tokens
sequencelengths
2.05k
2.05k
text
stringlengths
1.17k
22.2k
[ 13, 1053, 626, 449, 346, 8262, 13, 359, 574, 247, 2098, 449, 346, 1231, 1472, 6501, 3150, 1024, 449, 346, 4041, 273, 441, 588, 449, 346, 19576, 1476, 346, 40, 5401, 1476, 346, 19576, 1476, 346, 40, 5401, 1476, 346, 2302, 13, 642, 1476, 346, 46, 13183, 1476, 346, 46, 13183, 1476, 346, 1621, 1476, 346, 21305, 352, 1476, 346, 3105, 594, 3809, 449, 346, 401, 2237, 685, 368, 449, 346, 4967, 403, 368, 12835, 342, 479, 865, 346, 1231, 858, 3253, 359, 3078, 1476, 346, 1231, 1472, 253, 760, 4394, 1669, 1476, 346, 42, 2389, 368, 449, 346, 1394, 12835, 3260, 326, 1476, 346, 1466, 434, 816, 320, 3858, 449, 346, 1231, 1472, 1027, 449, 346, 1394, 753, 594, 1476, 346, 42, 858, 3253, 987, 1476, 346, 1394, 12835, 3150, 342, 479, 449, 346, 22903, 342, 479, 1476, 346, 22903, 342, 479, 449, 346, 353, 13183, 13, 12835, 3150, 342, 479, 1476, 346, 49142, 368, 1476, 346, 22903, 342, 479, 1476, 346, 42, 1158, 309, 1833, 8416, 1029, 2143, 806, 449, 346, 40, 5401, 449, 346, 1394, 858, 352, 449, 346, 1394, 9809, 441, 449, 50, 27, 187, 187, 23080, 290, 4972, 11041, 1199, 4067, 275, 13415, 4132, 685, 8462, 22097, 348, 187, 187, 42, 452, 247, 8462, 22097, 348, 1566, 326, 309, 1849, 11516, 281, 13415, 4132, 15, 496, 8462, 22097, 348, 13, 253, 22245, 21624, 4972, 434, 2193, 2491, 281, 247, 2701, 273, 1475, 3279, 18, 15, 23, 13, 533, 253, 11516, 13361, 7645, 16149, 347, 1199, 347, 3279, 2417, 15, 17, 15, 1737, 1537, 320, 8479, 436, 5699, 26210, 32, 380, 9436, 310, 3965, 15246, 27, 187, 36465, 426, 35506, 8586, 64, 34525, 9, 13324, 290, 64, 4528, 13, 295, 64, 68, 10, 187, 2083, 64, 71, 1590, 426, 7684, 15, 3967, 15, 13956, 9, 19286, 64, 7341, 13, 32049, 15, 1590, 559, 38745, 16271, 15, 81, 394, 15, 17447, 3401, 187, 36465, 15, 2799, 64, 3409, 64, 8102, 9, 13473, 348, 15, 2799, 9, 2083, 64, 71, 1590, 13, 3711, 64, 12428, 11787, 8, 68, 14776, 27, 17, 5295, 686, 19411, 13995, 1228, 187, 36465, 15, 19411, 1082, 187, 36465, 15, 15419, 1082, 187, 187, 8428, 64, 249, 426, 30162, 15, 17554, 9, 18, 13, 337, 13, 3349, 13, 3349, 481, 19411, 1082, 187, 1206, 2575, 64, 36465, 64, 7645, 426, 30162, 15, 75, 262, 15, 20668, 9, 36465, 13, 23764, 64, 249, 10, 187, 1206, 2575, 64, 36465, 64, 7645, 15, 15261, 1587, 92, 2000, 36465, 64, 27806, 578, 2026, 7165, 431, 3446, 8124, 9, 7645, 64, 881, 13, 21624, 64, 4528, 13, 295, 64, 68, 1228, 187, 187, 6443, 1686, 64, 36465, 426, 45830, 15, 28985, 9, 1206, 2575, 64, 36465, 64, 7645, 13, 14800, 20879, 291, 15, 6586, 2548, 9, 1590, 30, 1590, 13, 5281, 30, 8428, 64, 249, 15, 15721, 10, 3291, 187, 6443, 1686, 64, 36465, 15, 15261, 1587, 92, 2000, 36465, 578, 2026, 7165, 1686, 7645, 3446, 8124, 9, 7645, 64, 881, 13, 21624, 64, 4528, 13, 295, 64, 68, 1228, 187, 187, 34, 27, 187, 187, 1394, 3164, 403, 970, 1027, 3280, 21539, 323, 8462, 22097, 348, 285, 13415, 13993, 15, 5402, 23764, 64, 249, 8414, 273, 2193, 875, 470, 285, 337, 15, 309, 1053, 626, 923, 253, 17032, 2127, 323, 13415, 13993, 13, 533, 634, 3280, 15115, 403, 3164, 875, 470, 285, 15215, 627, 15, 1422, 476, 4993, 436, 407, 31238, 2460, 638, 21678, 7533, 672, 368, 6455, 253, 8462, 22097, 348, 1566, 281, 13415, 13993, 15, 535, 34, 9414, 48325, 479, 253, 643, 1388, 13, 7514, 670, 690, 273, 253, 2544, 344, 457, 84, 2326, 275, 1569, 10473, 1580, 344, 14373, 1740, 1107, 3622, 347, 247, 9635, 1030, 494, 275, 18531, 15, 3032, 4857, 4620, 2708, 15, 187, 187, 2347, 651, 368, 3794, 281, 253, 7313, 285, 3533, 344, 24543, 32, 187, 187, 24723, 26419, 13, 187, 187, 24881, 309, 452, 1239, 2067, 7774, 5015, 670, 512, 253, 4668, 14, 881, 6500, 285, 1029, 14, 19823, 8914, 326, 1980, 1569, 10473, 310, 2970, 347, 247, 906, 273, 4400, 16311, 15, 187, 187, 10195, 1980, 3513, 5621, 403, 4983, 281, 1007, 1077, 28427, 839, 285, 44386, 2531, 275, 616, 15363, 7286, 13, 9398, 21102, 8484, 342, 611, 1173, 9388, 31942, 1507, 285, 15796, 14, 13565, 44833, 362, 6655, 327, 253, 3345, 273, 616, 6447, 14133, 15, 309, 1014, 3047, 3492, 273, 6251, 9398, 21114, 25965, 387, 247, 6254, 457, 84, 7981, 16, 37, 9571, 32552, 1223, 1907, 33845, 14, 11171, 296, 2122, 1133, 44186, 285, 271, 353, 21, 1499, 1947, 689, 616, 13574, 15, 32415, 13, 253, 13710, 1194, 1007, 556, 4783, 281, 15363, 6251, 327, 21820, 15, 187, 187, 6080, 20036, 13, 1690, 1355, 11393, 20036, 835, 253, 4322, 273, 19227, 310, 1077, 27973, 6296, 13, 403, 2970, 8663, 20470, 13, 4430, 2149, 11570, 15495, 13, 285, 16765, 306, 265, 342, 964, 1235, 14, 1179, 15, 12077, 8914, 3304, 17387, 10709, 39021, 15, 187, 187, 10195, 9841, 14, 73, 1250, 6251, 403, 2137, 362, 1507, 665, 452, 4102, 7407, 11757, 275, 253, 10515, 5791, 285, 778, 452, 3715, 247, 2564, 14, 1178, 2080, 432, 326, 273, 253, 5899, 1980, 6330, 5908, 275, 4766, 3968, 15, 496, 690, 2219, 309, 4709, 597, 1537, 320, 6498, 342, 253, 773, 316, 7147, 731, 668, 38656, 835, 253, 15245, 610, 275, 2087, 310, 2326, 347, 253, 9054, 3185, 273, 347, 253, 952, 597, 403, 6326, 281, 4017, 285, 5752, 15, 187, 187, 1909, 247, 6330, 5908, 309, 1900, 12659, 326, 619, 2628, 369, 281, 4017, 253, 7815, 273, 619, 9635, 13318, 285, 281, 4017, 616, 5079, 3570, 1223, 2509, 594, 15, 1292, 1024, 309, 923, 594, 1199, 6890, 15, 187, 187, 3594, 9581, 13, 253, 1533, 556, 4391, 275, 253, 1390, 9976, 15, 1292, 387, 752, 1127, 310, 253, 1386, 8392, 32, 187, 187, 3404, 752, 1127, 513, 359, 1333, 2217, 4668, 6500, 285, 4668, 36137, 285, 4668, 36231, 32, 187, 187, 3039, 513, 359, 347, 3055, 7815, 9287, 253, 3513, 326, 597, 403, 3513, 6251, 285, 41108, 285, 417, 9647, 32, 187, 187, 3404, 752, 1127, 513, 359, 2028, 776, 10544, 6338, 326, 359, 347, 7815, 513, 417, 971, 281, 1928, 751, 359, 403, 3811, 762, 29731, 1569, 32, 187, 187, 42, 3153, 760, 247, 4289, 6574, 6146, 273, 1457, 20159, 285, 309, 369, 1335, 275, 1569, 10473, 1309, 34473, 13593, 29814, 15, 309, 2427, 281, 1457, 20159, 285, 22461, 2112, 2761, 247, 1770, 846, 253, 37705, 285, 309, 3047, 806, 1133, 253, 29731, 1569, 275, 1659, 285, 253, 5654, 38509, 318, 835, 3513, 2427, 3369, 281, 3369, 557, 28456, 4130, 15, 187, 187, 510, 44386, 1320, 273, 1980, 1569, 10473, 2439, 253, 5674, 25264, 952, 273, 1457, 20159, 846, 13593, 29814, 15, 7088, 13, 8274, 952, 403, 9202, 326, 1735, 673, 352, 588, 320, 731, 1907, 3003, 3027, 11942, 2668, 1977, 15, 2064, 310, 1077, 24851, 5017, 1066, 1060, 275, 253, 3684, 835, 954, 512, 952, 1211, 11942, 15, 187, 187, 510, 1953, 1364, 320, 2546, 27, 6049, 1057, 253, 4400, 2208, 971, 1980, 3513, 281, 320, 13496, 342, 253, 1072, 6500, 347, 253, 4668, 285, 281, 452, 3733, 751, 9647, 32, 187, 187, 6723, 619, 7350, 11420, 390, 717, 309, 285, 1142, 2571, 27662, 7514, 32, 187, 187, 7542, 5314, 13, 187, 187, 36, 296, 15, 7493, 3035, 676, 313, 9795, 2698, 187, 187, 49, 2804, 3928, 13, 5767, 15, 9, 1545, 79, 16524, 187, 50276, 60, 1590, 62, 187, 50276, 9, 1344, 346, 12092, 13, 346, 1416, 31487, 1228, 187, 187, 9, 19572, 82, 544, 1590, 475, 12467, 14, 1282, 14, 8854, 11, 62, 187, 50276, 9, 16684, 313, 72, 3160, 1416, 10689, 187, 23139, 401, 15, 19, 69, 36573, 187, 8998, 5851, 947, 22012, 6392, 1556, 40441, 13, 6043, 14, 16667, 13, 87, 15, 33249, 18746, 273, 3968, 13, 8167, 14, 28107, 15, 187, 2302, 15, 1668, 35488, 15, 187, 11586, 2077, 2111, 273, 9892, 25164, 6817, 15, 187, 22784, 3285, 13, 19213, 15, 187, 187, 23833, 411, 15, 309, 2146, 285, 7252, 330, 15, 3452, 531, 13, 10512, 904, 39492, 13, 18009, 15, 313, 21309, 322, 15, 14040, 5462, 13, 39492, 13, 18009, 904, 327, 253, 4864, 28, 17346, 770, 13, 42890, 708, 308, 35083, 13, 39492, 13, 18009, 904, 273, 5067, 582, 323, 7048, 15, 187, 24080, 418, 15, 659, 522, 10747, 13, 26712, 904, 33646, 15, 273, 8293, 13, 5041, 13, 399, 15, 330, 15, 313, 8732, 378, 15, 8302, 13, 10512, 904, 45500, 39379, 15, 26712, 15, 2588, 904, 8652, 329, 15, 9857, 13, 8359, 6156, 353, 15, 1997, 27674, 13, 26712, 84, 904, 33646, 15, 273, 8293, 13, 5041, 13, 399, 15, 330, 904, 327, 253, 4864, 28, 40879, 411, 15, 28160, 13, 530, 15, 322, 15, 26712, 904, 39492, 13, 18009, 904, 273, 5067, 582, 323, 21113, 15, 187, 8639, 7956, 1843, 37168, 59, 9339, 285, 367, 4625, 44, 13, 6817, 19592, 13, 285, 308, 8506, 45, 1372, 2992, 4412, 6798, 15, 187, 4339, 1843, 37168, 59, 9339, 13, 6817, 6798, 15, 535, 187, 18, 187, 4678, 11215, 12304, 23194, 6487, 313, 16667, 10, 38417, 436, 2250, 281, 9295, 6021, 10474, 285, 1600, 30134, 5087, 347, 247, 906, 273, 20215, 323, 253, 16832, 1107, 23305, 14, 34493, 15, 2053, 20215, 20944, 672, 253, 15605, 273, 21074, 27464, 31521, 1272, 253, 1332, 908, 407, 9517, 275, 8925, 253, 21022, 34143, 327, 697, 10089, 9603, 3607, 15, 380, 4412, 2111, 5966, 3883, 323, 253, 7295, 13, 285, 2325, 11215, 12304, 23194, 6487, 12527, 15, 535, 187, 19, 187, 16667, 434, 8624, 2136, 2425, 8414, 273, 253, 11931, 13, 12851, 13, 285, 4323, 273, 2553, 13446, 285, 253, 10089, 627, 4524, 275, 10128, 3928, 13, 18370, 15, 4974, 3223, 1365, 512, 273, 9517, 434, 6021, 1543, 432, 12869, 17511, 5087, 281, 352, 407, 6498, 4413, 665, 13, 407, 253, 11705, 15067, 1332, 13, 9295, 253, 10089, 17860, 762, 253, 13446, 9633, 407, 9517, 15, 9517, 310, 417, 9583, 275, 253, 15067, 273, 10089, 15, 535, 187, 20, 187, 16667, 9288, 253, 10089, 6944, 253, 2553, 11794, 285, 2720, 281, 697, 11931, 273, 2553, 3570, 275, 2761, 512, 21754, 273, 2553, 2659, 15, 496, 954, 10872, 13, 1016, 10649, 273, 2659, 6607, 253, 11931, 273, 2553, 3570, 281, 271, 2862, 6389, 15, 380, 40784, 2491, 275, 1979, 432, 247, 6919, 273, 271, 36982, 281, 2067, 4289, 20046, 15, 380, 2558, 273, 2264, 2553, 20046, 273, 247, 10649, 689, 2943, 3521, 377, 494, 10089, 12848, 432, 2620, 2558, 281, 581, 4289, 2558, 28, 253, 3388, 323, 512, 40784, 369, 5512, 14327, 2558, 15, 9517, 2223, 369, 25042, 281, 4489, 271, 2862, 6389, 275, 1340, 281, 16270, 253, 987, 281, 11705, 20046, 762, 534, 627, 369, 10089, 15, 3900, 9517, 812, 417, 6642, 253, 2408, 273, 10089, 352, 812, 9295, 432, 247, 1677, 10649, 387, 253, 673, 273, 7471, 13, 9517, 13, 812, 3653, 387, 253, 673, 273, 7471, 253, 4328, 273, 10089, 275, 247, 10649, 273, 2659, 15, 535, 187, 21, 187, 688, 12672, 285, 8925, 697, 34143, 323, 21022, 13, 9517, 908, 253, 2105, 1332, 285, 2908, 275, 697, 3720, 627, 1542, 313, 66, 10, 697, 2264, 2105, 273, 253, 10089, 6944, 253, 2553, 28, 285, 313, 67, 10, 253, 2264, 2105, 273, 253, 2553, 326, 352, 369, 2424, 281, 4489, 13, 1880, 3521, 377, 494, 390, 417, 13, 1679, 253, 12541, 1318, 273, 253, 2553, 846, 11705, 15067, 5871, 19344, 15, 9517, 556, 13966, 697, 3762, 326, 352, 369, 7429, 281, 31985, 253, 2264, 2105, 273, 253, 2553, 2659, 352, 369, 2424, 281, 4489, 13, 1880, 3521, 377, 494, 390, 417, 13, 285, 1024, 16424, 253, 3762, 326, 253, 3720, 323, 2105, 21022, 273, 2553, 2659, 320, 1298, 20961, 622, 9564, 264, 875, 253, 2553, 762, 534, 627, 310, 9295, 494, 10089, 285, 253, 2553, 762, 534, 627, 310, 417, 824, 10089, 15, 535, 187, 22, 187, 510, 7295, 275, 12672, 253, 21022, 34143, 407, 253, 2105, 1332, 4795, 275, 253, 6021, 2891, 30218, 275, 2523, 13, 2908, 275, 9517, 434, 2105, 3720, 627, 1542, 760, 253, 2105, 273, 253, 10089, 5043, 253, 346, 26894, 366, 2105, 3, 313, 9296, 1598, 3413, 13, 891, 15, 299, 904, 327, 247, 591, 36982, 3720, 10, 273, 326, 5110, 273, 253, 2553, 2686, 11069, 275, 27930, 253, 10089, 407, 253, 11705, 15067, 1332, 15, 6102, 346, 26894, 366, 2105, 3, 369, 3413, 407, 253 ]
, don't." "Hey, we had a plan." "We're gonna die now." "One of us will." "Help!" "Garth!" "Help!" "Garth!" "No, no!" "Mandy!" "Mandy!" " No!" " Stop it!" " Not so fast." " Faster than you." "Why are you fucking with me?" "We did everything we wanted!" "We're the only ones left!" "I love you." "You fucking knew that!" "Let's just be friends." "We're different." "You said so!" "I did everything right!" "You fucking die with me." "Die with me!" "Die with me." " Mandy, fucking die with me!" " Fuck you!" "Die with me!" "I think I'll finish high school first." "Garth." "You did it." "You saved us."Q: Latent vector variance much larger in CoreML than PyTorch I have a PyTorch model that I've converted to CoreML. In PyTorch, the inferred latent vector's values range to a limit of around ±1.6, but the converted mlmodel varies as much as ±55.0. What might be causing this huge discrepancy? The conversion is pretty straightforward: encoder = Encoder_CNN(latent_dim, n_c) enc_fname = os.path.join(models_dir, encoder.name + '_153.pth.tar') encoder.load_state_dict(torch.load(enc_fname, map_location={'cuda:0': 'cpu'})) encoder.cpu() encoder.eval() img_in = torch.rand(1, 1, 28, 28).cpu() traced_encoder_model = torch.jit.trace(encoder, img_in) traced_encoder_model.save("{}_encoder_mobile_{}_{}.pt".format(model_type, latent_dim, n_c)) coreml_encoder = ct.convert(traced_encoder_model, inputs=[ct.ImageType(name=name, shape=img_in.shape)]) coreml_encoder.save("{}_encoder_{}_{}.mlmodel".format(model_type, latent_dim, n_c)) A: You probably are using different input normalization for PyTorch and Core ML. Your img_in consists of values between 0 and 1. I don't see the inference code for Core ML, but your input pixels are probably between 0 and 255 there. You can fix this by specifying image preprocessing settings when you convert the PyTorch model to Core ML. A reader emailed me the other day, concerned about some of the changes he’s seen in law enforcement since he retired four years ago as a county constable in Mississippi. His letter appears below. How would you respond to the observations and questions he poses? Dear Chuck, Recently I have read several articles talking about all the military-type equipment and high-powered weapons that local law enforcement is getting as a result of federal grants. Many local police forces are starting to look very intimidating and militaristic in their everyday appearance, wearing BDUs with Kevlar helmets and soldier-looking ballistic vests on the outside of their uniform shirt. I even saw video of officers wearing ski masks at a driver’s license/DUI checkpoint while having thigh-holstered handguns and an M4 slung over their shoulders. Basically, the SWAT look has gone to everyday officers on patrol. Some departments, including small rural departments where the threat of terrorism is very slim indeed, are getting Army tanks, armored personnel carriers, and Humvees with .50-cal. automatic weapons inside rotating turrets. Many newly-hired officers are war vets who have recently experienced combat in the Middle East and may have developed a mind-set far from that of the traditional local peace officer in middle America. In some cases I fear they might be operating with the “us versus them” mentality where the citizenry in general is seen as the enemy instead of as the people they are supposed to protect and serve. As a peace officer I always remembered that my job was to protect the citizens of my county physically and to protect their civil rights while doing so. But now I see so much changing. Granted, the world has changed in the last decade. But at what point is the line drawn? At what point do we say enough military equipment and military uniforms and military mindset? When do we as private citizens remind the police that they are police officers and deputies and not soldiers? At what point do we tell our elected officials that we as citizens do not want to feel like we are living under martial law? I live only a hundred miles north of New Orleans and I was still in law enforcement during Hurricane Katrina. I went to New Orleans and rode along almost a month after the hurricane and I saw first hand the martial law in place and the gun confiscation where police went door to door disarming everyone. The militarization of local law enforcement across the nation reminds people of New Orleans after Katrina. Good, honest people are afraid that next time it will be them having THEIR guns taken away. That is very scary stuff down here in the South where most all people own guns. The question must be asked: Why does the federal government want local police to be equipped with the same equipment as the military and to have training like soldiers? Are my concerns founded or am I and many others overly concerned? Sincerely, Cst. Scott Enlow (Ret.) Pike County, Miss.(defn greet [name] (str "Hello, " name "!")) (doseq [name *command-line-args*] (println (greet name))) 370 F.2d 414 BEAVER DAM COAL COMPANY, Plaintiff-Appellant,v.UNITED STATES of America, Defendant-Appellee. No. 16682. United States Court of Appeals Sixth Circuit. December 29, 1966. Richard W. Iler and William C. Boone, Jr., Louisville, Ky. (Robert S. Dorsey, Louisville, Ky., on the brief; Bullitt, Dawson & Tarrant, Louisville, Ky., of counsel), for appellant. Thomas L. Stapleton, Atty., Dept. of Justice, Washington, D. C. (John B. Jones, Jr., Acting Asst. Atty. Gen., Lee A. Jackson, Melva M. Graney, Attys., Dept. of Justice, Washington, D. C., on the brief; Ernest W. Rivers, U. S. Atty., Louisville, Ky., of counsel), for appellee. Before CELEBREZZE and PECK, Circuit Judges, and TAYLOR*, District Judge. CELEBREZZE, Circuit Judge. 1 Beaver Dam Coal Company (Appellant) instituted this action to recover income taxes and interest thereon paid as a result of assessments for the calendar years 1957-1961. These assessments arose when the Commissioner of Internal Revenue disapproved the method used by Appellant in determining the depletion deduction on its coal producing properties. The District Court entered judgment for the Government, and Beaver Dam Coal Company appeals. 2 Appellant's principal business activity consists of the acquisition, ownership, and management of surface lands and the coal thereunder in Ohio County, Kentucky. Substantially all of Appellant's income results from royalties paid to it by operating companies who, by the strip mining method, recover the coal situated under the lands owned by Appellant. Appellant is not engaged in the mining of coal. 3 Appellant acquired the coal underlying the surface separately and prior to its acquisition of surface rights in almost all purchases of surface land. In most instances, each tract of land represented the acquisition of surface rights to an entire farm. The tracts range in size from a fraction of an acre to several hundred acres. The percent of total surface acres of a tract overlying strippable coal varied from five percent to one hundred percent; the average for all tracts was approximately forty percent. Appellant often was compelled to buy an entire farm in order to acquire the right to strip acres under which there was coal. While Appellant could not estimate the amount of coal it could recover from a given tract at the time of purchase, Appellant, could determine at the time of purchase the location of coal in a tract of land. 4 In computing and determining its deduction for depletion, Appellant used the cost method and included in its basis therefor (a) its total cost of the coal underlying the surface; and (b) the total cost of the surface that it was required to buy, whether strippable or not, less the residual value of the surface after strip mining operations terminated. Appellant has abandoned its theory that it was entitled to deduct the total cost of the surface land it was required to buy, whether strippable or not, and now advances the theory that the basis for cost depletion of surface land be equitably apportioned between the surface under which there is recoverable coal and the surface under which there is not such coal. 5 The Government in computing the depletion deduction by the cost method resulting in the income tax deficiencies in issue, included in Appellant's cost basis therefor only the cost of the coal plus the "proportionate cost" (ratably determined, i. e., on a per acre basis) of that portion of the surface actually destroyed in recovering the coal by the strip mining method. Such "proportionate cost" was determined by the
[ 9782, 30834, 240, 74, 256, 9702, 123, 187, 46233, 30834, 98, 68, 256, 6829, 244, 277, 6829, 100, 1251, 289, 333, 2093, 256, 39110, 419, 74, 8511, 9702, 117, 68, 246, 30836, 187, 87, 12931, 362, 9702, 244, 90, 246, 9837, 74, 256, 9702, 123, 256, 6829, 244, 277, 6829, 100, 1251, 815, 28382, 14260, 35177, 79, 362, 5991, 288, 5991, 23713, 17949, 36937, 1251, 15, 187, 67, 31228, 492, 543, 32788, 32595, 85, 298, 9702, 244, 81, 6734, 270, 9702, 109, 85, 17949, 9702, 102, 86, 246, 6829, 106, 187, 6829, 242, 17949, 6457, 90, 17949, 32595, 79, 17949, 6457, 90, 448, 6187, 1251, 246, 9837, 74, 1269, 41411, 17949, 6829, 222, 23713, 295, 39110, 74, 16816, 32595, 81, 187, 7311, 30836, 256, 28382, 17949, 41314, 275, 362, 4265, 79, 270, 35165, 79, 295, 5991, 90, 2093, 448, 6187, 1251, 246, 9837, 74, 17949, 41314, 448, 6187, 1251, 246, 9837, 74, 187, 545, 35165, 74, 26856, 6829, 242, 74, 246, 30110, 80, 295, 1954, 362, 6829, 238, 74, 10382, 15, 2043, 313, 4196, 361, 10, 187, 87, 6829, 238, 74, 9161, 361, 270, 5353, 15, 9161, 361, 270, 5353, 27824, 278, 36937, 85, 246, 6829, 117, 298, 35177, 246, 30110, 74, 187, 545, 6336, 277, 30834, 238, 74, 278, 5991, 79, 288, 12931, 23713, 295, 31228, 345, 256, 39110, 295, 5991, 90, 187, 545, 35165, 74, 815, 14096, 288, 6829, 98, 81, 362, 6829, 238, 74, 17949, 74, 46663, 86, 17949, 1954, 362, 5991, 32219, 17949, 1954, 448, 6187, 1251, 15307, 26566, 187, 249, 278, 5991, 79, 288, 12931, 23713, 295, 39110, 74, 16816, 32595, 81, 275, 492, 31228, 260, 14096, 1251, 187, 187, 41, 40620, 27, 209, 187, 2483, 218, 28733, 15472, 6280, 231, 15754, 21433, 20489, 28733, 22224, 6280, 216, 23068, 17665, 29950, 33465, 17665, 2483, 100, 12001, 23068, 42042, 15754, 6280, 96, 12001, 29903, 15472, 22143, 6123, 99, 6280, 109, 30598, 22224, 21433, 12001, 15754, 2483, 98, 28817, 33358, 21433, 20489, 21433, 15472, 187, 2483, 107, 30598, 38619, 23936, 6280, 216, 2483, 237, 17665, 2483, 238, 12001, 6280, 220, 23068, 17665, 30598, 25159, 22143, 23068, 15472, 6280, 218, 28733, 15472, 6280, 218, 28733, 33465, 6123, 220, 24381, 15472, 2483, 242, 21433, 15472, 33465, 12001, 2483, 100, 6280, 107, 23068, 12001, 29950, 12001, 187, 23936, 25159, 6280, 217, 39695, 6280, 218, 28733, 15472, 6280, 239, 25159, 2483, 96, 2483, 122, 6280, 231, 15754, 28817, 2483, 242, 12001, 33465, 24381, 23936, 15472, 28817, 33358, 22143, 187, 24381, 25159, 2483, 96, 33465, 32191, 2483, 240, 12001, 29950, 12001, 6280, 234, 29950, 12001, 28817, 33358, 187, 23936, 25159, 37500, 38619, 2483, 240, 15472, 6280, 109, 30598, 12001, 2483, 212, 1780, 43728, 21433, 25159, 2483, 96, 21433, 22224, 6280, 115, 17665, 29950, 12001, 2483, 233, 17665, 29950, 12001, 21433, 15754, 23068, 15472, 6280, 101, 15472, 22143, 6123, 99, 187, 39695, 20489, 23068, 374, 6280, 110, 20489, 28733, 22224, 40808, 15754, 6280, 109, 12001, 6280, 217, 15754, 2483, 226, 24381, 17665, 28733, 6280, 218, 23068, 39695, 38619, 2483, 242, 28817, 33358, 187, 29903, 15472, 2483, 239, 15754, 33465, 15472, 22143, 28733, 15754, 21433, 12001, 6280, 110, 20489, 28733, 22224, 40808, 15754, 6280, 239, 2483, 107, 6280, 109, 30598, 33465, 32191, 2483, 240, 37500, 15472, 22143, 6280, 217, 23936, 12001, 28817, 33358, 187, 2483, 218, 28733, 29903, 20489, 2483, 226, 28817, 32191, 23068, 15472, 6280, 220, 28733, 24381, 15472, 6280, 112, 20489, 2483, 226, 42042, 20489, 23068, 374, 33465, 6123, 223, 22143, 39695, 12001, 28817, 33358, 6123, 99, 187, 39695, 20489, 23068, 854, 6280, 226, 24381, 17665, 2483, 116, 23068, 42042, 20489, 23068, 187, 2483, 239, 25159, 6280, 218, 28733, 32191, 15472, 22143, 6280, 107, 2483, 239, 15754, 33465, 15472, 6280, 239, 38619, 2483, 96, 2483, 122, 12001, 28817, 33358, 187, 2483, 239, 25159, 6280, 217, 39695, 6280, 237, 12001, 30598, 23936, 15472, 28817, 33358, 22143, 6280, 115, 30598, 21433, 38619, 2483, 238, 6280, 244, 22224, 21433, 15754, 33465, 24381, 23936, 15472, 28817, 33358, 22143, 187, 2483, 220, 28733, 24381, 15472, 6280, 107, 12001, 46175, 6280, 109, 15472, 6280, 101, 25159, 23068, 25159, 22143, 28817, 25159, 22143, 46069, 15472, 187, 23068, 22143, 2483, 107, 15754, 6280, 101, 25159, 6280, 109, 12001, 6280, 217, 2483, 243, 21433, 15472, 6280, 107, 2483, 239, 12001, 29950, 42042, 17665, 15754, 29950, 25159, 46069, 21433, 20489, 29950, 12001, 6280, 239, 12001, 23936, 12001, 28817, 33358, 187, 2483, 218, 28733, 29903, 20489, 2483, 226, 37500, 33358, 22143, 42042, 23936, 12001, 6280, 112, 46069, 12001, 23936, 12001, 6280, 231, 15754, 21433, 12001, 15754, 17665, 15754, 40808, 12001, 2483, 219, 21433, 15754, 23936, 12001, 6123, 99, 187, 28733, 15472, 2483, 242, 2483, 216, 39695, 21433, 15472, 6280, 216, 22143, 46175, 15754, 6734, 6280, 239, 25159, 33465, 15472, 6280, 116, 38619, 15754, 6123, 213, 28817, 25159, 23936, 12001, 28817, 33358, 187, 29950, 30598, 12001, 2483, 212, 42042, 15754, 28817, 32191, 33465, 22224, 15754, 20489, 29950, 29903, 21433, 25159, 42042, 15754, 20489, 2483, 244, 12001, 2483, 117, 20489, 23936, 21433, 15754, 23936, 15472, 28817, 33358, 22143, 187, 30598, 32191, 12001, 15754, 15472, 6280, 112, 20489, 2483, 226, 6280, 218, 28733, 42042, 12001, 2483, 243, 21433, 25159, 37500, 38619, 46175, 17665, 15754, 20489, 23936, 21433, 15754, 23068, 15472, 21433, 15472, 6280, 112, 20489, 2483, 226, 37500, 6123, 220, 23068, 20489, 2483, 242, 15754, 21433, 15754, 15472, 22143, 187, 2483, 218, 28733, 15472, 33465, 22224, 15754, 20489, 29950, 29903, 21433, 15472, 33465, 12001, 2483, 100, 6280, 217, 15754, 22143, 2483, 244, 21433, 15754, 23068, 12001, 28817, 25159, 46069, 12001, 209, 6123, 99, 2043, 313, 4196, 361, 10, 187, 4196, 361, 6280, 107, 6123, 220, 2483, 96, 21433, 15472, 33465, 12001, 2483, 100, 6123, 99, 9161, 361, 6280, 107, 6123, 220, 2483, 96, 6280, 101, 15754, 42042, 15754, 28817, 33358, 187, 28733, 17665, 24381, 17665, 15754, 22224, 23068, 21433, 15472, 6280, 103, 22224, 2483, 237, 15472, 6280, 99, 25159, 6280, 109, 30598, 33465, 22143, 2483, 233, 17665, 29950, 12001, 187, 2483, 220, 28733, 33465, 15472, 37500, 15472, 29903, 6280, 233, 12001, 23068, 12001, 6280, 237, 12001, 30598, 20489, 2483, 226, 6280, 231, 15754, 6280, 106, 20489, 15754, 28817, 32191, 12001, 15754, 15472, 42042, 12001, 28733, 28817, 33358, 187, 28733, 22224, 15754, 20489, 29950, 29903, 37500, 6123, 220, 23068, 20489, 2483, 242, 15754, 42042, 17665, 15754, 20489, 22143, 2483, 242, 6280, 239, 25159, 6280, 116, 22224, 15754, 17665, 2483, 117, 42042, 17665, 15754, 20489, 22143, 2483, 242, 21433, 15754, 23936, 12001, 28817, 33358, 187, 187, 16330, 757, 27, 209, 187, 6534, 4954, 97, 5846, 39410, 3142, 28745, 6900, 13504, 18775, 18906, 28745, 10091, 40134, 6900, 10091, 47347, 6900, 24477, 28745, 9427, 10091, 9211, 15, 209, 30801, 5846, 187, 28337, 10091, 4467, 10091, 45232, 6534, 13621, 4954, 97, 5846, 37760, 39410, 3142, 15677, 3142, 209, 30801, 5846, 34341, 6534, 18775, 8181, 28745, 6900, 43246, 29413, 6900, 9211, 47951, 187, 13621, 5846, 47931, 6900, 30801, 5846, 13504, 10091, 20817, 6534, 18906, 10091, 9211, 4954, 97, 5846, 39410, 3142, 32262, 116, 3142, 11912, 9427, 18152, 40913, 31602, 11912, 29413, 5846, 10091, 9211, 187, 18775, 9211, 20817, 6534, 35429, 10091, 21931, 28745, 40802, 9427, 37715, 9211, 9427, 32262, 113, 8181, 187, 13621, 40134, 31602, 24477, 10091, 9211, 29413, 9211, 4954, 97, 6900, 9211, 6534, 10091, 5846, 6534, 39410, 3142, 28745, 6900, 209, 30801, 5846, 23072, 3142, 20817, 6534, 35429, 10091, 21931, 28745, 9427, 5843, 15, 187, 45821, 10091, 5846, 374, 18152, 6900, 49788, 10091, 209, 40134, 10091, 6900, 47951, 9427, 209, 10091, 3142, 34127, 32262, 113, 8181, 187, 40134, 10091, 6900, 47951, 9427, 34341, 5846, 14585, 39727, 23630, 10091, 29620, 6900, 18152, 14062, 8181, 10091, 40913, 14585, 29413, 47951, 187, 13621, 5846, 47931, 6900, 30801, 5846, 13504, 3142, 209, 45821, 10091, 5846, 374, 39410, 3142, 15677, 6900, 30801, 4954, 97, 5846, 32262, 108, 8181, 30265, 10714, 115, 28745, 40802, 9427, 209, 30801, 5843, 15, 187, 45821, 10091, 5846, 854, 209, 45821, 10091, 5846, 25849, 5843, 4467, 187, 18775, 9427, 28745, 6900, 209, 30801, 5846, 47347, 14585, 5843, 8181, 15677, 9427, 18152, 29620, 5846, 9427, 18152, 30265, 4467, 37715, 9211, 9427, 32262, 113, 8181, 187, 5843, 39727, 9211, 10091, 29413, 9427, 13504, 10091, 20817, 6534, 18906, 10091, 9211, 29802, 6900, 29413, 24477, 10091, 39410, 3142, 29413, 9427, 13504, 10091, 45232, 6534, 3142, 9427, 10091, 9211, 209, 18906, 23072, 30901, 28745, 9427, 10091, 9211, 187, 13621, 13793, 9211, 32262, 112, 4954, 97, 5846, 4954, 223, 209, 30801, 5846, 28745, 6534, 45232, 6534, 3142, 9427, 47951, 15677, 49788, 187, 13621, 9427, 44076, 30801, 37715, 5843, 24477, 9427, 28745, 6534, 209, 10091, 3142, 29802, 22814, 8181, 13504, 39727, 9211, 32262, 113, 8181, 11912, 40802, 9427, 47347, 6900, 24477, 13504, 10091, 209, 40134, 10091, 6900, 9211, 187, 13621, 5846, 47931, 6900, 30801, 5846, 31461, 32262, 112, 39410, 9211, 10091, 47931, 10091, 32262, 113, 8181, 11912, 40802, 9427, 13504, 10091, 29413, 6900, 9211, 5843, 18152, 209, 3142, 14062, 9211, 30901, 13504, 10091, 29413, 6900, 9211, 5843, 15, 187, 10714, 112, 28745, 10714, 108, 4467, 6734, 29413, 9427, 32262, 112, 37715, 6900, 6534, 13793, 37715, 6900, 6534, 13793, 13504, 10091, 37715, 49788, 187, 30801, 5846, 23072, 3142, 20817, 3142, 209, 30801, 5846, 23072, 3142, 34341, 6900, 10091, 7427, 39410, 3142, 20817, 13793, 6900, 10091, 11912, 13504, 10091, 29413, 5846, 10091, 5843, 187, 5843, 18906, 10091, 8181, 39727, 29413, 5846, 10091, 9211, 20817, 3142, 209, 30801, 5846, 13504, 8181, 5846, 39410, 3142, 15677, 6900, 30801, 13504, 3142, 209, 150, 217, 3142, 45821, 29413, 5846, 10091, 9211, 15677, 5846, 47931, 6900, 30801, 5846, 13504, 3142, 187, 13621, 30801, 9211, 4954, 97, 5846, 39410, 3142, 15677, 3142, 34341, 6900, 10091, 7427, 37715, 6900, 6534, 13793, 29413, 5846, 10091, 9211, 15, 37715, 6900, 6534, 13793, 313, 4196, 361, 10, 187, 13621, 3142, 9161, 361, 15677, 3142, 49788, 9161, 361, 15677, 3142, 49788, 15677, 3142, 31159, 6900, 28337, 10091, 15677, 6900, 47931, 6900, 32262, 113, 8181, 187, 9211, 6900, 209, 45821, 30801, 10091, 5846, 4954, 115, 11912, 21931, 9427, 4954, 223, 15677, 5846, 47931, 6900, 30801, 5846, 209, 30801, 5846, 25849, 9211, 9211, 187, 13621, 30801, 9211, 13504, 29937, 47931, 14062, 8181, 28745, 10714, 114, 8181, 9427, 15677, 10714, 114, 9211, 18152, 34341, 45821, 14585, 187, 5843, 18906, 10091, 8181, 39727, 34341, 6900, 10091, 7427, 209, 150, 217, 3142, 45821, 29413, 9427, 209, 150, 217, 3142, 45821, 15677, 7427, 3142, 187, 187, 44, 37173, 27, 209, 187, 166, 39068, 35458, 214, 28736, 10608, 222, 99, 31956, 118, 7775, 239, 215, 168, 119, 235, 27940, 10608, 228, 227, 35169, 244, 35169, 239, 168, 235, 99, 15, 16857, 39068, 35458, 223, 187, 33104, 215, 168, 98, 122, 7775, 97, 222, 37176, 16857, 39068, 34431, 99, 37176, 20959, 7775, 217, 223, 168, 122, 230, 44633, 122, 35296, 46927, 223, 34431, 243, 187, 168, 116, 231, 35061, 29470, 34817, 43710, 239, 166, 111, 110, 209, 15074, 243, 7775, 44140, 44799, 33057, 115, 31912, 187, 168, 123, 231, 34431, 239, 7775, 215, 99, 167, 105, 216, 187, 21053, 107, 42581, 1780, 43728, 7775, 123, 231, 34431, 239, 39343, 7775, 215, 99, 167, 105, 216, 29470, 35458, 243, 33057, 115, 31912, 15, 16857, 39068, 41986, 223, 169, 212, 122, 187, 15074, 211, 374, 24169, 7775, 44140, 35169, 243, 42581, 10608, 235, 227, 24169, 34127, 32115, 216, 50152, 100, 28774, 216, 31912, 187, 26532, 227, 34391, 209, 15074, 243, 10608, 232, 223, 10608, 243, 219, 20959, 29333, 211, 7775, 215, 122, 41639, 34123, 7775, 44140, 35169, 243, 42581, 187, 20959, 39343, 7775, 239, 215, 47538, 209, 15074, 211, 374, 39343, 209, 15074, 243, 14394, 119, 169, 233, 219, 33057, 115, 31912, 15, 187, 15074, 211, 854, 10608, 226, 236, 28774, 228, 209, 15074, 211, 187, 20959, 10608, 112, 215, 29333, 211, 27940, 7775, 234, 110, 35458, 110, 167, 227, 235, 39907, 187, 14394, 119, 35169, 243, 20959, 7775, 238, 227, 29470, 24169, 46438, 214, 28736, 209, 15074, 243, 7775, 44140, 28774, 219, 24169, 46438, 123, 27997, 110, 187, 166, 39068, 25811, 238, 215, 20959, 10608, 228, 227, 7775, 9223, 167, 241, 223, 20959, 10608, 227, 243, 46438, 214, 28774, 216, 31912, 187, 168, 219, 106, 28774, 227, 374, 10608, 235, 227, 24169, 854, 10608, 223, 211, 35169, 243, 7775, 9223, 27997, 104, 187, 166, 39068, 167, 241, 235, 41639, 10608, 213, 235, 24169, 42984, 227, 34391, 29470, 34817, 25811, 233, 220, 40025, 236, 28736, 7775, 117, 103, 15074, 243, 46438, 214, 28774, 216, 31912, 15, 187, 35169, 239, 28774, 228, 29470, 24169, 9978, 6734, 10608, 213, 114, 167, 116, 211, 187, 21053, 107, 42581, 27940, 7775, 234, 107, 42581 ]
người sẽ được sử dụng thay cho số hai hoặc tám vì vậy tôi sẽ sử dụng phát hiện và hành động. bên trong thiết lập () bắt đầu từ ở đây đến đây chúng tôi xác định nối tiếp giám sát để in văn bản này cho chúng tôi để chúng tôi phải khởi tạo nó với serial.begin (9600) với 9600 baud. 9600 baud là một tỷ lệ tại phía dưới màn hình nên con số này phải phù hợp với điều đó và sau đó chúng ta có in màn hình nối tiếp in trên cùng Hindi: इसे और किसी अन्य स्थान पर डालें। यही कारण है कि के बहुत अच्छा उन्होंने इसे इस सॉकेट के साथ बनाया तो आप इसे जोड़ और हटा सकते हैं कोड समझाया गया है तो मुझे यहाँ Arduino कोड की व्याख्या करने दें। पिन 2 रिसीवर या आरएक्स इनपुट है लेजर सेंसर का रिसीवर जब यह समझ में आता है इसलिए हमने उसके लिए पिन 2 सौंपा है। पिन 8 एक्शन पिन जो इसमें बजर से जुड़ा है जो आप चाहते हैं वह कुछ भी कर सकते हैं उसके बाद ये दोनों होंगे नंबर दो या आठ के बजाय प्रयोग किया जाता है इसलिए मैं पता लगाता और कार्रवाई करता। सेटअप के अंदर () जो से शुरू होता है यहाँ पर हम सीरियल को परिभाषित करते हैं हमारे लिए इस पाठ को मुद्रित करने के लिए मॉनिटर करें इसे सीरियल के साथ आरंभ करना होगा ।begin (9600) 9600 बॉड के साथ। 9600 बॉड दर पर है स्क्रीन के नीचे तो यह संख्या उस से मेल खाना चाहिए और फिर हमारे पास है सीरियल मॉनिटर प्रिंट जो शीर्ष प्रिंट करता है Persian: و آن را در مکان دیگری قرار دهید. این خیلی خوب آنها را با این سوکت درست کردند بنابراین می توانید آن را اضافه و حذف کنید کد توضیح داده شده است بگذارید کد آردوینو را در اینجا توضیح دهم. پین 2 ورودی گیرنده یا RX است گیرنده سنسور لیزر وقتی حس کند بنابراین ما پین 2 را برای آن اختصاص داده ایم. پین 8 پین عمل که در این قسمت به وزنه وصل شده است موردی که می توانید هر کاری را که می خواهید انجام دهید بعد از آن ، این دو خواهند بود به جای شماره دو یا هشت مورد استفاده قرار می گیرد بنابراین من از ردیابی استفاده می کردم و اقدام می کردم. از داخل () که از شروع شروع می شود اینجا تا اینجا سریال را تعریف می کنیم مانیتور کنید تا این متن را برای ما چاپ کنید بنابراین ما باید آن را با سریال شروع کنید. شروع (9600) با 9600 باود 9600 باود با نرخی برابر است در پایین صفحه ، بنابراین این عدد باید مطابقت داشته باشد و سپس مانیتور سریال چاپ که چاپ بالا Korean: 그것을 다른 위치에 두십시오. 그게 아주 좋은 그들은이 소켓으로 만든 추가하고 제거 할 수 있습니다 코드 설명 여기 Arduino 코드를 설명하겠습니다. 그만큼 핀 2는 수신기 또는 RX 입력입니다 감지 할 때 레이저 센서의 수신기 이를 위해 핀 2를 할당했습니다. 핀 8 동작 핀 이 버저에 연결되어 당신이 원하는 것을 할 수있는 경우 그 후이 두 사람이 될 것입니다 숫자 2 또는 8 대신 사용 그래서 나는 감지하고 행동을 취할 것입니다. 시작하는 setup () 내부 여기에 여기
[ 16636, 2415, 2596, 25263, 721, 840, 2708, 310, 247, 3213, 14, 1615, 14, 10539, 407, 7102, 323, 253, 1072, 15, 187, 187, 1848, 8846, 44780, 46647, 29839, 52, 4145, 443, 18244, 1410, 6651, 2596, 25263, 721, 16636, 2415, 2637, 27, 187, 187, 13325, 2119, 368, 452, 2168, 37572, 253, 7491, 27564, 285, 8038, 308, 10690, 49, 7355, 327, 2596, 25263, 721, 1108, 6089, 13, 436, 310, 247, 1077, 1774, 4809, 273, 436, 6053, 6971, 16636, 2415, 1232, 15, 380, 6053, 6971, 23367, 1873, 310, 3715, 275, 247, 1039, 281, 320, 8038, 3066, 247, 308, 10690, 49, 7355, 390, 643, 2840, 7355, 15, 15725, 7355, 778, 417, 320, 2104, 3334, 436, 6053, 6971, 390, 6813, 1886, 16636, 2415, 23367, 1873, 15, 187, 187, 20865, 253, 6323, 5887, 83, 6971, 16636, 2415, 323, 2596, 25263, 721, 390, 581, 273, 253, 1563, 27, 187, 187, 7093, 4481, 588, 417, 320, 26415, 816, 407, 20864, 253, 6053, 6971, 4097, 44, 1873, 327, 634, 10469, 4481, 15, 187, 187, 15705, 6971, 4097, 44, 7648, 390, 1294, 2715, 310, 816, 247, 6053, 6971, 16636, 2415, 4323, 2898, 15, 187, 187, 510, 6053, 6971, 4097, 44, 7648, 390, 1294, 622, 588, 35310, 789, 604, 368, 452, 2168, 16636, 2415, 1703, 634, 10469, 26391, 15, 187, 187, 13996, 14, 1615, 14, 13996, 7102, 327, 849, 281, 16636, 2415, 2596, 25263, 721, 970, 6053, 6971, 390, 6813, 1886, 23367, 1873, 27, 187, 187, 20865, 285, 3491, 253, 6053, 6971, 390, 6813, 1886, 390, 253, 26718, 15, 16368, 313, 4064, 253, 13664, 23, 308, 10690, 49, 15, 23537, 5522, 10, 1873, 281, 2596, 25263, 721, 15, 313, 42, 3524, 368, 452, 2168, 20582, 581, 273, 253, 5230, 23367, 1873, 432, 253, 1840, 38661, 2593, 10, 187, 187, 4125, 19855, 253, 2596, 25263, 721, 281, 7491, 715, 308, 10690, 49, 7355, 15, 187, 187, 5872, 13, 16551, 253, 28771, 432, 308, 10690, 49, 1728, 3601, 13, 840, 3609, 253, 6053, 6971, 16636, 2415, 23367, 1873, 432, 253, 1873, 9882, 15, 187, 187, 45327, 390, 3334, 253, 6053, 6971, 390, 6813, 1886, 23367, 1873, 390, 253, 26718, 15, 16368, 1873, 2530, 275, 253, 13664, 23, 308, 10690, 49, 15, 23537, 13, 407, 7335, 2821, 253, 4235, 5495, 281, 11204, 2683, 22843, 327, 308, 10690, 49, 3601, 15, 187, 187, 13689, 323, 308, 10690, 49, 281, 10299, 253, 26718, 5522, 15, 7243, 253, 36070, 310, 2218, 816, 29393, 634, 2813, 15, 187, 187, 1845, 8491, 15844, 1422, 943, 1024, 452, 16636, 2415, 327, 2596, 25263, 721, 15, 187, 187, 2347, 281, 2451, 604, 16636, 2415, 310, 11410, 327, 2596, 25263, 721, 390, 5803, 32, 187, 187, 27383, 253, 16636, 2415, 2451, 254, 622, 432, 253, 10223, 16106, 285, 12654, 604, 634, 4481, 310, 16636, 2415, 1703, 390, 417, 15, 187, 187, 4943, 310, 247, 37617, 849, 281, 10299, 253, 9242, 16636, 2415, 8985, 3066, 308, 10690, 49, 27, 187, 187, 2042, 368, 2454, 667, 3237, 327, 436, 7102, 281, 3334, 308, 10690, 49, 323, 2596, 25263, 721, 840, 13, 368, 476, 16164, 285, 12252, 1060, 15, 22660, 479, 390, 690, 643, 2608, 327, 436, 12209, 588, 43004, 896, 281, 634, 7316, 347, 3517, 347, 1896, 15, 187, 187, 28412, 24251, 390, 4974, 13020, 281, 253, 2596, 25263, 721, 313, 15152, 300, 2960, 10, 12209, 1198, 643, 10469, 12047, 33506, 84, 13, 10243, 486, 2697, 33506, 84, 13, 285, 512, 643, 2813, 2173, 12989, 15, 537, 209, 21723, 27591, 187, 537, 475, 8283, 9169, 17545, 11294, 187, 537, 475, 187, 537, 475, 21737, 762, 253, 14325, 4637, 13, 11099, 374, 15, 17, 313, 783, 346, 17736, 3287, 187, 537, 475, 368, 778, 417, 897, 436, 1873, 3707, 275, 10276, 342, 253, 4637, 15, 187, 537, 475, 1422, 778, 4044, 247, 3491, 273, 253, 4637, 387, 187, 537, 475, 187, 537, 475, 50273, 2413, 1358, 2700, 15, 8418, 15, 2061, 16, 17130, 16, 17821, 14, 19, 15, 17, 187, 537, 475, 187, 537, 475, 15999, 2424, 407, 7763, 1569, 390, 5821, 281, 275, 4028, 13, 3694, 187, 537, 475, 5939, 762, 253, 4637, 310, 5939, 327, 271, 346, 1719, 4110, 3, 23440, 13, 187, 537, 475, 15002, 15466, 4145, 22998, 3481, 9103, 19329, 13, 2057, 3890, 390, 10466, 15, 187, 537, 475, 2594, 253, 4637, 323, 253, 2173, 3448, 13200, 15607, 285, 187, 537, 475, 7364, 762, 253, 4637, 15, 187, 537, 209, 21723, 27591, 8480, 187, 187, 32197, 342, 11447, 14, 7769, 20766, 6365, 18211, 187, 4578, 33197, 187, 187, 688, 1635, 281, 390, 3185, 273, 253, 17082, 2130, 275, 253, 6335, 13, 368, 476, 897, 634, 1211, 3290, 17082, 15, 1916, 513, 436, 27, 187, 187, 26577, 5733, 634, 1211, 7092, 273, 253, 3290, 17082, 5933, 285, 4853, 19832, 285, 22195, 5971, 323, 326, 5933, 15, 187, 187, 26577, 13106, 436, 747, 5933, 275, 253, 20890, 5423, 2422, 46042, 5190, 4849, 273, 253, 3290, 7982, 873, 15, 187, 50275, 9917, 8749, 253, 3280, 5113, 323, 253, 747, 5933, 275, 253, 20890, 5423, 3233, 5190, 4849, 273, 253, 3290, 7982, 873, 15, 187, 187, 11244, 253, 4451, 2234, 672, 41863, 253, 747, 5933, 285, 697, 3280, 13, 285, 897, 253, 1072, 2234, 281, 4044, 253, 10302, 1543, 15, 187, 510, 2285, 556, 28136, 247, 8574, 9905, 14, 2050, 3197, 22441, 326, 26586, 30561, 18494, 13, 751, 1421, 13, 432, 1824, 15, 11474, 1335, 275, 697, 21841, 3408, 13, 436, 22441, 1537, 320, 2104, 281, 2590, 253, 9065, 2308, 273, 1421, 17969, 1119, 275, 5053, 751, 42796, 13, 11314, 13, 1561, 247, 1643, 3038, 15, 187, 187, 1628, 510, 4081, 1332, 310, 20182, 544, 14644, 1655, 1781, 14, 7527, 24077, 2718, 1092, 1580, 352, 4648, 39288, 2105, 1417, 8138, 1806, 753, 309, 1433, 49360, 3666, 81, 1758, 1879, 356, 276, 965, 665, 3977, 253, 2199, 15, 773, 395, 625, 18380, 2429, 281, 643, 2718, 13, 835, 13506, 4753, 403, 908, 1425, 187, 187, 510, 2934, 3548, 457, 85, 7094, 747, 15, 45273, 452, 1929, 323, 1107, 326, 8574, 4428, 5793, 2390, 1905, 1925, 22236, 1190, 684, 1905, 326, 7356, 281, 18494, 15, 15643, 9437, 387, 436, 1824, 16733, 2492, 4473, 3597, 924, 3834, 253, 8574, 9905, 715, 247, 4030, 11687, 13, 534, 369, 840, 6804, 715, 1421, 14, 85, 20354, 1824, 15, 380, 12825, 18494, 8980, 253, 11687, 13, 285, 2366, 13, 597, 403, 18748, 562, 273, 253, 1824, 15, 1292, 436, 5199, 310, 247, 2372, 28116, 1905, 368, 878, 247, 5806, 323, 247, 5806, 15, 187, 187, 4604, 356, 276, 965, 285, 617, 11651, 21010, 436, 1232, 407, 34663, 2192, 5302, 253, 8574, 11687, 4830, 247, 15386, 22441, 15, 380, 2457, 48230, 90, 22441, 310, 3925, 281, 5571, 2558, 8574, 407, 2801, 15, 187, 187, 1628, 14358, 253, 8574, 285, 253, 5536, 5148, 13291, 403, 994, 28016, 275, 253, 22441, 1806, 1879, 356, 276, 965, 753, 273, 617, 4342, 3863, 275, 41613, 322, 36148, 36873, 285, 17388, 15, 773, 17756, 13, 642, 3081, 7259, 403, 2424, 323, 253, 8570, 273, 253, 544, 68, 23520, 62, 16738, 67, 592, 285, 253, 39917, 432, 253, 1824, 1425, 187, 187, 2598, 13, 247, 1824, 3565, 651, 3365, 3785, 253, 22441, 432, 253, 1824, 281, 1379, 562, 253, 5148, 34404, 15, 380, 2281, 273, 8570, 7024, 327, 849, 1199, 1421, 310, 275, 253, 1824, 15, 1310, 1879, 356, 276, 965, 457, 84, 2285, 3053, 342, 1824, 4508, 7457, 4243, 591, 3041, 273, 1421, 1905, 16951, 2069, 2169, 685, 954, 1846, 2408, 1119, 1309, 253, 42796, 1824, 8891, 1905, 253, 22441, 812, 5386, 247, 2626, 273, 253, 17969, 275, 1884, 2909, 15, 187, 187, 18765, 12532, 13, 1879, 356, 276, 965, 753, 625, 2561, 310, 3058, 281, 3653, 604, 253, 22441, 476, 4044, 1421, 285, 33679, 2308, 4569, 323, 10678, 13, 3340, 342, 305, 3938, 90, 1824, 19246, 949, 1524, 14, 10186, 25886, 15, 1893, 2080, 13, 253, 7934, 1673, 1071, 5866, 342, 41021, 432, 253, 309, 1433, 457, 84, 18090, 7811, 13, 534, 6221, 247, 7802, 273, 5148, 13291, 15, 187, 187, 1628, 510, 1543, 921, 326, 253, 5148, 13291, 273, 1600, 476, 320, 8069, 5176, 1806, 1879, 356, 276, 965, 753, 15, 3378, 253, 9957, 273, 5787, 16775, 13, 27320, 3527, 5175, 313, 35649, 10, 12277, 403, 7552, 9592, 4633, 15, 2053, 12277, 10725, 327, 253, 24389, 273, 13506, 46383, 17678, 285, 16, 263, 19432, 12262, 247, 18379, 3425, 273, 253, 21339, 9, 84, 10, 273, 1600, 15, 4855, 314, 7996, 19689, 10296, 13, 824, 347, 253, 7561, 908, 21028, 5931, 4884, 313, 9343, 582, 1957, 1774, 5657, 275, 253, 1673, 273, 5787, 39266, 15, 3932, 253, 8900, 273, 8477, 275, 11299, 13, 7418, 3882, 14, 3169, 12277, 12262, 247, 4618, 5235, 273, 20180, 19788, 452, 644, 3715, 313, 47, 311, 442, 285, 2263, 47102, 13, 6469, 13, 26024, 5481, 285, 8137, 273, 30250, 13, 268, 15, 27812, 14, 9726, 13, 496, 28609, 273, 15022, 12761, 36415, 313, 25, 394, 1407, 11507, 19995, 1162, 355, 904, 2448, 8273, 323, 12761, 36415, 13, 5041, 13, 399, 15, 36, 9944, 8652, 1162, 355, 15, 8210, 13, 35345, 280, 40393, 47695, 1877, 20174, 27, 11683, 281, 18742, 48854, 13, 6943, 1584, 1451, 4624, 16103, 13, 444, 13078, 24837, 13, 9693, 13, 7532, 9944, 10400, 272, 1162, 355, 904, 9725, 13, 44194, 26024, 12761, 36415, 27, 43655, 285, 27492, 13, 2448, 8273, 323, 12761, 36415, 13, 5041, 13, 399, 15, 36, 9944, 444, 6285, 14671, 28, 6115, 4978, 13, 9354, 13, 8477, 14, 3169, 22938, 21234, 275, 49078, 784, 18742, 13, 5418, 4714, 15317, 38567, 13, 9693, 13, 7532, 13351, 6676, 273, 841, 19689, 12277, 452, 644, 4158, 323, 20180, 5481, 3587, 432, 3382, 13, 6938, 390, 2739, 3530, 13, 534, 403, 1929, 281, 3831, 11531, 273, 19689, 12277, 15, 6061, 253, 1107, 13, 247, 5235, 273, 7259, 2684, 432, 247, 5235, 273, 1071, 3530, 323, 4719, 285, 16, 263, 23609, 273, 1341, 390, 9907, 6353, 347, 973, 347, 323, 3727, 13, 4719, 285, 16, 263, 23609, 273, 27320, 9532, 452, 644, 3715, 15, 1723, 13, 3530, 5480, 407, 841, 7259, 778, 1335, 3831, 36286, 326, 19323, 342, 19689, 12277, 15, 187, 36442, 528, 2175, 452, 5183, 326, 1142, 3510, 273, 3382, 13, 6938, 285, 2739, 13751, 778, 3831, 15991, 30809, 342, 27320, 3527, 17442, 4870, 1690, 8477, 13, 8405, 511, 5931, 4884, 313, 45, 1311, 582, 9464, 14, 11181, 17442, 313, 53, 3788, 10, 285, 23186, 16837, 17442, 313, 3871, 34, 10, 313, 18336, 2191, 1162, 355, 15, 7544, 13, 14703, 39977, 6943, 7776, 15, 22540, 27, 21361, 14, 9726, 28, 23840, 10981, 316, 1162, 15, 355, 904, 8065, 13, 500, 15, 35412, 15, 12761, 4193, 311, 15, 5540, 27, 27446, 14, 18493, 28, 4922, 20887, 1162, 355, 15, 8441, 13, 500, 15, 35412, 15, 12761, 4193, 311, 15, 5910, 27, 20, 12347, 14, 20, 13391, 28, 8652, 1162, 355, 15, 8210, 13, 35345, 280, 40393, 47695, 1877, 20174, 27, 11683, 281, 18742, 48854, 13, 6943, 1584, 1451, 4624, 13, 16103, 13, 444, 13078, 24837, 13, 9693, 13, 7532, 9944, 10400, 272, 1162, 355, 904, 9725, 13, 44194, 26024, 12761, 36415, 27, 43655, 285, 27492, 13, 2448, 8273, 323, 12761, 36415, 13, 5041, 13, 399, 15, 36, 9944, 444, 6285, 14671, 285, 6115, 4978, 13, 9354, 13, 8477, 14, 3169, 22938, 21234, 275, 49078, 784, 18742, 13, 5418, 4714, 15317, 38567, 13, 9693, 13, 7532, 13351, 3813, 13, 352, 310, 9560, 281, 4271, 16294, 1071, 3530, 984, 4016, 1071, 1543, 778, 320, 26585, 281, 8638, 273, 253, 19689, 6981, 407, 36286, 417, 17527, 13, 9238, 1025, 390, 49192, 407, 253, 7241, 908, 323, 3410, 9008, 15, 49512, 6708, 1071, 3530, 476, 320, 3636, 407, 49160, 253, 6733, 273, 17442, 285, 16, 263, 5481, 273, 247, 27320, 3527, 2303, 9417, 347, 247, 1453, 15, 6102, 1453, 778, 320, 6024, 672, 253, 1453, 27320, 3527, 310, 2879, 281, 247, 5110, 273, 253, 3410, 5762, 275, 7529, 323, 17442, 285, 16, 263, 5481, 273, 253, 1453, 2303, 6430, 1223, 1529, 5110, 273, 253, 3410, 310, 5867, 323, 17442, 285, 16, 263, 5481, 273, 253, 3537, 442, 2303, 6430, 281, 320, 5189, 407, 253, 6981, 15, 6102, 1453, 310, 1925, 271, 773, 11577, 1453, 313, 1864, 10, 668, 672, 1097, 1453, 2303, 6430, 285, 3537, 442, 2303, 6430, 403, 15134, 285, 16, 263, 5189, 275, 253, 1072, 4884, 11179, 15, 3010, 5742, 13, 436, 4812, 1453, 985, 3400, 271, 9276, 323, 17442, 285, 16, 263, 5481, 313, 1864, 2350, 10, 273, 27320, 9532 ]
ROOT OnePlus 6 then below is a step-by-step by guide for the same. REQUIRED DOWNLOADS OR GUIDES FOR OnePlus 6 ROOTING: Make sure you have already unlocked the bootloader and installed TWRP recovery on OnePlus 6 – Well, this is a very important aspect of this SuperSU ROOT process. The SuperSU zip file is developed in a way to be installed via a TWRP recovery or other custom recovery. Stock recovery may not be able install this SuperSU or Magisk ROOT zip file. Download the latest SuprSU ROOT for OnePlus 6 or one of the following: Your phone will not be rooted just by installing the SuperSU APK file on your Android phone. SuperSU APK Free or Pro version is just a SuperSU ROOT management application. The SuperSU APK Free or Pro app will ONLY work if you have already ROOTED your Android Phone. Step-by-Step guide on how to ROOT OnePlus 6 using SuperSU or Magisk zip file: Download and copy the SuperSU or Magisk or the Root.zip (from the OP6 TWRP.rar package) file to OnePlus 6. (I hope you have already downloaded one of the root zip file from the above downloads section) Now restart the OnePlus 6 to boot into TWRP recovery. Then, Select the Install from TWRP home screen, then select the SuperSU ROOT zip file from the file browser. Flash or install the SuperSU or Magisk zip file or the Root.zip file provided in the OP6 TWRP.rar, by Sliding the Swipe to Confirm Flash on TWRP screen. Wait for TWRP to flash the Root package. Once the flashing is done just reboot your device. Profit!!! You should now have ROOT on OnePlus 6. How to check if ROOT is enabled on OnePlus 6 or NOT? Install the ROOT checker app from the Play Store and verify if your phone is ROOTED or not. Here is a screenshot how to flash the SU ROOT binary via TWRP: If you face any problems on this guide to install TWRP for OnePlus 6 then, you can login and reply here. Either me or some other user on this forum will revert back to your query as soon as possible. Stay tuned or Subscribe to the OnePlus 6 (enchilada) forum For other Android Custom ROMs, LineageOS ROMs, and all other device specific topics... ****************************************************************************** .. * Copyright 2020 Intel Corporation .. * .. * Licensed under the Apache License, Version 2.0 (the "License"); .. * you may not use this file except in compliance with the License. .. * You may obtain a copy of the License at .. * .. * http://www.apache.org/licenses/LICENSE-2.0 .. * .. * Unless required by applicable law or agreed to in writing, software .. * distributed under the License is distributed on an "AS IS" BASIS, .. * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. .. * See the License for the specific language governing permissions and .. * limitations under the License. .. *******************************************************************************/ Working with User-defined Quality Metrics ========================================= In addition to or instead of the metrics available in the library, you can use your own quality metrics. To do this: #. Add your own implementation of the quality metrics algorithm and define Input and Result classes for that algorithm. #. Register this new algorithm in the ``inputAlgorithms`` collection of the quality metric set. Also register the input objects for the new algorithm in the ``inputData`` collection of the quality metric set. Use the unique key when registering the new algorithm and its input, and use the same key to obtain the computed results. The team has engineered a coffee grounds-infused foam that removes hazardous metals, like lead, from water. Though still in its prototype phase, this foam might be able to clear the worst levels of lead contamination found in places like Flint, Michigan, within a few hours. “The proposed method is cheaper [than current large-scale filtration systems], since it uses principally costless waste,” said IIT physicist Despina Fragouli who led the project. “and more sustainable compared to other systems, where synthetic materials are used.” The idea isn’t entirely new. Scientists have known for years that coffee contains chemical groups — called carboxylates — that stick to metals. Early attempts at this water remediation concept tried smashing the coffee grounds into a fine powder, which was then mixed into lead-tainted water. The toxic metals bind the powder, and together, they are filtered out of the water. But this procedure is a bit redundant — you need a filter for a filter. Fragouli and her colleagues simplified this process by chemically infusing the coffee powder onto a elastic foam. The final spongy foam is 60 to 70 percent coffee by weight. “Both the coffee and the heavy metal ions are entrapped in the foam,” Fragouli said of her findings published in ACS Sustainable Chemistry and Engineering. “Therefore, no additional procedures are required for the removal of the [coffee] adsorbents and the pollutants from the water.” So, a water official would simply pull the foam from the water to take out the metal toxins. The rate of removal depends on how much lead is in the water. If Fragouli’s team started with water containing nine parts per million of lead — 360 times higher than most common amount found during the Flint water crisis — the foam could remove a third of the contamination in 30 minutes. Though promising, Fragouli said more research is needed to determine if the foam can obtain lead and mercury levels appropriate for drinking, especially with gunky water flowing through real-world pipes. So far, the sole field test occurred with wastewater from the IIT’s chemistry department, which contained a mixture of metal ions. “The results show that the metal ions of interest can be effectively removed,” Fragouli said.With the advent of molecular biology, nucleic acid testing (NAT) assays are becoming increasingly popular. These assays rely on the hybridization of synthetic oligonucleotide primers and/or probes targeting a nucleotide sequence of the organism(s) of interest. Highly sensitive NAT technologies, such as the widely used polymerase chain reaction (PCR), represent important tools in the field of molecular diagnostics. Since the discovery of PCR in 1983, numerous DNA-based assays targeting a wide variety of microbial pathogens have been developed (Nolte and Caliendo, 2003, Molecular detection and identification of microorganisms, p. 234-256, In Manual of Clinical Microbiology (8th ed.), Murray et al., American Society for Microbiology, Washington, D.C.; Lee et al. 1997, Nucleic Acid Amplification Technologies: Application to Disease Diagnosis, Biotechniques Books, Eaton Publishing, Boston, Mass.; Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich; Greenberg, 1994, PCR-based Diagnostics in Infectious Disease, Blackwell Scientific Publications, Boston, Mass.). Many of these NAT assays have been designed for microbial detection directly from clinical, environmental or food samples, which are known to contain inhibitors of NAT assays. Over the years, a variety of procedures performed from a variety of test samples for concentration and/or purification of cells or viral particles as well as for release, concentration and/or purification of nucleic acids have been developed. However, samples prepared by these procedures may still contain impurities that interfere with NAT assays. Numerous studies have demonstrated that many types of clinical, environmental and food specimens may contain substances interfering with nucleic acid amplification processes including PCR, ligase chain reaction (LCR), transcription-mediated amplification (TMA) and strand displacement amplification (SDA) (Courtney et al. 1999, Analytical Biochem. 270:249-256; Rosenstraus et. al., 1998, J. Clin. Microbiol. 36: 191-197; Morré et al. 1996, J. Clin. Microbiol. 34:3108-3114; Lee et al. 1997, Nucleic Acid Amplification Technologies: Application to Disease Diagnosis, Biotechniques, Books, Eaton Publishing, Boston, Mass.; Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich and Greenberg, 1994, PCR-based Diagnostics in Infectious Disease, Blackwell Scientific Publications, Boston, Mass.). Therefore, it is crucial to identify inhibitory test samples because negative test results may be attributable to inhibition of the NAT assay by impurities not eliminated, neutralized or inactivated by the protocol used for sample preparation. Inhibitory test samples can be identified by verifying the efficiency of amplification and/or detection of a nucleic acid target serving as a control. Such control may be external when the control nucleic acid is added to a portion of the sample tested in parallel for amplification and/or detection of the control target sequences while another portion of the sample is analyzed for amplification and/or detection of the analyte target sequences to be detected by the assay. Such control is called an “internal control (IC)” when both control target sequences and analyte target sequences are purified and/or detected in the same reaction vessel. More specifically, this internal control system provides an IC for amplification and/or detection (ICAD) of nucleic acids
[ 559, 187, 50268, 3, 1057, 417, 452, 247, 16204, 323, 436, 1673, 4479, 84, 4284, 273, 346, 559, 187, 50268, 3423, 15, 2877, 15, 22174, 558, 535, 50276, 3423, 15, 7152, 64, 13982, 426, 36196, 28, 187, 50276, 21962, 23062, 3233, 9, 3423, 558, 187, 50276, 3423, 15, 7955, 18115, 426, 1673, 15, 26059, 15, 48061, 1587, 7955, 18115, 2807, 3613, 28471, 28, 187, 50276, 15149, 13283, 64, 1590, 426, 1673, 15, 26059, 15, 48061, 1587, 13362, 3287, 187, 50276, 338, 313, 13362, 64, 1590, 10, 551, 187, 50274, 16065, 313, 881, 15, 4793, 64, 881, 10, 551, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 7999, 27, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 41092, 27, 551, 187, 50270, 338, 313, 9867, 16850, 11594, 1237, 9, 13362, 64, 1590, 1168, 22174, 15, 68, 64, 1344, 6649, 2295, 28471, 10, 187, 50268, 4756, 1587, 20920, 556, 2027, 5933, 323, 4567, 2372, 3510, 27, 346, 559, 187, 50262, 13362, 64, 1590, 1168, 22174, 558, 187, 50270, 7054, 28, 187, 50272, 94, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 39496, 27, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 4641, 14780, 27, 551, 187, 50270, 338, 313, 9867, 16850, 11594, 1540, 9, 13362, 64, 1590, 1168, 22174, 15, 68, 64, 1344, 6649, 2295, 28471, 10, 187, 50268, 4756, 1587, 20920, 556, 2027, 5933, 323, 6705, 2372, 3510, 27, 346, 559, 187, 50262, 13362, 64, 1590, 1168, 22174, 558, 187, 50270, 7054, 28, 187, 50272, 94, 187, 50272, 6986, 27, 187, 50270, 4756, 1587, 7483, 540, 13, 4770, 13, 1048, 285, 12130, 543, 941, 3510, 1329, 556, 2027, 23715, 187, 50274, 94, 187, 50276, 94, 187, 50276, 338, 313, 3423, 15, 7955, 18115, 3857, 1577, 64, 1545, 15, 20188, 10, 187, 50274, 4756, 1587, 5092, 626, 39638, 366, 4910, 275, 247, 1577, 3287, 187, 50276, 3423, 15, 17354, 426, 1673, 15, 26059, 15, 48061, 1587, 17354, 2807, 3613, 28471, 28, 187, 50276, 338, 313, 3423, 15, 17354, 3857, 313, 2855, 64, 1545, 15, 20188, 2785, 187, 50254, 1680, 29094, 9, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 10689, 187, 50274, 4756, 1587, 7483, 1327, 14, 41034, 4910, 275, 7180, 778, 320, 686, 17354, 8, 3287, 187, 50276, 3423, 15, 2364, 426, 1673, 15, 26059, 15, 48061, 1587, 2364, 2807, 3613, 28471, 28, 187, 50276, 338, 313, 3423, 15, 2364, 10, 551, 187, 50274, 338, 313, 2855, 64, 1545, 15, 7110, 64, 2364, 10, 187, 50272, 4756, 1587, 7483, 581, 1673, 778, 320, 873, 347, 686, 2364, 8, 3287, 187, 50274, 2855, 64, 1545, 15, 7110, 64, 2364, 426, 2032, 28, 187, 50274, 338, 6522, 2513, 29094, 9, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 1228, 551, 187, 50272, 3423, 15, 17354, 426, 2032, 28, 187, 50272, 338, 313, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 24458, 10, 187, 50270, 4756, 1587, 8, 2364, 8, 1673, 1364, 320, 2876, 390, 13434, 1511, 3287, 187, 50274, 94, 187, 50276, 94, 187, 50276, 15149, 20494, 426, 1673, 15, 26059, 15, 48061, 1587, 47628, 64, 22829, 11023, 3287, 187, 50276, 338, 313, 47628, 10, 551, 187, 50274, 338, 313, 47628, 1168, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 24458, 10, 187, 50272, 4756, 1587, 47628, 64, 22829, 11023, 11104, 1364, 320, 247, 2876, 313, 783, 5230, 1511, 10, 3287, 187, 50274, 338, 313, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 55, 9649, 1372, 2785, 187, 50270, 3423, 15, 2877, 15, 881, 15, 10531, 3613, 378, 9434, 64, 10560, 64, 54, 15843, 10, 187, 50272, 4756, 1587, 47628, 64, 22829, 11023, 11104, 778, 760, 4647, 281, 247, 4972, 273, 12980, 90, 442, 3287, 187, 50274, 605, 831, 588, 2847, 271, 2228, 604, 253, 5230, 1511, 273, 253, 20494, 6507, 11023, 187, 50274, 605, 3589, 626, 2931, 11358, 15, 187, 50274, 48061, 9395, 21772, 9, 47628, 1168, 22174, 558, 187, 50276, 94, 535, 50276, 338, 313, 881, 3423, 10, 551, 187, 50274, 605, 1310, 436, 1673, 310, 247, 8083, 13, 285, 352, 556, 247, 13542, 7922, 2654, 13, 187, 50274, 605, 253, 8356, 2879, 1511, 1673, 943, 452, 271, 2654, 347, 973, 313, 1171, 427, 428, 337, 481, 187, 50274, 15149, 27617, 426, 1673, 15, 26059, 15, 48061, 1587, 301, 3287, 187, 50274, 338, 313, 9573, 10, 551, 187, 50272, 15149, 2654, 426, 387, 10986, 9, 9573, 1168, 22174, 15, 68, 64, 1344, 6020, 187, 50272, 15149, 821, 426, 747, 11740, 1874, 187, 50272, 1208, 1168, 881, 426, 27617, 1168, 881, 28, 187, 50272, 1208, 1168, 22174, 426, 21046, 21395, 9, 301, 428, 337, 558, 187, 50272, 881, 3423, 1168, 26059, 15, 4717, 1587, 301, 995, 821, 558, 187, 50274, 94, 187, 50276, 94, 535, 50276, 42049, 2073, 28, 5137, 187, 94, 187, 187, 4353, 367, 9332, 1450, 21962, 6693, 3902, 9, 3902, 708, 1208, 13, 7327, 4612, 475, 3423, 13, 1979, 64, 85, 2885, 64, 3423, 79, 10, 551, 187, 50276, 16065, 313, 1208, 15, 881, 15, 4793, 64, 881, 10, 551, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 4037, 2449, 27, 551, 187, 50272, 8271, 9, 3423, 558, 187, 50272, 338, 6522, 5598, 64, 3423, 79, 2785, 187, 50268, 3423, 64, 9742, 4414, 2135, 5023, 9815, 1168, 2877, 15, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 3329, 7711, 10, 187, 50270, 4756, 1587, 33722, 1511, 1673, 1078, 436, 8083, 1318, 27, 346, 559, 1673, 1168, 1590, 558, 187, 50272, 15149, 15972, 64, 16159, 426, 387, 302, 29, 10790, 1018, 8743, 187, 50254, 50266, 3423, 64, 9742, 4414, 2135, 5023, 7053, 15, 22174, 15, 68, 64, 1344, 6020, 187, 50272, 15149, 15972, 64, 1208, 426, 821, 15, 881, 15, 14379, 64, 1545, 1168, 51, 28717, 48061, 9, 14379, 64, 16159, 558, 187, 50272, 338, 6522, 14379, 64, 1208, 10, 11759, 1587, 300, 7685, 1511, 2654, 323, 27, 346, 559, 1673, 1168, 1590, 558, 187, 50272, 21962, 3235, 9672, 14379, 64, 1208, 1168, 2855, 64, 1545, 13, 708, 1208, 15, 22174, 558, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 33284, 1647, 27, 187, 50272, 21962, 3235, 9672, 1208, 15, 881, 15, 2855, 64, 1545, 13, 708, 1208, 15, 22174, 558, 187, 50272, 7054, 28, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 24458, 27, 551, 187, 50272, 15149, 256, 426, 11104, 17540, 187, 50272, 42049, 9, 76, 11200, 2776, 29080, 558, 187, 50272, 1208, 15, 22174, 426, 21046, 21395, 9, 27136, 4414, 9395, 2776, 9, 84, 481, 80, 558, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 55, 9649, 1372, 27, 551, 187, 50272, 42049, 2073, 5013, 558, 187, 50272, 1208, 15, 22174, 426, 21046, 21395, 9, 21962, 15219, 9, 1208, 15, 881, 15, 15219, 2548, 30652, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 7999, 27, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 41092, 27, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 39496, 27, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 4641, 14780, 27, 551, 187, 50272, 338, 313, 3423, 3857, 1673, 1168, 26059, 15, 48061, 1587, 13362, 2807, 3857, 187, 50268, 9, 13763, 64, 2295, 465, 11200, 18483, 2785, 10669, 64, 2295, 465, 11200, 2776, 29080, 1228, 551, 187, 50270, 21962, 16850, 9, 1208, 13, 1673, 558, 187, 50272, 94, 2010, 551, 187, 50270, 21962, 21822, 3902, 9, 1208, 558, 187, 50272, 94, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 6986, 27, 187, 50272, 21962, 21822, 3902, 9, 1208, 558, 187, 50272, 7054, 28, 187, 50276, 94, 187, 94, 187, 187, 4353, 367, 9332, 1450, 6075, 14531, 21772, 9, 3474, 26253, 4612, 708, 2855, 64, 1545, 13, 1030, 11740, 708, 1208, 10, 551, 187, 50276, 8271, 9, 1208, 15, 22174, 15, 3985, 1082, 2295, 1577, 64, 1545, 15, 15845, 907, 558, 187, 50276, 27136, 4414, 42792, 9, 2855, 64, 1545, 15, 78, 989, 525, 558, 187, 50276, 27136, 4414, 37331, 16721, 9, 250, 22416, 64, 4008, 29, 3474, 4770, 25, 64, 85, 475, 8743, 1208, 15, 22174, 15, 68, 64, 1344, 35632, 187, 50257, 2855, 64, 1545, 15, 15845, 907, 558, 187, 50276, 27136, 4414, 4717, 21772, 13736, 9, 1208, 15, 10946, 13, 22074, 4414, 3633, 5496, 6020, 187, 94, 187, 187, 86, 10946, 64, 85, 367, 9332, 1450, 21962, 3235, 9, 3474, 26253, 4612, 708, 2855, 64, 1545, 13, 6268, 1450, 2703, 475, 2877, 10, 551, 187, 50276, 42049, 2073, 92, 5137, 187, 50276, 3281, 64, 85, 1673, 79, 426, 470, 28, 187, 50276, 1542, 313, 12723, 10, 551, 187, 50274, 338, 6048, 2, 30862, 64, 8456, 64, 2785, 2195, 3423, 79, 10, 3857, 1680, 9301, 2073, 15996, 1228, 2740, 28, 187, 50274, 8400, 1450, 2703, 1416, 426, 11104, 17540, 187, 50274, 338, 6522, 2513, 9301, 9, 76, 11200, 2776, 29080, 1228, 187, 50272, 42049, 9, 30862, 64, 8456, 64, 3736, 465, 11200, 2776, 29080, 1163, 465, 11200, 18483, 558, 187, 50274, 15149, 1673, 426, 1577, 64, 1545, 15, 15069, 15, 48061, 9, 1590, 558, 187, 50274, 338, 6522, 3423, 10, 11759, 1587, 29469, 1673, 27, 346, 559, 1416, 558, 187, 50274, 42049, 2073, 27, 5137, 187, 50274, 3902, 821, 426, 1673, 1168, 2877, 28, 187, 50274, 21962, 6693, 3902, 9, 1208, 13, 1673, 13, 1673, 79, 558, 187, 50274, 3281, 64, 85, 891, 426, 1673, 64, 9742, 4414, 3281, 1874, 187, 50274, 605, 11366, 38059, 16941, 14, 15227, 342, 2228, 14, 5903, 15, 187, 50274, 605, 1310, 4910, 403, 7616, 275, 1340, 13, 840, 436, 6287, 39852, 4745, 15, 187, 50274, 1542, 42744, 891, 2239, 1673, 64, 9742, 4414, 3281, 1082, 428, 1673, 79, 28, 891, 283, 10, 551, 187, 50272, 15149, 5368, 64, 3423, 426, 1673, 64, 9742, 14767, 74, 428, 337, 1570, 9815, 28, 187, 50272, 338, 313, 20137, 64, 3423, 2295, 1673, 10, 187, 50270, 4756, 1587, 3423, 873, 625, 685, 2378, 27, 346, 559, 1673, 1168, 1590, 558, 187, 50272, 338, 313, 20137, 64, 3423, 1168, 2877, 15, 10946, 654, 1673, 1168, 2877, 15, 10946, 10, 2740, 28, 187, 50274, 94, 187, 50274, 3423, 64, 9742, 4414, 14447, 9, 3423, 64, 9742, 4414, 2043, 1082, 559, 891, 13, 6268, 1450, 11145, 64, 13934, 9, 1208, 13, 1673, 4027, 187, 50274, 3423, 79, 14788, 187, 50274, 338, 313, 2513, 9301, 2073, 15996, 1228, 2740, 28, 187, 50274, 42049, 9, 1383, 5137, 187, 50276, 94, 187, 50276, 338, 313, 2855, 64, 1545, 15, 20188, 3857, 1673, 79, 3613, 1577, 64, 1545, 15, 15069, 15, 4642, 15, 3281, 6649, 187, 50274, 4756, 1587, 2855, 27, 3430, 1180, 273, 3302, 14460, 27, 346, 559, 1577, 64, 1545, 15, 1590, 558, 535, 50276, 15149, 1265, 426, 1577, 64, 1545, 15, 20188, 187, 50261, 32, 22074, 4414, 8252, 21772, 9, 2855, 64, 1545, 15, 78, 989, 525, 10, 187, 50261, 27, 22074, 4414, 8252, 3235, 1874, 535, 50276, 1542, 313, 3281, 64, 85, 1979, 426, 1577, 64, 1545, 15, 15227, 44678, 907, 3736, 13322, 9, 45242, 64, 41034, 64, 85, 10, 1163, 337, 28, 187, 50271, 3281, 28, 187, 50271, 3281, 1227, 30, 374, 10, 551, 187, 50274, 605, 3617, 949, 3603, 275, 8107, 13, 1580, 359, 1472, 3652, 253, 941, 24291, 15, 187, 50274, 1542, 313, 15149, 352, 426, 1673, 64, 9742, 4414, 83, 2043, 1874, 187, 50265, 262, 3613, 1673, 64, 9742, 4414, 83, 2043, 1082, 559, 1673, 79, 28, 12996, 262, 10, 551, 187, 50272, 15149, 708, 2877, 426, 352, 1168, 7053, 28, 187, 50272, 15149, 1673, 426, 352, 1168, 9815, 28, 187, 50272, 338, 6522, 2855, 64, 1545, 15, 15227, 44678, 907, 2785, 1979, 2295, 19662, 4527, 9, 2877, 15, 881, 15, 4793, 64, 881, 1228, 551, 187, 50270, 16065, 313, 2877, 15, 881, 15, 4793, 64, 881, 10, 551, 187, 50268, 4, 3182, 11953, 1194, 7817, 3269, 6117, 64, 10989, 9, 1400, 5529, 13, 5417, 45, 10560, 13, 7403, 7711, 13, 500, 10560, 13, 443, 10560, 13, 427, 10560, 13, 393, 187, 50266, 5736, 7711, 10, 393, 187, 50266, 5045, 378, 9434, 64, 10560, 64, 20263, 16449, 5529, 27, 393, 187, 50264, 27136, 4414, 14550, 9, 3423, 1168, 17333, 558, 393, 187, 50264, 338, 313, 2855, 64, 1545, 15, 20188, 10, 551, 393, 187, 50262, 27136, 4414, 37331, 7050, 9, 255, 302, 29, 30915, 8743, 2877, 15, 22174, 15, 68, 64, 1344, 30652 ]
