
"and",
"perpetuation",
"of",
"humoral",
"autoimmunity",
".",
"Overproduction",
"of",
"BAFF",
"in",
"transgenic",
"mice",
"has",
"been",
"shown",
"to",
"result",
"in",
"B",
"cell",
"proliferation",
"and",
"antibody",
"production",
"resulting",
"in",
"inflammation",
"and",
"destruction",
"of",
"the",
"salivary",
"glands",
",",
"as",
"well",
"as",
"kidney",
"failure",
"similar",
"to",
"observations",
"seen",
"in",
"SLE",
"-LSB-",
"10",
"-RSB-",
".",
"In",
"humans",
",",
"circulating",
"BAFF",
"levels",
"are",
"increased",
"in",
"patients",
"with",
"pSS",
"and",
"correlate",
"with",
"disease",
"activity",
"-LSB-",
"11",
"-RSB-",
".",
"Recent",
"insights",
"in",
"the",
"cellular",
"mechanisms",
"of",
"T",
"and",
"B",
"lymphocyte",
"activity",
"in",
"the",
"pathogenesis",
"of",
"SS",
"and",
"the",
"current",
"availability",
"of",
"various",
"biological",
"agents",
"have",
"resulted",
"in",
"new",
"strategies",
"for",
"therapeutic",
"intervention",
".",
"The",
"use",
"of",
"these",
"biological",
"agents",
"in",
"the",
"treatment",
"of",
"SS",
"will",
"be",
"discussed",
"in",
"this",
"review",
".",
"Biological",
"Agents",
"Currently",
",",
"biological",
"agents",
"have",
"been",
"introduced",
"in",
"various",
"systemic",
"autoimmune",
"diseases",
",",
"as",
"rheumatoid",
"arthritis",
"and",
"SLE",
".",
"Biological",
"agents",
"most",
"frequently",
"applied",
"in",
"autoimmune",
"diseases",
"are",
"monoclonal",
"antibodies",
",",
"soluble",
"receptors",
",",
"and",
"molecular",
"imitators",
"-LSB-",
"12",
"-RSB-",
".",
"These",
"biological",
"agents",
"enhance",
"or",
"replace",
"conventional",
"immunosuppressive",
"therapy",
".",
"In",
"contrast",
"to",
"rheumatoid",
"arthritis",
"and",
"SLE",
",",
"no",
"biological",
"agent",
"has",
"been",
"approved",
"yet",
"for",
"the",
"treatment",
"of",
"SS",
",",
"but",
"several",
"phase",
"II",
"and",
"III",
"studies",
"have",
"been",
"or",
"are",
"currently",
"conducted",
".",
"The",
"biological",
"agents",
"used",
"in",
"SS",
"trials",
"are",
"IFN-α",
"and",
"agents",
"targeting",
"TNF-α",
"and",
"B",
"cells",
"-LRB-",
"anti-CD20",
",",
"anti-CD22",
"-RRB-",
".",
"Although",
"no",
"trials",
"have",
"been",
"performed",
"yet",
"with",
"BAFF",
"antagonists",
",",
"this",
"might",
"be",
"a",
"promising",
"therapy",
"-LSB-",
"13",
"-RSB-",
"and",
"will",
"be",
"discussed",
"in",
"this",
"review",
",",
"as",
"well",
".",
"Anti-TNF-α",
"Monoclonal",
"Antibodies",
"There",
"are",
"three",
"main",
"biological",
"agents",
"targeting",
"TNF-α",
":",
"the",
"chimeric",
"monoclonal",
"IgG1",
"antibody",
"infliximab",
",",
"the",
"receptor",
"fusion",
"protein",
"etanercept",
",",
"and",
"the",
"fully",
"humanized",
"monoclonal",
"antibody",
"adalimumab",
".",
"In",
"an",
"open-label",
"study",
",",
"short-term",
"treatment",
"with",
"infliximab",
"was",
"reported",
"to",
"be",
"very",
"effective",
"in",
"active",
"pSS",
"over",
"a",
"3-month",
"period",
"-LSB-",
"14",
"-RSB-",
".",
"Sixteen",
"patients",
"received",
"three",
"infusions",
"-LRB-",
"3",
"mg/kg",
"-RRB-",
"at",
"weeks",
"0",
",",
"2",
",",
"and",
"6",
",",
"which",
"led",
"to",
"significant",
"improvement",
"in",
"all",
"clinical",
"and",
"functional",
"parameters",
",",
"including",
"global",
"assessments",
",",
"erythrocyte",
"sedimentation",
"rate",
",",
"whole",
"salivary",
"flow",
"rate",
",",
"tear",
"secretion",
"-LRB-",
"Schirmer",
"test",
"-RRB-",
",",
"tender",
"joint",
"count",
",",
"fatigue",
"score",
",",
"and",
"sensation",
"of",
"dry",
"eyes",
"and",
"dry",
"mouth",
".",
"Three",
"patients",
",",
"all",
"with",
"short",
"disease",
"duration",
"-LRB-",
"<",
"3",
"years",
"-RRB-",
",",
"were",
"considered",
"to",
"be",
"in",
"complete",
"remission",
"up",
"till",
"1",
"year",
".",
"In",
