image
imagewidth (px) 205
980
| latex
stringlengths 132
39.9k
| filename
stringlengths 18
19
|
|---|---|---|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Weak} & & & \multicolumn{2}{c|}{\textbf{\textbf{S}B}} & \multicolumn{2}{c|}{\textbf{BH}} & \multicolumn{2}{c|}{\textbf{\textbf{S}GoF}} \\
\hline
\textbf{N} & \textbf{\% effect} & \textbf{S} & \textbf{S}ignificant & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} \\
\hline
5 & 5\% & 100 & 5.2 & 0.04 & 98 & 0.04 & 98 & 0.07 & 85 \\
\hline
5 & 5\% & 1000 & 5.2 & 0.01 & 78 & 0.01 & 80 & 0.01 & 91 \\
\hline
5 & 5\% & 10000 & 5.2 & 0.00 & 91 & 0.00 & 88 & 0.02 & 89 \\
\hline
5 & 10\% & 100 & 5.4 & 0.06 & 86 & 0.06 & 87 & 0.09 & 83 \\
\hline
5 & 10\% & 1000 & 5.5 & 0.01 & 83 & 0.01 & 84 & 0.04 & 78 \\
\hline
5 & 10\% & 10000 & 5.5 & 0.00 & 80 & 0.00 & 83 & 0.11 & 80 \\
\hline
5 & 20\% & 100 & 5.9 & 0.08 & 57 & 0.08 & 60 & 0.12 & 64 \\
\hline
5 & 20\% & 1000 & 6.0 & 0.01 & 57 & 0.01 & 58 & 0.13 & 63 \\
\hline
\multirow{3}{*}{5} & 20\% & 10000 & 6.0 & 0.00 & 70 & 0.00 & 69 & 0.54 & 63 \\
\hline
& & Mean & 0.02 & 77.8 & 0.02 & 78.6 & 0.12 & 77.3 \\
\hline
& & \textbf{S}D & 0.030 & 14.18 & 0.030 & 13.45 & 0.161 & 11.24 \\
\hline
10 & 5\% & 100 & 5.7 & 0.05 & 72 & 0.06 & 70 & 0.09 & 80 \\
\hline
10 & 5\% & 1000 & 5.6 & 0.01 & 69 & 0.01 & 67 & 0.06 & 77 \\
\hline
10 & 5\% & 10000 & 5.6 & 0.00 & 71 & 0.00 & 71 & 0.22 & 74 \\
\hline
10 & 10\% & 100 & 6.2 & 0.06 & 56 & 0.08 & 57 & 0.19 & 67 \\
\hline
10 & 10\% & 1000 & 6.2 & 0.01 & 44 & 0.01 & 47 & 0.24 & 59 \\
\hline
10 & 10\% & 10000 & 6.3 & 0.00 & 44 & 0.00 & 45 & 0.84 & 61 \\
\hline
10 & 20\% & 100 & 7.6 & 0.12 & 35 & 0.15 & 35 & 0.52 & 42 \\
\hline
10 & 20\% & 1000 & 7.5 & 0.01 & 30 & 0.02 & 30 & 1.14 & 42 \\
\hline
\multirow{3}{*}{10} & 20\% & 10000 & 7.5 & 0.00 & 27 & 0.00 & 30 & 2.11 & 44 \\
\hline
& & Mean & 0.03 & 49.8 & 0.04 & 50.2 & 0.60 & 60.7 \\
\hline
& & \textbf{S}D & 0.041 & 17.85 & 0.051 & 16.72 & 0.674 & 15.15 \\
\hline
20 & 5\% & 100 & 6.4 & 0.14 & 33 & 0.17 & 35 & 0.20 & 60 \\
\hline
20 & 5\% & 1000 & 6.5 & 0.02 & 31 & 0.03 & 30 & 0.33 & 51 \\
\hline
20 & 5\% & 10000 & 6.4 & 0.00 & 18 & 0.00 & 19 & 1.01 & 53 \\
\hline
20 & 10\% & 100 & 7.8 & 0.24 & 17 & 0.32 & 18 & 0.61 & 38 \\
\hline
20 & 10\% & 1000 & 7.9 & 0.03 & 13 & 0.06 & 16 & 1.53 & 36 \\
\hline
20 & 10\% & 10000 & 7.9 & 0.01 & 7 & 0.01 & 10 & 2.46 & 40 \\
\hline
20 & 20\% & 100 & 10.7 & 0.36 & 8 & 0.57 & 10 & 2.24 & 24 \\
\hline
20 & 20\% & 1000 & 10.8 & 0.06 & 6 & 0.15 & 9 & 4.38 & 25 \\
\hline
\multirow{3}{*}{20} & 20\% & 10000 & 10.8 & 0.01 & 4 & 0.04 & 6 & 5.35 & 27 \\
\hline
& & Mean & 0.10 & 15.22 & 0.15 & 17 & 2.01 & 39.3 \\
\hline
& & \textbf{S}D & 0.126 & 10.67 & 0.188 & 9.89 & 1.81 & 13.02 \\
\hline
\end{tabular}
\end{table} | PMC2719628_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Weak} & & & \multicolumn{2}{c|}{\textbf{\textbf{S}B}} & \multicolumn{2}{c|}{\textbf{BH}} & \multicolumn{2}{c|}{\textbf{\textbf{S}GoF}} \\
\hline
\textbf{N} & \textbf{\% effect} & \textbf{S} & \textbf{S}ignificant & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} \\
\hline
20 & 5\% & 100 & 5.7 & 0.10 & 73 & 0.10 & 72 & 0.10 & 77 \\
\hline
20 & 5\% & 1000 & 5.7 & 0.01 & 53 & 0.01 & 57 & 0.07 & 78 \\
\hline
20 & 5\% & 10000 & 5.7 & 0.00 & 65 & 0.00 & 61 & 0.25 & 55 \\
\hline
20 & 10\% & 100 & 6.2 & 0.07 & 51 & 0.08 & 51 & 0.18 & 68 \\
\hline
20 & 10\% & 1000 & 6.1 & 0.01 & 41 & 0.01 & 40 & 0.19 & 56 \\
\hline
20 & 10\% & 10000 & 6.1 & 0.00 & 40 & 0.00 & 33 & 0.68 & 33 \\
\hline
20 & 20\% & 100 & 6.8 & 0.14 & 39 & 0.16 & 38 & 0.30 & 52 \\
\hline
20 & 20\% & 1000 & 7.0 & 0.01 & 24 & 0.01 & 25 & 0.70 & 35 \\
\hline
\multirow{3}{*}{20} & 20\% & 10000 & 7.0 & 0.00 & 16 & 0.00 & 16 & 1.58 & 19 \\
\hline
& & Mean & 0.04 & 44.7 & 0.04 & 43.7 & 0.45 & 52.6 \\
\hline
& & \textbf{S}D & 0.052 & 18.17 & 0.058 & 18.06 & 0.482 & 20.37 \\
\hline
40 & 5\% & 100 & 6.0 & 0.14 & 45 & 0.15 & 46 & 0.13 & 69 \\
\hline
40 & 5\% & 1000 & 6.0 & 0.02 & 31 & 0.02 & 33 & 0.15 & 57 \\
\hline
40 & 5\% & 10000 & 6.0 & 0.00 & 22 & 0.01 & 23 & 0.61 & 37 \\
\hline
40 & 10\% & 100 & 7.0 & 0.21 & 26 & 0.25 & 28 & 0.33 & 51 \\
\hline
40 & 10\% & 1000 & 7.0 & 0.03 & 18 & 0.04 & 20 & 0.71 & 38 \\
\hline
40 & 10\% & 10000 & 7.0 & 0.01 & 12 & 0.01 & 14 & 1.56 & 17 \\
\hline
40 & 20\% & 100 & 8.9 & 0.34 & 20 & 0.45 & 21 & 1.02 & 32 \\
\hline
40 & 20\% & 1000 & 8.9 & 0.05 & 8 & 0.10 & 9 & 2.50 & 21 \\
\hline
\multirow{3}{*}{40} & 20\% & 10000 & 8.9 & 0.01 & 5 & 0.04 & 7 & 3.44 & 6 \\
\hline
& & Mean & 0.09 & 20.8 & 0.12 & 22.3 & 1.16 & 36.4 \\
\hline
& & \textbf{S}D & 0.117 & 12.34 & 0.148 & 12.23 & 1.143 & 20.19 \\
\hline
\end{tabular}
\end{table} | PMC2719628_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{\textbf{S}trong} & & & \multicolumn{2}{c|}{\textbf{\textbf{S}B}} & \multicolumn{2}{c|}{\textbf{BH}} & \multicolumn{2}{c|}{\textbf{\textbf{S}GoF}} \\
\hline
\textbf{N} & \textbf{\% effect} & \textbf{S} & \textbf{S}ignificant & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} \\
\hline
5 & 5\% & 100 & 6.6 & 0.09 & 62 & 0.11 & 62 & 0.23 & 59 \\
\hline
5 & 5\% & 1000 & 6.7 & 0.01 & 53 & 0.01 & 54 & 0.47 & 60 \\
\hline
5 & 5\% & 10000 & 6.7 & 0.00 & 42 & 0.00 & 47 & 1.24 & 60 \\
\hline
5 & 10\% & 100 & 8.5 & 0.14 & 31 & 0.17 & 30 & 0.85 & 46 \\
\hline
5 & 10\% & 1000 & 8.4 & 0.01 & 36 & 0.02 & 35 & 1.97 & 43 \\
\hline
5 & 10\% & 10000 & 8.3 & 0.00 & 31 & 0.00 & 30 & 2.88 & 45 \\
\hline
5 & 20\% & 100 & 11.7 & 0.17 & 18 & 0.28 & 18 & 3.03 & 26 \\
\hline
5 & 20\% & 1000 & 11.7 & 0.02 & 17 & 0.03 & 18 & 5.28 & 28 \\
\hline
\multirow{3}{*}{5} & 20\% & 10000 & 11.7 & 0.00 & 22 & 0.00 & 21 & 6.23 & 29 \\
\hline
& & Mean & 0.05 & 34.7 & 0.07 & 35 & 2.46 & 44 \\
\hline
& & \textbf{S}D & 0.067 & 15.48 & 0.099 & 16.04 & 2.118 & 13.91 \\
\hline
10 & 5\% & 100 & 8.7 & 0.49 & 8 & 0.75 & 11 & 0.95 & 24 \\
\hline
10 & 5\% & 1000 & 8.6 & 0.09 & 6 & 0.27 & 8 & 2.25 & 23 \\
\hline
10 & 5\% & 10000 & 8.6 & 0.01 & 4 & 0.11 & 6 & 3.21 & 28 \\
\hline
10 & 10\% & 100 & 12.3 & 1.00 & 5 & 2.08 & 8 & 3.56 & 14 \\
\hline
10 & 10\% & 1000 & 12.3 & 0.18 & 2 & 1.18 & 6 & 5.92 & 17 \\
\hline
10 & 10\% & 10000 & 12.3 & 0.03 & 2 & 0.93 & 5 & 6.86 & 20 \\
\hline
10 & 20\% & 100 & 19.5 & 1.91 & 3 & 6.37 & 5 & 10.53 & 9 \\
\hline
10 & 20\% & 1000 & 19.6 & 0.33 & 1 & 5.38 & 4 & 13.23 & 11 \\
\hline
\multirow{3}{*}{10} & 20\% & 10000 & 19.6 & 0.05 & 1 & 5.30 & 4 & 14.17 & 12 \\
\hline
& & Mean & 0.45 & 3.6 & 2.49 & 6.3 & 6.74 & 17.6 \\
\hline
& & \textbf{S}D & 0.631 & 2.40 & 2.481 & 2.29 & 4.856 & 6.58 \\
\hline
20 & 5\% & 100 & 9.8 & 2.92 & 2 & 4.18 & 7 & 1.59 & 6 \\
\hline
20 & 5\% & 1000 & 9.7 & 1.38 & 0 & 4.04 & 5 & 3.35 & 4 \\
\hline
20 & 5\% & 10000 & 9.7 & 0.47 & 0 & 3.97 & 5 & 4.24 & 6 \\
\hline
20 & 10\% & 100 & 14.4 & 5.86 & 1 & 9.06 & 5 & 5.49 & 2 \\
\hline
20 & 10\% & 1000 & 14.3 & 2.75 & 0 & 8.90 & 5 & 7.93 & 3 \\
\hline
20 & 10\% & 10000 & 14.3 & 0.95 & 0 & 8.85 & 4 & 8.90 & 5 \\
\hline
20 & 20\% & 100 & 23.6 & 11.78 & 0 & 19.04 & 4 & 14.64 & 2 \\
\hline
20 & 20\% & 1000 & 23.6 & 5.50 & 0 & 18.88 & 4 & 17.23 & 2 \\
\hline
\multirow{3}{*}{20} & 20\% & 10000 & 23.7 & 1.91 & 0 & 19.01 & 4 & 18.27 & 3 \\
\hline
& & Mean & 3.72 & 0.3 & 10.66 & 4.7 & 9.07 & 3.7 \\
\hline
& & \textbf{S}D & 3.558 & 0.71 & 6.586 & 0.97 & 6.209 & 1.66 \\
\hline
\end{tabular}
\end{table} | PMC2719628_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{\textbf{S}trong} & & & \multicolumn{2}{c|}{\textbf{\textbf{S}B}} & \multicolumn{2}{c|}{\textbf{BH}} & \multicolumn{2}{c|}{\textbf{\textbf{S}GoF}} \\
\hline
\textbf{N} & \textbf{\% effect} & \textbf{S} & \textbf{S}ignificant & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} & \textbf{\textbf{\textbf{Detected}}} & \textbf{\textbf{\textbf{FDR}}} \\
\hline
20 & 5\% & 100 & 7.2 & 0.26 & 21 & 0.29 & 23 & 0.38 & 55 \\
\hline
20 & 5\% & 1000 & 7.1 & 0.04 & 8 & 0.05 & 10 & 0.77 & 34 \\
\hline
20 & 5\% & 10000 & 7.1 & 0.00 & 5 & 0.02 & 5 & 1.67 & 21 \\
\hline
20 & 10\% & 100 & 9.0 & 0.42 & 13 & 0.54 & 17 & 1.04 & 32 \\
\hline
20 & 10\% & 1000 & 9.0 & 0.07 & 3 & 0.15 & 7 & 2.58 & 20 \\
\hline
20 & 10\% & 10000 & 9.0 & 0.01 & 2 & 0.07 & 2 & 3.55 & 12 \\
\hline
20 & 20\% & 100 & 12.5 & 0.77 & 7 & 1.27 & 8 & 3.62 & 17 \\
\hline
20 & 20\% & 1000 & 12.7 & 0.13 & 2 & 0.65 & 3 & 6.29 & 10 \\
\hline
\multirow{3}{*}{20} & 20\% & 10000 & 12.8 & 0.02 & 1 & 0.47 & 2 & 7.33 & 7 \\
\hline
& & Mean & 0.19 & 6.9 & 0.39 & 8.6 & 3.03 & 23.1 \\
\hline
& & \textbf{S}D & 0.258 & 6.51 & 0.402 & 7.20 & 2.45 & 15.09 \\
\hline
40 & 5\% & 100 & 8.4 & 1.05 & 7 & 1.36 & 12 & 0.67 & 26 \\
\hline
40 & 5\% & 1000 & 8.5 & 0.29 & 2 & 0.95 & 6 & 2.08 & 14 \\
\hline
40 & 5\% & 10000 & 8.5 & 0.11 & 1 & 0.92 & 2 & 3.03 & 6 \\
\hline
40 & 10\% & 100 & 11.8 & 1.98 & 3 & 3.12 & 7 & 2.90 & 12 \\
\hline
40 & 10\% & 1000 & 11.9 & 0.58 & 1 & 2.76 & 4 & 5.50 & 9 \\
\hline
40 & 10\% & 10000 & 11.8 & 0.21 & 0 & 2.83 & 1 & 6.42 & 2 \\
\hline
40 & 20\% & 100 & 18.7 & 3.76 & 1 & 8.13 & 5 & 9.67 & 7 \\
\hline
40 & 20\% & 1000 & 18.6 & 1.17 & 0 & 7.72 & 2 & 12.23 & 4 \\
\hline
\multirow{3}{*}{40} & 20\% & 10000 & 18.6 & 0.42 & 0 & 7.62 & 0 & 13.18 & 1 \\
\hline
& & Mean & 1.06 & 1.7 & 3.93 & 4.3 & 6.19 & 9 \\
\hline
& & \textbf{S}D & 1.173 & 2.24 & 3.029 & 3.71 & 4.557 & 7.70 \\
\hline
\end{tabular}
\end{table} | PMC2719628_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Null}} & \multicolumn{2}{c|}{\textbf{Weak}} & \multicolumn{2}{c|}{\textbf{Strong}} \\
\hline
& \textbf{\textbf{\textbf{A}}} & \textbf{\textbf{\textbf{B}}} & \textbf{\textbf{\textbf{A}}} & \textbf{\textbf{\textbf{B}}} & \textbf{\textbf{\textbf{A}}} & \textbf{\textbf{\textbf{B}}} \\
\hline
Pop 1 & 1 & 1 & 1 & 0.67 & 1 & 0.43 \\
\hline
Pop 2 & 1 & 1 & 0.67 & 1 & 0.43 & 1 \\
\hline
\end{tabular}
\end{table} | PMC2719628_table_5 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{chr} & \textbf{p53-RE Start} & \textbf{p53-RE End} & \textbf{p53-RE_Dimer 1} & \textbf{p53-RE_Spacer} & \textbf{p53-RE_Dimer 2} & \textbf{Spacer Length} & \textbf{Ref.} \\
\hline
PLK2 & 5 & 57793857 & 57793877 & GGGCAAGTCC & & AGGCATGTTT & 0 & [11] \\
\hline
PPM1J & 1 & 113048061 & 113048081 & GGGCTTGCTC & & AGGCATGTTC & 0 & [25] \\
\hline
DDB2 & 11 & 47193105 & 47193126 & GAACAAGCCC & T & GGGCATGTTT & 1 & [11] \\
\hline
KIAA1486 & 2 & 226209743 & 226209763 & GAACATGCCT & & GGGCTAGCCT & 0 & [11] \\
\hline
MTHFD1L & 6 & 151220175 & 151220195 & GGACATGCCT & & GGGCATGTCC & 0 & [11] \\
\hline
PRKAG2 & 7 & 151016282 & 151016302 & GAGCATGTCT & & GAACATGTTC & 0 & [11] \\
\hline
AKAP6 & 14 & 31884451 & 31884471 & AGACATGTTT & & GGGCATGTCT & 0 & [25] \\
\hline
BIRC8 & 19 & 58490331 & 58490351 & GGACATGCCT & & GGGCATGTCT & 0 & [25] \\
\hline
APBB2 & 4 & 40721763 & 40721784 & AAACTTGTTT & C & AGGCTAGCCC & 1 & [26] \\
\hline
TSHR & 14 & 80618516 & 80618537 & AAACTTGCTT & C & AAGCTAGCCC & 1 & [25] \\
\hline
DMD & X & 31592231 & 31592252 & AAACATGCTC & T & GGACTAGCCT & 1 & [25] \\
\hline
SLCO2B1 & 11 & 74540123 & 74540146 & GAGCAAGCCT & GGG & GGACATGTTC & 3 & [26] \\
\hline
ATF3 & 1 & 210865885 & 210865908 & AGGCAAGTCC & TCA & GAGCATGTTT & 3 & [11] \\
\hline
FRMD4A & 10 & 14167552 & 14167577 & AAGCTTGCTT & TCAGA & GGGCTTGCCT & 5 & [11] \\
\hline
EGFR & 7 & 55176461 & 55176487 & AAACATGCCT & TTCAAA & GAACTAGTTC & 6 & [25] \\
\hline
MMP2 & 16 & 54067700 & 54067729 & AGGCAAGTCC & ATAAAGTGA & AAGCAAGTTT & 9 & [11] \\
\hline
KRT15 & 17 & 36930241 & 36930270 & GAACATGCCC & TGTGAGCCT & GAGCATGTTC & 9 & [25] \\
\hline
DLG2 & 11 & 83032605 & 83032636 & GAACATGTCC & ATGGCTGTCTC & AGACTTGTTT & 11 & [25] \\
\hline
NRXN3 & 14 & 78316130 & 78316162 & AGACTTGCCC & AACTAGACATCA & AGGCATGTTT & 12 & [25] \\
\hline
FHIT & 3 & 61206990 & 61207024 & AAACTTGCTT & TCACTTTACTCTGT & GGACTTGCCC & 14 & [26] \\
\hline
DOCK9 & 13 & 98270727 & 98270761 & GGGCAAGTCC & ACAGTGCAAAGTAA & AAGCAAGTTT & 14 & [25] \\
\hline
GRIN2A & 16 & 9796860 & 9796894 & AAACTTGCTT & TGACTTTACTCCAT & GGACTTGCCC & 14 & [25] \\
\hline
ACCN1 & 17 & 28722009 & 28722043 & AGGCAAGTCC & GCAGTGCAAAGCGA & AAGCAAGTTT & 14 & [25] \\
\hline
\end{tabular}
\end{table} | PMC2719629_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Species} & \textbf{Sequences} & \textbf{KOG Classifications} \\
\hline
Daphnia pulex & 30940 & 15806 \\
\hline
Ostreococcus tauri & 7725 & 4733 \\
\hline
Trichoderma virens & 11643 & 6879 \\
\hline
Xenopus tropicalis & 27916 & 27617 \\
\hline
\end{tabular}
\end{table} | PMC2719630_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Species} & \textbf{Predictions} & \textbf{OrthoSelect} & \textbf{Best-hit strategy} \\
\hline
Daphnia pulex & 12696 & 98\% & 86\% \\
\hline
Ostreococcus tauri & 4742 & 91\% & 76\% \\
\hline
Trichoderma virens & 5886 & 99\% & 87\% \\
\hline
Xenopus tropicalis & 18556 & 84\% & 69\% \\
\hline
\end{tabular}
\end{table} | PMC2719630_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Value} & \textbf{OrthoSelect} \\
\hline
Specificity & 98\% \\
\hline
Cases where \textbf{OrthoSelect} found better sequences & 63\% \\
\hline
Number of additional sequences found & 270 \\
\hline
Number of additional sequences found (good) & 268 \\
\hline
Number of additional sequences found (bad) & 2 \\
\hline
Number of sequences missed & 197 \\
\hline
Ratio of additional/missed sequences & +4\% \\
\hline
\end{tabular}
\end{table} | PMC2719630_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Test Set} & \textbf{Precision} & \textbf{Recall} & \textbf{F-score} \\
\hline
Documents & 61.8\% & 79.1\% & 69.5\% \\
\hline
Sentences & 80.1\% & 30.3\% & 44.0\% \\
\hline
Annotations & 97.3\% & 65.7\% & 78.8\% \\
\hline
\end{tabular}
\end{table} | PMC2719631_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Reason(s) for search failure} & \textbf{Percentage of total sentences (n = 78)} \\
\hline
Non-standard protein nomenclature (NSN) & 39.7\% (n = 31) \\
\hline
Missing category term(s) (MT) & 3.8\% (n = 3) \\
\hline
Information spread over multiple sentences (IMS) & 11.5\% (n = 9) \\
\hline
Information expressed with <3 categories (IFC) & 6.4\% (n = 5) \\
\hline
NSN + MT & 7.7\% (n = 6) \\
\hline
NSN + IMS & 3.8\% (n = 3) \\
\hline
NSN + IFC & 3.8\% (n = 3) \\
\hline
MT + IMS & 10.3\% (n = 8) \\
\hline
MT + IFC & 1.3\% (n = 1) \\
\hline
NSN + MT + IMS & 6.4\% (n = 5) \\
\hline
Technical issues & 5.1\% (n = 4) \\
\hline
\end{tabular}
\end{table} | PMC2719631_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Reason for search failure} & \textbf{Percentage of total sentences (n = 29)} \\
\hline
Run-on sentence or table contents & 44.8\% (n = 13) \\
\hline
Inappropriate category term & 17.2\% (n = 5) \\
\hline
Linguistic ambiguity & 37.9\% (n = 11) \\
\hline
\end{tabular}
\end{table} | PMC2719631_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Patient #} & \textbf{Sex} & \textbf{Age (yrs)} & \textbf{Tumor Location and Grade} & \textbf{History of ETOH or Smoking} & \textbf{Pathological Subtypes} \\
\hline
\multicolumn{2}{c|}{Normal Tissues} \\
\hline
A9 & F & 32 & tonsillectomy & No & Follicular hyperplasia \\
\hline
B9 & F & 30 & tonsillectomy & ETOH/Smoking & Follicular hyperplasia \\
\hline
C9 & M & 40 & tonsillectomy & No & Follicular hyperplasia \\
\hline
Tumors \\
\hline
A1 & / & / & Base of tongue Grade 3 & / & Primary SCCA \\
\hline
A6 & / & / & Base of tongue Grade 3 & / & Primary SCCA \\
\hline
E1 & F & 68 & Base of tongue Grade 4 & ETOH/Smoking & Recurrent SCCA \\
\hline
I1 & M & 38 & Base of tongue & ETOH/Smoking & Primary SCCA \\