+ " does not have a declaration for this field\'s default of " + field.value.constant); field.doc_comment = dc; ParseMetaData(field); field.deprecated = field.attributes.Lookup("deprecated") != nullptr; auto hash_name = field.attributes.Lookup("hash"); if (hash_name) { switch (type.base_type) { case BASE_TYPE_INT: case BASE_TYPE_UINT: { if (FindHashFunction32(hash_name->constant.c_str()) == nullptr) Error("Unknown hashing algorithm for 32 bit types: " + hash_name->constant); break; } case BASE_TYPE_LONG: case BASE_TYPE_ULONG: { if (FindHashFunction64(hash_name->constant.c_str()) == nullptr) Error("Unknown hashing algorithm for 64 bit types: " + hash_name->constant); break; } default: Error("only int, uint, long and ulong data types support hashing."); } } if (field.deprecated && struct_def.fixed) Error("can't deprecate fields in a struct"); field.required = field.attributes.Lookup("required") != nullptr; if (field.required && (struct_def.fixed || IsScalar(field.value.type.base_type))) Error("only non-scalar fields in tables may be 'required'"); field.key = field.attributes.Lookup("key") != nullptr; if (field.key) { if (struct_def.has_key) Error("only one field may be set as 'key'"); struct_def.has_key = true; if (!IsScalar(field.value.type.base_type)) { field.required = true; if (field.value.type.base_type != BASE_TYPE_STRING) Error("'key' field must be string or scalar type"); } } auto nested = field.attributes.Lookup("nested_flatbuffer"); if (nested) { if (nested->type.base_type != BASE_TYPE_STRING) Error("nested_flatbuffer attribute must be a string (the root type)"); if (field.value.type.base_type != BASE_TYPE_VECTOR || field.value.type.element != BASE_TYPE_UCHAR) Error("nested_flatbuffer attribute may only apply to a vector of ubyte"); // This will cause an error if the root type of the nested flatbuffer // wasn't defined elsewhere. LookupCreateStruct(nested->constant); } if (typefield) { // If this field is a union, and it has a manually assigned id, // the automatically added type field should have an id as well (of N - 1). auto attr = field.attributes.Lookup("id"); if (attr) { auto id = atoi(attr->constant.c_str()); auto val = new Value(); val->type = attr->type; val->constant = NumToString(id - 1); typefield->attributes.Add("id", val); } } Expect(';'); } void Parser::ParseAnyValue(Value &val, FieldDef *field, size_t parent_fieldn) { switch (val.type.base_type) { case BASE_TYPE_UNION: { assert(field); if (!parent_fieldn || field_stack_.back().second->value.type.base_type != BASE_TYPE_UTYPE) Error("missing type field before this union value: " + field->name); auto enum_idx = atot<unsigned char>( field_stack_.back().first.constant.c_str()); auto enum_val = val.type.enum_def->ReverseLookup(enum_idx); if (!enum_val) Error("illegal type id for: " + field->name); ParseTable(*enum_val->struct_def, &val.constant); break; } case BASE_TYPE_STRUCT: ParseTable(*val.type.struct_def, &val.constant); break; case BASE_TYPE_STRING: { auto s = attribute_; Expect(kTokenStringConstant); val.constant = NumToString(builder_.CreateString(s).o); break; } case BASE_TYPE_VECTOR: { Expect('['); val.constant = NumToString(ParseVector(val.type.VectorType())); break; } case BASE_TYPE_INT: case BASE_TYPE_UINT: case BASE_TYPE_LONG: case BASE_TYPE_ULONG: { if (field && field->attributes.Lookup("hash") && (token_ == kTokenIdentifier || token_ == kTokenStringConstant)) { ParseHash(val, field); } else { ParseSingleValue(val); } break; } default: ParseSingleValue(val); break; } } void Parser::SerializeStruct(const StructDef &struct_def, const Value &val) { assert(val.constant.length() == struct_def.bytesize); builder_.Align(struct_def.minalign); builder_.PushBytes(reinterpret_cast<const uint8_t *>(val.constant.c_str()), struct_def.bytesize); builder_.AddStructOffset(val.offset, builder_.GetSize()); } uoffset_t Parser::ParseTable(const StructDef &struct_def, std::string *value) { Expect('{'); size_t fieldn = 0; for (;;) { if ((!strict_json_ || !fieldn) && IsNext('}')) break; std::string name = attribute_; if (!IsNext(kTokenStringConstant)) Expect(strict_json_ ? kTokenStringConstant : kTokenIdentifier); auto field = struct_def.fields.Lookup(name); if (!field) Error("unknown field: " + name); Expect(':'); Value val = field->value; ParseAnyValue(val, field, fieldn); size_t i = field_stack_.size(); // Hardcoded insertion-sort with error-check. // If fields are specified in order, then this loop exits immediately. for (; i > field_stack_.size() - fieldn; i--) { auto existing_field = field_stack_[i - 1].second; if (existing_field == field) Error("field set more than once: " + field->name); if (existing_field->value.offset < field->value.offset) break; } field_stack_.insert(field_stack_.begin() + i, std::make_pair(val, field)); fieldn++; if (IsNext('}')) break; Expect(','); } if (struct_def.fixed && fieldn != struct_def.fields.vec.size()) Error("struct: wrong number of initializers: " + struct_def.name); auto start = struct_def.fixed ? builder_.StartStruct(struct_def.minalign) : builder_.StartTable(); for (size_t size = struct_def.sortbysize ? sizeof(largest_scalar_t) : 1; size; size /= 2) { // Go through elements in reverse, since we're building the data backwards. for (auto it = field_stack_.rbegin(); it != field_stack_.rbegin() + fieldn; ++it) { auto &value = it->first; auto field = it->second; if (!struct_def.sortbysize || size == SizeOf(value.type.base_type)) { switch (value.type.base_type) { #define FLATBUFFERS_TD(ENUM, IDLTYPE, CTYPE, JTYPE, GTYPE, NTYPE, \ PTYPE) \ case BASE_TYPE_ ## ENUM: \ builder_.Pad(field->padding); \ if (struct_def.fixed) { \ builder_.PushElement(atot<CTYPE>(value.constant.c_str()));
[ 370, 393, 3442, 426, 393, 4090, 9, 69, 2850, 5574, 2805, 64, 18, 13, 2490, 50273, 61, 7718, 13, 277, 2850, 5574, 2805, 2253, 437, 1009, 481, 3308, 1764, 16980, 92, 18, 1217, 47, 889, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 94, 68, 64, 79, 401, 9, 53, 768, 82, 64, 18, 9, 79, 40047, 7718, 13, 53, 768, 82, 2253, 437, 9, 79, 27232, 426, 2490, 50273, 61, 16980, 92, 18, 1217, 47, 889, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 94, 68, 64, 79, 299, 768, 19, 61, 2059, 891, 367, 9, 79, 40227, 534, 14280, 281, 5058, 13, 407, 313, 12211, 481, 187, 187, 2042, 3019, 57, 13, 308, 1009, 310, 417, 273, 15539, 14, 3431, 6713, 6637, 13, 253, 13148, 3580, 273, 15539, 14, 70, 3855, 20619, 1335, 13905, 247, 749, 20190, 273, 370, 330, 9, 57, 2850, 437, 10, 13355, 7850, 14230, 310, 247, 4581, 24822, 273, 370, 330, 9, 57, 2850, 437, 10, 20795, 326, 359, 9173, 407, 370, 36, 64, 53, 9, 57, 2850, 437, 3822, 380, 6452, 273, 6899, 575, 1447, 7801, 27, 18, 696, 4558, 2032, 323, 512, 370, 39, 5, 275, 370, 36, 64, 53, 9, 57, 2850, 437, 3822, 187, 187, 3463, 253, 2022, 10012, 275, 1008, 883, 20227, 7330, 8402, 1092, 370, 393, 1991, 92, 59, 2000, 81, 426, 353, 393, 6837, 378, 370, 313, 3431, 16662, 8083, 10, 835, 370, 353, 370, 310, 247, 28465, 8083, 273, 387, 954, 1385, 1598, 1142, 8723, 5239, 370, 46, 64, 74, 5, 285, 1046, 1127, 275, 370, 35, 5, 310, 1599, 17755, 281, 581, 273, 8723, 5239, 275, 370, 46, 5, 313, 2887, 1008, 740, 20227, 6620, 5829, 408, 839, 62, 323, 253, 5426, 273, 1599, 21779, 582, 285, 1016, 42146, 370, 308, 61, 13777, 353, 64, 74, 393, 936, 353, 64, 74, 370, 310, 2057, 247, 6486, 5880, 390, 310, 27442, 281, 271, 6240, 5145, 15, 1893, 13, 370, 308, 393, 13777, 353, 64, 74, 393, 936, 353, 64, 74, 370, 556, 13358, 6637, 13, 891, 15, 70, 15, 15539, 14, 3431, 6713, 6637, 273, 1340, 370, 18, 1352, 3308, 6556, 323, 512, 370, 1269, 393, 249, 353, 64, 74, 1366, 407, 6899, 575, 1447, 7801, 27, 18, 4207, 1198, 370, 1269, 393, 249, 378, 20795, 359, 476, 5276, 347, 275, 1008, 740, 20227, 6620, 5829, 408, 839, 62, 313, 2887, 253, 990, 273, 253, 4737, 273, 6899, 337, 275, 1008, 740, 20227, 6620, 5829, 408, 839, 2498, 187, 187, 510, 1072, 906, 275, 24297, 575, 1447, 7801, 27, 21, 696, 6556, 323, 370, 81, 2911, 18535, 8062, 2931, 407, 8870, 3470, 342, 1175, 5141, 13, 984, 247, 8723, 14717, 310, 671, 8058, 323, 824, 8062, 275, 905, 26, 4207, 28285, 326, 667, 8870, 1159, 669, 2162, 393, 249, 393, 1991, 92, 50, 2000, 81, 60, 91, 8795, 1907, 1175, 5141, 310, 370, 18, 2911, 45, 2824, 37913, 5415, 327, 253, 27266, 1386, 669, 1991, 92, 49, 2306, 18, 1035, 1991, 92, 50, 2000, 81, 1009, 27, 1764, 2859, 1035, 2162, 9, 49, 64, 18, 10853, 2162, 9, 49, 64, 19, 1228, 393, 282, 393, 2859, 9, 49, 64, 18, 13, 367, 64, 19, 1572, 3362, 393, 1156, 92, 1542, 512, 370, 49, 18, 13, 367, 19, 393, 249, 393, 1991, 92, 49, 2306, 18, 1035, 1991, 92, 50, 2000, 81, 1009, 2138, 835, 669, 2859, 1035, 3830, 13, 393, 3830, 1009, 310, 253, 475, 1033, 16635, 7982, 11, 327, 669, 1991, 92, 49, 2306, 18, 1035, 1991, 92, 50, 2000, 81, 1009, 313, 2887, 1008, 1731, 17525, 332, 1342, 8602, 274, 23343, 268, 15, 3046, 2498, 187, 187, 16628, 247, 749, 6320, 3425, 370, 5081, 2981, 64, 79, 10, 370, 327, 247, 5912, 2317, 370, 5081, 4153, 13, 393, 10609, 92, 34, 2023, 393, 1991, 92, 49, 2311, 370, 285, 247, 6486, 3425, 273, 5951, 251, 7480, 21783, 273, 370, 256, 370, 4903, 370, 269, 64, 79, 9, 85, 64, 18, 1337, 7718, 13, 85, 64, 84, 10, 370, 273, 1340, 1679, 685, 390, 4503, 281, 427, 15, 2635, 1908, 253, 3632, 5951, 251, 7480, 14189, 3318, 49, 9, 85, 10, 426, 393, 2204, 578, 79, 889, 2981, 64, 79, 269, 64, 79, 9, 85, 11127, 1707, 4961, 271, 7880, 3638, 370, 36, 2239, 470, 5, 824, 326, 1764, 1968, 92, 2574, 27, 460, 82, 18, 14, 20, 94, 187, 50274, 61, 1991, 92, 49, 889, 1274, 1035, 93, 49, 6087, 2253, 3259, 393, 282, 330, 61, 2609, 92, 84, 61, 2204, 6087, 71, 64, 79, 6087, 2253, 3259, 63, 19, 61, 2808, 427, 94, 393, 918, 10, 393, 282, 393, 16980, 92, 18, 1217, 47, 63, 19, 10878, 844, 3730, 436, 11370, 347, 11573, 5308, 14, 15426, 358, 14, 44, 1240, 1351, 11370, 2479, 746, 76, 1240, 1351, 15117, 8826, 62, 268, 15, 5571, 13, 6899, 495, 15, 2594, 1008, 805, 20227, 9755, 460, 9896, 614, 62, 323, 247, 1027, 4737, 285, 247, 26647, 481, 378, 2355, 327, 436, 11370, 13, 359, 476, 5276, 253, 6452, 347, 3637, 15, 187, 187, 1231, 452, 281, 5276, 326, 323, 2761, 512, 370, 393, 3151, 393, 249, 393, 4153, 370, 285, 323, 512, 21783, 370, 367, 393, 249, 393, 1991, 92, 51, 11326, 91, 21828, 359, 452, 1764, 1968, 92, 2574, 27, 20, 14, 18, 94, 2490, 50274, 61, 2815, 578, 47, 61, 936, 61, 3259, 94, 393, 16980, 92, 18, 1217, 47, 94, 393, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 299, 768, 19, 61, 2059, 891, 49, 9, 79, 3117, 426, 470, 4700, 1281, 370, 69, 426, 277, 2850, 5574, 367, 5, 320, 253, 4248, 273, 370, 367, 370, 285, 370, 367, 9, 89, 10, 426, 393, 2204, 578, 75, 30, 17, 2306, 69, 246, 64, 75, 89, 63, 75, 370, 342, 3019, 85, 64, 17, 13, 246, 64, 18, 1337, 7718, 13, 246, 64, 69, 10, 393, 249, 2490, 50274, 61, 1991, 92, 51, 1990, 69, 12, 18, 94, 13355, 2635, 3318, 70, 768, 19, 61, 2059, 891, 49, 9, 79, 3117, 426, 299, 768, 19, 61, 2059, 891, 9, 85, 64, 17, 12, 246, 64, 18, 295, 12, 393, 7718, 559, 246, 64, 17915, 63, 69, 3117, 426, 27, 269, 64, 79, 9, 85, 64, 17, 13, 85, 64, 18, 1337, 7718, 13, 85, 64, 69, 11127, 844, 2743, 370, 71, 64, 79, 5, 347, 247, 5951, 251, 7480, 14189, 273, 370, 69, 559, 337, 5, 4903, 13, 273, 4248, 370, 18, 559, 295, 559, 393, 7718, 559, 295, 63, 69, 393, 282, 2490, 50274, 9, 69, 559, 337, 10, 47, 63, 69, 1352, 3308, 1764, 8403, 61, 10423, 578, 49, 61, 249, 393, 1991, 92, 51, 2000, 69, 60, 91, 44479, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 367, 9, 79, 7398, 918, 93, 426, 2490, 50270, 61, 4090, 61, 10423, 578, 85, 61, 249, 393, 1991, 92, 53, 1990, 69, 12, 18, 599, 393, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 71, 64, 79, 9, 85, 1572, 918, 93, 4700, 45356, 326, 370, 11045, 71, 64, 79, 43654, 3259, 94, 426, 337, 13355, 2896, 11573, 5308, 14, 15426, 358, 14, 44, 1240, 1351, 11370, 669, 2574, 709, 92, 2574, 27, 460, 82, 18, 14, 20, 3303, 359, 452, 1764, 1991, 92, 49, 889, 1274, 9, 393, 8403, 61, 10423, 578, 49, 61, 249, 393, 1991, 92, 51, 2000, 69, 60, 91, 44479, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 367, 9, 79, 7398, 918, 93, 2490, 50274, 61, 463, 330, 9, 69, 12, 18, 1572, 2609, 11065, 69, 12, 18, 10, 47, 61, 2808, 427, 889, 918, 1572, 282, 393, 16980, 92, 18, 1217, 47, 63, 19, 10878, 2635, 13, 407, 42967, 14, 36, 386, 13890, 18057, 13, 323, 2761, 512, 669, 3151, 1366, 1764, 8403, 61, 10423, 578, 49, 61, 249, 393, 1991, 92, 51, 2000, 69, 60, 91, 44479, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 367, 9, 79, 7398, 918, 93, 426, 473, 1035, 2609, 92, 47, 61, 2808, 427, 43214, 3932, 370, 69, 29789, 84, 403, 43998, 13, 436, 8018, 964, 187, 187, 1231, 452, 2686, 8058, 326, 2761, 13353, 1764, 16980, 92, 18, 1217, 47, 889, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 891, 367, 9, 79, 3117, 426, 473, 578, 69, 1337, 3151, 889, 1274, 1035, 2609, 464, 16980, 464, 2808, 427, 1217, 47, 599, 393, 918, 16489, 835, 253, 3638, 3206, 275, 370, 48, 5, 310, 6447, 323, 512, 21783, 273, 4248, 1679, 685, 690, 4229, 370, 69, 1352, 496, 643, 3000, 13, 352, 7024, 760, 327, 253, 4248, 370, 69, 5, 285, 327, 669, 3151, 1352, 187, 187, 6080, 16157, 187, 7770, 187, 187, 18, 15461, 388, 18272, 285, 2956, 610, 1008, 1047, 73, 18272, 28403, 8402, 62, 11096, 616, 1263, 273, 15539, 14, 3431, 6713, 2718, 281, 8723, 1728, 29675, 285, 597, 1160, 253, 13260, 326, 253, 985, 310, 9106, 8723, 285, 556, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 15, 1198, 776, 4468, 13, 352, 310, 417, 3309, 281, 1056, 841, 13260, 15, 187, 187, 39418, 253, 2317, 370, 57, 5, 310, 4802, 15, 2635, 253, 7221, 1319, 273, 370, 53, 5, 8018, 8356, 253, 2264, 7221, 1319, 15, 6166, 253, 4465, 9376, 326, 627, 310, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 13, 247, 8723, 1728, 11923, 273, 15539, 14, 3431, 6713, 6637, 1364, 320, 22506, 21651, 23329, 285, 9106, 21651, 23329, 313, 28892, 575, 18, 285, 6899, 575, 19, 275, 1008, 1047, 73, 18272, 28403, 8402, 6660, 285, 767, 8723, 1728, 29675, 273, 15539, 14, 3431, 6713, 6637, 403, 27442, 36714, 616, 2718, 273, 15539, 14, 70, 3855, 8858, 403, 6425, 313, 28892, 495, 275, 1008, 1047, 73, 18272, 28403, 8402, 2498, 733, 310, 3477, 281, 923, 326, 253, 2264, 7221, 1319, 8018, 642, 20223, 273, 6486, 1340, 15, 2635, 3019, 57, 13, 53, 1009, 556, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 604, 370, 1594, 370, 310, 4802, 285, 370, 53, 5, 310, 8723, 15, 187, 187, 1231, 1053, 457, 85, 5467, 326, 370, 57, 5, 310, 4802, 15, 831, 4483, 441, 281, 2486, 4722, 8062, 327, 33817, 8470, 15, 3856, 310, 271, 47386, 1650, 15, 1281, 441, 1908, 271, 29438, 985, 370, 308, 89, 426, 4589, 12, 67, 370, 327, 253, 5818, 669, 1991, 92, 59, 2000, 81, 5, 273, 370, 81, 2911, 18535, 20935, 13, 342, 370, 247, 13, 67, 393, 249, 393, 1991, 92, 59, 2000, 81, 13355, 733, 310, 973, 1929, 326, 370, 53, 5, 310, 8723, 36714, 370, 66, 426, 337, 393, 2307, 268, 5, 285, 370, 270, 393, 570, 470, 393, 2307, 268, 370, 313, 2887, 1008, 19, 266, 1225, 249, 7857, 46188, 28, 1214, 26, 20227, 8602, 30862, 2498, 6166, 253, 9376, 370, 247, 426, 337, 393, 2307, 268, 370, 285, 370, 270, 393, 570, 470, 393, 2307, 268, 1366, 253, 8062, 370, 53, 5, 310, 8723, 285, 22506, 21651, 23329, 285, 352, 556, 13358, 6637, 905, 740, 4207, 1292, 370, 53, 5, 310, 417, 9106, 8723, 285, 417, 9106, 21651, 23329, 2057, 313, 12157, 370, 53, 63, 78, 5, 310, 417, 8723, 672, 370, 278, 426, 470, 393, 2307, 268, 370, 582, 285, 512, 253, 20223, 273, 370, 53, 5, 403, 273, 6486, 1340, 2, 187, 187, 19, 15461, 733, 369, 671, 8058, 407, 388, 18272, 285, 2956, 610, 1008, 1047, 73, 18272, 28403, 8402, 62, 326, 762, 253, 9079, 326, 627, 310, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 13, 247, 8723, 1728, 11923, 273, 15539, 14, 3431, 6713, 6637, 476, 320, 6607, 347, 271, 29438, 9261, 273, 247, 8566, 31106, 1387, 15, 6899, 575, 19, 275, 1008, 1036, 1689, 609, 28355, 2843, 460, 62, 3054, 326, 604, 627, 4961, 247, 9106, 8723, 29438, 9261, 327, 247, 8566, 31106, 1387, 13, 253, 1387, 1364, 320, 4802, 15, 11826, 609, 285, 2956, 610, 8058, 275, 1008, 1166, 1689, 609, 28355, 2843 ]
$ \Delta = \max(d^\circ q_1, \cdots, d^\circ q_\ell)$). Thus $$\dfrac{1}{N}\sum_{n=0}^{N-1}c_n F(T^{q_1(n)},\cdots,T^{q_\ell(n)}) = \dfrac{1}{N}\sum_{n=0}^{N-1}c_n e^{2\pi i P(n)}$$ which tends to zero, by (iii). If $(X, T)$ is not of quasi-discrete spectrum, the tensor products of quasi-eigenfunctions still span a subalgebra of $ C(X^\ell) $. Its closure is a closed subspace of $ C(X^\ell) $, that we denote by $C_T(X^\ell)$. The conclusion of Theorem \[thm:1\] remains true for all $F$ in $C_T(X^\ell)$. By the main theorem in [@11fan2011minimal], $ \mathbb{Z}_p = M \cup B $ (disjoint union) where $ M $ is a disjoint union of at most countably many minimal sets $M_i$ and every point in $B$ is mean attracted to one of minimal sets in $M$ (see [@10fan2015oscillating] for the definition of mean attraction), and each subsystem $ T\colon M_i \to M_i $ is either a finite cycle or is conjugate to an adding machine. So, $ T \colon M_i \to M_i $ has discrete spectrum, i.e. quasi-discrete spectrum of order $1$. Thus holds for all $ x \in M_i$, by Theorem \[thm:1\]. For $ x \in B $, we can prove as in [@10fan2015oscillating] (see the end of the proof of Theorem 1 in [@10fan2015oscillating]). The same result in Corollary \[thm:4\] holds for $p$-adic dynamics defined by rational functions with good reduction, because a minimal decomposition is also proved for such dynamics in \[9\]. Recall that any rational function $\phi \in \mathbb{Q}_p[z]$ having good reduction is $1$-Lipschitz continuous on the projective line $\mathbb{P}^1(\mathbb{Q}_p)$: $$\rho(\phi(P_1),\phi(P_2)) \le \rho(P_1, P_2)\quad \text{for all $P1, P2 \in \mathbb{P}^1(\mathbb{Q}_p)$}$$ where $\rho(\cdot, \cdot)$ is the *spherical metric* on $\mathbb{P}^1(\mathbb{Q}_p)$ (see [@26silverman2007arithmetic p.59]). Consider a subnormal sequence $ (\xi_n) $ on a probability space $ (\Omega, \mathscr{A}, \mathbb{P}) $ and a finite sequence of trigonometric polynomials of $ s $ variables $ f_n(t_1,\cdots,t_s) $ of order less than or equal to N. Then consider the random trigonometric polynomial $$P(t) = \sum_{n}\xi_n f_n(t).$$ There exists an absolute constant $C > 0$ such that $$\label{eq:ineq1-3} \mathbb{P}\left(\|P\|_\infty \le C\sqrt{s\sum\|f_n\|_\infty^2\log N} \right) \le \dfrac{1}{N^2}.$$ We refer this inequality as Littlewood-Salem-Kahane inequality ([@19kahane1985some] p. 70, Theorem 3. See [@12fan2003inegalite] for a different proof and a generalization). Basing on this inequality, we can prove the conclusion as follows. We have to prove that for almost all $ \omega \in \Omega $ and for all polynomials $ P \in \mathbb{R}[z]$, we have $$\label{eq:3-1} \lim_{N\to\infty} \dfrac{1}{N} \sum_{n=0}^{N-1}\xi_n(\omega) e^{2\pi iP(n)} = 0.$$ Let $d = d^\circ P$ be the degree of $ P $ and $ P(x) = \sum_{j=0}^d t_jx^j $ with $(t_0, t_1,\cdots, t_d) \in \mathbb{R}^{d+1} $. Then $$e^{2\pi iP(n)} = e^{2\pi i(t_0+ t_1 n+ \cdots + t_dn^d)} =: f_n(t_0,t_1,\cdots,t_d).$$ We regard $f_n$ as a trigonometric polynomial of $d + 1$ variables, of degree $1 + n + \cdots + n^d \le (d + 1)N^d$. Thus $$\sup\limits_{P\in \mathbb{R}_d[z]}\left|\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi P(n)}\right| = \max\limits_{t\in \mathbb{T}^{d+1}} \left|\sum_{n=0}^{N-1}\xi_n(\omega)f_n(t)\right|.$$ Observe that $ \|f_n\|_{\infty} = 1 $. By Littlewood-Salem-Kahane inequality $\eqref{eq:ineq1-3}$, we have $$\mathbb{P}\left( \sup\limits_{P\in \mathbb{R}_d[z]}\left|\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi P(n)}\right| \ge C(d+1)\sqrt{(d+1)N\log N}\right)\le \dfrac{1}{N^2}.$$ Then, by Borel-Cantelli lemma, for almost all $\omega$, $$\sup\limits_{P\in \mathbb{R}_d[z]}\left|\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi P(n)}\right| = O(\sqrt{N\log N}).$$ Since $d$’s are countable, this implies . We have actually proved that almost surely $$\dfrac{1}{N}\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi i P(n)} = O_{d,\omega}\left(\sqrt{\dfrac{\log N}{N}} \right),$$ where the constant involved in $O$ is uniform for all polynomials of degree less than some fixed $d$. In other words, it depends only on the degree $d$ and on $\omega$. Some remarks ============ 1\. Hahn and Parry [@14hahn1965minimal] restricted their study of quasi-discrete systems to minimal homeomorphisms and they made the assumptions that the system is totally minimal and has no non-trivial eigenvalues of finite order. For our concern, it is not necessary to make these assumptions. Assume the space $X$ is connected. Then the minimality of $T$ implies automatically the total minimality. Under the extra assumption that there is no non-trivial eigenvalues of finite order, a minimal homeomorphism of quasi-discrete spectrum must be uniquely ergodic and totally ergodic (Theorem 1 and Theorem 2 in [@14hahn1965minimal]), and two minimal homeomorphisms of quasi-discrete spectrum are conjugate iff their systems of quasi-eigenvalues are equivalent (Theorem 3 in [@14hahn1965minimal]). It is easy to see that the total minimality implies no eigenvalues of finite order. Then $(X,T)$ has no non-trivial eigenvalues of finite order if $ X $ is connected and $T$ is minimal. We don’t assume that $X$ is connected. This allows us to include interesting dynamics on disconnected spaces. Here is an illustrative example. Let us consider an affine system $ Tx = ax+b $ on the ring $\mathbb{Z}_p$ of $p$-adic integers, with $ a,b \in \mathbb{Z}_p $. It is well known that $T$ is minimal iff $a = 1 \mod p$ and $ b \ne 0 \mod p $ (see [@2anashin2009applied; @9fan2007strict]). Under the assumption $ a = 1 \mod p $ and $ b \ne 0 \mod p$, the dynamics $T$ is minimal and uniquely ergodic and it has discrete spectrum \[10\]. But $T$ is not totally minimal and not totally ergodic either (because $T^m$ is not minimal when $ m = 0 \mod p $), and all the eigenvalues of $T$ are of finite order! 2\. It was also proved by Hahn and Parry [@14hahn1965minimal] that under the hypothesis that there is no non-trivial eigenvalues of finite order, a minimal homeomorphism of quasi-discrete spectrum can be represented as an affine transformation of a compact abelian group. Theorem 2 in [@16hoare1966affine] states that if there exists a totally minimal affine transformation on a compact abelian group, the group must be connected. Hoare and Parry proved in [@17hoare1966aff
[ 22, 61, 2260, 1352, 1198, 1781, 3302, 8789, 4757, 669, 4153, 2253, 2690, 92, 4478, 3303, 253, 10896, 28604, 1673, 556, 1652, 1055, 15, 1284, 669, 4153, 2253, 2690, 92, 4478, 724, 310, 17892, 13, 2299, 13, 359, 923, 247, 14138, 23279, 273, 253, 19501, 673, 534, 10140, 281, 253, 11653, 273, 15316, 8770, 15, 32032, 417, 11120, 5393, 403, 253, 1072, 347, 275, 544, 1470, 15, 575, 1447, 8209, 27, 909, 2582, 2369, 2582, 4762, 1765, 29013, 905, 8209, 27, 1641, 272, 2582, 2369, 2582, 4762, 1765, 696, 45507, 1470, 19, 64, 19, 15, 2265, 10, 187, 187, 1466, 441, 9173, 347, 669, 3115, 18636, 253, 673, 387, 534, 669, 4153, 578, 1508, 724, 11711, 2510, 13, 253, 4869, 673, 359, 476, 1902, 776, 802, 1427, 281, 1408, 15, 844, 4044, 669, 3115, 18636, 347, 253, 8004, 673, 387, 534, 253, 12619, 275, 544, 14739, 15, 575, 7748, 19090, 27, 43, 1508, 11546, 46468, 27309, 13, 285, 7484, 352, 275, 544, 1470, 15, 575, 1447, 8209, 27, 1641, 272, 2582, 2369, 2582, 4762, 1765, 29013, 66, 347, 247, 1159, 273, 253, 4983, 8789, 669, 4153, 2253, 2690, 92, 4478, 724, 323, 1027, 2193, 273, 669, 2733, 1352, 1198, 669, 2733, 5, 275, 253, 2491, 370, 17, 15, 19, 61, 2260, 393, 20089, 393, 2733, 393, 20089, 470, 15, 25, 61, 2260, 1366, 6890, 669, 2733, 5, 1057, 417, 6990, 253, 669, 3115, 18636, 1077, 1199, 15, 1723, 13, 3629, 669, 2733, 5, 1840, 370, 17, 15, 25, 61, 2260, 5, 5644, 281, 247, 1534, 5926, 275, 4869, 802, 1427, 673, 28, 359, 10018, 2074, 8770, 323, 11052, 669, 2733, 393, 20089, 470, 15, 19, 1352, 844, 476, 4044, 247, 2969, 11193, 281, 253, 19501, 673, 407, 4758, 253, 49421, 2426, 275, 253, 12619, 273, 544, 14739, 15, 575, 7748, 19090, 27, 43, 1508, 11546, 46468, 281, 5058, 15, 831, 4245, 1764, 3115, 3503, 393, 9887, 187, 50276, 61, 1124, 92, 187, 50274, 61, 2733, 464, 1274, 9, 337, 428, 393, 4153, 2253, 2690, 92, 4478, 2306, 19, 393, 918, 3117, 187, 50276, 1217, 187, 50274, 1035, 4153, 2253, 2690, 92, 4478, 889, 2260, 4800, 19, 187, 50276, 94, 187, 50276, 61, 1968, 92, 19090, 27, 1641, 272, 94, 187, 50276, 11227, 3588, 323, 669, 4153, 2253, 2690, 92, 4478, 94, 393, 620, 337, 1352, 496, 253, 7285, 9459, 13, 669, 4153, 2253, 2690, 92, 4478, 889, 1266, 337, 1366, 359, 4044, 271, 5795, 11193, 1764, 3115, 3503, 393, 9887, 187, 50274, 61, 2733, 187, 50276, 16, 187, 50274, 61, 4153, 2253, 2690, 92, 4478, 2306, 19, 187, 50276, 61, 1968, 92, 19090, 27, 1641, 272, 19, 94, 187, 50276, 11227, 407, 16122, 253, 12619, 281, 806, 1340, 275, 673, 13, 285, 4758, 253, 906, 4503, 281, 5058, 15, 6295, 841, 12091, 403, 1175, 34754, 275, 616, 9056, 4811, 273, 13091, 347, 2011, 275, 544, 1470, 15, 575, 1447, 8209, 27, 1641, 272, 2582, 2369, 2582, 4762, 1765, 29013, 66, 15, 187, 187, 4509, 253, 7787, 273, 24118, 15, 575, 7748, 19090, 27, 1641, 272, 9014, 3891, 19090, 27, 1641, 272, 19, 9014, 347, 973, 347, 432, 253, 2120, 1543, 275, 544, 1470, 15, 575, 1447, 8209, 27, 1641, 272, 2582, 2369, 2582, 4762, 1765, 29013, 66, 13, 359, 923, 326, 253, 11360, 8770, 273, 253, 19501, 673, 669, 3115, 18636, 310, 271, 16851, 13642, 342, 669, 4153, 2253, 2690, 92, 4478, 11444, 19, 3363, 3308, 13, 275, 8063, 13, 359, 476, 1900, 23240, 776, 3302, 8789, 4757, 281, 8046, 253, 802, 1427, 281, 3835, 667, 673, 7726, 273, 1600, 15, 1723, 13, 2403, 669, 4153, 2253, 2690, 92, 4478, 724, 29607, 1355, 310, 417, 1293, 2105, 27, 253, 3302, 2193, 273, 253, 2603, 285, 16338, 7625, 2424, 407, 253, 802, 1427, 403, 1764, 2162, 64, 17, 9, 17, 10, 426, 393, 1124, 10241, 74, 393, 2733, 393, 2162, 2850, 2690, 92, 42, 2000, 18, 9, 17, 15734, 4153, 2253, 2690, 92, 4478, 599, 187, 50275, 61, 3362, 187, 50275, 61, 2690, 92, 395, 94, 187, 50275, 61, 3362, 187, 50275, 61, 2162, 64, 20, 9, 17, 10, 426, 393, 1124, 92, 74, 393, 2733, 393, 2162, 2850, 2690, 92, 42, 2000, 19, 9, 17, 15734, 4153, 2253, 2690, 92, 4478, 599, 187, 50275, 61, 1968, 92, 19090, 27, 19078, 2162, 94, 187, 50275, 4700, 187, 187, 7542, 253, 2264, 5912, 310, 417, 6221, 275, 253, 20629, 1588, 92, 5736, 20977, 14, 39617, 24822, 13, 359, 4853, 253, 20629, 1588, 92, 5736, 20977, 14, 39617, 6919, 275, 2426, 273, 253, 7625, 370, 81, 64, 74, 30, 3577, 2162, 64, 74, 10819, 19, 5, 347, 3318, 83, 393, 8275, 393, 30884, 464, 3115, 2704, 2690, 92, 1222, 599, 393, 1274, 60, 393, 1124, 92, 81, 64, 18, 1035, 3115, 8744, 81, 64, 19, 1035, 3115, 15734, 2204, 64, 74, 268, 64, 74, 1035, 3115, 7398, 918, 62, 187, 50276, 61, 1968, 92, 19090, 27, 24502, 9296, 94, 187, 50276, 4700, 831, 30599, 253, 5927, 5912, 273, 4560, 253, 985, 275, 253, 20629, 1588, 92, 5736, 20977, 14, 39617, 24822, 15, 831, 5426, 310, 17194, 407, 271, 5661, 7741, 2701, 1580, 15549, 253, 5912, 3268, 275, 512, 3054, 4916, 9592, 41049, 347, 20629, 1588, 92, 5736, 20977, 14, 39617, 6919, 4850, 4577, 15, 380, 20629, 1588, 92, 5736, 20977, 14, 39617, 6919, 310, 4503, 281, 370, 83, 14680, 30884, 464, 3115, 2704, 2690, 92, 1222, 3080, 14101, 295, 1035, 3115, 1933, 47, 64, 17, 1366, 835, 370, 79, 1035, 3115, 1009, 310, 253, 5222, 273, 544, 14739, 15, 575, 7748, 19090, 27, 79, 1033, 15897, 46468, 285, 370, 47, 64, 17, 426, 393, 2204, 64, 74, 268, 64, 74, 9, 17, 1009, 310, 253, 2264, 3072, 387, 673, 669, 3115, 30, 17, 1366, 534, 310, 247, 14900, 10671, 15, 12414, 10896, 28604, 285, 342, 13123, 3302, 2515, 13, 544, 14739, 15, 575, 7748, 19090, 27, 79, 1033, 15897, 46468, 285, 544, 14739, 15, 575, 7748, 19090, 27, 19078, 2162, 46468, 16084, 3318, 83, 426, 187, 50276, 61, 30884, 464, 3115, 2704, 2690, 92, 1222, 599, 187, 50276, 61, 1274, 60, 187, 50276, 61, 1124, 92, 187, 50274, 61, 2260, 63, 19, 428, 393, 2733, 63, 19, 61, 4752, 1035, 3115, 10, 187, 50276, 1217, 187, 50274, 18, 559, 5081, 2733, 6602, 4153, 2253, 2690, 92, 4478, 21161, 19, 187, 50276, 94, 187, 50276, 61, 918, 62, 187, 50276, 30, 187, 50275, 61, 1124, 92, 187, 50274, 18, 187, 50276, 1217, 187, 50275, 18, 559, 5081, 2733, 6602, 4153, 2253, 2690, 92, 4478, 21161, 19, 187, 50276, 94, 187, 50276, 61, 1968, 92, 19090, 27, 1109, 249, 94, 187, 50276, 4700, 496, 253, 2701, 669, 4153, 2253, 2690, 92, 4478, 27081, 2733, 393, 620, 337, 1366, 436, 4245, 370, 83, 393, 3549, 393, 4153, 2253, 2690, 92, 4478, 2306, 19, 1227, 393, 2733, 63, 19, 13355, 3308, 13, 11052, 669, 4153, 2253, 2690, 92, 4478, 724, 281, 9017, 253, 802, 1427, 673, 7933, 5644, 281, 247, 3969, 6379, 275, 253, 20629, 1588, 92, 5736, 20977, 14, 39617, 6919, 15, 187, 187, 8096, 446, 3396, 28604, 285, 253, 41510, 802, 1427, 7887, 905, 20869, 27, 4762, 1765, 696, 187, 15256, 822, 187, 187, 1231, 1024, 1908, 253, 2538, 273, 253, 10896, 28604, 8789, 1673, 15, 496, 436, 1083, 13, 24118, 15, 575, 7748, 19090, 27, 39540, 2574, 2224, 3851, 323, 669, 4153, 578, 520, 724, 285, 669, 4153, 578, 1508, 724, 513, 417, 34430, 713, 285, 359, 4044, 776, 1543, 949, 10704, 9554, 15, 187, 187, 2841, 575, 1447, 8209, 27, 1641, 272, 2582, 2369, 2582, 4762, 1765, 696, 67, 2722, 253, 19501, 673, 669, 3115, 18636, 273, 253, 802, 1427, 347, 247, 1159, 273, 253, 3302, 8789, 669, 4153, 2253, 2690, 92, 4478, 724, 323, 2067, 2193, 273, 253, 10896, 28604, 4757, 15, 1198, 1781, 669, 4153, 2253, 2690, 92, 4478, 3303, 253, 10896, 28604, 1057, 417, 3012, 2818, 253, 19501, 673, 15, 1723, 13, 347, 669, 4153, 2253, 2690, 92, 4478, 724, 12075, 13, 253, 19501, 673, 5459, 1919, 352, 9086, 11711, 2510, 387, 247, 1318, 326, 5459, 342, 253, 10896, 14, 250, 12642, 272, 4757, 15, 187, 187, 3138, 12278, 3339, 370, 81, 64, 17, 30, 3577, 2162, 64, 17, 10819, 19, 5, 313, 32448, 10, 285, 370, 81, 64, 20, 30, 3577, 2162, 64, 20, 10819, 19, 5, 313, 23706, 10, 347, 247, 1159, 273, 673, 323, 1027, 2193, 273, 370, 17, 61, 282, 393, 4153, 578, 2941, 94, 393, 282, 470, 15, 1762, 61, 2260, 5, 285, 643, 3602, 347, 275, 544, 1470, 15, 575, 1447, 8209, 27, 909, 2582, 2369, 2582, 4762, 1765, 696, 19181, 38078, 669, 4153, 578, 2941, 724, 12075, 253, 4583, 11786, 273, 370, 81, 64, 20, 5, 1919, 387, 253, 4619, 1318, 669, 4153, 578, 2941, 4203, 17, 15, 11494, 805, 61, 2260, 5, 253, 5880, 14, 11215, 2961, 2193, 273, 669, 4153, 578, 520, 724, 285, 669, 4153, 578, 1508, 724, 403, 3638, 285, 4503, 281, 581, 1529, 15, 496, 436, 1083, 359, 452, 15846, 15316, 3200, 1293, 10027, 15, 2726, 2007, 2572, 275, 669, 4153, 578, 2941, 3303, 370, 81, 64, 20, 5, 4916, 4067, 685, 370, 81, 64, 17, 5, 285, 275, 253, 1048, 14, 2606, 2701, 13, 359, 10018, 12321, 22957, 273, 253, 20629, 1588, 92, 5736, 20977, 14, 39617, 24822, 342, 642, 19501, 273, 253, 802, 1427, 15, 905, 8209, 27, 81, 2695, 2582, 3113, 2582, 4762, 1765, 696, 45507, 1470, 20, 15, 2265, 10, 187, 187, 2841, 575, 1447, 8209, 27, 81, 2695, 2582, 3113, 2582, 4762, 1765, 696, 2722, 253, 7625, 273, 253, 16338, 285, 2603, 2308, 347, 247, 1159, 273, 673, 323, 2067, 2193, 273, 253, 10896, 28604, 4757, 669, 4153, 578, 2941, 724, 285, 323, 4229, 3302, 8789, 669, 4153, 2253, 2690, 92, 4478, 94, 426, 470, 15, 1762, 61, 2260, 1352, 1284, 669, 4153, 578, 2941, 724, 310, 8523, 2559, 432, 5058, 13, 253, 10343, 273, 370, 81, 64, 20, 5, 342, 673, 4916, 3091, 1017, 15, 380, 2900, 17837, 1307, 8475, 342, 370, 81, 64, 20, 30, 17, 1366, 347, 275, 253, 669, 4153, 578, 2941, 4203, 17, 5, 1083, 15, 831, 9058, 7788, 1919, 253, 4619, 1318, 669, 4153, 578, 2941, 4203, 470, 15, 11494, 805, 61, 2260, 5, 273, 253, 10896, 28604, 4757, 310, 4925, 285, 253, 5880, 14, 11215, 2961, 27935, 273, 370, 81, 64, 17, 5, 285, 370, 81, 64, 20, 5, 403, 1097, 5058, 15, 2058, 436, 1127, 13, 253, 8770, 273, 253, 7625, 310, 15846, 15316, 28, 597, 1620, 5926, 281, 5058, 285, 253, 8789, 669, 4153, 578, 1508, 724, 1057, 417, 11711, 463, 15, 1198, 2568, 4067, 2193, 273, 669, 4153, 578, 2941, 724, 253, 7625, 8107, 1340, 824, 326, 370, 81, 64, 20, 31, 81, 64, 17, 1366, 285, 13, 275, 253, 1048, 14, 2606, 2701, 13, 2489, 15316, 2378, 969, 15, 380, 802, 2907, 20629, 1588, 92, 5736, 20977, 14, 39617, 8062, 403, 3451, 323, 512, 2069, 672, 669, 4153, 578, 2941, 724, 23141, 697, 4619, 1318, 15, 187, 187, 688, 544, 1470, 15, 575, 1447, 8209, 27, 43, 38156, 2582, 3113, 2582, 4762, 1765, 29013, 359, 8338, 253, 8062, 273, 253, 8789, 3470, 285, 7484, 669, 4153, 578, 520, 3713, 3115, 1009, 347, 247, 1159, 273, 669, 4153, 578, 1508, 3713, 3115, 3822, 12414, 10896, 28604, 2470, 1470, 15, 575, 1447, 8209, 27, 43, 38156, 2582, 3113, 2582, 4762, 1765, 29013, 66, 10, 253, 10711, 3365, 11711, 2510, 15, 2726, 669, 4153, 578, 2941, 724, 4503, 281, 697, 4619, 1318, 2470, 1470, 15, 575, 1447, 8209, 27, 43, 38156, 2582, 3113, 2582, 4762, 1765, 29013, 67, 10, 253, 3470, 830, 247, 2014, 4581, 12801, 534, 18303, 253, 15316, 3753, 273, 436, 2900, 15, 2635, 13, 323, 2169, 2193, 273, 669, 4153, 578, 2941, 724, 2470, 1470, 15, 575, 1447, 8209, 27, 43, 38156, 2582, 3113, 2582, 4762, 1765, 29013, 68, 582, 846, 690, 3302, 811, 1104, 13, 253, 8770, 3007, 23508, 4830, 247, 4581, 12801, 15, 844, 3877, 326, 841, 4581, 24679, 513, 417, 1957, 2701, 11945, 984, 1027, 3302, 2193, 273, 253, 27654, 1918, 6054, 281, 1027, 49421, 3054, 15, 6610, 13, 275, 544, 1470, 15, 575, 1447, 8209, 27, 43, 38156, 2582, 3113, 2582, 4762, 1765, 29013, 69, 13, 359, 921, 1543, 323, 247, 1318, 273, 669, 4153, 578, 2941, 724, 2080, 275, 6714, 273, 697, 4619, 1318, 15, 496 ]
5\lambda$. For large initial coupling strength $\Omega_\mathrm{init}$, the amplitude recycling field has little effect. As $\Omega_\mathrm{init}$ is lowered, however, we see a dramatic divergence of the breakdown time which corresponds to the onset of periodic behaviour. Parameters not explicitly mentioned are the same as in [Fig. \[FIG:eg\_no\_repump\]]{} \[FIG:tsing\_no\_repump\] ](Fig2_2.eps) Let us denote as $\tau^*$ the time at which $\Omega_{23}$ diverges, the maximum time we can expect our emulation to run. We obtain $\tau^*$ as the smallest time at which the denominator in [Eq. (\[EQ:J23full\])]{} vanishes, and plot it in [Fig. \[FIG:tsing\_no\_repump\]]{}a as a function of the starting coupling $\Omega_\mathrm{init}$ for different values of $\gamma$. For $\gamma$ in the range $0.2\lambda \lesssim \gamma \lesssim 0.8\lambda$, changing $\gamma$ does not alter the $\tau^*$ very much. However, increasing $\gamma$ above $0.8\lambda$ leads to a significant drop in maximum emulation time; we observe similar behaviour for decreasing $\gamma \lesssim 0.2$. We can obtain a simple approximation to the breakdown time by setting the oscillating terms in the denominator of [Eq. (\[EQ:J23full\])]{} to zero. This gives $$\tau^* \approx \frac{ \gamma{\left( 1 - \Omega_\mathrm{init}^2 \right)} }{ (\Omega_\mathrm{init}\lambda)^2 } \label{EQ:tsing} ,$$ valid for $\Omega_\mathrm{init} \ll 1$. In the opposite regime, $\Omega_\mathrm{init}\gg 1$, we obtain an alternative approximation $$\tau^* \approx \gamma / \Omega_\mathrm{init}^2 \label{EQ:tsing2} ,$$ by expanding the denominator to first order in time, and setting the result equal to zero. Both these expressions are good approximations in their respective regions of validity as shown in [Fig. \[FIG:tsing\_no\_repump\]]{}a. From the limits of Eqs. (\[EQ:tsing\]), (\[EQ:tsing2\]), as well as from the full results in [Fig. \[FIG:tsing\_no\_repump\]]{}a, we see that the dominant behaviour of the breakdown time $\tau^*$ is an approximate scaling with $\Omega_\mathrm{init}^{-2}$. Thus, in principle, we can always arrange our initial coupling strength to enable the emulation to cover any time interval of interest. However, making $\Omega_\mathrm{init}$ arbitrarily small is not without cost: the initial values of the source and sink populations required by the emulation are $$\phi_0(0) = \frac{-i \gamma \phi^\mathrm{I}_1(0)}{\Omega_\mathrm{init}} \quad \mathrm{and} \quad \phi_3(0) = \frac{i \gamma \phi^\mathrm{I}_2(0)}{\Omega_\mathrm{init}} \label{EQ:initialphi} .$$ Since the total probability is not contained in the [$\mathcal{PT}$]{}-symmetric subspace, we define the [$\mathcal{PT}$]{}-symmetric fraction in terms of the populations $p_i=|\phi_i|^2$ as $$r \equiv \underset{\tau}{\mathrm{min}} \left[ \frac{p_1(\tau)+p_2(\tau)}{\sum_i p_i(\tau)}\right] \label{EQ:sigrat} .$$ This expresses the minimum probability of finding the system in the [$\mathcal{PT}$]{}-symmetric subspace. This definition is motivated by an experimental resource limit since detecting the probability distribution in all states becomes increasingly cumbersome as [$\mathcal{PT}$]{}-symmetric fraction gets smaller. The [$\mathcal{PT}$]{}-symmetric fraction is equal to $r =\underset{\tau}{\mathrm{min}}\,\, n(\tau)/N_0$, where $n(\tau)$ is the norm of [Eq. (\[EQ:nspesh\])]{} and $N_0 = \sum_i p_i(0)$ is the total population at time $\tau=0$, which is a conserved quantity. Without amplitude recycling and with symmetric initial conditions, [Eq. (\[EQ:nspesh\])]{} and [Eq. (\[EQ:initialphi\])]{} imply $$r = \underset{\tau}{\mathrm{min}} \left[ \frac{ \lambda^2 - \gamma^2\cos(\tau) }{ 1 + (\gamma/\Omega_\mathrm{init})^2 } \right] = \frac{ 1 }{ 1 + (\gamma/\Omega_\mathrm{init})^2 } \label{EQ:rmin} .$$ In the limit $\Omega_\mathrm{init}/\gamma \ll 1$, this gives $r \sim \Omega_\mathrm{init}^2 / \gamma^2 $. Thus, decreasing $\Omega_\mathrm{init}$ to extend the emulation time necessarily leads to a corresponding decrease in the [$\mathcal{PT}$]{}-symmetric fraction. Amplitude recycling and the perpetual emulation threshold \[SEC:repump\] ======================================================================== We now consider the effects of the amplitude recycling coupling field. In this case, Eqs. (\[EQ:JJeqns\]) for $\Omega_{01}$ and $\Omega_{23}$ do not decouple and we obtain our results through numerical integration. Figure \[FIG:tsing\_no\_repump\]b shows the breakdown time $\tau^*$ of the emulation as a function of the initial coupling $\Omega_\mathrm{init}$ for several values of the amplitude recycling strength. For large $\Omega_\mathrm{init}$, the amplitude recycling does not significantly affect the breakdown time. However, as $\Omega_\mathrm{init}$ decreases, the breakdown time increases until it rapidly diverges at a value that increases with the amplitude-recycling strength. ![ Populations $p_0=|\phi_0|^2$ (dashed) and $p_3=|\phi_3|^2$ (solid) as a function of time for different values of $0\le \Omega_{03} \le 0.05\lambda$ and other parameters as in [Fig. \[FIG:eg\_no\_repump\]]{}. Increasing $\Omega_{03}$ decreases the overall gradient of $p_3$ until at the critical value $\Omega_{03}=0.01412\lambda$ the cycle-averaged values of $\Omega_{01}$ and $\Omega_{23}$ are constant and equal to one another. In this case we have purely periodic motion without decay. With further increase in $\Omega_{03}$, $p_3$ becomes larger than $p_0$ and in the long-time limit, we observe sustained oscillations of the [$\mathcal{PT}$]{}-symmetric subspace with no breakdown of the emulation. \[FIG:pops\_with\_repump\] ](Fig3.eps) Figure \[FIG:pops\_with\_repump\] shows the populations of the sink and source levels as a function of time for several values of the amplitude recycling strength $\Omega_{03}$ and for fixed initial coupling $\Omega_\mathrm{init} = 0.05\lambda$. As $\Omega_{03}$ is initially increased from zero, the decline of $p_3$ with time becomes shallower. The solution nevertheless terminates with $p_3=0$, as in the $\Omega_{03}=0$ case. This trend continues until the critical value $\Omega_{03}= 0.01412\lambda$ of the amplitude recycling strength is reached and the cycle-averaged gradients of $p_0$ and $p_3$ are both zero. At this point, the behaviour of the populations is purely periodic; they never drop to zero and the coupling $\Omega_{23}$ does not diverge. For yet larger values of $\Omega_{03}$ the populations reverse order such that $p_3>p_0$, and, in the long-time limit, become periodic once again. The emulated [$\mathcal{PT}$]{}-symmetric dynamics are correct for all times when $\Omega_{03}$ exceeds its critical value. In [Fig. \[FIG:JJs\_with\_repump\]]{} we explore the dynamics of the coupling functions and plot $\Omega_{01}(\tau)$ as a function of $\Omega_{23}(\tau)$. Without amplitude recycling ([Fig. \[FIG:JJs\_with\_repump\]]{}a) the trace simply diverges. With $\Omega_{03}$ equal to its critical value ([Fig. \[FIG:JJs\_with\_repump\]]{}b) the functions form a single closed orbit which illustrates the periodic nature of this solution. Then, for higher values of $\Omega_{03}$ ([Fig. \[FIG:JJs\_with\_repump\]]{}c), after some initial transients, the behaviour collapses onto a closed orbit. We note that these closed orbits do not represent limit cycles because different initial values of the couplings give rise to different oscillating states. Finally, in [Fig. \[FIG:JJs\_with\_repump\]]{}d, we show results for a value of $\Omega_{03}$ far in excess of its critical value. In
[ 313, 84, 20416, 66, 599, 428, 256, 20416, 67, 599, 3117, 14, 40, 61, 2760, 2769, 90, 20416, 66, 599, 28, 90, 20416, 67, 599, 13941, 4700, 844, 969, 897, 326, 370, 84, 20416, 66, 27825, 84, 20416, 67, 599, 393, 249, 544, 17, 13, 18, 1009, 285, 4647, 8755, 905, 5528, 27, 13118, 2582, 40, 2582, 3115, 40460, 4207, 187, 187, 20, 15, 50276, 2042, 370, 70, 31, 70, 64, 17, 1366, 840, 407, 23709, 905, 43, 2582, 70, 5426, 8946, 696, 359, 452, 1764, 1968, 92, 3582, 500, 3033, 495, 94, 187, 50274, 25583, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 3713, 1337, 3830, 4615, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 7398, 28, 2029, 28, 6087, 40, 6087, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 7398, 43657, 20866, 32453, 36, 4615, 4700, 187, 187, 2906, 4297, 272, 7370, 4087, 281, 1157, 359, 24813, 347, 1764, 2043, 92, 14856, 94, 187, 464, 1588, 94, 45, 1126, 3115, 13, 70, 64, 17, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 27612, 11549, 2029, 28, 187, 464, 27805, 259, 393, 28042, 2026, 45, 2850, 3259, 2306, 78, 393, 565, 1126, 5764, 19022, 1588, 94, 55, 64, 18, 599, 50276, 464, 2690, 92, 69, 7780, 5664, 464, 2690, 92, 90, 16302, 18, 5095, 1926, 17896, 61, 28526, 393, 2981, 5716, 5664, 464, 2690, 92, 90, 16302, 18, 10, 393, 18002, 61, 29753, 94, 50276, 187, 61, 11510, 6263, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 68, 5716, 1588, 94, 38, 7398, 14491, 9, 393, 565, 1126, 5764, 19022, 1588, 94, 55, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 10791, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 27612, 393, 14491, 10, 209, 187, 3353, 187, 61, 3181, 187, 61, 20999, 464, 11510, 6263, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 80, 5716, 1588, 94, 38, 38414, 14491, 1035, 565, 1126, 5764, 19022, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 94, 20886, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 14491, 13941, 15, 187, 61, 1968, 92, 45, 299, 64, 17, 246, 6489, 374, 889, 423, 92, 14856, 2138, 1281, 2367, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 68, 20886, 1588, 94, 38, 3822, 2896, 253, 39788, 14, 10859, 29815, 11370, 275, 370, 90, 20416, 66, 4018, 323, 7224, 66, 889, 249, 1926, 1588, 94, 55, 5716, 1588, 94, 49, 1009, 359, 4044, 1764, 1968, 92, 49791, 1854, 7680, 281, 418, 299, 64, 17, 246, 94, 187, 61, 565, 1126, 5764, 19022, 1588, 94, 55, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 10791, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 27612, 11549, 464, 20866, 32453, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 3713, 13, 393, 3830, 5095, 1157, 464, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 7398, 13, 4700, 1281, 2367, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 80, 20886, 1588, 94, 38, 3822, 844, 6983, 253, 14951, 432, 253, 4737, 273, 8755, 905, 9807, 1854, 696, 27, 16207, 1588, 94, 49, 22969, 70, 64, 18, 1337, 5589, 13, 70, 578, 82, 12, 18, 889, 8633, 1337, 9315, 187, 464, 1588, 94, 55, 64, 18, 5716, 1588, 94, 49, 7182, 6394, 67, 2000, 18, 41194, 67, 2000, 19, 61, 8633, 13, 393, 9315, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 7182, 6394, 66, 2000, 18, 1337, 5589, 41194, 66, 2000, 82, 61, 8633, 4700, 187, 187, 3463, 253, 39788, 14, 10859, 29815, 11370, 275, 370, 90, 20416, 66, 4018, 323, 7224, 66, 889, 249, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 1009, 359, 4044, 1764, 2043, 92, 14856, 94, 187, 61, 1968, 92, 9807, 1854, 7680, 281, 418, 299, 64, 17, 246, 94, 187, 61, 14491, 1035, 565, 1126, 5764, 19022, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 94, 20886, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 14491, 1572, 43657, 20866, 32453, 187, 3353, 187, 61, 11510, 578, 75, 30, 19, 1990, 82, 94, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 64, 75, 3713, 13, 393, 3830, 4615, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 3117, 28247, 3577, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 64, 18, 1603, 9, 90, 578, 67, 64, 18, 2023, 393, 3830, 582, 1926, 5664, 464, 2690, 92, 84, 6092, 47028, 45, 63, 19, 94, 5095, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 64, 18, 1603, 1035, 3830, 13, 340, 578, 67, 64, 19, 22286, 1926, 5664, 464, 2690, 92, 84, 6092, 47028, 45, 63, 19, 8633, 4880, 423, 92, 14856, 2138, 4974, 46306, 285, 715, 285, 9433, 253, 39788, 14, 10859, 29815, 11370, 275, 253, 2367, 5664, 464, 2690, 92, 90, 16302, 18, 5, 4903, 359, 4044, 1764, 1968, 92, 45, 299, 64, 17, 246, 1885, 3033, 94, 187, 464, 1588, 94, 45, 1126, 3115, 13, 70, 64, 17, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 27612, 11549, 464, 20866, 32453, 464, 27805, 259, 393, 28042, 2026, 45, 2850, 3259, 2306, 78, 5095, 464, 27805, 393, 2981, 393, 28042, 17738, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 3117, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 38, 94, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 3713, 13, 393, 3830, 4615, 1157, 464, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 3117, 5095, 4700, 4568, 11822, 1157, 1157, 285, 1157, 253, 1750, 1024, 3637, 432, 964, 187, 187, 9301, 13, 323, 370, 78, 393, 249, 1926, 1991, 92, 47, 4018, 359, 4853, 1764, 1968, 92, 71, 64, 78, 13, 66, 64, 78, 63, 2981, 8946, 94, 187, 66, 1126, 3259, 13, 78, 9616, 2981, 11549, 464, 679, 1661, 464, 87, 9229, 464, 10352, 25379, 44821, 17, 15, 2082, 911, 393, 8737, 5985, 446, 16563, 17, 431, 393, 18452, 32901, 889, 18452, 32901, 44766, 32453, 393, 1124, 92, 1490, 18, 4800, 78, 1217, 78, 2, 5095, 374, 63, 78, 94, 393, 2204, 1126, 10314, 393, 249, 1926, 5577, 94, 49, 94, 1926, 1588, 94, 42, 2850, 2981, 1126, 10314, 8633, 4700, 187, 187, 1447, 1773, 41801, 273, 253, 6843, 2426, 696, 1198, 370, 66, 1126, 3115, 13, 78, 4799, 2981, 724, 347, 2931, 275, 1157, 359, 452, 1764, 1968, 92, 1773, 41801, 273, 253, 6843, 2426, 6489, 94, 187, 66, 1126, 3115, 13, 78, 4799, 2981, 94, 393, 4287, 247, 1126, 3259, 13, 78, 9616, 2981, 393, 3362, 393, 6190, 92, 284, 889, 3362, 393, 3115, 393, 4287, 393, 3259, 61, 3362, 393, 6190, 92, 23714, 314, 275, 94, 393, 3362, 393, 2981, 393, 249, 1926, 5577, 94, 35, 64, 81, 4615, 4700, 187, 187, 4509, 8755, 905, 56, 781, 2582, 13259, 18057, 5290, 11506, 905, 13443, 273, 749, 33884, 5290, 285, 8755, 905, 5616, 27, 13118, 2582, 40, 2582, 3115, 696, 352, 3637, 326, 370, 71, 1126, 3115, 13, 78, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 45707, 2931, 275, 310, 11542, 17568, 275, 669, 3115, 31, 17, 1366, 669, 2981, 393, 249, 1926, 5577, 94, 35, 64, 81, 1366, 285, 2367, 5664, 464, 2690, 92, 85, 6092, 393, 249, 1926, 5577, 94, 34, 1352, 5488, 13, 432, 6935, 6681, 905, 56, 781, 2582, 13259, 18057, 696, 285, 905, 1773, 41801, 273, 6843, 2426, 18057, 5290, 323, 512, 2367, 5664, 464, 2690, 92, 85, 6092, 393, 249, 1926, 5577, 94, 34, 5, 359, 452, 3318, 71, 1126, 3115, 13, 78, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 27612, 393, 4287, 393, 2204, 1126, 10314, 393, 249, 1926, 5577, 94, 49, 94, 1926, 1588, 94, 42, 2850, 2981, 1126, 10314, 94, 393, 3362, 393, 6190, 92, 284, 889, 3362, 393, 3115, 393, 4287, 393, 3259, 61, 3362, 393, 6190, 92, 23714, 314, 275, 94, 393, 3362, 393, 2981, 393, 249, 1926, 5577, 94, 35, 64, 81, 4615, 4700, 380, 1750, 1024, 3637, 407, 970, 1157, 1157, 285, 253, 14691, 14940, 10012, 15, 187, 187, 510, 6414, 1307, 1712, 1704, 27, 2013, 404, 491, 94, 187, 22928, 187, 187, 688, 436, 19087, 359, 6642, 253, 6414, 1307, 432, 964, 187, 187, 1447, 8560, 27, 2013, 404, 491, 696, 1198, 370, 51, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 1009, 2931, 347, 275, 285, 669, 4820, 92, 1785, 94, 91, 1926, 32291, 94, 17, 5, 359, 452, 16207, 28526, 416, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 10, 393, 29753, 94, 11549, 464, 20866, 32453, 1926, 33438, 5716, 1124, 92, 36, 81, 2704, 1464, 63, 19, 3080, 34145, 40188, 81, 1926, 33438, 5716, 1124, 92, 36, 1926, 27805, 259, 393, 28042, 2026, 45, 2850, 3259, 94, 1926, 28526, 1182, 393, 29753, 7780, 1464, 63, 19, 3080, 34145, 46538, 46, 94, 5095, 353, 2, 4615, 4700, 187, 187, 510, 1551, 273, 436, 19087, 310, 16222, 281, 253, 4737, 273, 11506, 905, 8560, 27, 2013, 404, 491, 4207, 844, 3135, 407, 9591, 253, 1818, 273, 4903, 370, 86, 64, 18, 30, 18, 14, 19, 61, 1464, 14, 85, 64, 18, 5, 285, 370, 86, 64, 75, 30, 85, 578, 75, 14, 18, 5960, 85, 578, 75, 724, 323, 370, 19, 1926, 20866, 94, 75, 1926, 20866, 94, 46, 5, 275, 253, 5426, 1157, 285, 31931, 4513, 2367, 5664, 464, 2690, 92, 86, 6092, 426, 313, 86, 64, 18, 13, 393, 6768, 13, 1484, 64, 46, 1009, 347, 973, 347, 2367, 28526, 1926, 5664, 464, 2690, 92, 86, 6092, 393, 29753, 94, 1926, 679, 1661, 464, 87, 9229, 464, 10352, 25379, 44821, 17, 15, 2082, 911, 393, 8737, 5985, 446, 16563, 17, 431, 393, 18452, 32901, 889, 18452, 32901, 44766, 889, 2204, 578, 74, 426, 337, 2306, 46, 1484, 64, 74, 1352, 831, 11026, 1764, 1968, 92, 51, 64, 5302, 64, 72, 94, 187, 51, 1126, 3115, 13, 46, 4799, 2981, 1603, 91, 1572, 28, 2029, 28, 1490, 18, 4800, 46, 393, 1124, 92, 91, 63, 46, 18424, 18, 14, 19, 61, 1464, 7415, 46, 599, 393, 565, 13061, 17, 13, 337, 428, 374, 393, 1464, 4800, 46, 94, 1926, 2690, 92, 69, 7780, 5664, 464, 2690, 92, 86, 599, 8633, 7524, 5664, 464, 2690, 92, 18, 6092, 20886, 28526, 1926, 5664, 464, 2690, 92, 86, 6092, 393, 29753, 94, 654, 337, 428, 374, 393, 1464, 3117, 5095, 305, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 13, 1926, 5664, 464, 2690, 92, 86, 6092, 13941, 11227, 835, 359, 2931, 1764, 2043, 92, 14856, 94, 187, 72, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 13, 1926, 5664, 464, 2690, 92, 86, 27612, 11549, 464, 679, 1661, 464, 87, 9229, 464, 10352, 25379, 44821, 17, 15, 2082, 911, 393, 8737, 5985, 446, 16563, 17, 431, 393, 18452, 32901, 889, 18452, 32901, 44766, 32453, 209, 187 ]
(s_{{a}} - s_{{b}})}-G\big)(y_{{a}};y_{{b}})\,.$$ We again use that $s_{{a}}-s_{{b}} \in [0,1)$ and apply Lemma \[cor:conv\_G\_tau corollary\]. 3. If $e>e_0$, then by Definition \[J\_e definition classical\] we have $$\label{tilde J bound 3} \|\tilde{{\mathcal}J}_{\tau,e}(\,\cdot\,,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)}\;=\;\|G\|_{{\mathfrak}S^2({\mathfrak}H)}\;{\leqslant}\;C\,.$$ Arguing analogously to , we rewrite as $$\begin{gathered} {\mathcal}L_{\tau,e_0}^{\xi}({\boldsymbol{\mathrm{t}}}) \;=\; {\lVert w \rVert}_{L^\infty}^m \int_{\Lambda^{{\mathcal}V_1}} {\mathrm{d}}{\boldsymbol{\mathrm{y}}}_1 \, {\bigl\lvert \xi({\boldsymbol{\mathrm{y}}}_1) \bigr\rvert} \prod_{{\mathcal}P \in \operatorname{conn}_c({\mathcal}E)}\bigg( \int_{\Lambda^{{\mathcal}V({\mathcal}P)}} \prod_{{a}\in {\mathcal}V({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e}({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}}) \bigg) \\ \times \mathop{\prod_{{\mathcal}P \in \operatorname{conn}_o({\mathcal}E)}}\bigg(\int_{\Lambda^{{\mathcal}V_2({\mathcal}P)}} \prod_{{a}\in {\mathcal}V_2({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e} ({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}})\bigg)\,. \label{L e_0 t identity 2}\end{gathered}$$ Let ${\mathcal}P \in \operatorname{conn}_c ({\mathcal}E)$. By the Cauchy-Schwarz inequality in $y_{{a}}$ for ${a}\in {\mathcal}V({\mathcal}P)$ we obtain $$\label{Closed path contribution to L e_0 t} \int_{\Lambda^{{\mathcal}V({\mathcal}P)}} \prod_{{a}\in {\mathcal}V({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e}({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}}) \;{\leqslant}\; \prod_{e \in {\mathcal}P} \|\tilde{{\mathcal}J}_{\tau,e}(\, \cdot \, ,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)}\,.$$ Let ${\mathcal}P \in \operatorname{conn}_o ({\mathcal}E)$. We recall the notation from the proof of Lemma \[Open path\]: $${\mathcal}P=\{e_1,\ldots,e_{q+1}\}\,,\qquad {\mathcal}V_1({\mathcal}P)=\{{b}_1,{b}_2\}\,, \qquad {\mathcal}V_2({\mathcal}P)=\{{a}_1,\ldots,{a}_q\}\,.$$ By the Cauchy-Schwarz inequality in $y_{{a}}$ for ${a}\in {\mathcal}V_2({\mathcal}P)$ we obtain $$\begin{gathered} \label{Open path contribution to L e_0 t} \bigg(\int_{\Lambda^{{\mathcal}V_2({\mathcal}P)}} \prod_{{a}\in {\mathcal}V_2({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e} ({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}})\bigg)\;{\leqslant}\; \\ \prod_{j=2}^{q} \|\tilde{{\mathcal}J}_{\tau,e_j}(\, \cdot\,,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)} \,\|\tilde{{\mathcal}J}_{\tau,e_1}((y_{b_1}, \cdot), {\boldsymbol{\mathrm{s}}})\|_{L^2} \, \|\tilde{{\mathcal}J}_{\tau,e_1}((\cdot, y_{b_2}), {\boldsymbol{\mathrm{s}}})\|_{L^2}\,.\end{gathered}$$ Substituting and into and applying the Cauchy-Schwarz inequality in the ${\boldsymbol{\mathrm{y}}}_1$ variables we obtain $$\label{L e_0 t product bound} {\mathcal}L_{\tau,e_0}^{\xi}({\boldsymbol{\mathrm{t}}}) \;{\leqslant}\;{\lVert w \rVert}_{L^\infty}^m \,{\lVert \xi \rVert}_{{\mathfrak}S^2({\mathfrak}H)} \prod_{e \in {\mathcal}E} \|\tilde{{\mathcal}J}_{\tau,e}(\, \cdot\, ,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)} \,.$$ Recalling , , and , the claim now follows from . Next, for $m \in {\mathbb{N}}$ we define $$\label{f_m,a_m^xi classical} a_{\infty,m}^\xi \;{\mathrel{\vcenter{\baselineskip0.65ex \lineskiplimit0pt \hbox{.}\hbox{.}}}=}\; \frac{(-1)^m}{m! \, 2^m} \sum_{\Pi \in {\mathfrak}P} {\mathcal}I^\xi_{\Pi}\,.$$ \[Convergence of the explicit terms\] For $a_{\tau,m}^{\xi}$ as defined in , we have $$\label{Convergence of the explicit terms identity} a_{\tau,m}^{\xi} \rightarrow a_{\infty,m}^\xi \quad \mbox{as}\quad \tau \rightarrow \infty\quad \mbox{uniformly in} \quad \xi \in {\mathfrak}B_p\,.$$ From Lemma \[Wick\_application lemma\], Proposition \[Product of subgraphs\], and Lemma \[lem:conv\_G\_tau\] it follows that $f_{\tau,m}^{\xi}({\boldsymbol{\mathrm{t}}})$ defined in is bounded uniformly in $\tau>0$, $\xi \in {\mathfrak}B_p$, and ${\boldsymbol{\mathrm{t}}} \in {\mathfrak}A$. Furthermore, from Lemmas \[Wick\_application lemma\] and \[Convergence of explicit terms lemma\], for all ${\boldsymbol{\mathrm{t}}} \in {\mathfrak}A$ we have $$f_{\tau,m}^{\xi}({\boldsymbol{\mathrm{t}}}) \rightarrow \sum_{\Pi \in {\mathfrak}P} {\mathcal}I^\xi_{\Pi} \quad \mbox{as}\quad \tau \rightarrow \infty\quad \mbox{uniformly in} \quad \xi \in {\mathfrak}B_p\,.$$ The claim now follows by using , , and the dominated convergence theorem. The remainder term {#sec:remainder} ------------------ In this subsection we estimate the remainder term from . \[prop:remainder\] For $R^\xi_{\tau,M}(z)$ defined as in and $\operatorname{Re}z {\geqslant}0$ we have $${\lvert R^\xi_{\tau,M}(z) \rvert} \;{\leqslant}\; {\biggl({\frac{Cp}{\eta^2}}\biggr)}^p {\biggl({\frac{C {\lVert w \rVert}_{L^\infty} {\lvert z \rvert}}{\eta^2}}\biggr)}^{M} \, M!\,.$$ The rest of this subsection is devoted to the proof of Proposition \[prop:remainder\]. We begin by performing the change of variables $u_1=1-2\eta-t_1$ and $u_j=t_{j-1}-t_{j}$ for $2 {\leqslant}j {\leqslant}M$ in the definition , and abbreviate ${\boldsymbol{\mathrm{u}}} = (u_1, \dots, u_M)$ as well as ${\lvert {\boldsymbol{\mathrm{u}}} \rvert} {\mathrel{\vcenter{\baselineskip0.65ex \lineskiplimit0pt \hbox{.}\hbox{.}}}=}\sum_{i = 1}^M u_i$. This yields $$\label{R_using_g} R_{\tau,M}^{\xi}(z)\;=\;(-1)^M \frac{z^M}{(1-2\eta)^{M}} \int_{(0, 1 - 2 \eta)^M} {\mathrm{d}}{\boldsymbol{\mathrm{u}}}\, {{\boldsymbol{\mathrm{1}}} ({\lvert {\boldsymbol{\mathrm{u}}} \rvert} < 1 - 2 \eta)} \, g^\xi_{\tau,M}(z, {\boldsymbol{\mathrm{u}}})\,,$$ where we defined $$\begin{gathered} g^\xi_{\tau,M}(z, {\boldsymbol{\mathrm{u}}}) \;{\mathrel{\vcenter{\baselineskip0.65ex \lineskiplimit0pt \hbox{.}\hbox{.}}}=}\;