"10",
"out",
"of",
"the",
"16",
"patients",
",",
"SS",
"symptoms",
",",
"particularly",
"mouth",
"dryness",
",",
"relapsed",
"after",
"a",
"median",
"of",
"9",
"weeks",
".",
"In",
"a",
"follow-up",
"study",
",",
"a",
"maintenance",
"regimen",
"of",
"one",
"infusion",
"every",
"12",
"weeks",
"was",
"evaluated",
"in",
"these",
"10",
"patients",
".",
"Retreatment",
"induced",
"an",
"improvement",
"of",
"signs",
"related",
"to",
"SS",
"that",
"was",
"comparable",
"with",
"the",
"effects",
"from",
"the",
"three",
"loading",
"infusions",
"-LSB-",
"15",
"-RSB-",
".",
"To",
"confirm",
"these",
"promising",
"results",
"from",
"an",
"uncontrolled",
"study",
",",
"the",
"Trial",
"of",
"Remicade",
"In",
"Primary",
"Sjögren",
"'s",
"Syndrome",
"study",
"was",
"designed",
".",
"In",
"this",
"multicenter",
",",
"double-blinded",
",",
"placebo-controlled",
",",
"randomized",
"clinical",
"trial",
",",
"103",
"patients",
"with",
"active",
"pSS",
"were",
"included",
"and",
"treated",
"with",
"infliximab",
"infusions",
"-LRB-",
"5",
"mg/kg",
"-RRB-",
"or",
"placebo",
"at",
"weeks",
"0",
",",
"2",
",",
"and",
"6",
".",
"Follow-up",
"was",
"22",
"weeks",
".",
"Primary",
"endpoint",
"was",
"an",
"improvement",
"of",
">",
"30",
"%",
"of",
"two",
"of",
"three",
"VAS",
"scores",
"measuring",
"joint",
"pain",
",",
"fatigue",
",",
"and",
"dry",
"eyes",
".",
"There",
"were",
"several",
"secondary",
"endpoints",
"of",
"which",
"one",
"was",
"the",
"basal",
"salivary",
"flow",
"rate",
".",
"In",
"contrast",
"to",
"the",
"previously",
"mentioned",
"uncontrolled",
"studies",
",",
"no",
"evidence",
"of",
"efficacy",
"of",
"infliximab",
"treatment",
"on",
"all",
"clinical",
"and",
"functional",
"parameters",
"could",
"be",
"demonstrated",
"in",
"this",
"randomized",
"controlled",
"clinical",
"trial",
"-LSB-",
"2",
"-RSB-",
".",
"A",
"trial",
"on",
"15",
"pSS",
"patients",
"-LRB-",
"mean",
"disease",
"duration",
"3.6",
"years",
"-RRB-",
"with",
"25-mg",
"etanercept",
",",
"subcutaneously",
"twice",
"a",
"week",
"for",
"12",
"weeks",
",",
"did",
"not",
"reveal",
"a",
"reduction",
"in",
"sicca",
"symptoms",
"and",
"signs",
",",
"neither",
"did",
"the",
"repeated",
"treatment",
"for",
"up",
"to",
"26",
"weeks",
".",
"Only",
"in",
"the",
"subset",
"of",
"four",
"patients",
"with",
"severe",
"fatigue",
"a",
"decrease",
"in",
"fatigue",
"was",
"observed",
"-LSB-",
"16",
"-RSB-",
".",
"Another",
"trial",
"evaluating",
"subcutaneous",
"administration",
"of",
"etanercept",
"vs",
"placebo",
"for",
"12",
"weeks",
"-LRB-",
"28",
"patients",
"-RRB-",
"also",
"showed",
"no",
"clinical",
"efficacy",
"-LSB-",
"17",
"-RSB-",
".",
"No",
"trials",
"of",
"adalimumab",
"treatment",
"in",
"pSS",
"have",
"been",
"reported",
"in",
"the",
"literature",
"yet",
".",
"In",
"conclusion",
",",
"TNF-targeting",
"treatment",
"could",
"not",
"be",
"proven",
"to",
"be",
"of",
"benefit",
"in",
"reducing",
"the",
"complaints",
"of",
"pSS",
"patients",
".",
"IFN-α",
"IFNs",
"are",
"proteins",
"with",
"antiviral",
"activity",
"and",
"potent",
"immunomodulating",
"properties",
".",
"SS",
"patients",
"have",
"an",
"activated",
"type",
"I",
"IFN",
"system",
"-LSB-",
"6",
"-RSB-",
".",
"Such",
"a",
"role",
"for",
"IFN-α",
"appears",
"to",
"contradict",
"the",
"reports",
"described",
"below",
",",
"that",
"low",
"doses",
"of",
"IFN-α",
"administered",
"via",
"the",
"oromucosal",
"route",
"increase",
"the",
"unstimulated",
"salivary",
"output",
".",
"However",
",",
"it",
"is",
"hypothesized",
"that",
"oral",
"IFN-α",
"treatment",
"may",
"act",
"by",
"increasing",
"saliva",
"secretion",
"by",
"up-regulation",
"of",
"aquaporin",
"5",
"transcription",
"without",
"significantly",
"influencing",
"the",
"underlying",
"autoimmune",
"process",
"-LSB-",
"6",
",",
"7",
"-RSB-",
".",