\hline
F1 & F & 65 & Larynx, Grade 2 & ETOH/Smoking & Primary SCCA \\
\hline
C1 & M & 53 & Larynx, Grade 3 & ETOH/Smoking & Primary SCCA \\
\hline
D1 & F & 40 & Larynx, Grade 3 & No & Metastatic, unknown primary \\
\hline
A3 & / & / & Lymph node-neck & / & Primary SCCA \\
\hline
A5 & / & / & Lymph node-neck & / & Primary SCCA \\
\hline
H1 & F & 44 & Lymph node-neck, Grade 3 & No & Primary SCCA \\
\hline
B1 & M & 72 & Tonsil, Grade 3 & No ETOH, Smoking & Primary SCCA \\
\hline
B2 & M & 60 & Tonsil & ETOH/Smoking & Primary SCCA \\
\hline
B5 & M & 62 & Tonsil & ETOH/Smoking & Primary SCCA \\
\hline
B4 & M & 53 & Buccal mucosa & ETOH, Minimal Smoking & Recurrent SCCA \\
\hline
G1 & M & 72 & Buccal mucosa & Minimal ETOH/Smoking & Primary SCCA \\
\hline
A2 & M & 60 & Supraglottic & / & Primary SCCA \\
\hline
B3 & F & 72 & Supraglottic Grade 4 & ETOH/Smoking & Recurrent SCCA \\
\hline
\end{tabular}
\end{table} | PMC2719634_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Instrument} & \textbf{Author} & \textbf{Reason for exclusion} \\
\hline
Assisted Living Facilities Medication Assessment & Meade 2001 [21] & • No psychometric evaluation \\
\hline
Dexterity Test & Begley 1997 [22] & • Insufficient detail* • No psychometric evaluation • Assessment of physical ability only \\
\hline
Everyday Cognitive Battery & Allaire 1999 [23] & • Multi-domain tool† • Insufficient detail* • Assessment of cognitive ability only \\
\hline
Everyday Problems Test & Willis 1996 [24] & • Multi-domain tool† • Insufficient detail* • Assessment of cognitive ability only \\
\hline
Functional Limitations Assessment & Hurd 1986 [25] & • No psychometric evaluation \\
\hline
Medication Management Test & Corrigan 1994 [26] & • Insufficient detail* \\
\hline
Medication Regimen Adherence Capacity Test & Fitten 1995 [27] & • Psychometric evaluation of only part of the test \\
\hline
Observed Tasks of Daily Living (OTDL) & Diehl 1995 [28] & • Multi-domain tool† \\
\hline
Occupational Therapy Assessment Scale (OTAS) & Fairbrother 1997 [29] & • Multi-domain tool† • Insufficient detail* \\
\hline
Occupational Therapy Assessment of Performance and Support (OTAPS) & Nadler 1993 [30] & • Multi-domain tool† • Insufficient detail* \\
\hline
Reading/Comprehension and Task Performance Tool & Bailey 1995 [31] & • Insufficient detail* \\
\hline
Regimen Comprehension Scale & Yamada 2001 [32] & • Assessment of cognitive ability only • Insufficient detail* \\
\hline
Structured Assessment of Independent Living Skills (SAILS) & Mahurin 1991 [33] & • Multi-domain tool† \\
\hline
Self-Administration of Medication tool & Manias 2006 [34] & • No standardised structured observation of task performance \\
\hline
Self-Medication Risk Assessment \textbf{Instrument} & Fuller 2005 [35] & • No standardised structured observation of task performance \\
\hline
Structured Home Interview & Sedgeworth 1990 [36] & • Insufficient detail* \\
\hline
Timed Activities of Daily Living (TIADL) & Owsley 2002 [37] & • Multi-domain tool† • Assessment of cognitive ability only \\
\hline
Virtual Reality Apartment Medication Management Assessment & Kurtz 2007 [38] & • Assessment of cognitive ability only \\
\hline
\end{tabular}
\end{table} | PMC2719637_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Experiment} & \textbf{Cd2+ (mmol/L)} & \textbf{Ca2+ (mmol/L)} & \textbf{NaHCO3 (mmol/L)} & \textbf{pH} & \textbf{SIot} & \textbf{SIcal} & \textbf{SImaxa} & \textbf{XCdb} \\
\hline
Cd.1 & 0.1 & - & 0.1 & 8.4 & 3.17 & - & - & - \\
\hline
Cd.2 & 0.1 & - & 0.1 & 8.5 & 3.35 & - & - & - \\
\hline
Cd.3 & 0.1 & - & 0.1 & 7.96 & 2.34 & - & - & - \\
\hline
Cd.4 & 0.1 & - & 0.1 & 8.1 & 2.6 & - & - & - \\
\hline
Cd.5 & 0.1 & - & 0.1 & 8.23 & 2.81 & - & - & - \\
\hline
Cd.6 & 0.1 & - & 0.1 & 8.2 & 2.75 & - & - & - \\
\hline
Cd.7 & 0.1 & - & 0.1 & 8.22 & 2.83 & - & - & - \\
\hline
Cd.8 & 0.1 & - & 0.1 & 8.28 & 2.91 & - & - & - \\
\hline
Cd.9 & 0.1 & - & 0.1 & 8.24 & 2.83 & - & - & - \\
\hline
Cd.10 & 0.1 & - & 0.1 & 8.27 & 2.89 & - & - & - \\
\hline
Cd.11 & 0.1 & - & 0.1 & 8.08 & 2.56 & - & - & - \\
\hline
Cd.12 & 0.1 & - & 0.1 & 8.2 & 2.75 & - & - & - \\
\hline
Cd.13 & 0.001 & 0.34 & 0.9 & 8.75 & 1.54 & 1.63 & 1.89 & 0.92 \\
\hline
Cd.14 & 0.001 & 0.34 & 0.9 & 8.51 & 1.29 & 0.25 & 1.32 & 0.92 \\
\hline
Cd.15 & 0.001 & 0.34 & 0.9 & 9 & 2.12 & 1.1 & 2.16 & 0.91 \\
\hline
Cd.16 & 0.001 & 0.34 & 0.9 & 8.54 & 1.36 & 0.31 & 1.4 & 0.92 \\
\hline
\end{tabular}
\end{table} | PMC2719640_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\h\textbf{line}
\textbf{line} & \textbf{Location} & \textbf{2c-value} & \textbf{ploidy} \\
\h\textbf{line}
Bd21-3 & Iraq & 0.76 & diploid \\
\h\textbf{line}
population samples & Adiyaman & 0.69* & diploid \\
\h\textbf{line}
Adi-5 & Adiyaman & 0.71 & diploid \\
\h\textbf{line}
Adi-P1 & Adiyaman & 1.41 & poly\textbf{ploidy} \\
\h\textbf{line}
population samples & Balli & 1.32* & poly\textbf{ploidy} \\
\h\textbf{line}
population samples & Bismil & 0.7* & diploid \\
\h\textbf{line}
population samples & Gaziantep & 0.69* & diploid \\
\h\textbf{line}
population samples & Iskenderun & 1.31* & poly\textbf{ploidy} \\
\h\textbf{line}
population samples & Kahta & 0.7* & diploid \\
\h\textbf{line}
Kah-2 & Kahta & 0.72 & diploid \\
\h\textbf{line}
population samples & Kozluk & 0.68* & diploid \\
\h\textbf{line}
population samples & Tekirdag & 0.7* & diploid \\
\h\textbf{line}
\end{tabular}
\end{table} | PMC2719641_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{Microarray data of 6 genes}} \\
\hline
\textbf{Gene} & \textbf{Transcript ID} & \textbf{The ratio of wrky2 mutants vs WT} \\
\hline
ABI5 & At2G36270 & 2.30 \\
\hline
ABI3 & At3G24650 & 6.06 \\
\hline
Em1 & At3G51810 & 4.29 \\
\hline
Em6 & At2G40170 & 5.28 \\
\hline
MYB33 & At5G06100 & 1.15 \\
\hline
MYB101 & At2G32460 & 0.62 \\
\hline
\end{tabular}
\end{table} | PMC2719644_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{Quantitative RT-PCR primers}} \\
\hline
\textbf{Gene} & \multicolumn{2}{c|}{\textbf{Primer sequences (5'->3')}} \\
\hline
\textbf{ABI5} & \textbf{Primer forward} & \textbf{AGATGACACTTGAGGATTTCTTGGT} \\
\hline
AT2G36270 & Primer reverse & TGGTTCGGGTTTGGATTAGG \\
\hline
ABI3 & \textbf{Primer forward} & CTGATTCTTGAATGGGTC \\
\hline
AT3G24650 & Primer reverse & TTGTTATTAGGGTTAGGGT \\
\hline
Em1 & \textbf{Primer forward} & CGGAGGAAGAAGGGATTGAGA \\
\hline
AT3G51810 & Primer reverse & TGCCAAACACGGAACCTACA \\
\hline
Em6 & \textbf{Primer forward} & GCAAAGAAGGGCGAGACC \\
\hline
AT2G40170 & Primer reverse & TCCTCCTCAGCGTGTTCC \\
\hline
WRKY2 & \textbf{Primer forward} & TTTCTTTGGGTTACGATG \\
\hline
AT5G56270 & Primer reverse & CACAACAACTCTTGGCTC \\
\hline
ACT2 & \textbf{Primer forward} & TGTGCCAATCTACGAGGGTTT \\
\hline
AT3G18780 & Primer reverse & TTTCCCGCTCTGCTGTTGT \\
\hline
\end{tabular}
\end{table} | PMC2719644_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Stimulation} & \textbf{\textbf{Right}} & \textbf{\textbf{Right}} & \textbf{\textbf{Left}} & \textbf{\textbf{Left}} \\
\hline
Hemisphere & \textbf{\textbf{Right}} & \textbf{\textbf{Left}} & \textbf{\textbf{Right}} & \textbf{\textbf{Right}} \\
\hline
Talairach Coordinate & 62.37, -10.43, 24.47 & -57.42, -14.91, 32.07 & 63.36, -9.55, 22.59 & -54.45, -10.43, 43.82 \\
\hline
Brodmann Area & 3 & 3 & 3 & 3 \\
\hline
\end{tabular}
\end{table} | PMC2719647_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{X loc} & \textbf{Y loc} & \textbf{Z loc} & \textbf{X orient} & \textbf{Y orient} & \textbf{Z orient} \\
\hline
LH tangential & -0.53 & 0.08 & 0.11 & 0.1 & 0.3 & 0.9 \\
\hline
LH radial & -0.53 & 0.08 & 0.11 & 0.5 & -0.8 & -0.5 \\
\hline
RH tangential & 0.53 & 0.08 & 0.11 & 0.0 & 0.2 & 1.0 \\
\hline
RH radial & 0.53 & 0.08 & 0.11 & -0.1 & -1.0 & -0.3 \\
\hline
Residual & -0.07 & -0.40 & -0.01 & 0.0 & -0.5 & -0.9 \\
\hline
\end{tabular}
\end{table} | PMC2719648_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{HC} & \textbf{SZ} & \textbf{Statistic} & \textbf{p} \\
\hline
Age (years) & 44.4 +/- 6.8 & 39.8 +/- 10.5 & t[32] = 1.47 & 0.151 \\
\hline
Parental socio-economic status (ref. 24) & 3.1 +/- 1.3 & 3.2 +/- 0.9 & t[28] = -0.316 & 0.754 \\
\hline
Handedness & 0.78 +/- 0.16 & 0.77 +/- 0.25 & t[32] = 0.172 & 0.864 \\
\hline
Age of onset (years) & & 26.1 +/- 8.0 \\
\hline
Positive sym\textbf{p}tom total (SAPS) & & 9.0 +/- 4.2 \\
\hline
Negative sym\textbf{p}tom total (SANS) & & 13.9 +/- 4.9 \\
\hline
Medication dosage (chlor\textbf{p}romazine equivalents) & & 450 +/- 306 range 83–1200 \\
\hline
\end{tabular}
\end{table} | PMC2719648_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{7}{c|}{\textbf{DISTRIBUTION OF SPOLIGOTYPES PER DISTRICT}} \\
\hline
\textbf{Isolate} & \multirow{3}{*}{\textbf{Spoligotype SB Number*}} & \multirow{3}{*}{\textbf{L S K}} & \multirow{3}{*}{\textbf{M Z K}} & \multirow{3}{*}{\textbf{C H M}} & \multirow{3}{*}{\textbf{M B W}} & \multirow{3}{*}{\textbf{M Z E}} & \multirow{3}{*}{\textbf{N M A}} & \textbf{Total} & \textbf{Frequency} \\
\hline
& \textbf{No.} & \textbf{(\%)} \\
\hline
\\
\hline
C9 & SB1767 & & & & & 1 & & 1 & 3.2 \\
\hline
C19 & SB0162 & & & & & & 1 & 1 & 3.2 \\
\hline
C21 & SB1763 & & & & 1 & & & 1 & 3.2 \\
\hline
C26 & SB1764 & & & & & & 1 & 1 & 3.2 \\
\hline
C14 & SB1572 & 1 & & & & & & 1 & 3.2 \\
\hline
C42 & SB1765 & & & & & & 1 & 1 & 3.2 \\
\hline
C16 & SB1536 & & & & & & 1 & 1 & 3.2 \\
\hline
C4, C13, C15 & SB0871 & & & 1 & 1 & & 1 & 3 & 9.7 \\
\hline
C41 & SB1766 & & & & & & 1 & 1 & 3.2 \\
\hline
C2, C3, C5, \\
\hline
C6, C8, C17, \\
\hline
C18, C22, \\
\hline
C24, C25, \\
\hline
C27, C28, & SB0120 & 5 & 2 & & 3 & 4 & 6 & 20 & 64.5 \\
\hline
C29, C31, \\
\hline
C38, C39, \\
\hline
C40, C44, \\
\hline
C45, C46 \\
\hline
\textbf{Total} number & & 6 & 2 & 1 & 5 & 5 & 12 & 31 \\
\hline
\end{tabular}
\end{table} | PMC2719650_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Spoligotype1} & \textbf{Shared type2} & \textbf{Geographical distribution} \\
\hline
Sp1 & SB0120 & France, Belgium, Brazil, South Africa, Sri Lanka, Iran, The Netherlands, Spain, China, Japan, Portugal, Russia, Denmark, Zambia \\
\hline
Sp2 & SB0871 & France \\
\hline
Sp3 & SB1763* & Zambia \\
\hline
Sp4 & SB1764* & Zambia \\
\hline
Sp5 & SB1572 & Italy \\
\hline
Sp6 & SB1765* & Zambia \\
\hline
Sp7 & SB1536 & Italy \\
\hline
Sp8 & SB1766* & Zambia \\
\hline
Sp9 & SB1767* & Zambia \\
\hline
Sp10 & SB0162 & Belgium \\
\hline
\end{tabular}
\end{table} | PMC2719650_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Discourse} & \textbf{Databases} & \textbf{Keywords} & \textbf{Articles (n)} \\
\hline
Print media & Lexis-Nexis Academic Factiva & "Ritalin" "methylphenidate" "smart drugs" "Ritalin & study aid" "cognitive enhancement" "neuroethics" "stimulant abuse" "non-medical use" "illicit use" & 20*† \\
\hline
Bioethics literature & PubMed (bioethics limit) Expanded Academic & & 14 \\
\hline
Public health literature & PubMed Expanded Academic & & 7 \\
\hline
\end{tabular}
\end{table} | PMC2719652_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Lay designation} & \textbf{Occurrences} \\
\hline
"study aid" [37] & 9 \\
\hline
"brain steroid" [18] & 4 \\
\hline
"smart drug(s)" [21] & 4 \\
\hline
"vitamin R" [37] & 4 \\
\hline
"poor man's cocaine" [33] & 3 \\
\hline
"study tool(s)" [18] & 2 \\
\hline
"wonder drug" [38] & 2 \\
\hline
"new chemical aid" [18] & 1 \\
\hline
"smart pill(s)" [35] & 1 \\
\hline
"cramming drug" [34] & 1 \\
\hline
"academic steroids" [37] & 1 \\
\hline
"steroids of academia" [20] & 1 \\
\hline
"legal speed" [36] & 1 \\
\hline
"kiddie speed" [19] & 1 \\
\hline
\end{tabular}
\end{table} | PMC2719652_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\multicolumn{2}{c|}{\textbf{Print media}} \\
\hline
\textbf{Portrayal} & \textbf{“Lifestyle choice”: “better living through chemistry” [39]; “short cut in learning”; “new kind of drug abuse” [18].} \\
\hline
Examples of headlines & "Students taking danger drug to help with exams"; " 'Smart pills' are on the rise. But is taking them wise?"; "New campus high: Illicit prescription drugs". \\
\hline
Reported risks* & Physiological addiction (8); palpitations (7); psychological addiction (6); heart attack (5); unspecified cardiac risks (4); loss of appetite (4); hallucinations (4); stroke (2); tremors (2); increase in blood pressure (2); weight loss (2); vomiting (2); dizziness (2); seizures (2); withdrawal symptoms (2); require increasing amounts of drug (1); cardiac arrhythmia (1); overdose (1); changes in brain cell chemistry (1); fatigue (1); death (1); dry mouth (1). \\
\hline
Reported benefits† & Boost concentration (8); increase focus (7); increase energy (3); increase alertness (1); reduce appetite (1); eliminate jitters (1); filter out distractions (1); increase motivation (1); accumulate more information in less time (1); increase confidence (1); increase organization (1); increase retention of information (1); think more rationally (1); general feeling of well-being (1); make you feel smarter (1); make mundane tasks seem fun (1); enhance studying (1); do work faster (1); maintain high performance level (1); boost brain activity (1). \\
\hline
& Bioethics \\
\hline
\textbf{Portrayal} & "Cognitive enhancement": " 'neuroenhancement' (...) This term includes the use of drugs and other interventions to modify brain processes with the aim of enhancing memory, mood and attention in people who are not impaired by illness or disorder"[40]. \\
\hline
Examples of headlines & "Neurocognitive enhancement: what can we do and what should we do?" and "Cosmetic neurology: The controversy over enhancing movement, mentation, and mood". \\
\hline
Reported risks* & Addiction (3); toxicity (1). \\
\hline
Reported benefits† & Improve attention (4); improve memory (4); improve performance (2); increase focus (1); improve concentration (1); improve planning (1); think faster (1); stabilize mood (1); promote creativity (1). \\
\hline
& Public health \\
\hline
\textbf{Portrayal} & "Abuse", "misuse", "illicit drug use": "Ritalin (Novartis Pharmaceuticals Corp., East Hanover, NJ) has received the most attention in medical literature, little information is available regarding which specific stimulants are used illicitly by college students" [41]. \\
\hline
Examples of headlines & "Student perceptions of methylphenidate abuse at a public liberal arts college" and "Stimulant medication use, misuse, and abuse in an undergraduate and graduate student sample". \\
\hline
Reported risks* & Addiction (2); cardiovascular implications (1); withdrawal symptoms (1); increase in blood pressure (1); headache (1); overdose (1); blocking veins if injected/snorted (1); panic episodes (1); aggressive behavior (1); suicidal or homicidal tendencies (1). \\
\hline
Reported benefits† & Decreases fatigue (2); increases energy (1); increases dopaminergic activity (1); maintain high performance level (1); increase alertness (1). \\
\hline
\end{tabular}
\end{table} | PMC2719652_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Ethical, legal and social issues} & \multicolumn{4}{c|}{\textbf{Affirmation}} & \multicolumn{4}{c|}{\textbf{Negation}} & \textbf{\textbf{\textbf{Total}} Frequency} \\
\hline
& \textbf{\textbf{PM}} & \textbf{\textbf{B}} & \textbf{\textbf{PH}} & \textbf{\textbf{Total}} & \textbf{\textbf{PM}} & \textbf{\textbf{B}} & \textbf{\textbf{PH}} & \textbf{\textbf{Total}} \\
\hline