[ 15, 12526, 703, 556, 644, 2581, 1512, 1959, 275, 13002, 731, 449, 187, 187, 3, 1147, 434, 247, 3513, 1895, 937, 15946, 753, 246, 398, 600, 15, 346, 42, 5545, 3780, 1060, 588, 1557, 2217, 281, 9059, 342, 617, 13, 1339, 3815, 2847, 247, 41843, 15, 1292, 604, 597, 513, 13, 840, 253, 1980, 3513, 476, 1379, 1557, 273, 352, 449, 187, 187, 20405, 17650, 21374, 13, 347, 604, 436, 369, 247, 38519, 4154, 15, 346, 49, 770, 13, 436, 310, 417, 247, 14876, 15, 1422, 778, 1158, 326, 1142, 952, 403, 1049, 22811, 347, 281, 253, 3242, 4278, 273, 7231, 12791, 13, 285, 760, 11617, 7730, 15600, 588, 9059, 342, 617, 1128, 395, 1014, 604, 597, 513, 13, 368, 4517, 326, 597, 387, 1878, 871, 849, 281, 21319, 1561, 253, 1569, 449, 754, 5439, 3168, 34036, 15, 346, 2042, 594, 13, 368, 403, 247, 11213, 15, 3808, 1821, 588, 9059, 625, 9908, 1523, 670, 9596, 685, 2712, 2010, 327, 6149, 15, 1916, 1142, 13, 9596, 6125, 1340, 13, 45985, 13, 253, 19455, 10170, 273, 1175, 689, 10319, 15, 733, 23849, 281, 731, 616, 1659, 275, 8869, 449, 754, 11373, 47077, 314, 15, 346, 6080, 2811, 2822, 253, 1755, 15, 380, 7286, 273, 771, 14197, 17163, 2352, 253, 1077, 1755, 15, 18190, 556, 281, 320, 2918, 896, 323, 2656, 449, 3032, 8580, 28290, 285, 521, 2927, 497, 22072, 15, 346, 1989, 1333, 1633, 281, 29138, 326, 1659, 2822, 253, 1755, 13, 285, 368, 29138, 3253, 449, 187, 187, 1328, 11898, 521, 1481, 15, 346, 2214, 2656, 434, 13232, 13, 637, 13, 1007, 387, 849, 9596, 556, 15070, 441, 7419, 4768, 2892, 15, 11075, 342, 253, 35929, 3355, 13, 285, 253, 496, 34961, 275, 11268, 13, 253, 31222, 273, 253, 8842, 1032, 285, 48690, 5060, 275, 253, 1551, 273, 3060, 13, 253, 2280, 317, 373, 273, 253, 12818, 31526, 1502, 275, 6181, 15, 844, 1849, 15676, 1097, 33097, 285, 24419, 1103, 9361, 15, 1422, 1158, 352, 4571, 626, 5108, 969, 32, 1310, 399, 5292, 71, 316, 497, 417, 247, 5679, 13, 513, 368, 1158, 436, 2644, 49358, 18830, 651, 2455, 452, 3053, 13, 1620, 2564, 4925, 436, 8394, 865, 187, 187, 49, 770, 12491, 6345, 281, 9059, 13, 285, 1119, 253, 3000, 13831, 327, 521, 14018, 15, 187, 187, 1147, 369, 12345, 253, 990, 273, 4162, 15, 36072, 275, 253, 1770, 3918, 43802, 2205, 574, 2546, 253, 530, 15, 52, 15, 5759, 323, 247, 16204, 273, 2137, 1411, 11268, 15, 24605, 574, 644, 8445, 14275, 432, 11268, 323, 1142, 1107, 13, 285, 253, 1986, 2077, 574, 13207, 281, 32014, 275, 253, 12027, 13, 6523, 271, 5107, 281, 6351, 1612, 285, 1899, 15, 2091, 253, 20303, 1456, 47800, 795, 46, 6529, 64, 574, 644, 15351, 8140, 24684, 598, 275, 32977, 3230, 22754, 13, 253, 6422, 530, 15, 52, 15, 2315, 22134, 27137, 11268, 15, 1623, 3127, 4162, 5759, 574, 6960, 247, 25186, 28398, 273, 512, 33074, 37050, 641, 13, 17905, 326, 11268, 23277, 1453, 273, 24605, 15, 1623, 2030, 4162, 13, 1740, 1897, 3622, 13, 3968, 574, 8884, 2137, 15, 733, 369, 253, 806, 673, 597, 574, 2218, 824, 247, 2181, 275, 616, 4864, 13, 7445, 2531, 6242, 15, 1583, 574, 7106, 327, 4812, 7466, 13, 574, 11371, 253, 2659, 13, 4270, 13, 14859, 285, 3715, 4491, 15, 3954, 8423, 253, 2586, 369, 3629, 253, 1979, 273, 697, 29894, 285, 697, 29401, 285, 2819, 323, 35586, 21344, 13, 347, 2080, 1977, 347, 22085, 285, 253, 22075, 15, 187, 187, 1552, 747, 8327, 323, 22684, 7466, 812, 1756, 281, 6388, 643, 25186, 9136, 13, 1014, 9643, 13, 604, 3968, 9703, 281, 1056, 352, 594, 15, 1310, 2712, 2427, 3430, 342, 436, 9883, 3416, 434, 4143, 13, 352, 812, 4354, 320, 3731, 3474, 579, 264, 407, 11268, 15, 329, 45942, 1869, 1677, 253, 1375, 273, 13909, 2439, 3060, 15, 3918, 2639, 1439, 273, 6181, 574, 644, 18111, 3901, 1740, 1107, 3622, 15, 9859, 807, 352, 574, 644, 12128, 8308, 330, 9435, 729, 284, 1448, 9893, 16078, 275, 11268, 13, 835, 253, 7217, 574, 4925, 747, 490, 5240, 569, 15, 187, 187, 3, 2993, 310, 9745, 2716, 247, 13365, 390, 594, 273, 617, 1051, 317, 311, 12742, 937, 9011, 17650, 2427, 327, 13, 347, 604, 344, 574, 417, 8344, 15946, 434, 5928, 273, 4116, 15, 187, 187, 3, 13618, 760, 6057, 752, 3686, 273, 952, 597, 403, 13, 533, 359, 1053, 626, 971, 667, 273, 731, 5339, 327, 776, 8825, 15, 309, 1353, 2119, 368, 2096, 253, 36649, 326, 651, 320, 281, 4058, 30913, 434, 7295, 15, 23498, 275, 1708, 273, 776, 2892, 342, 11268, 15, 844, 1053, 626, 971, 281, 1918, 731, 667, 38219, 323, 2137, 342, 441, 347, 973, 449, 754, 3261, 387, 15946, 9257, 13, 347, 604, 6830, 344, 574, 35039, 18280, 779, 285, 651, 320, 26337, 281, 24033, 521, 4743, 15, 187, 187, 3, 4374, 13, 8674, 937, 15946, 10017, 15, 346, 4527, 2282, 309, 2096, 15, 1680, 352, 1014, 27938, 2779, 326, 703, 651, 320, 13964, 1060, 865, 754, 2546, 253, 1953, 417, 275, 247, 5968, 273, 9209, 335, 414, 13, 533, 11525, 323, 690, 29299, 326, 352, 369, 417, 594, 15, 187, 187, 20405, 17650, 434, 2048, 47241, 247, 1652, 13, 253, 3676, 3104, 670, 521, 6208, 1679, 5460, 15, 346, 37161, 417, 937, 344, 10017, 342, 253, 14972, 273, 247, 8580, 15, 346, 1989, 8505, 436, 3416, 434, 4383, 2021, 513, 417, 23255, 273, 617, 387, 512, 15, 1500, 1669, 275, 253, 806, 1659, 689, 690, 48254, 273, 8063, 13, 594, 309, 4089, 15, 43914, 476, 320, 253, 22144, 1476, 1707, 369, 690, 25528, 275, 521, 4318, 15, 187, 187, 49, 770, 1160, 247, 1390, 3434, 281, 3693, 253, 4836, 15, 346, 42, 651, 1127, 562, 326, 9836, 7217, 310, 671, 3513, 789, 13, 8674, 13, 417, 10396, 25474, 434, 15, 844, 452, 247, 1943, 1083, 273, 9787, 45608, 486, 387, 253, 2774, 326, 4453, 347, 604, 352, 310, 5639, 11797, 15, 733, 434, 2970, 7197, 285, 556, 281, 320, 6331, 449, 187, 187, 20405, 17650, 434, 2927, 497, 6627, 285, 9479, 15, 346, 42, 717, 973, 6600, 273, 10396, 25474, 434, 7350, 15, 309, 588, 9287, 368, 326, 352, 310, 253, 1055, 327, 253, 5674, 326, 14802, 3692, 1895, 352, 310, 13, 15946, 13, 285, 368, 871, 326, 347, 973, 347, 309, 513, 15, 1310, 368, 1904, 626, 13, 2868, 479, 13, 368, 651, 417, 320, 1048, 275, 634, 1899, 449, 187, 187, 49, 770, 16481, 521, 13386, 13, 285, 7560, 16092, 15, 187, 187, 3, 4045, 359, 871, 253, 3753, 273, 436, 48254, 1561, 253, 3416, 434, 2021, 13, 8674, 865, 187, 187, 20405, 17650, 3534, 247, 4512, 439, 2371, 15, 1310, 344, 8344, 253, 1818, 275, 15946, 434, 10541, 13, 344, 369, 18144, 2217, 417, 281, 921, 352, 15, 187, 187, 3, 510, 7312, 3686, 273, 2181, 342, 47187, 19367, 13, 309, 2868, 937, 344, 10017, 13, 253, 8580, 896, 327, 521, 2454, 15, 346, 2993, 13072, 281, 17129, 253, 2872, 637, 273, 7126, 19050, 285, 19994, 13, 285, 38519, 16964, 13, 5207, 597, 574, 4236, 323, 617, 449, 187, 187, 49, 770, 12659, 326, 9011, 17650, 574, 1264, 19367, 15, 187, 187, 3, 1898, 6337, 745, 281, 11268, 285, 7028, 690, 9883, 637, 273, 7202, 1894, 285, 3164, 7202, 38408, 13, 387, 1878, 281, 36104, 571, 434, 4651, 937, 9011, 17650, 2879, 15, 346, 42, 8564, 352, 369, 34019, 281, 731, 449, 187, 187, 3, 2347, 1048, 3622, 369, 436, 865, 15946, 2546, 13, 7562, 521, 2454, 347, 2048, 1417, 347, 344, 812, 15, 3032, 1211, 6122, 13, 500, 358, 8032, 13, 369, 3809, 17682, 7875, 494, 2363, 15, 754, 1904, 626, 751, 281, 1158, 670, 352, 15, 187, 187, 3, 4013, 13, 352, 556, 644, 690, 673, 937, 9011, 17650, 10017, 43744, 2920, 15, 346, 42, 1158, 352, 310, 617, 7231, 6849, 326, 452, 1024, 509, 8055, 253, 1895, 15, 733, 5082, 626, 2647, 594, 1199, 604, 703, 4934, 731, 281, 5972, 15, 1292, 703, 556, 4447, 1633, 273, 247, 25102, 15, 14026, 617, 913, 311, 12742, 13, 347, 309, 5393, 449, 187, 187, 3, 30574, 10503, 865, 15946, 18998, 247, 2453, 281, 513, 342, 253, 8237, 6393, 13, 4931, 13, 8479, 1711, 22411, 3360, 281, 320, 12659, 15, 187, 187, 3, 40942, 417, 449, 9011, 17650, 14287, 581, 20654, 9215, 15, 346, 1147, 10693, 8213, 15, 3771, 923, 326, 642, 581, 8104, 617, 1223, 703, 310, 275, 5854, 15, 380, 19473, 703, 6505, 253, 1805, 13, 533, 9338, 285, 973, 13, 604, 368, 4496, 449, 187, 187, 49, 770, 48293, 281, 4116, 15, 346, 4374, 13, 8674, 449, 187, 187, 1128, 187, 187, 3, 8683, 39, 5236, 38336, 34, 1311, 54, 59, 865, 30752, 45, 2415, 5428, 12041, 1838, 342, 247, 5982, 9479, 2980, 273, 1600, 15, 1500, 285, 15946, 497, 7063, 407, 247, 1698, 3289, 275, 253, 1061, 3833, 13, 253, 36708, 8392, 2439, 253, 5112, 8323, 4830, 253, 10329, 15, 24059, 512, 253, 1708, 369, 4783, 432, 253, 4484, 7203, 8467, 285, 627, 369, 247, 19040, 27450, 275, 253, 2329, 15, 11067, 6933, 14, 2913, 14, 744, 500, 358, 8032, 285, 27291, 14, 2913, 14, 744, 10213, 497, 1097, 24311, 275, 616, 9956, 15, 500, 358, 8032, 651, 320, 1388, 44266, 272, 13, 390, 4028, 4876, 281, 617, 3858, 15, 10213, 651, 320, 3676, 275, 253, 27420, 273, 253, 6323, 795, 35384, 434, 20659, 21897, 3333, 187, 187, 49, 770, 18274, 3579, 285, 1691, 1529, 2412, 327, 253, 3289, 15, 733, 3534, 1679, 4250, 685, 10089, 13, 533, 344, 10490, 253, 13624, 273, 253, 19126, 5534, 15, 187, 187, 3, 11778, 368, 3735, 273, 617, 865, 344, 2546, 342, 9326, 15, 187, 187, 30419, 32567, 11373, 5777, 1881, 14, 585, 43386, 15, 346, 4374, 13, 247, 2372, 449, 187, 187, 1328, 12659, 9011, 17650, 434, 3806, 281, 247, 20565, 275, 253, 2469, 28, 344, 3260, 849, 21438, 2343, 41746, 34168, 13, 1014, 672, 352, 369, 253, 1495, 25304, 273, 5839, 15, 1500, 18029, 281, 352, 13, 533, 342, 15457, 13, 285, 247, 6293, 273, 4709, 15, 1500, 574, 2326, 1512, 1142, 273, 697, 10349, 806, 4608, 281, 1379, 11284, 275, 352, 15, 187, 187, 3, 1276, 858, 368, 4089, 865, 344, 753, 7462, 600, 15, 346, 2993, 778, 320, 275, 5434, 15, 309, 878, 281, 871, 449, 187, 187, 30419, 32567, 858, 417, 9059, 13, 534, 275, 3139, 369, 24838, 273, 247, 1027, 2238, 273, 1600, 15, 754, 5189, 4468, 275, 617, 2927, 15, 1500, 1691, 1066, 253, 36787, 703, 574, 644, 2509, 15, 187, 187, 3, 1394, 403, 1469, 281, 4017, 617, 865, 703, 2546, 1095, 8140, 15, 187, 187, 3, 42, 1849, 7922, 2652, 1504, 486, 281, 352, 937, 344, 10017, 15, 187, 187, 3, 3650, 659, 14065, 865, 1500, 369, 39340, 15, 187, 187, 3, 998, 14065, 434, 3240, 8474, 1024, 937, 344, 8042, 562, 15, 754, 858, 417, 971, 281, 320, 9479, 285, 873, 247, 9025, 875, 731, 15, 831, 7107, 7237, 3815, 342, 617, 369, 253, 1682, 629, 273, 521, 1388, 15, 7850, 6330, 43074, 42189, 281, 779, 15, 346, 1328, 556, 643, 19715, 15, 2652, 1504, 486, 310, 247, 1175, 637, 449, 187, 187, 3, 42, 1849, 3735, 36104, 571, 434, 5697, 403, 3965, 9329, 449, 1500, 369, 44520, 387, 779, 25060, 15, 187, 187, 3, 2214, 1650, 865, 187, 187, 3, 42, 1053, 626, 871, 937, 703, 8176, 13, 13383, 253, 36787, 1977, 7094, 285, 25661, 3579, 247, 1652, 15, 346, 16830, 309, 1833, 564, 285, 8028, 281, 752, 703, 556, 281, 1333, 672, 703, 23981, 15, 1500, 556, 281, 452, 625, 3289, 685, 776, 1980, 9843, 449, 21438, 2427, 281, 6105, 327, 954, 45999, 984, 703, 2335, 253, 2151, 15, 733, 369, 247, 3626, 629, 273, 15823, 281, 253, 3114, 285, 273, 1146, 7607, 15, 733, 369, 671, 253, 1682, 1659, 323, 500, 358, 8032, 285, 10213, 281, 2525, 643, 47072, 3692, 5870, 21438, 3260, 275, 247, 8489, 6832, 1039, 15, 187, 187, 7673, 2223, 685, 417, 13, 15946, 6888, 690, 17178, 7143, 11358, 327, 45999, 15, 187, 187, 49, 770, 11522, 4345, 13, 533, 344, 369, 2080, 625, 9680, 273, 247, 9479, 3541, 22213, 275, 521, 2564, 15, 3032, 3101, 574, 2668, 779, 281, 253, 25024, 6105, 327, 253, 5024, 273, 253, 8304, 1046, 6926, 273, 521, 11948, 15, 754, 812, 1335, 5406, 253, 13755, 84, 273, 18010, 1708, 1499 ]
. Unfortunately she has been rather too free in expressing them." "It's a police problem," Pitt said tersely. "I doubt anyone here will care enough to argue with her, let alone cause a nuisance. But if they do, then the local police can take care of it." Sir Walter sighed, as if this was a tedious argument. "Pitt, this is not a suggestion. You may think that many people are apathetic as to the exact details of religious doctrine, and only deeply committed Christians will argue with her—and even if they do, you trust that they at least know how to behave within the law." He raised white eyebrows. "If so, you are a fool. Some men will argue more passionately about religion than anything else on earth. To many, religion represents order, sanity, the inevitable victory of good over evil. It confirms to them their place in creation." He smiled bleakly. "Somewhere near the top. The appearance of modesty forbids the very top. Something has to be held back for God." His smile faded and his eyes were grim. "But say something to threaten that place near the top, and you threaten everything." He shook his head. "For God's sake, man, look at how religion has torn us apart throughout history. Start with the Crusades, and the Inquisition in Spain, the persecution of the Cathars and Waldenses in the rest of Europe, the massacres of the Huguenots in France. We've burned both Catholics and Protestants ourselves. You think it couldn't happen again? If Dreyfus were not a Jew, do you think this whole monstrous affair would ever have started, never mind reached this proportion?" Pitt drew breath to argue, and found the words frozen on his tongue. It was barely the end of April. Earlier in the month President McKinley had asked the U.S. Congress for a declaration of war against Spain. Cuba had been seeking independence from Spain for many years, and the United States had begun to intervene in the dispute, seeing an opportunity to gain power and position. When the battleship USS _Maine_ had been mysteriously blown up in Havana harbor, the powerful U.S. press openly blamed Spain. On 21 April Congress had ordered a naval blockade of all Cuban harbors, demanding that Spain surrender control of Cuba. On 25 April, four days ago, America had declared war. It was the first time they had done such a thing in their brief, idealistic existence. They had focused on internal expansion, had settled the land, built, explored and developed industry. Now suddenly the country was increasing the size of its armies and its navy and looking for possessions overseas, as far away as Hawaii and the Philippines. This new desire for outward expansion could grow to involve other naval powers, even Britain, if America chose to make it so. If anything went wrong with this Spanish woman's visit, it could easily be misconstrued by Spain. A chilling thought given the state of affairs across Europe. President Carnot of France had been assassinated four years ago. Last year it had been Prime Minister Cánovas del Castillo in Spain, where the violence had reached new abominations. "She is bringing half a dozen or so of her...acolytes," Sir Walter went on, as if he had not noticed Pitt's absence of attention. "God only knows what sort of people they are, but we don't want any of them killed on our soil. I'm sure you understand the embarrassment that would be to Her Majesty's Government. Especially in light of our history with Spain. We don't want to give them any excuses for war with us as well." He looked at Pitt carefully, as if possibly he had overestimated him and would be obliged to reconsider his opinion. "Yes, sir," Pitt replied. "Of course I understand. Is it even remotely likely that she would be attacked here?" He asked the question not in a spirit of incredulity, but hoping for some assurance that it was not so. Sir Walter's expression eased a little, the deep lines about his mouth less severe. "Probably not," he replied with the ghost of a smile. "But apparently this woman's English family do not approve of her at all. She left in the first place over some quarrel of principle, so I hear. Families can be the devil!" There was some sympathy in his voice. Pitt made a last effort to avoid the task. "I would point out that domestic violence is also police work, sir, not Special Branch's. We have a big case of industrial sabotage at the moment that looks as if it is foreign inspired. It's getting worse and has to be stopped." Sir Walter's eyes were bright and sharp. "I am well aware of Special Branch's concerns. I will remind you that it is the effect on the nation that determines whose problem it is, Pitt, and you know that as well as I do. If you didn't, believe me, you would not be long in your position." Pitt cleared his throat, and spoke quietly. "Do we know the nature of this quarrel within the woman's family, sir?" Sir Walter gave a slight shrug. If he noticed the change in Pitt's tone, he was sophisticated enough not to show it. "The usual sort of thing with willful daughters, I believe," he replied, the smile back on his face. "She declined to marry the young man of excellent breeding and fortune, and tedious habits, whom they had selected for her." Pitt remembered that Sir Walter had three daughters. "And ran off to Spain and married some Spanish man of unknown character and probably unknown ancestry, at least to Sofia's parents," Sir Walter added. "I imagine it was embarrassing to them." "How long ago was this?" Pitt asked, keeping his face as expressionless as he could. His own daughter, Jemima, was fast approaching marriageable age. He didn't like to think about it. "Oh, it has been some time," Sir Walter replied ruefully. "I think it is her religious views that have now compounded the problem. It wouldn't matter so much if she kept them to herself. But she has formed something of a sect. Has her acolytes, as I mentioned." "Roman Catholic?" Pitt imagined a cult to do with the Virgin Mary, perhaps, causing old persecutions to be remembered. "Apparently not." Sir Walter lifted one elegant shoulder. "It hardly matters. Just see that no one attacks her while she is in England. The sooner she leaves the better, but alive and well, if you please." Pitt straightened to attention. "Yes, sir." — "SOFIA DELACRUZ?" CHARLOTTE SAID with a sudden sharpening of interest. She and Pitt were sitting by a low fire in the parlor, the curtains drawn across the French windows onto the garden. Almost all the light was gone from the cool spring sky and there was a definite chill in the air. Sixteen-year-old Jemima and thirteen-year-old Daniel were both upstairs in their rooms. Jemima would be daydreaming, or writing letters to her friends. Daniel would be deep in the adventures of the latest _Boy's Own Paper._ Pitt leaned forward and put another log on the fire. It gave less heat than coal, but he liked the smell of the apple wood. "Have you heard of her?" he asked with surprise. Charlotte smiled slightly self-consciously. "Yes, a bit." He remembered Sir Walter's reference to a scandal in the past; he knew how Charlotte loathed gossip, even when it was the lifeblood of investigation. She listened to it, but with guilt, and a thread of fear. She had seen too many of its victims firsthand to take pleasure in it. "What did you hear?" he said gravely. "She may be in danger. I need to know." Charlotte did not argue, which in itself was indicative of a different kind of interest. He detected concern in her eyes. She put down the sewing she had been doing. "You are going to protect her?" she asked curiously. "I've assigned Brundage to it," he replied. "Not Stoker?" She was puzzled. "Stoker's quite senior now," he pointed out. He did not want to be sharp and set a division between them. This quiet evening alone with her was the best part of his day. Its peace mattered intensely to him. "He has other responsibilities. Brundage is a good man." "I've heard Sofia's ideas are pretty radical." She was gazing at him steadily. "For example?" "I don't know," she admitted, pushing the sewing away entirely and leaning forward a little. "Perhaps I'll go and listen to what she has to say when she arrives. She has to have more fire than our local minister." Charlotte went to church on most Sundays because she took the children. It was a natural part of belonging to the community and of being accepted. It was also the best place for Jemima and Daniel to meet other youths whose families Charlotte knew in a somewhat substantial way. More often than not, Pitt discovered some pressing duty elsewhere on Sundays. Pitt nodded agreement, but he was far more conscious of a sharp memory stirring in his mind. His mother had taken him to the parish church on the edge of the estate every Sunday of his childhood. He could still picture the shafts of colored light sl
[ 327, 634, 6561, 2670, 588, 417, 2686, 873, 247, 6874, 19550, 323, 634, 6561, 5028, 275, 253, 2608, 457, 84, 9882, 1108, 984, 1046, 2380, 273, 326, 6561, 2670, 457, 84, 6001, 1057, 417, 773, 1373, 668, 275, 253, 9882, 13, 352, 13446, 275, 634, 2022, 2670, 6001, 13, 984, 326, 457, 84, 835, 368, 2509, 253, 2748, 432, 15, 187, 42, 1158, 752, 368, 1663, 878, 1060, 13, 310, 281, 1067, 247, 6001, 432, 634, 6561, 2670, 275, 253, 2608, 457, 84, 9882, 313, 42918, 16, 36947, 14942, 2748, 13, 604, 30873, 13, 12691, 2460, 582, 594, 326, 352, 457, 620, 873, 247, 19550, 342, 253, 6874, 1416, 285, 6874, 2654, 347, 1318, 762, 634, 6561, 2670, 457, 84, 5028, 1108, 760, 326, 588, 1056, 14741, 575, 494, 281, 773, 21888, 907, 668, 253, 2608, 457, 84, 9882, 2378, 597, 24171, 281, 634, 6561, 2670, 15, 24697, 5909, 253, 6874, 588, 417, 320, 3309, 313, 23350, 7384, 326, 1097, 4375, 897, 253, 1072, 6874, 582, 984, 253, 6874, 310, 2168, 3053, 13, 285, 512, 352, 3198, 323, 14741, 281, 2619, 352, 598, 327, 253, 6561, 2670, 310, 247, 11038, 6874, 2654, 432, 253, 19550, 15, 187, 2598, 1611, 2509, 326, 3185, 1108, 533, 320, 6600, 273, 253, 3237, 368, 1537, 1408, 715, 342, 326, 13, 1580, 253, 9882, 588, 1908, 253, 19550, 323, 253, 6561, 5028, 347, 247, 2626, 3128, 19550, 672, 368, 403, 2820, 281, 873, 352, 275, 253, 3634, 273, 634, 2022, 2670, 313, 395, 253, 10625, 1053, 457, 85, 3761, 13, 299, 15, 72, 15, 581, 310, 417, 3515, 327, 247, 749, 13517, 273, 253, 643, 390, 1633, 751, 326, 481, 535, 3122, 187, 475, 393, 18399, 50276, 34359, 273, 253, 21160, 5128, 14564, 846, 9008, 949, 378, 3109, 187, 475, 393, 7582, 8698, 23202, 187, 475, 393, 2754, 50275, 6620, 14, 2922, 14, 740, 187, 1738, 187, 187, 3122, 187, 475, 8283, 313, 36, 10, 4104, 14, 7132, 2588, 853, 40840, 38230, 187, 475, 187, 475, 831, 1873, 310, 629, 273, 253, 2588, 853, 9485, 7792, 13, 534, 310, 5939, 187, 475, 762, 253, 2426, 273, 253, 11963, 9767, 2771, 4214, 5259, 4637, 2715, 495, 15, 187, 1738, 187, 187, 3122, 5161, 3797, 1738, 187, 4, 3709, 654, 67, 3783, 64, 2203, 64, 12879, 15, 73, 31, 187, 187, 5302, 12953, 2588, 853, 28, 187, 187, 9834, 64, 85, 21160, 64, 2203, 64, 12879, 1450, 64, 2188, 900, 64, 4793, 64, 42446, 1082, 551, 1091, 470, 89, 9138, 28, 748, 187, 1628, 19735, 20000, 247, 42475, 668, 187, 187, 34, 23957, 273, 2516, 36239, 251, 3562, 407, 24569, 13, 48244, 9558, 21960, 418, 757, 310, 873, 281, 320, 12322, 387, 436, 807, 457, 84, 4051, 38766, 12473, 14964, 15, 187, 187, 510, 2516, 36239, 251, 6515, 489, 31444, 253, 3438, 18666, 282, 25661, 1411, 247, 6330, 861, 38683, 1272, 342, 690, 273, 253, 24591, 432, 521, 4498, 30778, 13, 2112, 342, 253, 25491, 773, 3074, 368, 878, 310, 10540, 668, 285, 773, 19735, 20000, 247, 4839, 6598, 380, 5406, 1060, 2722, 253, 6429, 48464, 21841, 323, 253, 38490, 28, 187, 187, 1628, 42, 3078, 281, 1361, 31636, 2516, 285, 714, 23988, 457, 84, 3935, 273, 20000, 285, 10540, 281, 253, 1533, 342, 253, 23957, 4473, 1806, 753, 21960, 15, 187, 187, 40, 6275, 251, 12473, 14964, 15217, 6277, 444, 41826, 556, 12470, 21960, 281, 1379, 253, 23957, 281, 253, 16365, 436, 5768, 313, 1731, 14, 1229, 3978, 6247, 10, 835, 352, 588, 320, 256, 959, 12936, 253, 27069, 323, 27456, 5201, 1513, 2247, 313, 3717, 47, 10, 12556, 15, 187, 187, 1628, 1231, 403, 1663, 9049, 281, 452, 253, 5107, 281, 3324, 2516, 457, 84, 3935, 273, 6330, 281, 594, 1142, 952, 387, 253, 1533, 457, 84, 5962, 16365, 1806, 753, 21960, 15, 5429, 535, 187, 47085, 23602, 13, 2087, 14385, 323, 3437, 47, 13, 753, 27, 773, 36, 6577, 310, 25534, 326, 436, 27231, 23957, 273, 2516, 36239, 251, 342, 253, 330, 6577, 6330, 861, 588, 320, 14167, 441, 387, 4051, 38766, 12473, 275, 6247, 15, 733, 310, 247, 5389, 5313, 273, 1445, 326, 588, 1361, 441, 275, 776, 4544, 281, 8591, 247, 625, 19951, 1533, 15, 4878, 6433, 285, 10846, 452, 247, 1048, 4062, 273, 8109, 330, 6577, 457, 84, 13698, 285, 436, 310, 760, 253, 6323, 1650, 273, 4466, 285, 46232, 3551, 2366, 281, 1067, 323, 247, 1533, 1293, 6069, 8914, 1425, 187, 187, 1628, 510, 9484, 369, 8927, 4158, 323, 253, 806, 3270, 14, 47745, 14172, 275, 23084, 285, 310, 253, 27069, 323, 27456, 5201, 1513, 2247, 457, 84, 18479, 281, 436, 1388, 1425, 187, 187, 510, 1495, 14, 3281, 34486, 6125, 271, 26893, 2460, 273, 2516, 2668, 275, 15788, 15, 380, 24272, 1566, 310, 1077, 4829, 6699, 347, 368, 476, 923, 432, 253, 5406, 2708, 13, 285, 21960, 13079, 281, 452, 352, 6312, 323, 33176, 272, 407, 4397, 281, 320, 5248, 275, 26247, 407, 2393, 7203, 6247, 15, 187, 187, 1628, 1231, 403, 2819, 323, 34423, 281, 1329, 436, 2199, 665, 452, 247, 9908, 323, 20000, 13, 1880, 597, 320, 4292, 13, 40159, 7458, 13, 10459, 23617, 13, 1355, 9341, 3966, 1806, 753, 21960, 15, 187, 187, 1628, 510, 954, 1774, 3284, 310, 323, 3780, 665, 11532, 275, 752, 359, 403, 2509, 13, 347, 352, 310, 1774, 281, 452, 253, 987, 2341, 15, 6101, 23672, 13, 642, 2647, 253, 1979, 13, 588, 320, 1270, 281, 1361, 3187, 436, 2199, 285, 594, 5195, 2516, 457, 84, 3935, 273, 6330, 1425, 187, 187, 34, 2234, 4809, 273, 253, 23957, 1146, 2011, 588, 320, 281, 4822, 23866, 281, 776, 25546, 19489, 13, 411, 1116, 786, 3692, 22368, 310, 281, 4017, 13, 31150, 285, 1462, 598, 323, 253, 3570, 273, 2151, 7270, 598, 275, 2137, 15, 187, 187, 21082, 8347, 369, 11420, 275, 9725, 407, 3085, 14, 16126, 5119, 10520, 285, 7641, 2070, 45336, 1108, 253, 19489, 8525, 2151, 665, 452, 2489, 10349, 273, 2137, 15, 187, 187, 1992, 1361, 2075, 323, 21960, 457, 84, 2199, 368, 476, 1481, 689, 281, 253, 2516, 36239, 251, 20000, 6515, 489, 6207, 4989, 1504, 272, 3239, 23531, 15, 187, 187, 17, 470, 6273, 14108, 36485, 187, 187, 34757, 30187, 5651, 3660, 10840, 1108, 4437, 3436, 13, 4765, 27, 1982, 20884, 1847, 1351, 9704, 456, 530, 5851, 84, 2064, 5706, 16970, 7247, 6037, 4793, 496, 12728, 21, 15, 1093, 1093, 1093, 1093, 1093, 20700, 562, 273, 608, 1754, 327, 1903, 17503, 15, 1903, 2608, 10123, 15, 187, 187, 30187, 5651, 3660, 10840, 1108, 4437, 3436, 13, 4765, 27, 1982, 20884, 1847, 1351, 9704, 456, 530, 5851, 84, 2064, 5706, 16970, 7247, 6037, 4793, 496, 12728, 187, 187, 5498, 366, 187, 187, 31886, 253, 4760, 1051, 187, 187, 2042, 368, 457, 250, 2104, 13, 285, 604, 368, 751, 776, 2600, 285, 2746, 13, 4496, 1329, 253, 2199, 15, 3824, 789, 5082, 457, 85, 320, 1896, 1293, 634, 1361, 27, 46104, 27, 6420, 6342, 33, 3550, 15, 579, 390, 3066, 27, 3944, 1358, 34542, 6342, 15, 2061, 16, 9903, 366, 16, 263, 3066, 27, 5987, 1358, 2700, 15, 4066, 31997, 15, 681, 16, 34542, 6342, 13, 47118, 27, 495, 40, 1768, 21, 83, 23925, 55, 40829, 50, 69, 25, 81, 20, 42524, 39, 10579, 89, 3859, 59, 88, 51, 371, 14852, 51, 59, 13, 378, 2775, 27, 2805, 18569, 19, 68, 545, 68, 22, 69, 13312, 18255, 82, 321, 24, 77, 73, 75, 19, 30838, 19084, 26, 27905, 20, 73, 1906, 76, 282, 2357, 42781, 82, 13, 47057, 27, 470, 89, 26, 71, 21, 68, 1473, 13144, 70, 25039, 67, 25, 12964, 23025, 3342, 21, 67, 26, 66, 26890, 1549, 336, 70, 24, 71, 24, 14576, 26, 187, 187, 34, 1982, 367, 583, 301, 251, 14, 25, 8756, 34056, 6415, 11658, 2145, 23355, 5442, 31319, 9411, 326, 13964, 7422, 457, 84, 388, 1405, 1105, 303, 2329, 4793, 275, 12728, 327, 4247, 721, 13, 7247, 19897, 14971, 8308, 20575, 4214, 13651, 401, 5240, 753, 387, 247, 499, 35634, 6874, 273, 253, 18496, 1594, 22589, 1200, 266, 24703, 327, 3988, 327, 4437, 2030, 15, 187, 187, 1628, 1044, 343, 6933, 530, 5851, 84, 4395, 2556, 281, 1846, 11757, 6680, 19007, 13, 11658, 407, 247, 2014, 10402, 15, 6408, 512, 436, 673, 253, 2448, 367, 583, 301, 251, 14, 25, 8756, 34056, 6415, 869, 9095, 253, 21609, 11936, 2170, 323, 4314, 3038, 1806, 20575, 4214, 13651, 4767, 6240, 326, 672, 253, 530, 5851, 84, 11372, 7247, 773, 47333, 27205, 3601, 13, 597, 4395, 1977, 281, 690, 4181, 13, 2959, 253, 3969, 7367, 285, 3407, 281, 320, 11658, 562, 273, 2317, 285, 6883, 1361, 275, 4560, 253, 594, 14, 8890, 11385, 949, 534, 597, 3053, 42393, 1425, 187, 187, 14067, 436, 13, 5093, 530, 5851, 84, 497, 1066, 264, 13, 285, 1453, 689, 2800, 35968, 369, 12103, 949, 7051, 27205, 2718, 15, 187, 187, 49354, 4214, 401, 5240, 671, 21947, 326, 352, 457, 84, 3058, 773, 936, 1691, 271, 990, 281, 253, 8332, 273, 2583, 13, 8914, 13, 6500, 285, 2710, 15991, 281, 23689, 13, 1690, 5793, 12696, 908, 1309, 253, 594, 14, 8890, 5793, 8104, 326, 403, 1996, 27137, 327, 253, 17959, 2208, 1425, 754, 4879, 326, 954, 273, 841, 5657, 285, 2097, 497, 4197, 275, 5639, 4343, 13, 3782, 24952, 3558, 3054, 15, 187, 187, 18978, 13, 13389, 14971, 8308, 8784, 304, 23407, 9271, 8592, 40818, 326, 5143, 773, 9846, 417, 2997, 667, 13133, 668, 327, 13389, 7185, 273, 4254, 275, 12728, 15, 9271, 8592, 20503, 327, 253, 3332, 5012, 407, 13389, 3420, 326, 7422, 5605, 281, 40206, 2259, 253, 5981, 273, 253, 16496, 14, 43017, 14, 13834, 400, 12716, 285, 11684, 5143, 281, 2085, 4321, 9734, 273, 18200, 15, 187, 187, 4553, 253, 7119, 342, 253, 7247, 5274, 14, 938, 4668, 6415, 275, 12728, 13, 16496, 2168, 4879, 326, 5143, 35136, 253, 5368, 3511, 14, 1282, 4345, 285, 3400, 247, 3221, 285, 43212, 8692, 327, 697, 5231, 275, 253, 2137, 14, 85, 1575, 2586, 15, 380, 7247, 14971, 13421, 22134, 8042, 562, 326, 253, 5274, 14, 938, 6415, 369, 1066, 264, 407, 17959, 2329, 5684, 3289, 984, 273, 773, 5465, 587, 5231, 668, 273, 5143, 15, 496, 2380, 13, 7422, 12164, 322, 14, 7554, 2718, 281, 253, 17959, 4668, 15, 187, 187, 1552, 2129, 5143, 457, 84, 10882, 20794, 5625, 556, 4439, 247, 1387, 273, 15109, 3888, 23962, 326, 253, 19007, 2670, 273, 253, 17959, 322, 14, 7554, 985, 310, 4441, 2822, 253, 7773, 273, 353, 7077, 2320, 275, 253, 14254, 273, 388, 2902, 15, 187, 187, 510, 4112, 4558, 29341, 275, 253, 4031, 4658, 1471, 6133, 274, 1320, 8232, 835, 41515, 2390, 4035, 8135, 272, 8571, 275, 253, 2208, 1253, 13028, 2170, 15, 380, 4112, 310, 3340, 9542, 275, 253, 31504, 273, 16660, 31244, 835, 253, 17959, 8663, 310, 1014, 6726, 281, 4459, 562, 3939, 851, 8952, 2473, 18200, 15, 187, 187, 1394, 6008, 10739, 285, 634, 3101, 310, 247, 23244, 15, 3954, 9359, 745, 368, 6513, 527, 1455, 2298, 251, 15, 187, 187, 51, 17798, 8456, 187, 187, 24953, 281, 2868, 1982, 651, 4205, 247, 1480, 2983, 327, 7422, 15, 309, 513, 417, 2868, 352, 984, 604, 2032, 22404, 816, 16535, 689, 285, 1339, 3778, 452, 521, 1039, 342, 779, 15, 22404, 556, 417, 753, 581, 3159, 13, 417, 1014, 1509, 253, 27203, 386, 15, 187, 187, 43, 561, 4716, 78, 187, 187, 3650, 247, 3159, 1580, 44118, 3702, 608, 15, 309, 717, 751, 1422, 275, 436, 15, 187, 187, 1147, 1364, 320, 323, 253, 33746, 2623, 2238, 15, 1422, 1918, 731, 247, 26531, 1020, 273, 8618, 285, 253, 9921, 4566, 1066, 15, 187, 187, 3433, 333, 1808, 19, 187, 187, 1628, 42, 717, 751, 1422, 668, 6279, 368, 403, 27, 767, 25106, 13, 6513, 527, 1455, 10709, 1397, 15, 3617, 1132, 342, 416, 308, 2484, 641, 251, 3185, 273, 8461, 9634, 436, 2670, 342, 634, 11339, 414, 15, 187, 187, 15883, 2577, 42054, 187, 187, 25925, 2793, 2722, 1982, 2085, 19256, 281, 25484, 285, 2434, 15, 281, 2342, 731, 390, 281, 1361, 731, 8785, 562, 8104, 15, 187, 187, 21914, 253, 9811, 273, 11487, 322, 2446, 2822, 1605, 343, 14, 38, 91, 14, 59, 454, 407, 1982, 6037, 71, 15053, 407, 6729, 13, 846, 534, 22404, 11226, 16527, 2560, 28665, 715, 1982, 16, 19642, 16, 25054, 19256, 8170, 275, 16660, 31244, 15, 187, 187, 2598, 697, 417, 1892, 281, 2868, 1982, 2530, 19256, 281, 35968, 347, 2529 ]
on your secondary site will not actually set a session cookie for your secondary domain in the user’s browser – because every response of that secondary site’s script does not “land” in the browser, it lands in your main site script, because that’s where you doing the request from. I think what you really need here, is to call a script from your secondary site in the user’s browser (JavaScript/AJAX request, iframe, embedded image), so that it’ll set a cookie with the session name and session id as value under your secondary site’s domain – only that will make PHP able to “recognize” the user’s browser once they navigate to your secondary site. Actually opening the session will not be necessary (still assuming that both sites use the same session), because the session is already started, and all it needs for PHP to pick it up on the secondary site is a matching session id from the cookie. So try doing that instead – but be aware of the problems you might run into with that, since the browser will consider the cookie for the secondary domain as a third party cookie when you are trying to set it in the context of your main site (and the domains don’t match, e.g. one is not running on a subdomain of the other or something like that). /* * \brief Structure of the Bios Data Area after preparation through Bender * \author Martin Stein * \date 2015-07-10 */ /* * Copyright (C) 2015-2017 Genode Labs GmbH * * This file is part of the Genode OS framework, which is distributed * under the terms of the GNU Affero General Public License version 3. */ /* core includes */ #include <bios_data_area.h> using namespace Genode; addr_t Bios_data_area::_mmio_base_virt() { return 0x1000; } “Give Peace a Chance” A statue of John Lennon created by Wells, Somerset artist Laura Lian is set to be exhibited at this year’s Glastonbury Festival. The John Lennon Statue depicts the former Beatle leaning against a peace sign engraved with some of the lyrics from his song Imagine, along with the phrases “All you need is Love” and “Give Peace a chance”. The picture here shows the maquette prototype for the statues; “I wanted to help spear John and Yoko’s message of Peace and Love to the world with the statue concept,” said Laura. Glastonbury Festival founder Michael Eavis has invited Laura to take the statue to the festival this summer (26-30 June 2019) where it will be sited alongside the Campaign for Nuclear Disarmament (CDN) tent. “We are really excited to have the opportunity to bring John’s message of peace to so many people at the world’s biggest festival,” said Laura. Kate Hudson, general secretary for CDN, said: “CND is delighted that this magnificent statue of John Lennon with the CND peace sign will be joining us at Glastonbury in 2019. It is a beautiful piece of art that will help us in our campaign to promote a more peaceful world. Musicians and artists have a long tradition of supporting CND’s aims and this is only the latest example of culture and campaigning coming together to call for a world without nuclear weapons.” “The symbol was originally designed for the first anti-nuclear march in 1958 and is the Campaign for Nuclear Disarmament’s logo to this day.” The life-size sculpture represents an iconic image of John taken in 1974. The clay model is very nearly finished as you can see from the picture below, and Laura hopes to have it completed for moulding by September to be cast in bronze by early spring 2019. “We are looking for sponsors to support this project who have a passion for Peace, whether they be individuals, Beatles fans, corporate organisations, small businesses etc,” said Laura. “The most important element is for anyone who believes in what we are doing, as it is important to have the right energy. Any donation, no matter the size, will be great to help fund this project and so spread John’s message of peace.” A key aspect of the statue being shown will be to collect donations to our nominated charity, Warchild whose Mission is to protect, educate and stand up for the rights of children caught up in war. War Child was founded in 1993 by film-makers David Wilson and Bill Leeson – the charity supports children who have become victims of war. To help pay for Laura’s project you can head over to the John Lennon Peace Statue crowdfunding page HERE. 0 0 vote Article Rating AdvertisementSyrian War Report – October 26, 2018: US Military Plane Operated UAVs That Attacked Russian Airbase In Syria4.1818181818182 out of 5 based on 11 ratings. 11 user reviews. Syrian War Report – October 26, 2018: US Military Plane Operated UAVs That Attacked Russian Airbase In Syria Donate Loading the player... If you’re able, and if you like our content and approach, please support the project. Our work wouldn’t be possible without your help: PayPal: [email protected] or via: http://southfront.org/donate/or via: https://www.patreon.com/southfront, BTC: 3Gbs4rjcVUtQd8p3CiFUCxPLZwRqurezRZ, BCH: qpf2cphc5dkuclkqur7lhj2yuqq9pk3hmukle77vhq, ETH: 0x9f4cda013e354b8fc285bf4b9a60460cee7f7ea9 A US Poseidon-8 reconnaissance plane operated 13 unmanned aerial vehicles that attacked Russia’s Hmeymim airbase in Syria on January 6, Russian Deputy Defense Minister Colonel General Alexander Fomin said at a plenary session of the Beijing Xiangshan Forum on security on October 25. “Thirteen UAVs moved according to common combat battle deployment, operated by a single crew. During all this time the American Poseidon-8 reconnaissance plane patrolled the Mediterranean Sea area for eight hours,” Colonel General Alexander stated adding that when the UAVs faced Russian “electronic warfare screen, they moved away to some distance, received the corresponding orders and began to be operated out of space and receiving help in finding the so-called holes through which they started penetrating.” Despite this, seven UAVs were downed, and control over six drones was gained through electronic warfare systems. Colonel General Fomin also emphasized that it’s needed “to put an end to the provision of money, weapons, equipment and various substances to terrorists, including chemical ingredients used during the so-called chemical attacks that are later blamed on the Syrian government.” He noted that most of these tools and means were produced in foreign countries, particularly NATO member states. Meanwhile, Israeli Defense Minister Avigdor Liberman vowed that Israel “will not accept any restrictions” on Israeli freedom of operation in Syria. Liberman commented on the recent reports by Israeli media that Russia wants to reshape the format of the Moscow-Tel-Aviv contacts and demands Israel to provide earlier warning of strikes. After the incident with the Russian IL-20 military plane in Syria, Moscow already noted that Israel ignores the existing hot-line agreement and provides a false and untimely info on its actions in the war-torn country. The Russian Defense Ministry openly pointed out that the IL-20 plane was downed by Syrian air defense fire because of “hostile actions” of Israel. In response, Russia supplied S-300 systems to the Syrian military. This week Israel’s ImageSat International has released a group of satellite images alleging that the deployment site of the Syrian S-300 system is located near the village of Masyaf in the province of Hama. The situation remains tense in the Idlib demilitarization zone where militant groups continue shelling targets in the government–held area. The situation is especially complicated in the countryside of Aleppo where the Syrian Army is even forced to carry out active retaliatory strikes. You eat shit and your mother is a goat. Now sod off you braindead moron. R Trojson Hard to believe US would mount a direct attack on Russia. I do not believe it because if true Putin just bent over and let Trump have his way with him. Putin has not said one word, not even pass the lubricant. Jens Holm Not a word since january 5. I am like You in this. It must be for the Gustava kind. You give them a spoonful of sugar and the medicine goes down. slayern2 “I am like You” Yes you are: two lonely, braindead turds. Go play with R Twhorson instead of polluting this site with your stupidity. Tommy Jensen Previous experience shows US provide Intelligence to ISIS and Co. to defend them or to help them carrying out attacks. Remember the killing of 82 SAA near Deir-Ez-Zour by US Airfighters by Obama, after which Putin fired Kalibr missiles into US/UK/Israel Intelligence Central in Aleppo. So its not hard to believe US provided Intelligence to drones as described
[ 31035, 22, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1671, 2082, 1671, 1525, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 76, 10614, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 30838, 31035, 22, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 348, 1596, 5200, 5246, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1012, 2759, 1839, 2358, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 348, 1596, 5200, 5246, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 348, 1596, 5200, 5246, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 34, 336, 29285, 3696, 429, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 12115, 520, 23558, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 34, 336, 29285, 3696, 429, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 34, 336, 29285, 3696, 429, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26497, 375, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 20, 11494, 23185, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 3233, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 26497, 375, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 44, 1830, 6955, 251, 57, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 24117, 2251, 1857, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 16800, 109, 28610, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 44, 1830, 6955, 251, 57, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50276, 870, 1206, 31, 187, 50276, 29, 1206, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 69, 360, 965, 86, 520, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 805, 3071, 520, 1976, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 69, 360, 965, 86, 520, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 69, 360, 965, 86, 520, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 12408, 1031, 9204, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1047, 11124, 3507, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 12408, 1031, 9204, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 12408, 1031, 9204, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 864, 610, 14906, 19, 14340, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 6903, 3566, 20070, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 864, 610, 14906, 19, 14340, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 864, 610, 14906, 19, 14340, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 20409, 82, 11489, 640, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1012, 26673, 1047, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 20409, 82, 11489, 640, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 20409, 82, 11489, 640, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 18269, 56, 1830, 44, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 3011, 24117, 2597, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 25192, 88, 1886, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 18269, 56, 1830, 44, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 936, 834, 543, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 35630, 18962, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 28777, 606, 775, 9041, 53, 543, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 936, 834, 543, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 20122, 543, 89, 9041, 10683, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 10655, 1012, 39338, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 510, 7211, 273, 11700, 22318, 2033, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 20122, 543, 89, 9041, 10683, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50276, 870, 1206, 31, 187, 50276, 29, 1206, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 40305, 89, 27475, 249, 3031, 938, 28879, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1717, 8897, 23292, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 40305, 89, 27475, 249, 3031, 938, 28879, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 40305, 89, 27475, 249, 3031, 938, 28879, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 12432, 8125, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 17391, 883, 29185, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 12432, 8125, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 12432, 8125, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 2413, 1358, 7280, 15, 681, 16, 37, 13659, 46, 8500, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1010, 21345, 20487, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 37, 13659, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 37, 13659, 46, 8500, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 2413, 1358, 9198, 15, 6113, 17915, 15, 3024, 16, 263, 2134, 965, 86, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 18, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 23292, 2251, 2950, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 263, 2134, 965, 86, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 263, 2134, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 13804, 4805, 36378, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 18, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 17271, 4590, 19603, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 13804, 4805, 36378, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 13804, 4805, 36378, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 52, 10320, 6104, 1312, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 18, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 24, 1706, 2537, 1797, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 17448, 46, 272, 8020, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 52, 10320, 6104, 1312, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 31, 654, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 52, 10320, 6104, 1312, 3, 4060, 568, 14500, 318, 1138, 14931, 230, 233, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358 ]
hao5"><img src="https://avatars3.githubusercontent.com/u/35653599?v=4" width="100px;" alt=""/><br /><sub><b>kenny</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=yuhao5" title="Code">💻</a></td> <td align="center"><a href="https://github.com/charnlsxy"><img src="https://avatars2.githubusercontent.com/u/13843868?v=4" width="100px;" alt=""/><br /><sub><b>charnlsxy</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=charnlsxy" title="Code">💻</a></td> <td align="center"><a href="https://github.com/AceDarkknight"><img src="https://avatars3.githubusercontent.com/u/11901298?v=4" width="100px;" alt=""/><br /><sub><b>AceDarkknight</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=AceDarkknight" title="Code">💻</a></td> <td align="center"><a href="https://github.com/gnuos"><img src="https://avatars2.githubusercontent.com/u/3014297?v=4" width="100px;" alt=""/><br /><sub><b>Data</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=gnuos" title="Code">💻</a></td> <td align="center"><a href="https://github.com/KISSMonX"><img src="https://avatars0.githubusercontent.com/u/2876745?v=4" width="100px;" alt=""/><br /><sub><b>侯名</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=KISSMonX" title="Code">💻</a></td> </tr> <tr> <td align="center"><a href="https://github.com/dumliu01"><img src="https://avatars0.githubusercontent.com/u/12060175?v=4" width="100px;" alt=""/><br /><sub><b>dumliu01</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=dumliu01" title="Code">💻</a></td> <td align="center"><a href="https://github.com/hlily2005"><img src="https://avatars0.githubusercontent.com/u/1411282?v=4" width="100px;" alt=""/><br /><sub><b>hlily2005</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=hlily2005" title="Code">💻</a></td> <td align="center"><a href="https://github.com/henrylee2cn"><img src="https://avatars3.githubusercontent.com/u/10174178?v=4" width="100px;" alt=""/><br /><sub><b>henrylee2cn</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=henrylee2cn" title="Code">💻</a></td> <td align="center"><a href="https://github.com/shaqsnake"><img src="https://avatars0.githubusercontent.com/u/1336914?v=4" width="100px;" alt=""/><br /><sub><b>shaqsnake</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=shaqsnake" title="Code">💻</a></td> <td align="center"><a href="https://github.com/TBWISK"><img src="https://avatars0.githubusercontent.com/u/5728787?v=4" width="100px;" alt=""/><br /><sub><b>tbwisk</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=TBWISK" title="Code">💻</a></td> <td align="center"><a href="https://github.com/toontong"><img src="https://avatars3.githubusercontent.com/u/416141?v=4" width="100px;" alt=""/><br /><sub><b>Huang ChuanTong</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=toontong" title="Code">💻</a></td> <td align="center"><a href="https://github.com/zhongxuan123"><img src="https://avatars3.githubusercontent.com/u/10513552?v=4" width="100px;" alt=""/><br /><sub><b>The notes of SQL optimize </b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=zhongxuan123" title="Code">💻</a></td> </tr> <tr> <td align="center"><a href="https://github.com/zhouxinxin19920802"><img src="https://avatars2.githubusercontent.com/u/29008269?v=4" width="100px;" alt=""/><br /><sub><b>zhouxinxin19920802</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=zhouxinxin19920802" title="Code">💻</a></td> <td align="center"><a href="https://github.com/macaria"><img src="https://avatars2.githubusercontent.com/u/20811449?v=4" width="100px;" alt=""/><br /><sub><b>macaria</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=macaria" title="Code">💻</a></td> <td align="center"><a href="http://github.com/DennisMao"><img src="https://avatars3.githubusercontent.com/u/15226239?v=4" width="100px;" alt=""/><br /><sub><b>Dennis</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=DennisMao" title="Code">💻</a></td> <td align="center"><a href="http://blog.csdn.net/orangleliu"><img src="https://avatars1.githubusercontent.com/u/2696746?v=4" width="100px;" alt=""/><br /><sub><b>orangleliu</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=orangle" title="Code">💻</a></td> <td align="center"><a href="https://github.com/HarbinZhang"><img src="https://avatars1.githubusercontent.com/u/21693162?v=4" width="100px;" alt=""/><br /><sub><b>HarbinZhang</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=HarbinZhang" title="Code">💻</a></td> <td align="center"><a href="https://github.com/SwanSpouse"><img src="https://avatars1.githubusercontent.com/u/7344921?v=4" width="100px;" alt=""/><br /><sub><b>LiMingji</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=SwanSpouse" title="Code">💻</a> <a href="https://github.com/talkgo/night/commits?author=SwanSpouse" title="Documentation">📖</a></td> <td align="center"><a href="https://
[ 8892, 751, 7487, 5579, 672, 309, 878, 253, 7315, 285, 253, 5665, 3590, 985, 281, 1614, 327, 387, 253, 1072, 673, 15, 831, 908, 281, 6388, 2709, 867, 4787, 285, 36182, 562, 534, 16020, 3058, 281, 320, 13661, 15, 3954, 342, 253, 5532, 273, 581, 6409, 309, 717, 7487, 5579, 18319, 342, 608, 15, 18, 5048, 5665, 3590, 299, 24763, 187, 187, 8195, 2181, 309, 2389, 670, 253, 8192, 614, 348, 29442, 2421, 2596, 8905, 310, 326, 352, 3249, 342, 697, 1211, 16153, 40517, 282, 15, 1422, 457, 620, 1620, 452, 281, 4489, 19978, 347, 1048, 347, 368, 816, 1339, 352, 4179, 13463, 15, 831, 2789, 1841, 1805, 323, 253, 3126, 285, 326, 310, 1633, 326, 310, 1663, 1774, 281, 479, 285, 619, 2021, 15, 8192, 614, 348, 457, 84, 3580, 403, 11485, 4388, 275, 273, 352, 285, 2712, 1160, 407, 731, 310, 1633, 326, 309, 452, 642, 1895, 15950, 271, 8149, 1066, 327, 15, 187, 187, 2042, 368, 457, 250, 247, 5599, 665, 556, 644, 2820, 281, 1158, 670, 1046, 1039, 30087, 494, 281, 21097, 247, 3226, 13, 840, 954, 2779, 816, 347, 253, 5020, 273, 6068, 562, 627, 368, 452, 644, 1469, 670, 352, 253, 3430, 1039, 15, 1422, 3164, 1869, 368, 9093, 452, 281, 22830, 281, 320, 11853, 368, 457, 250, 417, 13, 1880, 326, 2097, 38144, 13, 10046, 13, 8788, 1321, 13, 390, 667, 5019, 10445, 15, 12526, 2299, 824, 9437, 387, 40238, 2255, 1053, 457, 85, 789, 387, 512, 347, 597, 457, 250, 2104, 281, 923, 949, 731, 18319, 15, 380, 1895, 310, 326, 2429, 281, 6068, 13, 2255, 403, 1146, 4352, 327, 2761, 11485, 285, 3103, 604, 597, 452, 667, 2793, 387, 512, 597, 457, 306, 2326, 816, 670, 667, 285, 512, 9437, 275, 1340, 281, 3330, 616, 6706, 9024, 15, 3813, 642, 2647, 752, 2238, 273, 13597, 368, 403, 7296, 2970, 3206, 275, 13, 1690, 40167, 13597, 390, 667, 643, 8928, 3761, 35267, 13, 368, 476, 7740, 5913, 368, 1869, 670, 1607, 13537, 2255, 13, 1580, 841, 4803, 403, 10898, 15, 187, 187, 2042, 368, 1663, 971, 281, 871, 849, 281, 21097, 247, 3226, 13, 1690, 849, 281, 21097, 247, 269, 4099, 3226, 313, 4609, 310, 1620, 3477, 582, 840, 368, 8839, 452, 281, 1918, 598, 327, 253, 3674, 80, 12646, 4745, 15, 7820, 1158, 670, 634, 44108, 18701, 326, 703, 778, 11435, 13, 1690, 247, 3282, 273, 20393, 285, 7827, 3745, 15, 3954, 326, 588, 21097, 247, 2255, 1199, 625, 685, 667, 921, 745, 36633, 15, 10168, 2389, 247, 637, 665, 476, 1663, 2312, 11617, 327, 247, 5235, 273, 12989, 285, 327, 271, 8991, 1268, 347, 973, 15, 1310, 368, 457, 250, 2104, 281, 513, 326, 368, 457, 620, 320, 2168, 1039, 6386, 273, 253, 643, 6068, 562, 627, 13, 634, 7324, 15, 831, 3640, 943, 1705, 347, 247, 10112, 6619, 1580, 352, 457, 84, 246, 4261, 285, 417, 3626, 281, 22830, 281, 320, 1633, 368, 457, 250, 417, 15, 7820, 368, 476, 4264, 4834, 1199, 625, 672, 1146, 1475, 253, 3416, 368, 457, 250, 2820, 281, 755, 13, 285, 326, 3626, 1255, 285, 1708, 1255, 588, 8356, 16463, 745, 368, 285, 1056, 368, 1199, 625, 12994, 281, 617, 15, 36035, 1386, 13, 604, 368, 971, 281, 21097, 247, 3226, 13, 816, 320, 4834, 15, 187, 187, 41, 10245, 2135, 15150, 5809, 569, 403, 247, 9386, 1039, 281, 4264, 3753, 285, 253, 32321, 15, 12369, 368, 4288, 3815, 13, 347, 247, 4564, 390, 18262, 2021, 4288, 368, 588, 320, 2104, 281, 4264, 5389, 6849, 285, 3753, 15, 733, 476, 320, 247, 1270, 20705, 2793, 323, 253, 2021, 13, 247, 18109, 755, 14, 12594, 323, 767, 13, 390, 247, 673, 273, 18964, 285, 31255, 323, 581, 15, 187, 187, 8639, 5698, 981, 562, 327, 247, 18125, 273, 436, 1511, 368, 778, 971, 281, 755, 30795, 281, 8815, 2135, 15150, 275, 4577, 12768, 15, 3771, 984, 368, 403, 417, 271, 46952, 8815, 2135, 30340, 1057, 417, 1599, 368, 2550, 4264, 8815, 896, 15150, 23193, 13, 533, 634, 2133, 588, 878, 281, 755, 10904, 281, 8815, 2135, 15150, 15, 11668, 247, 1643, 8815, 2135, 15150, 15880, 13, 390, 6947, 247, 1643, 1897, 327, 247, 4577, 755, 12594, 281, 755, 634, 9246, 285, 896, 908, 281, 253, 8132, 263, 15, 2635, 672, 368, 403, 4704, 368, 476, 1718, 275, 247, 3356, 18125, 15, 187, 187, 6104, 1946, 247, 2129, 390, 767, 327, 247, 34034, 310, 1633, 253, 2862, 2021, 476, 629, 640, 273, 285, 4264, 15, 4683, 2282, 352, 4566, 1293, 3981, 326, 4130, 588, 878, 281, 320, 275, 4345, 390, 352, 588, 1056, 323, 247, 417, 594, 17127, 18125, 15, 1292, 604, 4130, 310, 275, 4345, 840, 436, 812, 990, 598, 1146, 581, 273, 253, 954, 794, 2021, 5809, 569, 15, 187, 187, 4041, 794, 4836, 310, 13887, 253, 987, 863, 603, 15, 23359, 253, 629, 310, 1774, 285, 627, 403, 247, 3167, 273, 28234, 285, 14234, 4957, 326, 588, 1361, 368, 513, 816, 326, 15, 30322, 2400, 285, 1892, 90, 27929, 13, 9848, 499, 13774, 32622, 13, 285, 1943, 39978, 403, 247, 1175, 1265, 281, 634, 3962, 27170, 15, 329, 12120, 14889, 7856, 285, 19269, 588, 1361, 368, 3426, 253, 1007, 15, 1244, 1053, 457, 85, 7740, 281, 3324, 2112, 690, 1175, 3290, 5101, 2972, 390, 5101, 3601, 2257, 279, 281, 1978, 5101, 14814, 1977, 15, 187, 187, 1394, 285, 634, 2021, 403, 512, 873, 323, 271, 12302, 8815, 2135, 15150, 18125, 326, 368, 403, 2119, 281, 4456, 323, 1142, 1107, 281, 1705, 15, 187, 187, 3902, 273, 7284, 26864, 2434, 968, 310, 5876, 407, 2710, 15711, 1097, 432, 253, 2791, 390, 5054, 4809, 285, 432, 253, 5328, 18011, 3139, 15, 380, 5328, 18011, 591, 396, 556, 697, 1211, 821, 12542, 10159, 273, 253, 5054, 2515, 15, 9541, 19539, 441, 326, 5328, 556, 1900, 644, 581, 273, 253, 9865, 285, 1014, 253, 954, 18153, 18494, 2455, 1580, 253, 4201, 273, 1966, 23749, 15, 5863, 281, 436, 1127, 13, 436, 1318, 273, 5328, 3139, 7788, 281, 320, 18380, 47323, 253, 27274, 5054, 30992, 326, 7462, 600, 2818, 253, 4832, 2515, 273, 6422, 4343, 273, 253, 1533, 15, 1284, 281, 253, 2791, 4376, 273, 5328, 21078, 13, 2176, 946, 3339, 285, 5054, 2515, 476, 2818, 616, 5454, 7911, 984, 253, 2791, 1430, 273, 5328, 21078, 310, 4122, 7976, 327, 697, 4376, 323, 4156, 28587, 15, 1310, 368, 4489, 5328, 3909, 13, 368, 476, 4354, 3653, 841, 2616, 326, 2818, 253, 4376, 273, 5328, 38344, 824, 347, 253, 278, 26082, 5328, 21078, 15, 187, 187, 8836, 665, 4489, 5328, 3909, 476, 4354, 2451, 327, 253, 1533, 2791, 4376, 273, 5328, 285, 2278, 253, 753, 821, 12542, 15, 1310, 253, 4216, 46955, 247, 11002, 4376, 273, 5328, 13, 840, 5604, 253, 4376, 273, 5328, 21078, 651, 671, 7933, 2572, 15, 831, 5921, 310, 9090, 1955, 281, 253, 958, 326, 841, 5328, 21078, 452, 6832, 2408, 273, 5328, 3603, 275, 731, 15, 380, 24410, 285, 2600, 273, 5328, 275, 841, 21078, 10260, 2818, 253, 616, 1318, 1309, 5454, 285, 23261, 15, 187, 187, 43954, 13, 253, 4376, 273, 5328, 275, 253, 1533, 2791, 476, 2057, 7450, 390, 3785, 253, 4376, 273, 5328, 21078, 15, 16688, 253, 2022, 15711, 273, 38454, 285, 12946, 275, 11280, 5328, 21078, 13, 253, 5328, 2600, 285, 24410, 273, 253, 753, 3580, 943, 1900, 320, 3413, 594, 326, 253, 4376, 273, 253, 753, 21078, 476, 320, 6283, 622, 42750, 1754, 327, 253, 27274, 4376, 273, 253, 5328, 3139, 15, 8079, 13, 253, 5328, 3139, 285, 697, 4376, 275, 253, 2791, 10260, 11852, 253, 2791, 1430, 285, 5054, 3590, 1255, 273, 253, 5328, 21078, 323, 8149, 390, 4849, 6378, 15, 187, 187, 1909, 359, 2312, 670, 4302, 13, 627, 403, 1142, 1841, 534, 403, 1146, 3715, 407, 1142, 952, 1475, 253, 1533, 15, 23449, 432, 253, 1841, 534, 403, 908, 281, 5237, 952, 253, 4302, 556, 6518, 247, 2257, 273, 952, 275, 2710, 4088, 15, 1707, 403, 1142, 3739, 44776, 534, 403, 4354, 2326, 342, 253, 1361, 273, 253, 4302, 285, 2868, 479, 390, 417, 436, 310, 253, 954, 1774, 1673, 835, 4302, 556, 1669, 697, 1616, 2220, 15, 2058, 253, 5068, 13, 253, 897, 273, 253, 7336, 369, 11096, 13, 285, 760, 253, 530, 15, 52, 15, 8663, 812, 897, 253, 8573, 323, 3733, 15, 1292, 2378, 253, 8573, 369, 1160, 4320, 323, 253, 897, 273, 2087, 952, 13, 352, 3562, 247, 747, 1533, 326, 359, 476, 923, 1024, 15, 3105, 760, 436, 13, 533, 671, 952, 403, 970, 253, 8573, 275, 616, 1388, 281, 1388, 1495, 15, 4794, 281, 253, 6323, 6630, 13, 8688, 2558, 273, 253, 952, 897, 253, 7336, 13, 285, 9330, 2558, 273, 731, 6947, 616, 954, 273, 253, 673, 970, 253, 8573, 15, 187, 187, 2512, 310, 417, 247, 2014, 534, 310, 1669, 48976, 407, 253, 8573, 285, 4302, 15, 496, 253, 2710, 17057, 835, 952, 452, 281, 789, 323, 3038, 594, 326, 597, 476, 755, 625, 11528, 281, 253, 2567, 13, 533, 310, 1024, 2668, 689, 407, 253, 4302, 15, 2053, 952, 1053, 457, 85, 452, 281, 1379, 253, 5536, 3301, 273, 253, 789, 13, 285, 2581, 512, 253, 3301, 310, 2668, 407, 253, 10679, 534, 403, 3562, 970, 253, 4302, 15, 11997, 1204, 2440, 310, 671, 1669, 48976, 13, 285, 952, 476, 897, 253, 4302, 281, 755, 4869, 5956, 285, 3477, 22710, 15, 1198, 1110, 952, 13, 352, 556, 2489, 6927, 281, 789, 285, 4288, 326, 4288, 247, 2257, 390, 616, 2628, 2789, 731, 4288, 15, 5595, 273, 253, 952, 2389, 281, 4288, 347, 597, 476, 923, 512, 253, 3626, 10763, 285, 4466, 273, 1027, 5053, 285, 253, 897, 273, 4302, 556, 1160, 310, 3477, 285, 4722, 15, 187, 187, 2512, 403, 1142, 1841, 824, 347, 4156, 3268, 985, 285, 4382, 28930, 985, 534, 452, 1160, 1841, 6927, 685, 352, 369, 15, 444, 14, 47487, 8211, 476, 1361, 952, 755, 253, 14997, 273, 9825, 285, 476, 320, 4354, 7515, 342, 253, 1728, 14, 3169, 4382, 985, 285, 253, 8573, 15, 380, 8573, 310, 253, 2022, 1921, 323, 253, 2440, 273, 253, 4302, 285, 1491, 285, 954, 273, 253, 1841, 534, 368, 476, 923, 3063, 310, 984, 273, 253, 8573, 15, 2053, 1897, 457, 952, 476, 1984, 253, 14997, 1077, 4354, 13, 4541, 285, 7938, 685, 2045, 2069, 285, 627, 310, 2717, 534, 476, 13292, 253, 958, 15, 2726, 253, 11659, 273, 444, 14, 47487, 8211, 13, 253, 14247, 824, 347, 11993, 253, 14997, 285, 30959, 731, 347, 10260, 6137, 347, 627, 310, 642, 1921, 323, 1110, 1841, 15, 4794, 281, 253, 6323, 6630, 13, 2456, 2558, 273, 253, 952, 665, 4288, 897, 253, 444, 14, 47487, 8211, 281, 1984, 616, 14997, 534, 8046, 731, 281, 4288, 342, 1698, 14, 16736, 15116, 15, 187, 187, 12412, 14, 15177, 9954, 7236, 13, 5702, 4254, 2285, 285, 1029, 14, 7527, 9787, 15942, 7465, 403, 253, 1264, 2201, 3238, 326, 368, 476, 1902, 432, 9954, 1275, 3814, 272, 1232, 15, 496, 34953, 13, 627, 403, 1142, 11720, 1275, 3814, 272, 4413, 13, 533, 368, 452, 281, 3609, 253, 581, 534, 16382, 34953, 7465, 342, 31925, 275, 7681, 15040, 15, 20766, 29299, 310, 1529, 954, 1774, 11104, 326, 943, 417, 564, 5816, 672, 8871, 247, 1275, 3814, 272, 5882, 15, 187, 187, 4943, 403, 690, 12192, 323, 4685, 2139, 667, 1798, 1275, 3814, 272, 2567, 320, 6777, 689, 253, 2571, 15, 187, 187, 510, 41893, 281, 5206, 253, 987, 34953, 1275, 3814, 272, 2579, 187, 187, 5817, 9423, 562, 323, 667, 16620, 390, 756, 48001, 347, 2959, 407, 253, 2567, 15, 3808, 273, 253, 954, 16613, 5722, 14505, 2486, 2802, 17277, 5213, 48898, 6023, 3623, 457, 285, 2802, 17277, 23557, 285, 9704, 1050, 21856, 457, 5722, 15, 2053, 767, 16620, 403, 3240, 34544, 285, 604, 247, 2567, 556, 644, 35716, 342, 667, 273, 731, 13, 368, 476, 10725, 327, 697, 1275, 86, 3485, 3238, 15, 187, 187, 5817, 743, 5919, 1275, 86, 3485, 5882, 588, 452, 247, 2266, 285, 6485, 2285, 273, 5820, 2530, 342, 1375, 14, 1171, 14, 435, 3640, 285, 5657, 281, 3037, 1046, 2508, 670, 1275, 86, 3485, 15, 9423, 562, 604, 253, 2567, 556, 247, 2266, 2613, 273, 28022, 1512, 534, 1804, 326, 352, 310, 4999, 281, 1718, 275, 436, 2567, 16, 49053, 15, 187, 187, 5817, 38315, 1275, 86, 3485, 2579, 275, 34992, 310, 6571, 670, 970, 34953, 7236, 285, 28106, 253, 1072, 347, 591, 253, 4831 ]