"In",
"a",
"phase",
"II",
"study",
",",
"treatment",
"of",
"pSS",
"patients",
"with",
"IFN-α",
"administered",
"via",
"the",
"oromucosal",
"route",
"-LRB-",
"by",
"dissolving",
"lozenges",
"-RRB-",
"was",
"demonstrated",
"to",
"be",
"effective",
"-LRB-",
"improvement",
"of",
"salivary",
"output",
",",
"decreased",
"complaints",
"of",
"xerostomia",
"-RRB-",
"and",
"safe",
"-LSB-",
"18",
"-RSB-",
".",
"Based",
"on",
"these",
"promising",
"results",
",",
"a",
"randomized",
",",
"parallel",
"group",
",",
"double-blinded",
",",
"placebo-controlled",
"clinical",
"trial",
"-LRB-",
"497",
"pSS",
"patients",
"-RRB-",
"was",
"designed",
".",
"Patients",
"were",
"randomized",
"into",
"two",
"groups",
"and",
"received",
"a",
"24-week",
"daily",
"treatment",
"with",
"either",
"450",
"IU",
"IFN-α",
"-LRB-",
"150",
"IU",
"three",
"times",
"per",
"day",
"-RRB-",
"or",
"placebo",
"in",
"a",
"ratio",
"3:2",
",",
"administered",
"by",
"the",
"oromucosal",
"route",
".",
"This",
"randomized",
",",
"controlled",
"clinical",
"trial",
"failed",
"to",
"demonstrate",
"a",
"significant",
"effect",
"on",
"the",
"primary",
"endpoints",
"-LRB-",
"VAS",
"score",
"for",
"oral",
"dryness",
"and",
"stimulated",
"whole",
"salivary",
"flow",
"-RRB-",
"in",
"the",
"IFN-α",
"group",
"relative",
"to",
"the",
"placebo",
"group",
".",
"There",
"was",
"a",
"significant",
"increase",
"in",
"unstimulated",
"whole",
"saliva",
"in",
"the",
"patients",
"treated",
"with",
"IFN-α",
",",
"which",
"correlated",
"positively",
"and",
"significantly",
"with",
"improvement",
"in",
"seven",
"of",
"eight",
"symptoms",
"associated",
"with",
"oral",
"and",
"ocular",
"dryness",
".",
"No",
"adverse",
"events",
"were",
"observed",
"-LSB-",
"7",
"-RSB-",
".",
"In",
"conclusion",
",",
"no",
"clinical",
"evidence",
"for",
"the",
"efficacy",
"of",
"IFN-á",
"treatment",
"in",
"pSS",
"patients",
"has",
"been",
"shown",
"yet",
";",
"however",
",",
"an",
"improvement",
"of",
"unstimulated",
"whole",
"saliva",
"was",
"observed",
".",
"Further",
"research",
"is",
"needed",
"to",
"objectify",
"the",
"effect",
"of",
"IFN-á",
"on",
"salivary",
"gland",
"tissue",
".",
"Anti-CD20",
"Monoclonal",
"Antibodies",
"Anti-CD20",
"-LRB-",
"rituximab",
"-RRB-",
"is",
"a",
"chimeric",
"humanized",
"monoclonal",
"antibody",
"specific",
"for",
"the",
"B",
"cell",
"surface",
"molecule",
"CD20",
",",
"which",
"is",
"expressed",
"on",
"the",
"surface",
"of",
"normal",
"and",
"malignant",
"pre-B",
"and",
"mature",
"B",
"lymphocytes",
".",
"CD20",
"mediates",
"B",
"cell",
"proliferation",
"and",
"differentiation",
".",
"This",
"antibody",
"has",
"been",
"demonstrated",
"to",
"prevent",
"B",
"cells",
"from",
"proliferating",
"and",
"to",
"induce",
"lysis",
"of",
"B",
"cells",
"by",
"complement-dependent",
"and",
"antibody-dependent",
"cytotoxicity",
"mechanisms",
"as",
"well",
"as",
"by",
"direct",
"induction",
"of",
"apoptosis",
"-LSB-",
"19",
"-RSB-",
".",
"Rituximab",
"is",
"currently",
"used",
"for",
"the",
"treatment",
"of",
"low-grade",
"B",
"cell",
"lymphomas",
"-LSB-",
"20",
"-RSB-",
".",
"In",
"controlled",
"studies",
",",
"it",
"was",
"shown",
"to",
"be",
"safe",
"and",
"effective",
"in",
"the",
"treatment",
"of",
"rheumatoid",
"arthritis",
"-LSB-",
"21",
"--",
"23",
"-RSB-",
".",
"Moreover",
",",
"open-label",
"studies",
"in",
"SLE",
"patients",
"are",
"promising",
"-LSB-",
"24",
"-RSB-",
".",
"In",
"an",
"open-label",
"phase",
"II",
"study",
",",
"15",
"patients",
"with",
"pSS",
"were",
"treated",
"with",
"4",
"infusions",
"of",
"rituximab",
"-LRB-",
"375",
"mg/m2",
"once",
"weekly",
"-RRB-",
"and",
"followed",
"up",
"for",
"a",
"3-month",
"period",
".",
"Eight",
"of",
"the",
"15",
"patients",
"were",
"early",
"pSS",
"patients",
"-LRB-",
"mean",
"disease",
"duration",