Social integration and acceptability & 11 & 13 & - & 24 & 5 & - & - & 5 & 29 \\
\hline
Social meaning & 11 & 9 & 5 & 25 & 1 & 2 & - & 3 & 28 \\
\hline
Unsafe & 2 & 11 & 2 & 15 & 3 & 2 & 2 & 7 & 22 \\
\hline
Abuse & 11 & 1 & 5 & 17 & 1 & 1 & 1 & 3 & 20 \\
\hline
Cheating & 5 & 8 & - & 13 & 3 & 3 & - & 6 & 19 \\
\hline
Inauthenticity, identity and personhood & 1 & 12 & - & 13 & - & 5 & - & 5 & 18 \\
\hline
Injustice and inequalities & - & 10 & - & 10 & - & 6 & - & 6 & 16 \\
\hline
Overprescription & 9 & 2 & 4 & 15 & 1 & - & - & 1 & 16 \\
\hline
Lack of autonomy, individual choice and informed consent & - & 10 & - & 10 & - & 5 & - & 5 & 15 \\
\hline
Illegality & 8 & 2 & - & 10 & 3 & 1 & - & 4 & 14 \\
\hline
Commercialization & 1 & 7 & - & 8 & - & 1 & - & 1 & 9 \\
\hline
Inefficacy & 2 & 4 & 1 & 7 & - & - & - & - & 7 \\
\hline
\end{tabular}
\end{table} | PMC2719652_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{A. Proposed recommendations to prevent non-medical use of MPH}} \\
\hline
\textbf{Print media} & \textbf{Bioethics} & \textbf{Public health} \\
\hline
Diagnosing ADHD more carefully [37,38,50] Supervising of students with stimulant prescriptions [33,47] Teaching students effective study skills and stress management [17,37] Informing students and staff of the dangers of abusing prescription drugs [18,33,34,37] & Criminalizing non-approved uses of medications [3,48] Prohibiting prescription of drugs for lifestyle purposes by doctors [48] Obliging manufacturers to declare safety data for unapproved uses to the FDA [48] Subsidizing cognition enhancing drugs to allow equal access [40,48] Establishing a "ceiling" as the maximum cognitive enhancement permissible [48,53] & Ensuring prescription compliance and responsible prescription practices [49,52] Prescribing preparations that are less easily abused [41,51] Identifying persons who are liable to abuse medication [49] Educating healthcare providers dealing with university populations as to the abuse potential of stimulants [51,52] \\
\hline
\multicolumn{2}{c|}{B. Identified} & MPH \\
\hline
\textbf{Print media} & \textbf{Bioethics} & \textbf{Public health} \\
\hline
Logistical problems of enforcing a ban [37,38,54] Perceived safety of MPH makes convincing students about its dangers more difficult [35,37] Abundance of MPH in healthcare system [50] Misuse of MPH bypasses traditional sources of information on indications and risks when taking a prescription medication [37] & Difficult to propose a ban on cognitive enhancers because of their routine use in treatment [40,48,53] Ban is liable to encourage a black market and be just as coercive as social pressure [40,48,53] FDA has little experience in assessing social cost/benefit of a drug and thus is unfit to take charge of such regulation [53] & None identified \\
\hline
\end{tabular}
\end{table} | PMC2719652_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{CASES}} & \multicolumn{2}{c|}{\textbf{CONTROLS}} \\
\hline
& \textbf{\textbf{Median}} & \textbf{\textbf{IQR}} & \textbf{\textbf{Median}} & \textbf{\textbf{IQR}} \\
\hline
P. falciparum \\
\hline
<1 & 9,480 & [640, 39,800] & 3000 & [740, 14,800] \\
\hline
1 & 19,880 & [4,640, >40,000] & 1,200 & [160, 5,360] \\
\hline
2–3 & 21,100 & [5,600, >40,000] & 1,600 & [320, 6,550] \\
\hline
4–6 & 17,220 & [3,520, >40,000] & 680 & [200, 2,560] \\
\hline
7–9 & 14,840 & [2,440, >40,000] & 480 & [160, 1,680] \\
\hline
10–19 & 9,080 & [1,100, 31,460] & 240 & [80, 720] \\
\hline
20+ & 1,600 & [320, 9,610] & 160 & [80, 440] \\
\hline
P. vivax \\
\hline
<1 & 4,480 & [240, 15,260] & 120 & [70, 1,520] \\
\hline
1 & 5,540 & [1,360, 12,870] & 480 & [130, 2,960] \\
\hline
2–3 & 4,500 & [920, 12,820] & 440 & [120, 1,600] \\
\hline
4–6 & 2,440 & [320, 9,120] & 200 & [120, 640] \\
\hline
7–9 & 1,280 & [200, 7,480] & 160 & [80, 280] \\
\hline
10–19 & 300 & [80, 3,380] & 80 & [40, 200] \\
\hline
20+ & 120 & [80, 280] & 80 & [40, 160] \\
\hline
P. malariae \\
\hline
<1 & 220 & [90, 350] & 80 & [40, 740] \\
\hline
1 & 420 & [120, 1,910] & 200 & [40, 360] \\
\hline
2–3 & 1380 & [210, 3,360] & 320 & [120, 800] \\
\hline
4–6 & 1160 & [450, 3,240] & 320 & [120, 680] \\
\hline
7–9 & 960 & [280, 2,400] & 160 & [80, 360] \\
\hline
10–19 & 440 & [120, 1760] & 120 & [60, 200] \\
\hline
20+ & 120 & [80, 480] & 80 & [40, 160] \\
\hline
\end{tabular}
\end{table} | PMC2719654_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{β0,, Intercept [95\% CI]}} & \multicolumn{2}{c|}{\textbf{β1, Slope, [95\% CI]}} \\
\hline
\textbf{P. falciparum (excluding < 1 year old)} & \textbf{-4.29} & \textbf{[-4.62, -3.97]} & \textbf{1.33} & \textbf{[1.24, 1.42]} \\
\hline
P. falciparum (all) & -5.03 & [-5.62, -4.43] & 1.40 & [1.23, 1.57] \\
\hline
P. vivax & -5.51 & [-6.07, -4.95] & 1.57 & [1.40, 1.73] \\
\hline
P. malariae & -5.75 & [-6.75, -4.75] & 1.56 & [1.26, 1.87] \\
\hline
\end{tabular}
\end{table} | PMC2719654_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{c|}{\textbf{Private health insurance}} \\
\hline
\textbf{Lifestyle factors} & \textbf{N} & \textbf{\% column} & \textbf{\% PHI} & \textbf{RR crude*} & \textbf{RR adjusted+} \\
\hline
BMI categories‡ \\
\hline
Underweight & 3,903 & 4.0 & 61.1 & 0.91 (0.89, 0.94) & 0.97 (0.95, 0.99) \\
\hline
Healthy weight§ & 31,256 & 31.9 & 67.0 & 1 & 1 \\
\hline
Overweight & 36,027 & 36.8 & 67.4 & 1.01 (1.00, 1.02) & 1.02 (1.01, 1.03) \\
\hline
Obese & 19,619 & 20.1 & 61.0 & 0.91 (0.90, 0.92) & 0.97 (0.96, 0.99) \\
\hline
Smoking status \\
\hline
\textbf{N}ever§ & 55,522 & 56.7 & 69.7 & 1 & 1 \\
\hline
Past & 34,989 & 35.8 & 62.8 & 0.90 (0.89, 0.91) & 0.94 (0.93, 0.94) \\
\hline
Current & 7,319 & 7.5 & 41.4 & 0.59 (0.58, 0.61) & 0.71 (0.70, 0.73) \\
\hline
Alcohol consumption (drinks/week) \\
\hline
Zero§ & 31,098 & 31.8 & 55.4 & 1 & 1 \\
\hline
1 to 6 & 28,339 & 29.0 & 70.2 & 1.27 (1.25, 1.28) & 1.11 (1.10, 1.12) \\
\hline
7 to 13 & 17,992 & 18.4 & 72.7 & 1.31 (1.29, 1.33) & 1.12 (1.10, 1.13) \\
\hline
14 to 20 & 10,732 & 11.0 & 72.5 & 1.31 (1.29, 1.33) & 1.11 (1.10, 1.13) \\
\hline
21 and over & 7,642 & 7.8 & 63.0 & 1.14 (1.12, 1.16) & 1.03 (1.01, 1.05) \\
\hline
Physical activity (sessions/week) \\
\hline
Zero§ & 4,047 & 4.1 & 52.7 & 1 & 1 \\
\hline
1 to 6 & 24,557 & 25.1 & 65.0 & 1.23 (1.20, 1.27) & 1.09 (1.06, 1.12) \\
\hline
7 to 10 & 24,526 & 25.1 & 65.8 & 1.25 (1.21, 1.29) & 1.08 (1.05, 1.11) \\
\hline
11 to 15 & 20,030 & 20.5 & 68.0 & 1.29 (1.25, 1.33) & 1.10 (1.07, 1.13) \\
\hline
16 and over & 22,810 & 23.3 & 65.8 & 1.25 (1.21, 1.29) & 1.07 (1.04, 1.10) \\
\hline
Vegetable intake (serves/day) \\
\hline
Zero§ & 1,994 & 2.0 & 47.8 & 1 & 1 \\
\hline
>0 to 1 & 9,576 & 9.8 & 58.4 & 1.22 (1.16, 1.28) & 1.08 (1.04, 1.13) \\
\hline
2 to 3 & 40,085 & 41.0 & 66.2 & 1.38 (1.32, 1.45) & 1.14 (1.10, 1.19) \\
\hline
4 to 5 & 24,065 & 24.6 & 68.5 & 1.43 (1.37, 1.50) & 1.17 (1.12, 1.22) \\
\hline
6 and over & 20,035 & 20.5 & 65.0 & 1.36 (1.30, 1.42) & 1.17 (1.12, 1.22) \\
\hline
Fruit intake (serves/day) \\
\hline
Zero§ & 6,225 & 6.4 & 50.7 & 1 & 1 \\
\hline
>0 to 1 & 19,018 & 19.4 & 62.5 & 1.23 (1.20, 1.26) & 1.12 (1.09, 1.15) \\
\hline
2 to 3 & 53,961 & 55.2 & 67.4 & 1.33 (1.30, 1.36) & 1.17 (1.15, 1.20) \\
\hline
4 and over & 16,362 & 16.7 & 67.7 & 1.34 (1.30, 1.37) & 1.19 (1.16, 1.22) \\
\hline
\end{tabular}
\end{table} | PMC2719656_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Fearful-deviant}} & \multicolumn{2}{c|}{\textbf{Happy-deviant}} \\
\hline
& \textbf{\textbf{Latency range}} & \textbf{\textbf{t- and p-values}} & \textbf{\textbf{Latency range}} & \textbf{\textbf{t- and p-values}} \\
\hline
\multirow{6}{*}{Fz} & 109 – 127 & t = 2.2 – 3.5 & 123 – 172 & t = 2.2 – 3.5 \\
\hline
& p = .005 – .049 & & p = .005 – .047 \\
\hline
137 – 162 & t = 2.2 – 3.2 \\
\hline
& p = .009 – .048 \\
\hline
& & 260 – 282 & t = 2.2 – 3.3 \\
\hline
& & & p = .007 – .047 \\
\hline
\multirow{2}{*}{Cz} & 112 – 156 & t = 2.2 – 3.6 & 124 – 168 & t = 2.2 – 3.9 \\
\hline
& p = .005 – .047 & & p = .002 – .047 \\
\hline
Pz & No differences & & 281 – 300 & t = 2.2 – 3.9 p = .002 – .048 \\
\hline
\multirow{6}{*}{Oz} & 164 – 183 & t = 2.3 – 2.6 & 142–153 & t = 2.2 – 2.9 \\
\hline
& p = .023 – .045 & & p = .014 – .049 \\
\hline
296 – 330 & t = 2.6 – 5.5 & 280 – 302 & t = 2.2 – 3.8 \\
\hline
& p = .0001 – .046 & & p = .003 – .047 \\
\hline
& & 319 – 341 & t = 2.4 – 3.4 \\
\hline
& & & p = .006 – .038 \\
\hline
\multirow{6}{*}{O1} & & & 140 – 154 & t = 2.2 – 3.3 \\
\hline
& & & p = .007 – .049 \\
\hline
174 – 185 & t = 2.6 – 3.2 \\
\hline
& p = .008 – .039 \\
\hline
300 – 323 & t = 2.3 – 5.2 & 319 – 341 & t = 2.3 – 3.6 \\
\hline
& p = .0001 – .042 & & p = .004 – .040 \\
\hline
\multirow{10}{*}{O2} & & & 142 – 151 & t = 2.3 – 2.7 \\
\hline
& & & p = .019 – .046 \\
\hline
164 – 185 & t = 2.2 – 4.44 \\
\hline
& p = .001 – .048 \\
\hline
& & 202 – 218 & t = 2.2 – 2.5 \\
\hline
& & & p = .032 – .047 \\
\hline
& & 253 – 305 & t = 2.3 – 5.6 \\
\hline
& & & p = .0001 – .045 \\
\hline
281 – 331 & t = 2.3 – 4.5 & 318 – 340 & t = 2.4 – 4.6 \\
\hline
& p = .001 – .042 & & p = .001 – .038 \\
\hline
\end{tabular}
\end{table} | PMC2719659_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Global}} & \multicolumn{2}{c|}{\textbf{Europe}} & \multicolumn{2}{c|}{\textbf{Middle East}} & \multicolumn{2}{c|}{\textbf{Africa}} & \multicolumn{2}{c|}{\textbf{Central South Asia}} & \multicolumn{2}{c|}{\textbf{East Asia}} & \multicolumn{2}{c|}{\textbf{Oceania}} & \multicolumn{2}{c|}{\textbf{America}} \\
\hline
\textbf{BritAIMs} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{Fst}}}}}}}} & \textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{\textbf{P}}}}}}}} \\
\hline
rs7696175 & 0.074 & 0.551 & 0.129 & 0.000 & 0.002 & 0.840 & 0.052 & 0.469 & 0.011 & 0.748 & 0.018 & 0.802 & 0.067 & 0.439 & 0.118 & 0.333 \\
\hline
rs1460133 & 0.035 & 0.842 & 0.062 & 0.043 & 0.027 & 0.286 & 0 & 1 & 0.022 & 0.502 & 0.010 & 0.916 & NA & NA & 0.042 & 0.695 \\
\hline
rs9378805 & 0.115 & 0.321 & 0.030 & 0.280 & 0.043 & 0.136 & 0.019 & 0.796 & 0.020 & 0.554 & 0.016 & 0.831 & 0.072 & 0.424 & 0.027 & 0.754 \\
\hline
rs11790408 & 0.067 & 0.594 & 0.043 & 0.141 & 0.088 & 0.022 & 0.028 & 0.714 & 0.046 & 0.169 & 0.009 & 0.920 & 0.015 & 0.709 & 0.108 & 0.370 \\
\hline
rs12295525 & 0.068 & 0.591 & 0.034 & 0.226 & 0.008 & 0.666 & 0.047 & 0.513 & 0.024 & 0.454 & 0.017 & 0.809 & NA & NA & 0.021 & 0.820 \\
\hline
rs12797951 & 0.106 & 0.365 & 0 & 1 & 0.105 & 0.015 & 0.037 & 0.611 & 0.053 & 0.116 & 0.061 & 0.136 & NA & NA & 0.175 & 0.167 \\
\hline
rs10774241 & 0.103 & 0.383 & 0 & 1 & 0 & 1 & 0.090 & 0.226 & 0.024 & 0.470 & 0.029 & 0.580 & 0.004 & 0.760 & 0.139 & 0.247 \\
\hline
rs17449560 & 0.036 & 0.835 & 0.017 & 0.520 & 0.043 & 0.135 & 0.112 & 0.146 & 0.003 & 0.909 & 0.017 & 0.814 & 0.199 & 0.210 & 0.061 & 0.581 \\
\hline
rs3760843 & 0.033 & 0.855 & 0.024 & 0.369 & 0 & 1 & 0.073 & 0.320 & 0.014 & 0.665 & 0.021 & 0.747 & 0.144 & 0.295 & 0.139 & 0.247 \\
\hline
rs2143877 & 0.078 & 0.529 & 0.046 & 0.117 & 0.011 & 0.585 & 0.053 & 0.460 & 0.004 & 0.892 & 0.015 & 0.857 & 0.005 & 0.754 & 0.038 & 0.714 \\
\hline
\end{tabular}
\end{table} | PMC2719660_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Continental Group} & \textbf{Median Fst} & \textbf{P value} \\
\hline
Europe & 0.0316 & 0.039 \\
\hline
Central South Asia & 0.021 & 0.574 \\
\hline
Africa & 0.0492 & 0.49 \\
\hline
Middle East & 0.01895 & 0.302 \\
\hline
East Asia & 0.017 & 0.992 \\
\hline
America & 0.08465 & 0.414 \\
\hline
Oceania & 0.067 & 0.362 \\
\hline
\end{tabular}
\end{table} | PMC2719660_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & \textbf{Neuropilin-2} & & \textbf{p value} \\
\hline
Factor & & Negative & Positive \\
\hline
\multirow{2}{*}{Age} & < 50 & 35 (54\%) & 30 (46\%) & 0.0911 \\
\hline
�51 & 18 (38\%) & 30 (62\%) \\
\hline
\multirow{4}{*}{Histology} & Ductal & 47 (45\%) & 57 (55\%) & 0.4328 \\
\hline
Lobular & 3 (60\%) & 2 (40\%) \\
\hline
Medullary & 1 (100\%) & 0 (0\%) \\
\hline
Mucinous & 2 (67\%) & 1 (33\%) \\
\hline
\multirow{2}{*}{Tumor size} & pT1 & 19 (53\%) & 17 (47\%) & 0.4240 \\
\hline
pT2–4 & 34 (44\%) & 43 (56\%) \\
\hline
\multirow{2}{*}{Lymph node metastasis} & Negative & 31 (57\%) & 23 (43\%) & 0.0389 \\
\hline
Positive & 22 (37\%) & 37 (63\%) \\
\hline
\multirow{2}{*}{Estrogen receptor} & Negative & 22 (49\%) & 23 (51\%) & 0.8476 \\
\hline
Positive & 31 (46\%) & 37 (54\%) \\
\hline
\multirow{2}{*}{Progesterone receptor} & Negative & 24 (47\%) & 27 (53\%) & 1.0000 \\
\hline
Positive & 29 (47\%) & 33 (53\%) \\
\hline
\multirow{2}{*}{Histological grade} & I and II & 34 (51\%) & 33 (49\%) & 0.3440 \\
\hline
III & 19 (41\%) & 27 (59\%) \\
\hline
\multirow{2}{*}{VEGF-C} & Negative & 17 (85\%) & 3 (15\%) & < 0.001 \\
\hline
Positive & 36 (39\%) & 57 (61\%) \\
\hline
\multirow{2}{*}{CXCR4 (cytoplasmic)} & Negative & 37 (65\%) & 20 (35\%) & < 0.001 \\
\hline
Positive & 16 (29\%) & 40 (71\%) \\
\hline
\multirow{2}{*}{CXCR4 (nuclei)} & Negative & 42 (50\%) & 42 (50\%) & 0.2879 \\
\hline
Positive & 11 (38\%) & 18 (62\%) \\
\hline
\multirow{2}{*}{Distant metastasis} & Negative & 41 (49\%) & 43 (51\%) & 0.5243 \\
\hline
Positive & 12 (41\%) & 17 (59\%) \\
\hline
\end{tabular}
\end{table} | PMC2719661_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Sample} & \textbf{CA125 (unit/ml)} & \textbf{Claudin-4*} \\
\hline
N32 & 0 & 1 \\
\hline
N2 & 0 & 0 \\
\hline
N3 & 41 & 0 \\
\hline
N4 & 4 & 0 \\
\hline
N5 & 122 & 0 \\
\hline
N6 & 44 & 0 \\
\hline
N7 & 0 & 0 \\
\hline
N8 & 0 & 0 \\
\hline
N9 & 0 & 0 \\
\hline
N21 & 0 & 0 \\
\hline
N22 & 8 & 0 \\
\hline
N23 & 0 & 0 \\
\hline
N24 & 0 & 0 \\
\hline
N25 & 76 & 0 \\
\hline
N26 & 27 & 0 \\
\hline
N27 & 6 & 0 \\
\hline
N28 & 4 & 0 \\
\hline
N29 & 0 & 0 \\
\hline
N30 & 0 & 0 \\
\hline
N31 & 20 & 0 \\
\hline
N33 & 1 & 0 \\
\hline
N34 & 0 & 0 \\
\hline
N35 & 0 & 0 \\
\hline
N36 & 47 & 0 \\
\hline
N37 & 0 & 0 \\
\hline
N38 & 0 & 0 \\
\hline
N39 & 0 & 0 \\
\hline
N19 & 9 & 0 \\
\hline
N15 & 0 & 0 \\
\hline
N11 & 0 & 0 \\
\hline
N1 & 0 & 0 \\
\hline
N10 & 30 & 0 \\
\hline
N41 & 0 & 0 \\
\hline
N42 & 0 & 0 \\
\hline
N43 & 0 & 0 \\
\hline
N44 & 22 & 0 \\
\hline
N45 & 80 & 0 \\
\hline
N46 & 0 & 0 \\
\hline
N47 & 16 & 0 \\
\hline
N48 & 99 & 0 \\
\hline
N49 & 27 & 0 \\
\hline
N51 & 0 & 0 \\
\hline
N52 & 0 & 0 \\
\hline
N53 & 85 & 0 \\
\hline
N54 & 0 & 0 \\
\hline
N55 & 9 & 0 \\
\hline
N56 & 4 & 0 \\
\hline
N57 & 0 & 0 \\
\hline
N58 & 2 & 0 \\
\hline
N59 & 171 & 0 \\
\hline
\end{tabular}
\end{table} | PMC2719664_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Cl4 +} & \textbf{Cl4 -} \\
\hline
CA125 Positive & 31 & 14 \\
\hline
CA125 Negative & 1 & 17 \\
\hline
\end{tabular}
\end{table} | PMC2719664_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & \multicolumn{2}{c|}{\textbf{Score of CA 9 expression}} \\
\hline
\multicolumn{2}{c|}{\textbf{Patient characteristics (n = 31)}} & \textbf{<80} & \textbf{$\geq$ 80} & \textbf{P value} \\
\hline
& & \textbf{(n = 20)} & \textbf{(n = 11)} \\
\hline
Age, median (range) & 51.6 (31.8 – 67.8) & 52.6 (33.3 – 66.7) & 50.4 (31.8 – 67.8) & 0.741* \\
\hline
Gender \\
\hline
Male & 15 & 10 & 5 & 0.809† \\
\hline
Female & 16 & 10 & 6 \\
\hline
Performance status \\
\hline
0 & 3 & 2 & 1 & 1.000‡ \\
\hline
1 & 25 & 16 & 9 \\
\hline
2 & 3 & 2 & 1 \\
\hline
Line of bevacizumab \\
\hline
2nd line & 13 & 9 & 4 & 0.718‡ \\
\hline
$\geq$ 3rd line & 18 & 11 & 7 \\
\hline
Primary sites \\
\hline
Rectum & 12 & 9 & 3 & 0.452‡ \\
\hline