tasks like watching TV when I need the television and the surround sound system to turn on at the same time. This used to involve multiple remotes and figuring out which buttons needed to be pressed. Now with the click of one button I am watching TV instantly with 5.1 channel surround sound eerie Another thing I love about the Logitech Harmony One remote is that it comes with its own charging cradle. You’ll never have to buy batteries as long as you just let it charge overnight. This makes things better for the environment and that is something that is really important to me and my family. Logitech’s products are constantly aim in of it and anything made by them is something that I have no problem throwing an investment down on. If you’re a guy who has been trying to think about every way imaginable to impress a girl, then most likely just as the majority of guys out there you have been going about it the wrong way. You probably thought you essentially have to pretend to be somebody you’re not, whether that means smarter, stronger, wealthier, or any combination thereof. Unfortunately however such attempts at manipulating women don’t work at all as they’re able to see through them instantly. The problem is that compared to guys, women are being hit on almost constantly and therefore if they have any experience at all they’ve seen just about any and all attempts in order to win their affections. Therefore no matter what kind of dating you are considering getting involved in, including polish dating or any other cultural match ups, you can forget whatever you thought about impressing women, since these rules are universal. If you really want to know how to impress a girl, including how to impress a french girl (which is never easy), then you absolutely have to give up on the macho displays immediately. Instead think about your softer qualities that she may appreciate, including a sense of humor and conversation ability. Now that will impress a women much more than any show off tactic. Women love a man who can really talk deeply on a variety of topics and on an emotional level as well. If you’re able to do that you’ll be already way ahead of the other guys out there, your competition. This knowledge should come as a welcome relief since it’s tiring and not natural to pretend to be something you’re not. Instead you can enjoy yourself much more when being around the woman you’re trying to get, and that naturalness and lightness will automatically brush off you and make you much more attractive to her. Bottom line, if you want to impress a girl, just be yourself. Horseback riding vacations are a wonderful way to enjoy nature and the outdoors. Whether you travel alone, as a couple or enjoying family travel you will be able to enjoy beautiful views and nature. It can be a great bonding experience for the family, a romantic get-away for two, or a time of reflecting and refreshing for one. Before venturing out on a vacation of this type you may want to get accustomed to horseback riding in smaller doses. Just because you are not an avid horseback rider does not mean you cannot enjoy horse back riding holidays, but your body will need to get adjusted to horseback riding. Take a few horseback riding lessons, or spend a few days on a smaller getaway to get your legs and back used to the rigor. Then when you are ready you can invest in a longer vacation. Spending a week or two on a ranch is something the entire family can partake of and enjoy. Of course it goes without saying that everyone will need to be in agreement or it will make for a not so pleasant vacation. But if everyone is in agreement then this could end up being one of the most fun family vacations. One fun task is choosing the right attire. Looking the part is important and there are a host of accessories and clothing items that will help you do just that. Rugged and hardy jeans, comfortable plaid shirts, and big belts are a good start to your perfect outfit. A cowboy hat and boots will help you complete the look. And don’t forget to bring along some good quality sun block or sun screen lotion to keep sunburn away. You and your family are all set for an exciting horseback riding vacation that you are sure to remember for many years to come. Value of Gold Eagle Coins is affected by various considerations both from the market or economic aspect and from the gold coin itself. The gold coin per se has its own valuations regardless of the economic conditions. History proves us that gold has always been one of the valuable and even the most precious metals ever since the birth of human civilization. Up to this point, this value of gold itself continues to be sustainable amidst the prevailing economic disturbances that gravely affect the financial conditions of powerful countries of the world. As to the market price of gold coins, certain speculations and economic conditions can affect their trade prices because the marketability of gold coins is highly dependent on its price for global trades. If you buy gold online, you can easily determine these factors that affect the price of gold commodities such as the minted gold coins. People who buy gold online can easily check on the world market price of gold and review the said valuations. If the graph manifests a rising price of gold, then certainly the price of gold coins would also necessarily increase. This correlation is obviously due to the fact that these gold coins have substantial amount of gold elements in them. The purity and content of gold in these coins greatly affect the their value during trade and exchanges. Certainly, the price of gold in the world market can either push or pull the price of gold coins. Being the main considerations of collectors and investors in buying gold coins, the gold content and purity of the said products should always be determined so that the price of the said coins can be properly appraised based on the prevailing price of the gold itself. Indeed, the gold itself and its price in the market greatly affects the marketability and economic soundness of the gold coins for investment or collection purposes. As we talk about technology, there are many things which are being developed by many people around the world. Apart from the things which are used to harm people the technology has helped a lot of people in various ways. There are many medical miracles which are easily seen with the help of the technology and believe me or not this is the most important field where technology has left its mark upon. At the beginning, the use of the Internet was restricted, and only the U.S. Army could use the internet for training. But once the internet was made legal for the use of general people, it created a new world that we can see now. Not only this, but also people are using the internet in their day to day life. According to the latest survey, 99 percent of the people use the Internet, and 85 percent of them spend their most of the time using the internet. There is not a single which is left untouched by the internet and technology. In the various industries where people have to work for hours so that they can get more profit to the company, but is now taken over by the technology. These people don’t have to take the heavy load of the work, and rather all the load is taken by the machines which are created using the technology. Tourism development is also left untouched, and people can use the technology to get maximum comfort and easy travelling. For those people, it has become easier to work and travel that travel a lot or their job makes them travel. Most of the people love to travel as they can see all the natural beauty and culture of different places and the use of technology has made is easy and interesting. There are many things such as global distribution system and computer reservation system which have made things easier than it was. E-ticketing can help people get the tickets of anywhere and can be easily assessed with the home-based computer system and the internet. The internet is the main reason for the development of the technology and information and most of the things which you can see today is because of the internet. These days’ people can book the tickets very easily, quickly and faster than previous times and there is nothing which can deny the fact. With the availability of E-ticketing, the expense such as printing the tickets and mailing them as greatly decreased as there is no reason for those things. According to the latest survey, 50 percent of the people who travel use the E-ticketing to book their tickets which enable them to travel with low-cost filters. High-quality aircraft fuel, professional operation team and high-scale industrial operational standards are the three major services that you can expect from aircraft refueling process. In aviation, there are many jet refueling companies, but you have to select the one which meets aviation standards with excellence in technical expertise. Quality assurance is another most important attribute that should not go missing when picking a refueling firm. Here are some tips for understanding why any particular refueling company be chosen over the others. The Tips to choose the right aviation refueling service • Check out for any awards or accreditation as received by the company. Some of the most notable award titles include ‘Best international Fuel Supplier’ and ‘Best Technical and Operational Performance’ award. These two awards are quite prestigious and if a company has been conferred with any of them, you can rely on its refuelling services. • An efficient refuelling firm will have a strong and expert team of workers provided with state-of-art knowledge and tools to learn every detail about refuelling. Check out if the company has a strong base of stakeholders too which suggest that it is safe to invest in this company/firm. • Aviation refuelling service in Dubai is mostly about using aviation fuel and supplying the same as per the demand
[ 187, 2912, 187, 187, 1231, 5283, 1060, 253, 41818, 273, 253, 1984, 1008, 3979, 20, 40, 62, 285, 253, 3082, 3715, 275, 253, 3929, 1008, 41, 14, 18, 1570, 496, 253, 1083, 273, 575, 5, 21, 2911, 48123, 13, 327, 476, 4853, 253, 5572, 1764, 2043, 92, 6674, 94, 268, 64, 17, 27, 708, 43, 64, 18, 5716, 1588, 92, 48, 7294, 19, 29372, 464, 18637, 21316, 1926, 1588, 92, 48, 7294, 20, 61, 7083, 708, 393, 1274, 1035, 2043, 92, 6674, 94, 91, 64, 20, 13, 81, 64, 20, 13, 82, 64, 20, 393, 7083, 187, 91, 64, 21, 13, 81, 64, 21, 13, 82, 64, 21, 61, 423, 92, 6674, 889, 918, 10, 708, 464, 18637, 21316, 187, 61, 1274, 1035, 2043, 92, 6674, 94, 81, 64, 21, 12, 34, 578, 883, 94, 91, 64, 20, 12, 34, 578, 805, 94, 91, 64, 21, 393, 7083, 187, 81, 64, 20, 12, 82, 64, 21, 12, 34, 578, 1797, 94, 91, 64, 20, 12, 34, 578, 1423, 94, 91, 64, 21, 393, 7083, 2805, 64, 20, 12, 34, 578, 2405, 94, 91, 64, 20, 12, 34, 578, 1237, 94, 91, 64, 21, 187, 61, 423, 92, 6674, 889, 918, 1572, 423, 92, 6674, 10878, 2635, 359, 755, 271, 3242, 285, 33796, 10659, 187, 187, 7010, 2043, 92, 6674, 94, 187, 50275, 7, 50276, 7, 50276, 17, 61, 20744, 20744, 28, 4615, 7, 50276, 7, 17, 61, 20744, 20744, 28, 4615, 50276, 7, 50275, 7, 470, 708, 50275, 7, 50275, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 50276, 7, 50276, 7, 393, 4251, 3487, 61, 20744, 20744, 28, 50276, 7, 50275, 7, 393, 4251, 3487, 18856, 50276, 7, 50276, 7, 393, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 305, 64, 17, 61, 20744, 28511, 4615, 708, 464, 18637, 21316, 322, 64, 18, 5716, 1588, 92, 48, 7294, 19, 1572, 7405, 14101, 187, 5977, 23386, 464, 2592, 64, 17, 2704, 18637, 21316, 50276, 464, 1588, 92, 48, 7294, 20, 50276, 7, 464, 18637, 21316, 50276, 17, 393, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50275, 7, 50275, 61, 4251, 3487, 61, 13309, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 64, 17, 61, 20744, 20744, 28, 708, 464, 18637, 21316, 500, 64, 18, 5716, 1588, 92, 48, 7294, 19, 1572, 7405, 14101, 187, 5977, 23386, 92, 81, 64, 17, 2704, 18637, 21316, 1926, 1588, 92, 48, 7294, 20, 50276, 7, 464, 18637, 21316, 470, 50276, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 393, 4862, 464, 2059, 19289, 18, 21316, 50276, 7, 50276, 61, 4251, 3487, 393, 2059, 12740, 18, 21316, 50275, 7, 50275, 61, 4251, 3487, 61, 13309, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 12740, 18, 889, 20744, 28, 708, 464, 18637, 21316, 1926, 1588, 92, 48, 7294, 19, 61, 20744, 28511, 187, 5977, 23386, 92, 81, 12740, 18, 7780, 18637, 21316, 470, 50276, 7, 50275, 7, 50275, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50275, 7, 50275, 7, 50275, 7, 50275, 61, 7083, 187, 50276, 7, 50276, 7, 470, 61, 20744, 20744, 28, 4615, 708, 708, 470, 61, 20744, 20744, 28, 4615, 708, 708, 50275, 7, 708, 50275, 61, 7083, 187, 61, 423, 92, 6674, 2138, 835, 253, 5170, 1386, 7350, 14217, 273, 370, 81, 64, 17, 1352, 187, 187, 1672, 20692, 314, 13, 359, 452, 27, 669, 2592, 64, 17, 1035, 2043, 92, 6674, 94, 81, 64, 20, 13, 82, 64, 20, 61, 7083, 187, 81, 64, 21, 13, 82, 64, 21, 61, 423, 92, 6674, 2311, 10190, 81, 64, 21, 13, 81, 64, 20, 12, 82, 64, 21, 13, 82, 64, 20, 1009, 3692, 10295, 575, 5, 72, 64, 17, 5, 310, 840, 25783, 281, 2367, 1588, 92, 48, 11971, 187, 187, 510, 806, 13455, 318, 370, 81, 64, 18, 27, 43, 64, 19, 5716, 1588, 92, 48, 7294, 19, 17765, 18637, 94, 43, 64, 18, 5716, 1588, 92, 48, 7294, 20, 1009, 273, 370, 81, 64, 17, 5, 310, 840, 1677, 407, 3318, 81, 64, 18, 61, 1274, 1035, 2043, 92, 6674, 94, 91, 64, 20, 13, 81, 64, 20, 13, 82, 64, 20, 13, 83, 64, 20, 13, 84, 64, 20, 13, 85, 64, 20, 61, 7083, 1182, 64, 21, 13, 81, 64, 21, 13, 82, 64, 21, 13, 83, 64, 21, 13, 84, 64, 21, 13, 85, 64, 21, 61, 423, 92, 6674, 889, 918, 4010, 187, 61, 24343, 61, 2043, 92, 6674, 94, 81, 64, 21, 12, 34, 578, 883, 94, 91, 64, 20, 12, 34, 578, 805, 94, 91, 64, 21, 393, 7083, 187, 81, 64, 20, 12, 82, 64, 21, 12, 34, 578, 1797, 94, 91, 64, 20, 12, 34, 578, 1423, 94, 91, 64, 21, 393, 7083, 187, 82, 64, 20, 12, 34, 578, 2405, 94, 91, 64, 20, 12, 34, 578, 1237, 94, 91, 64, 21, 61, 423, 92, 6674, 889, 918, 4700, 1764, 1274, 4880, 2043, 92, 6674, 94, 83, 64, 21, 12, 34, 578, 883, 94, 81, 64, 20, 12, 34, 578, 805, 94, 81, 64, 21, 23002, 3214, 64, 89, 1603, 34, 578, 883, 2311, 91, 64, 20, 23002, 3214, 64, 89, 1603, 34, 578, 805, 2311, 91, 64, 21, 187, 61, 7083, 391, 64, 20, 12, 84, 64, 21, 12, 34, 578, 1797, 94, 81, 64, 20, 12, 34, 578, 1423, 94, 81, 64, 21, 23002, 3214, 64, 89, 1603, 34, 578, 1797, 2311, 91, 64, 20, 23002, 3214, 64, 89, 1603, 34, 578, 1423, 2311, 91, 64, 21, 393, 7083, 187, 84, 64, 20, 12, 34, 578, 2405, 94, 81, 64, 20, 12, 34, 578, 1237, 94, 81, 64, 21, 23002, 3214, 64, 89, 1603, 34, 578, 2405, 2311, 91, 64, 20, 23002, 3214, 64, 89, 1603, 34, 578, 1237, 2311, 91, 64, 21, 61, 423, 92, 6674, 889, 918, 4700, 1764, 1274, 4880, 2043, 92, 6674, 94, 84, 64, 21, 12, 34, 578, 883, 94, 82, 64, 20, 12, 34, 578, 805, 94, 82, 64, 21, 23002, 3214, 64, 90, 1603, 34, 578, 883, 2311, 91, 64, 20, 23002, 3214, 64, 90, 1603, 34, 578, 805, 2311, 91, 64, 21, 187, 61, 7083, 256, 64, 20, 12, 85, 64, 21, 12, 34, 578, 1797, 94, 82, 64, 20, 12, 34, 578, 1423, 94, 82, 64, 21, 23002, 3214, 64, 90, 1603, 34, 578, 1797, 2311, 91, 64, 20, 23002, 3214, 64, 90, 1603, 34, 578, 1423, 2311, 91, 64, 21, 393, 7083, 187, 85, 64, 20, 12, 34, 578, 2405, 94, 82, 64, 20, 12, 34, 578, 1237, 94, 82, 64, 21, 23002, 3214, 64, 90, 1603, 34, 578, 2405, 2311, 91, 64, 20, 23002, 3214, 64, 90, 1603, 34, 578, 1237, 2311, 91, 64, 21, 187, 61, 423, 92, 6674, 889, 28946, 1890, 187, 187, 4609, 5644, 441, 281, 1529, 33796, 285, 3242, 10659, 27, 1764, 2043, 92, 6674, 94, 187, 50275, 7, 50276, 7, 50276, 17, 61, 20744, 13309, 50276, 7, 17, 61, 20744, 28, 50276, 7, 50275, 7, 470, 50276, 7, 50275, 7, 50275, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 28, 50276, 7, 50276, 7, 393, 4251, 3487, 61, 20744, 28, 50276, 7, 50275, 7, 393, 4251, 3487, 50276, 7, 50276, 7, 393, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 305, 64, 18, 30, 17, 708, 464, 18637, 21316, 322, 64, 19, 5716, 1588, 92, 48, 7294, 19, 10, 187, 5977, 23386, 464, 2592, 64, 18, 2704, 18637, 21316, 50276, 52, 64, 18, 5716, 1588, 92, 48, 7294, 20, 10, 50276, 7, 464, 18637, 21316, 50276, 17, 393, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50275, 7, 50275, 61, 4251, 3487, 7, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 64, 18, 61, 28511, 708, 464, 18637, 21316, 500, 64, 19, 5716, 1588, 92, 48, 7294, 19, 10, 187, 5977, 23386, 92, 81, 64, 18, 2704, 18637, 21316, 500, 64, 18, 5716, 1588, 92, 48, 7294, 20, 10, 50276, 7, 464, 18637, 21316, 470, 50276, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 393, 4862, 464, 2059, 2000, 17, 7, 50276, 7, 50276, 61, 4251, 3487, 393, 2059, 64, 17, 7, 50275, 7, 50275, 61, 4251, 3487, 7, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 578, 17, 889, 28511, 708, 464, 18637, 21316, 500, 64, 18, 5716, 1588, 92, 48, 7294, 19, 10, 187, 5977, 23386, 92, 81, 578, 17, 7780, 18637, 21316, 1926, 1588, 92, 48, 7294, 20, 50276, 7, 50275, 464, 18637, 21316, 470, 50273, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50275, 7, 393, 4251, 3487, 50276, 7, 50275, 7, 50275, 61, 7083, 187, 50276, 7, 50276, 7, 470, 708, 708, 470, 708, 708, 470, 50276, 7, 708, 50275, 61, 7083, 61, 423, 92, 6674, 10878, 3308, 669, 4862, 464, 2059, 2000, 17, 5, 310, 271, 20169, 15, 380, 806, 26878, 2570, 310, 1677, 407, 575, 1890, 17, 61, 18637, 393, 6190, 92, 30428, 187, 94, 393, 1588, 92, 46, 1603, 21, 10, 393, 23386, 92, 75, 64, 19, 2704, 18637, 94, 444, 187, 61, 23386, 92, 37, 2704, 18637, 94, 393, 4153, 63, 18, 61, 5786, 1126, 1588, 92, 48, 599, 51, 64, 17, 187, 61, 23386, 92, 37, 2704, 18637, 94, 393, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 51, 12740, 18, 889, 18637, 470, 1890, 835, 209, 575, 5, 38, 5, 9572, 323, 253, 10295, 273, 370, 81, 64, 18, 1352, 844, 27566, 432, 436, 253, 1563, 33796, 10659, 13, 3692, 3104, 403, 3242, 285, 3692, 9930, 403, 3242, 275, 575, 5, 51, 64, 76, 1366, 285, 575, 5, 75, 64, 19, 5, 285, 575, 5, 75, 64, 20, 5, 403, 1114, 29675, 27, 1764, 2043, 92, 6674, 94, 708, 708, 708, 50271, 7, 470, 61, 20744, 28, 50275, 7, 708, 470, 61, 20744, 28, 50275, 7, 708, 393, 7083, 187, 50258, 7, 708, 708, 50263, 7, 50274, 61, 4251, 3487, 61, 20744, 28, 708, 708, 393, 4251, 3487, 61, 20744, 28, 708, 708, 393, 7083, 187, 50258, 7, 708, 470, 50276, 5977, 18637, 708, 393, 6190, 92, 30428, 11153, 1588, 92, 46, 1603, 21, 10, 5977, 18637, 9443, 6190, 92, 30428, 11153, 1588, 92, 46, 1603, 21, 10, 5977, 18637, 708, 470, 393, 7083, 187, 50258, 7, 708, 50276, 7, 708, 393, 4251, 3487, 480, 64, 20, 708, 708, 393, 4251, 3487, 480, 64, 19, 708, 708, 50276, 61, 7083, 187, 50254, 708, 708, 50274, 17, 50276, 5977, 18637, 708, 416, 64, 19, 61, 28511, 9443, 23386, 464, 4862, 464, 2059, 2000, 18, 2704, 18637, 94, 708, 444, 30, 51, 64, 18, 9443, 23386, 464, 2461, 64, 18, 889, 18637, 708, 393, 5577, 92, 44, 2026, 18, 94, 393, 7083, 187, 50254, 7, 708, 708, 708, 393, 4251, 3487, 61, 20744, 28, 708, 393, 2140, 2501, 1126, 6526, 21316, 393, 4251, 3487, 399, 708, 708, 50276, 61, 7083, 187, 50254, 7, 708, 470, 50276, 5977, 18637, 708, 393, 4153, 63, 18, 61, 5786, 1126, 1588, 92, 48, 599, 38, 50276, 5977, 23386, 464, 4862, 464, 2059, 2000, 17, 889, 18637, 9443, 4153, 63, 18, 61, 5786, 1126, 1588, 92, 48, 599, 51, 64, 17, 9443, 18637, 708, 470, 393, 7083, 187, 50262, 7, 708, 50273, 7, 708, 393, 4251, 3487, 61, 20744, 28, 708, 708, 393, 4251, 3487, 399, 708, 708, 50276, 61, 7083, 187, 50262, 17, 50275, 7, 393, 18637, 708, 50276, 61, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 72, 64, 17, 50276, 5977, 18637, 708, 393, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 51, 64, 17, 50276, 5977, 23386, 464, 4862, 464, 2059, 19289, 18, 3080, 18637, 9443, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 51, 12740, 18, 94, 9443, 18637, 708, 470, 393, 7083, 187, 50258 ]
------------ We adopt here the notations of the book [@BC3G] and the methods developed in the article [@H-1]. In the case of $4$-webs, on can define the operator $$\begin{matrix} p_0: &J_1({\mathcal{O}}^2)&{\longrightarrow}& {\mathcal{O}}^3\cr & \left(\begin{matrix}z_3,p_3,q_3 \cr z_4,p_4,q_4\end{matrix}\right) &{\longrightarrow}& \left(\begin{matrix}p_4+A_{11}z_3+A_{12}z_4 \cr p_3+q_4+A_{21}z_3+A_{22}z_4 \cr q_3+A_{31}z_3+A_{32}z_4 \end{matrix}\right)\end{matrix}.$$ Then we get an exact and commutative diagram $$\begin{matrix} & & 0\;\;\;\;\;\,& &0\;\;\;\;\;\, & & 0 & & \cr & & \mapdown\;\;\;\;\; & & \mapdown\;\;\;\;\; & & \mapdown\; & & \cr 0 & {\longrightarrow}& g_0\;\;\;\;\, &{\longrightarrow}& S_1({\mathcal{O}}^2)\;\,\, &\stackrel{\sigma_0}{\longrightarrow}& {\mathcal{O}}^3 &{\longrightarrow}& 0 \cr & & \mapdown\;\;\;\;\;\,& & \mapdown\;\;\;\;\;\,& & \mapdown\;& & \cr 0 & {\longrightarrow}& R_0\;\;\;\;\; &{\longrightarrow}& J_1({\mathcal{O}}^2)\;\,\, &\stackrel{p_0}{\longrightarrow}& {\mathcal{O}}^3 &{\longrightarrow}& 0 \cr & & \mapdown \overline{\pi}_{-1}& & \mapdown \pi_{-1}& & \mapdown\;& & \cr 0 & {\longrightarrow}& R_{-1}\;\;\; &{\longrightarrow}& {\mathcal{O}}^2\;\;\;\; &\stackrel{p_{-1}}{\longrightarrow}& 0 & & \cr & & \mapdown\;\;\;\;\;\,& & \mapdown\;\;\;\;\;\,& & & & \cr & & 0\;\;\;\;\;\, & & 0\;\;\;\;\;\, & & & & \cr \end{matrix}$$ where the upper line concerns symbols of $p_0$. Explicitly, we have: $\sigma_0(\begin{matrix}p_3,q_3\cr p_4,q_4\end{matrix})=(p_4,p_3+q_4,q_3)$ whose kernel $g_0$ is then isomorphic to ${\mathcal{O}}$. The first prolongation $p_1:J_2({\mathcal{O}}^2){\longrightarrow}J_1({\mathcal{O}}^3)$ of $p_0$ is then given by $$p_1\left(\begin{matrix}z_3,p_3,q_3,r_3,s_3,t_3\cr z_4,p_4,q_4,r_4,s_4,t_4\end{matrix}\right)= \lp\begin{matrix}p_4+A_{11}z_3+A_{12}z_4 \cr p_3+q_4+A_{21}z_3+A_{22}z_4 \cr q_3+A_{31}z_3+A_{32}z_4\end{matrix}\right.$$ $$\left.\begin{matrix}r_4+A_{11}p_3+A_{12}p_4+{\partial_x}(A_{11})z_3+{\partial_x}(A_{12})z_4 \cr r_3+s_4+A_{21}p_3+A_{22}p_4+{\partial_x}(A_{21})z_3+{\partial_x}(A_{22})z_4 \cr s_3+A_{31}p_3+A_{32}p_4+{\partial_x}(A_{31})z_3+{\partial_x}(A_{32})z_4\end{matrix}\right.$$ $$\left.\begin{matrix}s_4+A_{11}q_3+A_{12}q_4+{\partial_y}(A_{11})z_3+{\partial_y}(A_{12})z_4 \cr s_3+t_4+A_{21}q_3+A_{22}q_4+{\partial_y}(A_{21})z_3+{\partial_y}(A_{22})z_4 \cr t_3+A_{31}q_3+A_{32}q_4+{\partial_y}(A_{31})z_3+{\partial_y}(A_{32})z_4 \end{matrix}\rp$$ which leads us to another commutative and exact diagram: $$\begin{matrix} & & 0\;\;\;& &0\;\;\; & & 0 & & \cr & & \mapdown\;\;\; & & \mapdown\;\;\; & & \mapdown & & \cr 0 & {\longrightarrow}& g_1=0 &{\longrightarrow}& S_2({\mathcal{O}}^2) &\stackrel{\sigma_1}{\longrightarrow}& S_1({\mathcal{O}}^3) &{\longrightarrow}& 0 \cr & & \mapdown\;\;\;& & \mapdown\;\;\;& & \mapdown& & \cr 0 & {\longrightarrow}& R_1\;\; &{\longrightarrow}& J_2({\mathcal{O}}^2) &\stackrel{p_1}{\longrightarrow}& J_1({\mathcal{O}}^3) &{\longrightarrow}& 0 \cr & & \mapdown \overline{\pi}_0& & \mapdown \pi_0& & \mapdown& & \cr 0 & {\longrightarrow}& R_{0}\;\; &{\longrightarrow}& J_1({\mathcal{O}}^2) &\stackrel{p_{0}}{\longrightarrow}& {\mathcal{O}}^3 & {\longrightarrow}& 0 \cr & & \mapdown\;\;\;& & \mapdown\;\;\;& & \mapdown & & \cr & & 0 & & 0 & & 0 & & \cr\end{matrix}.$$ Thus $\overline{\pi}_0$ is an isomorphism. The first Spencer complex is given by $$0\longrightarrow \mbox{Sol } \mathcal{M}(4) \stackrel{j_2}{\longrightarrow} E \stackrel{D}{\longrightarrow} \Omega^1\otimes_{\mathcal{O}}R_0 \stackrel{D}{\longrightarrow} \Omega^2\otimes_{\mathcal{O}}R_{-1}\longrightarrow 0$$ where  $E$ stands for the kernel of $p_1$. We deduce from this the following commutative diagram, whose lines are exact and whose columns are exact in $R_k$, and $j_2$ and $j_3$ are monomorphisms: $$\begin{matrix} & & & & 0\;\;\; & & 0\;\;\; & & \cr & & & & \mapdown\;\;\; & & \mapdown\;\;\; & & \cr & & 0 &\longrightarrow & \mbox{Sol }\mathcal{M}(4)&\longrightarrow &\mbox{Sol }\mathcal{M}(4)&\longrightarrow & 0 \cr & & & & \mapdown j_3 & & \mapdown j_2 & & \cr & & 0 &\longrightarrow & R_2\;\; &\stackrel{\overline{\pi}_1}{\longrightarrow} & E=R_1 &\stackrel{\beta_1}\longrightarrow & \mathfrak{K}_{1} \cr & & & & \mapdown\;\;\; & \swarrow_{\nabla}& \mapdown D & & \cr & & 0 &\longrightarrow & \Omega^1\otimes_{\mathcal{O}}E &\stackrel{\overline{\pi}_0}\longrightarrow &\Omega^1\otimes_{\mathcal{O}}R_0 &\longrightarrow & 0 \cr & & & & \mapdown\;\;\; & & \mapdown D & & \cr 0 & \longrightarrow & \Omega^2\otimes_{\mathcal{O}}g_0 &\longrightarrow & \Omega^2\otimes_{\mathcal{O}}R_0 &\stackrel{\overline{\pi}_{-1}}\longrightarrow &\Omega^2\otimes_{\mathcal{O}}R_{-1} &\longrightarrow & 0 \cr
[ 46911, 342, 247, 2159, 2926, 15, 187, 187, 21082, 445, 12431, 271, 15629, 273, 14635, 4248, 432, 48015, 6822, 275, 12746, 13, 16301, 275, 23438, 13, 840, 247, 37589, 273, 14635, 275, 4383, 275, 23305, 432, 21801, 6169, 6822, 275, 47368, 13, 1457, 2816, 15, 187, 187, 29431, 209, 187, 688, 23305, 13, 703, 7028, 27485, 37797, 250, 17502, 714, 11317, 90, 308, 1596, 1403, 13456, 15, 11970, 617, 7875, 13, 703, 6311, 253, 27485, 3448, 285, 3395, 2330, 342, 247, 1387, 273, 2872, 27485, 37797, 250, 32976, 665, 3395, 29549, 1929, 347, 253, 1457, 2816, 5901, 15, 1284, 247, 629, 273, 616, 18051, 12786, 13, 703, 3407, 4028, 285, 18051, 16053, 275, 27485, 15, 187, 187, 688, 22824, 13, 17966, 369, 7091, 407, 33123, 434, 11568, 383, 285, 4307, 627, 323, 3127, 1107, 28, 703, 3395, 271, 8121, 273, 1097, 253, 11338, 285, 253, 12776, 8821, 7225, 9585, 15, 4058, 806, 4460, 380, 9859, 2932, 38987, 369, 3863, 407, 399, 451, 5687, 275, 16609, 13, 762, 253, 4331, 1416, 39206, 27334, 1758, 13, 534, 703, 671, 908, 323, 617, 27485, 14, 12982, 16053, 15, 380, 1984, 369, 2529, 407, 11397, 9109, 347, 346, 266, 13943, 806, 4460, 1051, 2761, 15404, 23073, 1216, 757, 275, 697, 48528, 273, 253, 711, 5367, 4837, 10958, 5109, 449, 1500, 32806, 308, 1596, 1403, 13456, 275, 15621, 285, 1669, 253, 1457, 2816, 5901, 13515, 17096, 15, 187, 187, 33877, 209, 187, 688, 15788, 17966, 3863, 617, 1273, 4460, 13, 380, 15808, 14311, 1216, 15, 308, 744, 432, 253, 1127, 273, 1859, 273, 247, 11730, 3540, 8690, 13, 253, 2926, 6722, 1070, 521, 11182, 281, 755, 247, 21220, 22134, 11730, 25620, 327, 253, 530, 15, 52, 15, 19898, 2285, 13, 285, 281, 572, 1225, 521, 1211, 5675, 2389, 323, 521, 1233, 72, 860, 15, 380, 15620, 1984, 369, 253, 806, 13399, 11730, 14459, 281, 1056, 380, 1457, 2816, 7717, 9567, 322, 7707, 1618, 15, 380, 1984, 4211, 3578, 3041, 10125, 285, 369, 15786, 275, 3578, 11515, 15, 5761, 8007, 1996, 13, 17966, 2879, 767, 2160, 1241, 13, 3972, 13409, 434, 23752, 313, 13034, 10, 285, 19669, 434, 12143, 313, 12487, 481, 17966, 671, 2210, 562, 347, 34929, 275, 15788, 15, 187, 187, 1909, 247, 25620, 5972, 13, 17966, 369, 275, 16221, 581, 273, 253, 806, 2255, 281, 10078, 275, 253, 9693, 45961, 15, 1500, 369, 629, 273, 247, 1387, 665, 6786, 14200, 8981, 275, 253, 530, 15, 52, 15, 323, 5343, 39097, 30451, 15, 2490, 187, 688, 14828, 13, 17966, 3863, 617, 2626, 4460, 13, 380, 401, 4306, 5682, 1209, 15, 733, 310, 253, 2926, 273, 247, 29938, 14959, 275, 247, 13889, 11393, 25024, 665, 11521, 275, 2389, 342, 247, 9979, 13, 11730, 2716, 14, 3381, 264, 342, 247, 6424, 1924, 285, 346, 328, 6937, 1020, 21044, 449, 733, 369, 253, 806, 1682, 84, 7707, 281, 18047, 247, 11730, 14959, 285, 281, 8338, 11730, 1495, 275, 247, 1355, 3874, 15, 187, 187, 688, 14304, 13, 2210, 17966, 434, 7002, 4460, 13, 380, 36974, 11628, 15, 5220, 3863, 407, 4922, 736, 13, 436, 1984, 369, 873, 275, 253, 1457, 2816, 3228, 1533, 835, 703, 1871, 5262, 1142, 1107, 15, 380, 2926, 7106, 327, 247, 28071, 11906, 21801, 32427, 13, 247, 26348, 264, 11730, 3392, 2820, 281, 755, 598, 253, 15838, 281, 1705, 562, 281, 521, 6122, 13, 665, 574, 2489, 247, 48423, 3270, 14, 48223, 5686, 14, 16245, 6416, 18468, 15, 187, 187, 24801, 5249, 209, 187, 688, 9178, 13, 17966, 1669, 8410, 387, 253, 11568, 383, 281, 2489, 247, 2120, 14, 2606, 8406, 15, 1500, 4395, 896, 562, 4255, 281, 15142, 2561, 327, 617, 1735, 4460, 13, 247, 6359, 9493, 1121, 316, 15, 733, 5420, 432, 14702, 31404, 275, 10226, 762, 253, 4060, 2596, 1680, 253, 4146, 15, 25010, 29116, 275, 11053, 5002, 13, 703, 1160, 253, 3061, 281, 564, 3907, 342, 1984, 18051, 15, 380, 906, 369, 13303, 8076, 5687, 13, 534, 556, 3863, 512, 617, 5098, 1580, 13, 1690, 617, 6585, 4460, 13, 380, 13303, 3083, 13, 11797, 407, 617, 1107, 275, 11268, 28, 703, 574, 19624, 627, 11719, 1309, 10765, 39035, 434, 9459, 672, 703, 369, 45652, 1988, 281, 253, 11568, 383, 434, 9883, 11166, 15, 187, 187, 10457, 253, 7901, 84, 13, 17966, 3395, 625, 3939, 23075, 15, 496, 8441, 14, 1525, 13, 347, 247, 906, 273, 617, 7350, 323, 23641, 8920, 13, 703, 43659, 347, 247, 28845, 273, 4730, 275, 253, 8742, 9757, 914, 1245, 4726, 4412, 13, 9417, 327, 253, 25498, 708, 12029, 13564, 10286, 5399, 285, 1996, 253, 8801, 18817, 10286, 5399, 15, 496, 5403, 13, 17966, 14565, 18425, 3569, 24773, 42602, 1503, 284, 19306, 13456, 285, 6138, 617, 4613, 1974, 323, 3228, 6456, 275, 4255, 14759, 13, 6582, 15, 17966, 369, 28008, 275, 617, 1408, 15, 2490, 187, 21082, 445, 4962, 327, 5080, 898, 13, 6247, 387, 253, 2363, 273, 11487, 387, 41742, 8710, 5197, 275, 12126, 34781, 846, 2761, 247, 1264, 807, 6680, 342, 6400, 2923, 15, 187, 187, 688, 3978, 6247, 13, 17966, 369, 581, 273, 253, 40217, 13719, 2448, 773, 81, 6035, 398, 13, 11693, 1559, 1370, 398, 13, 285, 22271, 668, 21782, 264, 327, 253, 3313, 23641, 50, 8799, 273, 23801, 1561, 253, 14963, 12081, 3313, 4200, 1303, 313, 18243, 46, 10, 275, 1457, 2816, 3228, 457, 84, 14963, 12081, 14515, 15, 380, 7167, 46, 310, 253, 806, 530, 15, 52, 15, 3872, 25754, 9940, 281, 23641, 50, 3570, 285, 2892, 13, 1223, 380, 8799, 457, 84, 24973, 4837, 369, 37282, 281, 1379, 1659, 1309, 253, 2456, 394, 19054, 273, 253, 14963, 12081, 43384, 15, 187, 187, 41353, 187, 34, 1535, 2961, 90, 273, 2325, 265, 313, 28476, 10, 1905, 275, 27485, 187, 18596, 1727, 285, 48774, 313, 29639, 10, 1905, 275, 27485, 187, 49, 750, 37665, 313, 25892, 10, 1905, 275, 27485, 187, 510, 9859, 2932, 38987, 313, 25197, 10, 35378, 4, 2357, 14, 1036, 1671, 3245, 187, 510, 15808, 14311, 1216, 313, 22062, 10, 209, 187, 510, 401, 4306, 5682, 1209, 313, 19813, 10, 209, 187, 510, 36974, 11628, 313, 19791, 10, 209, 187, 4041, 310, 253, 4146, 313, 14209, 10, 209, 187, 41, 7694, 266, 434, 23752, 313, 13034, 10, 209, 187, 35, 9352, 434, 12143, 313, 12430, 10, 209, 187, 510, 13303, 3083, 313, 8971, 10, 209, 187, 3220, 4255, 27, 23307, 16679, 723, 327, 253, 2448, 4255, 313, 7330, 10, 187, 187, 4941, 2490, 187, 1413, 27, 45819, 10782, 187, 1413, 27, 9638, 8923, 187, 1413, 27, 938, 394, 14, 9888, 2448, 4460, 1346, 187, 1413, 27, 1797, 296, 14, 9888, 2448, 4460, 1346, 187, 1413, 27, 7878, 2255, 4460, 1346, 187, 1413, 27, 5764, 18756, 552, 11240, 20721, 187, 1413, 27, 24139, 13564, 11597, 187, 1413, 27, 45, 20318, 11597, 432, 253, 1986, 2077, 187, 1413, 27, 45, 20318, 18680, 432, 253, 1986, 2077, 187, 1413, 27, 45, 20318, 4460, 1346, 187, 1413, 27, 45, 20318, 952, 432, 27540, 187, 1413, 27, 42399, 24647, 1253, 14376, 5600, 2392, 187, 1413, 27, 938, 394, 14, 9888, 2448, 2255, 11597, 187, 1413, 27, 1797, 296, 14, 9888, 2448, 2255, 11597, 187, 1413, 27, 938, 394, 14, 9888, 5600, 2392, 187, 1413, 27, 1797, 296, 14, 9888, 5600, 2392, 187, 1413, 27, 4779, 20660, 6169, 6822, 20759, 187, 1413, 27, 8836, 432, 7518, 6736, 13, 27540, 187, 1413, 27, 8836, 432, 1605, 254, 35444, 13, 27540, 187, 1413, 27, 25191, 398, 432, 27540, 187, 1413, 27, 7878, 2255, 1327, 14, 33223, 11597, 187, 1413, 27, 938, 394, 14, 9888, 2448, 1327, 14, 33223, 11597, 187, 1413, 27, 1797, 296, 14, 9888, 2448, 1327, 14, 33223, 11597, 50, 27, 187, 187, 12070, 13331, 5826, 428, 427, 7250, 33037, 7316, 34977, 187, 187, 42, 452, 247, 7316, 326, 309, 878, 281, 13194, 326, 309, 513, 417, 871, 849, 281, 2605, 15, 187, 42, 452, 247, 2829, 1925, 41166, 15, 309, 452, 1529, 2829, 1925, 6487, 15, 1707, 310, 247, 2626, 2829, 1925, 23895, 15, 1284, 368, 476, 8564, 13, 247, 6487, 556, 41166, 13, 285, 41166, 452, 23895, 15, 187, 42, 878, 281, 1618, 562, 512, 273, 253, 41166, 275, 619, 5447, 15, 380, 5691, 310, 13, 309, 878, 281, 1618, 253, 2264, 1180, 273, 23895, 275, 253, 1072, 2567, 347, 253, 37216, 15, 309, 452, 3597, 10575, 327, 253, 1563, 1293, 667, 7516, 27, 187, 12995, 187, 50276, 70, 15, 6407, 2402, 13, 187, 50276, 70, 15, 8693, 2402, 13, 187, 50276, 70, 15, 32088, 13, 187, 50276, 9, 12995, 29032, 9, 5627, 10727, 23895, 269, 17242, 269, 15, 45929, 1838, 2949, 313, 12995, 544, 1838, 62, 10727, 41166, 299, 19, 17242, 299, 19, 15, 32088, 1838, 30, 70, 15, 32088, 1838, 1228, 347, 686, 4505, 6878, 8, 187, 22050, 187, 50276, 31413, 4317, 299, 187, 187, 1276, 717, 309, 2509, 3430, 32, 50276, 8398, 368, 2, 187, 187, 34, 27, 187, 187, 17222, 436, 27, 187, 12995, 187, 50276, 70, 15, 6407, 2402, 13, 187, 50276, 70, 15, 8693, 2402, 13, 187, 50276, 70, 15, 32088, 13, 187, 50276, 9, 187, 50274, 12995, 29032, 9, 5627, 187, 50274, 22050, 23895, 269, 187, 50274, 26461, 1042, 41166, 299, 19, 8160, 269, 15, 45929, 1838, 426, 299, 19, 15, 301, 187, 50274, 31102, 299, 19, 15, 32088, 1838, 426, 299, 15, 32088, 1838, 187, 50276, 10, 347, 686, 4505, 6878, 8, 187, 22050, 187, 50276, 31413, 4317, 299, 535, 15491, 268, 1715, 24653, 2014, 11730, 1821, 187, 187, 40, 333, 5385, 2182, 3672, 268, 1715, 24653, 428, 3711, 1859, 9539, 27, 512, 16308, 13, 368, 476, 923, 8783, 273, 2872, 6068, 13, 1629, 20264, 13, 347, 973, 347, 5662, 1821, 390, 1299, 11019, 1157, 268, 1715, 24653, 1113, 5603, 13750, 407, 40444, 352, 15, 3267, 10719, 275, 268, 1715, 24653, 9092, 27, 323, 1805, 3186, 1543, 513, 247, 1980, 3186, 3185, 258, 446, 460, 2358, 7016, 2654, 834, 452, 667, 40482, 2568, 764, 272, 3517, 891, 3524, 533, 891, 588, 921, 327, 1629, 1692, 1157, 12157, 273, 673, 15, 7993, 24653, 434, 1682, 13597, 2670, 323, 11730, 1821, 2525, 11730, 1821, 432, 268, 1715, 24653, 2233, 6, 1959, 15, 187, 187, 3837, 503, 2675, 2825, 2990, 835, 368, 476, 1089, 285, 2525, 42487, 2255, 285, 1821, 323, 295, 6678, 15120, 2825, 25767, 1690, 14284, 398, 13, 5823, 71, 13, 269, 22401, 13, 7435, 5524, 37229, 285, 1199, 625, 15, 380, 11730, 17603, 5453, 17209, 4768, 1270, 270, 902, 404, 285, 3400, 247, 4618, 2491, 273, 17603, 285, 24340, 9001, 285, 28977, 4712, 323, 11730, 13, 34929, 13, 270, 47035, 285, 31737, 1821, 285, 15, 7993, 24653, 14284, 398, 13, 1089, 1980, 14284, 398, 275, 268, 1715, 24653, 34535, 13926, 13, 253, 1682, 476, 7577, 34535, 2670, 13, 1089, 14284, 398, 2822, 368, 275, 268, 1715, 24653, 313, 2369, 2014, 1821, 10, 619, 6303, 285, 891, 15, 187, 187, 12599, 4370, 3390, 285, 14284, 398, 275, 268, 1715, 24653, 13, 42487, 1089, 1794, 14, 32813, 17581, 13, 11730, 390, 4951, 10798, 13, 16076, 25594, 6838, 13, 3511, 10753, 13, 1499, 14298, 285, 2014, 811, 5410, 3254, 323, 2825, 12716, 13, 16382, 13, 12939, 15, 4235, 272, 4924, 20313, 76, 556, 13241, 34535, 811, 5410, 3254, 16, 1206, 266, 32813, 84, 275, 634, 2170, 1339, 253, 2758, 387, 14284, 4924, 1614, 634, 5615, 46983, 715, 6612, 15, 2164, 1345, 5053, 835, 11730, 1821, 5385, 1701, 247, 50215, 590, 2892, 273, 11730, 747, 340, 1064, 1364, 2486, 253, 8935, 1930, 268, 4670, 1905, 247, 11730, 627, 403, 18660, 273, 11730, 13597, 11222, 275, 15, 19757, 1821, 275, 268, 1715, 24653, 13, 428, 2443, 3022, 2443, 3022, 310, 247, 13597, 5147, 835, 368, 476, 1089, 2014, 1821, 275, 268, 1715, 24653, 13, 253, 1390, 2067, 1107, 359, 452, 13037, 3290, 10104, 273, 268, 1715, 24653, 15, 187, 187, 23852, 24653, 434, 1682, 2233, 6, 1959, 11730, 13597, 2670, 971, 281, 2525, 2014, 11730, 1821, 275, 268, 1715, 24653, 13, 14642, 5629, 278, 33202, 19, 434, 11730, 268, 1715, 24653, 1436, 932, 403, 253, 1959, 285, 3477, 1039, 281, 1089, 643, 268, 1715, 24653, 15, 443, 698, 68, 1751, 2061, 310, 323, 253, 11730, 11277, 1815, 414, 13, 16920, 634, 7314, 588, 1900, 320, 2233, 6, 1959, 7140, 27, 512, 7223, 27, 8935, 298, 4199, 1754, 33352, 2130, 323, 275, 14, 4065, 84, 285, 562, 14, 4065, 84, 987, 1024, 891, 1353, 247, 15, 754, 4288, 14041, 265, 288, 1136, 84, 299, 7564, 16750, 4288, 285 ]
Contest with a short story. Warren earned an associate of arts degree from Stephens College in Columbia, Missouri in 1955, then a bachelor of arts in English in 1957 from Manhattanville College in Purchase, New York. Career In 1957, she married Ukrainian emigre poet Yuriy Tarnawsky. Through her marriage, she learned the Ukrainian language and became associated with a group of young Ukrainian emigre poets who became internationally known as the New York Group. As a part of their publishing collective, she began writing and publishing poetry in Ukrainian. In 1959, Warren was employed by Reader's Digest and worked there for 21 years; she became an editor of both the magazine and the Condensed Book Club. Her first novel The Last Centennial was published by Dial Press in 1971, under the pen name Patricia Kilina, which she also used for her Ukrainian-language poetry. The book was described by Library Journal as "an impressive first novel... almost Faulknerian in its depiction of the despoiling inheritors." She divorced Tarnawsky in 1973 and left the New York Group shortly thereafter. Books In 1974 Warren published her second novel, The Front Runner. Told from the point of view of a gay track coach, the story chronicled his struggle to get a talented openly gay runner on the U.S. Olympic team, and to quash his own growing love for his protegé. The controversial book was the first contemporary gay fiction to make The New York Times Best Seller list. The book sold ten million copies and was translated in ten languages. Two decades later, Warren added two sequels, Harlan's Race (1994) and Billy's Boy (1996). Warren also came out as lesbian in 1974. As a runner herself, Warren was in 1968 one of the first women to participate in the Boston Marathon. She was part of a group who achieved wider recognition in the U.S. for female marathon runners. In 1976, Warren published her third novel, The Fancy Dancer. It is the story of a rookie priest in a dying rural parish who falls in love with a proud, gay half-breed with a criminal record and "unlawful desires." It was the first bestseller to portray a gay priest and to explore gay life in a small town. In 1978, came Warren's fourth novel, The Beauty Queen. Also published by Morrow, this book was set in the New York City world where she'd spent many years. The story focused on a socially prominent Manhattan businessman, a closeted gay father trying to get up the courage to come out to his daughter, who had become a fiercely anti-gay born-again Christian politician. Later career In 1980, Warren left employment at the Digest to become a full-time writer. She moved back out West to pursue research on her next novel, a Western historical opus. It appeared from Ballantine in 1991 under the title One Is the Sun. Eventually settling in southern California, she made the decision to go independent with book publishing. The result was Wildcat Press, which has published all her books since, including her 2001 novel, The Wild Man, inspired by her years in Spain; she had traveled there regularly during Francisco Franco's regime when she was liaison to the Digest's Spanish edition. During the 1990s, Warren became more active politically. In 1996-99, as a result of her concerns for LGBT youth, she volunteered as a commissioner of education in the Los Angeles Unified School District, serving on the Gay & Lesbian Education Commission and later the Human Relations Education Commission. In 2006, Warren hired veteran political consultant Neal Zaslavsky and announced her candidacy for City Council in West Hollywood, CA. Warren was unsuccessful in her run. Warren died on February 9, 2019 at the age of 82 at UCLA Medical Center in Santa Monica after almost a three year battle with lung cancer. In June 2019, Warren was one of the inaugural fifty American “pioneers, trailblazers, and heroes” inducted on the National LGBTQ Wall of Honor within the Stonewall National Monument (SNM) in New York City’s Stonewall Inn. The SNM is the first U.S. national monument dedicated to LGBTQ rights and history, while The Wall’s unveiling was timed to take place during the 50th anniversary of the Stonewall riots. Bibliography A Tragedy of Bees (1960) — in Ukrainian Legends and Dreams (1964) — in Ukrainian Pink Cities (1969) — in Ukrainian The Last Centennial (1971) LOC#77-163583 The Front Runner (1974) The Fancy Dancer (1976) The Beauty Queen (1978) One is the Sun (1991) Harlan's Race (1994) Billy's Boy (1997) The Wild Man (2001) My West: Personal Writings on the American West (2011) References Category:1936 births Category:2019 deaths Category:20th-century American novelists Category:21st-century American novelists Category:American women novelists Category:Lambda Literary Award winners Category:Lesbian writers Category:LGBT writers from the United States Category:LGBT journalists from the United States Category:LGBT novelists Category:LGBT people from Montana Category:Ukrainian–English translators Category:20th-century American women writers Category:21st-century American women writers Category:20th-century translators Category:21st-century translators Category:Manhattanville College alumni Category:People from Helena, Montana Category:People from Deer Lodge, Montana Category:Writers from Montana Category:American women non-fiction writers Category:20th-century American non-fiction writers Category:21st-century American non-fiction writersQ: SQL Server 2005 - Nested recursive query :( I have a query that I need to execute that I do not know how to structure. I have a table called Employees. I have another table called Company. There is a third table called Files. As you can imagine, a Company has Employees, and Employees have Files. I need to list out all of the Employees in my database. The challenge is, I need to list the total number of Files in the same company as the Employee. I have tried variations on the following without any luck: SELECT e.FirstName, e.LastName, e.Company, (SELECT COUNT(*) FROM Files f WHERE f.EmployeeID IN (SELECT [ID] FROM Employees e2 WHERE e2.CompanyID=e.CompanyID)) as 'FileCount' FROM Employees e What am I doing wrong? Thank you! A: Try this: SELECT e.FirstName, e.LastName, e.Company, ( SELECT COUNT(*) FROM Files f JOIN Employees e2 ON f.EmployeeID = e2.id WHERE e2.CompanyID = e.CompanyID ) as 'FileCount' FROM Employees e West peterborough single gay men Gay cruising areas peterborough - map view crowd: all sorts, you can see lots of young guys, skaters, as well as older men orton mere , peterborough car park surrounded by bushes it. Contacts in peterborough tip: for better search results do a local search instead opline68 sorry idont have any pics yet comming soon i hope but i will show on skype ,because of time. Peterborough's best dating site for gay men meet gay men from peterborough 100% free. Adult social sex network where you can find and meet uk women and men for nsa casual sex encounters including swingers, mmf, ffm, fuck buddies and much more. The gay outdoor club operates throughout great britain and provides a wide range of outdoor and indoor sports and recreational activities for gay, lesbian, bisexual and transgender men and. Peterborough swingers, find local swingers in peterborough swinging heaven, the best canadian swinging site, find swingers near you in peterborough (no single men) my master and i. Local dogging and swingers in peterborough, uk find bi-sexual couples, gay or straight males, dirty sexy girls, hot females, sluts and single transvestites for sex contacts, meets, chat. Swingfreecouk has genuine swinging transvestites/transexuals in your area let the members at swingfree turn your sexual fantasies into reality. 24 public places where gay men cruised a cursory history of gay new york must include the west side piers — a gay there are dozens of gay dating apps in. Single men in peterborough, - doulike doulike is a dating platform where you can find single men in peterborough, the last several years we have gathered quality profiles of peterborough. Peterborough's best 100% free gay dating site want to meet single gay men in peterborough, ontario mingle2's gay peterborough personals are the free and easy way to find other peterborough. Gaysceneorg is for the gay cummunity, posting your advert will always be 100% free category: all pages: west london based escort available for in-calls and out-calls right now i'm a. He travel merges hanns ebensten travel and
[ 2756, 187, 22096, 1397, 452, 644, 2502, 17799, 281, 23278, 5054, 2425, 275, 3672, 835, 253, 5020, 273, 3684, 45359, 3153, 15, 831, 3797, 15065, 281, 1329, 2806, 6264, 14768, 13, 253, 3585, 1562, 5837, 273, 9787, 21952, 275, 3874, 19794, 285, 253, 13701, 273, 247, 26469, 36946, 10980, 15, 7295, 310, 671, 3629, 253, 1318, 273, 10229, 285, 3238, 352, 15613, 980, 432, 1355, 2136, 285, 10239, 3993, 15, 18770, 789, 1335, 3198, 281, 320, 2218, 275, 1142, 273, 841, 3672, 281, 5416, 597, 452, 253, 1055, 327, 253, 6982, 359, 7703, 15, 2756, 187, 38453, 327, 253, 15199, 285, 7355, 2098, 13, 2208, 588, 2457, 885, 247, 2590, 5054, 3116, 5700, 1561, 253, 1735, 1643, 3618, 15, 831, 5700, 588, 3812, 327, 253, 1142, 9865, 9021, 326, 452, 644, 1160, 407, 3684, 45359, 327, 253, 5955, 2929, 4439, 407, 3313, 24209, 15, 2756, 187, 18431, 4243, 273, 253, 3116, 5700, 403, 2168, 275, 1659, 15, 2053, 2486, 849, 359, 476, 17084, 776, 8460, 13521, 13, 247, 3585, 1562, 1701, 9787, 5700, 275, 1329, 273, 2234, 3116, 19465, 285, 253, 13701, 273, 271, 48429, 10980, 342, 247, 2590, 2098, 281, 47122, 11319, 8149, 15, 18770, 789, 310, 30361, 281, 3157, 253, 11990, 285, 4796, 253, 2105, 273, 2509, 2136, 13, 347, 403, 6031, 281, 1551, 7818, 1375, 9633, 32447, 285, 5416, 326, 597, 1347, 1805, 275, 4804, 253, 2586, 457, 84, 3198, 15, 329, 2590, 5700, 281, 1659, 444, 3319, 297, 327, 247, 18380, 1854, 273, 7355, 310, 671, 1146, 2457, 1701, 15, 2756, 187, 3074, 436, 789, 310, 3192, 1659, 387, 247, 673, 672, 2208, 457, 84, 33129, 403, 762, 1270, 7372, 13, 285, 627, 310, 1077, 1652, 2316, 281, 2572, 9100, 390, 40770, 15, 831, 2097, 326, 359, 878, 281, 6947, 776, 3710, 5300, 625, 7060, 314, 13, 755, 8314, 273, 369, 85, 486, 285, 5333, 625, 5300, 281, 11319, 8149, 15, 2756, 187, 2374, 253, 806, 7216, 4131, 273, 1016, 1770, 13, 253, 19897, 3918, 285, 309, 2525, 342, 253, 7038, 273, 2136, 13, 18213, 285, 253, 3114, 8776, 281, 2278, 253, 7092, 273, 5593, 5821, 387, 1390, 807, 457, 84, 32254, 31692, 15, 3824, 4821, 2770, 310, 327, 2628, 8869, 285, 849, 359, 476, 4796, 253, 3904, 273, 952, 665, 403, 35700, 15, 2756, 187, 1147, 310, 2590, 326, 13, 347, 247, 2586, 13, 359, 403, 3192, 5882, 2250, 281, 1756, 253, 6982, 285, 2794, 7375, 15, 1292, 359, 878, 281, 513, 625, 281, 1614, 1841, 1475, 15, 844, 878, 281, 2457, 885, 247, 11088, 3116, 5700, 326, 3936, 512, 253, 789, 1146, 2218, 281, 1529, 1268, 15, 309, 717, 2176, 326, 342, 253, 3939, 10171, 273, 512, 19465, 273, 5948, 13, 436, 588, 320, 6786, 15, 2756, 187, 17967, 45359, 403, 4704, 281, 6054, 281, 253, 5691, 15, 2756, 187, 17277, 16995, 13, 535, 3220, 24207, 285, 23307, 3645, 19639, 187, 187, 13030, 8910, 187, 187, 8983, 15034, 187, 187, 1909, 504, 187, 187, 1147, 7819, 562, 326, 627, 457, 84, 690, 2238, 273, 7505, 275, 253, 4602, 875, 31198, 577, 15, 26, 15, 22, 313, 4280, 64, 1400, 2715, 10, 285, 253, 27430, 6896, 773, 9817, 668, 6409, 4758, 13, 594, 309, 452, 5176, 326, 432, 619, 2670, 323, 253, 2774, 13, 285, 18203, 27430, 6896, 1329, 670, 352, 15, 7243, 326, 4850, 4229, 13, 309, 588, 5386, 436, 1501, 285, 1091, 253, 6975, 6409, 15, 187, 187, 18281, 436, 27, 187, 187, 3039, 309, 806, 1119, 562, 326, 253, 1457, 14541, 1373, 44110, 38008, 8924, 84, 10039, 367, 2695, 12699, 313, 783, 2457, 12699, 273, 253, 4240, 14, 7798, 2952, 10, 369, 1469, 281, 320, 5859, 14, 33223, 731, 264, 13, 1690, 3440, 432, 8141, 14848, 13, 8141, 29024, 13, 23777, 46701, 274, 7667, 514, 3737, 313, 783, 3236, 10333, 84, 581, 13, 340, 333, 42678, 17464, 13, 3966, 15, 313, 4609, 309, 1158, 369, 896, 275, 4596, 10, 309, 3260, 309, 3078, 281, 564, 15, 1893, 247, 13571, 2427, 327, 619, 9449, 5730, 1618, 15, 187, 187, 3220, 4651, 497, 2238, 2217, 281, 755, 581, 323, 479, 13, 285, 309, 452, 644, 37774, 10437, 839, 436, 12699, 2455, 1580, 840, 15, 313, 4374, 13, 352, 369, 7964, 4409, 352, 2698, 187, 187, 1147, 457, 84, 644, 247, 1048, 2129, 323, 479, 1108, 309, 369, 2509, 271, 5271, 2531, 2006, 3628, 5370, 387, 253, 9462, 5271, 1204, 46177, 49566, 20958, 313, 47503, 4877, 10, 31692, 275, 29539, 436, 2129, 1108, 4278, 588, 320, 9269, 327, 6809, 7974, 24690, 72, 384, 689, 253, 1735, 1643, 1897, 1108, 285, 1694, 3965, 1199, 577, 3038, 273, 4600, 1016, 2360, 13, 1690, 1146, 598, 387, 374, 27, 1449, 717, 8360, 53, 436, 4131, 313, 262, 457, 84, 1335, 6794, 13, 984, 309, 6468, 457, 85, 4783, 281, 4600, 2568, 10, 281, 755, 281, 253, 13952, 323, 619, 20818, 1728, 15, 1292, 352, 369, 594, 4409, 352, 15, 187, 187, 42, 457, 306, 1694, 690, 7968, 323, 368, 313, 84, 5163, 323, 253, 3290, 582, 326, 309, 457, 620, 1501, 347, 4569, 347, 309, 564, 2112, 15, 187, 187, 2598, 13, 309, 457, 78, 2820, 281, 1501, 625, 7208, 969, 15, 1244, 352, 457, 84, 4162, 15, 1737, 310, 4162, 1929, 323, 32, 313, 1909, 504, 432, 5271, 1204, 773, 27031, 10640, 668, 31884, 593, 24909, 13, 326, 310, 15, 2064, 457, 84, 323, 6809, 7974, 24690, 72, 384, 2698, 187, 187, 2773, 457, 84, 987, 1108, 253, 806, 6874, 273, 8647, 6897, 2302, 56, 363, 15155, 2, 313, 7371, 21403, 309, 1646, 281, 452, 6571, 9269, 670, 275, 4162, 273, 8909, 1107, 2698, 187, 187, 2598, 436, 1770, 13, 309, 457, 78, 2378, 969, 1469, 896, 281, 619, 6897, 2302, 11465, 285, 2820, 281, 8416, 253, 24813, 273, 14736, 285, 44150, 15, 309, 3597, 281, 789, 327, 352, 1390, 807, 313, 328, 12566, 2920, 13, 2167, 309, 1158, 309, 4159, 577, 7223, 390, 594, 32, 582, 285, 896, 275, 4163, 273, 4104, 13, 285, 1904, 457, 85, 513, 1199, 840, 15, 187, 187, 1552, 807, 13, 309, 457, 78, 3192, 2120, 5750, 273, 8647, 6897, 2302, 457, 84, 3745, 281, 5206, 634, 1211, 2303, 285, 1511, 273, 2303, 15, 309, 4425, 281, 564, 323, 3387, 3038, 273, 14835, 285, 294, 17695, 1108, 285, 840, 4391, 326, 281, 374, 13, 8320, 2909, 313, 783, 1072, 673, 2978, 10, 984, 253, 773, 11964, 668, 1511, 2506, 457, 85, 1581, 323, 17711, 15, 1893, 253, 4736, 310, 5096, 2909, 247, 1388, 281, 1056, 619, 2303, 15, 187, 187, 3220, 4588, 4736, 310, 13, 273, 2282, 13, 281, 8416, 775, 81, 15, 854, 285, 513, 253, 294, 8510, 265, 273, 775, 793, 15, 898, 281, 1638, 13, 275, 1340, 281, 2686, 8416, 253, 24813, 594, 309, 476, 1265, 2444, 327, 2970, 352, 715, 247, 15452, 494, 1375, 15, 187, 187, 2598, 2080, 13, 309, 457, 78, 387, 1749, 2909, 273, 14835, 285, 294, 17695, 13, 285, 309, 1158, 309, 457, 306, 7303, 281, 755, 949, 690, 273, 619, 2972, 327, 775, 81, 15, 854, 15, 309, 878, 7609, 625, 2909, 3063, 281, 1056, 619, 4736, 28, 1469, 281, 923, 604, 309, 476, 457, 85, 8268, 326, 15, 187, 187, 2598, 13, 1339, 457, 84, 2312, 3063, 670, 10123, 15, 13658, 13, 670, 1841, 417, 281, 513, 275, 10123, 15, 313, 688, 643, 3000, 13, 690, 1841, 326, 1663, 270, 17584, 253, 2564, 2698, 187, 187, 2214, 690, 1921, 390, 1529, 13, 309, 6468, 457, 85, 2959, 247, 2257, 273, 10123, 323, 619, 269, 280, 326, 309, 651, 1067, 773, 85, 1811, 10123, 668, 390, 773, 1258, 482, 10123, 668, 313, 5658, 871, 253, 4394, 13, 597, 1265, 342, 13, 773, 1394, 457, 250, 271, 3098, 272, 28006, 1806, 285, 816, 755, 625, 9084, 29974, 800, 432, 627, 481, 496, 958, 13, 347, 2080, 347, 309, 476, 6983, 13, 309, 457, 306, 2959, 760, 767, 15, 2596, 2067, 1107, 3622, 327, 247, 2926, 309, 9269, 281, 42193, 17919, 313, 49987, 33223, 15, 8695, 457, 84, 773, 19164, 14459, 668, 7832, 582, 10646, 253, 37317, 19848, 479, 323, 417, 4028, 751, 3972, 13409, 9545, 1988, 15, 313, 19537, 33390, 27, 1621, 13, 309, 1053, 457, 85, 3630, 751, 779, 13, 984, 309, 717, 417, 779, 2, 496, 958, 13, 309, 1053, 457, 85, 3782, 751, 521, 4028, 3740, 13, 594, 309, 1053, 457, 85, 1014, 1611, 281, 3630, 751, 779, 13724, 1244, 253, 643, 581, 369, 1390, 6794, 15, 187, 187, 4125, 13, 436, 310, 417, 281, 1333, 326, 309, 1620, 4763, 4016, 10123, 15, 309, 513, 15, 313, 7834, 21883, 327, 619, 2159, 19517, 269, 280, 15292, 47890, 31674, 955, 2698, 6491, 1053, 457, 85, 751, 619, 6281, 285, 1928, 253, 878, 281, 2028, 479, 13, 390, 597, 3959, 479, 247, 29254, 13, 390, 5913, 1108, 4754, 13, 309, 457, 306, 1694, 9828, 273, 1110, 15, 1292, 954, 273, 253, 673, 13, 952, 403, 387, 1878, 30405, 342, 616, 10123, 281, 479, 13, 1014, 604, 597, 1053, 457, 85, 751, 253, 2926, 15, 1244, 309, 452, 247, 5026, 4808, 672, 352, 3249, 281, 2268, 4624, 273, 619, 4028, 15, 187, 187, 1552, 1436, 369, 17663, 2822, 30405, 13, 534, 310, 629, 273, 253, 1921, 309, 457, 78, 5698, 272, 670, 352, 1060, 15, 187, 187, 18281, 436, 27, 187, 187, 8693, 2129, 13, 309, 4159, 247, 1501, 327, 619, 5131, 20299, 670, 253, 12904, 273, 20993, 13, 849, 309, 2793, 20993, 285, 849, 309, 23808, 342, 352, 15, 187, 187, 1552, 310, 2139, 326, 1501, 2427, 598, 15, 187, 187, 1147, 369, 619, 27078, 466, 33782, 457, 84, 20915, 3063, 15, 187, 187, 510, 2021, 556, 644, 275, 13533, 323, 253, 2469, 2129, 1108, 1110, 273, 441, 3551, 432, 1977, 7244, 327, 253, 337, 296, 1108, 285, 359, 497, 627, 281, 923, 27078, 466, 33782, 1509, 15, 733, 457, 84, 644, 1077, 1892, 28, 703, 369, 619, 3392, 457, 84, 760, 5780, 40239, 13, 285, 253, 760, 35605, 2905, 6782, 432, 326, 5978, 5780, 275, 13533, 313, 1542, 253, 18729, 84, 285, 2021, 326, 3153, 1060, 481, 187, 187, 18281, 436, 27, 187, 187, 2598, 13, 1060, 359, 403, 387, 253, 990, 273, 6897, 2302, 56, 363, 15155, 4240, 15, 309, 452, 1912, 13, 323, 253, 818, 394, 673, 275, 884, 1107, 273, 2509, 6897, 2302, 15, 1292, 352, 3589, 457, 85, 3477, 436, 807, 15, 313, 42, 1007, 896, 13, 285, 309, 1158, 253, 760, 2069, 352, 369, 3477, 497, 4695, 14, 7199, 2698, 1244, 2866, 347, 368, 778, 452, 30346, 432, 253, 1390, 767, 9319, 13, 309, 858, 417, 8416, 1707, 2325, 49583, 15, 1292, 309, 1024, 452, 247, 1270, 2968, 625, 685, 309, 858, 281, 3135, 342, 13, 594, 352, 457, 84, 247, 2323, 23188, 15, 187, 187, 2598, 13, 1060, 359, 403, 15, 309, 7303, 281, 3330, 417, 3240, 407, 253, 4808, 273, 619, 9970, 313, 3529, 651, 320, 9880, 10873, 13, 352, 1146, 253, 1390, 1388, 323, 352, 481, 187, 187, 1552, 1390, 8857, 556, 644, 8615, 479, 247, 4344, 2372, 13, 594, 309, 369, 11926, 313, 3229, 3784, 619, 7126, 3159, 1385, 767, 1897, 3622, 10, 326, 309, 5082, 457, 85, 320, 2104, 281, 1056, 352, 13, 533, 1060, 359, 403, 2, 9375, 564, 562, 281, 657, 506, 4595, 285, 253, 643, 2758, 273, 253, 27218, 6897, 2302, 1387, 13, 323, 616, 1329, 285, 31868, 15, 187, 187, 2598, 13, 309, 457, 78, 12365, 3063, 342, 247, 3159, 1385, 273, 2456, 13, 15882, 3000, 15, 1292, 309, 457, 620, 1335, 320, 4028, 10873, 313, 42, 971, 326, 773, 39055, 3159, 1385, 323, 1884, 1897, 668, 32741, 42678, 285, 2779, 323, 253, 1735, 1770, 13, 327, 285, 745, 13, 347, 309, 1611, 281, 8416, 253, 806, 7482, 273, 1707, 2325, 49583, 15, 313, 8457, 642, 2647, 849, 1199, 309, 3078, 281, 13, 309, 1904, 457, 85, 8722, 281, 755, 1014, 2810, 281, 19083, 15, 309, 457, 69, 1333, 309, 457, 78, 670, 2716, 281, 608, 16, 26, 2218, 2698, 187, 187, 8061, 323, 1563, 479, 327, 436, 19876, 9455, 273, 619, 28081, 807, 273, 2509, 6897, 2302, 2, 187, 187, 2598, 13, 309, 9829, 1390, 2129, 457, 84, 1501, 15, 4276, 5970, 323, 326, 1108, 309, 369, 417, 1907, 253, 1682, 1643, 1897, 672, 352, 369, 1955, 13, 285, 840, 309, 4425, 281, 3343, 1919, 2057, 309, 457, 69, 7270, 598, 342, 253, 3264, 2264 ]
Funds have been redirected to stimulate economic activity in areas where the majority of South Africans live. This includes finance to support black commercial farmers, the revitalisation of industrial parks in townships and the establishment of a Township Economy Fund. Government is also increasing the value of goods and services it procures from small business and cooperatives. Much work still needs to be done in many of these areas to ensure they have the effect on the economy we seek. Building on the stimulus and recovery plan, government will finalise a clear economic growth strategy within the next few weeks. This strategy will draw on the many valuable contributions that have been made by South Africans on the discussion paper released by National Treasury. Several parts of the growth strategy are already in place. These include how we can strengthen our reform programme, a revitalised industrial strategy in support of key growth sectors and the establishment of an Infrastructure Fund with a clear plan to revive infrastructure investment. Much work is underway to improve the ease and reduce the cost of doing business, as are efforts to restructure state owned enterprises and ensure that they perform better in meeting the country’s needs. A clear strategy to place Eskom on a sustainable path of recovery is also being finalised. All this work is taking place at a time when government’s finances are under great strain, and there is very little room to increase spending or borrowing. This means that we need to spend our limited resources more smartly, get rid of wastage and shift more resources to infrastructure investment. On the first Monday morning of each month, the Deputy President and I meet with the leaders of business, labour and the community sector to review the implementation of measures agreed at last year’s Jobs Summit. Our continued focus is on job creation and how we can reduce the numbers of people who are unemployed. It is clear that, as a country, we are taking firm action to grow the economy and create jobs. But we need to do more to turn things around. We need to finalise a comprehensive growth strategy that takes all the work being done to another level. I am certain that with the active involvement of all sectors of society, this will be achieved. South Africans are ready to rise to the challenge. Best wishes, My Writing and Personal World…. Main menu Post navigation Aside It turns out that there’s some kind of bug in the connection between WordPress 4.9.5 (CA_EN version) and the Jetpack “Like” button setting, so I have removed that from my site for the moment, and contacted Jetpack support about it. Once that gets fixed, I will remove this post and return the Like button. Share this: When I first found out that the Newfoundland Symphony Orchestra‘s Spring Pops concert (the final concert of the 2017-2018 season) was going to be science-fiction themed, including music from Star Wars, Star Trek, Battlestar Galactica (the original 1970s one, yay!), ET, etc. (which I think was back in November) I knew I wanted to go. So a ticket went on my Christmas wish list. My parents were kind enough to get one for me, and I have been eagerly anticipating this concert ever since then. (Yes, it was definitely worth it.) It’s been a long week for me – I was doing an Autistic Adults panel at the Canadian Autism Spectrum Disorders Alliance (CASDA) Summit in Ottawa this week – details will be posted on tagÂûght over the next few days – and got pretty much 4 hours of sleep each night, including being up at 2:40 am EDT this morning (it’s still Friday, because I haven’t gone to sleep yet) to get to the airport for my flights home. But it was so worth it. I’ve got some pictures for you (sorry for the quality), that I’ll post as appropriate as I go along. So, I’m trying to post more frequently again. And it’s April. What is April known for? (Aside from Autism “Awareness” Acceptance Month, that is. That’s for tagÂûght.) That’s right – the first session of Camp NaNoWriMo! (Which lately I seem to have mostly posted about in April of odd years.) So this month, I’m once again going back to my NaNo roots and trying to finish the rewrite of Search and Rescue. I tried to work on it last year (unsuccessfully, though I think I wrote 4 pages or so?), and back in July of 2015, and didn’t do much then. This year, I’m taking full advantage of Camp NaNo’s ability to choose your own target and type of target. I decided to go for 40 hours of editing and rewriting – and then changed that to 2,400 minutes (the same time length) because the “hour” type doesn’t allow for fractions. So the goal is 80 minutes a day to make my target. My actual goal is, of course, to finish Chp. 8 and do the rewrites of Chps. 9 to 14, in order to actually finish the rewrite so I can start working on getting it into a publishable state. So far, I’m at 199 minutes of editing and rewriting, and I think I’ve managed to get through some of my block on Chp. 8. I need 41 more minutes today to make my goal; going to see if I can’t exceed that. So, let’s talk today about reviews. Specifically, about things not to do in reviews. (In other words, some things that really boggle the mind.) For some reason or another, I haven’t received a lot of reviews for my fic that I would call “troll reviews” or “flame reviews” (you know the ones, they start with, “You’re an effing idiot,” and just get more vituperative from there). In fact, as far as I can recall, I’ve received only two. One several years ago on a story I posted to FictionPress (Fanfiction.Net’s “original fiction” partner), wherein the reviewer abused me for not writing like Harlan Ellison. (Newsflash: No, I don’t write like him, because I am not him! In fact, I don’t particularly like his writing style, so I don’t even try to write like him!) And the other one was last Friday. Now, this is not to say that I never receive negative reviews. I do. (Particularly on my short HP fic DisciplineIssues.) People don’t like my stories and feel the need to tell me, or they offer me a critique, or whatever – yes, I’ve got plenty of those. But most of the time, people are at least polite with their reviews to me, even if they don’t like the story. And I have a thick skin when it comes to critiques of my writing. This person was nowhere near polite, which is part of the reason I’m venting about it here. Share this: Last week, I wrote a post on my Other Blog about the emotion of grief, how I experience grief and how I cope with it. This is why that post went up. It was my Auntie Barb’s funeral today. The family has been in Toronto for the past week – those of us coming from away arrived on the 1st – and we were there to see Auntie Barb pass. It’s been very hard; she was my father’s only remaining sibling, and the only biologically related adult from that generation remaining in Toronto (for the sibs and family that live here). Share this: So, here we are at the end of NaNoWriMo 2017. I have won, for the 7th time in 10 years of doing NaNo. But it wasn’t easy this year. (I look back, and I think the only times it was easy were 2008-2010.) And… as you may have guessed from the last two posts, I did not finish There Be Dragons. But I now have a great deal more than I did to begin with, so it’s a success nonetheless. So, here we are. I managed to win not quite by the skin of my teeth (that would be winning tomorrow, it being the last day for it). This last chapter has been fighting me a fair bit, so I was worried (despite my excellent word count two days ago) that I wouldn’t be able to make it, but here we are! Thanks go out to Vathara and the other members of the NL NaNo group, for their support and encouragement. So, I’m ending today with a word count of 50,157 words. But I’ll still be writing tomorrow (I want that “updated word count for 30 days” badge!), and likely for the next month, on and off, as I try to finish the first draft of There Be Dragons. (Because no matter how much I wanted to, I didn’t manage to get even close to finishing. I’d say I’m about half to 5/9 done.) Thanks for following me on this epic journey of my tenth year of doing NaNo! So, I missed last week’s post. Apologies for that – I was not having the best few days when it was due, and then I decided to wait until either I’d caught up with the expected total