"28",
"months",
",",
"all",
"had",
"residual",
"salivary",
"gland",
"function",
"at",
"baseline",
"-RRB-",
",",
"and",
"7",
"patients",
"had",
"a",
"concomitant",
"mucosa-associated",
"lymphoid",
"tissue",
"-LRB-",
"MALT",
"-RRB-",
"lymphoma",
"-LRB-",
"mean",
"disease",
"duration",
"79",
"months",
"-RRB-",
".",
"In",
"the",
"early",
"pSS",
"patients",
",",
"rituximab",
"treatment",
"resulted",
"in",
"significant",
"improvement",
"of",
"subjective",
"symptoms",
"and",
"an",
"increase",
"in",
"salivary",
"gland",
"function",
".",
"All",
"patients",
"showed",
"a",
"rapid",
"depletion",
"of",
"peripheral",
"B",
"cells",
"within",
"a",
"few",
"weeks",
",",
"accompanied",
"by",
"a",
"decrease",
"in",
"IgM-RF",
"levels",
"-LSB-",
"8",
"-RSB-",
".",
"Repeated",
"parotid",
"gland",
"biopsies",
"in",
"five",
"of",
"the",
"early",
"patients",
"after",
"treatment",
"showed",
"redifferentation",
"of",
"the",
"lymphoepithelial",
"duct",
"lesions",
"into",
"normal",
"striated",
"ducts",
",",
"possibly",
"indicating",
"regeneration",
"of",
"salivary",
"gland",
"tissue",
"-LRB-",
"unpublished",
"data",
"-RRB-",
".",
"Five",
"of",
"the",
"eight",
"pSS",
"patients",
"without",
"a",
"MALT",
"lymphoma",
"received",
"a",
"second",
"course",
"of",
"rituximab",
"-LRB-",
"after",
"9",
"--",
"11",
"months",
"-RRB-",
"due",
"to",
"recurrence",
"of",
"symptoms",
".",
"Retreatment",
"resulted",
"in",
"the",
"same",
"significant",
"improvement",
"of",
"the",
"salivary",
"flow",
"rate",
"and",
"subjective",
"symptoms",
"compared",
"to",
"the",
"results",
"of",
"the",
"first",
"treatment",
",",
"together",
"with",
"a",
"decrease",
"in",
"B",
"cells",
"and",
"IgM-RF",
"levels",
".",
"Six",
"of",
"the",
"seven",
"MALT/pSS",
"patients",
"were",
"initially",
"effectively",
"treated",
"with",
"rituximab",
".",
"The",
"remaining",
"MALT/pSS",
"patient",
"had",
"progressive",
"MALT",
"disease",
"and",
"severe",
"extraglandular",
"SS",
"disease",
"within",
"3",
"months",
"after",
"the",
"start",
"of",
"rituximab",
"treatment",
".",
"Cyclophosphamide",
"was",
"added",
",",
"which",
"led",
"to",
"stable",
"disease",
"of",
"both",
"MALT",
"and",
"SS",
".",
"One",
"of",
"the",
"six",
"patients",
"initially",
"responding",
"had",
"a",
"recurrence",
"of",
"MALT",
"lymphoma",
"after",
"9",
"months",
"and",
"was",
"successfully",
"retreated",
"with",
"rituximab",
".",
"The",
"other",
"patients",
"are",
"still",
"in",
"remission",
"-LRB-",
"unpublished",
"data",
"-RRB-",
".",
"In",
"another",
"open-label",
"study",
",",
"16",
"pSS",
"patients",
"received",
"only",
"two",
"weekly",
"rituximab",
"infusions",
"-LRB-",
"375",
"mg/m2",
"-RRB-",
",",
"with",
"a",
"follow-up",
"of",
"36",
"weeks",
".",
"Again",
",",
"treatment",
"resulted",
"in",
"rapid",
"complete",
"depletion",
"of",
"peripheral",
"B",
"cells",
".",
"At",
"week",
"12",
",",
"a",
"significant",
"improvement",
"of",
"VAS",
"scores",
"for",
"fatigue",
"and",
"dryness",
"was",
"recorded",
",",
"and",
"at",
"week",
"36",
",",
"a",
"significant",
"improvement",
"for",
"VAS",
"scores",
"for",
"global",
"disease",
",",
"fatigue",
",",
"dry",
"mouth",
",",
"dry",
"eyes",
",",
"and",
"dry",
"vagina",
",",
"but",
"also",
"in",
"the",
"number",
"of",
"tender",
"joint",
"and",
"tender",
"joint",
"counts",
"was",
"seen",
"-LSB-",
"25",
"-RSB-",
".",
"Both",
"in",
"the",
"study",
"of",
"Pijpe",
"et",
"al.",
"-LSB-",
"8",
"-RSB-",
"and",
"the",
"study",
"of",
"Devauchelle-Pensec",
"et",
"al.",
"-LSB-",
"25",
"-RSB-",
",",
"patients",
"with",
"a",
"short",
"disease",
"duration",
"showed",
"more",
"improvements",
"than",
"patients",
"with",
"longer",
"disease",
"duration",
".",
"Two",
"trials",
"retrospectively",
"evaluated",
"the",
"effect",
"of",
"rituximab",
"-LRB-",
"four",
"infusions",
"of",