Colon & 19 & 11 & 8 \\
\hline
Site of distant metastasis \\
\hline
Liver & 17 & 10 & 7 & 0.465† \\
\hline
Lymph node & 15 & 12 & 3 & 0.081† \\
\hline
Lung & 14 & 9 & 5 & 0.981† \\
\hline
Omentum & 11 & 9 & 2 & 0.241‡ \\
\hline
Bone & 7 & 6 & 1 & 0.372‡ \\
\hline
Sum of metastatic sites & 4 & 3 & 1 \\
\hline
< 3 & 20 & 13 & 7 & 1.000‡ \\
\hline
$\geq$ 3 & 11 & 7 & 4 \\
\hline
Combined chemotherapy \\
\hline
FOLFOX & 15 & 10 & 5 & 0.439‡ \\
\hline
FOLFIRI & 6 & 5 & 1 \\
\hline
Fluoropyrimidines alone & 10 & 5 & 5 \\
\hline
Treatment responses \\
\hline
Complete response & - & - & - \\
\hline
Partial response & 6 (19.4\%) & 4 & 2 \\
\hline
Stable disease & 13 (41.9\%) & 12 & 1 \\
\hline
Disease control rate§ & 19 (61.3\%) & 16 (80.0\%) & 3 (27.3\%) & 0.004‡ \\
\hline
Progressive disease & 11 (35.5\%) & 3 & 8 \\
\hline
Not evaluable & 1 (3.2\%) & 1 & 0 \\
\hline
\end{tabular}
\end{table} | PMC2719665_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Genotype} & \textbf{Control (\%) (N = 323)} & \textbf{SPCa (\%) (N = 391)} & \textbf{LPCa (\%) (N = 112)} \\
\hline
rs1447295 \\
\hline
CC & 218 (67.5) & 217 (55.5) & 71 (63.4) \\
\hline
CA & 89 (27.5) & 149 (38.1) & 34 (30.4) \\
\hline
AA & 16 (5.0) & 25 (6.4) & 7 (6.2) \\
\hline
rs6983267 \\
\hline
TT & 147 (45.5) & 151 (38.6) & 48 (42.9) \\
\hline
TG & 151 (46.8) & 181 (46.3) & 53 (47.3) \\
\hline
GG & 25 (7.7) & 59 (15.1) & 11 (9.8) \\
\hline
Allele & Control (\%) (2N = 646) & SPCa (\%) (2N = 782) & LPCa (\%) (2N = 224) \\
\hline
rs1447295 \\
\hline
C & 525 (81.3) & 583 (74.6) & 176 (78.6) \\
\hline
A & 121 (18.7) & 199 (25.4) & 48 (21.4) \\
\hline
HWE \\
\hline
chi-square & 2.91 & 0.01 & 1.09 \\
\hline
p value & 0.09 & 0.93 & 0.30 \\
\hline
rs6983267 \\
\hline
T & 445 (68.9) & 483 (61.8) & 149 (66.5) \\
\hline
G & 201 (31.1) & 299 (38.2) & 75 (33.5) \\
\hline
HWE \\
\hline
chi-square & 2.65 & 0.16 & 0.44 \\
\hline
p value & 0.10 & 0.69 & 0.51 \\
\hline
\end{tabular}
\end{table} | PMC2719668_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Genotype}} & \multirow{2}{*}{\textbf{\textbf{OR*}}} & \multirow{2}{*}{\textbf{Control vs. SPCa 95\% CI}} & \multirow{2}{*}{\textbf{\textbf{p value}}} & \multirow{2}{*}{\textbf{\textbf{OR*}}} & \multirow{2}{*}{\textbf{Control vs. LPCa 95\% CI}} & \multirow{2}{*}{\textbf{\textbf{p value}}} \\
\hline
\\
\hline
rs1447295 \\
\hline
CC & 1.0 & reference & & 1.0 & reference \\
\hline
CA & 1.54 & 1.08 – 2.21 & 0.02 & 1.22 & 0.75 – 1.98 & 0.42 \\
\hline
AA & 1.29 & 0.62 – 2.73 & 0.50 & 1.45 & 0.53 – 3.59 & 0.45 \\
\hline
CA + AA & 1.50 & 1.07 – 2.11 & 0.02 & 1.25 & 0.79 – 1.97 & 0.33 \\
\hline
rs6983267 \\
\hline
TT & 1.0 & reference & & 1.0 & reference \\
\hline
TG & 0.95 & 0.67 – 1.35 & 0.78 & 1.17 & 0.74 – 1.86 & 0.50 \\
\hline
GG & 2.21 & 1.24 – 4.03 & 7.0 × 10-3 & 1.40 & 0.62 – 3.03 & 0.40 \\
\hline
TG + GG & 1.12 & 0.80 – 1.57 & 0.50 & 1.21 & 0.78 – 1.88 & 0.41 \\
\hline
Allele \\
\hline
& \textbf{\textbf{OR*}} & 95\% CI & \textbf{\textbf{p value}} & \textbf{\textbf{OR*}} & 95\% CI & \textbf{\textbf{p value}} \\
\hline
rs1447295 \\
\hline
C & 1.0 & reference & & 1.0 & reference \\
\hline
A & 1.34 & 1.01 – 1.79 & 0.04 & 1.23 & 0.84 – 1.79 & 0.29 \\
\hline
rs6983267 \\
\hline
T & 1.0 & reference & & 1.0 & reference \\
\hline
G & 1.27 & 0.99 – 1.62 & 0.06 & 1.17 & 0.84 – 1.62 & 0.35 \\
\hline
\end{tabular}
\end{table} | PMC2719668_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & \multicolumn{3}{c|}{\textbf{rs6983267}} \\
\hline
& & \textbf{TT} & \textbf{TG} & \textbf{GG} \\
\hline
rs1447295 & OR* & 1.0 & 0.78 & 1.69 \\
\hline
\multirow{2}{*}{CC} & 95\% CI & reference & 0.50 – 1.23 & 0.78 – 3.75 \\
\hline
OR* & 1.07 & 1.33 & 2.74 \\
\hline
\multirow{2}{*}{CA} & 95\% CI & 0.58 – 1.94 & 0.77 – 2.29 & 1.13 – 7.17 \\
\hline
OR* & 0.54 & 1.34 \\
\hline
AA & 95\% CI & 0.15 – 1.81 & 0.42 – 4.48 \\
\hline
\end{tabular}
\end{table} | PMC2719668_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & & \multirow{2}{*}{\textbf{rs1447295 A allele frequency}} \\
\hline
\\
\hline
Author (Year) & N cases/N controls & Study population & Cases & Controls & OR & 95\% CI & p value \\
\hline
\multirow{4}{*}{Amundadottir, et al. (2006)} & 1291/997 & Iceland & 0.17 & 0.11 & 1.72 & — & 1.7 × 10-9 \\
\hline
1435/779 & Sweden & 0.16 & 0.13 & 1.29 & — & 4.5 × 10-3 \\
\hline
458/247 & European Americans & 0.13 & 0.08 & 1.66 & — & 6.7 × 10-3 \\
\hline
246/352 & African Americans & 0.34 & 0.31 & 1.15 & — & 0.29 \\
\hline
\multirow{5}{*}{Freedman, et al. (2006)} & 70/68 & Native Hawaiians & 0.37 & 0.16 & 3.02 & 1.66 – 5.50 & 1.5 × 10-4 \\
\hline
449/465 & Japanese Americans & 0.24 & 0.17 & 1.48 & 1.18 – 1.86 & 3.4 × 10-4 \\
\hline
640/567 & Latino Americans & 0.14 & 0.10 & 1.48 & 1.14 – 1.91 & 1.4 × 10-3 \\
\hline
455/447 & European Americans & 0.13 & 0.10 & 1.35 & 1.01 – 1.80 & 0.02 \\
\hline
989/804 & African Americans & — & — & 1.05 & 0.95 – 1.16 & 0.15 \\
\hline
\multirow{2}{*}{Wang, et al. (2007)} & 491/545 & Caucasians & 0.12 & 0.10 & 1.16 & 0.85 – 1.58 & 0.25 \\
\hline
435/545 & Caucasians* & 0.17 & 0.10 & 1.93 & 1.37 – 2.72 & 4.0 × 10-3 \\
\hline
\multirow{4}{*}{Gudmundsson, et al. (2007)} & 1453/3064 & Iceland & 0.17 & 0.10 & 1.71 & 1.49 – 1.95 & 1.6 × 10-14 \\
\hline
385/892 & Spain & 0.10 & 0.07 & 1.44 & 1.07 – 1.94 & 1.7 × 10-2 \\
\hline
367/1302 & The Netherlands & 0.14 & 0.11 & 1.39 & 1.09 – 1.78 & 9.0 × 10-3 \\
\hline
373/372 & African Americans & 0.32 & 0.31 & 1.01 & 0.81 – 1.25 & 0.96 \\
\hline
\multirow{5}{*}{Haiman, et al. (2007)} & 1614/837 & African Americans & — & — & — & — & — \\
\hline
722/728 & Japanese Americans & — & — & — & — & — \\
\hline
111/112 & Native Hawaiians & — & — & — & — & — \\
\hline
637/633 & Latino Americans & — & — & — & — & — \\
\hline
1182/942 & European Americans & — & — & — & — & — \\
\hline
Robbins, et al. (2007) & 490/567 & African Americans & 0.34 & 0.31 & 1.40 & 0.70 – 1.30 & 0.13 \\
\hline
\multirow{3}{*}{Present study (2009)} & 391/323 & Native Japanese & 0.25 & 0.19 & 1.34 & 1.01 – 1.79 & 0.04 \\
\hline
& & rs6983267 \\
\hline
& & G allele frequency \\
\hline
Author (Year) & N cases/N controls & Study population & Cases & Controls & OR & 95\% CI & p value \\
\hline
\multirow{4}{*}{Amundadottir, et al. (2006)} & 1291/997 & Iceland & — & — & — & — & — \\
\hline
1435/779 & Sweden & — & — & — & — & — \\
\hline
458/247 & European Americans & — & — & — & — & — \\
\hline
246/352 & African Americans & — & — & — & — & — \\
\hline
\multirow{5}{*}{Freedman, et al. (2006)} & 70/68 & Native Hawaiians & — & — & — & — & — \\
\hline
449/465 & Japanese Americans & — & — & — & — & — \\
\hline
640/567 & Latino Americans & — & — & — & — & — \\
\hline
455/447 & European Americans & — & — & — & — & — \\
\hline
989/804 & African Americans & — & — & — & — & — \\
\hline
\multirow{2}{*}{Wang, et al. (2007)} & 491/545 & Caucasians & — & — & — & — & — \\
\hline
435/545 & Caucasians* & — & — & — & — & — \\
\hline
\multirow{4}{*}{Gudmundsson, et al. (2007)} & 1453/3064 & Iceland & — & — & — & — & — \\
\hline
385/892 & Spain & — & — & — & — & — \\
\hline
367/1302 & The Netherlands & — & — & — & — & — \\
\hline
373/372 & African Americans & — & — & — & — & — \\
\hline
\multirow{5}{*}{Haiman, et al. (2007)} & 1614/837 & African Americans & 0.90† & 0.84 & 1.43 & 1.17 – 1.75 & — \\
\hline
722/728 & Japanese Americans & 0.37† & 0.32 & 1.22 & 1.05 – 1.42 & — \\
\hline
111/112 & Native Hawaiians & 0.36† & 0.28 & 1.29 & 0.88 – 1.89 & — \\
\hline
637/633 & Latino Americans & 0.63† & 0.62 & 1.05 & 0.89 – 1.24 & — \\
\hline
1182/942 & European Americans & 0.54† & 0.51 & 1.13 & 0.99 – 1.28 & — \\
\hline
Robbins, et al. (2007) & 490/567 & African Americans & 0.08 & 0.11 & 1.40 & 0.90 – 2.40 & 0.17 \\
\hline
Present study (2009) & 391/323 & Native Japanese & 0.38 & 0.31 & 1.27 & 0.99 – 1.62 & 0.06 \\
\hline
\end{tabular}
\end{table} | PMC2719668_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Strain} & \textbf{Serotype} & \textbf{Sequence source} & \textbf{LSPA6 lineage} & \textbf{SNP clade} & \textbf{Stx-phage insertion site genotype} \\
\hline
EC4024 & O157:H7 & NZ_ABJT00000000 & I/II & 8 & 1 \\
\hline
EC4042 & O157:H7 & NZ_ABHM00000000 & I/II & 8 & 1 \\
\hline
EC4045 & O157:H7 & NZ_ABHL00000000 & I/II & 8 & 1 \\
\hline
EC4076 & O157:H7 & NZ_ABHQ00000000 & I/II & 8 & 1 \\
\hline
EC4113 & O157:H7 & NZ_ABHP00000000 & I/II & 8 & 1 \\
\hline
EC4115 & O157:H7 & NZ_ABHN00000000 & I/II & 8 & 1 \\
\hline
EC4196 & O157:H7 & NZ_ABHO00000000 & I/II & 8 & 1 \\
\hline
EC4206 & O157:H7 & NZ_ABHK00000000 & I/II & 8 & 1 \\
\hline
EC4401 & O157:H7 & NZ_ABHR00000000 & I/II & 8 & 1 \\
\hline
EC4486 & O157:H7 & NZ_ABHS00000000 & I/II & 8 & 1 \\
\hline
EC508 & O157:H7 & NZ_ABHW00000000 & I/II & 8 & 1 \\
\hline
EC71074 & O157:H7 & Public Health Agency of Canada & I/II & 8 & 1 \\
\hline
EC869 & O157:H7 & NZ_ABHU00000000 & II & uncertain & 6 \\
\hline
EC4501 & O157:H7 & NZ_ABHT00000000 & I & 2 & 3 \\
\hline
TW14588 & O157:H7 & NZ_ABKY00000000 & I & 2 & 3 \\
\hline
EDL933 & O157:H7 & NC_002655.2 & I & 3 & 3 \\
\hline
Sakai & O157:H7 & NC_002695.1 & I & 1 & 3 \\
\hline
EC33264 & O145:NM & Public Health Agency of Canada & NA & NA & NA \\
\hline
MG1655 & K12 & NC_000913.2 & NA & NA & NA \\
\hline
\end{tabular}
\end{table} | PMC2719669_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
Strain & Lineage & Strain & Lineage & Strain & Lineage \\
\hline
AA10002 & I & H2727 & I & EC4113 & I/II \\
\hline
AA10021 & I & H2731 & I & EC4115 & I/II \\
\hline
APF593 & I & H432 & I & EC4196 & I/II \\
\hline
2328 & I & H435 & I & EC4206 & I/II \\
\hline
23339 & I & H4420 & I & EC4401 & I/II \\
\hline
58212 & I & H451 & I & EC4486 & I/II \\
\hline
63154 & I & H453 & I & EC508 & I/II \\
\hline
70490 & I & H454 & I & EC71074 & I/II \\
\hline
813601 & I & H568 & I & R1388 & I/II \\
\hline
93111 & I & H571 & I & Zap0046 & I/II \\
\hline
97701 & I & H572 & I & AA6192 & II \\
\hline
EC4501 & I & H573 & I & AA9952 & II \\
\hline
EC980120 & I & H574 & I & E12491 & II \\
\hline
EC980121 & I & LN6374 & I & EC19920026 & II \\
\hline
EC980122 & I & LRH6 & I & EC869 & II \\
\hline
EC980125 & I & LRH73 & I & EC970520 & II \\
\hline
EDL933 & I & LS110 & I & F1081 & II \\
\hline
F1082 & I & LS236 & I & F12 & II \\
\hline
F1095 & I & M01MD3265 & I & F1305 & II \\
\hline
F1103 & I & OK1 & I & FRIK1985 & II \\
\hline
F1299 & I & R1195 & I & FRIK1990 & II \\
\hline
F2 & I & S23021 & I & FRIK1999 & II \\
\hline
F30 & I & S2628 & I & FRIK2001 & II \\
\hline
F5 & I & S3722 & I & FRIK920 & II \\
\hline
F732 & I & Sakai & I & LRH13 & II \\
\hline
F744 & I & TS97 & I & LS68 & II \\
\hline
H2160 & I & TW14588 & I & R1797 & II \\
\hline
H2161 & I & 09601Fe046.1 & I/II & 493/89 & O157:H- \\
\hline
H2163 & I & 32511 & I/II & CB2755 & O157:H- \\
\hline
H2164 & I & 59243 & I/II & Dec5d & O55:H7 \\
\hline
H2176 & I & EC4024 & I/II & TB182A & O55:H7 \\
\hline
H2704 & I & EC4042 & I/II & 5905 & O55:H7 \\
\hline
H2718 & I & EC4045 & I/II & EC33264 & O145:NM \\
\hline
H2723 & I & EC4076 & I/II & MG1655 & K12 \\
\hline
\end{tabular}
\end{table} | PMC2719669_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Number of proteins} & \textbf{1722} \\
\hline
\textbf{Number of proteins} with OG & 1626 \\
\hline
\textbf{Number of proteins} with a BP GO annotation (depth = 5) & 1026 \\
\hline
\textbf{Number of proteins} with a CC GO annotation (depth = 5) & 688 \\
\hline
\textbf{Number of proteins} with gene expression data & 1821 \\
\hline
Number of interactions & 3035 \\
\hline
Number of interactions with OG & 3032 \\
\hline
Number of interactions between proteins with sufficient information on different genomic features & 1457 \\
\hline
Number of interactions with a BP GO annotation (depth = 5, depth = 8) & 1457,157 \\
\hline
Number of interactions with BP score > = 5, > = 8 & 913, 123 \\
\hline
Number of interactions with a CC GO annotation (depth = 5) & 757 \\
\hline
Number of interactions with CC score > = 5 & 565 \\
\hline
Number of interactions with gene expression data & 2482 \\
\hline
Number of interactions with PCC> = 0.3 & 837 \\
\hline
Number of interactions with a BP GO annotation (depth = 5) and expression data & 1276 \\
\hline
Number of interactions with BP score > = 5 and PCC > = 0.3) & 317 \\
\hline
Total number of filtered interactions with CC score > = 5 or BP score > = 5 and PCC > = 0.3 or BP score > = 8) & 767 \\
\hline
\end{tabular}
\end{table} | PMC2719670_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{#proteins} & \textbf{#interactions} \\
\hline
Yeast & 4662 & 175322 \\
\hline
Yeast CC5 & 1182 & 9384 \\
\hline
Yeast BP5+PCC 0.3 & 1249 & 8986 \\
\hline
Yeast BP8 & 290 & 1336 \\
\hline
Yeast total filtered & 1919 & 16145 \\
\hline
Human & 3346 & 28397 \\
\hline
Human CC5 & 694 & 1821 \\
\hline
Human BP5+PCC 0.3 & 632 & 1082 \\
\hline
Human BP8 & 185 & 421 \\
\hline
Human total filtered & 1089 & 2795 \\
\hline
C. elegans & 1549 & 4174 \\
\hline
C. elegans CC5 & 149 & 199 \\
\hline
C. elegans BP5+PCC 0.3 & 234 & 256 \\
\hline
C. elegans BP8 & 70 & 100 \\
\hline
C. elegans total filtered & 330 & 432 \\
\hline
Drosophila & 3355 & 19315 \\
\hline
Drosophila CC5 & 430 & 924 \\
\hline
Drosophila BP5+PCC0.3 & 368 & 438 \\
\hline
Drosophila BP8 & 87 & 140 \\
\hline
Drosophila total filtered & 646 & 1282 \\
\hline
All species – Interologs with CC annotation (CC > = 5) & 2123 (1431) & 43698 (11891) \\
\hline
All species – Interologs with BP annotation (BP > = 5, BP > = 8) & 3087 (2111, 416) & 79475 (25037, 1890) \\
\hline
All species – Interologs with gene expression data (PCC > = 0.3) & 5369 (4688) & 161928 (62178) \\
\hline
All species – Filtered & 2233 & 18674 \\
\hline
All species – Predicted & 3014 & 51885 \\
\hline
All species – interologs (without filtering) & 6206 & 216972 \\
\hline
\end{tabular}
\end{table} | PMC2719670_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{23 DAP library}} & \multicolumn{2}{c|}{\textbf{35 DAP library}} & \multicolumn{2}{c|}{\textbf{Combined data}} \\
\hline
\textbf{Category} & \textbf{\textbf{\textbf{Unique sequences}}} & \textbf{\textbf{\textbf{All sequences}}} & \textbf{\textbf{\textbf{Unique sequences}}} & \textbf{\textbf{\textbf{All sequences}}} & \textbf{\textbf{\textbf{Unique sequences}}} & \textbf{\textbf{\textbf{All sequences}}} \\
\hline
Total extracted ditags & - & 34,984 & - & 15,919 & - & 50,903 \\
\hline
Rejected ditags (Phred $\leq$ score 20a) & - & 10,685 & - & 3,306 & - & 13,991 \\
\hline
Accepted ditags (Phred score > 20a) & 23,996 & 24,299 & 11,846 & 12,613 & 35,842 & 36,912 \\
\hline
Total extracted tags & 24,655 & 48,534 & 12,714 & 25,198 & 37,369 & 73,732 \\
\hline
Accepted tags (excluding polyA tags) & 24,654 & 48,514 & 12,713 & 25,183 & 37,367 & 73,697 \\
\hline
\multicolumn{2}{c|}{Copy number of accepted} \\
\hline
1 & 18,183 (73.8.\%) & 18,183 (37.5\%) & 9,741 (76.6\%) & 9,741 (38.7\%) \\
\hline
2–5 & 5,329 (21.6\%) & 14,320 (29.5\%) & 2,510 (19.7\%) & 6,596 (26.2\%) \\
\hline
6–20 & 1,016 (4.1\%) & 9,450 (19.5\%) & 406 (3.2\%) & 3,668 (14.6\%) \\
\hline
21–99 & 118 (0.5\%) & 4,437 (9.1\%) & 46 (0.4\%) & 1,997 (7.9\%) \\
\hline
>100 & 8 (0.03\%) & 2,124 (4.4\%) & 9 (0.07\%) & 3,181 (12.6\%) \\
\hline
\end{tabular}
\end{table} | PMC2719671_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{gene A. thaliana locus} & \textbf{Gene} & \textbf{Cumulated counts,35:23 DAP LongSAGE (non-normalized)} & \textbf{Fold-change 35:23 DAP LongSAGE (normalized)} & \textbf{Fold-change 35:23 DAP Real-time RT- PCR} & \textbf{EST B. napus contigs assembled by CAP3} \\