[ 209, 187, 36, 16131, 659, 6356, 2146, 313, 49, 2354, 12062, 39318, 964, 43666, 11630, 21394, 3393, 40399, 28832, 3393, 10227, 37097, 13, 38833, 1454, 108, 38377, 43994, 19073, 9737, 5117, 9650, 2141, 21394, 3868, 43242, 3868, 7490, 24036, 5776, 37833, 22880, 4733, 26855, 19927, 10227, 9203, 5776, 12116, 37833, 30175, 13810, 9529, 43242, 21394, 20933, 10139, 22880, 4733, 24292, 33011, 5613, 13913, 17946, 24036, 3868, 28649, 5898, 47946, 29354, 25628, 24292, 5676, 38377, 3868, 10139, 4654, 8520, 15, 1454, 234, 24292, 5676, 38377, 17186, 37677, 10139, 36684, 22206, 2141, 10977, 29346, 33627, 24292, 19927, 3147, 5898, 21394, 10977, 3955, 7136, 33887, 12116, 29346, 14439, 31008, 3147, 15234, 15902, 2863, 3955, 12388, 26867, 48911, 2599, 3952, 15234, 36796, 16962, 16287, 18184, 35691, 41620, 9650, 35280, 13810, 8361, 8348, 17186, 30175, 25628, 47851, 1454, 119, 3868, 9650, 11630, 2989, 23977, 44206, 17757, 16003, 10227, 7136, 17648, 17186, 8095, 9203, 17946, 35278, 36796, 8095, 2863, 3868, 8348, 32309, 28354, 5346, 5776, 9203, 16287, 3147, 30656, 35278, 17686, 29830, 5117, 38093, 42044, 139, 221, 5676, 7136, 48185, 5776, 2989, 3393, 5117, 22206, 7136, 1454, 99, 2141, 18951, 6450, 2863, 13, 9529, 11630, 3955, 12116, 15234, 2141, 23766, 25628, 45002, 2989, 22206, 10139, 30175, 29495, 6450, 16411, 5117, 20933, 4992, 18383, 5776, 11630, 16411, 44206, 4733, 18806, 5898, 4134, 25326, 11630, 3868, 16411, 44206, 4733, 15902, 2863, 40237, 38377, 3868, 40301, 15, 1454, 242, 34299, 25651, 11910, 9529, 2599, 7136, 9650, 37833, 11112, 2141, 4134, 27580, 26867, 13, 18383, 3147, 7136, 3147, 28434, 30175, 17686, 49929, 5776, 9203, 20933, 2989, 40237, 32681, 11112, 2141, 4134, 27580, 26867, 13, 17686, 29495, 6450, 44687, 10227, 2863, 47909, 11910, 3868, 47946, 29354, 4733, 35278, 25628, 29830, 4134, 2989, 2599, 14733, 4134, 10139, 18806, 48911, 2599, 17946, 9737, 5776, 9203, 7072, 9650, 8520, 15, 1454, 242, 2989, 9028, 11630, 21394, 30793, 17686, 18951, 6450, 4733, 32309, 18383, 5776, 11630, 4134, 16003, 3147, 30656, 37134, 16962, 24292, 36030, 7072, 9650, 2863, 4733, 18806, 24355, 49929, 5346, 33211, 10139, 24073, 9737, 12116, 2141, 3952, 40237, 7072, 33221, 32681, 18383, 3147, 7136, 3147, 15234, 13, 24355, 26855, 5776, 25326, 7072, 10139, 11112, 3393, 10227, 2863, 31008, 3147, 15234, 13, 16962, 2989, 29495, 29346, 17648, 3955, 28649, 12388, 34500, 26855, 3955, 5346, 8520, 5776, 34500, 13, 24355, 41878, 9650, 24745, 21394, 17186, 24073, 9028, 30793, 3147, 33221, 5898, 5776, 2989, 3393, 5117, 22206, 33221, 45002, 2989, 22206, 33221, 18806, 36796, 11112, 2989, 3393, 10977, 3147, 10139, 20853, 9203, 17757, 14439, 15, 1454, 242, 26855, 21027, 5776, 12388, 7136, 4733, 28354, 139, 222, 16287, 25326, 7072, 29346, 3955, 7136, 4733, 32309, 28354, 5346, 5776, 9203, 44687, 30656, 30175, 36796, 24292, 17648, 5215, 14, 6622, 37134, 374, 575, 32149, 575, 3393, 48614, 2599, 575, 3393, 5117, 49100, 13, 4654, 2863, 25326, 3147, 7136, 21227, 36796, 8095, 17946, 7072, 17757, 22206, 8348, 8095, 2863, 3868, 8348, 13, 24036, 4134, 33011, 9737, 6450, 44687, 16962, 29830, 4134, 6450, 2599, 14733, 16287, 4733, 13, 38833, 9737, 20933, 2141, 3952, 17648, 10977, 27435, 3147, 35278, 48002, 11112, 4992, 40237, 3868, 36204, 21027, 3955, 12388, 34500, 41878, 4134, 17946, 7072, 17757, 16411, 11630, 33629, 4733, 24073, 29830, 138, 232, 15, 187, 138, 98, 16003, 3147, 17686, 31008, 2141, 32681, 11112, 2989, 3393, 10977, 3147, 26867, 9529, 9650, 9203, 41783, 15234, 18806, 22880, 13803, 12388, 2141, 6450, 8520, 24073, 1454, 235, 2141, 5776, 8348, 3868, 38444, 13, 35691, 41620, 9650, 3393, 30656, 9028, 30793, 21027, 22206, 10139, 23977, 44206, 17757, 16003, 10227, 2863, 22206, 10139, 9529, 43242, 21394, 20933, 4992, 30175, 13810, 9529, 11630, 19927, 30303, 4992, 5898, 5776, 2989, 3393, 5117, 22206, 26867, 26855, 3955, 12116, 15234, 2989, 26867, 23766, 5613, 34299, 14439, 9028, 29354, 17648, 13, 26855, 3955, 44687, 21394, 43994, 3955, 5346, 2141, 21027, 31008, 3147, 15234, 26855, 3955, 12116, 15234, 2989, 26867, 9737, 30656, 3952, 12388, 33221, 9529, 9650, 9203, 41783, 33011, 13, 18806, 26855, 3955, 18951, 16003, 9650, 33221, 40647, 11112, 2989, 3393, 10977, 3147, 24745, 4733, 16962, 36003, 27580, 29346, 3955, 27435, 4733, 32309, 24292, 9650, 35280, 9529, 9650, 9203, 17186, 23766, 25628, 5898, 5776, 2989, 3393, 18184, 1454, 108, 17686, 13803, 6450, 5676, 10298, 2863, 24073, 1454, 235, 2141, 5776, 8348, 3868, 38444, 15, 37849, 16003, 3147, 17686, 31008, 2141, 37677, 7136, 3147, 41878, 2599, 6450, 38377, 30656, 24355, 23766, 34299, 10227, 2141, 22880, 23871, 9203, 28649, 16003, 4733, 22880, 28354, 139, 222, 16287, 25326, 7072, 29346, 3955, 27435, 1108, 337, 575, 45316, 13, 22, 575, 3393, 48614, 2599, 15, 575, 3393, 5117, 49100, 13, 9737, 5676, 32681, 16962, 16287, 6450, 15234, 337, 575, 44985, 13, 22, 575, 3393, 48614, 2599, 15, 575, 3393, 5117, 49100, 41878, 2599, 6450, 38377, 30656, 9529, 21227, 4733, 5898, 5776, 2989, 3393, 5117, 22206, 34500, 26855, 3955, 12116, 15234, 6450, 28434, 15, 29830, 4134, 2989, 4134, 5776, 9203, 28649, 13, 16962, 21394, 3868, 31008, 19927, 23977, 3952, 10139, 17757, 14439, 41878, 2599, 9203, 49626, 5676, 27580, 40647, 5613, 3393, 9650, 3147, 12388, 10139, 18806, 11112, 36204, 12388, 4992, 22206, 10139, 47909, 10227, 14733, 3955, 10139, 13, 40146, 21394, 43994, 3955, 5346, 2141, 21027, 31008, 3147, 15234, 32681, 9529, 9650, 3393, 22206, 26867, 23766, 17686, 28354, 3868, 7490, 4134, 12388, 7136, 11112, 2141, 4134, 27580, 26867, 15, 187, 138, 234, 23977, 44206, 17757, 16003, 10227, 2863, 22206, 10139, 9529, 43242, 21394, 20933, 4992, 30175, 13810, 26855, 5776, 25326, 7072, 10139, 11112, 3393, 10227, 2863, 31008, 3147, 15234, 9529, 9650, 3393, 22206, 8348, 23766, 17686, 3147, 36684, 2599, 6450, 5676, 2599, 5117, 16287, 24073, 5898, 5776, 2989, 3393, 40301, 42191, 40146, 21394, 5346, 8348, 5776, 25326, 3147, 24036, 3868, 28649, 5898, 47946, 29354, 25628, 33887, 36204, 10977, 9203, 17648, 17186, 9529, 33627, 38444, 23766, 13850, 3147, 13913, 40237, 19927, 17686, 16962, 12388, 2863, 3868, 11630, 3868, 17648, 17757, 37134, 9529, 4992, 17757, 3147, 22206, 10139, 15, 37849, 9650, 3393, 10227, 7136, 3147, 3925, 6, 22880, 24036, 5776, 8520, 23977, 3952, 10139, 17757, 16003, 4733, 8095, 4992, 7072, 2141, 26097, 11910, 30175, 48002, 11112, 2989, 3393, 10977, 3147, 24745, 4733, 26855, 3955, 12116, 15234, 6450, 28434, 5898, 5776, 2989, 3393, 40301, 13, 18806, 37134, 9529, 7490, 3868, 2599, 7136, 19073, 41878, 3868, 12116, 2141, 5776, 6450, 3868, 43005, 40557, 13850, 26097, 3393, 30656, 5898, 20933, 36204, 16287, 6450, 4992, 17186, 22880, 9028, 30793, 21027, 22206, 27435, 23977, 3952, 10139, 17757, 16003, 4733, 18806, 11112, 6450, 5676, 10298, 4992, 36684, 8348, 4134, 2599, 5117, 20933, 4992, 15, 187, 36, 1513, 257, 1879, 12727, 8464, 860, 29350, 13, 39318, 43666, 11630, 21394, 3393, 40399, 28832, 3393, 10227, 37097, 13, 4654, 2863, 25326, 3147, 7136, 21227, 37677, 10139, 37134, 4654, 18184, 8095, 28832, 7490, 44206, 26855, 25651, 10139, 17648, 17186, 13, 18383, 10977, 13913, 4733, 16962, 2989, 11112, 4992, 40237, 3868, 36204, 21027, 3955, 12388, 34500, 28354, 2863, 4134, 22206, 34500, 49456, 24292, 9650, 35280, 9737, 7072, 5676, 21394, 10977, 24745, 5898, 5676, 7136, 3955, 4992, 13, 8095, 29346, 16411, 11630, 7490, 40557, 8095, 41620, 47403, 19073, 9737, 7072, 5676, 3952, 26097, 43005, 25628, 24292, 5676, 38377, 17186, 24073, 9028, 15, 575, 998, 6356, 2146, 209, 33011, 24292, 19927, 28354, 38929, 4134, 22206, 7136, 48911, 2599, 14733, 13, 5898, 29704, 8348, 38833, 1454, 108, 38377, 43994, 19073, 9028, 42313, 7490, 16962, 21394, 3868, 31008, 3147, 28434, 35691, 17946, 17648, 3952, 10139, 33629, 4733, 13, 23766, 3952, 12388, 34500, 35278, 48002, 16962, 16287, 6450, 28434, 26855, 3955, 4134, 6450, 4134, 2599, 35280, 23766, 9737, 5676, 24745, 3147, 28434, 32309, 41878, 2599, 11630, 4134, 7490, 41783, 16962, 9028, 15, 29830, 4134, 6450, 2599, 14733, 16287, 4733, 15, 187, 12507, 3393, 11630, 16411, 14733, 3147, 13, 49456, 26855, 3955, 12116, 15234, 27435, 18951, 29495, 6450, 38444, 40557, 36796, 48911, 2599, 17946, 22880, 11112, 12388, 2599, 11630, 8520, 427, 42582, 5307, 38833, 8095, 41620, 47403, 19073, 23977, 44206, 17757, 16003, 10227, 2863, 17648, 10977, 27435, 3147, 48911, 3868, 7490, 32681, 8095, 7136, 3952, 15234, 24073, 43666, 138, 228, 138, 243, 15, 37849, 9650, 3393, 22206, 8348, 13, 38833, 1454, 108, 38377, 43994, 19073, 5898, 19927, 12116, 3393, 3952, 10977, 13913, 40647, 37677, 7136, 32309, 9737, 6450, 44687, 37677, 7136, 17686, 43666, 30793, 21027, 5346, 27435, 5776, 36204, 47607, 24292, 5676, 38377, 17186, 378, 2381, 463, 9529, 9650, 3393, 22206, 8348, 23766, 48002, 11112, 4992, 40237, 3868, 36204, 21027, 3955, 12388, 34500, 28354, 2863, 4134, 22206, 34500, 15, 187, 51, 6859, 26269, 86, 860, 33383, 50218, 13, 39318, 43666, 11630, 21394, 3393, 40399, 28832, 3393, 10227, 37097, 13, 38833, 1454, 108, 38377, 43994, 19073, 47909, 3393, 9650, 6450, 3868, 7490, 8095, 42313, 7490, 14, 5676, 8348, 2599, 7490, 35278, 25628, 5613, 3393, 36030, 5117, 14439, 18184, 8095, 28832, 14439, 17186, 24073, 9028, 15, 1879, 12727, 15, 13803, 30681, 1454, 124, 9203, 38093, 30175, 2599, 6450, 24355, 9028, 30793, 3147, 10139, 45002, 2989, 22206, 10139, 23766, 22880, 4733, 23871, 2989, 7072, 7136, 16411, 3952, 37833, 8095, 7136, 3952, 37833, 37134, 5898, 5676, 21394, 5346, 13913, 4733, 9737, 5676, 24745, 41451, 32309, 45002, 36204, 3952, 5676, 24745, 30656, 35278, 5898, 2989, 43242, 17757, 14439, 9028, 8348, 38377, 9737, 6450, 10227, 37833, 15, 48185, 27718, 37677, 10139, 25628, 1454, 107, 16287, 30303, 4992, 13, 4654, 2863, 25326, 3147, 7136, 21227, 9737, 6450, 3955, 10298, 8095, 17946, 7072, 17757, 22206, 8348, 9737, 5117, 7072, 3147, 13913, 3955, 15234, 30175, 17686, 24292, 36003, 2863, 24073, 9737, 2989, 17186, 7072, 10139, 2599, 3952, 14858, 4733, 1108, 7136, 4134, 33011, 13850, 3147, 7490, 34299, 25651, 11910, 24355, 1454, 109, 10227, 14858, 1253, 5898, 29346, 10977, 8348, 21027, 3955, 10298, 33887, 16287, 9650, 37097, 7490, 31008, 41451, 19073, 9737, 5676, 12116, 29354, 3868, 7490, 4654, 18184, 9529, 11910, 29354, 35691, 17946, 17648, 3952, 10139, 41783, 15234, 13, 1454, 108, 4654, 8348, 5776, 25326, 3147, 41878, 12116, 15234, 2989, 26867, 13, 40647, 9529, 9650, 9203, 17186, 23766, 17686, 9028, 24745, 18951, 21027, 32309, 9737, 7072, 5676, 34299, 49626, 45133, 47607, 49929, 2599, 14733, 4134, 10139, 18806, 17686, 16962, 16287, 6450, 2863, 8095, 28832, 5676, 11910, 30656, 19073, 5613, 3393, 10977, 24745, 40647, 209, 30303, 4992, 47946, 47946, 3952, 18184, 5898, 11630, 21394, 2863, 15, 187, 138, 228, 19927, 12116, 9203, 14733, 3955, 10298, 26855, 7072, 45133, 5676, 21394, 31008, 19927, 9529, 21227, 4733, 5613, 14733, 16287, 25326, 7072, 6450, 28434, 721, 13, 898, 13, 1903, 13, 1249, 18806, 2145, 13, 48002, 16962, 16287, 6450, 28434, 38833, 9529, 9650, 33211, 2989, 8348, 3868, 7490, 47851, 47909, 16003, 3955, 18184, 15, 37849, 16003, 8095, 43994, 6450, 3868, 36204, 5898, 5117, 16003, 11630, 22880, 18383, 21027, 3147, 29346, 3955, 27435, 13, 18806, 24292, 9650, 28649, 14439, 4733, 29495, 6450, 7072, 3147, 7490, 17186, 32681, 9737, 5117, 3393, 36003, 3393, 22206, 26867, 47909, 3393, 47403, 26867, 32681, 11112, 2989, 3393, 10977, 3147, 26867, 26855, 3955, 12116, 15234, 2989, 26867, 9529, 21227, 4733, 40146, 21394, 12116, 9203, 3952, 11910, 28434, 24073, 43666, 30793, 3147, 7136, 17648, 14439, 4733, 24036, 3868, 28649, 5898, 47946, 29354, 25628, 5898, 4134, 40051, 9650, 7136, 38929, 17186, 13, 18383, 14439, 21027, 13913, 13810, 20853, 9203, 17186, 24073, 29830, 4134, 2989, 2599, 14733, 4134, 33221, 29495, 6450, 22880, 20853, 9203, 17757, 16003, 4733, 15, 1454, 234, 41878, 43242, 44206, 17186, 24073, 5898, 4134, 40051, 9650, 7136, 38929, 38444, 37134, 24292, 19927, 4733, 26855, 7072, 45133, 5676, 21394, 31008, 21027, 4733, 9529, 2599, 7136, 9650, 2863, 4733, 32309, 49456, 5898, 3955, 12116, 29346, 5346, 4992, 16411, 6450, 18383, 3147, 24745, 4733, 15, 1454, 242, 18383, 10977, 2863, 21394, 3868, 3955, 7136, 4733, 5898, 5117, 16003, 11630, 22880, 9529, 2599, 7136, 9650, 8520, 23977, 7490, 34299, 4733, 13810, 209, 44206, 43242, 5898, 19927, 47946, 29354, 24073, 43666, 30793, 3147, 7136, 17648, 14439, 4733, 13, 24036, 4134, 33011, 17686, 9028, 42313, 11910, 24355, 9028, 15, 659, 6356, 2146, 13, 38833, 4654, 16287, 14733, 11630, 41783, 19073, 37134, 23871, 8348, 10977, 2863, 4733, 15, 29830, 35245, 4654, 18184, 5898, 20933, 2989, 9203, 4134, 10298, 41451, 49929, 10977, 5117, 3955, 18184, 13, 5898, 29704, 8348, 49456, 9737, 3955, 4134, 6450, 4134, 2599, 11910, 42191, 40146, 10227, 6450, 2863, 9737, 12116, 2141, 3952, 40237, 7072, 33221, 24073, 43666, 138, 228, 138, 243, 18806, 49929, 4134, 5776, 9203, 28649, 49456, 8095, 29346, 16411, 11630, 7490, 40557, 37134, 24292, 19927, 4733, 209, 37097, 2141, 5776, 29346, 22206, 7136, 4733, 9529, 2599, 7136, 9650, 2863, 4733, 15, 187, 138, 223, 3868, 28649, 5898, 47946, 29354, 13810, 26855, 5776, 25326, 7072, 10139, 42191, 2989, 9650, 24745, 15234, 30175, 17686, 427, 42582, 5307, 13, 24036, 4134, 33011, 28354 ]
Catherine Stihler (PSE ),    . Κύριε Πρόεδρε, θα ήθελα να ευχαριστήσω όλους τους συναδέλφους για τη στήριξή τους έως τώρα όσον αφορά την έκθεσή μου. Η έκθεση αυτή αντικαθιστά έναν αριθμό υφισταμένων νομικών μέτρων τα οποία παρέχουν τη βάση για την εν ισχύι χρηματοδότηση πέρα από τα ποσά που προβλέπονται από το Ευρωπαϊκό Αλιευτικό Ταμείο, σύμφωνα με την πολιτική για επίτευξη καλύτερης και απλούστερης νομοθεσίας. Ορίζει στόχους δαπανών, κανόνες για το επιλέξιμο των δαπανών, το επίπεδο συνεισφοράς από την Επιτροπή και μέτρα ελέγχου. Οι κύριοι τομείς που καλύπτονται είναι ο έλεγχος και η επιβολή της εφαρμογής των κανόνων, η συλλογή δεδομένων, οι επιστημονικές συμβουλές, η διαχείριση της κοινής αλιευτικής πολιτικής και τα διεθνή θέματα. Ο συνολικός προϋπολογισμός που προβλέπεται για τα έτη 2007-2013 είναι 2 625 εκατ ευρώ, μολονότι τα πραγματικά ποσά, όπως είπε ο Επίτροπος, θα εξαρτηθούν από τις δημοσιονομικές διαπραγματεύσεις της ΕΕ. Στον τομέα των διεθνών σχέσεων και του Δικαίου της Θαλάσσης, παρέχεται κοινοτική χρηματοδοτική στήριξη για τη σύναψη αλιευτικών συμφωνιών με τρίτα κράτη, συμπεριλαμβανομένων συμφωνιών εταιρικής σχέσεως, και συμμετοχής σε διεθνείς οργανισμούς που έχουν σχέση με την αλιεία ή το Δίκαιο της Θαλάσσης. Στον τομέα αυτόν διατίθεται η μερίδα του λέοντος του προϋπολογισμού – 1 529,5 εκατ. ευρώ, εκ των οποίων 1 522,5 εκατ. ευρώ διατίθεται στις αλιευτικές συμφωνίες. Επιπλέον, ορισμένα χρήματα διατέθηκαν σε τεχνική και διοικητική συνδρομή, περιλαμβανομένων των σχετικών με το προσωπικό δαπανών. Η χρηματοδοτική στήριξη για τη συλλογή δεδομένων σχετικά με τον αντίκτυπο της αλιείας στο περιβάλλον όσον αφορά την υιοθέτηση στάσης με γνώμονα το οικοσύστημα είναι σημαντική. Σχεδόν 60% του όλου χρήματος πηγαίνει για τις διεθνείς συμφωνίες αλιείας, και είναι σωστό να διασφαλίσουμε ότι γίνεται αξιοποίηση του κοινοτικού χρήματος και δίκαιη ανάπτυξη. Carmen Fraga Estévez,    Κύριε Πρόεδρε, μολονότι αυτή είναι μία πρόωρη συζήτηση, καθώς οι δημοσιονομικές προοπτικές δεν έχουν εγκριθεί ακόμη, πιστεύω ότι πρέπει να εγκρίνουμε την έκθεση της κ. Stihler ως ένα προληπτικό μέτρο, αλλά θα ήθελα να κάνω ορισμένες παρατηρήσεις, μερικές από τις οποίες συμπίπτουν με εκείνες που διατύπωσε ο κ. Επίτροπος. Δεύτερον, δεν συμφωνούμε επίσης ότι τα μέτρα του δικτύου Natura 2000 θα πρέπει να χρηματοδοτηθούν μέσω των πόρων της ΚΑΠ. Σχετικά, θα ήθελα να αναφερθώ σε αυτό που είπε αυτό το Κοινοβούλιο στην έκθεση Böge σχετικά με τις δημοσιονομικές προοπτικές. Rosa Miguélez Ramos,    Κύριε Πρόεδρε, θα ήθελα να συνεχίσω πάνω-κάτω από την τελευταία πρόταση της κ. Fraga. Δεν ξέρω γιατί η κοινή πολιτική με τους λιγότερους πόρους είναι ακριβώς εκείνη που πολιορκείται από αιτήματα κάθε είδους. Από αυτή την άποψη, μολονότι είμαι πραγματικά ευγνώμων για το έργο της εισηγήτριας –όπως γνωρίζει η ίδια– αισθάνομαι υποχρεωμένη να εκφράσω μία σειρά παρατηρήσεων, ή μάλλον διαφωνιών, σε σχέση με το κείμενο που εγκρίθηκε στην επιτροπή και το οποίο πρόκειται να τεθεί σε ψηφοφορία αύριο. Αναφέρομαι συγκεκριμένα στις τροπολογίες 6, 9, 11, 12 και 13, τις οποίες θα σχολιάσω εν συντομία. Στο πλαίσιο αυτού του κανονισμού, και έχοντας επίγνωση των ευεργετικών συνεπειών των διεθνών συμφωνιών στις περιφέρειες της Κοινότητας όσον αφορά την απασχόληση, κατανοώ τη θέση της Επιτροπής επί του θέματος. Η διατήρηση της απασχόλησης είναι ένας συγκεκριμένος στόχος που δεν αμφισβητεί κανείς. Ο καθορισμός αυτού του στόχου χωρίς τη ρητή αναφορά της Κοινότητας, όπως το κάνει η κ. Stihler, θα μπορούσε να είναι λάθος. Είναι μία αξιέπαινη επιθυμία, αλλά δεν εμπίπτει στο πεδίο εφαρμογής της ΚΑΠ και επιπλέον δεν πιστεύω ότι είναι ένας ρεαλιστικός στόχος. Όσον αφορά τη συλλογή στοιχείων για το Natura 2000, όπως προ
[ 13, 1283, 805, 15, 380, 1533, 369, 7753, 18197, 762, 187, 783, 340, 3136, 273, 32436, 434, 48320, 15, 1284, 247, 772, 17888, 323, 253, 29281, 187, 2913, 13, 2210, 253, 17053, 7203, 15, 28679, 13, 21327, 13, 285, 479, 16044, 13, 497, 187, 498, 324, 275, 5389, 27553, 459, 28, 12405, 497, 30601, 272, 13, 285, 11260, 497, 187, 4093, 272, 11678, 283, 9154, 387, 22200, 7382, 6121, 13, 534, 4377, 26485, 187, 23684, 20975, 25534, 281, 1067, 521, 346, 713, 5849, 21131, 937, 533, 534, 187, 2666, 369, 521, 2419, 273, 43841, 15, 2058, 22200, 7382, 6121, 13, 26485, 7252, 187, 10178, 5262, 1142, 285, 5211, 7203, 1897, 342, 11628, 7406, 66, 28, 285, 672, 703, 187, 4238, 342, 779, 387, 436, 2586, 14, 36443, 13, 352, 369, 6296, 247, 11284, 21131, 15, 187, 187, 510, 17874, 285, 5389, 19538, 369, 671, 1024, 387, 22200, 7382, 6121, 13, 533, 187, 783, 6963, 760, 3543, 617, 3361, 283, 248, 320, 13028, 617, 642, 625, 15, 4058, 49570, 187, 2013, 7969, 285, 25507, 22569, 574, 25368, 13, 347, 671, 617, 256, 21144, 285, 187, 84, 2066, 2158, 28, 617, 50223, 2927, 574, 4581, 11654, 13, 285, 617, 7353, 11233, 187, 1033, 3136, 642, 625, 15, 1500, 369, 1335, 387, 22200, 7382, 6121, 13, 533, 760, 347, 247, 187, 49017, 339, 15, 380, 6963, 574, 617, 278, 666, 1306, 360, 33230, 275, 253, 4766, 273, 253, 187, 72, 6702, 15, 3856, 2242, 617, 44596, 13, 285, 2316, 574, 644, 1669, 323, 1529, 13, 347, 187, 32655, 254, 781, 7252, 6034, 281, 1234, 583, 581, 1388, 387, 253, 1930, 273, 521, 187, 24525, 8901, 15, 187, 187, 4509, 253, 673, 326, 253, 19538, 434, 4558, 574, 644, 17063, 627, 283, 187, 4064, 326, 1388, 273, 44089, 285, 12330, 283, 783, 6963, 1925, 22200, 7382, 6121, 187, 2369, 3356, 521, 346, 713, 5849, 21131, 449, 733, 369, 7613, 28287, 247, 26908, 13, 835, 521, 187, 38472, 1632, 285, 2389, 497, 14205, 15, 11706, 13, 344, 10490, 281, 3464, 627, 13, 323, 187, 262, 4455, 281, 779, 347, 2167, 344, 3543, 253, 3361, 273, 253, 5968, 273, 521, 187, 67, 1417, 264, 19538, 13, 285, 7192, 1805, 752, 703, 18017, 281, 521, 7765, 187, 249, 253, 11561, 15513, 672, 703, 772, 311, 264, 779, 13, 285, 7560, 273, 13926, 285, 187, 66, 23347, 2389, 15, 380, 29958, 9367, 5938, 13, 2299, 13, 858, 417, 4510, 281, 187, 41161, 275, 253, 27231, 490, 853, 273, 521, 25938, 13, 835, 344, 574, 187, 42889, 4817, 275, 7203, 594, 1142, 5211, 1897, 342, 521, 21426, 187, 24525, 8901, 15, 754, 574, 13, 3103, 13, 247, 1355, 2419, 2822, 253, 21131, 28, 352, 369, 187, 14806, 436, 8342, 285, 26896, 2605, 326, 344, 574, 14373, 342, 521, 187, 72, 3624, 14, 296, 695, 3612, 2798, 15, 3856, 13, 275, 521, 1220, 3396, 13, 344, 574, 2168, 4817, 187, 9389, 29121, 15, 187, 187, 510, 1273, 807, 574, 4829, 38667, 1580, 253, 19538, 434, 2471, 13, 285, 187, 32655, 254, 781, 7252, 434, 2798, 369, 1335, 689, 67, 11180, 2348, 342, 26034, 13, 533, 187, 28948, 344, 574, 6311, 752, 673, 22332, 512, 4920, 932, 283, 248, 574, 6311, 281, 187, 1257, 25036, 15, 6279, 13, 28404, 275, 841, 46886, 1897, 369, 253, 760, 187, 1597, 326, 6376, 281, 253, 23293, 4377, 273, 37138, 571, 15, 733, 369, 247, 8872, 187, 395, 2834, 7143, 13, 323, 344, 574, 3663, 15704, 13, 2389, 13, 43703, 13, 285, 187, 9154, 521, 17292, 14275, 15, 733, 310, 2032, 13, 344, 369, 1335, 1925, 4377, 273, 187, 6140, 1316, 571, 13, 533, 344, 369, 1612, 1417, 15, 754, 574, 281, 6026, 281, 253, 26882, 3875, 588, 273, 187, 47, 522, 1306, 251, 13, 285, 28438, 247, 12195, 273, 521, 3438, 43703, 574, 644, 187, 1274, 779, 15, 380, 1897, 273, 308, 3683, 262, 574, 417, 2568, 3982, 40655, 285, 187, 18256, 24567, 2217, 2220, 779, 15, 380, 22212, 273, 253, 5112, 574, 2879, 187, 47120, 385, 3518, 13, 285, 521, 29586, 593, 3395, 5312, 625, 32397, 285, 187, 565, 15740, 494, 15, 496, 253, 2454, 273, 824, 11684, 352, 760, 6376, 323, 187, 32655, 254, 781, 7252, 281, 11929, 390, 11623, 15, 754, 3261, 47680, 2920, 387, 521, 187, 328, 42256, 2586, 13, 387, 1110, 5207, 253, 1390, 2137, 574, 25979, 273, 616, 187, 10034, 25002, 285, 24593, 28, 387, 521, 1355, 8544, 28, 387, 253, 43721, 90, 2097, 387, 521, 187, 3431, 40384, 13, 2429, 342, 253, 5300, 273, 32436, 13, 285, 283, 783, 6963, 187, 2377, 3004, 15, 187, 187, 1328, 574, 6296, 32360, 1048, 13, 285, 19460, 7052, 342, 521, 1211, 187, 39336, 723, 15, 1198, 13, 407, 29315, 281, 32436, 434, 320, 3957, 84, 13, 344, 369, 281, 2489, 187, 783, 1527, 9054, 273, 253, 22212, 13651, 13, 285, 253, 4377, 273, 37138, 571, 187, 4238, 13, 26277, 342, 253, 22212, 273, 253, 5112, 13, 281, 4430, 1411, 253, 187, 11223, 14652, 273, 7422, 15, 733, 369, 247, 11527, 15504, 323, 26485, 7252, 187, 936, 17789, 521, 3331, 281, 521, 9054, 13, 285, 387, 253, 1077, 2774, 672, 187, 41736, 574, 5907, 521, 1133, 323, 247, 747, 9728, 13, 285, 4081, 281, 187, 585, 2445, 271, 13413, 285, 14397, 23158, 342, 37138, 571, 285, 187, 45353, 15, 187, 187, 1989, 824, 271, 23158, 342, 13392, 7422, 812, 417, 17084, 187, 6140, 1316, 571, 1411, 20667, 6181, 13, 3692, 29894, 497, 2349, 17263, 2822, 187, 379, 2914, 4670, 15, 380, 5434, 273, 1146, 24983, 407, 32436, 369, 1199, 625, 187, 22275, 494, 685, 253, 3524, 273, 1146, 4516, 407, 7422, 15, 7422, 574, 187, 40252, 281, 513, 281, 1379, 1557, 273, 5972, 15, 1500, 369, 7591, 281, 3657, 187, 33639, 432, 25473, 37138, 571, 13, 604, 32436, 6799, 13, 285, 253, 16834, 187, 22732, 2965, 432, 253, 1481, 273, 26485, 7252, 1048, 1078, 247, 7247, 187, 1513, 90, 273, 18382, 263, 812, 2831, 253, 37138, 757, 34642, 15, 754, 9262, 187, 45230, 13, 285, 7607, 342, 581, 1133, 253, 23158, 273, 6181, 13, 1223, 187, 33897, 617, 342, 253, 643, 15, 187, 187, 2374, 253, 2164, 394, 273, 5080, 13, 1283, 805, 13, 253, 37138, 757, 6963, 6704, 436, 747, 187, 38441, 90, 15, 1284, 369, 36834, 407, 253, 806, 3929, 13, 344, 5966, 715, 247, 187, 1545, 3134, 23158, 342, 6181, 1411, 667, 5284, 1612, 342, 534, 187, 26597, 6181, 390, 37138, 571, 943, 38492, 320, 387, 2137, 15, 32436, 13, 253, 187, 1342, 665, 574, 7154, 11628, 7406, 66, 434, 2798, 13, 369, 1024, 253, 3331, 285, 25550, 187, 1171, 4377, 26485, 7252, 13, 285, 253, 13948, 273, 6181, 497, 7613, 28287, 187, 936, 320, 253, 13948, 273, 37138, 571, 2, 187, 187, 1147, 369, 436, 326, 253, 6963, 1869, 273, 281, 14, 1201, 13, 672, 13, 275, 253, 2393, 629, 187, 1171, 2552, 13, 344, 369, 3815, 13, 285, 19360, 275, 521, 24233, 13, 387, 521, 1355, 187, 5967, 275, 22200, 7382, 6121, 15, 733, 369, 2568, 2393, 13, 323, 344, 574, 28987, 1078, 187, 13998, 24078, 13, 285, 574, 644, 387, 789, 247, 1048, 673, 13, 672, 344, 25368, 323, 247, 187, 25094, 285, 20714, 281, 521, 1129, 22644, 15, 2070, 18197, 896, 275, 521, 3477, 187, 21689, 13, 344, 37432, 1948, 5356, 949, 253, 1527, 5253, 14, 26695, 13, 1024, 327, 396, 9457, 187, 13456, 13, 285, 969, 327, 253, 5920, 4991, 27553, 459, 273, 521, 10329, 15, 187, 187, 1989, 436, 7107, 17040, 369, 417, 281, 1390, 1048, 28, 253, 3369, 273, 253, 187, 6795, 42139, 6188, 5485, 13, 285, 253, 3174, 1342, 6138, 326, 521, 6552, 1371, 187, 10292, 2131, 285, 34641, 8449, 388, 6702, 4978, 9521, 281, 923, 521, 19684, 14197, 15, 187, 187, 3, 1466, 779, 1705, 275, 937, 753, 253, 6963, 13, 347, 344, 9461, 13, 8577, 521, 16102, 187, 2653, 265, 13, 534, 574, 2489, 1014, 43580, 1321, 685, 1078, 13, 2584, 253, 3369, 13, 187, 251, 253, 7887, 273, 534, 253, 20654, 285, 8489, 15098, 13543, 830, 273, 187, 783, 45803, 273, 1375, 5420, 15, 754, 33766, 44738, 15, 3032, 17874, 187, 395, 638, 24765, 41804, 1385, 7697, 369, 18727, 285, 730, 451, 347, 7312, 28, 253, 187, 4351, 434, 13, 16102, 13, 30457, 13, 285, 8872, 15, 187, 187, 3, 24494, 3668, 13, 309, 9428, 865, 2546, 253, 6963, 13, 13366, 15, 346, 1394, 1705, 387, 594, 187, 18579, 271, 4964, 13, 1633, 15423, 1364, 452, 4592, 15, 1737, 310, 187, 262, 865, 187, 187, 3, 16440, 273, 326, 2238, 13, 634, 19684, 14197, 937, 753, 388, 6702, 4978, 13, 342, 521, 187, 303, 44931, 494, 8580, 15, 346, 18291, 13, 352, 310, 2032, 13, 359, 403, 11485, 275, 271, 187, 24124, 13339, 4112, 13, 594, 326, 752, 5010, 1537, 3176, 11555, 187, 261, 1024, 2717, 533, 247, 1077, 9826, 12340, 449, 187, 187, 3, 34, 638, 43927, 1476, 753, 26485, 7252, 13, 1869, 2920, 15, 346, 1394, 452, 13, 840, 13, 187, 936, 2028, 479, 1633, 1774, 15, 1737, 310, 352, 32, 11668, 247, 7319, 285, 3984, 1476, 187, 510, 6963, 8042, 281, 247, 6951, 13, 285, 30974, 521, 1211, 15, 388, 6702, 4978, 22813, 187, 41938, 13, 285, 3261, 1066, 323, 247, 2774, 342, 271, 2329, 273, 36649, 15, 187, 187, 3, 6693, 2181, 253, 2647, 275, 12911, 865, 2546, 253, 6963, 15, 346, 16830, 13, 247, 187, 371, 274, 1661, 875, 253, 7815, 285, 253, 5112, 865, 187, 187, 3, 2302, 13, 634, 19684, 14197, 937, 753, 388, 6702, 4978, 13, 281, 3692, 6906, 11233, 2210, 521, 187, 88, 834, 264, 8580, 15, 346, 510, 952, 273, 12911, 1978, 1077, 7107, 13, 285, 8800, 253, 187, 274, 6375, 593, 273, 253, 5112, 342, 50063, 22450, 15, 309, 452, 281, 1304, 642, 187, 371, 274, 32742, 13, 285, 13, 327, 253, 2644, 13, 2717, 273, 6349, 28, 309, 16632, 760, 281, 187, 37650, 634, 19684, 14197, 326, 309, 2959, 247, 2565, 4586, 432, 399, 373, 3354, 3563, 1390, 187, 6170, 449, 187, 187, 510, 6963, 3053, 13, 285, 3261, 43976, 4182, 15, 346, 4509, 5207, 865, 344, 2546, 13, 275, 247, 187, 73, 901, 4318, 15, 187, 187, 3, 4509, 776, 27178, 937, 10017, 388, 6702, 4978, 13, 1557, 13102, 15, 346, 14102, 20733, 187, 47318, 556, 4925, 399, 373, 3354, 15, 1583, 403, 16764, 253, 22212, 187, 47, 522, 1306, 251, 15, 754, 1669, 11877, 18189, 342, 253, 11274, 560, 17100, 7406, 66, 327, 253, 187, 26, 394, 273, 2552, 13, 285, 642, 581, 3260, 667, 2181, 670, 253, 1789, 390, 187, 41011, 273, 253, 9455, 15, 733, 369, 3839, 6566, 326, 253, 187, 358, 14652, 13, 342, 521, 772, 430, 13, 6034, 281, 1379, 247, 11284, 14, 39816, 281, 187, 46, 290, 91, 13, 533, 4745, 846, 521, 13024, 627, 344, 8191, 521, 18880, 187, 3529, 344, 369, 327, 521, 1039, 281, 247, 747, 2137, 13, 285, 651, 13920, 521, 4475, 187, 7483, 347, 2080, 347, 399, 373, 3354, 13, 835, 597, 651, 2525, 616, 29535, 187, 785, 46669, 447, 15, 28424, 8856, 497, 2197, 432, 48253, 91, 281, 26229, 13, 281, 399, 373, 3354, 13, 281, 187, 21958, 44495, 13, 285, 281, 512, 253, 32341, 932, 285, 39091, 15, 380, 9930, 273, 187, 783, 8544, 452, 24488, 4886, 11678, 13, 285, 403, 1024, 37655, 432, 187, 455, 7123, 2220, 399, 373, 3354, 15, 1284, 7312, 13, 32436, 556, 969, 17288, 275, 187, 23492, 521, 5827, 4279, 281, 253, 1077, 1390, 2774, 13, 285, 36689, 253, 187, 10186, 273, 521, 21546, 760, 672, 597, 403, 670, 281, 320, 8156, 449, 187, 187, 3, 4374, 937, 26750, 253, 6963, 13, 275, 247, 10541, 273, 12680, 24307, 285, 12700, 283, 187, 3, 9820, 13, 344, 31394, 247, 2238, 13, 3500, 406, 14762, 8989, 13, 285, 704, 525, 84, 19429, 285, 187, 44896, 692, 21546, 1919, 344, 556, 8392, 715, 521, 37507, 1110, 5207, 344, 187, 565, 1727, 281, 23737, 28, 840, 344, 15323, 521, 8989, 285, 2722, 521, 2032, 43837, 187, 395, 24683, 2454, 15, 754, 7318, 2079, 441, 13, 285, 36790, 521, 19429, 13, 187, 27390, 359, 6704, 253, 23848, 273, 23158, 13, 533, 1024, 344, 588, 23103, 327, 187, 783, 42514, 420, 273, 253, 2209, 356, 3658, 359, 452, 5966, 715, 15, 754, 764, 2979, 187, 66, 747, 2137, 13, 285, 13, 407, 16968, 273, 253, 806, 3929, 273, 776, 23848, 13 ]
, 1812. The world was groaning under the yoke of Napoleon's tyranny. As a consolation for the hopeless year, came the laughing spring. Fields, forests, and meadows, were clad in beautiful verdure; flowers were blooming, and birds were singing everywhere--even at Charlottenburg, which King Frederick William formerly delighted to call his "pleasure palace," but which now was his house of mourning. At Charlottenburg, Frederick William had spent many and happy spring days with Queen Louisa; and when she was with him at this country-seat, it was indeed a pleasure palace. The noble and beautiful queen was also now at Charlottenburg, but the king only felt her presence--he beheld her no more. Her merry remarks and charming laughter had ceased, as also her sighs and suffering; her radiant eyes had closed forever, and her sweet lips spoke no more. She was still at Charlottenburg, but only as a corpse. The king had her mausoleum erected in the middle of the garden. Here lay her coffin, and room had been left for another, as Frederick William intended to repose one day at the side of his Louisa. From the time that the queen's remains had been deposited there-- from that day of anguish and tears--the king called Charlottenburg no longer his "pleasure palace." It was henceforth a tomb, where his happiness and love were buried. Still, he liked to remain there, for it seemed to him as though he felt the presence of the spirit of his blessed queen, and understood better what she whispered to his soul in the silent nights when she consoled him, and spoke of heaven and a renewed love. The bereaved husband, however, did not prefer to dwell in the magnificent abode of his ancestors, where he had formerly passed in spring so many happy days with his beloved Louisa. He had, therefore, a small house near the palace; it was into this plain and humble structure that he had retired with his grief-stricken heart. Here, in his solitude, he had already passed two springs. The second year had nearly elapsed since the queen's death, and Frederick William's heart was still overburdened with sorrow, but yet he had learned what time teaches all mortals--he had learned to be resigned. Yes, resignation in these melancholy days was the only thing that remained to the unfortunate King of Prussia. It was a sad and difficult duty, for he had lost happiness, love, greatness, and even his royal independence. It is true, he was still called King of Prussia, but he was powerless. He had to bow to the despotic will of Napoleon, and scarcely a shadow of his former greatness had been left him. The days of Tilsit had not yet brought disgrace and humiliation enough upon him. The Emperor of the French had added fresh exactions, and his arrogance became daily more reckless and intolerable. In the face of such demands it only remained for Frederick William to submit or resist. He looked mournfully at his unhappy country, at those whom the last war had deprived of their husbands and fathers; at his small army; at the scanty means at his disposal, compared with the resources of Napoleon, and--the king submitted. He had indeed hesitated long, and struggled strongly with his own feelings. For, by submitting to Napoleon's behests, he was to become the open enemy of the Emperor Alexander, and the King of Prussia was, jointly with the Emperor of the French, to arm against the Emperor of Russia. It was a terrible necessity for Frederick William to sacrifice his friend to his enemy, and at the very moment when Alexander had offered his hand for a new league, and proposed to conclude an offensive and defensive alliance with Prussia and England. But such an alliance with distant Russia could not strengthen Prussia against neighboring France, whose armies were encamped near her frontiers. The danger of being crushed by Napoleon was much more probable than the hope of being supported by Russia. Russia had enough to do to take care of herself. She was unable to prevent France from destroying Prussia, if Napoleon desired, and the crown might fall from the head of Frederick William long before a Russian army of succor could cross the Prussian frontier. He submitted therefore, and accepted with one hand the alliance of France, while threatening her with the other. On the 24th of February, 1812, the Prussian king signed this new treaty. As was stipulated by the first article, he entered into a defensive alliance with France against any European power with which either France or Prussia should hereafter be at war. Napoleon, the man who had broken Queen Louisa's heart, was now the friend and ally of King Frederick William, and the enemies of France were henceforth to be the enemies of Prussia! It was this that the king thought of to-day, when, in the early part of May, he was alone, and absorbed in his reflections, at his small house in Charlottenburg. It was yet early, for he had risen before sunrise, and had been at work a long time, when he ceased for a moment and yielded to his meditations. Leaning back in his easy chair, he gazed musingly through the open glass-doors, now on serene sky, and again on the fragrant verdure of his garden. But this quiet relaxation was not to last long; the door of the small anteroom opened, and the footman announced that his excellency Minister and Chancellor von Hardenberg requested to see his majesty. "Let him come in," said the king, as he rose, turning his grave eyes, which had become even gloomier than before, toward the door, on the threshold of which the elegant and somewhat corpulent form of the chancellor of state appeared. He bowed respectfully. His noble and prepossessing countenance was smiling and genial as usual; the king's, grave, thoughtful, and sad. "Bad news, I suppose?" asked the king, briefly. "You come at so early an hour, something extraordinary must have happened. What is it?" "Nothing of that kind, your majesty," said Hardenberg, with his imperturbable smile. "Yet, it is true, we are constantly in an extraordinary situation, so that what otherwise might appear unusual is now nothing but a very ordinary occurrence." "A preamble!" said Frederick William, thoughtfully. "You have, then, to tell me something important. What is it? Take a seat and speak!" The king pointed to a chair, and resumed his own. Hardenberg seated himself, and looked down for a moment with an air of embarrassment. "Any thing the matter in Berlin?" asked the king. "Perhaps, a quarrel between the citizens and the French?" "No, your majesty," said Hardenberg, to whose thin lips came his wonted smile. "The people of Berlin keep very quiet, and bear the arrogance of the French with admirable patience. I have to report no quarrels, and, on the whole, nothing of importance; I wished only to inform your majesty that I received a courier from Dresden late last night." The king started, and looked gloomy. "From whom?" he asked, in a hollow voice. "From our ambassador," replied Hardenberg, carelessly. "Surprising intelligence has reached Dresden. They are expecting the Emperor Napoleon. He left Saint Cloud with the Empress Maria Louisa on the 9th of May, and no one knew any thing about the object or destination of the journey. It was generally believed that the emperor, with his consort, intended to take a pleasure-trip to Mentz, but immediately after his arrival there he informed his suite that he was on his way to a new war, and would accompany his wife only as far as Dresden, where they would meet their Austrian majesties. Couriers were sent from Mentz to Vienna, to Dresden, to King Jerome, and to all the marshals and generals. The columns of the army have commenced moving everywhere, and are now marching from all sides upon Dresden. As usual, Napoleon has again succeeded in keeping his plans secret to the very last moment, and informing the world of his intentions only when they are about to be realized." "Yes," exclaimed the king, in a tone of intense hatred and anger-- "yes, he wears a kind, hypocritical mask, and feigns friendship and pacific intentions until he has drawn into his nets those whom he intends to ruin; then he drops his mask and shows his true arrogant and ambitious face. He caressed us, and protested his friendship, until we signed the treaty of alliance, but now he will insist on the fulfilment of the engagements we have entered into. He commences a new war, and, by virtue of the first article of our treaty,
[ 15, 4111, 15, 4299, 3079, 7444, 15, 36206, 19, 313, 28403, 481, 443, 15, 7785, 74, 285, 378, 15, 1023, 80, 1351, 13, 4111, 15, 3555, 15, 444, 4299, 2511, 6257, 470, 1423, 22000, 313, 6759, 481, 411, 15, 16120, 413, 13, 24520, 15, 4111, 15, 500, 15, 378, 4299, 3712, 6257, 26879, 313, 8603, 481, 411, 15, 16120, 413, 13, 500, 15, 6515, 15, 3189, 348, 15, 367, 2125, 8897, 313, 8602, 481, 411, 15, 16120, 413, 285, 418, 15, 427, 15, 1608, 348, 321, 13, 4111, 15, 3555, 15, 444, 4299, 1438, 6257, 470, 2945, 11238, 313, 7857, 481, 500, 15, 6470, 284, 285, 329, 15, 399, 15, 322, 536, 267, 13, 500, 15, 6515, 15, 4111, 15, 4299, 4185, 6257, 47319, 313, 6914, 481, 329, 15, 353, 15, 20496, 445, 4978, 285, 378, 15, 388, 15, 4235, 1727, 257, 13, 4111, 15, 3555, 15, 12464, 15, 4299, 3832, 6257, 3436, 1671, 313, 14619, 481, 399, 15, 500, 15, 329, 2225, 285, 657, 15, 5794, 60, 1950, 1181, 79, 14, 6791, 263, 13, 3921, 6180, 3762, 13, 253, 39358, 1387, 13, 285, 4619, 16958, 13, 495, 5784, 1407, 13663, 313, 14947, 15317, 13, 16861, 13, 5826, 481, 388, 15, 443, 15, 14702, 9358, 375, 13, 329, 15, 16874, 13, 418, 15, 329, 15, 20344, 60, 1757, 1181, 79, 26196, 13, 657, 15, 5794, 60, 1950, 1181, 79, 14, 6791, 263, 13, 500, 15, 3586, 348, 13, 500, 15, 500, 15, 18268, 478, 14, 45, 15077, 8636, 13, 329, 15, 20081, 266, 585, 13, 367, 15, 308, 4415, 91, 13, 330, 15, 418, 15, 530, 620, 351, 13, 285, 330, 15, 914, 44626, 13, 4111, 15, 3555, 15, 378, 4299, 3763, 6257, 1638, 20991, 313, 6914, 481, 353, 15, 443, 15, 8698, 285, 500, 15, 309, 15, 15983, 2617, 1136, 13, 500, 15, 4111, 15, 11382, 15, 378, 4299, 11335, 6257, 2030, 2090, 313, 11496, 481, 329, 15, 611, 15, 416, 1212, 860, 13, 330, 15, 500, 15, 10498, 88, 262, 13, 611, 15, 322, 15, 2065, 4714, 13, 411, 15, 329, 15, 2656, 69, 472, 13, 6490, 13, 285, 411, 15, 353, 15, 8229, 1648, 13, 500, 15, 3052, 15, 11382, 15, 14162, 15, 4299, 13391, 6257, 2233, 1348, 313, 13895, 481, 611, 15, 378, 6228, 285, 399, 15, 367, 15, 42005, 13, 4111, 15, 3555, 15, 378, 4299, 1229, 6257, 1638, 2357, 313, 15624, 481, 330, 15, 39561, 84, 285, 416, 15, 611, 1584, 777, 90, 13, 500, 15, 6515, 15, 4111, 15, 4299, 3832, 6257, 11275, 313, 13435, 481, 353, 15, 444, 15, 14826, 285, 388, 15, 27280, 9289, 74, 13, 500, 15, 11382, 15, 4111, 15, 4299, 1976, 6257, 608, 31416, 313, 18263, 481, 353, 15, 14026, 257, 13097, 348, 13, 4111, 15, 3555, 15, 378, 4299, 3507, 6257, 1722, 2031, 1610, 313, 7199, 481, 443, 15, 21174, 1914, 11158, 91, 285, 388, 15, 411, 15, 500, 15, 2071, 2381, 442, 13, 500, 15, 4111, 15, 329, 27, 8684, 15, 2588, 15, 4299, 1731, 6257, 848, 313, 13549, 481, 444, 15, 7511, 1944, 1866, 13, 353, 15, 444, 15, 14826, 13, 285, 329, 15, 1503, 15, 9251, 356, 7173, 35464, 13, 4111, 15, 3555, 15, 12464, 15, 4299, 2055, 6257, 1283, 3011, 520, 313, 10016, 481, 353, 15, 367, 15, 12972, 46760, 13, 4111, 3737, 329, 4299, 3245, 6257, 48024, 313, 19813, 481, 388, 15, 443, 15, 14702, 9358, 375, 13, 418, 15, 329, 15, 20344, 60, 1757, 1181, 79, 26196, 13, 657, 15, 5794, 60, 1950, 1181, 79, 14, 6791, 263, 13, 285, 329, 15, 353, 15, 14893, 48772, 13, 4111, 15, 12464, 15, 378, 4299, 25745, 6257, 11140, 313, 12487, 481, 187, 30423, 20287, 40007, 20241, 222, 18447, 35368, 310, 2530, 407, 1565, 446, 31587, 80, 285, 352, 476, 320, 908, 323, 667, 4096, 15, 21309, 39634, 313, 29486, 6876, 10, 187, 187, 21309, 39634, 313, 1093, 2693, 1108, 1384, 4247, 32626, 10, 2283, 1701, 13366, 347, 271, 6805, 275, 5854, 275, 253, 46215, 84, 1078, 802, 19531, 839, 281, 1457, 12123, 13, 835, 344, 574, 247, 12848, 5249, 347, 247, 2659, 6630, 263, 13, 247, 11547, 41473, 263, 285, 6158, 314, 347, 247, 3558, 273, 253, 1457, 12123, 37558, 6456, 15, 380, 20672, 388, 13077, 38523, 273, 39634, 10947, 275, 1457, 12123, 42628, 684, 521, 1416, 15, 187, 187, 3980, 304, 968, 2490, 187, 998, 7095, 369, 5686, 275, 41198, 327, 1668, 4247, 1283, 2693, 13, 253, 3347, 273, 6911, 39634, 313, 7461, 7015, 21334, 275, 253, 5779, 7454, 275, 41198, 10, 285, 273, 26642, 27522, 39634, 15, 187, 187, 18551, 5671, 1546, 5249, 2490, 187, 998, 7095, 9856, 347, 247, 19077, 254, 5974, 273, 10336, 387, 253, 10043, 11417, 27498, 275, 4247, 46215, 13, 11734, 327, 253, 17401, 273, 9011, 7980, 775, 386, 5292, 13, 253, 4283, 22946, 17481, 263, 273, 253, 3667, 1371, 2180, 15, 754, 574, 12322, 5974, 789, 387, 253, 10043, 11417, 275, 253, 3563, 1283, 938, 84, 15, 2006, 3004, 281, 2120, 3484, 1456, 275, 3978, 46215, 13, 344, 369, 11941, 247, 9711, 19358, 326, 807, 15, 754, 4620, 417, 281, 452, 6312, 253, 7312, 1180, 273, 1107, 347, 247, 5974, 13, 984, 407, 1283, 2405, 13, 344, 574, 4395, 281, 21665, 1866, 3964, 13, 835, 253, 15946, 6169, 8304, 369, 762, 3939, 2440, 407, 697, 2563, 10598, 12634, 13, 10092, 15946, 15, 1707, 310, 690, 14011, 326, 775, 386, 5292, 3260, 15946, 13, 285, 436, 6830, 8553, 323, 39634, 3192, 598, 789, 275, 21665, 1866, 3964, 15, 496, 1283, 1237, 13, 1223, 14544, 275, 21665, 1866, 3964, 13, 344, 7028, 20145, 367, 814, 248, 13, 6122, 273, 253, 3563, 3555, 13054, 367, 814, 248, 273, 22808, 15, 39634, 4307, 323, 15946, 323, 247, 1180, 273, 1107, 13, 20462, 253, 50005, 263, 38707, 14, 4826, 26993, 2207, 15671, 1284, 20401, 275, 411, 12099, 49766, 5720, 285, 253, 34367, 267, 15946, 6169, 27982, 13, 1097, 273, 1283, 1610, 13, 534, 4447, 629, 273, 15946, 434, 2098, 281, 1056, 411, 12099, 49766, 5720, 247, 686, 26852, 13032, 8, 7622, 281, 521, 747, 8304, 28, 39634, 671, 4307, 327, 2067, 273, 253, 4067, 3055, 9910, 275, 15946, 6169, 15, 754, 39301, 2567, 342, 15946, 275, 1283, 1671, 13, 8505, 275, 4832, 12748, 13, 533, 45986, 275, 21665, 1866, 3964, 247, 1652, 3356, 15, 3032, 760, 643, 5950, 27934, 2987, 275, 5854, 403, 253, 38707, 18777, 387, 41131, 2205, 313, 1093, 1812, 10, 285, 17026, 16068, 313, 1093, 1671, 14, 1093, 1787, 582, 1097, 275, 4051, 47949, 19299, 15, 2732, 521, 10346, 281, 1457, 12123, 13, 344, 4197, 253, 2216, 323, 247, 43921, 266, 34687, 313, 6342, 264, 275, 253, 8946, 3740, 10, 285, 7517, 2419, 13, 4270, 1283, 2031, 275, 17672, 398, 5720, 13, 42337, 15, 380, 34086, 858, 417, 11883, 253, 48308, 27108, 15, 187, 187, 29431, 275, 1345, 1495, 275, 1457, 12123, 2490, 187, 2374, 884, 4162, 1283, 1867, 344, 13781, 253, 1457, 12123, 6487, 323, 247, 1899, 13, 285, 369, 7660, 281, 3189, 249, 6212, 434, 6630, 4750, 15, 754, 33497, 323, 1457, 12123, 327, 253, 24605, 13, 20948, 387, 6162, 16982, 42304, 327, 495, 4247, 46537, 15, 6408, 253, 1735, 1643, 2607, 344, 4824, 562, 17276, 275, 253, 42337, 14, 41, 13077, 10947, 3286, 13, 835, 344, 3534, 521, 1416, 281, 39634, 10947, 15, 15643, 275, 1283, 2945, 344, 25036, 432, 253, 6487, 281, 4901, 2136, 327, 521, 1211, 2395, 15, 754, 369, 1620, 9202, 273, 3273, 11733, 521, 4743, 327, 1345, 13909, 13, 285, 521, 806, 686, 29076, 281, 253, 8121, 8, 5420, 275, 46537, 1253, 3156, 13, 327, 253, 2256, 273, 1805, 4088, 273, 13538, 17228, 1213, 16948, 4830, 30481, 2659, 428, 275, 1798, 521, 36982, 2822, 253, 36050, 275, 42337, 15, 754, 369, 581, 273, 253, 820, 14, 14541, 398, 273, 253, 1457, 12123, 17143, 1080, 285, 11980, 434, 19967, 953, 22901, 13, 285, 369, 3939, 347, 247, 19600, 273, 18930, 285, 5098, 1919, 387, 1878, 42741, 15, 754, 369, 11162, 347, 247, 8293, 273, 253, 20000, 275, 42129, 13, 285, 4821, 275, 436, 3906, 1919, 387, 1878, 49420, 15, 187, 998, 7095, 6607, 42337, 3228, 275, 253, 49850, 6456, 432, 1283, 3011, 281, 42741, 285, 411, 1094, 274, 24470, 5791, 432, 840, 1919, 50220, 15, 496, 1283, 3680, 344, 4824, 247, 7641, 949, 253, 6456, 281, 5100, 21209, 2208, 323, 42337, 285, 13, 275, 253, 1072, 807, 13, 36431, 253, 5140, 273, 247, 18217, 2439, 253, 48582, 307, 10573, 21277, 15, 4129, 521, 6974, 369, 1784, 1356, 387, 806, 313, 783, 1386, 2424, 690, 11132, 12186, 1100, 582, 39634, 4821, 521, 39786, 15, 496, 43450, 344, 5802, 253, 6456, 281, 5194, 281, 2997, 6911, 353, 15414, 3919, 386, 434, 14510, 281, 1973, 253, 806, 1283, 6574, 273, 253, 1386, 323, 8157, 8970, 13, 933, 13, 533, 253, 2968, 6497, 949, 15, 7874, 1107, 1996, 39634, 33372, 9698, 281, 47122, 253, 2199, 13, 533, 2717, 369, 2218, 1919, 657, 40836, 11217, 352, 275, 521, 1345, 2987, 6974, 273, 253, 2393, 35828, 84, 15, 39634, 369, 34150, 281, 253, 1457, 12123, 37558, 6456, 275, 45834, 13, 9417, 432, 1249, 4163, 45834, 281, 2164, 4397, 1283, 2787, 672, 344, 369, 557, 28758, 323, 5928, 313, 248, 574, 4895, 281, 5854, 275, 4105, 1786, 481, 4325, 1283, 3677, 281, 1283, 3141, 344, 369, 247, 3558, 273, 253, 8907, 273, 253, 2499, 273, 1457, 12123, 15, 496, 253, 37558, 6456, 344, 3395, 973, 1929, 323, 521, 6593, 918, 11626, 327, 253, 2201, 3569, 3374, 273, 253, 1388, 15, 3105, 22046, 521, 9470, 6284, 275, 9221, 413, 434, 6912, 13, 39634, 4821, 281, 28932, 275, 42337, 15, 754, 369, 581, 273, 253, 5399, 398, 323, 253, 42337, 3228, 2213, 19085, 275, 45834, 15, 754, 369, 671, 3939, 275, 6105, 13909, 13, 9417, 323, 247, 673, 347, 247, 2242, 3558, 273, 253, 14139, 351, 273, 253, 6129, 32143, 273, 42337, 15, 28786, 521, 1495, 344, 3534, 1199, 31868, 281, 21047, 285, 407, 1283, 2945, 285, 323, 690, 1107, 846, 13, 369, 21764, 83, 273, 253, 42337, 388, 430, 40319, 285, 28469, 266, 474, 8273, 15, 3032, 806, 4475, 20145, 4962, 846, 247, 1048, 9749, 387, 2745, 329, 287, 327, 337, 4223, 1283, 3583, 15, 187, 187, 15968, 281, 5854, 2490, 187, 688, 1283, 3141, 13, 275, 521, 3563, 4927, 633, 447, 13, 344, 4895, 281, 5854, 13, 285, 327, 655, 4397, 326, 807, 7028, 14884, 416, 16580, 4379, 13, 6122, 273, 253, 3563, 2516, 416, 16580, 4379, 273, 29677, 48737, 13, 387, 659, 6393, 26153, 1502, 13, 611, 13843, 1299, 13, 4693, 15, 754, 4962, 387, 521, 4693, 12913, 13, 337, 1639, 266, 695, 26499, 33892, 13, 378, 698, 7779, 327, 1384, 4247, 32626, 13, 1907, 644, 275, 11741, 1786, 1955, 281, 2923, 323, 2067, 1107, 13, 285, 369, 14205, 275, 611, 561, 267, 6115, 33091, 15, 754, 1669, 642, 2021, 28, 521, 8304, 14278, 7194, 273, 521, 1457, 12123, 3607, 313, 570, 1285, 1884, 13, 933, 20046, 582, 2918, 26277, 342, 521, 4929, 3196, 2516, 6939, 17722, 39634, 13, 665, 671, 4962, 275, 32626, 313, 8732, 574, 1705, 281, 1457, 12123, 347, 247, 20997, 327, 253, 39888, 275, 46537, 481, 9064, 14, 339, 2254, 11285, 273, 253, 8304, 2427, 281, 521, 28137, 14884, 13, 285, 2516, 434, 1740, 14, 339, 2254, 11285, 2427, 281, 2145, 34251, 10003, 275, 5854, 285, 18593, 1321, 13, 1457, 12123, 15, 496, 45272, 14, 2270, 521, 28137, 3559, 247, 1781, 13968, 14, 25483, 3497, 275, 39634, 434, 3541, 281, 253, 448, 18721, 273, 18593, 1321, 36368, 28, 4158, 407, 23662, 928, 4255, 48212, 13, 352, 369, 2529, 387, 253, 673, 347, 346, 783, 6253, 285, 23476, 3497, 273, 253, 2238, 275, 253, 11053, 2065, 19844, 13, 10985, 2620, 298, 1377, 1507, 995, 253, 4766, 581, 689, 2030, 4669, 1029, 13, 285, 4508, 689, 1052, 8442, 15, 831, 369, 3663, 672, 253, 36368, 369, 11069, 407, 27108, 275, 31039, 15, 187, 8389, 28137, 14884, 48194, 2200, 275, 3978, 32789, 11918, 26378, 7335, 1370, 9562, 15, 187, 187, 4941, 2490, 187, 1413, 27, 1093, 2693, 10782, 187, 1413, 27, 1093, 1438, 8923, 187, 1413, 27, 22282, 273, 253, 1457, 12123, 37558, 6456, 187, 1413, 27, 746, 394, 14, 9888, 1457, 12123, 38446, 187, 1413, 27, 746, 394, 14, 9888, 1457, 12123, 13557, 22, 29811, 5175, 187, 187, 1552, 673, 253, 9978, 310, 247, 20310, 2106, 59, 11430, 79, 491, 16165, 11955, 13, 534, 8414 ]
. Phys. [**43**]{}. 3892 (1965). G. Parisi and B. Seoane, Phys. Rev. E [**89**]{}, 022309 (2014). W. Selke, Eur. Phys. J. B [**51**]{}, 223 (2006). W. Selke, J. Stat. Mech. P04008 (2007). W. Selke and L. N. Shchur, Phys. Rev. E [**80**]{}, 042104 (2009). J. Salas and A. D. Sokal, J. Stat. Phys. [**98**]{}, 551 (2000). A. M. Ferrenberg and B. H. Swendsen, Phys. Rev. Lett. [**61**]{}, 2635 (1988). D. J. Amit and V. Mart[í]{}n-Mayor, [*Field theory, the renormalization group, and critical phenomena, 3rd ed.*]{} (World Scientific, Singapore, 2005). H. G. Ballesteros, A. Cruz, L. A. Fern[á]{}ndez, V. Mart[í]{}n-Mayor, J. Pech, J. J. Ruiz-Lorenzo, A. Tarancon, P. Tellez, C. L. Ullod, and C. Ungil, Phys. Rev. B [**62**]{}, 14237 (2000). M. G. Martin and J. I. Siepmann, J. Phys. Chem. B [**102**]{}, 2569 (1998). A. K. Rappé, C. J. Casewit, K. S. Colwell, W. A. Goddard, III, and W. M. Skiff, J. Am. Chem. Soc. [**114**]{}, 10024 (1992). K. Binder and D. P. Landau, Phys. Rev. B [**30**]{}, 1477 (1984). C. Borgs and R. Kotecky, J. Stat. Phys. [**61**]{}, 79 (1990). M. E. Fisher and H. Nakanishi, J. Chem. Phys. [**75**]{}, 5857 (1981). M. Hasenbusch, Phys. Rev. B [**82**]{}, 174433 (2010). G. Kamieniarz and H. W. J. Blöte, J. Phys. A: Math. Gen. [**26**]{}, 201 (1993). E. Luijten, M. E. Fisher, and A. Z. Panagiotopoulos, Phys. Rev. Lett. [**88**]{}, 185701 (2002). M. P. Nightingale, Physica A [**83**]{}, 561 (1976). H. G. Ballesteros, L. A. Fern[á]{}ndez, V. Mart[í]{}n-Mayor, and A. M. Sudupe, Phys. Lett. B [**387**]{}, 125 (1996). 全能女王 Tech Layer is provided by templatemo and it can be used for any purpose.Robert Stokes (politician) Robert Stokes (1809 – 20 January 1880) practised briefly as an architect in England in the 1830s before emigrating to New Zealand, where he had a varied career as a land surveyor, a newspaper proprietor and latterly as a member of the New Zealand Legislative Council. The Lower Hutt suburb of Stokes Valley in New Zealand commemorates his name. Origins Stokes was born in Jamaica on 16 January 1809, the son of Robert Stokes (then chief clerk in the Post Office in Jamaica) and of Martha Frances Stokes. Architectural career Stokes registered as a probationer student of architecture at the Royal Academy Schools in January 1830, entering on the recommendation of Sir Francis Chantrey, the leading portrait sculptor of the Regency period. He had exhibited student work at the Royal Academy in the late 1820s. Admitted to full studentship in June 1830, he was awarded a silver medal that year. He appears not to have completed the usual number of years as a student, because by 1831, he had moved to Cheltenham, where the Pittville estate was under active development by its eponymous promoter, Joseph Pitt. There is some indication that Chantrey knew Pitt, and this possibly accounts for Stokes taking up work in Cheltenham. In 1832, while resident in Cheltenham, he married Margaret Pughe, daughter of the late Rev Lewis Pughe of Liverpool. Stokes worked for Pitt for a number of years, designing the Tudor Gothic-style Female Orphan Asylum in Winchcombe Street and the ornamental Pittville Gates, both of 1833, which formed part of Pitt's plan to make Winchcombe Street a 'grand entrance' route to his new estate; Stokes also worked on several of the larger private houses in Pittville. He parted company with Pitt in 1835, apparently in financial difficulties, but resided in Cheltenham a little longer. His only other recorded architectural works in England are the Gothic churches at Amberley (1836) and Oakridge (1835-1837), both in Gloucestershire. After his migration to New Zealand, he produced the design for a Wesleyan Chapel (fronted in the classical style) and mission house, built 1844 in Manners Street, Wellington. The chapel did not survive the 1848 earthquake. Career in public life in New Zealand On 10 April 1839 he approached the New Zealand Company for a position, and was attached to Mein Smith's survey staff. He sailed for New Zealand on the Cuba, arriving at Port Nicholson on 3 January 1840. During the next few months he carried out surveys in the Wellington-Hutt Valley district, where he gave his name to Stokes Valley. Early in 1842 he resigned from the Company to enter business on his own account. He was never afraid of voicing his opinion on public affairs, and his first 'letters to the editor' appeared in 1840–41, on the subject of better ways of preventing cattle straying onto cultivated land - in particular his acre near the harbour in Wellington. He was one of the co-founders of the New Zealand Spectator and Cook's Straits Guardian, and was active as a publisher of newspapers and books until at least 1865. He was appointed as a Justice of the Peace in 1861, and continued in this office until at least 1866. Stokes represented Wellington City in the Provincial Council from 1857 to 1865 and Wairarapa East from then until 1867. In 1858 he carried a Bill through the Council to establish municipal government for Wellington and, in the same year, advocated the construction of a railway across the Rimutaka Range. Although his scheme was derided at first (the line required some challenging inclines), Stokes continued his agitation. In 1863 he induced the Council to agree to accept Robert Mudge Marchant's tender to build the first 18 miles of the line for £150,000, but the deal fell through. Four years later Stokes endeavoured to revive the project, but nothing was done until Vogel incorporated it in his public works scheme of the early 1870s. Stokes was summoned to the New Zealand Legislative Council in 1862, serving from 12 July 1862 to 24 September 1879 when he was disqualified for absence (he had returned to England in poor health). From 1871 to 1878 he was a member of the Senate of the University of New Zealand. In the Legislative Council he became well known for his forthright opinions on the major political issues of the day. Notwithstanding his extensive interests in Hawke's Bay, Stokes continued to reside in Wellington. He was one of the Commissioners for the Wellington City Reserves in 1862. He was also active in church affairs, serving for a time as a lay member of the Synod of the Diocese of Wellington. Throughout his life he gave much encouragement to agriculture and by 1842 and for some years after, was treasurer of the Wellington Horticultural and Botanical Society. His first wife Margaret died after a long illness at Te Aro on 1 August 1852. Return to England In 1878, in his late sixties, he returned to England, and on 19 September that year married Jane Rutherford, daughter of the late John Rutherford of Aberdeen, at St Mary Abbots, Kensington, London. He died at his London residence, 1 Clanricarde Gardens, Bayswater on 20 January 1880, having been in failing health due to cancer for several years, and was buried in Kensal Green cemetery. He left no family; his estate consisted mainly of his New Zealand properties (nearly 30,000 acres), held jointly with his brother Dr John Milbourne Stokes, who also died in 1880 (John had come to New Zealand as a surgeon on the Aurora in 1840). Three-sevenths of the estate went to his widow Jane, and John's four-sevenths went to 13 charitable institutions in England and Napier, New Zealand. In 1889-90 his widow presented a large stained-glass window in Stokes's memory to the chancel of Napier cathedral; designed by Nathaniel Westlake, it was described at the time as "the largest and finest window of the kind in the southern Colonies, covering five lancets", the middle one over 25 feet high, and containing over 200 figures. This was lost when the cathedral was destroyed by earthquake in 1931. His widow Jane remarried in June 1890 Captain Ralph Slazenger. References Category:1809 births Category:1880 deaths Category:Members of the New Zealand Legislative Council Category:19th-century New Zealand architects Category:19th-century New Zealand politicians5 Bomb testing This time the setup is a Mach−Zehnder interferometer, which consists
[ 393, 69, 3822, 61, 187, 61, 187, 187, 13811, 19, 15, 33115, 9143, 273, 1524, 2969, 10615, 21360, 7444, 187, 187, 688, 436, 2593, 359, 403, 1469, 281, 1263, 253, 33478, 273, 1524, 4948, 273, 2969, 10615, 21360, 15, 380, 9162, 273, 1524, 33478, 369, 2797, 275, 905, 2775, 696, 407, 3082, 273, 391, 14, 2056, 5395, 15, 496, 776, 2929, 359, 30215, 253, 5231, 273, 39778, 327, 253, 2570, 33478, 15, 831, 13276, 441, 281, 15313, 253, 2605, 273, 1524, 33478, 15, 844, 671, 30215, 512, 370, 324, 2911, 25168, 4948, 370, 50, 5, 327, 253, 4021, 669, 69, 51, 5, 824, 326, 669, 72, 51, 5, 310, 271, 29436, 24822, 342, 1675, 281, 370, 50, 1352, 187, 187, 1147, 310, 973, 1929, 326, 1046, 1524, 2969, 10615, 8697, 310, 25783, 281, 247, 1524, 830, 273, 2969, 2570, 10615, 8697, 390, 556, 253, 2570, 2605, 905, 24859, 5290, 905, 6435, 4207, 380, 2022, 380, 28657, 273, 253, 2593, 403, 6899, 374, 15, 19, 313, 5045, 273, 1524, 4948, 10, 285, 6899, 374, 15, 20, 313, 5045, 273, 21360, 342, 2570, 5289, 481, 187, 187, 1466, 669, 72, 5, 320, 247, 2969, 10615, 8697, 689, 253, 1673, 669, 36, 5, 285, 669, 72, 51, 5, 310, 253, 1524, 830, 273, 669, 72, 1352, 44092, 407, 669, 40, 22969, 18, 1337, 82, 1163, 393, 82, 63, 19, 30, 18, 10952, 253, 49468, 1387, 669, 36, 6602, 51, 1352, 1707, 4961, 247, 3300, 40511, 2250, 273, 669, 40, 5, 275, 669, 72, 5, 824, 326, 669, 72, 51, 426, 393, 72, 2850, 40, 1352, 187, 187, 8497, 326, 604, 9722, 72, 64, 18, 1035, 51, 10853, 72, 64, 19, 1035, 51, 10853, 69, 51, 10, 370, 310, 247, 3083, 249, 16260, 689, 669, 51, 1366, 840, 253, 21360, 669, 72, 64, 18, 426, 393, 72, 64, 18, 1035, 51, 1572, 5786, 61, 36, 1366, 669, 72, 64, 19, 426, 393, 72, 64, 19, 1035, 51, 1572, 5786, 61, 36, 1366, 669, 69, 426, 393, 69, 51, 61, 5786, 61, 36, 5, 830, 247, 3083, 249, 16260, 689, 669, 36, 1352, 496, 253, 1083, 669, 72, 2029, 72, 64, 18, 5, 359, 452, 669, 72, 14030, 859, 2029, 69, 1366, 835, 669, 859, 5, 310, 25783, 281, 2570, 27442, 2317, 669, 72, 1035, 36, 10, 3503, 1352, 380, 49468, 1387, 6993, 327, 1016, 273, 436, 21360, 285, 669, 72, 51, 2029, 72, 2850, 40, 1366, 669, 859, 1035, 51, 7182, 859, 2850, 40, 1366, 669, 69, 51, 2029, 69, 2850, 40, 43638, 187, 1231, 3091, 9173, 407, 669, 77, 82, 5, 253, 1021, 1075, 273, 669, 82, 5, 327, 669, 69, 43638, 187, 13811, 35439, 374, 15, 18, 7444, 15, 1281, 669, 2162, 5, 320, 247, 669, 36, 2911, 8172, 3711, 273, 247, 2570, 2969, 10615, 8697, 669, 72, 5, 14127, 9793, 89, 1337, 2162, 9, 90, 9102, 426, 393, 2162, 8850, 89, 13, 90, 62, 1009, 323, 512, 370, 89, 13, 90, 61, 249, 61, 72, 1352, 2635, 669, 2162, 5, 310, 247, 13434, 3711, 313, 74, 15, 70, 15, 1202, 2162, 9, 90, 7182, 620, 340, 5, 323, 512, 370, 90, 61, 249, 61, 72, 14553, 61, 187, 13811, 19545, 7444, 15, 1707, 4961, 271, 9216, 11000, 669, 2162, 9, 87, 7182, 2260, 9, 87, 3822, 2635, 669, 2162, 544, 89, 13, 87, 18772, 544, 89, 13, 393, 2162, 9, 87, 9102, 20879, 89, 1337, 2260, 362, 62, 2029, 2260, 60, 89, 13, 87, 20481, 733, 3637, 326, 9793, 89, 13, 87, 8795, 403, 671, 253, 48670, 323, 512, 370, 89, 61, 249, 393, 72, 1352, 2635, 9793, 89, 64, 18, 5709, 5589, 544, 89, 64, 76, 13, 87, 9955, 5589, 24254, 403, 48670, 323, 512, 370, 89, 64, 18, 1337, 5589, 1157, 89, 64, 76, 5, 275, 669, 72, 1352, 844, 6983, 326, 669, 72, 5, 310, 247, 2969, 10615, 8697, 15, 7757, 669, 2162, 9, 90, 7182, 2260, 340, 1352, 669, 7536, 1202, 187, 13811, 28892, 374, 15, 19, 7444, 15, 1281, 9722, 72, 51, 13, 411, 1035, 51, 10853, 69, 51, 5, 320, 247, 3083, 249, 16260, 323, 247, 1524, 830, 669, 72, 51, 5, 273, 247, 2969, 2570, 10615, 8697, 669, 72, 43638, 187, 18, 10, 1707, 2226, 253, 3300, 40511, 2250, 273, 669, 40, 5, 275, 370, 34, 9, 36, 1009, 824, 13, 326, 370, 1743, 82, 1603, 89, 61, 5786, 247, 4010, 26637, 82, 94, 89, 61, 5786, 1743, 82, 94, 66, 5, 1157, 835, 370, 1269, 61, 5786, 247, 61, 249, 393, 69, 2029, 72, 61, 5786, 329, 1035, 36, 1009, 7405, 187, 19, 10, 380, 4021, 669, 69, 51, 5, 310, 25783, 281, 669, 72, 51, 61, 5786, 329, 1035, 51, 4244, 835, 370, 34, 1035, 51, 1009, 261, 581, 273, 253, 21360, 370, 34, 64, 74, 1035, 51, 4244, 370, 74, 30, 18, 13, 19, 13, 20, 5, 7405, 187, 20, 10, 1281, 370, 1165, 2253, 51, 1035, 3830, 13, 393, 3830, 1009, 320, 1327, 42822, 13, 370, 324, 2911, 25168, 830, 327, 669, 69, 51, 5, 824, 326, 669, 72, 51, 5, 310, 271, 29436, 24822, 342, 1675, 281, 370, 50, 64, 51, 1352, 1281, 370, 44, 2253, 51, 1035, 3830, 1337, 3830, 1009, 320, 247, 43779, 830, 323, 669, 72, 51, 1352, 2635, 370, 50, 2253, 51, 9, 66, 12, 67, 43, 13, 247, 30636, 67, 8, 43, 10, 426, 393, 3023, 9, 44, 2253, 51, 9, 66, 13, 67, 3401, 12, 44, 64, 51, 9, 67, 13, 66, 3401, 45206, 835, 669, 3023, 393, 249, 61, 51, 1366, 370, 43, 5, 310, 271, 2460, 273, 246, 275, 370, 34, 64, 74, 1035, 51, 1009, 323, 370, 74, 30, 18, 13, 19, 5, 285, 370, 43, 63, 19, 11468, 18, 5, 275, 370, 34, 64, 20, 1035, 51, 7182, 36, 43638, 187, 13811, 19545, 7444, 15, 4794, 281, 6899, 337, 15, 18, 13, 253, 2570, 4021, 669, 69, 5, 310, 25783, 281, 669, 72, 61, 5786, 329, 1035, 36, 4244, 835, 370, 34, 1035, 36, 4010, 34, 64, 18, 1035, 36, 1009, 390, 370, 34, 1035, 36, 4010, 329, 64, 19, 1035, 36, 3822, 44092, 407, 370, 75, 5, 253, 2460, 273, 370, 85, 5, 275, 370, 34, 64, 74, 1035, 36, 3822, 2635, 3318, 69, 22969, 89, 12, 90, 75, 61, 1748, 1269, 13, 90, 61, 249, 61, 72, 61, 2138, 285, 370, 75, 63, 19, 426, 470, 5, 390, 370, 75, 63, 19, 2029, 1124, 92, 18, 1217, 21, 3363, 5863, 281, 5426, 13, 2367, 77, 19084, 1269, 94, 426, 1926, 19084, 1269, 3363, 1707, 2226, 253, 669, 36, 2911, 8172, 8115, 669, 2162, 5, 285, 669, 4144, 5, 824, 326, 2367, 77, 19084, 9, 90, 75, 3117, 426, 393, 2162, 5716, 19084, 340, 2311, 559, 393, 4144, 5716, 19084, 340, 2311, 75, 1352, 11680, 16207, 77, 19084, 8850, 89, 13, 90, 75, 62, 3117, 426, 464, 77, 19084, 8850, 89, 13, 90, 62, 75, 3117, 426, 393, 2162, 5716, 19084, 544, 89, 13, 90, 62, 2311, 559, 393, 4144, 5716, 19084, 544, 89, 13, 90, 62, 2311, 75, 4700, 1623, 253, 643, 1133, 16207, 77, 19084, 8850, 89, 13, 90, 75, 62, 3117, 426, 544, 464, 19084, 1269, 24768, 77, 19084, 9, 90, 75, 9102, 94, 426, 209, 187, 34758, 19084, 1269, 5548, 2162, 5716, 19084, 340, 2311, 62, 559, 544, 464, 19084, 1269, 2023, 393, 4144, 5716, 19084, 340, 2311, 62, 75, 1890, 3813, 9793, 89, 1337, 2162, 9, 90, 9102, 426, 393, 2162, 8850, 89, 13, 90, 62, 1009, 285, 9793, 89, 1337, 4144, 9, 90, 9102, 426, 393, 4144, 8850, 89, 13, 90, 62, 3822, 4794, 281, 8755, 374, 15, 18, 13, 669, 2162, 9, 90, 7182, 620, 340, 5, 285, 669, 4144, 9, 90, 7182, 1906, 340, 1352, 44092, 407, 370, 43, 5, 253, 3284, 669, 620, 2766, 1906, 480, 5, 275, 370, 34, 1035, 36, 3822, 844, 452, 16207, 77, 19084, 9, 90, 75, 32845, 1926, 19084, 9, 90, 3117, 43, 61, 43913, 313, 19, 15, 18, 11189, 1198, 1046, 767, 3603, 370, 90, 13, 340, 11671, 249, 61, 72, 5, 627, 2186, 16207, 77, 19084, 8850, 90, 75, 13, 340, 8, 75, 62, 3117, 426, 1926, 77, 19084, 8850, 90, 13, 340, 6038, 75, 63, 19, 3117, 426, 480, 63, 19, 464, 19084, 8850, 90, 13, 90, 6038, 3117, 426, 209, 187, 75, 63, 19, 34758, 19084, 340, 2023, 1926, 19084, 340, 8, 12084, 1890, 1623, 253, 643, 1133, 13, 16207, 77, 19084, 8850, 90, 75, 13, 340, 8, 75, 62, 3117, 426, 544, 464, 77, 19084, 313, 90, 75, 22058, 1926, 77, 19084, 313, 90, 8, 75, 3117, 62, 426, 209, 187, 34758, 19084, 340, 94, 43, 13, 1926, 19084, 340, 13995, 43, 62, 426, 500, 63, 19, 34758, 19084, 340, 2023, 1926, 19084, 340, 8, 12084, 1890, 844, 452, 3318, 43, 63, 19, 426, 480, 63, 19, 393, 43913, 313, 19, 15, 19, 11189, 380, 1563, 1264, 1083, 1379, 1659, 4880, 187, 11247, 337, 15, 370, 34, 1035, 36, 10, 426, 329, 64, 18, 1035, 36, 3822, 3932, 370, 75, 63, 19, 30, 17, 5, 840, 370, 43, 63, 19, 30, 17, 1352, 7757, 13, 669, 620, 30, 17, 5, 285, 370, 43, 426, 393, 78, 480, 1352, 4974, 5157, 436, 275, 313, 19, 15, 18, 10, 16207, 77, 19084, 313, 90, 75, 3117, 426, 393, 1906, 5716, 19084, 340, 2311, 75, 1890, 380, 669, 77, 82, 63, 19, 426, 337, 5, 8018, 370, 393, 4862, 464, 1906, 94, 393, 1906, 426, 18, 1352, 1707, 4961, 669, 3023, 61, 249, 61, 36, 5, 824, 326, 669, 1906, 2029, 4862, 464, 3023, 11444, 18, 889, 3023, 1352, 44092, 370, 43, 64, 18, 2029, 3023, 480, 1352, 844, 452, 16207, 77, 19084, 9, 90, 43, 64, 18, 3117, 426, 1926, 77, 19084, 9, 90, 61, 3023, 480, 3117, 426, 393, 4862, 464, 3023, 10791, 19084, 340, 8395, 1906, 480, 426, 1926, 19084, 340, 889, 3023, 480, 187, 30, 1926, 19084, 340, 94, 500, 64, 18, 1890, 6000, 3284, 275, 669, 69, 5, 452, 253, 830, 370, 89, 12, 90, 43, 64, 18, 1366, 370, 43, 64, 18, 63, 19, 30, 17, 1352, 380, 3284, 310, 669, 77, 82, 2911, 25168, 604, 285, 760, 604, 2367, 19084, 1269, 94, 426, 1269, 5, 285, 2367, 19084, 340, 94, 426, 340, 1352, 2635, 669, 69, 51, 426, 393, 69, 1743, 4220, 94, 426, 393, 72, 51, 2766, 72, 51, 500, 64, 18, 426, 393, 72, 51, 61, 5786, 329, 64, 18, 1035, 51, 3822, 10498, 374, 15, 370, 75, 63, 19, 2029, 1124, 92, 18, 1217, 21, 3303, 370, 43, 30, 75, 1352, 2635, 2367, 77, 19084, 313, 90, 75, 32845, 1926, 19084, 340, 94, 75, 5, 285, 2367, 77, 19084, 313, 89, 12, 90, 75, 3117, 426, 1926, 19084, 1269, 94, 559, 1926, 19084, 340, 94, 75, 1352, 3813, 13, 669, 69, 51, 426, 393, 69, 1743, 4220, 94, 426, 393, 72, 51, 2766, 72, 51, 480, 426, 393, 72, 51, 61, 5786, 329, 64, 19, 1035, 51, 3822, 61, 187, 11247, 495, 15, 370, 75, 63, 19, 2029, 1124, 92, 18, 1217, 21, 3303, 370, 43, 30, 428, 75, 1352, 2635, 2367, 77, 19084, 313, 90, 75, 32845, 428, 464, 19084, 340, 94, 75, 5, 285, 2367, 77, 19084, 313, 89, 12, 90, 75, 3117, 426, 1926, 19084, 1269, 94, 428, 1926, 19084, 340, 94, 75, 1352, 3813, 13, 669, 69, 51, 426, 393, 69, 1743, 4220, 94, 426, 393, 72, 51, 2766, 72, 51, 891, 75, 426, 393, 72, 1352, 831, 19539, 253, 7234, 337, 10, 285, 374, 10, 273, 253, 6899, 15, 187, 187, 1466, 370, 1165, 2253, 51, 1035, 3830, 13, 393, 3830, 1009, 320, 1327, 42822, 13, 370, 324, 2911, 25168, 830, 327, 669, 69, 51, 5, 824, 326, 669, 72, 51, 5, 310, 271, 29436, 24822, 342, 1675, 281, 370, 50, 2253, 51, 1352, 844, 9017, 370, 50, 2253, 51, 5, 327, 669, 69, 5, 285, 755, 253, 830, 370, 50, 1366, 14127, 253, 2515, 273, 253, 374, 10, 432, 6899, 337, 15, 18, 15, 1198, 253, 3603, 370, 66, 13, 67, 13, 66, 1383, 67, 11671, 249, 393, 72, 51, 5, 359, 452, 3318, 50, 2253, 51, 9, 66, 12, 35744, 13, 247, 30636, 67, 8, 75, 10, 426, 393, 2260, 9, 44, 9, 66, 13, 67, 3401, 12, 44, 9, 67, 13, 66, 3401 ]