"375",
"mg/m2",
"-RRB-",
"in",
"18",
"pSS",
"patients",
"-LRB-",
"mean",
"disease",
"duration",
"10",
"years",
"-RRB-",
"with",
"systemic",
"features",
".",
"Self-reported",
"dryness",
"improved",
"in",
"six",
"patients",
"-LRB-",
"VAS",
"scores",
"not",
"known",
"for",
"three",
"patients",
",",
"no",
"improvement",
"in",
"the",
"other",
"nine",
"patients",
"-RRB-",
".",
"Both",
"studies",
"reported",
"good",
"efficacy",
"of",
"the",
"treatment",
"on",
"systemic",
"features",
"-LSB-",
"26",
",",
"27",
"-RSB-",
".",
"In",
"conclusion",
",",
"in",
"phase",
"II",
"trials",
",",
"it",
"has",
"been",
"shown",
"that",
"rituximab",
"seems",
"to",
"be",
"effective",
"for",
"at",
"least",
"6",
"--",
"9",
"months",
"in",
"pSS",
"patients",
"with",
"active",
"disease",
",",
"improving",
"both",
"subjective",
"and",
"objective",
"complaints",
".",
"Retreatment",
"with",
"rituximab",
"resulted",
"in",
"a",
"similar",
"good",
"clinical",
"response",
".",
"In",
"pSS",
"patients",
"with",
"longer",
"disease",
"duration",
",",
"without",
"residual",
"salivary",
"gland",
"function",
",",
"rituximab",
"treatment",
"seems",
"to",
"be",
"effective",
"for",
"systemic",
"features",
".",
"To",
"confirm",
"these",
"promising",
"results",
",",
"randomized",
"placebo-controlled",
"clinical",
"trials",
"are",
"needed",
".",
"Anti-CD22",
"Monoclonal",
"Antibodies",
"Epratuzumab",
"is",
"a",
"fully",
"humanized",
"monoclonal",
"antibody",
"specific",
"for",
"the",
"B",
"cell",
"surface",
"molecule",
"CD22",
".",
"CD22",
"is",
"expressed",
"on",
"the",
"surface",
"of",
"normal",
"mature",
"and",
"malignant",
"B",
"lymphocytes",
".",
"CD22",
"appears",
"to",
"be",
"involved",
"in",
"the",
"regulation",
"of",
"B",
"cell",
"activation",
"through",
"B",
"cell",
"receptor",
"signaling",
"and",
"cell",
"adhesion",
"-LSB-",
"28",
"-RSB-",
".",
"In",
"an",
"open-label",
"phase",
"I/II",
"study",
",",
"safety",
"and",
"efficacy",
"of",
"epratuzumab",
"were",
"investigated",
"in",
"16",
"pSS",
"patients",
".",
"Follow-up",
"was",
"6",
"months",
".",
"These",
"pSS",
"patients",
"received",
"four",
"doses",
"of",
"360",
"mg/m2",
"epratuzumab",
"intravenously",
".",
"Mean",
"disease",
"duration",
"before",
"therapy",
"was",
"2.9",
"years",
",",
"and",
"none",
"of",
"the",
"patients",
"had",
"received",
"prior",
"B",
"cell-targeted",
"therapy",
".",
"Most",
"improvements",
"occurred",
"in",
"the",
"Schirmer",
"test",
",",
"unstimulated",
"whole",
"salivary",
"flow",
"and",
"the",
"VAS",
"score",
"for",
"fatigue",
".",
"The",
"new",
"developed",
"disease",
"activity",
"score",
"consisted",
"of",
"the",
"four",
"domains",
":",
"dryness",
"of",
"the",
"eyes",
",",
"dryness",
"of",
"the",
"mouth",
",",
"fatigue",
",",
"and",
"laboratory",
"parameters",
".",
"Based",
"on",
"this",
"score",
",",
"53",
"%",
"achieved",
"at",
"least",
"20",
"%",
"improvement",
"in",
"at",
"least",
"two",
"domains",
"at",
"6",
"weeks",
".",
"Corresponding",
"rates",
"for",
"10",
",",
"18",
",",
"and",
"32",
"weeks",
"are",
"53",
",",
"47",
",",
"and",
"67",
"%",
".",
"Remarkably",
",",
"the",
"number",
"of",
"responders",
"was",
"higher",
"6",
"months",
"after",
"the",
"treatment",
"administration",
"than",
"earlier",
".",
"Peripheral",
"B",
"cells",
"decreased",
"with",
"a",
"median",
"decrease",
"of",
"54",
"and",
"39",
"%",
"at",
"6",
"and",
"18",
"weeks",
",",
"respectively",
".",
"In",
"conclusion",
",",
"epratuzumab",
"seems",
"to",
"be",
"an",
"effective",
"treatment",
".",
"Randomized",
",",
"placebo-controlled",
"clinical",
"trials",
"are",
"needed",
"before",
"epratuzumab",
"can",
"be",
"advised",
"for",
"general",
"treatment",
"in",
"pSS",
"patients",
"-LSB-",
"29",
"-RSB-",
".",
"Anti-BAFF",
"BAFF",
"is",
"a",
"B",
"cell-activating",
"factor",