\hline
AT2G40890 & Coumarate 3- hydroxylase (C3H) & 2:2 & 1.9 & 2.0 4.1 & Contig 1 from 5 ESTs Contig 2 from 2 ESTs \\
\hline
AT5G48930 & Hydroxycinnamoyl- Coenzyme A shikimate/quinate hydroxycinnamoyl- transferase (HCT) & 5:3 & 3.2 & 2.3 & 1 EST \\
\hline
AT1G15950 & Cinnamoyl-CoA reductase 1 (CCR1) & 2.2:1 & 4.3 & 0.9 & Contig from 4 ESTs \\
\hline
AT2G23910 & Cinnamoyl-CoA reductase-related (CCR1-related) & 0:0 & - & 1.2 1.7 & Contig 1 from 22 ESTs Contig 2 from 13 ESTs \\
\hline
AT3G19450 & Cinnamoyl alcohol dehydrogenase (CAD1) & 8:9.5 & 1.6 & 2.1 & Contig 3 from 4 ESTs \\
\hline
AT4G27140 AT4G27150 AT4G27160 AT4G27170 & 2S seed storage proteins (napin) & 669.1:3.4 560.1:1.9 575.3:1.9 636.5:7.9 & 374.1 564.4 579.6 155.0 & 1224 & Contig from SAGE primer-amplified cloned 3'-terminal napin gene fragments \\
\hline
\end{tabular}
\end{table} | PMC2719671_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Rank} & \textbf{A. thaliana locus} & \textbf{No. of matched Brassica ESTs at 1e-6} & \textbf{No. of different tags matched to Brassica ESTs} & \textbf{Mean tag count per locus} & \textbf{Frequency of tag counts (\%, normalized)} & \textbf{Description of matched A. thaliana gene locus} \\
\hline
1 & AT5G45890 & 4,452 & 44 & 772 & 1.590 & SAG12 (SENESCENCE- ASSOCIATED GENE 12); cysteine-type peptidase \\
\hline
2 & AT5G50260 & 109 & 15 & 320 & 0.660 & cysteine proteinase, putative \\
\hline
3 & AT3G48350 & 14 & 7 & 299 & 0.615 & cysteine proteinase, putative \\
\hline
4 & AT5G38195 & 1,640 & 36 & 263 & 0.541 & protease inhibitor/seed storage/lipid transfer protein (LTP) family protein \\
\hline
5 & AT1G48750 & 8 & 4 & 209 & 0.430 & protease inhibitor/seed storage/lipid transfer protein (LTP) family protein \\
\hline
6 & AT3G20210 & 630 & 13 & 156 & 0.323 & DELTA-VPE (delta vacuolar processing enzyme); cysteine-type endopeptidasee \\
\hline
7 & AT2G12465 & 160 & 11 & 134 & 0.275 & LCR50 (Low-molecular-weight cysteine-rich 50) \\
\hline
8 & AT4G32110 & 852 & 20 & 127 & 0.263 & transferase, transferring glycosyl groups \\
\hline
9 & AT3G04120 & 814 & 30 & 124 & 0.256 & GAPC (GLYCERALDEHYDE-3- PHOSPHATE DEHYDROGENASE C SUBUNIT) \\
\hline
10 & AT5G37474 & 35 & 10 & 120 & 0.247 & Encodes a defensin-like (DEFL) family protein \\
\hline
11 & AT2G14846 & 191 & 13 & 118 & 0.244 & protease inhibitor/seed storage/lipid transfer protein (LTP) family proteinperoxidise \\
\hline
12 & AT4G21960 & 1,312 & 16 & 118 & 0.243 & PRXR1 (peroxidase 42); peroxidase \\
\hline
13 & AT5G60390 & 2,771 & 30 & 113 & 0.233 & elongation factor 1-alpha/ EF-1-alpha \\
\hline
14 & AT4G32105 & 79 & 13 & 109 & 0.225 & Galactosyltransferase \\
\hline
15 & AT1G58055 & 23 & 5 & 100 & 0.206 & Encodes a defensin-like (DEFL) family protein \\
\hline
16 & AT1G04645 & 502 & 11 & 97 & 0.200 & self-incompatibility protein- related \\
\hline
17 & AT1G05850 & 426 & 11 & 96 & 0.198 & POM1; chitinase \\
\hline
18 & AT1G08830 & 410 & 14 & 95 & 0.196 & CSD1 (copper/zinc superoxide dismutase 1) \\
\hline
19 & AT4G12960 & 351 & 6 & 93 & 0.191 & gamma interferon responsive lysosomal thiol reductase family protein/ GILT \\
\hline
20 & AT4G21650 & 53 & 8 & 92 & 0.189 & subtilase family protein \\
\hline
\end{tabular}
\end{table} | PMC2719671_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Rank} & \textbf{A. thaliana locus} & \textbf{No. of matched Brassica ESTs at 1e-6} & \textbf{No. of different tags matched to Brassica ESTs} & \textbf{Mean tag count per locus} & \textbf{Frequency of tag counts (\%, normalized)} & \textbf{Description of matched A. thaliana gene locus} \\
\hline
1 & AT4G27140 & 16,413 & 96 & 669 & 2.657 & 2S seed storage protein 1/ 2S albumin storage protein/NWMU1-2S albumin 1 \\
\hline
2 & AT4G27170 & 6,691 & 67 & 637 & 2.528 & 2S seed storage protein 4/ 2S albumin storage protein/NWMU2-2S albumin 4 \\
\hline
3 & AT4G27160 & 2,402 & 34 & 575 & 2.284 & 2S seed storage protein 3/ 2S albumin storage protein/NWMU2-2S albumin 3 \\
\hline
4 & AT4G27150 & 249 & 24 & 560 & 2.224 & 2S seed storage protein 2/ 2S albumin storage protein/NWMU2-2S albumin 2 \\
\hline
5 & AT4G28520 & 126 & 13 & 195 & 0.776 & CRU3 (CRUCIFERIN 3) \\
\hline
6 & AT3G27660 & 1,226 & 15 & 183 & 0.728 & OLEO4 (OLEOSIN4) \\
\hline
7 & AT5G38195 & 1,640 & 36 & 161 & 0.640 & protease inhibitor/seed storage/lipid transfer protein (LTP) family protein \\
\hline
8 & AT4G25140 & 1,119 & 15 & 146 & 0.580 & OLEO1 (OLEOSIN1) \\
\hline
9 & AT5G44120 & 1,112 & 17 & 143 & 0.567 & CRA1 (CRUCIFERINA); nutrient reservoir \\
\hline
10 & AT5G45890 & 4,452 & 44 & 143 & 0.566 & SAG12 (SENESCENCE- ASSOCIATED GENE 12); cysteine-type peptidase \\
\hline
11 & AT1G03880 & 1,791 & 12 & 138 & 0.549 & CRU2 (CRUCIFERIN 2); nutrient reservoir \\
\hline
12 & AT1G48750 & 8 & 4 & 136 & 0.538 & protease inhibitor/seed storage/lipid transfer protein (LTP) family protein \\
\hline
13 & AT1G79870 & 5 & 3 & 123 & 0.487 & oxidoreductase family protein \\
\hline
14 & AT1G12920 & 1 & 2 & 113 & 0.447 & ERF1-2 (EUKARYOTIC RELEASE FACTOR 1-2); translation release factor \\
\hline
15 & AT5G35530 & 401 & 6 & 102 & 0.406 & 40S ribosomal protein S3 (RPS3C) \\
\hline
16 & AT3G12580 & 31 & 8 & 102 & 0.405 & HSP70 (heat shock protein 70); ATP binding \\
\hline
17 & AT3G01570 & 170 & 6 & 99 & 0.393 & glycine-rich protein/ oleosin \\
\hline
18 & AT1G69830 & 1 & 2 & 97 & 0.385 & AMY3/ATAMY3 (ALPHA- AMYLASE-LIKE 3); alpha- amylase \\
\hline
19 & AT3G05020 & 401 & 14 & 86 & 0.340 & ACP1 (ACYL CARRIER PROTEIN 1) \\
\hline
20 & AT5G09440 & 31 & 3 & 82 & 0.326 & phosphate-responsive protein, putative \\
\hline
\end{tabular}
\end{table} | PMC2719671_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Locus} & \textbf{Number of alleles/ No. of individuals} & \textbf{No. polymorphic sites within PBR} \\
\hline
Maeu-UM & 3/4 & 1 \\
\hline
Maeu-UE & 2/4 & 0 \\
\hline
Maeu-UK & 3/4 & 1 \\
\hline
Maeu-UO & 2/4 & 0 \\
\hline
Modo-UG & 12/16 & 2 \\
\hline
\end{tabular}
\end{table} | PMC2719672_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{BAC location in wallaby} & \textbf{Location in opossum} & \textbf{Predicted location in wallaby} \\
\hline
HNRPM & 3 & 3 & 4 [45] \\
\hline
GPR128 & 5q (distal) & 4 & 5q (proximal) [44] \\
\hline
ARPP19 & 7 & 1 & 7 [45] \\
\hline
ARHGAP20 & 6 & 4 & 5 [45] \\
\hline
\end{tabular}
\end{table} | PMC2719672_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Class I locus} & \textbf{Primers} \\
\hline
Maeu-UE & α1F – ATG TGC CTG CAG AAA GTG TCT GCG \\
\hline
Primer set 1 & α2R – AT GGT TCA GGG CTC CTG AGT TCC \\
\hline
Maeu-UK & α1F – AGT AGT TAG AGA GAC GGA GCA CAC \\
\hline
Primer set 2 & α2R – GTA CTT CTG CAG CCA TTC AGT \\
\hline
Maeu-UO & α1F – CAA GAG ATA CCA GAT TAC TGG GA \\
\hline
Primer set 4 & α2R – CGT TCC CAG CGA TCC AAC TTA GA \\
\hline
Maeu-UM & α1F – GCG GGC CCA GAC TGG GGT TAG AG \\
\hline
Primer set 4 & α2R – ACG TTT AGG GCC ACG TTG TCC AAT \\
\hline
MHC un-linked class I & α1F – CACTCCATGAGGTATTTCGACA \\
\hline
Primer set 5 & α3R – GGCTCAGGCAGCCCCTCGTGC \\
\hline
\end{tabular}
\end{table} | PMC2719672_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{S.No} & \textbf{Complexes} & \textbf{Color} & \textbf{◦C Melting point} & \textbf{Mole Ratio} & \textbf{\% yield} \\
\hline
1 & Enoxacin & off white & 225 & — \\
\hline
2 & MnII complex & off white & 265d & 1 : 2 & 78 \\
\hline
3 & FeIII complex & dark brown & 275d & 1 : 1 & 70 \\
\hline
4 & NiII complex & leaf green & 246 & 1 : 2 & 76 \\
\hline
5 & CuII complex & light blue & 255 & 1 : 2 & 72 \\
\hline
\end{tabular}
\end{table} | PMC2719789_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{S.\textbf{N}o} & \textbf{\textbf{C}ompound name} & & \textbf{C} & \textbf{H} & \textbf{N} & \textbf{C}hloride & \textbf{Metal} \\
\hline
\multirow{2}{*}{1} & \multirow{2}{*}{Enoxacin} & Found & 56.42 & 5.85 & 16.99 & — & — \\
\hline
\textbf{C}alculated & 56.24 & 5.35 & 17.49 \\
\hline
\multirow{2}{*}{2} & \multirow{2}{*}{[Mn(eno)2(\textbf{H}2O)2]·3\textbf{H}2O} & Found & 45.40 & 6.12 & 14.04 & — & 7.05 \\
\hline
\textbf{C}alculated & 45.90 & 5.92 & 14.34 & — & 6.99 \\
\hline
\multirow{2}{*}{3} & \multirow{2}{*}{[Fe(eno)(\textbf{H}2O)2]·\textbf{C}l·4\textbf{H}2O} & Found & 33.67 & 5.27 & 10.47 & 13.2 & 10.43 \\
\hline
\textbf{C}alculated & 33.73 & 5.20 & 10.58 & 13.5 & 10.24 \\
\hline
\multirow{2}{*}{4} & \multirow{2}{*}{[\textbf{N}i(eno)2(\textbf{H}2O)2]·3\textbf{H}2O} & Found & 45.53 & 5.74 & 14.01 & — & 7.77 \\
\hline
\textbf{C}alculated & 45.65 & 5.62 & 14.19 & — & 7.43 \\
\hline
\multirow{2}{*}{5} & \multirow{2}{*}{[\textbf{C}u(eno)2(\textbf{H}2O)2]·3\textbf{H}2O} & Found & 45.39 & 5.56 & 14.12 & — & 8.02 \\
\hline
\textbf{C}alculated & 45.37 & 5.58 & 14.11 & — & 8.00 \\
\hline
\end{tabular}
\end{table} | PMC2719789_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Sample}} & \multirow{2}{*}{\textbf{Clostridium hofmani Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Staphylococcus aureus Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Bacillus subtilis Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Shigella flexneri Conc. (mg/disc)}} \\
\hline
\\
\hline
& \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} \\
\hline
Enoxacin & 8 & 14 & 16 & 8 & \textbf{\textbf{\textbf{\textbf{10}}}} & 14 & 8 & \textbf{\textbf{\textbf{\textbf{10}}}} & 12 & 8 & 11 & 13 \\
\hline
Enox +Mn & \textbf{\textbf{\textbf{\textbf{10}}}} & 16 & \textbf{\textbf{\textbf{\textbf{20}}}} & 1\textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & 21 & 12 & 1\textbf{\textbf{\textbf{\textbf{5}}}} & 16 & 8 & 9 & 13 \\
\hline
Enox + Fe & 8 & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & 7 & 9 & 11 & 7 & 8 & \textbf{\textbf{\textbf{\textbf{10}}}} \\
\hline
Enox + Ni & 14 & 18 & 24 & 7 & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & 12 & 16 & \textbf{\textbf{\textbf{\textbf{10}}}} & 11 & 1\textbf{\textbf{\textbf{\textbf{5}}}} \\
\hline
Enox + Cu & 11 & 13 & 17 & 14 & 1\textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & 11 & 11 & 8 & 11 & 12 \\
\hline
\end{tabular}
\end{table} | PMC2719789_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Sample}} & \multirow{2}{*}{\textbf{Pseudomonas areuginosa Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Salmonella typhi Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Streptococcus pneumonia Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Citrobacter Conc. (mg/disc)}} \\
\hline
\\
\hline
& \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} & \textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{20}}}} \\
\hline
Enoxacin & 12 & 16 & 18 & 12 & 17 & 21 & 9 & 12 & 14 & \textbf{\textbf{\textbf{\textbf{10}}}} & 12 & 14 \\
\hline
Enox +Mn & 9 & 12 & 1\textbf{\textbf{\textbf{\textbf{5}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & 1\textbf{\textbf{\textbf{\textbf{5}}}} & 18 & 9 & 12 & 14 & \textbf{\textbf{\textbf{\textbf{10}}}} & \textbf{\textbf{\textbf{\textbf{10}}}} & 11 \\
\hline
Enox + Fe & 8 & 8 & \textbf{\textbf{\textbf{\textbf{10}}}} & 9 & \textbf{\textbf{\textbf{\textbf{10}}}} & 12 & 8 & \textbf{\textbf{\textbf{\textbf{10}}}} & 12 & \textbf{\textbf{\textbf{\textbf{10}}}} & 12 & 12 \\
\hline
Enox + Ni & 13 & 18 & \textbf{\textbf{\textbf{\textbf{20}}}} & 11 & 17 & 22 & \textbf{\textbf{\textbf{\textbf{10}}}} & 12 & 22 & 14 & 1\textbf{\textbf{\textbf{\textbf{5}}}} & 18 \\
\hline
Enox + Cu & \textbf{\textbf{\textbf{\textbf{10}}}} & 11 & 12 & 8 & 12 & 14 & 11 & 13 & 13 & 14 & 16 & 18 \\
\hline
\end{tabular}
\end{table} | PMC2719789_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Sample}} & \multirow{2}{*}{\textbf{Escherichia coli Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Klebsiella pneumonia Conc. (mg/disc)}} & \multirow{2}{*}{\textbf{Proteus mirabilis Conc. (mg/disc)}} \\
\hline
\\
\hline
& \textbf{\textbf{\textbf{5}}} & \textbf{\textbf{\textbf{10}}} & \textbf{\textbf{\textbf{20}}} & \textbf{\textbf{\textbf{5}}} & \textbf{\textbf{\textbf{10}}} & \textbf{\textbf{\textbf{20}}} & \textbf{\textbf{\textbf{5}}} & \textbf{\textbf{\textbf{10}}} & \textbf{\textbf{\textbf{20}}} \\
\hline
Enoxacin & 12 & 1\textbf{\textbf{\textbf{5}}} & 19 & 9 & 12 & 13 & \textbf{\textbf{\textbf{10}}} & 13 & 14 \\
\hline
Enox +Mn & 12 & 13 & 14 & 11 & 11 & 12 & \textbf{\textbf{\textbf{10}}} & 11 & 13 \\
\hline
Enox + Fe & \textbf{\textbf{\textbf{10}}} & 11 & 12 & 9 & 11 & 11 & 11 & 13 & 12 \\
\hline
Enox + Ni & 14 & 16 & 2\textbf{\textbf{\textbf{5}}} & 11 & 14 & 18 & \textbf{\textbf{\textbf{10}}} & 12 & \textbf{\textbf{\textbf{20}}} \\
\hline
Enox + Cu & \textbf{\textbf{\textbf{10}}} & 12 & 12 & \textbf{\textbf{\textbf{10}}} & 11 & 13 & 11 & 13 & 13 \\
\hline
\end{tabular}
\end{table} | PMC2719789_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Age} & \textbf{PMI} & \textbf{Cause of death} & \textbf{DSM-IV (six months diagnosis)} & \textbf{Toxicology screening} \\
\hline
C & 51 & 15 & Motor vehicle accident & Alcohol dependence & Alcohol \\
\hline
C & 31 & 24 & Cardiac arrest & Alcohol dependence \\
\hline
C & 19 & 32 & Motor vehicle accident \\
\hline
C & 47 & 12 & Cardiac arrest & Alcohol abuse \\
\hline
C & 30 & 30 & Cardiac arrest \\
\hline
C & 28 & 27 & Motor vehicle accident \\
\hline
C & 41 & 24 & Myocardial Infarction \\
\hline
C & 31 & 29.5 & Motor vehicle accident \\
\hline
C & 46 & 19.5 & Myocardial Infarction \\
\hline
C & 21 & 24 & Cardiac arrest \\
\hline
C & 27 & 20.5 & Cardiac arrest \\
\hline
C & 32 & 26.5 & Cardiac arrest & Cannabis abuse \\
\hline
C & 55 & 24 & Motor vehicle accident \\
\hline
S & 38 & 23 & Hanging & Alcohol dependence, cocaine dependence & Alcohol \\
\hline
S & 21 & 21 & Asphyxiation & OCD, Alcohol dependence & Alcohol \\
\hline
S & 31 & 32.5 & Hanging \\
\hline
S & 29 & 26.5 & Hanging \\
\hline
S & 33 & 18 & Hanging \\
\hline
S & 26 & 69 & Hanging \\
\hline
S & 30 & 27 & Stabbing & Paranoid schizophrenia \\
\hline
S & 36 & 25 & Hanging \\
\hline
S & 51 & 21 & Self inflicted gun shot & Alcohol dependence \\
\hline
S & 42 & 27 & Carbon monoxide \\
\hline
SMD & 28 & 20 & Hanging & MDD, alcohol dependence & Alcohol \\
\hline
SMD & 22 & 11.5 & Hanging & MDD, alcohol dependence & Alcohol, cocaine \\
\hline
SMD & 53 & 14 & Carbon monoxide & MDD \\
\hline
SMD & 26 & 34 & Hanging & MDD & Cocaine \\
\hline
SMD & 40 & 23 & Hanging & MDD, alcohol dependence \\
\hline
SMD & 19 & 29.5 & Hanging & MDD \\
\hline
SMD & 53 & 29 & Hanging & MDD, alcohol dependence \\
\hline
SMD & 42 & 21 & Drowning & MDD & SSRI \\
\hline
SMD & 45 & 20.5 & Self inflicted gun shot & MDD, pathological gambling \\
\hline
SMD & 35 & 31 & Hanging & MDD, alcohol dependence \\
\hline
SMD & 39 & 25.5 & Hanging & MDD \\
\hline
SMD & 49 & 32 & Hanging & MDD, alcohol abuse \\
\hline
SMD & 40 & 22 & Hanging & MDD \\
\hline
SMD & 53 & 33.5 & Hanging & MDD \\
\hline
SMD & 18 & 27 & Carbon monoxide & MDD \\
\hline
SMD & 22 & 20 & Hanging & MDD \\
\hline
\end{tabular}
\end{table} | PMC2719799_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Brain Region} & \textbf{Genes analyzed} & \textbf{Genes significant} & \textbf{\textbf{C-S}MD} & \textbf{C-S} & \textbf{SMD-S} \\
\hline
BA4 (C = 6; S = 5; SMD = 8) & 14632 & 202 & 128 (66 up; 62 down) & 55 (28 up; 27 down) & 62 (35 up; 27 down) \\
\hline
BA6 (C = 7; S = 6; SMD = 13) & 15266 & 286 & 216 (105 up; 111 down) & 76 (31 up; 45 down) & 46 (20 up; 26 down) \\