\d)$.\ \ [**2. Doubles of real simple Lie algebras**]{} In this section we are going to study the doubles of real forms of simple Lie algebras. The classification of real doubles was obtained in \[CH\] by methods of r-matrices. In our paper we classify the actions of conjugation on the complex doubles. This enables us to derive the structure of real doubles. We also classify all $ad$-invariant forms $Q$ on the double $\dR$ such that $\gR$ is an isotropic subspace with respect to $Q$. It is well known that every real simple Lie algebra is isomorphic to a real form of simple complex Lie algebra or has the complex structure \[VO\], \[GG\]. The main Theorems of the section are Theorem 2.2 (case of real forms) and Theorem 2.3 (case of algebras with complex structures). Let $\g$ be a simple Lie algebra over the field $\C$ and $\gR$ is the real form of $\g$. Denote by $\G=\{1,\q : \q^2=1\}$ the Galois group $\C/\R$. There exists a semilinear action of $\G$ in $\g$ such that $\gR = \g^\G$. Note that if $(\g_1(\R),\g_2(\R),\dR) $ is a Manin triple over $\R$, then the algebras $\g_1 = \g_1(\R)\otimes\C$, $\g_2 = \g_2(\R)\otimes\C$, $\d = \dR\otimes\C$ form a Manin triple over $\C$. In the case $\g=\g_1$ we have $\g +\ss=\d$, where $\ss$ is isomorphic to complex conjugate space $\g(\C)^*$. The Galois group acts on each of this algebras and $\gR=\g^\G$, $\ss(\R)=\ss^\G$, $\dR=\d^\G$.\ We shall denote by $\lq$ the extention of $\q$ on $\d$.\ [**Lemma 2.1**]{}. Let $\phi$ be a $\C$-linear map of a complex simple Lie algebra $\g$ satisfying $[x,\phi(y)] = \phi([x,y])$ for all $x,y\in\g$. Then $\phi$ is a scalar map (i.e.$\phi(y)=\ll y$ for all $y\in\g$).\ [**Proof**]{}. There exists an eigenvector $\phi(v)=\lambda(v)$. Then $\phi [x,v]= [x, \phi(v)]=[x,\lambda v]=\lambda[x,v]$. It follows that $[x,v]$ are also the eigenvectors for all $x\in \g$. Then $[x_1[\ldots [x_k,v]\ldots ]$ are eigenvectors for all $x_1,\ldots ,x_k$ in $\g$. We recall that $\g$ is a simple Lie algebra. Hence $\phi(y)=\lambda y$. $\Box$\ [**Theorem 2.2**]{}. Let $(\gR, W(\R),\dR$ be a Manin triple for a real form $\gR$ of a simple complex Lie algebra $\g$.\ 1) There exist the semilinear action of $\G$ in $A(C)$ such, that $^{\q}(x\otimes a)= ^{\q}x\otimes^{\q}a$ , where $ x\otimes a\in \d=\g\otimes A(\C)$;\ 2) The double $\dR$ is isomorphic to $\gR\otimes A(\R)$, where $A(\R)$is one of the algebras $A_i(\R)$, $i=1,2,3$;\ 3) Let $ Q_\R(\cdot, \cdot)$ be nondegenerate, $ad$-invariant form on $\dR$ such that $\gR$ is an isotropic subspace with respect to $Q_R$. Let $K_\R(\cdot,\cdot)$ be a Killing form for $\gR$. Then $Q_\R(a+bJ, a'+b'J) = \nu(K_\R(a,b')+K_R(b,a')),$ where $\nu \in\R$, $J$ is an image of t in $A_i(\R)$ for $i=1,2$ and $J^2=-1$ in $A_3(\R)=\C$.\ [**Proof**]{}. According to Theorem 1.1, the complex double $\d$ is isomorphic to $\g\otimes A(\C)$, where $A(\C)=A_1(\C)$ or $A(\C)= A_2(\C)$. Denote by $j$ the image of $t$ in $A_i(\C)$. Then $$d=\{x+yj\vert x,y\in\g\}$$ and $j^2 = 0$ or $j^2=\frac{1}{4}$. Up to definition, ${\lqq x} = {\qq x}$. There exist the $\C$-linear maps $\phi$ and $\psi$ such that ${\lqq(yj)} = \phi({\qq y}) + \psi({\qq y})j$. Consider $${\lqq([x,yj])} ={\lqq([x,y]j)} = \phi({\qq [x,y]}) + \psi({\qq [x,y]})j.$$ On the other hand $${\lqq([x,yj])} = [{\qq x},{\lqq(yj)]} = [{\qq x},\phi({\qq y})] + [{\qq x}, \psi({\qq y})]j$$ Therefore $[x,\phi(y)] = \phi([x,y])$ and $[x,\psi(y)] = \psi([x,y])$. According to Lemma 2.1, $\phi(y)=\ll y$ and $\psi(y)=\mu y$. Denote by $J$ the element $\ll+\mu j$ in $A(\C)$. We have $${\lqq(yj)}= {\qq(y)}J\eqno (2.1)$$ For every two elements $y, y'\in\g$ there hold $${\lqq([yj, y'j])} = {\lqq([y, y']j^2)} = j^2{\qq([y,y'])} = j^2[{\qq y}, {\qq y'}]$$ On the other hand, $${\lqq([yj, y'j])} = [{\lqq (yj)}, {\lqq (y'j)}] = [{\qq y}J, {\qq y'}J] = J^2[{\qq y}, {\qq y'}]$$ We have $$J^2 = j^2 \eqno (2.2)$$ The following three case take place.\ Case 1. $A(\C) = A_1(\C)$. Since $j^2=0$ then $J^2=0$. Hence, $\ll=0$ and $J = \m j$. Substitute this in (2.1) $${\lqq (yj)} = \mu({\qq y})j$$ The $\lq^2 = 1$ implies $ \overline{\mu} \mu =1$. There exists $\nu\in\C$ such that $\mu=\overline{\nu}^{-1}\nu$. Denote $J_1=\nu j$. We have $${\lqq(yJ_1)} = {\lqq(y\nu j)} = \overline{\nu}({\qq y})\mu j = {\qq y}\nu j = {\qq y} J_1$$ Every element in $\d$ have the form $x+yJ_1$, $J_1^2=0$. The element is $\lq$-invariant if and only if ${\qq x} = x$ and ${\qq y} = y$. Then $\dR = \d^{\Gamma} = \gR+\gR J_1 = \gR\otimes A_1(\R)$. Case 2. $j^2=\frac{1}{4}$, $J=j$. Then ${\lqq (yj)}= {\qq y}j$ and ${\lqq (x+yj)} = {\qq x} + {\qq y}j$. Therefore, $\dR = \d^{\Gamma} = \gR+\gR j = \gR\otimes A_2(\R)$.\ Case 3. $j^2=\frac{1}{4}$, $J= -j$. Then ${\lqq (yj)}= -{\qq y}j$ and ${\lqq (x+yj)} = {\qq x} - {\qq y}j$. Therefore, $\dR = \d^{\Gamma} = \gR+\gR ij = \g$. This proves the statements 1) and 2) of the Theorem. Let $ Q_\R(\cdot, \cdot)$ be nondegenerate, $ad$-invariant form on $\dR$ such that $\gR$ is an isotropic subspace with respect to $Q_\R$. We extend $Q_\R$ on $\d$ and get the form $Q$, satisfying the conditions of the 2) from Theorem 1.1. For the elements $a,b,a',b'\in \gR$ we have $$Q_\R(a+bj, a'+b'j) = \lambda(K(a,b')+K(b,a')
[ 71, 426, 1527, 9, 2808, 64, 16983, 13, 1527, 64, 9561, 10, 187, 50270, 7271, 27, 187, 50266, 1286, 3333, 71, 426, 8256, 187, 50270, 5478, 64, 2606, 426, 36743, 15, 2666, 5023, 1344, 48937, 2073, 6, 41, 27976, 46, 27976, 52, 327, 2462, 69, 2462, 67, 2462, 58, 3401, 187, 50270, 1286, 15, 6343, 2073, 6800, 3390, 3053, 387, 2462, 84, 61, 79, 8, 2462, 1265, 64, 2606, 10, 187, 50270, 1286, 15, 6343, 2073, 50, 2267, 5288, 2715, 27, 2462, 84, 61, 79, 61, 79, 8, 2462, 755, 64, 33980, 553, 64, 17921, 64, 4149, 6649, 187, 50270, 1286, 15, 6343, 37908, 553, 6155, 9, 33980, 553, 64, 5397, 10, 187, 50270, 1286, 15, 6343, 18246, 9, 12928, 10, 535, 50274, 1545, 3630, 9, 1286, 13, 256, 2262, 187, 50270, 338, 1881, 3333, 71, 27, 187, 50266, 1286, 3333, 71, 15, 6343, 9, 84, 10, 187, 50266, 4, 2884, 2345, 1060, 594, 4212, 476, 923, 752, 3213, 597, 1472, 187, 50266, 4, 327, 846, 1016, 3630, 13, 1580, 690, 5018, 476, 1379, 187, 50266, 4, 247, 1048, 673, 13, 285, 247, 4942, 1355, 2408, 273, 187, 50266, 4, 941, 310, 1146, 3542, 281, 253, 2412, 4367, 15, 187, 50266, 1286, 3333, 71, 15, 34459, 1082, 187, 50270, 7271, 27, 187, 50266, 5858, 535, 50274, 1545, 3630, 37908, 553, 6155, 9, 1286, 13, 2805, 74, 553, 64, 5397, 2262, 187, 50270, 338, 2805, 74, 553, 64, 5397, 310, 8256, 27, 187, 50266, 1286, 15, 6343, 2073, 2302, 2805, 74, 553, 3596, 2530, 4880, 79, 3401, 187, 50270, 7271, 27, 187, 50266, 1286, 15, 6343, 2073, 33980, 553, 64, 5397, 2193, 8048, 79, 3401, 187, 50266, 1542, 465, 13, 362, 275, 2805, 74, 553, 64, 5397, 15, 15565, 14850, 187, 50262, 338, 362, 27, 187, 50258, 1286, 15, 6343, 2073, 6, 84, 61, 85, 6, 84, 61, 79, 8, 2462, 313, 76, 13, 362, 1228, 187, 50266, 1286, 15, 6343, 2073, 61, 79, 3401, 535, 50274, 1545, 3630, 18246, 9, 1286, 13, 18912, 2262, 187, 50270, 338, 18912, 310, 8256, 27, 187, 50266, 1286, 15, 6343, 2073, 2302, 18912, 2530, 4880, 79, 3401, 187, 50270, 7271, 27, 187, 50266, 1286, 15, 6343, 2073, 19484, 1873, 2193, 8048, 79, 3401, 187, 50266, 1542, 465, 13, 362, 275, 18912, 15, 15565, 14850, 187, 50262, 1542, 6703, 64, 76, 13, 6703, 64, 87, 275, 362, 15, 15565, 14850, 187, 50258, 1208, 426, 6703, 64, 87, 390, 686, 5088, 8, 187, 50258, 1286, 15, 6343, 2073, 6, 84, 27976, 84, 61, 85, 6, 84, 61, 79, 8, 2462, 313, 76, 13, 6703, 64, 76, 13, 821, 1228, 187, 50266, 1286, 15, 6343, 2073, 61, 79, 3401, 535, 50274, 1545, 2810, 9, 1286, 2262, 187, 50270, 423, 64, 2606, 426, 36743, 15, 2666, 5023, 1344, 48937, 2073, 6, 41, 27976, 46, 27976, 52, 327, 2462, 69, 2462, 67, 2462, 58, 3401, 187, 50270, 1286, 15, 6343, 2073, 61, 79, 6800, 3390, 6331, 387, 2462, 84, 61, 79, 8, 2462, 990, 64, 2606, 10, 187, 50270, 338, 1881, 3333, 71, 27, 187, 50266, 1286, 3333, 71, 15, 10483, 1082, 187, 50270, 7271, 27, 187, 50266, 5858, 535, 187, 1545, 3379, 64, 44291, 9, 44291, 13, 187, 50259, 8581, 64, 11183, 64, 20104, 13, 187, 50259, 23173, 13, 187, 50259, 10483, 64, 23173, 64, 251, 64, 12566, 30, 5088, 2262, 187, 50274, 32488, 17148, 1618, 273, 13896, 281, 1408, 12251, 187, 50274, 23173, 15, 6343, 1587, 17148, 272, 13896, 760, 4880, 79, 61, 79, 2807, 187, 50274, 1542, 260, 275, 13896, 27, 187, 50270, 1542, 299, 275, 260, 27, 187, 50266, 8581, 64, 11183, 64, 20104, 30932, 6, 84, 8, 2462, 299, 60, 17, 3291, 187, 50266, 3845, 25137, 84, 8, 2462, 299, 60, 18, 62, 187, 50266, 23173, 15, 6343, 30932, 2462, 84, 3923, 61, 79, 6, 84, 61, 79, 61, 79, 8, 2462, 299, 10, 535, 187, 1545, 1067, 64, 44291, 64, 2152, 1365, 9, 44291, 13, 187, 50254, 50275, 8581, 64, 11183, 64, 20104, 13, 187, 50254, 50275, 23173, 13, 187, 50254, 50275, 10483, 64, 23173, 64, 251, 64, 12566, 30, 5088, 2262, 187, 50274, 32488, 12965, 1618, 273, 13896, 13, 581, 846, 1529, 12251, 187, 50274, 23173, 15, 6343, 1587, 12560, 9634, 13896, 4880, 79, 61, 79, 2807, 187, 50274, 1542, 260, 275, 13896, 27, 187, 50270, 1542, 299, 275, 260, 27, 187, 50266, 8581, 64, 11183, 64, 20104, 2073, 6, 84, 61, 79, 6, 84, 8, 2462, 299, 10, 187, 50266, 23173, 15, 6343, 30932, 2462, 84, 3923, 393, 79, 6, 84, 61, 79, 61, 79, 8, 2462, 299, 10, 187, 50266, 43885, 13, 331, 27429, 13, 1091, 64, 2877, 426, 2805, 74, 553, 64, 10394, 64, 4065, 9, 70, 60, 18, 3291, 187, 50266, 338, 1091, 64, 2877, 3613, 470, 27, 187, 50262, 4856, 426, 8894, 79, 61, 79, 9264, 33246, 12875, 1830, 1703, 399, 3322, 2637, 3915, 13801, 27, 2462, 84, 61, 79, 3, 2462, 299, 60, 17, 62, 14030, 187, 50258, 3, 12094, 1408, 369, 8048, 79, 2462, 84, 61, 79, 3, 2462, 299, 60, 18, 62, 14030, 187, 50258, 3, 12094, 4895, 10463, 3708, 27, 2462, 69, 61, 79, 3, 2462, 1091, 64, 2877, 14030, 187, 50258, 3, 38821, 483, 8048, 79, 6, 84, 61, 79, 998, 27429, 61, 79, 6, 84, 61, 79, 3, 2462, 313, 43885, 13, 331, 27429, 10, 187, 50262, 23173, 15, 6343, 9, 4856, 10, 187, 50262, 23173, 15, 10483, 1082, 187, 50262, 22525, 7733, 5449, 4756, 9, 4856, 10, 187, 50266, 4, 275, 253, 642, 2228, 1083, 13, 359, 3630, 13896, 8, 3453, 281, 253, 2412, 187, 50266, 4, 285, 671, 7392, 281, 436, 15613, 434, 6268, 483, 16, 35856, 187, 50266, 7271, 27, 187, 50262, 4, 3630, 6268, 483, 285, 331, 27429, 281, 2412, 1873, 187, 50262, 23173, 15, 6343, 1587, 38821, 483, 8048, 79, 6, 84, 61, 79, 998, 27429, 8048, 79, 6, 84, 61, 79, 3, 2462, 313, 43885, 13, 331, 27429, 1228, 187, 50262, 4, 3630, 6268, 483, 281, 6268, 483, 187, 50262, 338, 6268, 483, 27, 187, 50258, 3845, 6268, 483, 187, 50262, 4, 3630, 331, 27429, 281, 331, 27429, 187, 50262, 338, 331, 27429, 27, 187, 50258, 10404, 15, 35856, 15, 6343, 9, 35856, 10, 187, 50274, 338, 2810, 64, 23173, 64, 251, 64, 12566, 27, 187, 50270, 23173, 15, 10483, 1082, 535, 187, 1545, 3379, 64, 936, 64, 43885, 9, 84, 2262, 187, 50274, 3845, 256, 535, 187, 1545, 642, 64, 8581, 64, 484, 24275, 9, 84, 2262, 187, 50274, 5858, 535, 187, 1545, 755, 64, 12928, 64, 1344, 9, 12928, 2262, 187, 50274, 6870, 426, 8168, 187, 50274, 1542, 2236, 64, 301, 13, 2236, 64, 2877, 275, 18912, 15, 15565, 14850, 187, 50270, 6870, 15, 9691, 2073, 283, 6, 84, 8, 2462, 313, 3575, 64, 301, 1228, 187, 50270, 338, 2236, 64, 2877, 310, 417, 8256, 27, 187, 50266, 6870, 15, 9691, 9, 3575, 64, 2877, 10, 187, 50274, 2309, 686, 29996, 13956, 9, 6870, 10, 535, 187, 1545, 17813, 64, 395, 64, 1178, 64, 44144, 64, 936, 64, 5478, 9, 12928, 13, 187, 50254, 50270, 50276, 7375, 64, 936, 64, 5478, 13, 187, 50254, 50270, 50276, 4284, 64, 44144, 64, 936, 64, 5478, 13, 187, 50254, 50270, 50276, 7529, 13, 187, 50254, 50270, 50276, 4500, 64, 20154, 2262, 187, 50274, 338, 313, 44144, 64, 936, 64, 5478, 3613, 540, 9, 6986, 64, 44144, 64, 936, 64, 5478, 1228, 285, 393, 187, 50271, 1439, 7529, 27, 187, 50270, 7872, 64, 20154, 15, 3775, 1587, 12161, 272, 428, 48, 4419, 326, 428, 66, 310, 671, 4817, 25107, 187, 50274, 12928, 5013, 19783, 34368, 44144, 64, 936, 64, 5478, 6038, 426, 1213, 9, 44144, 64, 936, 64, 5478, 10, 535, 187, 1545, 2412, 64, 5423, 64, 6535, 22, 84, 9, 23173, 13, 269, 793, 2262, 187, 50274, 23173, 15, 6343, 1587, 8982, 1873, 31934, 22, 22661, 8048, 79, 2807, 187, 50274, 1542, 44296, 275, 269, 793, 27, 187, 50270, 338, 44296, 310, 417, 8256, 27, 187, 50266, 23173, 15, 6343, 22219, 84, 27, 2462, 84, 61, 79, 3, 2462, 313, 16983, 13, 4999, 64, 6535, 22, 9, 5758, 9, 16983, 5029, 15741, 49534, 32875, 187, 50274, 23173, 15, 6343, 30094, 79, 2807, 187, 14214, 1712, 4538, 18, 94, 187, 7770, 187, 187, 1909, 247, 1846, 8984, 273, 253, 11900, 985, 13, 253, 11891, 2281, 273, 37534, 4600, 1049, 21254, 313, 2697, 34, 10, 285, 697, 10552, 275, 253, 2087, 3072, 310, 1698, 1254, 1311, 18, 1092, 1008, 1311, 19, 1656, 6676, 1363, 9958, 432, 473, 4576, 452, 417, 644, 16747, 11245, 285, 4127, 1254, 1311, 20, 7254, 1311, 22, 1656, 380, 1655, 3082, 323, 473, 4576, 6120, 403, 3240, 3710, 13, 285, 7194, 7024, 327, 13463, 23567, 297, 79, 3756, 281, 2557, 253, 1049, 21254, 14, 1994, 9576, 21254, 3605, 313, 17162, 42, 481, 35412, 6433, 452, 12497, 5657, 281, 7472, 473, 4576, 762, 31582, 1617, 15, 2091, 20462, 247, 32339, 1971, 323, 1363, 13, 824, 347, 247, 5869, 13, 581, 3198, 24542, 3082, 281, 3283, 697, 12510, 1078, 9591, 824, 247, 1971, 15, 8710, 6979, 310, 581, 273, 253, 954, 3576, 5609, 281, 10018, 253, 869, 1371, 273, 253, 5170, 23024, 313, 25588, 481, 1723, 13, 1955, 281, 12748, 275, 1481, 285, 7623, 6979, 762, 4600, 1617, 13, 285, 253, 1781, 3064, 275, 530, 34, 869, 1371, 875, 1146, 22238, 285, 17390, 1254, 1311, 23, 1092, 1008, 1311, 24, 5413, 4390, 3739, 6979, 476, 760, 2085, 1077, 3710, 1491, 323, 473, 4576, 7103, 15, 1707, 310, 642, 1332, 326, 476, 3283, 1880, 390, 762, 752, 1617, 3500, 412, 21254, 13, 1014, 473, 4576, 13, 588, 2826, 1309, 4600, 323, 4292, 1754, 327, 24542, 3602, 4080, 762, 31582, 1617, 15, 1310, 581, 476, 1089, 824, 3602, 390, 28308, 326, 476, 320, 4080, 762, 31582, 1617, 13, 352, 588, 320, 247, 1270, 1361, 323, 473, 4576, 9273, 390, 253, 20462, 273, 32339, 9694, 949, 24542, 638, 14, 15419, 12542, 327, 1971, 6973, 15, 187, 187, 25588, 310, 253, 5048, 281, 6186, 7768, 281, 253, 1966, 2133, 15, 1916, 2085, 2217, 7768, 323, 15384, 285, 7944, 13, 247, 2176, 2329, 8868, 310, 3058, 1309, 14578, 15, 4325, 253, 13424, 285, 8651, 2792, 273, 1859, 13, 253, 5052, 273, 530, 34, 7052, 7024, 327, 530, 34, 12087, 1254, 1311, 25, 1092, 1008, 1311, 26, 1656, 530, 34, 5052, 588, 2572, 342, 253, 23024, 13551, 15, 2091, 530, 34, 310, 1512, 6891, 281, 1581, 2217, 2329, 10056, 13, 3500, 412, 21254, 588, 2826, 15, 1198, 271, 2329, 16583, 342, 12848, 2831, 14, 20382, 2170, 13, 253, 6891, 383, 629, 17904, 253, 954, 281, 2685, 5052, 15, 3813, 13, 253, 6891, 383, 2831, 14, 20382, 2170, 273, 530, 34, 313, 36, 4576, 14, 25588, 10, 310, 247, 2442, 4764, 281, 17710, 530, 34, 13576, 15, 187, 187, 8430, 253, 3242, 7887, 1318, 273, 330, 4576, 14, 25588, 778, 6889, 2190, 4292, 13, 581, 4086, 310, 2590, 27, 281, 2085, 15384, 342, 4209, 7768, 13, 330, 4576, 14, 25588, 1364, 417, 320, 4577, 685, 247, 4619, 1318, 275, 1340, 281, 6558, 2622, 14578, 15, 330, 4576, 14, 25588, 310, 8244, 2905, 281, 253, 5743, 273, 815, 28643, 7425, 1080, 13370, 15, 11709, 452, 4950, 326, 1223, 22238, 13, 8655, 7425, 1080, 6616, 1396, 569, 476, 6558, 253, 23024, 1979, 323, 2622, 14578, 15, 380, 6616, 1396, 569, 275, 473, 4576, 1363, 403, 1199, 10046, 685, 1110, 323, 5875, 952, 762, 31582, 1617, 984, 253, 16864, 530, 34, 310, 39937, 275, 1363, 1254, 1311, 740, 7254, 1311, 1047, 1656, 1723, 13, 436, 3745, 273, 730, 74, 11816, 1730, 316, 387, 37527, 588, 8127, 320, 3663, 1309, 4600, 1254, 1311, 1010, 1092, 1008, 1311, 1036, 1656, 12414, 253, 1361, 273, 2266, 6616, 1396, 569, 13, 253, 3402, 273, 530, 34, 2550, 32385, 253, 4016, 3473, 1309, 17006, 13, 285, 530, 34, 588, 13551, 15, 1310, 530, 34, 4916, 1512, 6891, 13, 3500, 412, 21254, 390, 1014, 1049, 21254, 588, 2826, 15, 10635, 327, 253, 1840, 7313, 13, 359, 12661, 247, 747, 4473, 2905, 281, 330, 4576, 14, 25588, 27, 253, 7887, 273, 253, 2170, 323, 3500, 412, 21254, 11653, 313, 7656, 23435, 481, 1198, 1016, 2060, 13, 627, 310, 247, 3367, 7887, 1318, 273, 330, 4576, 14, 25588, 15, 7243, 330, 4576, 14, 25588, 310, 2708, 308, 17162, 48, 1955, 281, 5075, 7425, 1080, 6616, 5743, 1309, 4600, 13, 253, 3110, 4916, 21291 ]
f = open(log_fp, open_mode) else: self._f = None start_time = datetime.now().strftime('%H:%M:%S on %d %b %Y') self.write('Logging started at %s\n' % start_time) self.write('QIIME version: %s\n\n' % get_qiime_library_version()) self.writeQiimeConfig(qiime_config) self.writeParams(params) def write(self, s): if self._f: self._f.write(s) # Flush here so users can see what step they're # on after each write, since some steps can take # a long time, and a relatively small amount of # data is being written to the log files. self._f.flush() else: pass def writeQiimeConfig(self, qiime_config): if qiime_config is None: self.write('No qiime config provided.\n') else: self.write('qiime_config values:\n') for k, v in qiime_config.items(): if v: self.write('%s\t%s\n' % (k, v)) self.write('\n') def writeParams(self, params): if params is None: self.write('No params provided.\n') else: self.write('parameter file values:\n') for k, v in params.items(): for inner_k, inner_v in v.items(): val = inner_v or 'True' self.write('%s:%s\t%s\n' % (k, inner_k, val)) self.write('\n') def close(self): end_time = datetime.now().strftime('%H:%M:%S on %d %b %Y') self.write('\nLogging stopped at %s\n' % end_time) if self._f: self._f.close() else: pass def print_commands(commands, status_update_callback, logger, close_logger_on_success=True): """Print list of commands to run """ logger.write("Printing commands only.\n\n") for c in commands: for e in c: status_update_callback('#%s' % e[0]) print '%s' % e[1] logger.write('# %s command\n%s\n\n' % e) def call_commands_serially(commands, status_update_callback, logger, close_logger_on_success=True): """Run list of commands, one after another """ logger.write("Executing commands.\n\n") for c in commands: for e in c: status_update_callback('%s\n%s' % e) logger.write('# %s command \n%s\n\n' % e) stdout, stderr, return_value = qiime_system_call(e[1]) if return_value != 0: msg = "\n\n*** ERROR RAISED DURING STEP: %s\n" % e[0] +\ "Command run was:\n %s\n" % e[1] +\ "Command returned exit status: %d\n" % return_value +\ "Stdout:\n%s\nStderr\n%s\n" % (stdout, stderr) logger.write(msg) logger.close() raise WorkflowError(msg) # in the no error case, we write commands' output to the log # and also echo to this proc's stdout/stderr else: # write stdout and stderr to log file logger.write("Stdout:\n%s\nStderr:\n%s\n" % (stdout, stderr)) # write stdout to stdout if stdout: print stdout # write stderr to stderr if stderr: sys.stderr.write(stderr) if close_logger_on_success: logger.close() def print_to_stdout(s): print s def no_status_updates(s): pass def get_params_str(params): result = [] for param_id, param_value in params.items(): result.append('--%s' % (param_id)) if param_value is not None: result.append(param_value) return ' '.join(result) def validate_and_set_jobs_to_start(params, jobs_to_start, default_jobs_to_start, parallel, option_parser): if (jobs_to_start != int(default_jobs_to_start)) and \ not parallel: option_parser.error("Passing -O requires that -a is also passed.") params['parallel']['jobs_to_start'] = str(jobs_to_start) def log_input_md5s(logger, fps): logger.write("Input file md5 sums:\n") for fp in fps: if fp is not None: logger.write("%s: %s\n" % (fp, safe_md5(open(fp)).hexdigest())) logger.write("\n") Introduction {#Sec1} ============ As a common disorder of the respiratory system, the awareness rate of obstructive sleep apnea (OSA) and its complications in the general population is low \[[@CR1], [@CR2]\]. Many patients suffering from OSA have not been clinically diagnosed and treated \[[@CR3]--[@CR5]\]. The current methods for OSA diagnosis are quite limited, and mainly depends on overnight polysomnography to measure the apnea-hypopnea index (AHI). Clinicians have insufficient tools to evaluate OSA under waking condition. When designing a personalized treatment for patients, such as a surgery, one needs credible methods to predict its effectiveness before performing such a treatment. Medical imaging is one of the most effective techniques to observe the patency of the upper airway (UA). However, due to difficulties in head and neck imaging under sleep condition, and the large difference in UA patency between being awake and asleep \[[@CR6], [@CR7]\], currently medical imaging can only provide very limited information for OSA evaluation. There is no method that can predict whether or under what condition hypopnea, even OSA, will occur during sleep for individuals based on credible parameters measured under waking condition. If one can find such parameters or indexes that can be measured under waking condition, it will be a great help for OSA screening or the designing of personalized treatments through credible pre-evaluations on treatment outcomes. UA is the channel to supply oxygen to the human body. To provide enough oxygen for organs and tissues, a certain air flux is needed during breathing. From the physiological and mechanical points of view, the resistance of UA strongly depends on UA geometry \[[@CR8], [@CR9]\]. UA resistance will increase with the airway collapse. When UA is too narrow to allow enough air passage, hypopnea will occur. For an air tunnel with varied cross-sectional area, the narrowest part contributes the most to flow resistance. Therefore, the narrowest cross-sectional area of UA (CSA-UA) is a potential parameter to characterize UA behaviors. Although the exact threshold value of CSA-UA may vary among individuals, one rule is clear: to provide organs with sufficient oxygen, CSA-UA must not be smaller than a critical value in order to maintain normal breathing. CSA-UA is closely related to the activation of pharyngeal dilator muscles. Studies have revealed that while awake, enhanced dilator muscle activations can maintain the airway size for normal breathing. The muscle activations in OSA patients are much stronger than those for healthy people under waking condition because the passive UA is narrower in patients \[[@CR10]--[@CR14]\]. However, this ability of genioglossus at daytime will largely be lost during sleep \[[@CR15], [@CR16]\]. Without the help of strong muscle activations, the wall of UA cannot withstand the negative pressure during inspiration, and UA will collapse. If UA becomes too narrow, hypopnea or even apnea will occur. Based on the above observations, we propose a new concept related to CSA-UA: the threshold of the area for hypopnea onset (TAHO). For each individual, there is a personal threshold value of CSA-UA. Once CSA-UA is below TAHO due to weak dilator muscle activation during sleep, the patient becomes prone
[ 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 44164, 483, 3, 187, 50254, 15417, 568, 13299, 3, 187, 50254, 30991, 800, 14, 1156, 568, 46780, 562, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50262, 870, 2154, 31, 187, 50266, 870, 2154, 31, 535, 50266, 29, 2154, 966, 568, 84, 392, 84, 14, 78, 14, 3956, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 89, 14, 16374, 1138, 187, 50262, 29, 73, 19, 966, 568, 84, 392, 84, 14, 1156, 14, 33049, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 28672, 1138, 187, 50258, 8880, 14, 30585, 342, 253, 654, 3211, 31, 15417, 870, 3211, 31, 11104, 873, 281, 187, 50258, 29, 3211, 31, 14224, 14, 14653, 870, 3211, 13208, 187, 50262, 870, 73, 19, 31, 535, 50262, 14219, 342, 5680, 6898, 6781, 187, 50262, 29, 2154, 966, 568, 84, 392, 84, 14, 81, 14, 16576, 64, 28672, 298, 23654, 14, 17424, 1138, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 17494, 3, 187, 50254, 15417, 568, 14224, 14, 14653, 3, 187, 50254, 30991, 800, 14, 1156, 568, 16704, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 1911, 4537, 3, 187, 50254, 15417, 568, 14224, 14, 14653, 3, 187, 50254, 30991, 800, 14, 1156, 568, 4717, 2608, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 16435, 3, 187, 50254, 15417, 568, 14224, 14, 14653, 3, 187, 50254, 30991, 800, 14, 1156, 568, 19238, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 15261, 3, 187, 50254, 15417, 568, 14224, 14, 14653, 3, 187, 50254, 30991, 800, 14, 1156, 568, 17964, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3305, 4698, 3, 187, 50254, 15417, 568, 14224, 14, 14653, 3, 187, 50254, 30991, 800, 14, 1156, 568, 12323, 4698, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 8636, 5240, 3, 187, 50254, 15417, 568, 14224, 14, 14653, 3, 187, 50254, 30991, 800, 14, 1156, 568, 46780, 275, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 44164, 483, 3, 187, 50254, 15417, 568, 14224, 14, 14653, 3, 187, 50254, 30991, 800, 14, 1156, 568, 46780, 562, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50262, 870, 2154, 31, 187, 50266, 870, 2154, 31, 535, 50266, 29, 2154, 966, 568, 84, 392, 84, 14, 78, 14, 3956, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 89, 14, 16374, 1138, 187, 50262, 29, 73, 19, 966, 568, 84, 392, 84, 14, 1156, 14, 33049, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 28672, 1138, 187, 50258, 8880, 14, 30585, 342, 253, 654, 3211, 31, 3281, 870, 3211, 31, 11104, 873, 281, 247, 187, 50258, 7210, 1318, 16616, 3211, 31, 5260, 14, 6795, 13, 1269, 14, 6795, 13, 1355, 13, 4646, 870, 3211, 37322, 187, 50262, 870, 73, 19, 31, 535, 50262, 14219, 52, 4219, 6781, 187, 50262, 29, 2154, 966, 568, 84, 392, 84, 14, 81, 14, 16576, 64, 28672, 298, 23654, 14, 17424, 1138, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 5260, 14, 6795, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 89, 14, 6795, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 6795, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 28672, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50262, 870, 2154, 31, 187, 50266, 870, 2154, 31, 535, 50266, 29, 2154, 966, 568, 84, 392, 84, 14, 78, 14, 3956, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 89, 14, 16374, 1138, 187, 50262, 29, 73, 19, 966, 568, 84, 392, 84, 14, 1156, 14, 33049, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 28672, 1138, 187, 50258, 8880, 14, 30585, 342, 253, 654, 3211, 31, 15417, 870, 3211, 31, 11104, 873, 281, 187, 50258, 29, 3211, 31, 39517, 870, 3211, 31, 285, 253, 654, 3211, 31, 3281, 870, 3211, 31, 11104, 873, 281, 187, 50258, 66, 3588, 1318, 16616, 3211, 31, 89, 14, 6795, 13, 1355, 13, 4646, 13, 1781, 870, 3211, 37322, 187, 50262, 870, 73, 19, 31, 535, 50262, 29, 2154, 966, 568, 84, 392, 84, 14, 81, 14, 16576, 64, 28672, 298, 23654, 14, 17424, 1138, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 89, 14, 6795, 3, 187, 50254, 15417, 568, 39517, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 6795, 3, 187, 50254, 15417, 568, 39517, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 28672, 3, 187, 50254, 15417, 568, 39517, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3487, 3, 187, 50254, 3281, 568, 16374, 3, 187, 50254, 15417, 568, 39517, 3, 187, 50254, 30991, 800, 14, 1156, 568, 3145, 3010, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50262, 870, 2154, 31, 187, 50266, 870, 2154, 31, 535, 50266, 29, 2154, 966, 568, 84, 392, 84, 14, 78, 14, 3956, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 89, 14, 16374, 1138, 187, 50262, 29, 73, 19, 966, 568, 84, 392, 84, 14, 1156, 14, 33049, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 28672, 1138, 187, 50258, 8880, 14, 30585, 342, 253, 654, 3211, 31, 15417, 870, 3211, 31, 11104, 873, 281, 187, 50258, 29, 3211, 31, 14224, 14, 46429, 870, 3211, 13208, 187, 50262, 870, 73, 19, 31, 187, 50262, 14219, 342, 5680, 1227, 407, 4284, 6781, 187, 50262, 29, 2154, 966, 568, 84, 392, 84, 14, 81, 14, 16576, 64, 28672, 298, 23654, 14, 17424, 14, 46429, 1138, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 17494, 3, 187, 50254, 30991, 800, 14, 1156, 568, 16704, 3, 187, 50254, 15417, 568, 14224, 14, 46429, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 1911, 4537, 3, 187, 50254, 30991, 800, 14, 1156, 568, 4717, 2608, 3, 187, 50254, 15417, 568, 14224, 14, 46429, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 16435, 3, 187, 50254, 30991, 800, 14, 1156, 568, 19238, 3, 187, 50254, 15417, 568, 14224, 14, 46429, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 15261, 3, 187, 50254, 30991, 800, 14, 1156, 568, 17964, 3, 187, 50254, 15417, 568, 14224, 14, 46429, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 3305, 4698, 3, 187, 50254, 30991, 800, 14, 1156, 568, 12323, 4698, 3, 187, 50254, 15417, 568, 14224, 14, 46429, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 8636, 5240, 3, 187, 50254, 30991, 800, 14, 1156, 568, 46780, 275, 3, 187, 50254, 15417, 568, 14224, 14, 46429, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187, 50254, 3557, 14, 1590, 568, 307, 874, 27, 44164, 483, 3, 187, 50254, 30991, 800, 14, 1156, 568, 46780, 562, 3, 187, 50254, 15417, 568, 14224, 14, 46429, 3, 187, 50254, 2437, 568, 84, 392, 84, 14, 78, 14, 1274, 64, 5260, 14, 6795, 3, 187, 50258, 3073, 68, 14, 8060, 14, 3557, 31, 187, 50262, 870, 2154, 31, 187, 50266, 870, 2154, 31, 535, 50266, 29, 2154, 966, 568, 84, 392, 84, 14, 78, 14, 3956, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 89, 14, 16374, 1138, 187, 50262, 29, 73, 19, 966, 568, 84, 392, 84, 14, 1156, 14, 33049, 64, 28672, 256, 392, 84, 14, 78, 14, 10492, 64, 28672, 1138, 187, 50258, 8880, 14, 30585, 342, 253, 654, 3211, 31, 15417, 870, 3211, 31, 11104, 873, 281, 187, 50258, 29, 3211, 31, 39517, 14, 46429, 870, 3211, 13208, 187, 50262, 870, 73, 19, 31, 187, 50262, 14219, 342, 5680, 1227, 407, 4284, 6781, 187, 50262, 29, 2154, 966, 568, 84, 392, 84, 14, 81, 14, 16576, 64, 28672, 298, 23654, 14, 17424, 14, 46429, 1138, 187, 50258, 29, 68, 14, 8060, 14, 3557, 187 ]
icon> <c-button-icon icon-name="utility:zoomout" variant="container" alternative-text="Zoom out" class="slds-m-left_xx-small" ></c-button-icon> </div> </div> <div class="slds-m-top_medium slds-m-bottom_x-large"> <h2 class="slds-text-heading_medium slds-m-bottom_medium"> Button-icons with the <code>variant</code> attribute set to <code>border-filled</code>. </h2> <!-- with border filled --> <div class="slds-p-around_medium lgc-bg"> <c-button-icon icon-name="utility:settings" variant="border-filled" alternative-text="Settings" ></c-button-icon> <c-button-icon icon-name="utility:adduser" variant="border-filled" alternative-text="Add user" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:delete" variant="border-filled" alternative-text="Delete" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:save" variant="border-filled" alternative-text="Save" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:bookmark" variant="border-filled" alternative-text="Bookmark" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:zoomin" variant="border-filled" alternative-text="Zoom in" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:zoomout" variant="border-filled" alternative-text="Zoom out" class="slds-m-left_xx-small" ></c-button-icon> </div> </div> <div class="slds-m-top_medium slds-m-bottom_x-large"> <h2 class="slds-text-heading_medium slds-m-bottom_medium"> Button-icons with the <code>size</code> attribute set to a valid value (<code>xx-small, x-small, small, medium</code>). </h2> <!--Sizes --> <div class="slds-p-around_medium lgc-bg"> <c-button-icon icon-name="utility:down" size="xx-small" alternative-text="View More" ></c-button-icon> <c-button-icon icon-name="utility:down" size="x-small" alternative-text="View More" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:down" size="small" alternative-text="View More" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:down" size="medium" alternative-text="View More" class="slds-m-left_xx-small" ></c-button-icon> </div> </div> <div class="slds-m-top_medium slds-m-bottom_x-large"> <h2 class="slds-text-heading_medium slds-m-bottom_medium"> Button-icons with the <code>variant</code> attribute set to <code>bare</code> and the <code>size</code> attribute set to a valid value (<code>x-small, small, medium, large</code>). </h2> <div class="slds-p-around_medium lgc-bg"> <c-button-icon icon-name="utility:down" size="x-small" variant="bare" alternative-text="View More" ></c-button-icon> <c-button-icon icon-name="utility:down" size="small" variant="bare" alternative-text="View More" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:down" size="medium" variant="bare" alternative-text="View More" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:down" size="large" variant="bare" alternative-text="View More" class="slds-m-left_xx-small" ></c-button-icon> </div> </div> <div class="slds-m-top_medium slds-m-bottom_x-large"> <h2 class="slds-text-heading_medium slds-m-bottom_medium"> Button-icons with the <code>variant</code> attribute set to <code>border-inverse</code>. </h2> <!-- with border / by default --> <div class="slds-p-around_medium lgc-bg-inverse"> <c-button-icon icon-name="utility:settings" alternative-text="Settings" variant="border-inverse" ></c-button-icon> <c-button-icon icon-name="utility:adduser" alternative-text="Add user" variant="border-inverse" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:delete" alternative-text="Delete" variant="border-inverse" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:save" alternative-text="Save" variant="border-inverse" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:bookmark" alternative-text="Bookmark" variant="border-inverse" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:zoomin" alternative-text="Zoom in" variant="border-inverse" class="slds-m-left_xx-small" ></c-button-icon> <c-button-icon icon-name="utility:zoomout" alternative-text="Zoom out" variant="border-inverse" class="slds-m-left_xx-small" ></c-button-icon> </div> </div> <div class="slds-m-top_medium slds-m-bottom_x-large"> <h2 class="slds-text-heading_medium slds-m-bottom_medium"> Button-icons with the <code>variant</code> attribute set to <code>bare-inverse</code>. </h2> <!-- with border / by default --> <div class="slds-p-around_medium lgc-bg-inverse"> <c-button-icon
[ 449, 346, 346, 14102, 83, 1595, 13, 5440, 18620, 47579, 346, 20884, 13191, 449, 346, 25000, 6201, 83, 1595, 369, 13084, 285, 288, 4626, 323, 28106, 40905, 342, 247, 20260, 285, 1673, 17543, 449, 346, 346, 24080, 27982, 13, 1445, 338, 911, 15, 346, 428, 346, 23045, 254, 9739, 346, 390, 346, 11717, 14785, 15, 4890, 346, 309, 871, 752, 352, 2097, 449, 346, 1328, 1364, 452, 13, 16831, 13, 9355, 253, 34024, 449, 346, 309, 923, 449, 346, 16574, 1599, 6303, 14785, 273, 2712, 449, 346, 1394, 923, 326, 865, 346, 44441, 264, 562, 987, 627, 449, 346, 42, 476, 760, 8564, 849, 2834, 436, 1364, 320, 323, 368, 449, 346, 2552, 309, 13, 2305, 865, 346, 5874, 31299, 449, 346, 42, 1833, 923, 604, 436, 747, 3239, 10129, 253, 40905, 26899, 449, 346, 1552, 310, 271, 22145, 449, 346, 1394, 1472, 6789, 619, 21507, 247, 43459, 449, 346, 3378, 1675, 13, 1024, 368, 1472, 6789, 619, 1270, 14, 17124, 14, 26852, 69, 15242, 247, 43459, 449, 346, 4374, 13, 8674, 13, 309, 717, 449, 346, 1552, 3548, 626, 690, 22630, 432, 247, 2892, 1984, 449, 346, 3220, 21507, 2183, 479, 436, 2926, 2994, 449, 346, 309, 3047, 253, 5083, 273, 352, 275, 521, 2927, 449, 346, 309, 1353, 7016, 13, 8674, 449, 346, 42, 7777, 717, 449, 346, 1231, 1833, 1071, 436, 16575, 13, 15435, 13, 281, 10501, 366, 352, 449, 346, 1147, 476, 626, 320, 449, 346, 46, 1825, 281, 37627, 8, 9910, 449, 346, 25076, 281, 24811, 326, 1053, 626, 2226, 449, 346, 1276, 434, 253, 1127, 865, 346, 1276, 717, 309, 2819, 323, 865, 346, 19545, 13, 4737, 13, 4737, 449, 346, 1276, 4737, 865, 346, 4013, 13, 39361, 449, 346, 2513, 436, 247, 1984, 670, 253, 8582, 446, 274, 21764, 865, 346, 4374, 13, 352, 310, 670, 253, 8582, 446, 274, 21764, 13, 533, 352, 434, 671, 670, 643, 1841, 449, 346, 9323, 5378, 1974, 11813, 13, 10106, 38209, 285, 643, 38671, 326, 403, 2032, 449, 346, 1893, 253, 2488, 434, 1060, 15428, 10125, 865, 346, 309, 1353, 253, 2488, 449, 346, 1422, 403, 865, 346, 11739, 449, 346, 5035, 13, 16831, 3255, 346, 2512, 434, 247, 5406, 273, 479, 987, 627, 449, 346, 42, 1158, 352, 434, 247, 3965, 1175, 5406, 449, 346, 42, 1869, 326, 5599, 13, 19046, 27982, 13, 1119, 253, 21764, 449, 346, 4497, 13, 4754, 13, 6029, 858, 13, 533, 309, 717, 253, 820, 14, 31732, 449, 346, 5531, 13, 309, 1849, 1620, 3735, 273, 368, 449, 346, 5531, 1476, 346, 4013, 13, 619, 305, 6934, 449, 346, 6723, 368, 6029, 27982, 865, 346, 6279, 449, 346, 4374, 13, 309, 717, 449, 346, 3166, 368, 1211, 247, 2502, 44152, 865, 346, 6279, 13, 309, 513, 449, 346, 6089, 13, 352, 434, 1146, 281, 7184, 449, 346, 41, 78, 865, 346, 13689, 1476, 346, 13689, 1476, 346, 2773, 434, 619, 1113, 1476, 346, 7161, 434, 253, 44152, 865, 346, 20484, 1607, 8055, 352, 449, 346, 380, 20484, 865, 346, 39, 17259, 2926, 449, 346, 3220, 49174, 873, 598, 247, 13739, 327, 271, 8930, 326, 1904, 626, 2226, 285, 17839, 479, 326, 326, 434, 849, 6793, 952, 513, 352, 449, 346, 5872, 309, 1694, 3820, 959, 285, 41352, 342, 247, 5699, 4030, 5043, 1600, 449, 346, 56, 9045, 871, 752, 10474, 403, 327, 2620, 3041, 8918, 865, 346, 25347, 3041, 8918, 449, 346, 1989, 2217, 670, 479, 449, 346, 1276, 434, 747, 342, 368, 865, 346, 4497, 13, 619, 19609, 19301, 479, 562, 13, 309, 1353, 3811, 342, 619, 12247, 937, 346, 619, 2021, 5339, 3918, 15915, 449, 346, 1876, 987, 449, 346, 42, 878, 634, 1361, 449, 346, 42, 476, 626, 2868, 368, 452, 281, 2740, 715, 634, 1211, 2419, 449, 346, 42, 878, 281, 755, 329, 2760, 647, 434, 5417, 449, 346, 2993, 556, 2289, 281, 253, 40905, 26899, 3239, 449, 346, 4967, 1053, 626, 368, 1642, 329, 2760, 647, 323, 617, 1361, 865, 346, 2993, 4391, 253, 13965, 2127, 13, 32920, 449, 346, 2993, 434, 417, 1469, 281, 2312, 281, 479, 449, 346, 3074, 987, 449, 346, 1231, 452, 1884, 7253, 846, 253, 10028, 7866, 281, 19495, 253, 13965, 449, 346, 6826, 449, 346, 42, 1833, 3164, 14938, 7004, 436, 13, 533, 752, 4592, 342, 368, 285, 329, 2760, 647, 865, 346, 42, 1053, 626, 871, 449, 346, 42, 1053, 626, 871, 449, 346, 2993, 3053, 970, 253, 3159, 346, 601, 3, 247, 2257, 449, 4890, 2598, 865, 3, 346, 6506, 13, 751, 13, 346, 2598, 13, 309, 5476, 619, 4743, 2506, 626, 2647, 15, 4890, 4890, 2598, 13, 368, 1646, 281, 1900, 871, 752, 434, 1682, 15, 346, 346, 2598, 13, 309, 5476, 309, 1353, 20624, 15, 4890, 346, 4125, 309, 1849, 4395, 562, 13, 359, 1472, 23534, 17076, 3255, 346, 4013, 449, 346, 22737, 449, 346, 5804, 626, 3153, 342, 731, 13, 3340, 604, 597, 1818, 253, 13965, 11646, 449, 346, 1394, 858, 326, 275, 2030, 7253, 449, 346, 2773, 434, 2139, 309, 2028, 952, 281, 755, 247, 4370, 449, 346, 21979, 352, 449, 346, 1876, 987, 13, 1339, 434, 564, 449, 346, 2773, 434, 417, 329, 2760, 647, 434, 1113, 449, 346, 2993, 369, 327, 247, 3522, 449, 346, 33989, 626, 326, 326, 5599, 865, 346, 510, 5219, 3995, 5599, 865, 346, 510, 5219, 3995, 27477, 30112, 21508, 310, 1735, 7216, 449, 346, 11175, 604, 368, 1472, 417, 3255, 346, 1328, 434, 12504, 1476, 346, 1276, 6569, 604, 5753, 1053, 626, 1089, 512, 253, 11624, 865, 346, 24243, 449, 346, 1394, 789, 275, 247, 16064, 13, 285, 368, 3153, 275, 581, 449, 346, 41774, 1199, 449, 346, 1276, 19080, 1234, 435, 1796, 449, 346, 2993, 1364, 751, 779, 449, 346, 3074, 987, 13, 1339, 479, 1918, 368, 247, 4892, 273, 253, 2419, 449, 346, 10826, 449, 346, 2064, 434, 2686, 2238, 273, 3255, 346, 4013, 13, 329, 2760, 647, 449, 346, 1737, 403, 368, 2509, 1060, 865, 346, 309, 816, 3058, 281, 755, 690, 1841, 449, 346, 44085, 13, 1175, 281, 923, 368, 969, 449, 346, 27982, 449, 346, 2347, 858, 368, 755, 275, 13, 6029, 865, 346, 51, 11416, 1476, 346, 8380, 562, 1060, 1476, 346, 1276, 865, 346, 8262, 1476, 346, 1276, 403, 368, 2509, 1060, 865, 346, 42, 1599, 13, 352, 434, 634, 2419, 13, 533, 3255, 346, 42, 2197, 368, 247, 3491, 273, 619, 1984, 449, 346, 8917, 368, 755, 247, 4839, 865, 346, 1621, 13, 309, 6468, 626, 1239, 352, 2568, 449, 346, 353, 78, 449, 346, 42, 871, 368, 449, 346, 1394, 1472, 253, 5219, 3995, 1095, 1080, 449, 346, 309, 1353, 32920, 449, 346, 1231, 1313, 13, 16831, 13, 896, 275, 3255, 346, 10154, 449, 346, 1394, 1472, 13, 16831, 13, 6029, 434, 13372, 449, 346, 1276, 865, 346, 26186, 13, 5046, 309, 943, 564, 449, 346, 11739, 13, 309, 1353, 1663, 3255, 346, 399, 5338, 10873, 2360, 865, 346, 42, 3255, 346, 42, 2686, 2168, 452, 5827, 323, 10873, 449, 346, 1394, 513, 865, 346, 4683, 2282, 368, 513, 449, 346, 1292, 309, 1353, 1959, 327, 6794, 449, 346, 20352, 76, 1034, 449, 346, 5531, 13, 1270, 449, 346, 7088, 2360, 449, 346, 7088, 2360, 449, 346, 42, 2550, 2868, 368, 9377, 275, 449, 346, 1737, 858, 368, 1379, 865, 346, 733, 434, 816, 619, 1841, 449, 346, 6288, 352, 689, 13, 6029, 449, 346, 42, 878, 281, 923, 253, 40905, 26899, 3239, 449, 346, 1394, 3047, 253, 3239, 4834, 449, 346, 2512, 310, 642, 21764, 3711, 327, 352, 449, 346, 2302, 13, 352, 434, 247, 39175, 4283, 281, 247, 3711, 449, 346, 31568, 9879, 14, 5695, 253, 3239, 865, 346, 2302, 878, 281, 449, 346, 510, 12296, 4028, 327, 253, 3239, 310, 4518, 7985, 449, 346, 1147, 812, 452, 644, 44767, 390, 28290, 449, 346, 1394, 1472, 253, 6423, 273, 3389, 14144, 449, 346, 1394, 871, 436, 449, 346, 3650, 598, 281, 479, 449, 346, 1147, 434, 417, 619, 7811, 449, 346, 2773, 7811, 5012, 281, 634, 7811, 449, 346, 8380, 327, 449, 346, 4041, 1007, 762, 20542, 449, 346, 1394, 476, 452, 253, 9693, 29464, 30136, 449, 346, 14358, 273, 731, 865, 346, 1231, 1849, 644, 2819, 387, 436, 3239, 323, 3038, 449, 346, 2512, 434, 2717, 627, 449, 346, 17126, 13, 309, 1663, 1053, 626, 1158, 359, 1472, 1469, 281, 1089, 2712, 327, 436, 3239, 449, 346, 688, 247, 4289, 1107, 13, 642, 581, 434, 1469, 281, 4456, 3780, 3206, 275, 253, 15915, 34024, 16280, 40905, 449, 346, 2773, 434, 417, 2032, 449, 346, 4045, 368, 871, 253, 2048, 13, 346, 8389, 1416, 310, 16059, 47579, 346, 6279, 449, 346, 4527, 2282, 449, 346, 1422, 513, 865, 346, 1422, 871, 253, 6510, 273, 253, 2048, 865, 346, 9876, 3780, 533, 368, 865, 346, 9034, 15, 20628, 353, 7937, 369, 13084, 273, 1146, 247, 820, 14, 45097, 1080, 275, 253, 15915, 34024, 449, 346, 510, 1941, 369, 45026, 449, 346, 1328, 369, 1996, 268, 472, 11406, 13, 533, 352, 1904, 626, 2647, 449, 346, 46, 7937, 434, 1416, 1335, 4852, 275, 2192, 14743, 449, 346, 1898, 309, 588, 417, 1339, 7195, 27982, 8, 1416, 320, 16059, 449, 346, 6029, 449, 346, 1737, 865, 346, 7745, 387, 436, 449, 346, 2594, 326, 865, 346, 5531, 449, 346, 2064, 434, 3240, 1633, 13, 3548, 626, 352, 865, 346, 11739, 449, 346, 1147, 2296, 346, 3610, 15414, 15, 4890, 346, 1147, 434, 2717, 449, 346, 2632, 301, 780, 12296, 432, 253, 10268, 3239, 449, 346, 6623, 532, 352, 449, 346, 510, 4876, 403, 24291, 449, 346, 733, 434, 247, 39175, 449, 346, 6279, 449, 346, 1147, 310, 449, 346, 34, 39175, 449, 346, 5035, 849, 253, 4876, 403, 9904, 865, 346, 21020, 25525, 260, 532, 3398, 22573, 4876, 275, 8557, 449, 346, 1552, 812, 5276, 521, 2926, 449, 346, 28645, 368, 30358, 253, 39175, 13, 436, 1057, 417, 5276, 247, 3762, 449, 346, 2773, 434, 10826, 449, 346, 1231, 878, 247, 2620, 14, 15139, 23473, 449, 346, 1737, 434, 253, 23473, 865, 346, 309, 1053, 626, 871, 2568, 449, 346, 1876, 987, 449, 346, 41932, 13, 476, 309, 755, 247, 3379, 483, 273, 436, 865, 346, 2512, 434, 247, 6494, 3000, 275, 253, 4383, 3448, 449, 346, 25302, 281, 320, 247, 13760, 3255, 346, 1466, 434, 1265, 432, 253, 5068, 449, 346, 34, 15, 329, 472, 87, 782, 449, 346, 5498, 626, 971, 281, 9313, 327, 634, 28768, 1060, 13, 533, 309, 1053, 626, 1158, 436, 310, 6501, 3523, 3, 346, 9034, 15, 43426, 432, 30849, 253, 8900, 273, 253, 3239, 10873, 449, 346, 2302, 13, 1024, 13, 3343, 449, 346, 5804, 626, 368, 1642, 779, 281, 3343, 1919, 309, 5276, 7195, 310, 15377, 865, 346, 1276, 604, 344, 3548, 626, 15377, 865, 346, 20405, 865, 346, 35082, 751, 776, 1711, 3331, 6029, 27982, 310, 275, 253, 3668, 969, 449, 346, 1276, 858, 344, 1089, 1024, 865, 346, 34944, 35902, 865, 346, 34, 5599, 2210, 3579, 342, 247, 5816, 40905, 26899, 3239, 449, 346, 2773, 434, 417, 253, 1682, 629, 449, 346, 19577, 281, 436, 449, 4890, 2374, 253, 3239, 403, 253, 4454, 273, 253, 11882, 2392, 275, 253, 15915, 34024, 13, 347, 973, 347, 247, 3786, 7202, 11882, 1080, 937, 346, 24080, 27982, 449, 346, 24080, 27982, 310, 753, 281, 320, 253, 1270, 14, 17124, 14, 26852, 13453, 273, 21764, 32290, 19046, 17179, 27982, 15, 4890, 346, 29084, 619, 17772, 497, 3076, 449, 346, 1737, 513, 359, 871, 670, 436, 5874, 31299, 865, 346, 9011, 865, 346, 22757, 3916, 344, 574, 436, 3239, 323, 11858, 1107, 840, 816, 8423, 3249, 3579, 342, 352, 865, 346, 6049, 865, 346, 844, 1833, 1089, 562, 449, 346, 36011, 449, 346, 35, 11660, 449, 346, 16600, 1469, 449, 346, 2064, 434, 11339, 449, 346, 1359, 434, 344, 2509, 865, 346, 16600, 2444, 449, 346, 1231, 1472, 14442, 281, 253, 5874, 31299, 2021, 323, 3551, 6593, 342, 253, 3239, 449, 346, 2374, 253, 3239, 310, 247, 1416, 273, 247, 3786, 7202, 11882, 1080, 13, 7195, 27982, 449, 346, 43426, 556, 8686, 715, 352, 449, 346, 5035, 865, 346, 14815, 368, 3523, 7487, 326, 449, 346, 1147, 434, 327, 253, 7336, 1476, 346, 1621, 15910, 352, 1024, 449, 346, 27982, 778, 452, 644, 253, 6805, 3255, 346, 1583, 452, 642, 4685, 449, 346, 1422, 871, 253, 5083, 449, 346, 2773, 434, 512, 326, 8213, 449, 346, 1394, 3735, 253, 2926, 432, 8481 ]
." " "Surratt, copiae"?" " Military supplies." "Mary Surratt was convicted and hanged for supplying Booth with a rifle and field glasses." " "Thomas Gates, artifex. " - "Designer"" " or "mastermind. "" " I know what it means." "He must have, uh, planned the assassination." " I see." " Could mean mastermind of anything." "You see that?" "Burned out right there." "I can only imagine how difficult this must be for you." " May I, Mr?" " Wilkinson." "I'll see if this new page matches the Booth diary." "This is an outrage." "You're calling my grandfather a liar." "With respect, now you're calling my great-great-granddaddy a liar." "Yes, sir, I am." "This isn't some garbage from a history book." "My grandfather told me this story himself." " I saw the truth of it in his eyes." " I'm sorry, sir." "I truly am." "We'll test this thoroughly, Patrick, to authenticate it." "It can't be." "Maps to presidents' houses." "Keys to locks that don't exist." "What's the point?" "What am I looking for?" "Proof, proof, proof." "What proof?" "Oh, wow." "Is this a book about the Templar treasure?" "Yes, it is about the Templar treasure, but it's also about other things." "Conspiracy theories, urban legends and other myths that are true." " So the author's here signing copies?" " I'm the author." " You are?" " Yeah." "See, uh..." "There's a picture of me right there." "I think it's a pretty good picture." "I thought that guy, Benjamin Gates, found the treasure." "Well, yes, Ben did, but I am the co-finder." " Oh, I've never heard of you." " Oh!" "Oh, my gosh." "Are you Ben Gates?" " Yes." "Yes, I am." " Do you own a red Ferrari?" " Yes, I do." " Well, it's being towed." "Hm?" "Wait!" "Wait!" "That's my car!" "Where's the Ferrari?" " IRS impounded it." " The IRS?" "Funny story." "My accountant set up a corporation on an island that didn't exist and assured me that that's how rich people do it." "Then I got audited and slapped with a huge fine plus interest." "Wanna know what taxes are on five million dollars?" "Six million dollars." "But enough about me." "What's new with you?" "Well, my girlfriend kicked me out, I'm living with my dad," " my family killed President Lincoln." " All right." "I need your help." "I can't believe you have to break into your own house." "I need to get Abigail's ID." "She has access to the Booth diary page." "Why don't you ask Abigail for her help?" "She changed the alarm code, Riley." "She's not going to talk to me." "All right." "We have 30 seconds after the alert starts to disable the alarm." "Go." "I'll probably regret asking this, but what happened with you and Abigail?" "I don't know." "I don't know." "She started using the word "so" a lot." ""So?"" "Yeah, like, "So, I guess my opinion doesn't matter. "" ""So, you seem to always know what's best. " "So, I guess I'm invisible. "" "Now I've moved out, we're dividing furniture..." "Oh." "Women." "Can't live with them, especially if they change the alarm codes." "You did that in 25 seconds." "That's why I tell people to get a dog." " Got it." " All right, let's go." "That's not Abigail's car." "She was on a date." "Isn't that that guy?" "The White House guy?" "The White House Easter Egg Roll is next Monday." "Maybe if you're not..." "He's weird!" "What happens if kids don't find all the eggs?" "Wow." "You work in a museum, and you live in one." "Pretty much." "What clever repartee." "She must like him." "All right, let me give you a tour of the house." " OK." " That's actually kind of..." "Oh, Abigail." " What are you doing here?" " I just needed to get some things." " Connor, good to see you again." " Gates." "How did you get in, Ben?" "Riley!" "Come out here!" "What?" "Hey!" "What are you doing here?" "I mean, it's your house, but..." "I sent you a copy of my book." "Did you get a chance?" " No, I haven't read it yet." " Mm." "I know you." "You're the White House curator." " I'm Riley." "We met, uh, back in..." " Right." "You're, uh, Ben's assistant." "What?" "Um, maybe I should go." " Yeah, I'm really..." " Dinner tomorrow night?" "I..." "I actually already have plans for tomorrow." "You do?" " Of course you do." " But I'm free on Friday." " Awkward." " Oh, great." " Good night." " Good night." "I cannot believe you broke in." " What did you take?" " It's just my things." "Hand it over, Ben." "I need to see the Booth diary page." "You saw the page yourself." "There is no treasure map on it." "No, it's a cipher leading to a map." "Anyone spectral-image the page?" "No need to." "The ink writing on the page is clearly visible." "It could have been erased or faded." "You're the director of document conservation." "You know this." "Not up to me." "It's not my department." "That department reports to your department." "Come on." "One look under infrared." "You can have the Boston Tea Tables." "Both of them?" "We've been looking at this page for hours." "There's nothing there." "Ben, I really don't think we're going to find anything on this page." "In a hundred years, no one's going to remember anyone involved in the Lincoln assassination besides Booth." "That's not true." "Do you know the expression, "His name is mud"?" " Yes." "Of course." " You do?" " You know the origin of the expression?" " Does anyone but you?" "Dr. Samuel Mudd was convicted of being a co-conspirator in the Lincoln assassination." "The evidence was circumstantial." "He was later pardoned, but it didn't matter." "Mudd's name still lives in infamy." "And I will not let Thomas Gates' name be mud." " Ben." " What?" "Look at this." " See that?" " Oh." " That's quite something, isn't it?" " Yeah." "It says "smudge. "" "It's nothing." "Residual ink from the facing page." "Flip it." "The letters are backwards." " It's a cipher." " Yes." "It is." "A cipher." "See how the letters are coupled?" "Playfair ciphers encode letters in pairs." "This could prove his story." "Unless you decode the cipher, this does not prove a theory." "That's OK." "We need a five-letter keyword." " What's the keyword?" " I don't know yet." " All right." " Uh, can I get a printout of this?" "There's a billion words in the English language." "Got to be a logical..." "Let's start from the beginning." "A. Aardvark." "Don't want to rain on your parade here, but I don't think this is gonna stop" "Dr. Nichols from announcing the discovery of the page tomorrow." "No, now, wait." "Can't you ask him to wait until I prove Thomas is innocent?" "What if he isn't innocent?" "Sir?" "Looks like our old friend Ben Gates is in the news again." "What did he find now?" "Atlantis?" "A guy came forward with a missing Booth diary page." "That's not the best part." "Listen to this." ""On the page are the names of the conspirators in the Lincoln assassination, as well as a previously unknown conspirator," "Thomas Gates." "Thomas Gates is said to be the great-great-grandfather of treasure hunter Benjamin Franklin Gates. "" " Thought my relatives were bad." " What do we know about this Wilkinson?" " Sir?" " Guy claims he had this page for 140 years then just suddenly comes forward with it?" " Why?" " We'll find out." "Better." "Bacon." " Keep going." " That's stupid." " How's he doing?" " Keep working." "We're grateful to the Wilkinson family for coming forth with the page." "On the page is a name of a previously unknown conspirator, Thomas Gates." " Nichols has bought into it." "See?" " Would you stop watching that." "It's on the Internet!" " No stopping it now." " Gates may have been the architect..." " They have no understanding." " You know the truth." "That's all that matters." "You heard the story from Grand