"that",
"acts",
"as",
"a",
"positive",
"regulator",
"of",
"B",
"cell",
"function",
"and",
"expansion",
".",
"BAFF",
"levels",
"were",
"found",
"elevated",
"in",
"serum",
"and",
"saliva",
"in",
"SS",
"patients",
",",
"but",
"no",
"correlation",
"could",
"be",
"shown",
"between",
"serum",
"and",
"saliva",
"levels",
"-LSB-",
"30",
"-RSB-",
".",
"However",
",",
"circulating",
"levels",
"of",
"BAFF",
"in",
"pSS",
"patients",
"were",
"shown",
"to",
"be",
"a",
"marker",
"for",
"disease",
"activity",
"-LSB-",
"11",
"-RSB-",
".",
"To",
"the",
"best",
"of",
"our",
"knowledge",
",",
"no",
"trials",
"have",
"been",
"performed",
"with",
"anti-BAFF",
"treatment",
"in",
"SS",
"yet",
",",
"but",
"such",
"an",
"approach",
"might",
"be",
"considered",
"for",
"future",
"trials",
".",
"Currently",
",",
"two",
"human",
"BAFF",
"antagonists",
"have",
"been",
"developed",
",",
"a",
"human",
"antibody",
"-LRB-",
"anti-BLyS",
"-RRB-",
"that",
"binds",
"to",
"soluble",
"BAFF",
"and",
"a",
"fusion",
"protein",
"of",
"one",
"of",
"the",
"BAFF",
"receptors",
"-LSB-",
"31",
",",
"32",
"-RSB-",
".",
"Especially",
",",
"SS",
"patients",
"with",
"elevated",
"BAFF",
"levels",
",",
"hypergammaglobulinemia",
",",
"elevated",
"levels",
"of",
"autoantibodies",
",",
"and",
"associated",
"B",
"cell",
"lymphoma",
"might",
"be",
"candidates",
"for",
"anti-BAFF",
"treatment",
"-LSB-",
"33",
"-RSB-",
".",
"Safety",
"and",
"Tolerability",
"of",
"Biological",
"Agents",
"The",
"most",
"important",
"side",
"effects",
"of",
"treatment",
"with",
"biological",
"agents",
"are",
"direct",
"mild",
"infusion",
"reactions",
".",
"Several",
"patients",
"developed",
"a",
"serum",
"sickness-like",
"disease",
"a",
"few",
"days",
"after",
"the",
"second",
"infusion",
"that",
"might",
"be",
"related",
"to",
"the",
"formation",
"of",
"antibodies",
"against",
"the",
"biological",
"agent",
"-LSB-",
"human",
"anti-chimeric",
"antibodies",
"-LRB-",
"HACAs",
"-RRB-",
"or",
"human",
"anti-human",
"antibodies",
"-RSB-",
".",
"A",
"few",
"patients",
"developed",
"infections",
"during",
"treatment",
"with",
"a",
"biological",
"agent",
";",
"however",
",",
"some",
"patients",
"concomitantly",
"used",
"other",
"immunosuppressive",
"therapies",
".",
"Therefore",
",",
"the",
"direct",
"relation",
"between",
"the",
"biological",
"agent",
"and",
"the",
"infection",
"is",
"unsure",
".",
"All",
"adverse",
"events",
"reported",
"in",
"the",
"trials",
"described",
"in",
"this",
"review",
"are",
"reported",
"in",
"Table",
"1",
".",
"According",
"to",
"this",
"table",
",",
"the",
"most",
"frequent",
"side",
"effects",
"of",
"treatment",
"with",
"biological",
"agents",
"are",
"mild",
"infusion",
"reactions",
".",
"The",
"most",
"severe",
"side",
"effect",
"of",
"the",
"various",
"treatments",
"used",
"in",
"SS",
"patients",
"was",
"the",
"development",
"of",
"a",
"serum",
"sickness-like",
"disease",
".",
"This",
"adverse",
"effect",
"of",
"treatment",
"occurred",
"in",
"16",
"%",
"-LRB-",
"8",
"of",
"49",
"-RRB-",
"of",
"the",
"patients",
"treated",
"with",
"rituximab",
".",
"HACA",
"formation",
"was",
"observed",
"in",
"patients",
"developing",
"a",
"serum",
"sickness-like",
"disease",
"and",
"occurred",
"only",
"in",
"patients",
"receiving",
"low-dose",
"corticosteroids",
"and",
"no",
"other",
"immunosuppressive",
"drugs",
".",
"It",
"is",
"assumed",
"that",
"higher",
"doses",
"of",
"corticosteroids",
"during",
"treatment",
"might",
"prevent",
"the",
"occurrence",
"of",
"serum",
"sickness",
".",
"Table",
"1Adverse",
"events",
"after",
"treatment",
"with",
"biological",
"agents",
"in",
"SS",
"Agent/doseNumber",
"of",
"patients",
"in",
"trial",
"-LRB-",
"number",
"treated",
"with",
"the",
"agent",
"-RRB-",
"Premedication/concomitant",
"immunosuppressive",
"therapyInfusion",