\hline
BA8,9 (C = 6; S = 5; SMD = 9) & 14854 & 589 & 73 (33 up; 40 down) & 302 (71 up; 231 down) & 411 (147 up; 264 down) \\
\hline
BA10 (C = 6; S = 6; SMD = 7) & 11935 & 636 & 604 (436 up; 168 down) & 41 (30 up; 11 down) & 69 (31 up; 38 down) \\
\hline
BA11 (C = 6; S = 5; SMD = 9) & 14410 & 152 & 85 (19 up; 66 down) & 33 (11 up; 22 down) & 77 (50 up; 27 down) \\
\hline
BA20 (C = 5; S = 5; SMD = 6) & 13944 & 255 & 77 (36 up; 41 down) & 68 (21 up; 47 down) & 173 (50 up; 123 down) \\
\hline
BA21 (C = 9; S = 6; SMD = 5) & 14129 & 204 & 161 (42 up; 119 down) & 20 (8 up; 12 down) & 64 (37 up; 27 down) \\
\hline
BA38 (C = 7; S = 5; SMD = 6) & 14395 & 182 & 65 (37 up; 28 down) & 102 (58 up; 44 down) & 64 (16 up; 48 down) \\
\hline
BA24 (C = 7; S = 5; SMD = 9) & 15243 & 84 & 52 (27 up; 25 down) & 20 (5 up; 15 down) & 27 (15 up; 12 down) \\
\hline
BA29 (C = 8; S = 7; SMD = 10) & 15032 & 83 & 19 (7 up; 12 down) & 40 (13 up; 27 down) & 40 (24 up; 16 down) \\
\hline
Amy (C = 8; S = 6; SMD = 14) & 15007 & 153 & 95 (56 up; 39 down) & 47 (22 up; 25 down) & 35 (25 up; 10 down) \\
\hline
Hippo (C = 6; S = 6; SMD = 10) & 14495 & 426 & 34 (16 up; 18 down) & 118 (60 up; 58 down) & 359 (196 up; 163 down) \\
\hline
NAcc (C = 6; S = 6; SMD = 10) & 15232 & 140 & 22 (8 up; 14 down) & 60 (10 up; 50 down) & 91 (11 up; 80 down) \\
\hline
BA44 (C = 12; S = 6; SMD = 13) & 15788 & 140 & 88 (32 up; 56 down) & 24 (15 up; 9 down) & 48 (30 up; 18 down) \\
\hline
BA45 (C = 11; S = 6; SMD = 12) & 15886 & 101 & 60 (13 up; 47 down) & 21 (8 up; 13 down) & 27 (17 up; 10 down) \\
\hline
BA46 (C = 7; S = 7; SMD = 12) & 15655 & 622 & 140 (37 up; 103 down) & 192 (148 up; 44 down) & 470 (373 up; 97 down) \\
\hline
BA47 (C = 9; S = 7; SMD = 12) & 15303 & 163 & 102 (48 up; 54 down) & 29 (13 up; 16 down) & 51 (29 up; 22 down) \\
\hline
Total & 251206 & 4472 \\
\hline
\end{tabular}
\end{table} | PMC2719799_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Category} & \textbf{Term} & \textbf{Count} & \textbf{\%} & \textbf{P-value} \\
\hline
Biological Process & signal transduction & 237 & 41.73\textbf{\%} & 2.57E-37 \\
\hline
Biological Process & intracellular signaling cascade & 138 & 24.30\textbf{\%} & 2.80E-42 \\
\hline
Biological Process & cell organization and biogenesis & 132 & 23.24\textbf{\%} & 1.38E-24 \\
\hline
Biological Process & protein localization & 79 & 13.91\textbf{\%} & 2.03E-25 \\
\hline
Biological Process & protein transport & 77 & 13.56\textbf{\%} & 8.29E-26 \\
\hline
Biological Process & establishment of protein localization & 77 & 13.56\textbf{\%} & 6.87E-25 \\
\hline
Biological Process & transmission of nerve impulse & 61 & 10.98\textbf{\%} & 6.73E-25 \\
\hline
Biological Process & small GTPase mediated signal transduction & 59 & 10.39\textbf{\%} & 1.54E-29 \\
\hline
Biological Process & synaptic transmission & 57 & 10.03\textbf{\%} & 2.50E-22 \\
\hline
Biological Process & vesicle-mediated transport & 55 & 9.68\textbf{\%} & 3.12E-20 \\
\hline
\end{tabular}
\end{table} | PMC2719799_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{4}{c|}{\textbf{SemiQ RT-\textbf{\textbf{P}}CR (Mean)}} & \multicolumn{4}{c|}{\textbf{Affymetrix (Mean)}} \\
\hline
\textbf{Gene} & \textbf{Region} & \textbf{\textbf{Control}} & \textbf{\textbf{Suicide}} & \textbf{\textbf{SMD}} & \textbf{\textbf{P}} & \textbf{\textbf{Control}} & \textbf{\textbf{Suicide}} & \textbf{\textbf{SMD}} & \textbf{\textbf{P}} \\
\hline
GABARA\textbf{\textbf{P}}L1 & BA46 & 135.35 & 102.88 & 171.73 & 0.13 & 197.566 & 181.244 & 261.768 & 0.002 \\
\hline
GABARD & BA45 & 70.96 & 49.53 & 69.86 & 0.04 & 265.784 & 190.645 & 273.365 & 0.002 \\
\hline
GABARD & BA46 & 196.79 & 92.43 & 109.35 & 0.04 & 405.741 & 300.856 & 443.493 & 0.003 \\
\hline
GABARG1 & BA21 & 64.17 & 85.35 & 61.89 & 0.13 & 262.739 & 215.787 & 170.116 & 0.002 \\
\hline
GABARG1 & BA46 & 35.92 & 46.04 & 31.30 & 0.02 & 120.571 & 174.447 & 107.812 & 0.000 \\
\hline
GABRG2 & BA46 & 52.95 & 36.15 & 48.91 & 0.04 & 416.956 & 267.694 & 418.698 & 0.007 \\
\hline
GABRR1 & BA44 & 195.05 & 376.23 & 138.60 & 0.01 & 23.6967 & 35.345 & 19.1808 & 0.007 \\
\hline
GLS & BA46 & 56.56 & 48.36 & 56.43 & 0.12 & 231.561 & 163.459 & 243.658 & 0.002 \\
\hline
GLUL & Amy & 93.46 & 76.52 & 68.49 & 0.02 & 789.678 & 438.535 & 422.579 & 0.002 \\
\hline
GLUL & BA21 & 131.67 & 118.04 & 107.04 & 0.08 & 463.524 & 442.932 & 265.696 & 0.002 \\
\hline
GLUL & BA45 & 142.64 & 128.99 & 108.66 & 0.02 & 338.71 & 307.803 & 197.303 & 0.002 \\
\hline
GLUL & BA46 & 128.30 & 184.69 & 87.91 & 0.01 & 251.503 & 361.113 & 190.146 & 0.001 \\
\hline
GRIA1 & BA21 & 71.30 & 67.63 & 142.03 & 0.04 & 118.831 & 150.885 & 180.902 & 0.004 \\
\hline
GRIA3 & BA46 & 82.77 & 48.63 & 51.32 & 0.05 & 132.681 & 93.5443 & 100.471 & 0.006 \\
\hline
GRM3 & BA46 & 70.75 & 52.57 & 38.63 & 0.02 & 286.41 & 281.21 & 241.308 & 0.004 \\
\hline
SLC6A1 & BA4 & 150.61 & 156.09 & 140.69 & 0.58 & 648.13 & 648.05 & 478.61 & 0.002 \\
\hline
\end{tabular}
\end{table} | PMC2719799_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene symbol} & \textbf{Gene name} & \textbf{FC microarray} & \textbf{qRT-PCR} & \textbf{DChip criteria} \\
\hline
Insulin Signaling \\
\hline
GAB1 & GRB2-associated binding protein 1 & 1.25 & Yes \\
\hline
PIK3CA & Phosphoinositide-3-kinase, catalytic, alpha & 1.21 & Yes \\
\hline
PIK3CB & Phosphoinositide-3-kinase, catalytic, beta & 1.25 \\
\hline
PIK3R3 & Phosphoinositide-3-kinase, regulatory subunit 1 & 21.22 \\
\hline
PIK3C3 & Phosphoinositide-3-kinase, class 3 & 1.21 \\
\hline
TBC1D4 & TBC1 domain family, member 4 & 1.24 \\
\hline
SORBS1 & Sorbin and SH3 domain containing 1 & 1.27 \\
\hline
RHOQ & Ras homolog gene family, member Q & 1.27 \\
\hline
SLC2A4 & Solute carrier family 2 member 4 (GLUT4) & 21.04 & Yes \\
\hline
FOXO3A & Forkhead box O3 & 1.22 & Yes \\
\hline
RPS6KB1 & Ribosomal protein S6 kinase, 70kDa, polypept. 1 & 1.30 \\
\hline
SOS2 & Son of sevenless homolog 2 & 1.25 \\
\hline
MAPK8 & Mitogen-activated protein kinase 8 & 1.23 \\
\hline
MAP3K2 & Mitogen-activated protein kinase kinase kinase 2 & 1.23 \\
\hline
MAP3K7 & Mitogen-activated protein kinase kinase kinase 7 & 1.21 \\
\hline
MAP4K3 & Mitogen-act protein kinase kinase kinase kinase 3 & 1.24 \\
\hline
RPS6KA3 & Ribosomal protein S6 kinase, 90kDa, polypeptide 3 & 1.21 \\
\hline
\multicolumn{2}{c|}{Modulators of Insulin Action} \\
\hline
PTPN11 & Protein tyrosine phosphatase, non-R type 11 & 1.23 \\
\hline
MAPK8 & Mitogen-activated protein kinase 8 & 1.23 \\
\hline
PRKAA2 & Protein kinase, AMP-act., alpha 2 catalytic subunit & 1.22 \\
\hline
Metabolic Regulation \\
\hline
HK2 & Hexokinase 2 & 21.42 & Yes \\
\hline
LDHB & Lactate dehydrogenase B & 21.62 & Yes & Yes \\
\hline
LPL & Lipoprotein lipase & 21.31 & Yes \\
\hline
Mitochondrial Function \\
\hline
PGC1a & PPARc coactivator 1a & 1.05 & Yes \\
\hline
PGC1b & PPARc coactivator 1b & 21.18 & Yes \\
\hline
HK2 & Hekokinase 2 & 21.42 & Yes \\
\hline
Collagens \\
\hline
COL1A1 & Collagen, type I, alpha 1 & 21.57 & Yes & Yes \\
\hline
COL3A1 & Collagen, type III, alpha 1 & 21.53 & Yes & yes \\
\hline
Miscellaneous \\
\hline
TCF7L2 & Transcription factor 7-like 2 & 21.15 & Yes \\
\hline
KIF1B & Kinesin family member 1B & 1.51 & Yes & Yes \\
\hline
GDF8 & Growth differentiation factor 8 & 1.76 & Yes & Yes \\
\hline
PDLIM5 & PDZ and LIM domain 5 & 1.63 & Yes & yes \\
\hline
TncRNA & Trophoblast-derived noncoding RNA & 1.67 & & Yes \\
\hline
GOLGA8A & Golgi autoantigen, golgin subfamily a, 8A & 1.57 & & Yes \\
\hline
ARID5B & AT rich interactive domain 5B & 1.43 & & Yes \\
\hline
LONRF2 & LON peptidase NT domain & ring finger 2 & 1.46 & & Yes \\
\hline
\end{tabular}
\end{table} | PMC2719801_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Pathway/function} & \textbf{Z-score} & \textbf{Permuted p-value} & \textbf{Adjusted p-value} \\
\hline
First degree relatives \\
\hline
Insulin signaling & 7.06 & ,0.001 & 0.005 & Upregulated \\
\hline
TGF-b signaling & 6.25 & ,0.001 & 0.068 & Upregulated \\
\hline
RNA splicing & 5.76 & ,0.001 & 0.089 & Upregulated \\
\hline
Focal adhesion & 6.52 & ,0.001 & 0.140 & Downregulated \\
\hline
Inorganic anion transport & 4.18 & 0.002 & 0.740 & Downregulated \\
\hline
Inflammatory response pathway & 5.59 & 0.003 & 0.326 & Downregulated \\
\hline
People with type 2 diabetes \\
\hline
Apoptosis & 4.31 & ,0.001 & 0.388 & Upregulated \\
\hline
Protein modification & 2.88 & 0.005 & 0.979 & Upregulated \\
\hline
Cell cycle G1 to S control reactome & 3.47 & 0.006 & 0.676 & Upregulated \\
\hline
Insulin signaling & 6.17 & ,0.001 & 0.002 & Downregulated \\
\hline
MAPK signaling & 5.78 & ,0.001 & 0.002 & Downregulated \\
\hline
G-protein signaling & 4.53 & ,0.001 & 0.078 & Downregulated \\
\hline
\end{tabular}
\end{table} | PMC2719801_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Total Cells Counted} & \textbf{# Actin Polymerized} & \textbf{\% Actin Polymerized} \\
\hline
WT & 443 & 402 & 90.7\% \\
\hline
VavNULL & 427 & 51 & 11.9\% \\
\hline
Vav1WT & 434 & 330 & 76.0\% \\
\hline
Vav1GEF2 & 400 & 324 & 81.0\% \\
\hline
\end{tabular}
\end{table} | PMC2719804_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Total Cells Counted} & \textbf{# MTOC Polarized} & \textbf{\% MTOC Polarized} \\
\hline
WT & 197 & 167 & 84.7\% \\
\hline
VavNULL & 195 & 77 & 39.5\% \\
\hline
Vav1WT & 152 & 115 & 75.7\% \\
\hline
Vav1GEF2 & 165 & 134 & 81.2\% \\
\hline
\end{tabular}
\end{table} | PMC2719804_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Drug Dose} & \textbf{Mean (Days)} & \textbf{Standard Error} \\
\hline
Lithium \\
\hline
10 & 11.1 & 0.12 \\
\hline
1 & 14.6 & 0.15 \\
\hline
0.1 & 15.2 & 0.11 \\
\hline
Control & 13.4 & 0.31 \\
\hline
Valproic Acid \\
\hline
10 & 8.2 & 0.06 \\
\hline
1 & 11.3 & 0.15 \\
\hline
0.1 & 10.2 & 0.15 \\
\hline
Control & 12.4 & 0.15 \\
\hline
Theobromine \\
\hline
10 & 10.6 & 0.14 \\
\hline
1 & 12.1 & 0.44 \\
\hline
0.1 & 11.4 & 0.2 \\
\hline
Control & 12.2 & 0.38 \\
\hline
Caffeine \\
\hline
10 & 11.1 & 0.39 \\
\hline
1 & 12.2 & 0.88 \\
\hline
0.1 & 17.9 & 0.78 \\
\hline
Control & 12.2 & 0.38 \\
\hline
\end{tabular}
\end{table} | PMC2719805_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Supplement} & \textbf{Dose} & \multicolumn{2}{c|}{\textbf{Fraction mated to control}} & \multicolumn{2}{c|}{\textbf{p-value for significance tests}} \\
\hline
& & \textbf{early} & \textbf{late} & \textbf{dose} & \textbf{dosage} \\
\hline
\multirow{3}{*}{Caffeine} & 10 & 0.78 & 1 & ,0.00001 & ,0.00001 \\
\hline
1 & 0.75 & 0.97 & ,0.00001 & 0.00001 \\
\hline
0.1 & 0.68 & 0.86 & ,0.00001 & 0.006 \\
\hline
\multirow{3}{*}{Valproic acid} & 10 & 0.75 & 1 & ,0.00001 & ,0.00001 \\
\hline
1 & 0.73 & 1 & ,0.00001 & ,0.00001 \\
\hline
0.1 & 0.7 & 1 & ,0.00001 & ,0.00001 \\
\hline
\multirow{3}{*}{Lithium} & 10 & 0.97 & 1 & ,0.00001 & 0.11 \\
\hline
1 & 0.88 & 0.97 & ,0.00001 & 0.039 \\
\hline
0.1 & 0.82 & 0.98 & ,0.00001 & 0.0005 \\
\hline
\multirow{3}{*}{Theobromine} & 10 & 0.68 & 0.76 & ,0.00001 & 0.38 \\
\hline
1 & 0.59 & 0.54 & 0.01 & 0.71 \\
\hline
0.1 & 0.51 & 0.43 & 0.56 & 0.42 \\
\hline
\end{tabular}
\end{table} | PMC2719805_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Variables} & \textbf{National Average and Range (Lowest and Highest Values)} \\
\hline
Education index (2002) [44] & 0.82 (state range 0.74–0.90) \\
\hline
Income index (2002) [44] & 0.74 (state range 0.59–0.90) \\
\hline
Human development index (2004) [45] & 0.81 (state range 0.71–0.88) (municipal range 0.38–0.91) \\
\hline
Households with access to water (2005) [3] & 94.5\% (state range 85.2–98.4) \\
\hline
Life expectancy (2005) [22] & 73 y old for men, 77.9 y old for women (There is a 10-y difference in life expectancy between the poorest and richest groups.) \\
\hline
Infant mortality rate (2004) [45] & 19.7 per 1,000 live births (state range 14.4–26.3) \\
\hline
Maternal mortality rate (2005) [22] & 63.4 per 100,000 live births (state range 9.6–126.7) \\
\hline
Mortality due to infectious diseases (preventable and avoidable if there is timely access to health care) [3] & In poor communities, 25\% of deaths for children ,5 y of age are due to infectious diseases; in affluent communities, the corresponding figure is 5\%. \\
\hline
Health resources \\
\hline
Per capita expenditure 2005 [22] & US$498 per capita (state range 316–1,103) \\
\hline
Private health care expenditures 2005 (95\% out of pocket) [22] & 54\% of health expenditure is private (state range 28.5\%–76.5\%). In 2003 [41] health expenditures represented 8.5\% of income for lowest income decile and 2.6\% for the highest income decile \\
\hline
Public health expenditure as percent of GDP (2006) [3] & 2.9\% of GDP (state range 2–8.2\%) \\
\hline
Physicians per 1,000 population (2005) [22] & 1.9 (state range: 1–4) \\
\hline
Beds per 1,000 population (2005) [22] & 1.1 (state range: 0.6–2.5) \\
\hline
Nurses per 1,000 population (2005) [22] & 2.2 (state range: 1.3–4.6) \\
\hline
\end{tabular}
\end{table} | PMC2719806_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Functions} & \textbf{Public Social Security Schemes for Formal Sector Workers and Families} & \textbf{Uninsured} & \textbf{Affluent} \\
\hline
\multirow{4}{*}{Responsibility for services and typical coverage of total population (percent varies each year according to employment conditions)} & IMSS for private formal sector employees 40\% & MoH 46\% & Private insurers 3\% \\
\hline
ISSSTE for government employees 9\% \\
\hline
SEDENA & SESMAR for armed forces 2\% \\
\hline
Petro´leos Mexicanos (PEMEX) for oil workers less than 0.5\% \\
\hline
Financing & Social Security schemes were financed from three sources: the employer, the government, and the employee. The proportions paid by each source were different for each scheme. & Government (mainly federal with some state contributions) & Private funds \\
\hline
\multirow{2}{*}{Health care providers} & A network of clinics and hospitals staffed and operated by the different schemes & A network of clinics and hospitals staffed and operated by the MoH. Some states and municipalities had developed their own network. & Private network \\
\hline
& The IMSS-COPLAMAR program, which was financed by the MoH and operated by the IMSS, provided health care mainly in rural areas. \\
\hline
Access to services & Free at point of service (including medications) & Free at point of service (including medicines for priority programs) & Varied \\
\hline
Per capita expenditure & Large variations depending on the type of scheme & Varied by state & Varied \\
\hline
\end{tabular}
\end{table} | PMC2719806_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Responsibility for Services} & \textbf{State Health System} \\
\hline
Financing & Federal government, state governments, and user fees. States committed to increase their allocations to health, \\
\hline
Health care providers & A network of state health services: all public facilities to be managed by the state health secretariats (including IMSS-COPLAMAR). Federal health employees refused to become state employees because salaries and fringe benefits tended to be lower. Labor unions refused to accept the decentralization. All state health workers were given the opportunity of becoming federal employees. Ironically, most workers at the state health secretariats are now federal employees \\
\hline
Access to services & User fees for services and medicines. Medicines for priority programs were free. \\