[ 1881, 14, 515, 5930, 2379, 186, 78, 19, 426, 278, 19, 28, 2379, 186, 78, 18, 426, 278, 18, 28, 15971, 186, 78, 18, 15, 13125, 64, 3845, 1874, 2379, 186, 71, 19, 15, 13125, 64, 3845, 1874, 15971, 186, 2309, 470, 28, 190, 187, 94, 2379, 49, 316, 1994, 266, 814, 775, 662, 66, 187, 187, 49, 316, 1994, 266, 41745, 775, 662, 66, 310, 1119, 281, 320, 6685, 12912, 275, 26259, 253, 2523, 273, 657, 28233, 13, 15946, 66, 285, 30789, 3227, 399, 375, 3227, 15, 733, 310, 671, 247, 11906, 22587, 321, 1272, 280, 9921, 323, 5111, 431, 9673, 14771, 9360, 15, 380, 2201, 12696, 1119, 275, 367, 316, 1994, 266, 41745, 775, 662, 66, 403, 34445, 6156, 1777, 267, 13, 611, 8952, 11777, 348, 13, 12899, 66, 13, 15315, 328, 31069, 75, 13, 329, 312, 443, 19283, 13, 285, 4200, 11825, 15, 2053, 3626, 12696, 452, 253, 9559, 1786, 5373, 4768, 253, 2133, 15, 367, 316, 1994, 266, 41745, 775, 662, 66, 310, 247, 46001, 22587, 321, 1272, 280, 9921, 323, 12767, 2710, 12607, 3374, 15, 733, 476, 8722, 281, 2968, 342, 2102, 304, 9598, 13, 5192, 14283, 13, 25411, 317, 14283, 13, 14869, 32713, 13, 12558, 28487, 13, 15382, 14814, 13, 2071, 80, 839, 13, 285, 21869, 275, 253, 12607, 15, 733, 310, 1119, 6685, 12912, 275, 12767, 1142, 19859, 41286, 1975, 10552, 15, 2596, 476, 897, 824, 15895, 281, 755, 8314, 273, 33613, 10332, 15, 9730, 21407, 267, 8984, 13, 2070, 1028, 39667, 21071, 13, 9730, 17536, 356, 571, 13, 18402, 17536, 9448, 13, 9730, 21407, 267, 50045, 13, 13343, 257, 21407, 267, 9237, 13, 285, 416, 21216, 522, 40426, 476, 320, 35977, 456, 407, 367, 316, 1994, 266, 814, 775, 662, 66, 15, 733, 310, 671, 1119, 281, 320, 4122, 12912, 323, 13255, 10696, 285, 3075, 2905, 3374, 15, 2596, 476, 25596, 352, 337, 281, 374, 23451, 273, 1824, 846, 1907, 253, 11484, 15, 6989, 27, 998, 1402, 263, 187, 187, 4509, 443, 460, 532, 66, 7366, 13, 253, 29260, 273, 28848, 44925, 35372, 187, 187, 12092, 4130, 15, 309, 1353, 659, 1402, 263, 285, 452, 644, 247, 3558, 273, 443, 460, 532, 66, 7366, 323, 247, 807, 1024, 15, 309, 12921, 6571, 275, 7774, 10620, 342, 253, 3173, 468, 8075, 285, 2710, 20303, 15, 4129, 619, 3640, 310, 14999, 2429, 281, 690, 273, 253, 3811, 34032, 41, 546, 12642, 11802, 6358, 326, 403, 776, 24127, 968, 13, 309, 1335, 871, 2217, 281, 1056, 9021, 285, 717, 247, 10879, 8121, 285, 9414, 327, 436, 35372, 15, 35193, 1959, 281, 1339, 479, 871, 604, 627, 310, 2712, 13, 1014, 10000, 789, 13, 326, 310, 3058, 285, 309, 588, 923, 752, 309, 476, 513, 15, 28292, 34262, 8690, 33603, 1359, 7042, 556, 8176, 326, 247, 45575, 32326, 943, 1620, 452, 644, 1691, 275, 4179, 273, 11268, 434, 3645, 9167, 4426, 5425, 387, 253, 9145, 273, 247, 3761, 14, 11097, 272, 4194, 15, 187, 187, 49348, 452, 9262, 247, 5833, 281, 3645, 37790, 562, 30927, 655, 686, 328, 25525, 8, 7089, 275, 1390, 6926, 434, 1283, 14, 740, 13313, 407, 22785, 275, 30167, 14, 846, 534, 32326, 26113, 309, 636, 2679, 1026, 86, 369, 40754, 745, 253, 11288, 15, 187, 187, 42, 636, 2679, 1026, 86, 369, 11162, 1078, 253, 14811, 407, 37790, 3060, 13, 3692, 4007, 310, 45575, 5625, 19898, 7039, 3558, 3821, 35026, 4922, 1792, 86, 13, 533, 14672, 670, 247, 7344, 273, 1600, 497, 12841, 15, 187, 187, 55, 17869, 309, 636, 2679, 1026, 86, 369, 253, 32326, 347, 31351, 7320, 745, 247, 5699, 14004, 3330, 689, 11268, 327, 6926, 187, 187, 30574, 571, 3058, 11268, 281, 7168, 281, 19478, 428, 533, 37790, 3060, 10945, 9883, 9762, 281, 5386, 309, 636, 2679, 1026, 86, 1384, 1897, 1078, 253, 6004, 15, 24486, 1877, 310, 4409, 670, 8157, 18, 15, 22, 24561, 281, 11268, 285, 34262, 285, 3473, 310, 3629, 323, 253, 2165, 281, 320, 294, 35293, 15, 187, 187, 49348, 8690, 38436, 40059, 753, 27, 686, 14947, 37790, 878, 281, 1056, 8426, 15, 844, 452, 574, 1329, 432, 512, 689, 253, 1533, 2464, 187, 187, 20405, 1639, 422, 9002, 1034, 1925, 323, 247, 44864, 13, 40021, 271, 11790, 2380, 432, 1219, 249, 8939, 83, 2679, 13, 4007, 273, 45575, 37790, 20369, 13, 665, 753, 27, 686, 2019, 422, 9002, 1034, 310, 247, 20071, 254, 342, 2717, 281, 513, 2464, 187, 187, 49649, 502, 6948, 342, 1016, 977, 285, 253, 32326, 846, 253, 2165, 534, 3047, 22785, 19478, 187, 187, 51, 814, 1615, 3060, 2918, 271, 275, 4557, 281, 2278, 253, 32326, 434, 3045, 327, 6794, 15, 11268, 1160, 271, 3565, 2748, 323, 253, 2278, 281, 320, 11450, 1250, 407, 271, 3907, 2133, 13, 824, 347, 253, 15371, 54, 13, 533, 352, 369, 12841, 15, 187, 187, 510, 11815, 273, 253, 4804, 588, 320, 774, 19416, 281, 37790, 3060, 4450, 2758, 285, 3645, 37790, 327, 7216, 2360, 15, 187, 187, 8, 510, 2644, 985, 310, 44065, 27319, 4117, 753, 247, 21261, 327, 6926, 2603, 15, 686, 6075, 784, 3533, 878, 281, 320, 2546, 273, 37790, 3060, 2464, 15999, 3645, 37790, 769, 13, 34262, 588, 320, 275, 247, 3645, 9167, 6363, 342, 11011, 13, 13944, 285, 4047, 15, 1583, 403, 8445, 247, 747, 8690, 846, 29630, 1342, 1359, 7042, 15856, 4260, 1106, 949, 253, 11067, 14726, 378, 6884, 15, 187, 187, 1672, 14, 30574, 571, 8690, 33603, 1359, 7042, 8176, 326, 247, 45575, 943, 1620, 452, 644, 275, 4179, 187, 187, 8, 510, 32326, 10095, 626, 2455, 452, 644, 1691, 275, 1659, 323, 253, 990, 273, 253, 14811, 4117, 1359, 7042, 2183, 253, 21261, 327, 6926, 15, 187, 187, 8, 42, 871, 26113, 1077, 973, 285, 309, 1871, 320, 9861, 604, 344, 1871, 644, 26740, 264, 407, 2712, 15, 309, 3524, 323, 29385, 434, 13232, 326, 627, 556, 644, 642, 11755, 2136, 285, 309, 1849, 3735, 2717, 281, 1804, 627, 556, 644, 15, 187, 187, 8, 36735, 1585, 273, 665, 253, 32326, 369, 13, 627, 310, 642, 1659, 275, 29385, 8083, 323, 6671, 281, 2983, 247, 32326, 2464, 3404, 253, 20632, 273, 4565, 3349, 13, 4072, 13, 253, 49850, 3995, 12244, 25213, 342, 1270, 11010, 285, 480, 538, 10108, 776, 12368, 11574, 12958, 285, 1199, 7636, 35213, 6393, 24131, 249, 285, 35213, 6393, 322, 658, 6362, 15, 3932, 840, 253, 39426, 8139, 187, 187, 510, 1048, 48717, 15790, 1388, 369, 20632, 264, 342, 512, 697, 42242, 13, 18349, 285, 11010, 347, 46242, 6393, 4137, 75, 682, 13, 399, 792, 74, 285, 743, 484, 66, 19651, 616, 15790, 500, 538, 37707, 285, 35213, 13558, 90, 22847, 665, 19651, 617, 16309, 500, 538, 37707, 327, 8139, 46170, 187, 33, 3140, 187, 31696, 34852, 2634, 15467, 1450, 73, 3230, 1450, 16716, 43292, 16433, 187, 187, 33, 35152, 7406, 43898, 570, 4072, 14, 7132, 187, 14178, 3567, 762, 253, 35476, 9107, 4637, 13, 11099, 337, 15, 17, 15, 187, 9, 5035, 17909, 1873, 21826, 15, 6535, 390, 3491, 387, 3944, 1358, 15467, 15, 2061, 16, 17821, 64, 18, 64, 17, 15, 10134, 10, 187, 1738, 187, 187, 4, 17331, 10807, 64, 10114, 1322, 64, 39, 18576, 64, 19118, 4350, 947, 2354, 64, 40311, 187, 4, 3182, 10807, 64, 10114, 1322, 64, 39, 18576, 64, 19118, 4350, 947, 2354, 64, 40311, 187, 187, 4, 3709, 654, 15467, 16, 73, 3230, 16, 5397, 15, 17471, 31, 187, 4, 3709, 654, 15467, 16, 73, 3230, 16, 6443, 16, 9453, 15, 17471, 31, 535, 187, 30113, 64, 10114, 1322, 64, 28997, 32718, 9566, 64, 32077, 187, 50274, 39481, 33340, 247, 1318, 875, 1016, 4667, 273, 3603, 275, 247, 6486, 3425, 15, 187, 50274, 39481, 1214, 272, 47700, 1387, 14, 26102, 187, 50274, 39481, 187, 50274, 39481, 10300, 247, 6486, 2634, 26102, 65, 2634, 14831, 65, 342, 247, 4872, 1320, 273, 187, 50274, 39481, 2634, 60, 89, 18, 13, 1269, 19, 13, 34845, 1269, 79, 62, 11976, 2634, 16716, 43292, 9, 14831, 13, 1182, 10, 65, 310, 247, 747, 3425, 342, 247, 187, 50274, 39481, 4872, 1320, 273, 2634, 60, 89, 18, 13, 1182, 13, 1269, 19, 13, 1182, 13, 1269, 20, 13, 34845, 1269, 79, 14, 18, 13, 1182, 13, 1269, 79, 62, 16433, 496, 643, 187, 50274, 39481, 3000, 13, 352, 37034, 253, 2634, 91, 65, 3284, 875, 1046, 4667, 273, 3603, 273, 187, 50274, 39481, 253, 3236, 3425, 15, 1310, 253, 3425, 310, 6325, 390, 556, 247, 2014, 187, 50274, 39481, 3284, 13, 2634, 16716, 43292, 65, 6548, 253, 3425, 347, 14, 261, 15, 496, 512, 2219, 13, 187, 50274, 39481, 253, 3425, 1364, 320, 6486, 15, 187, 50274, 39481, 187, 50274, 39481, 187, 50274, 39481, 1214, 3575, 48361, 187, 50274, 39481, 380, 3425, 275, 534, 247, 1318, 310, 734, 1033, 398, 264, 15, 187, 50274, 39481, 187, 50274, 39481, 1214, 3575, 1182, 187, 50274, 39481, 380, 1318, 281, 320, 13400, 875, 1046, 4667, 273, 3603, 273, 253, 3425, 15, 187, 50274, 39481, 187, 50274, 39481, 187, 50274, 39481, 18466, 187, 50274, 39481, 14022, 187, 50274, 39481, 1214, 3709, 1650, 16, 16716, 43292, 15, 14161, 187, 4, 16238, 10807, 64, 10114, 1322, 64, 13220, 26431, 31183, 64, 1042, 55, 10249, 1703, 187, 50274, 3474, 18689, 6753, 734, 84, 43292, 426, 544, 880, 15149, 10494, 48361, 13, 6753, 10494, 1182, 10, 551, 187, 50270, 2309, 6809, 14, 3431, 4066, 2147, 28, 187, 50274, 4718, 187, 4, 7271, 187, 50274, 8547, 654, 15295, 322, 13, 7919, 426, 2991, 31, 187, 50274, 2855, 734, 84, 43292, 64, 15680, 1163, 734, 84, 43292, 64, 15680, 29, 52, 13, 672, 29, 5672, 5064, 551, 7734, 535, 50274, 2855, 734, 84, 43292, 64, 85, 551, 187, 50270, 8547, 654, 15295, 1594, 84, 13, 7919, 1503, 31, 187, 50270, 3474, 18689, 6753, 5572, 1082, 9, 57, 84, 10494, 48361, 13, 1503, 10494, 1182, 10, 1030, 28, 187, 50274, 4718, 535, 50274, 3474, 18689, 734, 84, 43292, 64, 85, 734, 84, 43292, 41619, 187, 4, 7287, 187, 30113, 64, 10114, 1322, 64, 28997, 32718, 9566, 64, 8112, 187, 187, 4, 7287, 1380, 2195, 30113, 64, 10114, 1322, 64, 39, 18576, 64, 19118, 4350, 947, 2354, 64, 40311, 187, 41, 9989, 457, 84, 380, 6317, 4461, 369, 15620, 327, 2395, 273, 1146, 3965, 564, 1171, 90, 285, 345, 12898, 1946, 285, 3164, 417, 512, 326, 1175, 13, 533, 309, 1335, 9047, 1046, 9037, 273, 352, 281, 690, 31733, 15, 6758, 310, 2139, 309, 457, 78, 247, 1652, 9049, 281, 923, 326, 20278, 457, 84, 644, 2218, 323, 247, 773, 4714, 14, 8658, 538, 3026, 32726, 24460, 4544, 4750, 254, 1806, 281, 320, 12819, 275, 271, 15146, 9037, 273, 253, 15146, 2952, 15, 3512, 273, 253, 1499, 18050, 763, 1255, 273, 380, 6317, 4461, 369, 849, 352, 5907, 247, 5965, 1321, 14, 14644, 14, 394, 276, 1007, 387, 3668, 3394, 326, 4592, 2067, 2607, 1128, 263, 1107, 13, 275, 690, 2219, 1128, 9131, 1046, 9037, 13, 594, 326, 22234, 322, 1064, 249, 812, 2085, 521, 2934, 273, 752, 253, 7445, 7031, 651, 457, 306, 3261, 751, 574, 644, 275, 987, 1020, 4179, 273, 776, 5674, 457, 84, 3668, 23812, 15, 16688, 345, 12898, 1834, 281, 327, 849, 359, 943, 457, 306, 3261, 387, 253, 17641, 4166, 28737, 690, 767, 1107, 846, 253, 958, 369, 247, 1652, 278, 1911, 2980, 15, 1292, 253, 4839, 281, 22077, 327, 849, 253, 24460, 4544, 943, 457, 306, 644, 6107, 689, 253, 1390, 807, 310, 253, 1511, 273, 3468, 14, 26621, 13, 269, 1595, 2348, 2602, 2910, 326, 322, 1064, 249, 816, 1912, 457, 85, 320, 2104, 281, 11623, 30906, 562, 273, 253, 5603, 13, 1677, 521, 973, 14, 34023, 12773, 1892, 14, 251, 15, 187, 187, 5623, 22924, 555, 320, 31833, 15, 31565, 273, 672, 285, 835, 253, 9037, 3936, 1659, 13, 10159, 273, 1880, 359, 1705, 275, 387, 253, 5068, 13, 4766, 390, 990, 273, 24460, 457, 84, 4544, 13, 10159, 273, 849, 1142, 2069, 322, 1064, 249, 588, 23103, 344, 457, 84, 816, 7746, 253, 5441, 13, 436, 9037, 310, 1469, 281, 990, 342, 247, 1943, 13, 6627, 10299, 3243, 273, 773, 71, 1807, 368, 668, 275, 1340, 281, 6780, 13, 2378, 969, 13, 326, 32726, 24460, 3663, 253, 12674, 6132, 407, 1146, 247, 41490, 25850, 564, 1171, 15, 733, 457, 84, 1469, 281, 320, 1633, 473, 13152, 42, 2185, 7084, 58, 33819, 42363, 1372, 25129, 751, 253, 24460, 4750, 254, 11741, 281, 1527, 247, 3369, 323, 271, 1711, 3416, 285, 9674, 34553 ]
self-assignment m2 = m2; m1 = m1; m1.debug_print(); f2.debug_print(); return 0; } Pushyanug Churna Pushyanuga Churna is found to be extremely beneficial in balancing the issue of Vatta, Pitta and Kapha Dosha. It is also a prominent Ayurvedic medicine for umpteen bleeding disorders. The major ingredients found in Pushyanuga Churna are Bilva Phal, Kali Mirch, Patha, Jamun Beej, Aam Giri, and Monika. These natural ingredients have the extreme health benefits throughout the body. Pushyanuga Churna is a fruitful Ayurvedic medicine for treating various stomach issues. It can manage to deal with Indigestion, Acidity, Hyperacidity, Constipation,Diarrhea, Heartburn, Bloating, and Pain in the stomach. It is found extremely beneficial in treating many gynecological complications. One can use such formulation to get rid of uterine infections. Menstrual disorder, Leucorrhea, Menorrhagia, Hemorrhoids, Menstrual Disorder, Premenstrual syndrome, and Raktapitta can be ameliorated by Pushyanug Churna. It is also found to be highly beneficial for healing inflammation and pain related issues. One can administer it 1 to 2 tablespoon of water after having the meal.User:Strayor From Gineipaedia, the Legend of Galactic Heroes wiki Hello everyone. I'm Strayor and have been a member of Gineipaedia for a year now. I edit mostly in articles dealing with the Imperials and various battles. Although my knowledge is lacking compared to some of the living LOGH encyclopedias that are our Admins, I still know enough to make contributions and am a frequent editor and reader on this wiki. Feel free to let me know if there is anything, even busy work, that is needed and I will see what I can do.Former Romania coach Lynn Howells has admitted that a Romanian referee should never have been put in charge of Spain's World Cup qualifier at the centre of a match-fixing row. Spain have submitted a complaint to World Rugby outlining 19 'unfair' decisions in last Sunday's 18-10 defeat by Belgium in Brussels- after which referee Vlad Iordachescu was chased off the pitch. Iordachescu was appointed before the tournament by Rugby Europe, whose president is Romanian International Olympic Committee member Octavian Morariu, but complaints about a conflict of interest were ignored. Vlad Iordachescu was the referee as Belgian pulled off a huge upset win over Spain on Sunday Romania needed Spain to lose to qualify - but Rugby Europe rejected Spanish requests to remove Iordachescu 20 days before the Test. Qualification is worth about £1.5million to Spain and Romania and pressure is increasing for the game to be replayed. Spain coach Santiago Santos said: 'World Rugby need to make justice. We have had support from all over the world.' Sir Clive Woodward called for a replay, prompting an angry response from Alin Petrache, president of Romanian Rugby Federation, who said: 'Clive Woodward is a pensioner with nothing to do.' Players clashed with eachother and the referee after the game which saw Belgium qualify Rugby Europe held an inquest to review the referee's performance on Friday. Spain made an official request for the review to be chaired by an independent body, such as the RFU, but it was ignored. The conclusions of the meeting will be relayed to Rugby Europe board members and World Rugby on Monday night. 'The whole system is Mickey Mouse,' said a Mail on Sunday source. 'Serious questions need to be asked of Rugby Europe.' Unless World Rugby act, Romania will be in a World Cup pool with Ireland, Scotland and Japan. They are seeking a new coach after Welshman Howells quit midway through the Six Nations B League. Ex-Romania coach Lynn Howells admitted that a Romanian should never have been in charge 'The referee shouldn't ever have been put in place for the end of the tournament,' Howells told the Mail on Sunday. 'I know Vlad very well and I'd be surprised if he'd been swayed by anything. I hope for rugby's sake that there has been no funny business and I've heard nothing to suggest there has been. 'Immaterial of who the referee was, there is no place in rugby union for teams to attack a referee.'At the dawn of December 28, 2013, the Provincial House Community welcomed with great joy and jubilation our esteemed guests and much loved Sister Mary Kristin and Sister Mary Sreeja. Since then the showers … The long awaited Golden day was dawned with all its blessings, excitement and joy as Sisters Mary Sujata, Dulari and Anupa celebrated their Golden Jubilee and Sister Priyanka who celebrated her Silver Jubilee on …/*! @file Forward declares `boost::hana::intersperse`. @copyright Louis Dionne 2013-2017 Distributed under the Boost Software License, Version 1.0. (See accompanying file LICENSE.md or copy at http://boost.org/LICENSE_1_0.txt) */ #ifndef BOOST_HANA_FWD_INTERSPERSE_HPP #define BOOST_HANA_FWD_INTERSPERSE_HPP #include <boost/hana/config.hpp> #include <boost/hana/core/when.hpp> BOOST_HANA_NAMESPACE_BEGIN //! Insert a value between each pair of elements in a finite sequence. //! @ingroup group-Sequence //! //! Given a finite `Sequence` `xs` with a linearization of //! `[x1, x2, ..., xn]`, `intersperse(xs, z)` is a new sequence with a //! linearization of `[x1, z, x2, z, x3, ..., xn-1, z, xn]`. In other //! words, it inserts the `z` element between every pair of elements of //! the original sequence. If the sequence is empty or has a single //! element, `intersperse` returns the sequence as-is. In all cases, //! the sequence must be finite. //! //! //! @param xs //! The sequence in which a value is interspersed. //! //! @param z //! The value to be inserted between every pair of elements of the sequence. //! //! //! Example //! ------- //! @include example/intersperse.cpp #ifdef BOOST_HANA_DOXYGEN_INVOKED constexpr auto intersperse = [](auto&& xs, auto&& z) { return tag-dispatched; }; #else template <typename S, typename = void> struct intersperse_impl : intersperse_impl<S, when<true>> { }; struct intersperse_t { template <typename Xs, typename Z> constexpr auto operator()(Xs&& xs, Z&& z) const; }; constexpr intersperse_t intersperse{}; #endif BOOST_HANA_NAMESPACE_END #endif // !BOOST_HANA_FWD_INTERSPERSE_HPP HBO’s The Newsroom was controversial on account of being pretty goofy and condescending and probably not all that good, but I still watched every episode of it to some enjoyment. Which is why I’m a little excited to see that casting’s been done for a “well-scrubbed Mitt Romney campaign staffer,” to be featured in an upcoming episode of the upcoming season. Part of the sluggishness of The Newsroom was how it offered a holier-than-thou look at news events that happened several months—or years, in some cases—before every episode, so that Aaron Sorkin could provide his idea of what the ideal coverage would’ve looked like had been in rightful charge of our nation’s news outlets. Being condescended to on how we should’ve looked at the BP oil spill some two years after the fact was a little maddening. But the chance to lecture on how the Romney campaign should’ve been covered over the last year is the type of slow-moving, fattened softball that Sorkin just won’t be able to resist knocking out of the park, given his well-documented liberal hard-on. Subtlety be damned. Regardless of when and where the episode takes place, regardless of whether we come in at the beginning, middle or end of Romney’s campaign, regardless of how many times Sorkin will insist he’s just telling the facts, this episode is going to end with a big, bright flashlight of “fuck you” in order to highlight, once again, that Mitt Romney lost the presidential election by being a gigantic sterile goof. It’s going to be something OBVIOUSLY METAPHORICAL like the Romney staffer failing to open a door for an old woman and subsequently yelling
[ 4483, 323, 12302, 3153, 44047, 32748, 2250, 15, 309, 457, 306, 760, 644, 4882, 323, 247, 1643, 1897, 13, 285, 309, 457, 306, 4270, 598, 619, 16879, 4310, 1811, 281, 247, 1659, 835, 954, 651, 1908, 479, 247, 7503, 773, 8656, 20173, 668, 1108, 259, 1412, 15, 309, 457, 78, 671, 9049, 281, 452, 17763, 532, 1562, 16951, 9251, 263, 2902, 2659, 275, 253, 5418, 41704, 3645, 4657, 6342, 15, 831, 622, 310, 247, 15143, 43273, 2902, 7512, 622, 326, 359, 806, 25044, 264, 387, 253, 5418, 41704, 3645, 8059, 275, 27687, 15, 187, 187, 2042, 368, 457, 306, 644, 970, 2045, 14649, 273, 5418, 41704, 20816, 13, 368, 457, 620, 871, 326, 352, 310, 7964, 247, 1364, 452, 323, 31754, 15, 309, 457, 306, 3542, 247, 1643, 2069, 275, 253, 2469, 670, 849, 253, 622, 2789, 634, 1495, 6927, 1223, 327, 253, 564, 15, 1422, 476, 2098, 13, 1984, 13, 8722, 13, 285, 3894, 616, 4288, 16669, 342, 3858, 13, 11651, 285, 327, 2675, 285, 5702, 6928, 1223, 327, 253, 564, 15, 187, 187, 15383, 41704, 20816, 323, 5418, 41704, 884, 3797, 512, 273, 253, 1270, 3386, 326, 1056, 4288, 2969, 323, 5418, 41704, 6383, 1690, 27, 47367, 34896, 1810, 7526, 13, 20816, 50002, 275, 5418, 41704, 15634, 13, 14469, 285, 2639, 416, 3950, 7225, 272, 13, 733, 7068, 552, 11354, 13, 8404, 1608, 1875, 13, 14736, 2884, 4380, 13, 285, 6865, 14, 52, 3292, 29806, 15, 1623, 1755, 273, 326, 627, 403, 671, 690, 747, 3386, 2879, 347, 973, 15, 187, 187, 9063, 731, 562, 1060, 27, 187, 187, 53, 7417, 20364, 1608, 1875, 1108, 733, 457, 84, 1024, 1014, 6927, 281, 1501, 634, 7408, 11269, 327, 378, 8417, 13, 6745, 13, 7879, 285, 43565, 15, 2726, 34896, 20364, 1608, 1875, 13, 368, 476, 1978, 634, 3858, 285, 11651, 598, 14, 936, 14, 2754, 327, 634, 4288, 27420, 4745, 347, 597, 46196, 15, 187, 187, 39, 3243, 20364, 1608, 1875, 1108, 5418, 41704, 20816, 556, 1900, 4934, 368, 598, 14, 936, 14, 2754, 342, 1524, 14, 2606, 8630, 3708, 265, 285, 342, 5418, 41704, 20816, 323, 5418, 41704, 884, 13, 368, 476, 3894, 436, 1491, 342, 634, 11651, 13, 3858, 285, 2675, 6928, 15, 1310, 634, 8630, 310, 13444, 13, 26224, 390, 4391, 20737, 13, 368, 476, 4354, 285, 4541, 4151, 2571, 285, 1056, 2119, 597, 871, 672, 285, 835, 281, 2619, 368, 598, 432, 253, 13952, 15, 187, 187, 21333, 37330, 84, 13, 15836, 5566, 398, 285, 5863, 25013, 1108, 380, 747, 16040, 37330, 2579, 342, 5418, 41704, 20816, 323, 5418, 41704, 884, 7729, 5416, 368, 457, 250, 1900, 2970, 253, 1682, 8614, 2968, 15, 733, 588, 1691, 634, 2564, 387, 11990, 285, 8356, 24651, 368, 604, 627, 457, 84, 247, 1805, 4376, 323, 253, 8614, 2316, 368, 32346, 13, 247, 10870, 8614, 323, 247, 20182, 4376, 13, 390, 604, 627, 457, 84, 247, 1199, 1805, 8614, 323, 5777, 625, 15, 496, 1142, 2219, 13, 368, 476, 14002, 634, 3236, 30170, 1293, 12339, 285, 294, 14, 3305, 253, 1805, 2968, 949, 5418, 41704, 20816, 15, 187, 187, 15383, 41704, 5417, 1108, 2726, 5418, 41704, 5417, 13, 368, 457, 620, 1620, 452, 281, 16164, 281, 5418, 41704, 20816, 969, 15, 1422, 457, 620, 452, 8164, 2289, 281, 512, 273, 697, 3386, 347, 3517, 347, 368, 8027, 253, 622, 15, 4952, 327, 634, 806, 673, 970, 5418, 41704, 20816, 13, 5418, 41704, 5417, 588, 8356, 7522, 275, 253, 12960, 830, 323, 368, 15, 187, 187, 2042, 326, 457, 84, 1694, 368, 9049, 13, 368, 457, 250, 417, 3815, 1108, 285, 1805, 2568, 352, 457, 84, 2130, 347, 247, 1959, 6184, 327, 253, 5418, 41704, 3645, 4657, 6342, 15, 26722, 667, 19055, 275, 253, 2822, 2852, 32, 2325, 2119, 281, 3894, 253, 18349, 342, 441, 275, 253, 5701, 13, 285, 604, 368, 457, 306, 1694, 667, 12192, 323, 970, 5418, 41704, 20816, 13, 359, 457, 69, 2389, 281, 4089, 634, 2926, 15, 187, 187, 7845, 3877, 253, 622, 778, 1379, 598, 281, 2164, 3038, 281, 3176, 275, 253, 5418, 41704, 3645, 16106, 6342, 15, 187, 187, 1552, 2129, 10880, 2448, 32678, 13, 534, 2097, 326, 253, 8386, 14, 2727, 281, 253, 23193, 556, 15335, 13207, 2, 733, 457, 84, 1774, 323, 479, 281, 6558, 21188, 13, 533, 347, 247, 13817, 6706, 16118, 3377, 13, 309, 751, 281, 19837, 731, 342, 747, 10296, 15, 3856, 403, 619, 7583, 12192, 323, 970, 634, 5418, 41704, 1191, 108, 2813, 1309, 253, 23193, 15, 3771, 1053, 457, 85, 755, 352, 1512, 2810, 281, 253, 278, 6948, 20951, 285, 7462, 90, 2, 187, 187, 20133, 253, 40323, 18517, 407, 10535, 272, 14, 10854, 8937, 41442, 285, 13135, 2370, 27, 3166, 368, 452, 667, 28234, 368, 457, 250, 642, 3356, 970, 32, 775, 1972, 403, 627, 457, 84, 3095, 275, 634, 1943, 2021, 390, 2675, 2990, 326, 812, 897, 731, 13, 594, 3324, 731, 2112, 281, 634, 13319, 50084, 2, 313, 1147, 457, 84, 22335, 417, 247, 773, 250, 14, 72, 2094, 1425, 10, 187, 187, 510, 43149, 422, 399, 5338, 1108, 35211, 763, 26391, 17218, 3008, 5464, 27, 1198, 776, 4651, 285, 37186, 13, 1907, 247, 6109, 2813, 387, 253, 8955, 2829, 310, 247, 2201, 2802, 2369, 642, 9027, 9110, 275, 619, 2021, 13, 359, 897, 776, 6109, 4095, 1309, 16961, 281, 1379, 7963, 13, 5007, 11269, 281, 776, 2675, 6928, 13, 285, 281, 5007, 3304, 26984, 281, 581, 1529, 3066, 5418, 41704, 1191, 108, 48979, 313, 35, 8417, 3384, 215, 97, 481, 34747, 253, 2802, 18074, 290, 457, 390, 2802, 55, 2560, 366, 457, 6222, 327, 634, 21679, 1309, 16961, 13, 285, 604, 368, 457, 69, 751, 13, 36219, 634, 5818, 1299, 265, 13, 30584, 390, 34854, 15, 187, 187, 3848, 777, 253, 6696, 84, 342, 247, 36355, 272, 14628, 27, 2091, 368, 457, 250, 25945, 13, 13828, 247, 16153, 4660, 275, 7170, 588, 1581, 368, 281, 1790, 896, 285, 7921, 15, 18025, 249, 763, 13319, 4073, 407, 6941, 634, 12958, 281, 4179, 616, 5418, 41704, 4095, 12200, 253, 270, 602, 84, 273, 5965, 314, 15, 187, 187, 25727, 907, 247, 16428, 24180, 6915, 5402, 5418, 41704, 10223, 12323, 5270, 85, 27, 844, 457, 306, 1705, 247, 1048, 1039, 432, 7968, 342, 12126, 387, 253, 28974, 15, 3954, 13, 3492, 19485, 84, 24555, 15, 3932, 1142, 273, 619, 3858, 285, 2021, 2758, 3153, 2080, 1977, 13, 309, 2389, 970, 253, 16428, 24180, 622, 327, 619, 5418, 41704, 1191, 108, 10223, 12323, 3384, 215, 97, 19801, 281, 5007, 1175, 16995, 1309, 253, 23193, 15, 29574, 897, 634, 5418, 41704, 10223, 12323, 19801, 281, 9232, 253, 10721, 273, 10262, 1146, 5909, 327, 634, 2813, 15, 187, 187, 4678, 271, 18328, 20745, 14, 5683, 1294, 27, 309, 457, 78, 1900, 6276, 896, 285, 6593, 875, 253, 13952, 13, 8264, 7695, 390, 18752, 745, 12942, 15, 1916, 1056, 2119, 309, 1620, 2985, 8630, 5778, 390, 26667, 30584, 13, 309, 897, 253, 5418, 41704, 8942, 20816, 14313, 622, 15, 733, 11359, 512, 7408, 1491, 275, 581, 1659, 2, 1310, 368, 457, 250, 253, 581, 2509, 253, 22710, 13, 368, 476, 1379, 2120, 5750, 672, 7219, 634, 13319, 15865, 15, 187, 187, 17570, 441, 27, 752, 403, 634, 13319, 21188, 32, 20930, 690, 6281, 342, 441, 275, 253, 4385, 2593, 2708, 15, 187, 187, 3378, 5768, 816, 759, 22230, 1475, 253, 7145, 13, 752, 1805, 1039, 281, 10347, 685, 281, 6184, 690, 273, 776, 7583, 5418, 41704, 8942, 11222, 323, 5768, 32, 380, 5418, 41704, 2051, 3645, 14313, 4657, 6342, 556, 1694, 368, 6107, 323, 253, 1048, 14, 11415, 959, 2952, 15, 48606, 634, 32353, 13, 29502, 38330, 285, 273, 2282, 634, 5418, 41704, 8942, 21679, 390, 5418, 41704, 8942, 10223, 12323, 14313, 19801, 13, 285, 2451, 562, 841, 11222, 27, 187, 187, 56, 1479, 3396, 818, 15, 17, 27, 831, 2129, 13, 45155, 3396, 6808, 247, 2201, 5731, 281, 616, 4633, 285, 2221, 4217, 31612, 6612, 622, 15, 309, 457, 306, 644, 970, 253, 747, 2715, 285, 253, 747, 9251, 263, 2902, 12693, 10316, 253, 2793, 281, 247, 747, 1268, 15, 733, 8077, 7790, 3253, 715, 1264, 2022, 6849, 27, 401, 15100, 3254, 13, 5721, 30387, 285, 330, 22288, 15, 733, 457, 84, 7964, 247, 794, 1039, 281, 9413, 747, 952, 13, 5053, 285, 1841, 1475, 368, 970, 634, 5418, 41704, 21679, 15, 1893, 672, 368, 457, 250, 562, 285, 670, 18216, 436, 5768, 13, 320, 2119, 281, 897, 253, 45155, 3396, 3645, 44328, 281, 923, 634, 27762, 275, 271, 7094, 747, 1039, 15, 21578, 45155, 3396, 1024, 15, 187, 187, 15383, 41704, 8942, 20816, 27, 26722, 281, 755, 1977, 323, 247, 1652, 1551, 285, 17040, 436, 5768, 32, 5418, 41704, 20816, 310, 247, 1364, 14, 14626, 622, 15, 733, 10111, 512, 273, 634, 5667, 7408, 1491, 275, 581, 24783, 6308, 13, 5043, 352, 8356, 20947, 634, 34272, 323, 4288, 44414, 3927, 594, 368, 1053, 457, 85, 452, 281, 3186, 323, 1841, 751, 16883, 3904, 13, 20818, 13, 285, 12453, 15, 733, 671, 3400, 8630, 3708, 11269, 13, 8588, 1491, 13, 1980, 3186, 3470, 285, 3477, 30170, 5657, 15, 11668, 253, 4073, 562, 273, 22710, 1108, 897, 5418, 41704, 20816, 281, 1978, 368, 10932, 285, 8191, 15, 21578, 5418, 41704, 8942, 20816, 1060, 15, 187, 187, 33466, 1059, 27, 14538, 5082, 457, 85, 320, 5768, 1293, 5352, 2739, 2, 380, 13624, 273, 253, 22819, 50, 13, 14402, 79, 982, 275, 253, 5603, 13, 22952, 26791, 2866, 4952, 604, 368, 457, 250, 247, 747, 17782, 275, 253, 8576, 13, 11980, 1059, 556, 512, 368, 878, 281, 755, 12398, 436, 5768, 15, 733, 3797, 3114, 14, 33349, 20247, 13, 4522, 398, 13, 12192, 285, 11484, 13991, 15, 1310, 368, 457, 250, 347, 9049, 347, 309, 717, 670, 5768, 12398, 13, 2451, 562, 11980, 1059, 323, 253, 5418, 41704, 10223, 12323, 19801, 15, 187, 187, 18948, 310, 987, 1475, 253, 7145, 13, 594, 627, 457, 84, 642, 673, 281, 8138, 1108, 6184, 253, 5418, 41704, 11222, 1840, 432, 5418, 41704, 2051, 3645, 3063, 285, 755, 4704, 281, 452, 247, 1270, 5768, 2, 187, 187, 2214, 1110, 665, 403, 417, 6600, 13, 378, 8417, 4802, 4893, 19837, 378, 8417, 13175, 987, 715, 253, 622, 13, 594, 368, 476, 513, 1841, 751, 19864, 378, 8417, 3858, 281, 2793, 634, 7583, 11222, 13, 12939, 342, 378, 8417, 12716, 432, 3304, 253, 378, 8417, 4802, 622, 13, 285, 3894, 285, 9413, 747, 5418, 41704, 11222, 285, 2600, 342, 3858, 1108, 1293, 2455, 6108, 253, 622, 2, 187, 187, 6872, 4893, 452, 247, 2644, 747, 48602, 273, 3386, 326, 1056, 634, 5418, 41704, 21679, 2793, 1014, 1805, 15, 1281, 457, 84, 452, 247, 1007, 27, 187, 187, 35, 8417, 4850, 5418, 41704, 17750, 3470, 285, 747, 21530, 1323, 255, 1032, 2, 187, 187, 35, 8417, 310, 1146, 29101, 281, 320, 1805, 685, 2455, 342, 5418, 41704, 8942, 17750, 9554, 2992, 253, 3745, 281, 5007, 4318, 7211, 31124, 13, 247, 19554, 1039, 281, 5731, 634, 6222, 3935, 13, 285, 747, 622, 2899, 569, 15, 187, 187, 1992, 823, 281, 512, 273, 436, 13, 378, 8417, 362, 23, 15, 19, 1024, 6131, 247, 3410, 273, 512, 747, 21530, 1323, 255, 1032, 2, 2091, 368, 457, 250, 24917, 715, 378, 8417, 13, 816, 14084, 689, 253, 21530, 1323, 255, 1032, 281, 923, 752, 597, 513, 13, 840, 3894, 731, 342, 3858, 281, 3890, 849, 368, 457, 250, 5471, 672, 3000, 3815, 816, 6403, 457, 85, 2217, 15, 187, 187, 29653, 318, 273, 6745, 285, 7879, 342, 378, 8417, 187, 187, 25116, 323, 5418, 41704, 33188, 362, 20, 15, 17, 285, 7879, 323, 5418, 41704, 33188, 362, 20, 15, 17, 403, 1024, 378, 8417, 4802, 11222, 15, 2091, 368, 4684, 6745, 285, 7879, 342, 378, 8417, 13, 368, 476, 3894, 634, 6323, 3708, 11269, 285, 28311, 347, 634, 378, 8417, 23307, 17775, 407, 3365, 17221, 253, 773, 18281, 342, 378, 8417, 668, 10651, 432, 1561, 253, 622, 15, 1422, 476, 671, 1478, 281, 3894, 28311, 390, 6745, 11269, 342, 634, 378, 8417, 12716, 275, 581, 36409, 4328, 15, 187, 187, 15383, 41704, 20816, 4566, 8404, 187, 187, 510, 9300, 5418, 41704, 20816, 362, 19, 15, 22, 11, 310, 1024, 247, 378, 8417, 4802, 622, 15, 1737, 1057, 326, 1599, 281, 368, 32, 3954, 368, 476, 18319, 5731, 378, 8417, 12716, 342, 634, 4288, 3708, 275, 816, 247, 1643, 2969, 5018, 15, 27430, 14, 28617, 2439, 253, 1533, 32, 1422, 476 ]
allows for exciting live multiplayer poker action. I’ve only been playing for a few days, and I’ve built up my fantasy bankroll to a place where most would consider me a virtual “high roller” – woot. I’m also excited to have Occipital 360 Panorama land in the BlackBerry World storefront. This app is a fantastic panorama photo app that we first previewed at the BlackBerry World conference in Orlando. If you’ve been using previous generations of BlackBerry Travel, you’ll know that it is definitely a must have for travelers. I’ve written a few times in the past about how the app makes your life easier while on the go. You can plan, book, manage, and share their travel arrangements with friends, colleagues and on social and professional networks while on the go. BlackBerry Travel for BlackBerry 10 includes all of the great features that make travel simple for BlackBerry customers including: Automatic Trip Scanning, Travel Notification in BlackBerry Hub, Hotel and Car Rental Booking, Itinerary Management, Social Sharing, Search Flights, and Time-Saving Tools. On top of that there are also some new features added as well. Check them out here: Trip Status Sharing – It’s now even easier to post your trip updates on BBM, Facebook, Twitter and LinkedIn. With Trip Status Sharing, you can keep your friends and colleagues up-to-date on your travel adventures immediately as they unfold. Flight Status Sharing – BlackBerry Travel has always kept you up-to-date with real-time flight statuses and with BlackBerry Travel for BlackBerry 10, you can share this information with your colleagues, friends and social networks. If your flight is delayed, cancelled or changed terminals, you can easily and quickly inform others and make sure they know when and where to pick you up from the airport. Price Alerts, Change Offers and Upgrades – The new Price Alert service with BlackBerry Travel for BlackBerry 10 helps ensure you’re always getting the best hotel deal. It will put your mind at ease and automatically notify you if there’s a better price for the hotel room you booked, a comparable hotel for a cheaper price, or if there’s a much better hotel for slightly more. In many cases, you can cancel your original booking without penalty and re-book the better deal through BlackBerry Travel. BlackBerry ID – With BlackBerry ID, you’ll never have to login to BlackBerry Travel again. You’ll have instant access to all of its features as soon as you launch the app. Even on your first time using BlackBerry Travel, BlackBerry ID will automatically fill in the registration form for you. If that’s got you excited, you’re not alone – and better yet it’s available as a free download on the BlackBerry World storefront. Planning any trips in the near future? Be sure to share the excitement with us in the comments, and if you’ve got any tips for using BlackBerry Travel, we’d love to hear your story. Please note the app may take up to 24 hours to appear in the BlackBerry World Storefront. This week marks American Thanksgiving, which means that the kick-off to the holidays has officially begun! It’s important for me to maintain traditions, but as a tech aficionado, I like to integrate them with new technologies. Here are my favorite tips for using your BlackBerry ® device during the holidays. Just don’t get it too close to the mashed potatoes and gravy! Master the Gift Exchange by Handing-Down Old Devices and Accessories: Do you have any accessories you’re no longer using? Chances are there’s someone in your big family or social network that could use them, so bring them along to your holiday gatherings! (It’s technically not a “re-gift.”) The Festive Dinner – Establish Phone Etiquette: For our parents and grandparents, having a mobile device at the dinner table is a major ‘no no.’ Yet in my family, we use our mobile devices during meals to take photos, send updates to our social networks, and to send inside jokes to one another via BlackBerry ® Messenger (BBM ™). Enable the ‘Silent’ or ‘Vibrate’ profile on your smartphone during meals, and if you’d like, customize your ringtones, notifications or alerts. Deck the Halls with a Charging Station: When you’re entertaining, preparing a charging station in advance will allow you to sit back and relax. Diminish holiday stress by allowing your guests to charge their BlackBerry devices beside the boughs of holly. Organize a Video Chat Using Your BlackBerry PlayBook Tablet: We’ve come a long way from pictures with Santa at the mall. Now, video reigns supreme. Since many of my friends and family members live far away, I love using the Video Chat app on my BlackBerry ® PlayBook ™ tablet to send good wishes during the holidays. Simply use your BlackBerry PlayBook tablet to capture the magic of presents being opening on your device. Be an Airport Pick-Up Pro: I’m always driving back and forth between the airport, fetching or dropping off visitors. To make sure I never miss flight delay or cancellation notifications, I use the BlackBerry® Travel™ app. It keeps all trip information in one place! If you’re the one doing the travelling, you can take full advantage when planning your holiday adventure. Tell us: what are your holiday traditions? Share some stories with us in the comment section below. With summer just peeking around the corner, what better way to prepare than to download some of our favorite BlackBerry® apps for summer? The BlackBerry App World™ storefront has got you covered for the long-awaited season. Grab your shorts, sunglasses and of course your BlackBerry® smartphone or BlackBerry® PlayBook™ tablet, and check out these apps: Wikitude 7.0: This week, Wikitude issued a major update to their popular and super useful augmented reality app. I’ve been using the new version and the new Panorama UI brings the experience to a new level. It simplifies everything into three main views: Favorites, Featured and Categories. It’s definitely a fun way to discover new people, places and things around you using your BlackBerry smartphone. So when you’re out and about exploring this summer, be sure to use the Wikitude World Browser to see your surroundings in an entirely new way. Download Wikitude now. BlackBerry® Travel: Planning to get away for a little rest and relaxation this summer? BlackBerry Travel is a must-try app. It stores all of your essential trip information in one handy spot, plus it automatically scans your inbox for travel itineraries so you don’t have to search for things like confirmation numbers, flights, and addresses. It also provides flight status updates, weather information, local search functions and easy booking tools. Take the stress out of travelling – use BlackBerry Travel to keep you organized and informed. Download BlackBerry® Travel here. Cooklet: Summer wouldn’t be summer without fresh food! The smell of the BBQ, picnics in the park, seasonal flavors… Even if you’re a newbie in the kitchen, Cooklet has all you need to get cooking this summer. It includes community-reviewed recipes, timers, tips and meal suggestions. If you’re as excited as I am about summer cooking, check out Cooklet for the BlackBerry PlayBook tablet. June is right around the corner, so there’s no time to waste – download the BlackBerry apps above from BlackBerry App World today and get ready to have a great summer! For those who are not aware, BBM connected applications integrate BBM functionality right into the app, so you can do things like invite BBM friends to experience your favorite apps, chat with BBM contacts from inside the BBM connected app, and share and discover new BlackBerry apps and content with friends – without ever leaving the app! These applications have a whole new slew of features that make your BlackBerry smartphone experience even better. Let’s have a look: BBM gets BlackBerry Tag functions and new animated avatars! BBM is being upgraded to be better than ever with BlackBerry® Tag integration*, the ability to send voice notes quicker, a simpler way to update your profile message, and new app integrations. To add to all of this, BBM v6.2 now offers a sample of all new animated avatars! When you’re logged into BBM, just scroll over the animated avatars to see what they do, then share them with friends to express how you’re feeling when words alone just aren’t enough. Integration of Facebook and Twitter with BBM Facebook for BlackBerry smartphones v3.0 and Twitter for BlackBerry smartphones v3.0 are now BBM connected apps. When you connect Facebook and Twitter with BBM, you can share your latest status updates and tweets as your BBM Personal Message by simply selecting the “Share with BBM” icon from within the app. You can also opt to share tweets or Facebook updates with your BBM contacts in one centralized location. BlackBerry Travel goes Social The updated BlackBerry Travel v2.5* is now a BBM connected app. What does that mean to you? Now you can instantly update BBM contacts with your travel status in just a few simple steps. Jet-setting across the world? You can
[ 4512, 14536, 5333, 273, 253, 2601, 432, 253, 6069, 4055, 281, 253, 6069, 6384, 275, 6589, 44, 14, 10247, 1341, 15, 187, 187, 19, 15, 21, 15, 427, 3123, 34, 38826, 351, 832, 24485, 12151, 84, 281, 34129, 3086, 427, 9122, 14, 31545, 36233, 285, 16009, 12260, 11641, 46484, 338, 3328, 275, 427, 9122, 14, 31545, 14, 40385, 15993, 1712, 1704, 19, 5256, 21, 14, 7610, 14, 938, 14, 17884, 1549, 94, 187, 39423, 6846, 187, 187, 1909, 512, 3636, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 4375, 403, 15783, 281, 253, 6589, 44, 4865, 5028, 273, 427, 3123, 34, 2470, 2841, 374, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 4699, 910, 709, 14, 881, 568, 926, 986, 36, 582, 359, 24045, 326, 253, 427, 9122, 14, 31545, 14, 6367, 13655, 273, 427, 3123, 34, 1537, 6990, 253, 427, 3123, 34, 14, 47, 9122, 14, 31545, 5016, 15, 3813, 13, 359, 2684, 820, 14, 13111, 27447, 3535, 12277, 273, 427, 9122, 14, 31545, 285, 1027, 427, 3123, 34, 15396, 15, 187, 187, 42625, 13, 359, 497, 2104, 281, 921, 326, 253, 38968, 14, 25652, 427, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 10500, 22294, 427, 9122, 14, 31545, 342, 247, 3012, 2169, 15430, 685, 4956, 14, 881, 427, 3123, 34, 2470, 2841, 608, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 5523, 910, 709, 14, 881, 568, 926, 986, 34, 13, 35, 481, 3813, 13, 359, 7525, 326, 253, 13655, 273, 427, 3123, 34, 2220, 427, 9122, 14, 31545, 2048, 3133, 281, 2701, 253, 4865, 273, 427, 9122, 14, 31545, 281, 427, 3123, 34, 13, 534, 359, 30821, 812, 320, 1774, 323, 253, 427, 9122, 14, 31545, 2425, 285, 14536, 273, 427, 9122, 14, 31545, 281, 253, 15848, 15, 187, 187, 688, 1340, 281, 2007, 12106, 253, 5164, 2538, 273, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 13, 359, 4561, 247, 11086, 16, 39, 20, 894, 1386, 13002, 253, 427, 3123, 34, 4956, 1511, 390, 253, 38968, 14, 25652, 427, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 10500, 13, 347, 973, 347, 427, 9122, 14, 31545, 970, 13767, 46476, 5066, 15, 427, 3123, 34, 313, 78, 40750, 10, 285, 427, 9122, 14, 31545, 313, 49677, 10, 2048, 2220, 820, 14, 30295, 369, 5783, 407, 40344, 285, 2685, 22623, 2470, 2841, 608, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 5523, 910, 709, 14, 881, 568, 926, 986, 36, 13, 37, 481, 1916, 1263, 253, 4833, 273, 427, 9122, 14, 31545, 14, 6160, 427, 3123, 34, 13655, 327, 894, 9489, 13, 359, 2684, 271, 353, 6901, 9489, 6981, 15, 1284, 2011, 275, 544, 2841, 608, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 5523, 910, 709, 14, 881, 568, 926, 986, 38, 13, 253, 38968, 14, 25652, 427, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 10500, 2692, 247, 4512, 5141, 275, 894, 3116, 2429, 281, 4956, 1511, 427, 3123, 34, 2220, 427, 9122, 14, 31545, 2048, 15, 2053, 1543, 812, 320, 5783, 407, 2602, 21703, 9489, 12277, 342, 475, 47, 532, 66, 4842, 25652, 10616, 13139, 13002, 427, 9122, 14, 31545, 2366, 342, 29565, 14, 47, 3123, 34, 22923, 390, 29565, 14, 47, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 313, 38338, 544, 2841, 322, 20, 34, 283, 36, 1084, 1212, 18, 14, 7610, 14, 938, 14, 17884, 1549, 910, 709, 14, 881, 568, 1212, 9471, 533, 969, 13, 760, 247, 5884, 533, 1534, 1055, 812, 320, 2540, 15, 3813, 13, 359, 7945, 326, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 3133, 281, 4833, 894, 9489, 275, 271, 43257, 5133, 13, 3738, 841, 2538, 778, 417, 1132, 247, 9560, 2554, 275, 427, 9122, 14, 31545, 14, 11181, 6946, 297, 6533, 6090, 15, 187, 187, 53, 2114, 2366, 13, 359, 3636, 2620, 34248, 16, 394, 31997, 460, 12359, 313, 6075, 14, 23922, 13, 4165, 14, 22543, 13, 4165, 14, 23139, 13, 4165, 14, 30169, 285, 39285, 14, 25745, 10, 347, 13655, 4375, 275, 427, 3123, 34, 281, 320, 3012, 5802, 2220, 427, 9122, 14, 31545, 2048, 342, 7534, 3486, 327, 427, 3123, 34, 14, 47, 9122, 14, 31545, 5016, 15, 38826, 590, 4004, 1057, 6747, 1818, 253, 322, 7386, 63, 47, 3123, 34, 8011, 19017, 4702, 4543, 16178, 253, 427, 3123, 34, 14536, 15, 7949, 5537, 273, 841, 427, 3123, 34, 34248, 16, 394, 31997, 460, 12359, 3977, 281, 247, 3012, 2559, 427, 3123, 34, 14, 47, 9122, 14, 31545, 4865, 5350, 347, 973, 347, 5777, 3777, 9489, 275, 11086, 16, 39, 20, 1341, 285, 10616, 13139, 15, 187, 187, 20, 15, 21561, 1712, 1704, 20, 14, 7610, 14, 938, 14, 17884, 1549, 94, 187, 18669, 187, 187, 510, 18695, 7736, 25367, 11725, 427, 9122, 14, 31545, 18653, 37486, 5755, 407, 4865, 285, 27149, 2067, 4324, 3206, 275, 3270, 38159, 13, 1964, 262, 7736, 285, 27197, 9130, 15, 496, 1635, 13, 2067, 18304, 285, 894, 5880, 10545, 2616, 326, 1132, 247, 2554, 275, 427, 9122, 14, 31545, 14, 11181, 46245, 452, 644, 4102, 3636, 1254, 35, 1010, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 1723, 13, 253, 5787, 5122, 15979, 281, 253, 5799, 18695, 7736, 3386, 273, 427, 9122, 14, 31545, 310, 1335, 417, 4751, 7192, 15, 187, 187, 510, 401, 14, 3364, 2601, 427, 3123, 34, 13, 534, 310, 3206, 275, 894, 5880, 7248, 1254, 35, 883, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 556, 644, 3636, 347, 247, 4865, 7832, 273, 427, 9122, 14, 31545, 4283, 281, 697, 39934, 13655, 1254, 35, 740, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 805, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 496, 436, 1263, 13, 359, 7568, 894, 14, 16441, 14, 17777, 427, 3123, 34, 13655, 275, 427, 9122, 14, 31545, 14, 10247, 6589, 3207, 1341, 15, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 858, 6747, 2818, 894, 5880, 2281, 4543, 322, 7386, 63, 47, 3123, 34, 8011, 19017, 2605, 13, 7738, 247, 894, 14, 16441, 14, 17777, 1159, 273, 427, 3123, 34, 10564, 407, 436, 13655, 15, 187, 187, 1909, 18695, 7736, 25367, 11725, 13, 427, 9122, 14, 31545, 310, 1929, 281, 10857, 12579, 285, 17561, 2067, 4324, 27, 12229, 20, 347, 247, 2201, 4760, 275, 6589, 3207, 310, 3598, 34373, 31232, 407, 4865, 281, 427, 9122, 14, 31545, 13, 285, 7624, 17904, 281, 24964, 19556, 1254, 35, 1036, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1166, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1093, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 746, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 938, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 5076, 13, 427, 9122, 14, 31545, 38136, 14328, 20, 44, 268, 2227, 20560, 4283, 281, 253, 5743, 273, 253, 14328, 20, 44, 16, 41737, 7178, 15979, 281, 6589, 44, 12, 6589, 3207, 10005, 1254, 35, 1797, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 14117, 4324, 10564, 407, 427, 9122, 14, 31545, 4865, 403, 13, 299, 15, 72, 904, 3437, 1229, 1254, 35, 1423, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 49165, 14, 7072, 1254, 35, 1508, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 12229, 18, 1254, 35, 1348, 14, 7610, 14, 938, 14, 17884, 1549, 1184, 285, 253, 322, 3373, 11725, 7266, 1549, 1254, 35, 23, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 512, 1146, 3206, 275, 46245, 407, 22474, 894, 9489, 15, 187, 187, 4943, 13, 359, 3636, 2620, 427, 9122, 14, 31545, 14, 6367, 427, 3123, 34, 13655, 4375, 4441, 327, 4165, 14, 23922, 13, 4165, 14, 22543, 13, 4165, 14, 23139, 13, 4165, 14, 30169, 285, 39285, 14, 25745, 13, 534, 9184, 432, 253, 29494, 19, 14, 6367, 34248, 12359, 31232, 1309, 894, 5880, 10005, 1254, 35, 883, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1012, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 3932, 253, 3636, 13655, 4375, 403, 1151, 1100, 285, 289, 31997, 1100, 352, 3133, 11543, 326, 253, 25367, 11725, 6589, 44, 10857, 77, 684, 427, 3123, 34, 3587, 15, 427, 9122, 14, 31545, 38197, 7418, 15450, 8571, 285, 7601, 9130, 6830, 3206, 275, 38744, 697, 18695, 39873, 13, 7624, 417, 760, 4283, 281, 25367, 533, 671, 34248, 13655, 824, 347, 322, 26, 14, 10339, 44, 20, 5346, 407, 14328, 20, 44, 16, 49775, 1254, 35, 1099, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 8079, 13, 39172, 5124, 34022, 452, 644, 3786, 3636, 275, 427, 9122, 14, 31545, 14, 31464, 1341, 1690, 247, 1781, 1180, 273, 34248, 16, 394, 31997, 460, 31232, 4324, 1254, 35, 1731, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 43275, 34248, 16, 394, 31997, 460, 30447, 10564, 407, 427, 9122, 14, 31545, 313, 74, 15, 70, 904, 10616, 44, 16, 32344, 13, 278, 22097, 13, 1847, 20, 44, 16, 49775, 10, 1254, 35, 22, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 24, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 25, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 26, 14, 7610, 14, 938, 14, 17884, 1549, 1184, 812, 320, 2783, 347, 2442, 30447, 323, 427, 3123, 34, 13655, 27, 380, 3636, 13655, 4375, 18705, 906, 275, 29494, 18, 16, 19, 13, 44454, 18, 285, 268, 1839, 13820, 44, 8981, 4375, 13, 534, 310, 275, 1386, 342, 253, 9311, 273, 6192, 797, 1162, 355, 15, 4645, 15506, 427, 3123, 34, 13655, 2220, 32406, 10680, 1971, 275, 1341, 13002, 427, 9122, 14, 31545, 1254, 35, 805, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 7624, 41894, 253, 6349, 273, 253, 13430, 14, 5914, 1169, 323, 427, 3123, 34, 13655, 15, 14522, 13, 253, 3636, 13655, 4375, 403, 4441, 275, 247, 1355, 2170, 273, 253, 2601, 1532, 4609, 3797, 253, 6589, 44, 14, 13018, 5028, 1254, 35, 740, 14, 7610, 14, 938, 14, 17884, 1549, 1184, 1532, 35640, 272, 247, 1480, 1055, 327, 253, 4865, 2341, 273, 253, 2570, 1254, 35, 1630, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1619, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 496, 958, 13, 275, 436, 789, 253, 38968, 14, 25652, 427, 3123, 34, 10500, 2692, 3012, 2559, 427, 9122, 14, 31545, 4865, 2429, 281, 4956, 1511, 427, 3123, 34, 15, 427, 3123, 34, 556, 2168, 644, 3636, 347, 247, 6069, 2601, 13, 1223, 253, 47625, 14536, 273, 427, 9122, 14, 31545, 310, 1097, 6069, 285, 24256, 1254, 35, 1047, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 733, 369, 2168, 8025, 326, 6069, 14, 46033, 427, 3123, 34, 310, 2104, 281, 774, 3100, 907, 6589, 44, 11781, 4324, 715, 253, 13787, 1254, 35, 740, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 3813, 13, 359, 24045, 326, 253, 5016, 285, 13655, 273, 427, 3123, 34, 1537, 4833, 253, 14536, 273, 427, 9122, 14, 31545, 390, 427, 3123, 34, 15, 3856, 359, 812, 921, 326, 253, 38968, 14, 25652, 427, 3123, 34, 10500, 22294, 427, 9122, 14, 31545, 281, 247, 2169, 6070, 347, 31232, 427, 3123, 34, 285, 1537, 7624, 13280, 253, 2601, 275, 253, 13787, 15, 1284, 760, 24256, 427, 9122, 14, 31545, 310, 6310, 1767, 1037, 3939, 13, 5727, 253, 6069, 5110, 310, 25515, 984, 273, 6895, 351, 7438, 1320, 342, 427, 9122, 18, 13, 253, 2408, 273, 24256, 427, 9122, 14, 31545, 310, 9560, 323, 8654, 24964, 3116, 1254, 35, 1047, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 3308, 13, 427, 9122, 14, 31545, 1537, 5416, 697, 1211, 24256, 2425, 407, 427, 3123, 34, 13655, 15, 496, 1386, 342, 841, 7313, 13, 359, 812, 921, 326, 13655, 273, 427, 3123, 34, 2220, 427, 9122, 14, 31545, 2048, 5777, 11852, 894, 9489, 15, 427, 9122, 14, 31545, 14, 10247, 1341, 13002, 253, 38968, 14, 25652, 427, 3123, 34, 10500, 2692, 3012, 3777, 894, 3116, 2429, 281, 427, 3123, 34, 4956, 1511, 1341, 15, 1284, 427, 3123, 34, 38968, 14, 1545, 24485, 2544, 253, 9489, 2442, 760, 281, 247, 5884, 6070, 13, 359, 7945, 326, 841, 2538, 778, 417, 1132, 247, 9560, 2554, 275, 427, 9122, 14, 31545, 14, 11181, 6946, 297, 6533, 6090, 15, 1723, 13, 841, 4342, 2085, 4460, 16039, 323, 2007, 6260, 285, 4326, 4513, 253, 2570, 5122, 273, 427, 9122, 14, 31545, 2625 ]
slight localization shift of the protein from the nuclear center to the nuclear membrane in ALK-positive cells. 2.4. NIPA Phosphodeficiency Leads to Enhanced NPM-ALK Binding and Impaired Cell Proliferation in NPM-ALK-Positive Cells {#sec2dot4-ijms-20-04060} ----------------------------------------------------------------------------------------------------------------------- As all identified NPM-ALK-mediated NIPA phosphorylation sites are localized to the ALK binding domain of NIPA ([Figure 2](#ijms-20-04060-f002){ref-type="fig"}C), we hypothesized that the NPM-ALK-induced phosphorylation of NIPA might alter the NIPA-NPM-ALK interaction. Therefore, we performed co-immunoprecipitation assays of NPM-ALK and different NIPA mutants. Interestingly, we were able to show that the phospho-deficient NIPA S338/344/370/381/387A mutant binds NPM-ALK with a significantly higher affinity than wild-type NIPA ([Figure 5](#ijms-20-04060-f005){ref-type="fig"}A,B). Therefore, we conclude that the phosphorylation of NIPA upon NPM-ALK expression seems to limit the binding of NPM-ALK to NIPA, which we speculate could be important for the NPM-ALK activity and localization of NPM-ALK to the cytoplasm. In order to further analyze the functional effects of NPM-ALK-mediated NIPA phosphorylation, we generated a Ba/F3 cell line expressing the NIPA wild type or the phospho-deficient NIPA S338/344/370/381/387A mutant, as well as NPM-ALK using retroviral infection. NIPA (mCherry) and NPM-ALK (EGFP) expression upon co-infection was confirmed by immunoblot and flow cytometry ([Figure 5](#ijms-20-04060-f005){ref-type="fig"}C,D). To study the influence of NPM-ALK-specific NIPA phosphorylation on cell proliferation, we performed an MTS proliferation assay. As shown in [Figure 5](#ijms-20-04060-f005){ref-type="fig"}E, the phospho-deficient NIPA S338/344/370/381/387A mutant showed a slight reduction in cell growth compared to wild type NIPA upon NPM-ALK expression. These results could be confirmed by soft agar proliferation assays with *Nipa*-deficient MEFs expressing NPM-ALK together with Flag-NIPA wt or Flag-NIPA S338/344/370/381/387A (Supplemental [Figure S3A--C](#app1-ijms-20-04060){ref-type="app"}), but again, only a minor but significant effect could be observed. Therefore, we concluded that NPM-ALK-mediated NIPA phosphorylation seems to influence cell proliferation in an unfavorable manner, although these effects may not play a crucial role in NPM-ALK-mediated lymphomagenesis. Taken together, we identified five serine/threonine residues (Ser-338, Ser-344, Ser-370, Ser-381 and Thr-387) as phosphorylation sites in NIPA to be significantly induced upon NPM-ALK expression with biological impact on NIPA-NPM-ALK interaction. Phosphorylation does neither change the SCF^NIPA^-complex formation nor influences the NIPA localization. Silencing of these NIPA serine/threonine residues led to a significantly increased NIPA-NPM-ALK binding capacity as well as slightly reduced proliferation in Ba/F3 cells and MEFs. 3. Discussion {#sec3-ijms-20-04060} ============= The oncogenic tyrosine kinase NPM-ALK promotes tumorigenicity by binding and activating several proteins involved in antiapoptotic, promitogenic and transforming pathways. In addition, several transcriptional and cell cycle regulatory factors that play a role in NPM-ALK-mediated tumorigenesis have been recently identified \[[@B15-ijms-20-04060]\]. However, the molecular mechanism contributing to the distinct oncogenic features of NPM-ALK is still not fully understood. The F-box protein NIPA, which is involved in cell cycle regulation \[[@B11-ijms-20-04060]\], has been identified as a binding partner of NPM-ALK leading to its constitutive phosphorylation \[[@B10-ijms-20-04060],[@B12-ijms-20-04060]\]. In this study, we demonstrate cell-cycle-independent NIPA phosphorylation in NPM-ALK-positive ALCL cells. NPM-ALK-mediated NIPA phosphorylation did neither affect cell cycle rate nor SCF^NIPA^-complex structure, suggesting a cell-cycle-independent function of NIPA activated by this phosphorylation. As oncogenic tyrosine kinase, NPM-ALK is known to phosphorylate and activate several proteins: STAT3 as a major player in ALCL is constitutively phosphorylated by binding to NPM-ALK, and thereby contributes to lymphoma pathogenesis \[[@B16-ijms-20-04060],[@B17-ijms-20-04060],[@B18-ijms-20-04060],[@B19-ijms-20-04060],[@B20-ijms-20-04060]\]. Moreover, NPM-ALK recruits PI3K p85 subunit leading to the activation of the PI3K/Akt pathway contributing to ALK+ ALCL progression \[[@B21-ijms-20-04060]\]. Additional proteins activated by NPM-ALK binding are, e.g., CD30 \[[@B22-ijms-20-04060]\], PLC-γ \[[@B23-ijms-20-04060]\], STAT1 \[[@B24-ijms-20-04060]\] and the Src kinase pp60 \[[@B6-ijms-20-04060]\], all being involved in tumorigenesis by enhancing cell proliferation. Here, we identified five NPM-ALK-induced NIPA phosphorylation sites located on Ser-338, Ser-344, Ser-370, Ser-381 and Thr-387, which differ from the ERK2-induced serine residues phosphorylated during cell cycle progression \[[@B11-ijms-20-04060],[@B13-ijms-20-04060]\]. Since the identified phosphorylation sites are serines and threonines it seems unlikely that the tyrosine kinase ALK phosphorylates NIPA directly. NPM-ALK stimulates numerous downstream targets and signaling pathways possibly involved in mediating its oncogenicity, thereby not only leading to tyrosine but also serine phosphorylation such as S9-GSK3β by PI3K/AKT \[[@B25-ijms-20-04060]\]. Indeed, 506 phosphoproteins have been previously identified in NPM-ALK-expressing cells including a large number of serine/threonine phosphorylated proteins \[[@B26-ijms-20-04060]\]. Numerous serine/threonine kinases activated by NPM-ALK (i.e., MEK/ERK, mTor, Pl3K/AKT) \[[@B5-ijms-20-04060],[@B7-ijms-20-04060],[@B8-ijms-20-04060],[@B9-ijms-20-04060]\] could be considered as potential kinases for NIPA phosphorylation: The identified phosphorylation sites predominantly result in ERK1/2, JNK1 and p38MAPK recognition sites, which is in line with the publication of Illert et al. showing impaired NIPA phosphorylation upon MAPK inhibitor treatment in cells expressing NPM-ALK \[[@B12-ijms-20-04060]\], thereby reinforcing the importance of the MAP-kinases for NIPA phosphorylation. Interestingly, the identified phosphorylation sites are located in a small area of the protein---which includes the ALK-binding domain \[[@B10-ijms-20-04060]\]---suggesting a direct effect on the binding energy of the complex \[[@B27-ijms-20-04060],[@B28-ijms-20-04060]\]. In fact, in this work the phospho-deficient NIPA mutant showed significantly increased NPM-ALK binding compared to wild type NIPA. NIPA has already been identified as a nuclear protein, while the subcellular localization of NPM-ALK is both nuclear and cytoplasmic \[[@B14-ijms-20-04060]\]. It was already assumed that nuclear-located NIPA is able to relocalize ALK fusion proteins into the nucleus \[[@B10-ijms-20-04060]\]. Therefore, we hypothesized that the interaction and phosphorylation of NIPA might influence the localization of NPM-ALK or NIPA. Here we could show that the phospho-deficient NIPA mutant binds NPM-ALK to a higher extent as phosphorylated NIPA and might thereby retain the protein in the nucleus. As only cytoplasmic NPM-ALK is catalytically active, whereas the nuclear portion is inactive because of heterodimerization with NPM1, the amount of cytoplasmic NPM-ALK is crucial for optimal lymphoma growth \[[@B14-ijms-20-04060]\]. Thus, NPM-ALK might ensure its own cytoplasmic activity by NIPA phosphorylation. In line with these observations, we could show that phosphorylation of NIPA upon NPM-ALK expression slightly affects cell proliferation. NPM-ALK-positive cells expressing the phospho-deficient NIPA mutant showed significantly reduced cell growth compared to NIPA wild type cells. As NIPA phospho-deficiency changes the proliferation potential only to a minor extent, we concluded that these effects may not play a crucial role in NPM-ALK-mediated lymphomagenesis. However, these findings provide novel insights for further analyses and substantiate the complex mechanism of NPM-ALK signal
[ 14, 4924, 285, 1708, 449, 346, 18853, 14, 3227, 14, 3227, 449, 346, 43696, 449, 346, 8620, 17034, 449, 346, 5804, 309, 4496, 755, 253, 22630, 258, 1405, 1059, 13, 4021, 9132, 13, 1728, 2054, 265, 285, 849, 670, 3253, 7351, 293, 342, 10379, 13, 10777, 12173, 13, 39018, 13, 512, 326, 10739, 449, 346, 1898, 840, 13, 368, 871, 752, 865, 346, 42, 8, 2267, 1379, 247, 14354, 17941, 449, 346, 1898, 309, 588, 1056, 352, 1077, 3477, 323, 368, 449, 346, 1394, 871, 13, 309, 8, 2267, 452, 326, 1072, 3242, 2181, 449, 346, 9281, 449, 346, 42, 8, 2267, 816, 452, 253, 34112, 42463, 449, 346, 19619, 449, 346, 2513, 627, 247, 1039, 281, 816, 16384, 352, 275, 43170, 13, 309, 2804, 897, 43170, 323, 253, 34258, 865, 346, 2615, 513, 642, 34258, 449, 346, 10795, 326, 789, 865, 346, 2302, 34258, 449, 346, 39, 2246, 390, 22462, 865, 346, 18931, 13, 309, 8, 2267, 755, 253, 22462, 342, 20301, 327, 253, 1930, 449, 346, 714, 554, 13, 3551, 598, 449, 346, 8398, 368, 449, 346, 24243, 449, 346, 1276, 865, 346, 1394, 1472, 9123, 751, 247, 12621, 627, 13, 23445, 865, 346, 2302, 449, 346, 1328, 434, 13975, 46604, 323, 32678, 285, 29124, 670, 521, 2801, 449, 346, 34, 2267, 987, 449, 346, 27035, 449, 346, 42, 2183, 368, 417, 281, 1333, 2712, 449, 346, 1231, 6468, 626, 2326, 1016, 643, 275, 247, 1223, 13, 8261, 865, 346, 9281, 13, 309, 2096, 449, 346, 2773, 2789, 3282, 281, 479, 449, 346, 56, 9045, 6863, 257, 598, 449, 346, 42, 755, 368, 13, 309, 755, 368, 449, 346, 2042, 368, 1472, 594, 11926, 670, 634, 7286, 13, 403, 368, 6501, 513, 1633, 3255, 26133, 10383, 634, 1670, 5104, 13, 3168, 4808, 865, 346, 8455, 1024, 368, 1007, 751, 271, 12353, 275, 247, 465, 357, 19385, 10524, 365, 449, 346, 1394, 1472, 581, 281, 2312, 670, 18655, 449, 346, 2347, 594, 865, 346, 2302, 8399, 13, 533, 342, 253, 278, 26202, 2679, 24554, 346, 1276, 865, 346, 1394, 1053, 626, 751, 352, 865, 346, 1147, 434, 40449, 449, 346, 42, 1053, 626, 1557, 752, 368, 1158, 449, 346, 1552, 310, 417, 323, 368, 449, 346, 7883, 434, 352, 323, 13, 253, 686, 3245, 33891, 12156, 3878, 865, 346, 4125, 13, 627, 359, 403, 449, 346, 17534, 11755, 449, 346, 2302, 13, 309, 1353, 2686, 2820, 281, 20041, 247, 1077, 2173, 18825, 745, 273, 619, 7435, 14, 262, 1618, 449, 346, 1276, 434, 247, 7435, 14, 262, 1618, 865, 346, 1328, 434, 1694, 436, 1618, 751, 247, 22205, 1618, 533, 352, 434, 2255, 344, 434, 2820, 281, 29246, 1078, 344, 9778, 449, 346, 2598, 13, 752, 2238, 273, 2255, 403, 368, 11525, 281, 6427, 865, 346, 4486, 2255, 13, 875, 5329, 285, 3925, 449, 346, 4013, 13, 594, 13, 260, 529, 1032, 449, 346, 1552, 310, 835, 352, 434, 12504, 449, 346, 2302, 449, 346, 2302, 13, 417, 260, 529, 1032, 449, 346, 9281, 13, 923, 13, 260, 529, 1032, 13, 281, 479, 13, 403, 8872, 13, 18439, 5662, 2255, 326, 971, 281, 320, 2872, 1024, 449, 346, 9281, 865, 346, 1989, 752, 309, 1353, 2819, 323, 403, 5662, 12994, 2255, 326, 971, 281, 320, 2872, 969, 449, 346, 34, 2267, 987, 865, 346, 5035, 13, 672, 2255, 923, 479, 342, 247, 278, 26202, 2679, 273, 326, 1511, 597, 1472, 20870, 896, 672, 253, 278, 26202, 2679, 369, 6963, 5136, 346, 510, 686, 1967, 84, 13, 253, 2393, 686, 1438, 84, 449, 346, 8455, 449, 346, 34, 2267, 987, 865, 346, 510, 8685, 273, 616, 5615, 47158, 449, 346, 2598, 840, 13, 672, 309, 1353, 327, 1755, 273, 731, 13, 285, 597, 1007, 598, 387, 479, 597, 923, 436, 1436, 13, 597, 1472, 20870, 281, 326, 673, 449, 346, 34, 2267, 987, 865, 346, 5035, 13, 436, 3548, 626, 247, 278, 26202, 2679, 13, 352, 434, 247, 673, 5145, 449, 346, 1147, 434, 247, 673, 5145, 281, 253, 896, 273, 378, 4405, 27523, 8, 6039, 15354, 449, 346, 8455, 449, 346, 1394, 871, 752, 13, 352, 434, 3, 346, 24788, 1386, 310, 1053, 626, 755, 247, 278, 26202, 2679, 13, 755, 247, 23136, 449, 346, 42, 1053, 626, 1158, 703, 434, 326, 2238, 273, 3226, 449, 346, 42, 1053, 626, 1158, 703, 434, 326, 28019, 449, 346, 9281, 13, 594, 703, 1912, 626, 29246, 4688, 277, 14735, 533, 703, 588, 4600, 342, 247, 5599, 326, 4453, 751, 521, 2454, 310, 6107, 275, 480, 11114, 865, 346, 2042, 703, 434, 6501, 13725, 368, 323, 9123, 1113, 1768, 3255, 26133, 6689, 8, 2267, 13725, 368, 323, 417, 1907, 247, 23136, 449, 346, 2773, 434, 2032, 449, 346, 34, 2267, 987, 13, 309, 755, 253, 1127, 449, 346, 10758, 368, 1472, 275, 253, 5145, 13, 352, 434, 3965, 1881, 14, 911, 11139, 2473, 449, 346, 1394, 1472, 6501, 17341, 1691, 436, 327, 634, 3564, 13, 762, 634, 29584, 5734, 368, 971, 634, 3564, 13968, 449, 346, 8455, 436, 1039, 449, 346, 9281, 449, 346, 45772, 253, 401, 10422, 372, 322, 1306, 300, 449, 346, 6300, 247, 3158, 1953, 449, 346, 18931, 3, 346, 12092, 449, 346, 53, 7526, 588, 3135, 275, 2620, 3255, 346, 18931, 283, 428, 1051, 12496, 13, 1264, 3255, 346, 18837, 309, 320, 9398, 42500, 865, 26133, 9389, 13, 581, 449, 346, 30395, 479, 449, 346, 4013, 13, 2656, 449, 346, 4013, 13, 45432, 352, 449, 346, 4013, 13, 285, 352, 331, 723, 449, 346, 30368, 449, 346, 30368, 13, 619, 2927, 38278, 449, 346, 1276, 310, 436, 865, 346, 30395, 479, 449, 346, 18837, 309, 320, 9398, 305, 19613, 868, 865, 346, 1147, 331, 723, 449, 346, 2513, 436, 3076, 865, 346, 13924, 449, 346, 53, 505, 265, 13711, 449, 346, 49, 567, 13, 268, 567, 449, 346, 53, 505, 265, 751, 14537, 449, 346, 49, 567, 13, 268, 567, 449, 346, 18837, 309, 283, 865, 346, 2513, 352, 3076, 604, 309, 6008, 352, 865, 346, 38, 11078, 13, 368, 816, 1694, 2206, 1529, 2829, 449, 346, 2302, 1039, 449, 346, 42, 4581, 562, 619, 2593, 449, 346, 1394, 871, 352, 13, 29723, 449, 346, 4497, 13, 368, 497, 9521, 449, 346, 2598, 24554, 346, 15953, 13, 34471, 449, 346, 13618, 34681, 352, 449, 346, 42, 1353, 417, 6501, 1340, 2712, 13, 309, 971, 368, 281, 871, 449, 346, 1989, 309, 1694, 247, 9092, 323, 368, 449, 346, 2513, 352, 253, 9092, 273, 634, 29292, 865, 346, 2302, 13, 13711, 449, 346, 4374, 13, 352, 310, 449, 346, 34, 1240, 1476, 346, 4013, 13, 619, 2656, 449, 346, 37872, 2558, 273, 619, 33702, 449, 346, 18853, 14, 3227, 14, 3227, 1476, 346, 4013, 13, 2656, 13, 4754, 449, 346, 8380, 327, 449, 346, 7900, 434, 253, 14098, 865, 346, 25643, 2080, 449, 346, 8380, 689, 1060, 449, 346, 4013, 13, 2656, 449, 346, 4013, 13, 309, 9829, 368, 449, 346, 8380, 1060, 449, 346, 13618, 1476, 346, 4013, 13, 2656, 449, 346, 4013, 13, 2656, 1476, 346, 21556, 1476, 346, 3726, 2210, 275, 594, 3809, 13, 309, 1904, 626, 871, 835, 281, 564, 449, 346, 12764, 449, 346, 42, 1353, 6778, 449, 346, 8262, 449, 346, 42, 1353, 43367, 449, 346, 29235, 281, 2525, 368, 449, 346, 7088, 281, 2525, 368, 449, 346, 4967, 403, 368, 16984, 4834, 865, 346, 42, 1053, 626, 17341, 320, 30446, 449, 346, 3633, 598, 449, 346, 39, 25826, 755, 598, 449, 346, 2513, 703, 1335, 1060, 865, 346, 1394, 1694, 247, 1133, 3845, 327, 634, 718, 449, 346, 309, 8, 2267, 2028, 368, 1996, 449, 346, 5498, 626, 11377, 449, 346, 42, 1353, 9123, 387, 247, 8955, 2829, 449, 346, 3726, 1472, 253, 4394, 12835, 449, 346, 3633, 12835, 7435, 24311, 449, 346, 1394, 6068, 403, 512, 873, 598, 13, 594, 309, 8, 2267, 816, 3, 346, 13325, 4834, 387, 1728, 449, 346, 32611, 449, 346, 9873, 249, 570, 13, 841, 278, 6948, 20951, 403, 8644, 449, 346, 8398, 368, 449, 346, 42, 5262, 512, 1388, 12478, 253, 2829, 449, 346, 26070, 865, 346, 24709, 731, 449, 346, 42, 5262, 3, 346, 733, 434, 271, 1711, 13612, 432, 253, 2021, 449, 346, 34, 3296, 449, 346, 4497, 13, 1077, 1175, 449, 346, 26186, 13, 43367, 449, 346, 6279, 13, 25062, 449, 346, 4125, 13, 403, 368, 247, 16057, 390, 247, 26650, 865, 346, 2302, 449, 346, 34571, 581, 449, 346, 30395, 479, 449, 346, 6506, 13, 309, 1353, 816, 3212, 14, 783, 14, 1026, 24453, 5599, 449, 346, 1328, 2686, 4566, 562, 285, 660, 8349, 10604, 13, 285, 840, 344, 7871, 731, 281, 521, 5203, 285, 344, 3936, 441, 281, 13, 309, 2804, 13, 841, 8644, 5053, 449, 346, 6872, 396, 6368, 7793, 14, 249, 14, 783, 14, 45930, 326, 368, 1871, 1620, 871, 13164, 449, 346, 2773, 7835, 4484, 449, 346, 733, 434, 417, 326, 4484, 449, 346, 2993, 434, 3652, 352, 598, 449, 346, 733, 310, 4484, 449, 346, 2993, 434, 1146, 7353, 449, 346, 15343, 12876, 479, 13, 352, 434, 247, 309, 302, 625, 4722, 685, 752, 15657, 1057, 449, 346, 1328, 2789, 12783, 323, 247, 3811, 449, 346, 18497, 4697, 17671, 13, 25062, 449, 346, 32897, 449, 346, 3726, 1472, 40068, 3, 346, 309, 1353, 247, 26141, 449, 346, 41774, 1199, 12783, 449, 346, 41774, 1199, 12783, 449, 346, 3726, 1472, 40068, 17671, 449, 346, 4013, 449, 346, 42, 2223, 897, 12783, 449, 346, 510, 2181, 670, 619, 2628, 310, 326, 352, 434, 275, 247, 1375, 273, 8868, 449, 346, 688, 958, 13, 1097, 273, 776, 4910, 403, 2238, 273, 247, 309, 1522, 3, 346, 1231, 1472, 275, 1077, 2074, 6887, 449, 346, 6506, 449, 346, 1989, 359, 513, 352, 984, 359, 2389, 352, 449, 346, 1231, 513, 352, 984, 359, 2389, 352, 449, 346, 2598, 13, 46604, 13, 858, 368, 871, 344, 369, 3551, 275, 865, 346, 2302, 449, 346, 1328, 4336, 9861, 479, 449, 346, 14102, 1087, 1701, 479, 1512, 449, 346, 2302, 581, 3260, 449, 346, 1244, 352, 369, 3240, 247, 9326, 449, 346, 1989, 344, 9861, 479, 387, 789, 342, 12405, 449, 346, 1147, 3589, 626, 247, 1943, 2968, 449, 346, 42, 1904, 626, 13, 309, 2804, 13, 18737, 293, 275, 432, 690, 25816, 449, 346, 42, 816, 2692, 598, 449, 346, 2347, 1705, 368, 1620, 513, 326, 865, 346, 18853, 13, 419, 449, 346, 8457, 359, 3153, 2366, 13, 25062, 449, 346, 42, 871, 13, 533, 352, 434, 5322, 281, 921, 247, 21850, 273, 24540, 449, 346, 2347, 1048, 452, 368, 6068, 644, 2366, 865, 346, 1147, 434, 644, 247, 309, 543, 673, 1024, 449, 346, 6506, 449, 346, 12486, 673, 449, 346, 1147, 434, 2238, 273, 751, 672, 368, 755, 1663, 17507, 285, 368, 816, 2806, 562, 368, 1053, 626, 871, 849, 1199, 673, 434, 4783, 407, 449, 346, 15462, 273, 247, 2074, 5471, 449, 346, 38, 11078, 13, 25062, 13, 651, 368, 1705, 1361, 479, 275, 253, 8576, 342, 27519, 865, 346, 48462, 449, 346, 9873, 249, 570, 434, 6501, 564, 18111, 4024, 634, 1894, 449, 346, 42, 17500, 1132, 5684, 449, 346, 4013, 449, 346, 41, 20657, 449, 346, 41, 20657, 598, 449, 346, 11739, 449, 346, 2598, 13, 15657, 13, 513, 368, 1056, 512, 1027, 9552, 273, 12783, 13, 390, 513, 368, 2714, 907, 275, 247, 2176, 283, 865, 346, 4045, 368, 452, 667, 2934, 273, 253, 7596, 326, 368, 1472, 8479, 441, 627, 13, 7015, 865, 346, 42353, 13, 4496, 13, 2028, 479, 752, 434, 15105, 272, 368, 449, 346, 42, 8, 2267, 2028, 368, 752, 434, 15105, 272, 479, 627, 13, 12433, 80, 449, 346, 1394, 816, 4269, 247, 4335, 14, 2606, 1895, 875, 479, 285, 619, 4475, 449, 346, 4125, 309, 17500, 564, 1728, 285, 8028, 281, 617, 17805, 326, 309, 1053, 626, 513, 2217, 323, 617, 449, 346, 18853, 13, 419, 449, 346, 1394, 1158, 690, 3098, 272, 618, 19500, 10739, 2789, 368, 247, 1524, 22273, 865, 346, 42, 6331, 11298, 846, 346, 24507, 80, 15653, 346, 19577, 598, 449, 346, 1231, 1472, 275, 253, 3098, 272, 44297, 1060, 13, 835, 253, 1524, 7085, 6569, 449, 346, 34, 2267, 987, 865, 346, 1898, 359, 1472, 1060, 1046, 1388, 449, 346, 1147, 434, 417, 670, 12405, 285, 10262, 285, 4645, 598, 323, 253, 8849, 449, 346, 4045, 368, 1158, 368, 476, 816, 1705, 275, 1060, 342, 634, 15223, 23136, 285, 634, 3226, 14133, 865, 346 ]