"reactionInfectionsSerum",
"sicknessHACA/HAHA",
"formationOtherAnti-TNF-α",
"monoclonal",
"antibodiesSteinfeld",
"-LSB-",
"14",
"-RSB-",
"Infliximab",
"intravenous",
",",
"3",
"mg/kg16",
"-LRB-",
"16",
"-RRB-",
"n.r.",
"/",
"no1",
"-LRB-",
"6",
"%",
"-RRB-",
"2",
"-LRB-",
"13",
"%",
"-RRB-",
"-LRB-",
"respiratory",
"tract",
"-RRB-",
"--",
"n.r.",
"--",
"Steinfeld",
"-LSB-",
"15",
"-RSB-",
"Infliximab",
"intravenous",
",",
"3",
"mg/kg10",
"-LRB-",
"10",
"-RRB-",
"n.r.",
"/",
"no4",
"-LRB-",
"40",
"%",
"-RRB-",
"2",
"-LRB-",
"20",
"%",
"-RRB-",
"-LRB-",
"enteritis",
",",
"tonsillitis",
"-RRB-",
"--",
"n.r.",
"--",
"Marriette",
"-LSB-",
"2",
"-RSB-",
"Infliximab",
"intravenous",
",",
"5",
"mg/kg103",
"-LRB-",
"54",
"-RRB-",
"n.r.",
"/",
"continuation",
"of",
"hydroxychloroquine",
"and",
"corticosteroids",
"-LRB-",
"≤",
"15",
"mg/day",
"-RRB-",
"2",
"-LRB-",
"4",
"%",
"-RRB-",
"2",
"-LRB-",
"4",
"%",
"-RRB-",
"-LRB-",
"1",
"cutaneous",
",",
"1",
"respiratory",
"tract",
"-RRB-",
"--",
"n.r.",
"2",
"-LRB-",
"breast",
"cancer",
",",
"auto-immune",
"hepatitis",
"-RRB-",
"aZandbelt",
"-LSB-",
"16",
"-RSB-",
"Etanercept",
"subcutaneously",
",",
"25",
"mg15",
"-LRB-",
"15",
"-RRB-",
"n.r.",
"/",
"pilocarpine",
"at",
"a",
"constant",
"dose",
"--",
"1",
"-LRB-",
"7",
"%",
"-RRB-",
"-LRB-",
"parotitis",
"-RRB-",
"--",
"n.r.",
"--",
"Sankar",
"-LSB-",
"17",
"-RSB-",
"Etanercept",
"subcutaneously",
",",
"25",
"mg28",
"-LRB-",
"14",
"-RRB-",
"n.r.",
"/",
"allowed",
"to",
"use",
"long-term",
"medication1",
"-LRB-",
"7",
"%",
"-RRB-",
"1",
"-LRB-",
"7",
"%",
"-RRB-",
"-LRB-",
"skin",
"lesion",
"-RRB-",
"b",
"--",
"n.r.",
"--",
"IFN-αShip",
"-LSB-",
"18",
"-RSB-",
"IFN-α",
"oromucosal",
",",
"150",
"IU",
",",
"450",
"IU109",
"-LRB-",
"87",
"-RRB-",
"n.r.",
"/",
"non.a",
".",
"--",
"--",
"n.r.",
"--",
"cCummins",
"-LSB-",
"7",
"-RSB-",
"IFN-α",
"oromucosal",
",",
"450",
"IU497",
"-LRB-",
"300",
"-RRB-",
"n.r.",
"/",
"non.a",
".",
"--",
"--",
"--",
"23",
"-LRB-",
"7.7",
"%",
"-RRB-",
"d",
"-LRB-",
"34",
"%",
"gastrointestinal",
",",
"25",
"%",
"musculoskeletal",
"-RRB-",
"Anti-CD20Pijpe",
"-LSB-",
"8",
"-RSB-",
"Rituximab",
"intravenous",
",",
"375",
"mg/m215",
"-LRB-",
"15",
"-RRB-",
"25",
"mg",
"prednisolon",
"intravenously/patients",
"with",
"severe",
"extraglandular",
"manifestations",
"-LRB-",
"n",
"=",
"3",
"-RRB-",
"received",
"immunosuppressive",
"therapy2",
"-LRB-",
"13",
"%",
"-RRB-",
"1",
"-LRB-",
"7",
"%",
"-RRB-",
"-LRB-",
"zoster",
"-RRB-",
"4",
"-LRB-",
"27",
"%",
"-RRB-",
"e4",
"-LRB-",
"27",
"%",
"-RRB-",
"--",
"Devauchelle-Pensec",
"-LSB-",
"25",
"-RSB-",
"Rituximab",
"intravenous",
",",
"375",
"mg/m216",
"-LRB-",
"16",
"-RRB-",
"n.r.",
"/",
"no",
"--",
"--",
"1",
"-LRB-",
"6",
"%",
"-RRB-",
"n.r.",
"--",
"Gottenberg",
"-LSB-",
"26",
"-RSB-",
"Rituximab",
"intravenous",
",",
"375",
"mg/m26",
"-LRB-",
"6",
"-RRB-",
"n.r.",
"/",
"hydroxychloroquine",
"-LRB-",
"n",
"=",
"1",
"-RRB-",
",",
"methylprednisolone",
"-LRB-",
"n",
"=",
"3",
"-RRB-",
"1",
"-LRB-",
"17",
"%",
"-RRB-",
"--",
"1",
"-LRB-",
"17",
"%",
"-RRB-",
"n.r.",
"--",
"Seror",
"-LSB-",
"27",
"-RSB-",
"Rituximab",
"intravenous",
",",
"375",
"mg/m212",
"-LRB-",
"12",
"-RRB-",
"n.r.",
"/",
"cyclophosphamide",
"-LRB-",
"n",
"=",
"1",
"-RRB-",
",",
"hydroxychloroquine",
"-LRB-",
"n",
"=",
"1",
"-RRB-",
",",
"leflunomide",
"-LRB-",
"n",
"=",
"1",
"-RRB-",
"1",
"-LRB-",
"8",
"%",
"-RRB-",
"--",
"2",
"-LRB-",
"17",
"%",
"-RRB-",
"n.r.",
"--",
"Anti-CD22Steinfeld",
"-LSB-",
"29",
"-RSB-",
"Epratuzumab",
"intravenous",
",",
"360",
"mg/m216",
"-LRB-",
"16",
"-RRB-",
"0.5",
"--",
"1",
"g",
"acetominophen",
",",
"25",
"--",
"50",
"mg",
"antihistamine",
".",
"/",
"no2",
"-LRB-",
"13",
"%",
"-RRB-",
"2",
"-LRB-",
"13",
"%",
"-RRB-",
"-LRB-",
"sinusitis",