\hline
Per capita expenditure & Varied by state \\
\hline
Devolution of decision-making power & Minimal: programs continued to be designed by MoH; states had very little control over financial resources (except for user fees). Personnel appointments continued to be made by MoH \\
\hline
\end{tabular}
\end{table} | PMC2719806_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Responsibility for Services} & \textbf{State Health System} \\
\hline
Financing & Federal government, state governments, and user fees \\
\hline
Health care providers & A network of state health services: all public facilities to be managed by the state health secretary. The majority of state employees became federal employees, states gained some control over human resources, programs, and finances \\
\hline
Access to services & User fees for services and medicines. Medicines for priority programs were free. Attending physicians often waived fees for the indigent. \\
\hline
Per capita expenditure & Varied by state \\
\hline
\multirow{3}{*}{Devolution of decision-making power} & States obtained some control of personnel. In coordination with the state branch of the worker’s union, they could transfer and fire personnel, and recommend new federal hires. \\
\hline
MoH transferred ownership of physical infrastructure to the states. \\
\hline
The states were allowed ample discretionary power to spend federal transferred funds, except the funds allocated to human resources, although they were able to use the unspent personnel funds (due to absenteeism, leaves of absences) at their discretion. \\
\hline
\end{tabular}
\end{table} | PMC2719806_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Functions} & \textbf{Uninsured Not \textbf{Affiliated to SP} (Remains Basically Unchanged)} & \textbf{Affiliated to SP} \\
\hline
Responsibility for services & State health system & State Health System. The System for Social Protection for Health (SSPH), also referred to as SP, decides the services to be provided to the insured, and the protocols to be followed \\
\hline
\multirow{2}{*}{Financing} & Federal government, state governments, and user fees & The financing formula is very complicated. The MoH and the states make a fixed per family contribution. Enrolled families contribute to the system based on a sliding-fee scale. The federal government allocates extra funds to the most marginalized states. \\
\hline
& Family premiums are waived for families in the lowest two income deciles and for those in the third lowest income decile with a child under 5 y. \\
\hline
\multirow{2}{*}{Health care providers} & A network of state health services: all public facilities to be managed by the state health secretary. & States can decide, usually a network of private and public facilities and providers. \\
\hline
The majority of state employees are federal employees; states have some control over human resources, programs, and finances & Often the state is unable to provide mandatory package of services and there is a need to contract with the private sector. \\
\hline
\multirow{2}{*}{Access to services} & User fees for services and medicines. & Free at point of services (includes 312 medicines) \\
\hline
Medicines for priority programs were free. Attending physicians often waived fees for the indigent. \\
\hline
Per capita expenditure & Varied by state & Varies by state, but it is higher than for people unincorporated to SP who remain uninsured. \\
\hline
\end{tabular}
\end{table} | PMC2719806_table_4 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{Category} & \textbf{Type} & \textbf{Character Variation} \\
\hline
Gall hairiness & Morphology & Binary & Galls either have a smooth or hairy (defensive) surface. Labile. \\
\hline
Gall spininess & Morphology & Binary & Galls are either spineless or covered with spines (defensive). Labile. \\
\hline
Gall toughness & Morphology & Categorical & Four levels, increasing in toughness from 1 to 4. High toughness is defensive. Labile. \\
\hline
Gall stickiness & Morphology & Binary & Galls are either coated with sticky resin (defensive) or not. Labile. \\
\hline
Gall internal airspace & Morphology & Binary & Galls are either solid or have an internal airspace surrounding the larval chamber (defensive). Labile. \\
\hline
Host gall size & Morphology & Continuous & The volume of each mature gall type, with gall inducer larval chamber subtracted. \\
\hline
Host resource size & Resource availability & Continuous & The volume of each fully developed host gallwasp larva. \\
\hline
Gall locularity & Resource availability & Binary & Galls either contain a single host gallwasp larva, or .1. Labile. \\
\hline
Mean number of hosts/gall & Resource availability & Continuous & Mean number of parasitoids emerging from galls producing at least one parasitoid. \\
\hline
Organ galled & Spatiotemporal niche & Categorical & Gall location on the oak host, either shoot bud, dormant bud on the trunk (lenticel), acorn, leaf, catkin, or shoot. Labile. \\
\hline
Oak section & Spatiotemporal niche & Binary & Galls develop either on oaks in the section Cerris (Q. cerris) or in the section Quercus (Q. petraea, Q. robur)a. pubescens, and Q. Labile. \\
\hline
Season of development & Spatiotemporal niche & Continuous & The week, starting at April 1st, that the gall was first observed to start development. \\
\hline
Persistence & Spatiotemporal niche & Continuous & The mean duration of gall development, in weeks. \\
\hline
Sample size & Sampling effort & Continuous & Total number of parasitoids emerging from galls of a given type. \\
\hline
\end{tabular}
\end{table} | PMC2719808_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gall trait} & \textbf{Asexual} & \textbf{Sexual} \\
\hline
Gall morphology \\
\hline
Hairiness & — & — \\
\hline
Toughness & (+) p,0.05 & — \\
\hline
Spininess & p,0.01 (2) & — \\
\hline
Stickiness & p,0.05 (2) & — \\
\hline
Internal airspace & p,0.01 (2) & — \\
\hline
Gall size & (+) p,0.01 & — \\
\hline
Resource availability \\
\hline
Host resource size & — & (+) p,0.001 \\
\hline
Hosts/gall & — & — \\
\hline
Locularity & — & — \\
\hline
Spatiotemporal niche \\
\hline
Plant organ galled & (+) p,0.001 & — \\
\hline
Oak section & (+) p,0.001 & — \\
\hline
Persistence & — & (+) p,0.001 \\
\hline
Season & — & — \\
\hline
\end{tabular}
\end{table} | PMC2719808_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable} & \multicolumn{2}{c|}{\textbf{Dataset}} \\
\hline
& \textbf{Asexual} & \textbf{Sexual} \\
\hline
Sample size & 1 & — \\
\hline
Relatedness (alone) & ***4 & * \\
\hline
Relatedness in MAM & 1 & — \\
\hline
Gall morphology \\
\hline
Hairiness & *2 & — \\
\hline
Toughness & — & — \\
\hline
Spininess & *1 & N/A \\
\hline
Stickiness & ** \\
\hline
6Internal airspace & — & N/A \\
\hline
Gall size & *2 & 1 \\
\hline
Resource availability \\
\hline
Host size & 1 & — \\
\hline
Locularity & — & 1 \\
\hline
Hosts/gall & *2 & *1 \\
\hline
Spatiotemporal niche \\
\hline
Plant organ galled & ***2 & * \\
\hline
Oak section & **3 & **1 \\
\hline
Season & *1 & — \\
\hline
Persistence & — & ***1 \\
\hline
\end{tabular}
\end{table} | PMC2719808_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
SNP-43 & G/G & G/A & A/A & P \\
\hline
Calpain-10 expression & 1.0060.18 (16) & 1.3360.22 (11) & 1.2060.37 (4) & 0.32 \\
\hline
secretion1 Basal insulin & 0.03460.0028 (20) & 0.03960.0035 (13) & 0.04460.0056 (5) & 0.066 \\
\hline
GSIS1 & 0.07260.013 (20) & 0.08860.016 (13) & 0.1060.026 (5) & 0.0222 \\
\hline
Glucose SI & 1.9160.25 (20) & 2.2360.31 (13) & 2.4360.49 (5) & 0.042 \\
\hline
Arginine SI & 1.8760.16 (18) & 2.1560.19 (12) & 1.5560.33 (4) & 0.13 \\
\hline
Glibenclamide SI & 2.0460.26 (19) & 2.2660.33 (12) & 1.8360.65 (3) & 0.25 \\
\hline
SNP-44 & T/T & T/C & C/C & P \\
\hline
Calpain-10 expression & 1.1860.14 (26) & 1.0360.32 (5) & 0.42 (1) & 0.582 \\
\hline
secretion1 Basal insulin & 0.03760.002 (30) & 0.03360.005 (6) & 0.0360.009 (2) & 0.452 \\
\hline
GSIS1 & 0.08460.011 (30) & 0.0660.024 (6) & 0.0560.04 (2) & 0.272 \\
\hline
Glucose SI & 2.2160.21 (30) & 1.7160.47 (6) & 1.6760.81 (2) & 0.342 \\
\hline
Arginine SI & 2.0060.14 (25) & 1.5260.28 (6) & 2.1560.48 (2) & 0.09 \\
\hline
Glibenclamide SI & 2.0460.23 (25) & 1.9060.57 (6) & 2.8560.57 (2) & 0.98 \\
\hline
\end{tabular}
\end{table} | PMC2719809_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{\textbf{Gene} Ontology Biological Process at Level 6} & \textbf{Gene} & Uni\textbf{Gene} Accession & Percentage of \textbf{Gene}s & \multicolumn{2}{c|}{\textbf{Z-ratios}} \\
\hline
& & & & \textbf{PA6-DA} & \textbf{MM55K} \\
\hline
\multirow{8}{*}{Neurogenesis} & IDB4 & NM_031166.1 & 5.88 & 3.16 & 2.57 \\
\hline
EFNB1 & NM_010110.2 & & 8.56 & 7.43 \\
\hline
CXCL12 & NM_013655.2 & & 16.27 & 14.34 \\
\hline
TIMP2 & NM_011594.2 & & 3.32 & 1.66 \\
\hline
MYH10 & NM_009382.2 & & 9.62 & 5.18 \\
\hline
THY1 & NM_175260.1 & & 3.15 & 2.90 \\
\hline
RUNX1 & NM_009821.1 & & 4.28 & 4.71 \\
\hline
NOTCH1 & NM_008714.2 & & 3.02 & 3.99 \\
\hline
\multirow{5}{*}{Central nervous system development} & OTX1 & NM_011023.2 & 3.68 & 3.22 & 2.04 \\
\hline
IDB4 & NM_031166.1 & & 3.16 & 2.57 \\
\hline
CXCL12 & NM_013655.2 & & 16.27 & 14.34 \\
\hline
MYH10 & NM_175260.1 & & 3.15 & 2.90 \\
\hline
NOTCH1 & NM_008714.2 & & 3.02 & 3.99 \\
\hline
\multirow{5}{*}{Tissue development} & MGLAP & NM_008597.2 & 3.68 & 9.42 & 1.40 \\
\hline
PTN & NM_008973.1 & & 13.50 & 14.60 \\
\hline
SOX9 & NM_011448 & & 11.62 & 6.33 \\
\hline
OTOR & NM_020595 & & 4.04 & 4.61 \\
\hline
NOTCH1 & NM_008714.2 & & 3.02 & 3.99 \\
\hline
\multirow{4}{*}{Wnt receptor signaling pathway} & SFRP1 & NM_013834.1 & 2.94 & 14.24 & 14.53 \\
\hline
SFRP2 & NM_009144.1 & & 3.16 & 3.09 \\
\hline
FRZB & NM_011356.2 & & 3.44 & 2.56 \\
\hline
PPAP2B & NM_080555.1 & & 3.37 & 7.36 \\
\hline
\multirow{4}{*}{Cellular morphogenesis during differentiation} & EFNB1 & NM_010110.2 & 2.94 & 8.56 & 7.43 \\
\hline
CXCL12 & NM_013655.2 & & 16.23 & 14.34 \\
\hline
THY1 & NM_009382.2 & & 9.62 & 5.18 \\
\hline
NOTCH1 & NM_008714.2 & & 3.02 & 3.99 \\
\hline
\multirow{3}{*}{Neural crest cell differentiation} & EFNB1 & NM_010110.2 & 2.21 & 8.56 & 7.43 \\
\hline
SEMA3F & NM_011349.2 & & 4.66 & 0.40 \\
\hline
SOX9 & NM_011448 & & 11.62 & 6.33 \\
\hline
\multirow{2}{*}{Regulation of cell migration} & CXCL12 & NM_013655.2 & 2.21 & 16.23 & 14.34 \\
\hline
THY1 & NM_009382.2 & & 9.62 & 5.18 \\
\hline
\multirow{2}{*}{Cell fate specification} & SOX9 & NM_011448 & 2.21 & 11.62 & 6.33 \\
\hline
NOTCH1 & NM_008714.2 & & 3.02 & 3.99 \\
\hline
Neural tube development & LTAP & NM_033509.2 & 0.74 & 3.21 & 2.18 \\
\hline
\end{tabular}
\end{table} | PMC2719871_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Genes} & \textbf{UniGene Accession} & \multicolumn{5}{c|}{\textbf{Z-ratios}} \\
\hline
& & \textbf{PA6-DA/PA6-X} & \textbf{PA6-DA/PA6-X}1 & \textbf{PA6-DA/MS5} & \textbf{PA6-DA/MM55K} & \textbf{PA6-DA/MEF} \\
\hline
CXCL12 & NM 013655.2 & 16.27 & 16.92 & 15.08 & 14.34 & 9.96 \\
\hline
EFNB1 & NM 010110.2 & 8.56 & 9.26 & 8.40 & 7.43 & 7.01 \\
\hline
PTN & NM 008973.1 & 13.50 & 14.58 & 12.17 & 14.60 & 5.70 \\
\hline
IGF-II & NM 010514.1 & 13.19 & 13.83 & 11.63 & 13.52 & 3.28 \\
\hline
IGFBP4 & NM 010517.2 & 14.18 & 13.39 & 12.70 & 12.50 & 5.73 \\
\hline
\end{tabular}
\end{table} | PMC2719871_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{H. sapiens} & \textbf{C. elegans} & \textbf{\% conserved} & \textbf{Studied by RNAi} \\
\hline
Total CI subunits & 45 & 38 & 84\% & 28 \\
\hline
mtDNA-encoded & 7 & 7 & 100\% & 0 \\
\hline
\multirow{2}{*}{nDNA-encoded} & 38 & 31 predicted in silico & 82\% & 28 \\
\hline
& (26 confirmed by BNG) \\
\hline
Subcomplex of nDNA subunits \\
\hline
Il & 15 & 14 & 93\% & (+2)* 13 \\
\hline
Ia alone & 8 & 5 & 63\% & 4 \\
\hline
Ia, Ib & 2 & 2 & 100\% & 2 \\
\hline
Ib & 11 & 10 & 91\% & 9 \\
\hline
Ic** & 1 & 0 & 0\% & 0 \\
\hline
undefined*** & 1 & 0 & 0\% & 0 \\
\hline
CI Assembly Factors & 4 & 4 & 100\% & 2 \\
\hline
\end{tabular}
\end{table} | PMC2719872_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Accession number} & \textbf{Protein coded} & \textbf{Forward primer (59–39)} & \textbf{Reverse Primer (59–39)} \\
\hline
GRP78 & M19645 & BiP & CCTGGGTGGCGGAACCTTCGATGTG & CTGGACGGGCTTCATAGTAGACCGG \\
\hline
GADD153 & S40706 & CHOP & GCCTTTCTCCTTTGGGACACTGTCCAGC & CTCGGCGAGTCGCCTCTACTTCCC \\
\hline
HAMP & NM_021175 & Hepcidin & ATGGCACTGAGCTCCCAGAT & TTCTACGTCTTGCAGCACATCC \\
\hline
CEBPA & NM_004364 & C/EBPa & CTAGAGATCTGGCTGTGGGG & TCATAACTCCGGTCCCTCTG \\
\hline
SLC40A1 & NM_014585 & Ferroportin & CCCGGAGACAAGTCCTGAATC & TGGCCCATTGCCACAAAGGAG \\
\hline
FTH1 & AF088851 & Ferritin H & CAGAACTACCACCAGGACTCAGA & TAGCCCGAGGCTTAGCTTTCA \\
\hline
ALB & NM_000477 & Albumin & CAAAAACATGTGTTGCTGATGA & CTTGTTTTGCACAGCAGTCAG \\
\hline
GAPDH & NM_002046 & GADPH & GAAGGTGAAGGTCGGAGTC & GAAGATGGTGATGGGATTTC \\
\hline
\end{tabular}
\end{table} | PMC2719873_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\multicolumn{4}{c|}{\textbf{4-residue \textbf{\textbf{\textbf{Loop}}}s}} & \multicolumn{4}{c|}{\textbf{8-residue \textbf{\textbf{\textbf{Loop}}}s}} & \multicolumn{4}{c|}{\textbf{12-residue \textbf{\textbf{\textbf{Loop}}}s}} \\
\hline
\textbf{\textbf{\textbf{Loop}}} & \textbf{\textbf{\textbf{SOS}}} & \textbf{\textbf{\textbf{CSJD}}} & \textbf{\textbf{\textbf{CCD}}} & \textbf{\textbf{\textbf{Loop}}} & \textbf{\textbf{\textbf{SOS}}} & \textbf{\textbf{\textbf{CSJD}}} & \textbf{\textbf{\textbf{CCD}}} & \textbf{\textbf{\textbf{Loop}}} & \textbf{\textbf{\textbf{SOS}}} & \textbf{\textbf{\textbf{CSJD}}} & \textbf{\textbf{\textbf{CCD}}} \\
\hline
1dvjA_20 & 0.23 & 0.38 & 0.61 & 1cruA_85 & 1.48 & 0.99 & 1.75 & 1cruA_358 & 2.39 & 2.00 & 2.54 \\
\hline
1dysA_47 & 0.16 & 0.37 & 0.68 & 1ctqA_144 & 1.37 & 0.96 & 1.34 & 1ctqA_26 & 2.54 & 1.86 & 2.49 \\
\hline
1eguA_404 & 0.16 & 0.36 & 0.68 & 1d8wA_334 & 1.18 & 0.37 & 1.51 & 1d4oA_88 & 2.44 & 1.60 & 2.33 \\
\hline
1ej0A_74 & 0.16 & 0.21 & 0.34 & 1ds1A_20 & 0.93 & 1.30 & 1.58 & 1d8wA_46 & 2.17 & 2.94 & 4.83 \\
\hline
1i0hA_123 & 0.22 & 0.26 & 0.62 & 1gk8A_122 & 0.96 & 1.29 & 1.68 & 1ds1A_282 & 2.33 & 3.10 & 3.04 \\
\hline
1id0A_405 & 0.33 & 0.72 & 0.67 & 1i0hA_122 & 1.37 & 0.36 & 1.35 & 1dysA_291 & 2.08 & 3.04 & 2.48 \\
\hline
1qnrA_195 & 0.32 & 0.39 & 0.49 & 1ixh_106 & 1.21 & 2.36 & 1.61 & 1eguA_508 & 2.36 & 2.82 & 2.14 \\
\hline
1qopA_44 & 0.13 & 0.61 & 0.63 & 1lam_420 & 0.90 & 0.83 & 1.60 & 1f74A_11 & 2.23 & 1.53 & 2.72 \\
\hline
1tca_95 & 0.15 & 0.28 & 0.39 & 1qopB_14 & 1.24 & 0.69 & 1.85 & 1qlwA_31 & 1.73 & 2.32 & 3.38 \\
\hline
1thfD_121 & 0.11 & 0.36 & 0.50 & 3chbD_51 & 1.23 & 0.96 & 1.66 & 1qopA_178 & 2.21 & 2.18 & 4.57 \\
\hline
Average & 0.20 & 0.40 & 0.56 & Average & 1.19 & 1.01 & 1.59 & Average & 2.25 & 2.34 & 3.05 \\
\hline
\end{tabular}
\end{table} | PMC2719875_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{organ/tissue}} & \multirow{2}{*}{\textbf{silica-NPs (red)(a)}} & \multirow{2}{*}{\textbf{polystyrene-NPs (a) (YG)}} & \multirow{2}{*}{\textbf{polystyrene-NPs (a) (YO, carboxy)}} \\
\hline
\\
\hline
pharynx - lumen & +(b) & + & + \\
\hline
intestine - lumen & + & + & + \\
\hline
intestine - tissue & 2 & + & + \\
\hline
proximal gonad & 2 & + & + \\
\hline
spermatheca & 2 & 2 & + \\
\hline
early embryo/cytoplasm & 2 & 2 & + \\
\hline
\end{tabular}
\end{table} | PMC2719910_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{Septic Subjects (n = 40)} \\
\hline
Age (years) & 56.862.43 \\
\hline
Sex (\% Female) & 35\% \\
\hline
APACHE II & 17.161.04 \\
\hline
SOFA & 6.760.7 \\
\hline
Mechanical Ventilation (\%) & 42.5 \\
\hline
Vasopressors (\%) & 65 \\
\hline
Bactermia (\%) & 37.5 \\
\hline
28 Day Mortality (\%) & 17.5 \\
\hline
\end{tabular}
\end{table} | PMC2719911_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Sample duration} & \textbf{‘No rotation’ condition} & \textbf{‘Rotation’ condition} \\
\hline
100 ms & .50/.13 & .43/.23 \\
\hline
1,000 ms & .59/.12 & .45/.26 \\
\hline
2,000 ms & .63/.10 & .57/.21 \\
\hline
3,000 ms & .76/.09 & .55/.28 \\
\hline
\end{tabular}
\end{table} | PMC2719912_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Stimuli Type} & \textbf{0 colored squares} & \textbf{2 colored squares} & \textbf{4 colored squares} & \textbf{6 colored squares} \\
\hline
\multirow{2}{*}{0 geons} & geons & N/A & N/A & N/A & N/A \\
\hline
colored squares & N/A & .96/.03 & .94/.17 & .89/.28 \\
\hline
\multirow{2}{*}{1 geon} & geons & .97/.13 & .82/.17 & .97/.17 & .80/.17 \\
\hline
colored squares & N/A & .98/.03 & .90/.23 & .77/.45 \\
\hline
\multirow{2}{*}{2 geons} & geons & .93/.21 & .92/.23 & .77/.30 & .83/.12 \\
\hline
colored squares & N/A & .98/.05 & .85/.22 & .92/.30 \\
\hline
\multirow{2}{*}{3 geons} & geons & .83/.13 & .80/.18 & .88/.42 & .75/.20 \\
\hline
colored squares & N/A & .97/.08 & .92/.15 & .85/.28 \\
\hline
\end{tabular}
\end{table} | PMC2719912_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Condition} & \textbf{Hits/FAs} \\
\hline
Task 1: Different viewpoints & .66/.35 \\
\hline
Task 2: Different viewpoints & .51/.38 \\
\hline
Task 1: Same viewpoints & .76/.31 \\
\hline
Task 2: Same viewpoints & .45/.12 \\
\hline
Task 1: Different viewpoints & .77/.38 \\
\hline
Task 2: Same viewpoints & .53/.20 \\
\hline
Task 1: Same viewpoints & .71/.14 \\
\hline
Task 2: Different viewpoints & .56/.30 \\
\hline
\end{tabular}
\end{table} | PMC2719912_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Condition} & \textbf{Hits/FAs} \\
\hline
Task 1: Different basic-level category & .86/.28 \\
\hline
Task 2: Different basic-level category & .63/.06 \\
\hline
Task 1: Same basic-level category & .79/.28 \\
\hline
Task 2: Same basic-level category & .56/.06 \\
\hline
Task 1: Different basic-level category & .90/.31 \\
\hline
Task 2: Same basic-level category & .56/.11 \\
\hline
Task 1: Same basic-level category & .80/.29 \\
\hline
Task 2: Different basic-level category & .66/.08 \\
\hline
\end{tabular}
\end{table} | PMC2719912_table_3 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Cell line} & \textbf{Cell Type} & \textbf{Source/Reference} & \textbf{Karyotype/Notes} \\
\hline
human dermal fibroblast (HDF) & primary neonatal foreskin fibroblasts & ATCC & 46,XY \\
\hline
HT1080 & fibrosarcoma & ATCC & 46,XY/92,XXYY \\
\hline
LT690 & lymphoblastoid & Ref. 15 & 46,XY \\
\hline
t60-12 (somatic cell hybrid 1) & mouse-human hybrid; L cell derived & Ref.42 & contains single human active X chromosomes \\
\hline
Aha-11aB1 (somatic cell hybrid 2) & mouse-human hybrid; L cell derived & Ref. 42 & contains single human active X chromosome \\
\hline
HTM18TC8 & hamster-human hybrid & Refs. 21, 22 & contains single human X chromosome \\
\hline
FA3Wg8-4 & hamster-human hybrid & Refs. 21, 22 & truncated X chromosome from HTM18TC8 line \\
\hline
\end{tabular}
\end{table} | PMC2719913_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Genomic site} & \textbf{primer name} & \textbf{description} & \textbf{length} & \textbf{Position Assembly March 2006} & \textbf{Ta} \\
\hline
ZXDA & BS254/255 & F: 59 TCAATTAAGGTGGGAGGCAG 39 R: TGTGAGGTAATTATGGCAAAGTC 39 & 217 bp & chrX:57949717-57949933 & 59uC \\
\hline
1 (Xp sat jxn) & BS236/237 & F: 59 ATTTTCCCAGCACCATTTTTCAA 39 R: 59 CTGTCAAGATGGTATGGGCTGTGT 39 & 397 bp & chrX:58104524-58104920 & 56uC \\
\hline
2 (HSAT4) & BS392/393 & F: 59 TGTGGTCAGCGAGATGTCTC 39 R: 59 AGTTTCCTGTGTGACCCCAG 39 & 159 bp & chrX:58259011-58259169 & 64uC \\
\hline
3 (HSAT4-c jxn) & BS222/223 & 59 39 59 F: CCAGGCATTCAAGCGGGAGAG R: CGGCGGAAGTTATCGTTGAGAG 39 & 355 bp & chrX:58296350-58296704 & 60uC \\
\hline
4 (c-satellite) & BS160/161 & F: 59 TTC AAC GTA CCC CTG AAA GCC TGG 39 R: 59 CTA TTT TGT CCC AAG CCT GCC 39 & 339 bp & chrX:58329603-58329941 & 58uC \\
\hline
5 (c-ALR jxn) & BS226/227 & 59 39 59 F: AGCCCGAGGAAAATACTGGTGAGG R: GCTGTCTTTCTAGTTTTTGTCGTGGGTTAT 39 & 224 bp & chrX:58335817-58336040 & 62uC \\
\hline
6 (Xp mono-HOR jxn) & BS240/241 & F: 59 AACGCTGCGCTATCAAAGGGAAAGT 39 R: 59 39 GGACATGTGGAGCGCTTTGTGC & 313 bp & chrX:58577182-58577494 & 64uC \\
\hline
7 (a-satellite) & BS13/14 & F: 59 ATAATTTCCCATAACTAAACACA 39 R: 59 TGTGAAGATAAAGGAAAAGGCTT 39 & 535 bp & chrX:61610033-61610567 & 55uC \\
\hline
8 (Xq HOR-mono jxn) & BS258/259 & F: 59 GACCTCAAAGCACTCTAAATACAC 39 R: 59 39 CTTCACATAAAAACTAGACAGACAG & 495 bp & chrX:61642633-61643127 & 61uC \\
\hline
9 (Xq sat jxn) & BS238/239 & F: 59 CCTGCTGAATCAAAACAATGGT 39 R: 59 CAAAGAAGGCTGGGTGAGAAG 39 & 389 bp & chrX:61962313-61962701 & 59uC \\
\hline
jxn+150 10 (Xq kb) & BS260/261 & F: 59 TGCCTCCATGATTCAGTTACCA 39 R: 59 AATCTCCCTCCTCTTACCCTCTA 39 & 475 bp & chrX:62111658-62112132 & 58uC \\
\hline
\end{tabular}
\end{table} | PMC2719913_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{ID}} & \multirow{2}{*}{\textbf{Mission}} & \multirow{2}{*}{\textbf{Role*}} & \multirow{2}{*}{\textbf{Last Name}} & \multirow{2}{*}{\textbf{Mass{ kg}} & \multirow{2}{*}{\textbf{Height{ m}} & \multirow{2}{*}{\textbf{L1 m}} \\
\hline
\\
\hline
1 & 11 & CDR & Armstrong & 76.2 & 1.80 & 0.97 \\
\hline
2 & 11 & LMP & Aldrin & 75.5 & 1.78 & 0.96 \\
\hline
3 & 12 & CDR & Conrad & 66.8 & 1.69 & 0.91 \\
\hline
4 & 12 & LMP & Bean & 66.3 & 1.77 & 0.95 \\
\hline
5 & 14 & CDR & Shepard & 76.4 & 1.80 & 0.97 \\
\hline
6 & 14 & LMP & Mitchell & 80.1 & 1.80 & 0.97 \\
\hline
7 & 15 & CDR & Scott & 79.6 & 1.83 & 0.99 \\
\hline
8 & 15 & LMP & Irwin & 72.0 & 1.73 & 0.93 \\
\hline
9 & 16 & CDR & Young & 77.2 & 1.75 & 0.95 \\
\hline
10 & 16 & LMP & Duke & 71.8 & 1.82 & 0.98 \\
\hline
11 & 17 & CDR & Cernan & 78.2 & 1.83 & 0.99 \\
\hline
12 & 17 & LMP & Schmidt & 73.9 & 1.75 & 0.95 \\
\hline
\end{tabular}
\end{table} | PMC2719915_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Probeset ID} & \textbf{SNP (LCL)} & \textbf{P-value (LCL)} & \textbf{SNP (HOb)} & \textbf{P-value (HOb)} & \textbf{Replicated in HObs?} \\
\hline
Cep192 & 3779862 & rs482360 & 3.71E-19 & rs570505 & 4.22E-03 & No \\
\hline
ZNF83 & 3869658 & rs1012531 & 2.72E-10 & rs1012531 & 5.39E-02 & Yes \\
\hline
C17orf57 & 3724617 & rs3760372 & 5.54E-12 & rs3760372 & 4.29E-01 & No \\
\hline
CAST & 2821249 & rs7724759 & 7.17E-16 & rs13362120 & 4.73E-13 & Yes \\
\hline
CD46 & 2377476 & rs4844390 & 1.06E-14 & rs2761437 & 6.02E-02 & Yes \\
\hline
FLJ10241 & 3863093 & rs1043413 & 9.38E-11 & rs3810174 & 1.15E-03 & Yes \\
\hline
LRAP & 2821389 & rs2255546 & 8.37E-22 & rs2161657 & 8.39E-01 & Yes \\
\hline
POMZP3 & 3057764 & rs2005354 & 3.77E-22 & rs17718122 & 1.70E-10 & No \\
\hline
ULK4 & 2670619 & rs1717020 & 5.99E-11 & rs9852303 & 1.45E-05 & Yes \\
\hline
PARP2 & 3527423 & rs2297616 & 2.81E-37 & rs3093942 & 4.94E-07 & Yes \\
\hline
ATPIF1 & 2327383 & rs2481974 & 4.26E-11 & rs8559 & 1.70E-01 & No \\
\hline
MRPL43 & 3303658 & rs12241232 & 1.24E-11 & rs3740487 & 2.44E-05 & Yes \\
\hline
DKFZp451M2119 & 2588913 & rs10930785 & 1.93E-28 & rs10930785 & 1.56E-09 & Yes \\
\hline
RNH1 & 3358076 & rs11821392 & 4.34E-15 & rs12420868 & 4.88E-01 & Yes \\
\hline
SNX11 & 3725089 & rs7224014 & 4.20E-09 & rs2240122 & 1.47E-01 & No \\
\hline
USMG5 & 3304753 & rs7911488 & 2.66E-24 & rs1163073 & 6.45E-11 & Yes \\
\hline
SEP15 & 2421300 & rs1407131 & 7.57E-13 & rs17452535 & 1.01E-02 & Yes \\
\hline
SLC35B3 & 2941033 & rs3799255 & 2.12E-10 & rs3799255 & 1.30E-02 & Yes \\
\hline
DERP6 & 3708382 & rs2521985 & 2.55E-13 & rs222851 & 6.18E-04 & Yes \\
\hline
ARTS-1 & 2868133 & rs7705827 & 6.09E-19 & rs1862609 & 3.98E-06 & Yes \\
\hline
TAP2 & 2950168 & rs3763355 & 1.98E-13 & rs241448 & 4.48E-01 & No \\
\hline
IRF5 & 3023264 & rs6969930 & 8.27E-22 & rs10239340 & 8.94E-01 & Yes \\
\hline
PPIL2 & 3938301 & rs5999098 & 1.46E-12 & rs5754727 & 1.54E-02 & Yes \\
\hline
PTER & 3236819 & rs1055340 & 5.25E-18 & rs7909832 & 6.24E-13 & No \\
\hline
WARS2 & 2430765 & rs1325933 & 3.53E-08 & rs1325933 & 6.38E-01 & Yes \\
\hline
\end{tabular}
\end{table} | PMC2719916_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{GO CATEGORY} & \textbf{Total Genes} & \textbf{Changed Genes} & \textbf{Enrichmentt} & \textbf{LOG10(p)} \\
\hline
GO:0008283_cell_proliferation & 507 & 58 & 1.47 & 22.86 \\
\hline
GO:0012501_programmed_cell_death & 425 & 67 & 2.03 & 28.15 \\
\hline
GO:0006915_apoptosis & 423 & 67 & 2.04 & 28.24 \\
\hline
GO:0007249_I-kappaB_kinase_NF-kappaB_cascade & 104 & 20 & 2.48 & 23.94 \\
\hline
GO:0045595_regulation_of_cell_differentiation & 64 & 12 & 2.41 & 22.48 \\
\hline
GO:0007259_JAK-STAT_cascade & 31 & 8 & 3.32 & 22.70 \\
\hline
GO:0042509_regulation_of_tyrosine_phosphorylation_of_STAT_protein & 10 & 4 & 5.15 & 22.29 \\
\hline
GO:0042771_DNA_damage_response__signal_transduction_by_p53_class_ mediator_resulting_in_induction_of_apoptosis & 5 & 3 & 7.73 & 22.38 \\
\hline
\end{tabular}
\end{table} | PMC2720376_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{GO CATEGORY} & \textbf{Total Genes} & \textbf{Changed Genes} & \textbf{Enrichmentt} & \textbf{LOG10(p)} \\
\hline
GO:0046907_intracellular_transport & 282 & 53 & 1.56 & 23.32 \\
\hline
GO:0006892_post-Golgi_vesicle-mediated_transport & 14 & 7 & 4.16 & 23.25 \\
\hline
GO:0006099_tricarboxylic_acid_cycle & 7 & 4 & 4.76 & 22.27 \\
\hline
GO:0046356_acetyl-CoA_catabolic_process & 7 & 4 & 4.76 & 22.27 \\
\hline
GO:0009081_branched_chain_family_amino_acid_metabolic_process & 6 & 5 & 6.94 & 23.87 \\
\hline
\end{tabular}
\end{table} | PMC2720376_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene Symbol} & \textbf{Description} & \textbf{RT-PCR Ratio AR ChIP/IgG ChIP} \\
\hline
GSK3B & Glycogen synthase kinase 3 beta & 3.03 \\
\hline
OR9Q1 & Olfactory receptor, family 9, subfamily Q, member 1 & 25.03 \\
\hline
TADA2L & Transcriptional adaptor 2 (ADA2 homolog, yeast)-like & 3.26 \\
\hline
ZNF533 & Zinc finger protein 533 & 3.26 \\
\hline
ARL16 & ADP-ribosylation factor-like 16 & 0.79 \\
\hline
\end{tabular}
\end{table} | PMC2720376_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Toxidrome} & \textbf{Site of Action} & \textbf{Signs and symptoms} \\
\hline
Opioid & opioid receptor & sedation, miosis, decreased bowel sounds, decreased respirations \\
\hline
Anticholinergic & muscurinic acetylcholine receptors & altered mental status, sedation, hallucinations, mydriasis, dry skin, dry mucous membranes, decreased bowel sounds and urinary retention \\
\hline
Sedative-hypnotic & gamma-aminobutyric acid receptors & sedation, normal pupils, decreased respirations \\
\hline
Sympathomimetic & alpha and beta adrenergic receptors & agitation, mydriasis, tachycardia, hypertension, hyperthermia, diaphoresis \\
\hline
Cholinergic & nicotinic and muscurinic acetylcholine receptors & altered mental status, seizures, miosis, lacrimation, diaphoresis, bronchospasm, bronchorrhea, vomiting, diarrhea, bradycardia \\
\hline
Serotonin syndrome & serotonin receptors & altered mental status, tachycardia, hypertension, hyperreflexia, clonus, hyperthermia \\
\hline
\end{tabular}
\end{table} | PMC2720377_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Toxic alcohols} & \textbf{Ethanol} \\
\hline
& Isopropanol \\
\hline
& Methanol \\
\hline
& Ethylene Glycol \\
\hline
\multirow{5}{*}{Drugs/Additives} & Isoniazid \\
\hline
Mannitol \\
\hline
Propylene glycol \\
\hline
Glycerol \\
\hline
Osmotic contrast dyes \\
\hline
\multirow{3}{*}{Other Chemicals} & Ethyl ether \\
\hline
Acetone \\
\hline
Trichloroethane \\
\hline
\end{tabular}
\end{table} | PMC2720377_table_1 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Agent or Clinical Finding} & \textbf{Potential Antidote(s)} \\
\hline
Acetaminophen & N-acetylcysteine \\
\hline
Benzodiazapines & Flumazenil \\
\hline
Beta blockers & Glucagon \\
\hline
Cardiac glycosides & Digoxin immune Fab \\
\hline
Crotalid envenomation & Crotalidae polyvalent immune Fab \\
\hline
Cyanide & Hydroxocobalamin \\
\hline
Ethylene glycol & Fomepizole \\
\hline
Iron & Deferoxamine \\
\hline
Isoniazid & Pyridoxine \\
\hline
Lead & Succimer Dimercaprol Calcium ethylenediamine tetra-acetic acid \\
\hline
Methanol & Fomepizole \\
\hline
Methemoglobinemia & Methylene blue \\
\hline
Monomethylhydrazine Mushrooms & Pyridoxime \\
\hline
Opioids & Naloxone \\
\hline
Organophosphates & Atropine Pralidoxime \\
\hline
Sulfonylureas & Glucose Octreotide \\
\hline
\end{tabular}
\end{table} | PMC2720377_table_2 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Author} & \textbf{Sample} & \multicolumn{4}{c|}{\textbf{Attitude & Knowledge}} \\
\hline
& & \textbf{Scores range} & \textbf{Pre (M, SD)} & \textbf{Post (M, SD)} & \textbf{Statistical sig.} \\
\hline
\multirow{3}{*}{Shahmohamadi, 1991} & Behvarz: \\
\hline
(Experimental) & 0–50 & 22.96 $\pm$ 47.73 & 40.81 $\pm$ 11.08 & t = 11.65* \\
\hline
(Control) & & 24.87 $\pm$ 21.66 & 28.64 $\pm$ 18.9 & p < 0.01 \\
\hline
\multirow{3}{*}{Bolhari, 1995} & Behvarz: \\
\hline
(Experimental) & 0–29 & 17.68 $\pm$ 2.84 & 21.09 $\pm$ 2.37 & t = 5.63* \\
\hline
(Control) & & 16.4 $\pm$ 2.78 & 17.65 $\pm$ 2.03 & p < 0.01 \\
\hline
\multirow{4}{*}{Kadivar, 1997} & Karshenas & 0–20 & 6.2 $\pm$ 2.9 & 12 $\pm$ 5.1 & p < 0.05** \\
\hline
Kardan & 0–20 & 6.2 $\pm$ 2.9 & 12.6 $\pm$ 4.1 \\
\hline
Behvarz & 0–20 & 3.6 $\pm$ 2.7 & 10.8 $\pm$ 3.7 \\
\hline
Behdashtyar & 0–20 & 5.3 $\pm$ 2.4 & 13.6 $\pm$ 3.4 \\
\hline
\end{tabular}
\end{table} | PMC2720378_table_0 |
|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Study} & & \multicolumn{4}{c|}{\textbf{Knowledge}} & \multicolumn{4}{c|}{\textbf{Attitude}} \\
\hline
\textbf{Author} & \textbf{Sample} & \textbf{\textbf{Before M (SD)}} & \textbf{\textbf{After M (SD)}} & \textbf{\textbf{Score Range}} & \textbf{\textbf{Statistical sig.}} & \textbf{\textbf{Before M (SD)}} & \textbf{\textbf{After M (SD)}} & \textbf{\textbf{Score Range}} & \textbf{\textbf{Statistical sig.}} \\
\hline
Motallebi, 1996 & Behvarz & 15.43(5.04) & 32.52(2.84) & 0–38 & t = 30.99 p < 0.01 & 8.39(2.23) & 12.58(1.41) & 0–26 & t = 16 p < 0.01 \\
\hline
\multirow{4}{*}{Davasaz, 2004} & General population \\
\hline
Experimental & 36.36(8.4) & 46.9(4.78) & 0–58 & F = 107.26 & 6.29(5.7) & 14.51(3.36) & 0-22 & F = 56.43 \\
\hline
Control 1* & 32.73(8.85) & 35.96(5.44) & 0–51 & df = 2,270 & 6.36(4.04) & 6.65(3.67) & & df = 2,264 \\
\hline
Control 2* & 32.04(6.68) & 30.94(4.44) & 0–42 & p < 0.0001 & 4.43(3.01) & 5.20(2.79) & & P < 0.0001 \\
\hline
\multirow{3}{*}{Bolhari, 1995} & General population \\
\hline
Experimental & - & - & - & - & 14.33(2.87) & 14.7(3.07) & 0-22 & t = 2.21** p < 0.05 \\
\hline
Control & & & & & 14.44(2.91) & 14(3.04) \\
\hline
\multirow{3}{*}{Shahmohammadi, 1990} & General population \\
\hline
Experimental & - & - & - & - & 18.79(22.27) & 23.12(24.34) & 0–30 & t = 9.44** p < 0.01 \\
\hline
Control & & & & & 18.25(22.75) & 20.18(28.75) \\
\hline
\end{tabular}
\end{table} | PMC2720378_table_1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.