",",
"dental",
"abscess",
"-RRB-",
"--",
"3",
"-LRB-",
"19",
"%",
"-RRB-",
"6",
"-LRB-",
"38",
"%",
"-RRB-",
"-LRB-",
"TIA",
",",
"osteoporotic",
"fracture",
",",
"diarrhea",
",",
"dyspepsia",
",",
"palpitations",
",",
"paresthesia",
"-RRB-",
"n.a.",
"Not",
"applicable",
",",
"n.r.",
"not",
"reported",
",",
"HACA",
"human",
"anti-chimeric",
"antibodies",
",",
"HAHA",
"human",
"anti-human",
"antibodiesaOne",
"patient",
"in",
"the",
"placebo",
"group",
"developed",
"benign",
"lymph",
"node",
"enlargementbOne",
"patient",
"in",
"the",
"placebo",
"group",
"developed",
"a",
"prolonged",
"upper",
"respiratory",
"tract",
"infectioncIn",
"this",
"study",
",",
"there",
"were",
"mild",
"adverse",
"events",
";",
"however",
",",
"there",
"were",
"no",
"significant",
"differences",
"between",
"the",
"groups",
".",
"Adverse",
"events",
"were",
"not",
"specified.dEight",
"patients",
"-LRB-",
"4.1",
"%",
"-RRB-",
"in",
"the",
"placebo",
"group",
"developed",
"adverse",
"eventseOne",
"of",
"these",
"4",
"patients",
"developed",
"serum",
"sickness",
"after",
"retreatment",
"-LSB-",
"8",
"-RSB-",
"Future",
"Perspectives",
"Biological",
"agents",
"are",
"promising",
"therapies",
"for",
"SS",
".",
"Randomized",
"studies",
"failed",
"to",
"show",
"a",
"clinical",
"effect",
"of",
"anti-TNF-α",
"and",
"IFN-α",
"in",
"the",
"treatment",
"of",
"SS",
".",
"Notwithstanding",
"the",
"unfortunate",
"results",
"of",
"anti-TNF-α",
"and",
"IFN-α",
",",
"B",
"cell",
"depletion",
"-LRB-",
"both",
"anti-CD20",
"and",
"anti-CD22",
"-RRB-",
"seems",
"very",
"promising",
".",
"Again",
",",
"this",
"promising",
"effect",
",",
"as",
"was",
"previously",
"also",
"assumed",
"for",
"anti-TNF-α",
"and",
"IFN-α",
",",
"must",
"be",
"confirmed",
"in",
"larger",
"randomized",
"controlled",
"clinical",
"trials",
".",
"HACAs",
"have",
"been",
"reported",
"to",
"occur",
"at",
"a",
"higher",
"rate",
"in",
"patients",
"with",
"an",
"autoimmune",
"disease",
".",
"It",
"seems",
"that",
"monoclonal",
"antibodies",
"are",
"more",
"immunogenic",
"in",
"active",
"autoimmune",
"disease",
",",
"independent",
"of",
"the",
"type",
"of",
"disease",
".",
"Additional",
"use",
"of",
"immunosuppressive",
"therapy",
"in",
"these",
"patients",
"might",
"be",
"mandatory",
"to",
"prevent",
"serious",
"side",
"effects",
".",
"These",
"unwanted",
"side",
"effects",
"might",
"also",
"be",
"prevented",
"by",
"the",
"use",
"of",
"fully",
"humanized",
"antibodies",
".",
"The",
"currently",
"available",
"humanized",
"antibodies",
"are",
"promising",
",",
"but",
"need",
"further",
"study",
".",
"Moreover",
",",
"there",
"is",
"still",
"a",
"need",
"for",
"improved",
"assessment",
"parameters",
"to",
"monitor",
"treatment",
"effects",
",",
"both",
"subjectively",
"and",
"objectively",
".",
"For",
"studies",
"on",
"intervention",
"of",
"SS",
",",
"evaluation",
"of",
"the",
"parotid",
"gland",
"might",
"be",
"of",
"use",
"because",
"function",
",",
"composition",
"of",
"saliva",
",",
"and",
"histology",
"can",
"be",
"evaluated",
"on",
"the",
"same",
"gland",
"at",
"different",
"time",
"points",
".",
"Activity",
"scores",
"are",
"currently",
"under",
"development",
"by",
"Bowman",
"and",
"Vitali",
"-LSB-",
"34",
",",
"35",
"-RSB-",
".",
"Finally",
",",
"as",
"soon",
"as",
"effective",
"intervention",
"treatments",
"have",
"been",
"established",
",",
"the",
"cost-effectiveness",
"of",
"these",
"currently",
"very",
"expensive",
"antibodies",
"needs",
"to",
"be",
"analyzed",
"to",
"select",
"those",
"patients",
"that",
"might",
"benefit",
"the",
"most",
"from",
"this",
"kind",
"of",
"treatment",
"."
] | [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"I",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B",
"O"
] |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.