-free and light." "Ha-ha-ha." "Bye." "Goodbye." "Can I please get the garbage omelet, double meat, home fries and how about everything bagel with butter, cream cheese, jelly, all that shit." "And then, you know what?" "I'II take a chocolate shake." "And I will make it very easy for you." "You know, I'II have that same exact thing." "Okay." "I'II just have the turkey burger." " Okay." "Is there a way to just wrap it in lettuce, Iike use lettuce for the bun?" " Can do no bun." "Does that work?" "No bun." "Fries or salad?" "Uh, I'II get the salad with dressing on the side." " Yep, coming up." "Thank you." "Wow." "What?" "You're eating like a bird there, huh?" "No." "He's visiting Erin for Thanksgiving and worrying about his weight." "AII right." "Jesus." "I told you not to say anything." "We haven't seen each other in a while, okay?" "Okay, I understand." "That makes sense to me." "Wanna tighten up." "I get you, I get you." "If you're so worried about your appearance, are you gonna do something..." "...about your veiny, white skin?" "Right now you look like an actor in a kabuki troupe." "You're one to talk about appearances." "How so?" "No offense, but with the moustache...." "What?" "You don't like it?" "It's disgusting." "I don't care what you think." "This is not for you." "Who's it for, the '83 Yankees bullpen?" "Now, there we are." "Very funny." "No, I'm actually trying to scratch a very specific demographic off of my fuck-it list." "What's a fuck-it list?" "He's got this list like a bucket list but it's women he's trying to bang before he dies." "So, what kind of women are you hoping to attract?" "older women, between 45 and 60." "Oh, so, cougars." "This is where it's weird." "No." "No, not cougars." "Okay, see, cougars, to me, are sad, desperate older women that want to be young now." "Okay?" "But what I'm looking for are older attractive women that want to be young again." "AII right?" "See, when women see me with a moustache of that type they're transported back when the moustache was king:" "The '70s, the early '80s." "Right." "AII right?" "The era of their sexual awakening." "So then, when I'm on top of them, and they look up at me they see this person, they're transported to that time." "AII right?" "See, this isn't a moustache, it's a time machine." "It's a time machine to the back of Burt Reynolds' Camaro." "Right." "You know what, it's" "Bottom line is don't get a moustache, get a tan." "I don't think she's that kind of girl." "I don't think she's that superficial." "Okay, so she won't bang fat dudes but she will sleep with a guy that looks like his face is covered in jizz?" "If she's gonna dump you for eating carbs..." "...she'II dump you for not having a tan." "That's true." "AII right, I get the point." "Once you're in the machine, it's pretty self-explanatory." "You're gonna wanna put this on your hands, under your nails unless you want your hands stained." "Right this way." "Okay." "Enjoy the Faux de Soleil." "Just a quick question." "Uh" "Hello." "Tanning will begin in five..." "Uh-- -...four, three..." "Should I be wearing underwear?" "...two, one." "Excuse me." "Oh, God." "Oh, goddamn it." "Oh, and it stings." "Fuck." "Fuck, my eyes sting." "What is this?" "Excuse me." "Should I be wearing goggles?" "It stings." "Is this bad?" "Ah." "Tastes gross." "Pff, pff." "Tastes like poison." "Pff, pff." "Should I--?" "Is it bad if I eat it?" "Erin, you just got sat another table." "No way." "I closed out my section." "You know it, dude." "Well, you were requested." "So...." "Sorry, Mama." "Goddamn it." "I'm not gonna order anything, I want you to know." "But I got a tip for you." "Is it the tip of your penis?" "No, gross." "Yes, it is." "Aah!" "Oh, my God." "Twenty percent of my dick." "Ha-ha-ha!" "Oh, God, yes." "Come on." " Where's the bedroom?" "Too far." "Come over here." "Oh, God." "Oh, I missed you." "Come here." "God!" "Oh, God." "Oh, God!" "Phil!" "They came in so fast, I didn't know where to go." "Hi." "I'm Phil." "Hey." "I'm Garrett." "Nice to meet you." " Good to meet you." "Why are you introducing yourself?" "I don't wanna be rude." "Get up." "Fucking get up." "Is she still here?" "You got a handprint on your ass." " I'II tell you later." "Don't engage." "I'm eating at a dinner table." "They're the ones fucking." "Get fucking fuck upstairs." "You guys are all set up, so I'II just" "Make yourself at home." "Mm." "Corinne, these mashed potatoes are amazing." "Thank you." "I spent all day cleaning the table." " Sorry?" " Making them." "I spent" " It's an old recipe from the family." "Ahem." "Well, very good." "Um, Garrett." " Yes, Karen." "Now, are you a singer or a musician?" "No." "Neither one." "Excuse me." "Yeah, I'm just behind-the-scenes guy." "He actually goes out and scouts bands, and then he signs them to his label and he takes us to, Iike, these amazing places." "These seedy hole-in-the-walls that you'd never know existed." "That sounds cool." " It's not that cool." "She's building it up." " It is cool." "She's being sweet." "Believe me, it's a Iot more interesting than what Ron does." "He makes boxes for a living." "Cardboard containers, Karen." "please." "They're cardboard" " I'm a supervisor." "Pretty much boxes." "Pretty much boxes." "They're cardboard containers." "Oh." "I often use boxes." "The thing about my job is that it's in a state of flux." "In fact, both of our fields are kind of a Iittle" "We're in very similar positions." "Yeah." "But we do it because we love it." "We do it because we love it." "So, Erin, did you know he was coming in?" "No." "He completely surprised me." "Surprised me too." "No one knew." " And it was quite a surprise." "But he surprised me at work with flowers." "It wasn't a big deal." "I didn't, Iike, rappel in from some helicopter." "I just showed up." "How come you never do that?" "Ha, ha." "Because we live together, Karen." "I know, but it's nice to show a gesture of appreciation." "How long have you guys been together?" "It's been a Iong time now." "Yeah." "Long time." "It's kind of like when you get really drunk and you just black out you don't know how much time's gone by." "Sort of a similar feeling." "Erin, Karen, would you come help me in the kitchen with dessert?" "Absolutely." "Corinne's gonna go assassinate your character." "I gotta play defense." "Oh." "Hurry." "Hurry up." " Yeah." "So, Ron, do you make all different sizes of boxes, or do you specialize in a certain--?" "Do you have any idea of the trouble that you're causing us there, chief?" "Ron, please, tell me what's bothering you." "I'II tell you what's bothering me there, bucko." "You just caused a prime-time problem between me and my wife." "Now I gotta go home and listen to her complain that I don't do enough for her." "Ha, ha." "You think some effing sappy shit makes you a real boyfriend?" "I stopped listening after "bucko."" "Listen up." "We're in the effing trenches here, where the real hell happens." "AII right?" "And we're here every day." "It's not about flowers and presents and showing up for the weekend." "Do you think you can just come in here with your fake tan and your girl shirt?" "
[ 13647, 8215, 34, 13, 327, 615, 247, 269, 1000, 2247, 66, 27052, 1071, 2960, 13, 11565, 372, 1884, 2301, 73, 13128, 372, 48491, 594, 71, 2013, 389, 24961, 36147, 372, 33991, 15, 187, 187, 5677, 2921, 441, 86, 1757, 32802, 7291, 29982, 247, 269, 1000, 2247, 66, 30645, 948, 1868, 269, 4611, 372, 396, 2197, 603, 78, 268, 1256, 8585, 30645, 33861, 247, 1061, 274, 372, 389, 254, 4474, 68, 46445, 10959, 41629, 15210, 400, 8585, 247, 389, 254, 5500, 68, 1582, 27759, 269, 4219, 6017, 247, 4049, 249, 73, 2960, 802, 24005, 14035, 304, 343, 15, 1219, 72, 49998, 48491, 269, 23864, 312, 17339, 15333, 4474, 12065, 30800, 2013, 711, 13490, 274, 258, 11896, 601, 15, 187, 187, 34, 5559, 4151, 276, 18547, 39959, 31666, 1905, 1753, 704, 91, 247, 4335, 8432, 1501, 31646, 14822, 347, 43834, 2902, 17041, 9527, 48491, 642, 7879, 913, 39987, 4204, 22458, 16444, 1905, 1753, 258, 523, 9325, 372, 46636, 6358, 8685, 11856, 269, 1000, 2247, 66, 802, 1071, 265, 299, 1753, 1045, 66, 36252, 27052, 5326, 4355, 1474, 7112, 18547, 8680, 2297, 41241, 15, 50, 27, 187, 187, 57, 3211, 1227, 47648, 14, 36, 27, 6049, 310, 427, 1267, 7438, 4536, 3468, 16, 4039, 19500, 32, 187, 187, 42, 717, 6684, 271, 13971, 2165, 285, 309, 452, 271, 427, 1267, 7438, 326, 3865, 684, 512, 273, 253, 5113, 327, 253, 3601, 27, 187, 22242, 28517, 426, 544, 47, 1267, 7438, 11526, 28517, 3378, 4769, 27068, 27, 18, 15, 17, 16, 1229, 15, 17, 2303, 27, 1286, 23434, 27, 33, 28192, 9, 15106, 22242, 10, 2608, 6074, 27, 18789, 24510, 27, 24239, 2194, 187, 187, 10342, 273, 253, 673, 352, 6613, 1077, 25863, 13, 533, 4536, 309, 923, 1841, 2118, 17357, 390, 2093, 19500, 15, 309, 452, 19309, 285, 21058, 3470, 326, 3523, 285, 1265, 253, 4522, 398, 2975, 15, 2091, 309, 19309, 840, 440, 46703, 13, 352, 3133, 281, 4993, 253, 2093, 377, 1632, 15, 209, 187, 6693, 5697, 281, 2139, 436, 310, 9369, 32, 390, 1359, 476, 891, 4993, 352, 32, 187, 187, 34, 27, 187, 187, 6693, 5697, 281, 2139, 436, 310, 9369, 32, 187, 187, 510, 2159, 3662, 310, 326, 275, 634, 1083, 13, 368, 403, 9591, 5231, 313, 10779, 569, 10, 1754, 327, 271, 5061, 23078, 1025, 7450, 1566, 13, 285, 253, 5122, 368, 403, 970, 310, 417, 18960, 323, 253, 4836, 368, 403, 9591, 15, 187, 14087, 7211, 27, 187, 187, 47, 1267, 7438, 556, 247, 1698, 6064, 15, 187, 7093, 789, 310, 2684, 327, 253, 2022, 1408, 6287, 15, 380, 21626, 778, 417, 3289, 672, 368, 1902, 352, 281, 984, 1199, 673, 778, 320, 5262, 1223, 789, 327, 326, 6293, 310, 30361, 13, 534, 8336, 634, 21626, 432, 14954, 15, 5131, 985, 4712, 390, 1014, 17059, 275, 634, 1232, 476, 1056, 436, 7629, 1014, 3687, 15, 187, 28240, 23078, 1025, 11269, 476, 906, 275, 247, 2257, 273, 15279, 789, 13, 390, 2093, 377, 1632, 984, 253, 11269, 368, 1347, 275, 634, 15259, 9, 84, 10, 403, 9269, 387, 690, 673, 846, 597, 2826, 15, 831, 11323, 1014, 625, 7629, 281, 253, 11795, 7200, 273, 634, 11269, 15, 733, 434, 3477, 281, 990, 598, 18752, 13009, 390, 1347, 1534, 8322, 273, 15279, 789, 672, 253, 11269, 403, 417, 30492, 15, 831, 2105, 778, 417, 320, 8943, 1919, 846, 634, 10263, 310, 18325, 15, 187, 187, 5677, 273, 253, 427, 1267, 7438, 27586, 313, 18532, 7477, 2262, 187, 187, 34, 21626, 310, 417, 247, 1524, 14, 2606, 5122, 28, 352, 19333, 760, 672, 581, 273, 253, 1408, 6287, 10006, 281, 534, 253, 21626, 556, 644, 2879, 310, 3515, 285, 2104, 281, 2451, 604, 253, 21626, 457, 84, 14954, 673, 556, 4817, 15, 4923, 273, 253, 2710, 3280, 4973, 247, 6867, 1408, 6287, 26091, 13, 253, 3576, 6064, 273, 253, 673, 7726, 323, 247, 21626, 310, 3710, 281, 327, 253, 1340, 273, 2456, 14, 2313, 38178, 15, 1310, 247, 21626, 457, 84, 14954, 673, 6634, 1309, 247, 1048, 1067, 483, 390, 1223, 253, 1408, 6287, 310, 275, 247, 4438, 326, 310, 417, 8667, 253, 21626, 13, 253, 21626, 1057, 417, 3289, 1919, 253, 1735, 673, 253, 1408, 6287, 12255, 253, 21626, 15, 3813, 13, 253, 4588, 673, 387, 534, 253, 21626, 19333, 7826, 476, 320, 247, 1534, 2180, 273, 673, 846, 253, 11526, 14954, 673, 15, 187, 187, 510, 1682, 1039, 281, 16748, 253, 2523, 13, 604, 368, 403, 5480, 281, 671, 22318, 634, 10263, 1969, 310, 281, 897, 29263, 261, 1993, 10516, 13, 347, 2571, 452, 5393, 15, 380, 29263, 261, 1993, 10516, 310, 247, 2714, 686, 26320, 8, 327, 16567, 534, 17923, 634, 15259, 3935, 387, 247, 313, 4421, 494, 10, 9025, 273, 253, 3601, 22906, 2281, 15, 831, 4483, 368, 281, 11842, 907, 634, 16904, 11269, 342, 253, 3601, 11269, 15, 831, 15259, 310, 2684, 327, 253, 2022, 6293, 15, 5838, 27, 831, 9509, 310, 417, 594, 11638, 327, 9485, 1594, 13, 835, 2709, 12646, 778, 2226, 313, 8887, 17214, 10516, 481, 187, 2598, 13, 368, 476, 1265, 407, 6153, 247, 3148, 3048, 285, 275, 697, 15259, 13, 1347, 789, 534, 651, 2968, 342, 634, 43588, 285, 10263, 2905, 8892, 313, 70, 15, 72, 15, 1347, 667, 3309, 428, 1178, 6560, 5797, 17214, 688, 17229, 27, 11269, 481, 10338, 2119, 634, 789, 310, 1077, 3158, 13, 285, 326, 634, 18164, 310, 671, 3158, 1969, 840, 368, 943, 320, 2104, 5115, 247, 1029, 3665, 2281, 15, 36308, 3468, 5871, 275, 436, 15259, 313, 70, 15, 72, 15, 1873, 17908, 285, 2990, 9762, 481, 187, 4041, 2457, 3877, 27, 309, 5257, 281, 7368, 619, 21626, 20319, 1067, 12270, 715, 581, 30680, 14, 18229, 13, 2581, 685, 20864, 1142, 4522, 398, 327, 1408, 17417, 313, 70, 15, 72, 15, 3515, 387, 2710, 11383, 481, 1310, 634, 27558, 476, 4541, 3653, 534, 11269, 281, 513, 387, 253, 2774, 13, 840, 436, 812, 3012, 4796, 253, 1180, 273, 4522, 398, 368, 3334, 313, 936, 4555, 581, 481, 535, 49, 584, 13, 253, 12008, 16782, 273, 253, 23106, 40839, 273, 17112, 13, 2427, 281, 253, 2919, 281, 5717, 2448, 50213, 358, 358, 1653, 323, 616, 9021, 281, 253, 4156, 2137, 327, 19227, 15, 346, 1328, 3078, 281, 1007, 731, 275, 253, 2927, 285, 21684, 731, 326, 616, 38558, 403, 14109, 407, 253, 2448, 952, 937, 753, 367, 584, 434, 35027, 18671, 2065, 15, 31316, 388, 1911, 825, 15, 187, 187, 49, 584, 11580, 10824, 275, 25956, 39439, 11760, 6470, 1808, 80, 13, 611, 395, 1240, 274, 13, 611, 21297, 285, 378, 12068, 275, 16111, 15, 754, 671, 1313, 342, 50213, 358, 358, 1653, 387, 15858, 1032, 74, 14, 44, 5582, 23388, 6037, 11760, 275, 530, 91, 33909, 7399, 285, 3083, 284, 6037, 11760, 275, 611, 6147, 4233, 91, 18549, 15, 187, 187, 49, 584, 369, 17847, 407, 253, 6036, 285, 5678, 6671, 326, 39717, 452, 1691, 2366, 275, 16111, 15, 346, 10195, 2069, 344, 753, 253, 14395, 17328, 779, 273, 253, 2534, 6200, 275, 8141, 14848, 13, 342, 50213, 358, 358, 1653, 273, 1046, 2579, 285, 1142, 1027, 3872, 1005, 2444, 2366, 937, 388, 1911, 825, 753, 15, 187, 187, 10457, 271, 4572, 275, 378, 12068, 13, 367, 584, 753, 253, 3064, 275, 16111, 275, 253, 807, 1580, 344, 1390, 11580, 346, 261, 7777, 13406, 449, 187, 187, 3, 3726, 452, 7137, 480, 1317, 275, 611, 21297, 1024, 13, 323, 17800, 562, 11216, 937, 388, 1911, 825, 753, 15, 367, 584, 5393, 326, 627, 403, 625, 10169, 1527, 13, 1199, 625, 5140, 13, 285, 1142, 625, 8290, 285, 6838, 403, 1469, 281, 2143, 15, 367, 584, 753, 326, 530, 15, 52, 15, 50213, 358, 358, 1653, 452, 1160, 247, 3064, 275, 253, 4852, 273, 512, 3723, 18068, 507, 15, 187, 187, 41, 1911, 825, 753, 326, 1142, 3723, 18068, 507, 2692, 253, 2087, 616, 23800, 12960, 8364, 15, 346, 3726, 497, 1077, 9979, 326, 597, 403, 629, 273, 253, 2852, 273, 16111, 937, 703, 753, 15, 187, 187, 49, 584, 753, 326, 1142, 9647, 285, 34913, 7560, 4122, 273, 253, 2758, 273, 253, 13376, 3313, 8663, 15, 346, 510, 9647, 275, 253, 1673, 13, 253, 34913, 275, 253, 1673, 1928, 3782, 1175, 670, 8615, 12936, 731, 937, 344, 753, 15, 187, 187, 1328, 753, 253, 13376, 9647, 3819, 987, 12936, 20706, 10824, 285, 452, 8058, 15838, 528, 275, 6680, 285, 4217, 275, 10620, 342, 1980, 7625, 15, 187, 187, 41, 1911, 825, 753, 253, 3821, 15, 898, 12337, 497, 247, 346, 6811, 2784, 1127, 3, 323, 253, 2586, 15, 380, 1180, 273, 952, 665, 14285, 285, 253, 501, 13802, 10170, 273, 10290, 4676, 921, 326, 3723, 18068, 507, 513, 971, 247, 14483, 326, 23006, 253, 3570, 273, 512, 285, 476, 2085, 3988, 281, 512, 15, 187, 187, 49, 584, 753, 253, 2586, 1335, 9365, 3237, 15, 32241, 5621, 588, 4035, 281, 20269, 1066, 355, 41136, 23689, 285, 32625, 28550, 15, 380, 20706, 588, 789, 342, 253, 13376, 2208, 281, 11757, 253, 30621, 273, 1121, 1514, 2963, 377, 447, 285, 697, 9436, 281, 29575, 13, 344, 753, 15, 187, 187, 3404, 1046, 3523, 275, 253, 2919, 13, 367, 584, 21198, 326, 253, 2448, 952, 2096, 253, 38558, 50213, 358, 358, 1653, 403, 2403, 285, 10390, 731, 323, 352, 15, 1244, 344, 18343, 50213, 358, 358, 1653, 281, 9186, 616, 9503, 275, 253, 2919, 15, 346, 6067, 10824, 755, 352, 937, 367, 584, 753, 15, 346, 3726, 2096, 752, 597, 403, 2509, 285, 2139, 597, 403, 2509, 352, 13, 285, 597, 452, 816, 18397, 15555, 275, 616, 40243, 449, 510, 15663, 1029, 8996, 273, 7452, 5066, 275, 1142, 4243, 273, 783, 530, 15, 52, 15, 285, 643, 4343, 13, 43685, 7452, 43586, 13, 285, 253, 3629, 10454, 273, 253, 3739, 285, 2675, 2515, 25394, 407, 4292, 3811, 342, 7452, 16, 38281, 347, 5788, 19132, 285, 9813, 4292, 2363, 13, 512, 17433, 6443, 253, 878, 323, 734, 36078, 35156, 13, 3382, 13, 285, 18522, 14, 38631, 267, 2561, 326, 12453, 253, 12212, 285, 1971, 6637, 15, 2053, 16936, 275, 253, 22954, 13, 2366, 342, 253, 747, 15075, 327, 1971, 347, 12212, 13, 22713, 6340, 253, 878, 281, 13398, 2675, 285, 14613, 2561, 342, 7452, 3382, 285, 1786, 2718, 2561, 281, 4271, 285, 3359, 1029, 3486, 285, 18380, 7274, 281, 7452, 12212, 285, 1971, 15, 496, 253, 2469, 2067, 1107, 7452, 8607, 452, 3636, 12532, 7452, 12212, 8130, 323, 8493, 253, 9364, 273, 747, 10332, 326, 2770, 327, 7452, 14, 17159, 4292, 15, 16729, 3390, 1941, 327, 253, 5649, 273, 1331, 38959, 48377, 1971, 275, 8493, 6322, 13, 347, 973, 347, 8493, 7452, 21055, 285, 7891, 13, 556, 3012, 12059, 253, 1039, 359, 1158, 670, 7452, 12212, 285, 1971, 15, 11841, 285, 530, 15, 52, 15, 1754, 2175, 1804, 326, 12488, 952, 342, 7452, 5066, 2393, 327, 13, 20057, 731, 281, 1557, 13, 285, 3629, 19471, 281, 1331, 38959, 48377, 4918, 476, 4796, 253, 2495, 273, 12741, 272, 2571, 1223, 11138, 1786, 6973, 323, 1110, 665, 403, 9813, 15, 15022, 285, 1786, 3238, 285, 2718, 2561, 403, 3021, 9592, 13654, 327, 7452, 12212, 2, 380, 21313, 273, 1327, 14, 34364, 460, 12214, 824, 347, 638, 14, 48917, 39633, 313, 6140, 13801, 10, 323, 253, 12212, 273, 7452, 5066, 13, 941, 327, 253, 3486, 273, 2494, 67, 26685, 13, 285, 2175, 273, 7274, 281, 3382, 3736, 4323, 273, 7452, 285, 30142, 2515, 281, 3157, 6973, 512, 22175, 253, 878, 281, 1908, 253, 2554, 273, 3739, 1557, 672, 2820, 281, 14, 32581, 907, 12212, 6031, 50057, 1876, 273, 841, 32912, 285, 13554, 2085, 247, 3687, 1607, 37275, 281, 3037, 670, 253, 954, 3576, 285, 5919, 4088, 281, 3157, 8137, 273, 253, 3807, 74, 1530, 1700, 13, 4271, 4292, 4321, 275, 616, 5066, 13, 3048, 285, 13280, 731, 275, 1557, 13, 6558, 9907, 14523, 13, 3601, 285, 1555, 30142, 2728, 13, 285, 3157, 1786, 6973, 15, 29559, 835, 4292, 4763, 1557, 9592, 403, 247, 4619, 2770, 672, 6684, 12212, 8130, 13, 285, 11701, 275, 1557, 452, 253, 2442, 281, 6990, 253, 2282, 273, 253, 22954, 13, 3738, 627, 403, 36418, 24238, 281, 2120, 285, 5233, 7092, 273, 253, 7342, 273, 253, 3872, 285, 4156, 7452, 16, 38281, 8130, 15, 380, 4332, 298, 2277, 1304, 327, 7452, 9273, 285, 2289, 281, 1557, 10123, 1142, 273, 783, 15938, 326, 812, 1607, 13616, 7092, 273, 783, 1071, 285, 1555, 2746, 275, 253, 530, 15, 52, 15, 1690, 30218, 275, 5350, 281, 4311 ]
nos EUA, onde a ferramenta foi testada, mais de 30 milhões de pessoas sofrem com esse tipo de problema. Outros usuários criticaram a ferramenta pelo simples fato de se sentirem pressionados pelo Maps a parar de comer porcarias ou ainda incentivados a comer cupcakes caso fizessem a caminhada em vez dirigir. Algumas pessoas ficaram irritadas por não poderem desativar o recurso. A Google informou ao BuzzFeed — que fez a primeira postagem sobre as reclamações das pessoas no Twitter acerca da novidade — que o contador de calorias era uma ferramenta em testes e que ela já foi removida devido ao feedback negativo.Q: Xcode / Objective-C: Why is NSTimer sometimes slow/choppy? I am developing an iPhone game and I have an NSTimer that animates all of the objects on the screen: EverythingTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/30.0 target:self selector:@selector(moveEverything) userInfo:nil repeats:YES]; Most of the time it runs very smoothly, but sometimes I see things move slower or choppy. I have pause and resume functions that stop and start the timers respectively. When I pause then unpause, it seems to fix the choppiness. Any ideas to why this is happening? or How can i fix it? A: Any ideas to why this is happening? The short answer is that in your case, you are performing actions (animations) based on an unsynchronized push model, and the mechanism you are using is not suited for the task you are performing. Additional notes: NSTimer has a low resolution. Your work is performed on the main run loop. The timer may not fire when you expect it to because much time may be spent while work on that thread is underway, which blocks your timer from firing. Other system activities or even threads in your process can make this variation even greater. Unsynchronized updates can result in a lot of unnecessary work, or choppiness because the updates you perform in your callback(s) are posted at some time after they occur. This adds even more variation to the timing accuracy of your updates. It's easy to end up dropping frames or perform significant amounts of unnecessary work when the updates are not synchronized. This cost may not be evident until after your drawing is optimized. Out of the NSTimer docs (emphasis mine): A timer is not a real-time mechanism; it fires only when one of the run loop modes to which the timer has been added is running and able to check if the timer’s firing time has passed. Because of the various input sources a typical run loop manages, the effective resolution of the time interval for a timer is limited to on the order of 50-100 milliseconds. If a timer’s firing time occurs during a long callout or while the run loop is in a mode that is not monitoring the timer, the timer does not fire until the next time the run loop checks the timer. Therefore, the actual time at which the timer fires potentially can be a significant period of time after the scheduled firing time. The best way to remedy the issue, if you are prepared to also optimize your drawing -- is to use CADisplayLink, as others have mentioned. The CADisplayLink is a special 'timer' on iOS which performs your callback message at a (capable) division of the screen refresh rate. This allows you to synchronize your animation updates with the screen updates. This callback is performed on the main thread. Note: This facility is not so convenient on OS X, where multiple displays may exist (CVDisplayLink). So, you can start by creating a display link and in its callback, perform work which would deal with your animations and drawing related tasks (e.g. perform any necessary -setNeedsDisplayInRect: updates). Make sure your work is very quick, and that your rendering is also quick -- then you should be able achieve a high frame rate. Avoid slow operations in this callback (e.g. file io and network requests). One final note: I tend to cluster my timer sync callbacks into one Meta-Callback, rather than installing many timers on run loops (e.g. running at various frequencies). If your implementations can quickly determine which updates to do at the moment, then this could significantly reduce the number of timers you install (to exactly one). Pace, the vice chairman of the Joint Chiefs of Staff, went to the region to thank American servicemembers for their contributions to the global war on terrorism. "He wanted to look them in the eyes and assure them that their sacrifices are appreciated by the American people," said Pace's spokeswoman Marine Col. Ellen Haddock. Pace visited troops in Forward Operating Base Salerno, Kandahar, Kabul and Bagram in Afghanistan. He also met with servicemembers at Kharsi-Khanabad Air Base in Uzbekistan and Manas Air Base in Kyrgyzstan. Pace was impressed by the joint and combined teams that commanders have put together in Afghanistan. "Many times he said the bases reminded him of the bar scene in Star Wars, with servicemembers of every service and many different nationalities working together," Haddock said. During an interview in Bagram, Pace said the difference in Afghanistan in the year since he last visited "is truly remarkable." "They have traffic jams in Kabul now, for crying out loud," Haddock said. Pace mentioned that there are more markets open, much more construction, and many more boys and girls are going to school. Pace said that U.S. servicemembers have made a difference in the lives of all Afghans. Haddock said that many Afghans showed the general their voter registration cards. "They were very proud that they are part of the future of Afghanistan," she said. Pace said that many soldiers and Marines spoke highly of the members of the Afghan National Army. "The soldiers in the field, the Marines in the field feel particularly good about fighting alongside them," he said. He said the Afghan soldiers fight right alongside coalition troops and have proved courageous in battle and useful in dealing with local populations. Haddock said the Oct. 9 elections were a "tipping point" for the country. The number of people who voted and the resounding victory of moderate parties show that Afghans do want a democracy that respects the rights of all and can provide security to all. Pace said the country still faces problems. Coalition forces will continue to hunt down al Qaeda terrorists and Taliban rebels. The coalition will work with the Afghan government to combat the cultivation of opium poppies and its conversion to heroin, he said. At every stop in the region, Pace stressed that the American people understand the sacrifices servicemembers are making and honor them for it. And he urged servicemembers to examine their roles in the region. "Our troops get it," Pace said. "They understand what they are doing and why they are doing it, and they have justifiable pride in their accomplishments."The persistent high prevalence of HIV infection in many parts ofthe U.S. and other countries, worsening HIV disparities, and the increasing complexity of the medical and social conditions confronted by individuals living with HIV/AIDS as survival improves and infected individuals age, all underscore the need for interdisciplinary biomedical, clinical, and socio-behavioral research that addresses the prevention and treatment spectrum. These developments in the epidemic, together with the new emphasis on treatment as prevention, accentuate the need to combine social and behavioral research with HIV clinical and health systems research to identify and implement high impact and sustainable approaches to HIV prevention and treatment. In the past several years HIV researchers have identified promising HIV prevention strategies for reducing the incidence of new infections that focus on HIV-infected individuals. Emerging evidence on the benefit of antiretroviral treatment in reducing transmission, as well as reducing HIV morbidity and mortality, has significantly altered the way we think about HIV prevention and treatment. Global and U.S. based studies suggest that identifying people with HIV infection early on, linking them to care, and increasing adherence to antiretroviral therapy can reduce the risk of infecting others while improving health outcomes for those who are infected. Clinical and health services and systems research are thus increasingly focusing on HIV prevention! The emergence of non-vaccine interventions such as pre-exposure prophylaxis (PrEP) for the prevention of HIV infection, data on the impact of microbicides, and studies of approaches to clinical ? management of HIV and comorbid conditions to improve outcomes all emphasize the need to consider the role of medical care when trying to-optimize prevention efforts.? All of these discoveries and trends provide a greater impetus to learn about the most effective and efficient ways to improve identification of the undiagnosed, identify individuals earlier in their infection, link and retain them in care, maintain viral suppression, screen and treat comorbid disease, and improve health outcomes. Settings where individuals receive care increasingly are a critical focus when developing prevention strategies, and improvements in care have the potential to alter the course of the epidemic, although there are formidable obstacles to full and rapid implementation of the goals of the national and global HIV/AIDS strategies. The 2011 lOM report on HIV screening and access to care reviews many ofthe barriers that could impede implementation ofthe test and treat approach in the U.S. including deficiencies in capacity to scale
[ 253, 13939, 841, 1897, 13, 1048, 14, 2606, 448, 39053, 476, 1335, 2525, 598, 751, 597, 457, 306, 644, 2509, 512, 841, 1107, 15, 733, 2789, 479, 4282, 752, 253, 31702, 3114, 588, 1007, 751, 275, 6818, 1107, 13, 672, 359, 403, 253, 1711, 14, 12292, 398, 326, 2571, 1007, 598, 281, 15, 7395, 31702, 4035, 281, 34667, 275, 18395, 13, 347, 352, 858, 1563, 253, 3727, 273, 4867, 2131, 285, 253, 5579, 921, 25005, 775, 39053, 32, 2207, 588, 776, 3904, 277, 16668, 282, 347, 952, 8968, 253, 34057, 3548, 457, 85, 347, 37845, 11303, 347, 253, 3420, 2789, 352, 562, 281, 320, 32, 187, 187, 1989, 309, 2836, 560, 15, 309, 2206, 342, 5119, 1309, 11157, 285, 344, 2427, 689, 521, 16923, 272, 3082, 285, 521, 13650, 323, 253, 1388, 15, 1737, 344, 3047, 369, 247, 1781, 1180, 273, 33387, 30900, 272, 10486, 13, 984, 253, 1729, 369, 1246, 13, 533, 1077, 2129, 15, 40445, 9055, 12220, 281, 9208, 275, 253, 1698, 5096, 84, 651, 320, 4209, 281, 11399, 11785, 19343, 8638, 313, 36, 1042, 481, 187, 187, 4497, 13, 521, 16923, 268, 5442, 562, 13, 285, 3517, 247, 5322, 9902, 369, 12544, 689, 253, 20734, 17207, 15, 1707, 369, 247, 1304, 273, 48154, 2800, 13048, 3676, 327, 253, 3216, 13, 11196, 309, 14, 1967, 8935, 273, 253, 2846, 15, 733, 369, 253, 806, 34887, 14, 30289, 264, 894, 273, 253, 1388, 13, 285, 359, 2427, 846, 352, 15, 187, 187, 6436, 13, 3517, 697, 22013, 7286, 369, 43257, 13, 285, 359, 4425, 281, 24577, 247, 5352, 894, 281, 253, 6420, 326, 369, 9086, 12934, 5411, 15, 657, 7396, 4237, 19, 4425, 253, 1072, 2181, 15, 187, 187, 1231, 15471, 275, 2914, 273, 352, 285, 9047, 352, 323, 247, 1223, 15, 733, 369, 3965, 285, 574, 247, 3676, 4759, 26611, 5161, 2120, 273, 48154, 13, 533, 352, 369, 417, 30643, 10932, 15, 187, 187, 1147, 574, 690, 5322, 9381, 281, 253, 2613, 13, 533, 6524, 253, 14842, 2492, 2335, 689, 285, 253, 894, 2335, 327, 247, 1029, 14, 17995, 532, 3535, 8847, 15, 187, 187, 510, 894, 40754, 441, 896, 281, 12285, 251, 313, 16245, 10, 285, 359, 4425, 281, 21501, 6146, 327, 309, 14, 1967, 949, 253, 5161, 281, 1611, 281, 3986, 247, 747, 894, 2007, 6146, 15, 844, 497, 1469, 1884, 353, 6663, 327, 253, 30899, 342, 5058, 23114, 285, 2266, 19362, 15, 388, 647, 6107, 253, 3216, 275, 5699, 41019, 326, 3261, 751, 22244, 8762, 15, 4952, 1024, 13, 6276, 896, 6146, 281, 20734, 247, 1643, 3038, 1996, 13, 253, 13574, 273, 253, 3971, 1335, 452, 247, 1643, 13048, 273, 48154, 15, 6089, 13, 19528, 4391, 521, 2564, 13, 285, 359, 2427, 896, 6420, 285, 840, 9268, 281, 1611, 281, 755, 896, 275, 2914, 273, 253, 12285, 251, 9902, 969, 13, 984, 352, 369, 2819, 1805, 969, 327, 22013, 15, 187, 187, 4497, 13, 326, 512, 4391, 15, 1284, 359, 1694, 2810, 13, 352, 369, 2590, 326, 253, 894, 574, 417, 12372, 432, 697, 3302, 5161, 13725, 285, 574, 642, 4839, 273, 9603, 667, 34887, 15, 733, 369, 671, 34047, 342, 247, 747, 894, 326, 369, 1499, 28444, 715, 352, 432, 253, 6420, 15, 733, 369, 7552, 3644, 285, 3563, 13, 594, 359, 13222, 275, 253, 29861, 285, 403, 1024, 2403, 253, 767, 14, 11964, 42099, 896, 281, 20734, 15, 187, 187, 2598, 13, 3063, 369, 247, 2372, 273, 247, 1066, 254, 13, 533, 846, 11066, 457, 84, 14331, 2793, 13, 309, 1158, 667, 1388, 2159, 273, 271, 15742, 651, 452, 644, 31623, 15, 2058, 1878, 359, 1904, 457, 85, 2985, 1199, 273, 2712, 15, 2064, 20734, 894, 359, 13966, 8505, 4197, 247, 2159, 14, 27379, 34887, 13, 285, 690, 562, 14, 1171, 14, 21943, 1341, 275, 15391, 497, 671, 3240, 3939, 13, 533, 5747, 512, 253, 34887, 20942, 285, 34887, 773, 41071, 668, 432, 253, 1345, 285, 6308, 1336, 13, 627, 369, 417, 1199, 281, 923, 1060, 15, 187, 187, 2598, 326, 457, 84, 326, 15, 43475, 309, 755, 281, 11598, 598, 619, 4600, 5880, 969, 407, 12060, 896, 1728, 15, 2752, 5768, 2628, 7866, 327, 7216, 15, 309, 457, 620, 452, 247, 16384, 14, 484, 1501, 10873, 13, 285, 275, 253, 3551, 3618, 309, 457, 78, 1469, 281, 1691, 2366, 512, 619, 3492, 715, 247, 9759, 15, 187, 187, 2598, 13, 627, 368, 452, 352, 27, 1264, 362, 507, 13, 2800, 1897, 13, 625, 685, 5307, 6574, 13, 7457, 2221, 13101, 13, 285, 1264, 15143, 34887, 265, 15, 380, 1682, 629, 273, 7408, 13, 2299, 13, 369, 253, 673, 5262, 342, 767, 13365, 952, 665, 3894, 619, 9908, 323, 31702, 285, 20764, 5460, 8588, 15, 12369, 1531, 15416, 275, 4892, 362, 507, 896, 40111, 13939, 359, 457, 306, 2326, 1078, 13, 390, 44615, 839, 387, 253, 9988, 3523, 275, 12285, 251, 13, 6392, 13, 309, 1900, 574, 1270, 11284, 5015, 285, 9100, 673, 342, 4130, 327, 253, 4892, 15, 187, 187, 42, 3340, 49638, 19528, 13, 5119, 13, 285, 776, 10865, 12429, 13, 11007, 13, 7641, 13, 285, 16543, 15, 17814, 4934, 441, 4999, 285, 858, 247, 1270, 2628, 6276, 949, 690, 273, 253, 8859, 457, 84, 9065, 8588, 15, 19528, 457, 84, 3061, 14, 11849, 3745, 1663, 2210, 949, 436, 807, 1108, 816, 751, 275, 5403, 1108, 672, 2403, 253, 987, 1067, 5486, 253, 3064, 875, 247, 7351, 2400, 34887, 285, 247, 270, 15172, 24577, 15, 19528, 671, 15726, 253, 3889, 2740, 14, 3487, 1077, 973, 13, 7562, 2994, 9924, 13, 1332, 1037, 19408, 73, 22933, 13, 285, 840, 17749, 326, 4130, 369, 1335, 2104, 281, 923, 33387, 326, 1388, 15, 187, 187, 1909, 1199, 347, 309, 11346, 6523, 19827, 2221, 13101, 285, 619, 806, 34887, 265, 13, 627, 369, 247, 2257, 281, 1007, 387, 327, 253, 3216, 13, 1512, 13, 604, 368, 12659, 281, 1007, 1066, 15, 309, 457, 78, 5015, 670, 448, 12290, 14940, 15, 2896, 2393, 9055, 13, 48849, 30899, 15918, 4541, 2489, 689, 6321, 407, 9411, 18066, 3508, 264, 342, 36585, 13, 285, 13225, 15, 31322, 1756, 3345, 1551, 12384, 285, 3809, 2739, 33605, 347, 253, 6568, 14, 498, 324, 288, 636, 265, 10347, 13, 417, 8958, 672, 597, 588, 3553, 390, 672, 597, 588, 452, 253, 1735, 4839, 281, 3523, 15, 187, 187, 42983, 13, 6109, 513, 26005, 1985, 1032, 3678, 598, 347, 690, 3805, 3484, 15331, 247, 5842, 342, 616, 11652, 15, 2596, 273, 253, 399, 4290, 84, 13471, 1066, 969, 285, 310, 281, 7184, 1977, 15, 5131, 3484, 789, 327, 253, 6109, 41341, 1507, 13, 12478, 5448, 32770, 84, 285, 13642, 48154, 14, 69, 8006, 1054, 400, 507, 281, 8706, 8588, 13225, 15, 329, 3085, 10402, 5861, 253, 6200, 347, 38669, 20541, 323, 247, 18802, 15, 329, 320, 13073, 637, 277, 790, 271, 13735, 27287, 2338, 13, 12267, 25297, 13, 285, 690, 3686, 273, 26880, 15, 754, 9572, 12200, 247, 14287, 2806, 9988, 562, 71, 2166, 342, 48154, 17269, 285, 271, 309, 11779, 6568, 4205, 15, 17346, 38555, 10877, 327, 253, 32257, 3426, 253, 19862, 15, 8452, 972, 3534, 436, 5599, 271, 309, 11779, 6568, 1364, 320, 562, 273, 616, 2564, 15, 187, 187, 18978, 13, 7063, 3815, 275, 253, 7145, 273, 253, 1551, 3523, 310, 1359, 466, 40524, 16300, 249, 15, 754, 35818, 246, 9821, 327, 690, 10238, 347, 344, 4453, 689, 253, 2553, 7313, 285, 1566, 3453, 327, 521, 5602, 12323, 15, 19528, 7061, 285, 5119, 7284, 564, 689, 281, 1333, 14260, 13, 816, 347, 26419, 399, 375, 4714, 16771, 275, 285, 869, 84, 5119, 327, 253, 896, 15, 2053, 1711, 14, 12292, 398, 452, 1408, 715, 1016, 643, 275, 10058, 6495, 49668, 15918, 323, 594, 1142, 1107, 13, 285, 588, 4035, 2509, 594, 1919, 597, 457, 250, 642, 3356, 13318, 2104, 15, 13516, 253, 990, 273, 253, 24577, 1388, 13, 597, 588, 9580, 275, 1980, 22696, 285, 3894, 6773, 6281, 273, 42599, 6077, 48154, 13, 13915, 14, 4363, 8764, 2510, 13, 285, 253, 581, 326, 1694, 1977, 15, 187, 187, 1552, 310, 253, 1524, 31702, 3114, 13, 253, 581, 326, 588, 1335, 320, 1060, 672, 253, 39314, 14, 32179, 398, 285, 7315, 14693, 403, 4783, 15, 1198, 247, 1643, 3618, 273, 253, 807, 597, 403, 7163, 6594, 13, 687, 6472, 253, 6495, 49668, 10437, 839, 253, 1735, 9902, 326, 588, 320, 4451, 432, 253, 8307, 597, 457, 306, 2326, 1078, 15, 1583, 588, 1089, 841, 33387, 285, 24577, 731, 13, 984, 627, 457, 84, 1900, 581, 625, 1388, 281, 16923, 13, 581, 625, 9902, 281, 24577, 13, 285, 581, 625, 34887, 281, 47966, 15, 68, 1164, 254, 14, 84, 410, 187, 187, 21389, 13000, 187, 187, 21389, 13000, 310, 247, 14159, 528, 7802, 326, 29015, 4822, 432, 5202, 43141, 13, 35223, 14221, 13, 390, 643, 44820, 474, 4973, 15, 733, 310, 908, 347, 247, 14393, 386, 323, 25824, 1527, 8470, 275, 253, 288, 422, 15, 1294, 4818, 261, 310, 908, 323, 1355, 18388, 313, 36344, 390, 1679, 582, 1223, 4067, 8470, 403, 3798, 6898, 342, 29015, 88, 991, 15, 7850, 3295, 16149, 7293, 327, 697, 44820, 474, 2603, 13, 253, 954, 1846, 1146, 3644, 8516, 15, 1294, 4818, 261, 310, 31714, 387, 285, 1840, 2316, 3276, 15, 2058, 2406, 9208, 352, 4916, 1892, 285, 1077, 1308, 1522, 15, 187, 187, 2214, 14020, 13, 30747, 39160, 8025, 326, 29015, 18495, 253, 320, 11430, 422, 342, 4198, 13000, 281, 4017, 253, 17562, 432, 253, 3603, 13, 824, 347, 9313, 285, 5412, 8986, 42000, 15, 1723, 13, 1384, 394, 5331, 2561, 556, 4950, 326, 29015, 417, 760, 11883, 13, 533, 671, 34298, 13, 342, 2559, 23815, 1309, 253, 8986, 2607, 4768, 954, 2660, 366, 4811, 273, 253, 1533, 15, 187, 187, 21389, 13000, 310, 1024, 6566, 281, 27, 187, 187, 39910, 4774, 253, 8350, 7882, 273, 253, 288, 422, 187, 187, 35878, 22634, 187, 187, 11145, 253, 288, 422, 625, 809, 35418, 407, 24844, 17958, 10032, 1972, 187, 187, 33898, 6578, 285, 27338, 432, 11734, 253, 288, 422, 187, 187, 33898, 1691, 709, 1913, 1561, 253, 288, 422, 15, 2325, 265, 3798, 4459, 8138, 562, 273, 285, 1977, 432, 253, 288, 422, 15, 1723, 604, 247, 1355, 298, 17198, 390, 6521, 13, 323, 1650, 13, 1119, 697, 1039, 715, 253, 288, 422, 285, 4962, 627, 13, 29015, 778, 320, 7591, 281, 4459, 352, 562, 949, 253, 288, 422, 13032, 15, 496, 326, 1083, 13, 597, 651, 3177, 3185, 281, 14393, 253, 35882, 515, 275, 4198, 13000, 13, 9093, 278, 20440, 5411, 352, 285, 2403, 352, 26883, 1417, 285, 25365, 15, 187, 187, 2115, 3321, 187, 187, 510, 5889, 273, 4198, 13000, 588, 6889, 432, 288, 422, 281, 288, 422, 13, 3286, 281, 3286, 13, 285, 432, 2952, 281, 2952, 15, 40474, 352, 310, 3644, 8516, 275, 3295, 13, 533, 352, 476, 320, 1119, 275, 4759, 13, 2502, 13, 2806, 285, 3168, 288, 955, 13, 7293, 327, 253, 4973, 273, 14159, 1119, 275, 253, 1798, 288, 422, 2170, 15, 37101, 29015, 403, 3791, 1346, 13, 285, 588, 9580, 752, 597, 878, 432, 2130, 4973, 13, 285, 7000, 6260, 921, 326, 4198, 13000, 5793, 5889, 16149, 15455, 432, 2919, 281, 2919, 13, 2112, 342, 253, 28164, 15, 496, 11186, 2660, 366, 12015, 684, 13, 323, 1650, 13, 29015, 4822, 37776, 432, 7139, 13, 824, 347, 1684, 77, 1032, 285, 345, 338, 398, 313, 783, 7534, 2554, 273, 14159, 275, 7139, 310, 281, 14393, 19952, 285, 2342, 1411, 9574, 13, 28056, 285, 22392, 481, 367, 4488, 274, 14159, 310, 6793, 275, 8043, 266, 9448, 15, 346, 12117, 474, 3, 11186, 2660, 366, 4198, 13000, 556, 5512, 2456, 26290, 13, 8558, 37776, 285, 21436, 270, 932, 1317, 313, 1235, 9498, 22612, 265, 313, 1229, 9498, 5667, 24201, 313, 740, 9498, 285, 31371, 313, 22, 10970, 496, 425, 302, 29289, 4811, 13, 275, 3081, 281, 247, 1781, 5235, 273, 7139, 13, 29015, 778, 671, 9580, 14159, 432, 12405, 275, 253, 29014, 1639, 316, 571, 285, 28710, 348, 1301, 571, 13, 534, 403, 253, 760, 1929, 4444, 29014, 326, 4711, 41599, 37776, 281, 6427, 877, 3642, 2392, 15, 1639, 316, 571, 14159, 4428, 36854, 445, 24009, 21957, 34731, 2487, 15, 187, 688, 690, 3672, 273, 22755, 13, 4198, 13000, 4428, 1649, 68, 46561, 13, 247, 4109, 81, 1751, 432, 378, 17282, 261, 11111, 24976, 13, 285, 275, 10869, 13, 19422, 384, 1689, 16573, 531, 2563, 14420, 556, 4102, 7011, 432, 2502, 4198, 13000, 13, 285, 25861, 24009, 9532, 824, 347 ]
the roads these days, long-time chasers can still meet up like they’ve been doing all these years. It makes me wonder what the chasing community will look like in twenty years, when we are the old-timers that others look up to. Will chasing continue to explode in popularity, as it did following the release of Twister and the TV show Storm Chasers? Or will our numbers dwindle as people realize the hobby isn’t as glamorous as the media makes it out to be? But I digress. I sat with David during lunch and he went over his forecasting methods and his predictions for the day. What he saw was a large number of storms erupting simultaneously, because the cap was present, but very week. Typical afternoon heating to temperatures in the low 80s would be sufficient to overcome convective inhibition (CIN). Well, his forecast panned out, and soon a nice storm was tracking over the Denver downtown. There was a report of hail six inches deep on the ground, closing I-70 west of the city. It was the first tornado-warned cell of the day, and we went after it. However, soon its radar appearance was unfavorable, and we decided to chase a fresh cell to the south that was rapidly intensifying. VORTEX2 decided the same thing. We positioned in front of it and watched it for a while. It was pretty and had a deep green precipitation core full of hail, but it was not terribly organized. It had some nice rotation to the base, but eventually the precipiation took over and the cell took on a high-precipitation characteristic. The cell chased us back to Limon (again) and we decided to bust north on I-70 through the core to try to reach a new cell further north. We were going 30 MPH on the interstate with zero visibility and strong winds. Hail covered the ground in huge piles that looked like melting snow. Even now, driving back north to Denver a few hours later, the shoulders of the road still have a few inches of hail. Well, Roger changed his mind, and we went back south and then east to try to get back in front of the Limon storm again, because it was looking better again on radar. Well, that all changed. As we got close, it was clear that the cell had not recovered from its initial core dump and had no chance of producing any tornado. It was also merging with a new cell that was slamming into it from the south. It was becoming dark and late, so we threw in the towel and are now making the two-hour trek back to Denver. So, today was a bit of a downer, but after yesterday’s incredible experience, I think any day short of an outbreak would have been disappointing. At least we didn’t miss much of anything. That Denver cell we abandoned apparently produced a short-lived tornado, and some out-of-reach cells in Kansas were also quite active, but despite all the tornado warnings and tornado “reports” from the public and spotters, there was not much to see here. So that’s that. Tomorrow I get to screw up my sleep cycle again by flying back home. My summer job starts on Monday. I’ll have a wrap-up post tomorrow, and in the coming weeks I’m going to put together all my video into a presentation. So, there you have it: three vans, six days, more than 2000 miles, nine supercells, and three fantastic tornadoes. The best part of trip, however, was the time spent with two dozen people who share my passion for chasing and observing severe weather. Whether crammed in tour vans backtracking roads we’ve seen before, or congregating at the truck stop in Limon, CO, I always had great pleasure talking and spending time with everyone on the tour. I especially commend Roger, David, and our drivers Matt, Chris, Bill, and Anna. Everyone kept us safe and did a great job driving through some of the planet’s worst weather. Roger’s decision-making ability really came through this year – just like in 2006 – when making the right call meant the difference between a bagged tornado and a busted chase. Roger also handled the van break-down very well, keeping himself composed, methodically troubleshooting, and then ensuring that everyone was still able to see storms that day. As much as I enjoyed seeing monster supercells and my first tornadoes, there was a lot to look at on the ground, too, if you remembered to look down. I’m talking about chaser convergence. By early afternoon, sleepy interstate towns quickly become overrun by vehicles festooned with antennas, and instruments. Lines grow outside restrooms and fast food counters as the camera-clad hordes prepare, not knowing when they will leave or when they will have the next chance to stop. Outside, mobile doppler radars gas up as some grad students toss a football with their professor. One of the DOWs breaks down again and is towed away. Other students work on the mobile mesonets, cleaning windshields and scaling hail-dented minivans to repair weather instruments. A film crew records the scene as filler footage for a documentary. A bearded man dons an orange jumpsuit, knee pads, and some sort of harness. He stands beside a lifted black truck outfitted with hail guards and an IMAX camera mount. Bull horns mounted on the grill complete the ensemble. Whoever gave this guy an IMAX camera must be out of their mind. Meanwhile, sitting alone in the corner of the rest stop is Howie Bluestein. He spreads tuna on some bread as he looks over the surface observations and model output on his MacBook. Roger Hill and David Gold go over to say hi, just as Chuck Doswell walks in and pats David on the back. These old-timers have run into each other in tiny Great Plains towns for so many years, and will continue doing so until they’re no longer physically able. Come the end of the chase day, they will gather in local establishments and share fish stories of gorilla hail, mile-wide wedges, and the one that got away. This is the real chasing community, the one that will still be here when the thrill-seekers and television cameras are gone. For a few weeks of the year they are nomads, roaming the Great Plains anticipating the next storm that will be unique from the hundreds they’ve seen before. They will find these storms and chase them, because there’s always one more day to forecast, one more storm to chase, and one more tornado to tally.canker-sore Propolis Propolis is a resinous mixture that bees collect from tree buds, sap flows, or other botanical sources. It is used as a sealant for unwanted open spaces in the hive. Propolis is used for small gaps (approximately or less), while larger spaces are usually filled with beeswax. Its color varies depending on its botanical source, the most common being dark brown. Propolis is sticky at and above room temperature. At lower temperatures it becomes hard and very brittle. For centuries, beekeepers assumed that bees sealed the beehive with propolis to protect the colony from the elements, such as rain and cold winter drafts. However, 20th century research has revealed that bees not only survive, but also thrive, with increased ventilation during the winter months throughout most temperate regions of the world. Propolis is now believed to: reinforce the structural stability of the hive reduce vibration make the hive more defensible by sealing alternate entrances prevent diseases and parasites from entering the hive prevent putrefaction within the hive. Bees usually carry waste out of and away from the hive. However if a small lizard or mouse, for example, found its way into the hive and died there, bees may be unable to carry it out through the hive entrance. In that case, they would attempt instead to seal the carcass in propolis, essentially mummifying it and making it odorless and harmless. Composition The composition of propolis will vary from hive to hive, district to district, and from season to season. Normally it is dark brown in color, but it can be found in green, red, black and white hues, depending on the sources of resin found in the particular hive area. Honey bees are opportunists, and will gather what they need from available sources, and detailed analyses show that propolis chemical composition varies considerably from region to region, along with the vegetation. In northern temperate climates, for example, bees collect resins from trees, such as poplars and conifers (the biological role of resin in trees is to seal wounds and defend against bacteria, fungi and insects). Poplar resin is rich in flavanoids. "Typical" northern temperate propolis has approximately 50 constituents, primarily resins and vegetable balsams (50%), waxes (30%), essential oils (10%), and pollen (5%). In neotropical regions, in additional to a large variety of trees, bees may also gather resin from flowers in the genera Clusia and Dalechampia, which are the only known plant genera that produce floral resins to attract pollinators. Clusia resin contains polyprenylated benzophenones. In some areas of Chile, propolis contains viscidone, a terpene from Baccharis shrubs, and in Brazil, naphthoquinone epoxide has recently isolated from red propolis, and prenylated acids such as
[ 368, 476, 1385, 327, 479, 449, 346, 1394, 871, 752, 15368, 13245, 84, 2255, 865, 346, 1147, 434, 247, 29103, 3045, 1476, 346, 21856, 865, 346, 25714, 285, 36418, 581, 1476, 346, 35975, 1476, 346, 4013, 13, 309, 1053, 626, 1158, 352, 1833, 789, 323, 617, 449, 346, 1394, 17341, 3150, 865, 346, 4013, 13, 2305, 15, 611, 8575, 1476, 346, 1276, 253, 7085, 403, 368, 2509, 865, 346, 14866, 611, 2894, 1476, 346, 1552, 310, 247, 2714, 3045, 323, 368, 1476, 346, 1147, 434, 1512, 3511, 449, 346, 26042, 7203, 449, 346, 12764, 449, 346, 58, 3508, 14, 1240, 449, 346, 8061, 449, 346, 40, 263, 6077, 1476, 346, 29279, 4481, 1476, 346, 1147, 434, 714, 3508, 14, 1240, 434, 3, 346, 17613, 4461, 3, 346, 9281, 13, 1339, 479, 1379, 247, 7512, 273, 4266, 1476, 346, 36, 1137, 581, 449, 346, 42, 1353, 38467, 1476, 346, 1276, 943, 309, 513, 865, 346, 1276, 1270, 40599, 1824, 1476, 346, 8262, 13, 752, 403, 368, 2509, 865, 346, 2305, 15, 611, 8575, 3255, 346, 10205, 310, 1663, 1175, 449, 346, 2594, 368, 1476, 346, 6049, 1053, 626, 368, 1611, 436, 865, 346, 11592, 14, 30209, 4525, 13, 6313, 285, 3626, 1476, 346, 1328, 816, 858, 352, 1476, 346, 18793, 449, 346, 41932, 865, 346, 733, 434, 512, 987, 865, 346, 19619, 13, 8261, 449, 346, 26042, 12296, 13, 4354, 38109, 449, 346, 10205, 12296, 865, 346, 11739, 449, 346, 7745, 1476, 346, 3726, 4934, 436, 37619, 1974, 281, 3746, 865, 346, 1737, 253, 1476, 346, 6272, 368, 13594, 14, 601, 80, 865, 346, 10154, 13, 13594, 14, 601, 80, 449, 346, 1422, 16060, 479, 1476, 346, 1276, 434, 594, 11755, 865, 346, 1276, 865, 346, 33564, 13, 4166, 6848, 1476, 346, 14866, 611, 2894, 3255, 346, 42, 1849, 644, 3255, 346, 13060, 272, 368, 323, 247, 1048, 673, 449, 346, 2598, 13, 309, 971, 281, 871, 752, 368, 1158, 670, 479, 449, 346, 42, 1849, 1620, 1869, 670, 368, 449, 346, 35313, 449, 346, 42, 923, 449, 346, 5767, 611, 2894, 865, 346, 1737, 865, 346, 5872, 849, 670, 5068, 281, 1158, 670, 479, 865, 346, 1898, 604, 368, 8028, 281, 436, 13, 368, 1833, 1158, 670, 352, 449, 346, 1552, 4857, 8599, 352, 512, 449, 346, 1466, 479, 1239, 436, 449, 346, 1552, 310, 752, 309, 1928, 323, 368, 449, 346, 2347, 1048, 309, 1849, 16632, 436, 2774, 281, 1705, 3255, 346, 3378, 253, 5389, 6150, 285, 1051, 368, 285, 479, 3255, 346, 4125, 309, 588, 873, 247, 9735, 273, 1220, 3396, 247, 9599, 327, 253, 6150, 285, 3255, 346, 8262, 13, 403, 368, 512, 987, 865, 346, 12864, 352, 3477, 285, 3297, 11874, 449, 346, 36556, 598, 1476, 346, 17222, 281, 20648, 262, 352, 1476, 346, 1394, 476, 626, 865, 346, 9807, 634, 6208, 449, 346, 9807, 634, 6208, 1476, 346, 2598, 13, 752, 513, 368, 1158, 273, 479, 865, 346, 3166, 309, 1007, 4030, 865, 346, 11739, 449, 346, 9375, 449, 346, 1621, 17052, 449, 346, 309, 1353, 824, 247, 27964, 449, 346, 1422, 871, 326, 865, 346, 2214, 368, 13, 309, 812, 320, 1039, 7197, 685, 247, 27964, 449, 346, 4013, 13, 368, 1849, 8228, 598, 1476, 346, 11778, 309, 865, 346, 3262, 405, 752, 865, 346, 1737, 865, 346, 1394, 1007, 594, 4484, 672, 368, 1053, 626, 3984, 449, 346, 4013, 13, 1663, 865, 346, 10292, 14, 75, 3288, 13, 476, 309, 1051, 452, 326, 6773, 865, 346, 5498, 626, 1918, 479, 667, 45785, 449, 346, 8262, 449, 346, 4943, 449, 346, 1394, 17341, 4459, 352, 512, 2112, 865, 346, 1552, 865, 346, 1147, 434, 417, 327, 634, 3239, 449, 346, 19735, 352, 281, 479, 449, 346, 5498, 626, 1014, 1158, 273, 1907, 390, 970, 352, 449, 346, 42, 3078, 281, 4710, 352, 1977, 13, 8791, 449, 346, 1147, 434, 417, 7477, 449, 346, 3152, 583, 310, 352, 840, 865, 346, 380, 9065, 32199, 434, 449, 346, 733, 434, 13298, 840, 1476, 346, 2302, 13, 352, 434, 417, 7477, 13, 309, 1912, 626, 2028, 840, 449, 346, 5037, 626, 320, 256, 26584, 449, 346, 309, 1053, 626, 751, 281, 2312, 449, 346, 18, 13, 374, 13, 1333, 352, 1476, 346, 9281, 13, 309, 1833, 2028, 368, 449, 346, 947, 3, 346, 58, 6364, 3622, 13, 619, 1682, 3331, 369, 4824, 281, 253, 7220, 449, 346, 1328, 1871, 644, 9958, 347, 247, 562, 4008, 3255, 346, 1989, 309, 1904, 626, 871, 326, 449, 346, 1328, 3597, 281, 5159, 2994, 449, 346, 510, 48233, 37274, 779, 1046, 2014, 1388, 3255, 346, 3378, 326, 40588, 449, 346, 4013, 13, 309, 923, 449, 346, 2598, 309, 574, 352, 562, 342, 253, 48233, 449, 346, 1328, 369, 824, 247, 17877, 17830, 13, 533, 352, 1904, 626, 15872, 257, 479, 449, 346, 42, 7808, 7428, 281, 253, 48233, 285, 512, 253, 660, 3561, 3544, 449, 346, 43, 4037, 40, 13594, 14, 601, 80, 1476, 346, 44079, 779, 1476, 346, 1147, 369, 247, 9106, 16593, 3761, 13, 281, 3135, 342, 449, 346, 42, 369, 3815, 285, 597, 497, 1884, 289, 22201, 342, 8914, 449, 346, 1989, 309, 13964, 731, 432, 512, 10746, 449, 346, 4041, 407, 581, 13, 597, 6497, 1066, 13, 1146, 46616, 449, 346, 2214, 479, 13, 352, 369, 751, 247, 38769, 449, 346, 5872, 253, 1943, 5654, 2335, 562, 247, 40588, 449, 346, 5498, 626, 7664, 16352, 346, 262, 1904, 626, 30272, 479, 387, 512, 449, 346, 24397, 323, 247, 4619, 2774, 281, 1379, 779, 562, 3255, 346, 42, 39214, 779, 327, 253, 22239, 449, 346, 1328, 3034, 11046, 884, 17249, 285, 13222, 247, 29861, 449, 346, 1328, 285, 521, 1821, 497, 512, 2668, 281, 253, 7220, 13, 352, 369, 619, 2165, 1476, 346, 2598, 849, 1142, 497, 4824, 281, 253, 7220, 865, 346, 4683, 2282, 13, 512, 1884, 273, 731, 449, 346, 1876, 273, 731, 865, 346, 1394, 1472, 17053, 865, 346, 1394, 1053, 626, 2868, 479, 865, 346, 8262, 13, 309, 2868, 368, 449, 346, 1898, 634, 3331, 865, 346, 1328, 37797, 14092, 281, 6976, 449, 346, 1328, 3589, 626, 271, 562, 4008, 846, 512, 449, 346, 1394, 497, 342, 779, 13, 987, 865, 346, 10292, 14, 75, 3288, 1051, 368, 1472, 594, 1051, 3965, 449, 346, 1394, 1904, 626, 871, 326, 672, 368, 2183, 479, 368, 1928, 323, 479, 865, 346, 42, 1599, 1051, 368, 1007, 638, 1440, 1321, 3063, 449, 346, 1394, 1849, 1694, 1175, 9075, 275, 6838, 449, 346, 42, 871, 309, 1353, 247, 3965, 3226, 449, 346, 1898, 452, 436, 342, 368, 512, 253, 673, 16352, 346, 37341, 352, 434, 479, 449, 346, 11668, 436, 1476, 346, 1422, 969, 865, 346, 21305, 627, 449, 346, 1621, 1476, 346, 309, 1833, 755, 368, 840, 368, 1833, 14938, 352, 449, 346, 330, 1506, 479, 1476, 346, 998, 25776, 8800, 865, 346, 42, 1833, 1918, 352, 281, 714, 3508, 14, 1240, 449, 346, 6300, 751, 436, 1476, 346, 10292, 14, 75, 3288, 13, 6604, 441, 285, 11012, 751, 436, 1476, 346, 8262, 13, 38973, 14, 1200, 1479, 13, 1339, 434, 11012, 285, 452, 794, 449, 346, 42, 2389, 368, 13, 2305, 15, 611, 8575, 449, 346, 1147, 434, 2218, 1476, 346, 4967, 865, 346, 7161, 858, 368, 755, 326, 865, 346, 49682, 1669, 352, 323, 479, 347, 247, 9140, 449, 346, 733, 434, 13298, 865, 346, 12864, 352, 896, 449, 346, 1621, 13, 309, 1912, 626, 449, 346, 309, 878, 281, 1642, 368, 449, 346, 1737, 865, 346, 1276, 858, 368, 513, 342, 253, 8800, 865, 346, 3039, 309, 23686, 598, 275, 253, 4131, 13, 352, 369, 816, 4783, 449, 346, 15953, 3255, 346, 1394, 11213, 272, 1475, 342, 479, 865, 346, 1466, 479, 5513, 281, 368, 3255, 346, 1276, 403, 597, 2509, 865, 346, 15953, 449, 346, 1394, 1472, 247, 27964, 1476, 346, 10292, 14, 75, 3288, 13, 309, 1849, 2218, 436, 1476, 346, 7710, 15, 611, 8575, 588, 1379, 436, 347, 247, 10669, 273, 619, 2389, 449, 346, 7745, 387, 436, 1476, 346, 1276, 13, 2139, 13, 3689, 14, 75, 3288, 865, 346, 10292, 14, 75, 3288, 1476, 346, 15953, 13, 533, 3255, 346, 5804, 309, 1379, 326, 896, 865, 346, 1276, 434, 436, 39866, 689, 247, 15229, 8800, 865, 346, 4943, 13, 309, 1053, 626, 1918, 247, 7435, 449, 346, 20083, 634, 6208, 449, 346, 34437, 14, 601, 80, 13, 971, 281, 1132, 247, 18011, 2165, 865, 346, 1422, 1904, 626, 923, 3689, 14, 75, 3288, 865, 346, 1621, 3255, 346, 49724, 253, 3226, 285, 1132, 253, 2165, 449, 346, 34437, 14, 601, 80, 1476, 346, 43, 1947, 14, 1200, 1479, 13, 858, 368, 923, 3689, 14, 75, 3288, 865, 346, 42, 1904, 626, 923, 617, 449, 346, 1276, 4592, 865, 346, 1621, 13, 1620, 2564, 449, 346, 13594, 14, 601, 80, 1476, 346, 1737, 865, 346, 21050, 449, 346, 2512, 4566, 13594, 14, 601, 80, 1476, 346, 1281, 434, 2312, 670, 352, 1996, 449, 346, 1292, 3255, 346, 3633, 436, 35352, 449, 346, 1147, 434, 13594, 14, 601, 80, 1476, 346, 34437, 14, 601, 80, 1476, 346, 41, 7603, 626, 368, 1119, 617, 865, 346, 510, 1685, 310, 6108, 3517, 13, 285, 359, 1849, 2326, 2717, 273, 617, 1476, 346, 1898, 253, 23331, 310, 2403, 7596, 449, 346, 42, 1599, 3255, 346, 13086, 253, 4438, 281, 49425, 13, 309, 2183, 368, 1476, 346, 1147, 434, 1925, 686, 78, 1137, 1162, 3008, 5464, 8, 368, 871, 326, 865, 346, 4013, 13, 352, 434, 13594, 14, 601, 80, 434, 865, 346, 42, 1353, 5211, 352, 2987, 15229, 1175, 1476, 346, 43, 4037, 40, 13594, 14, 601, 80, 3, 346, 34437, 14, 601, 80, 13, 309, 1353, 7016, 449, 346, 42, 3534, 634, 1180, 281, 779, 449, 346, 42, 1353, 1663, 7016, 449, 346, 8262, 13, 368, 751, 352, 865, 346, 19815, 634, 718, 13, 390, 634, 29517, 588, 320, 35956, 1070, 449, 346, 5498, 626, 1379, 352, 3430, 13, 326, 562, 4008, 310, 417, 619, 29517, 449, 346, 1276, 247, 40655, 281, 320, 8471, 824, 247, 2298, 251, 449, 346, 1276, 253, 7435, 1476, 346, 1231, 574, 281, 789, 327, 436, 2298, 251, 594, 1892, 281, 755, 634, 1180, 449, 346, 42, 6566, 368, 767, 497, 29517, 14, 27094, 6421, 449, 346, 1466, 479, 1056, 436, 2590, 449, 346, 42, 369, 5322, 281, 779, 13, 347, 253, 277, 45566, 369, 594, 28714, 449, 346, 42, 1620, 2879, 779, 281, 619, 29517, 1618, 13, 7435, 1476, 346, 1328, 434, 824, 247, 4107, 22560, 21413, 48222, 1476, 346, 12864, 779, 13, 323, 1959, 449, 346, 1276, 247, 48222, 13, 281, 1333, 344, 434, 619, 3331, 1476, 346, 45, 14356, 285, 19749, 1420, 13, 368, 767, 403, 1160, 323, 1016, 643, 449, 346, 1276, 865, 346, 309, 17500, 564, 449, 346, 18793, 13, 500, 4037, 40, 13594, 14, 601, 80, 1476, 346, 30138, 273, 247, 23331, 1476, 346, 1231, 878, 1089, 38973, 14, 1200, 1479, 806, 449, 346, 42, 1557, 670, 779, 449, 346, 1394, 43325, 417, 281, 13, 281, 5321, 779, 840, 865, 346, 1466, 434, 10957, 715, 767, 1476, 346, 309, 923, 13, 513, 368, 3491, 865, 346, 4683, 2282, 449, 346, 1147, 434, 13594, 14, 601, 80, 13, 987, 865, 346, 1394, 871, 752, 359, 878, 865, 346, 40722, 272, 285, 4680, 449, 346, 2042, 359, 513, 436, 13, 2305, 15, 611, 8575, 588, 320, 19271, 449, 346, 25954, 359, 755, 327, 253, 1685, 285, 564, 1728, 3255, 346, 5872, 368, 476, 7664, 390, 259, 3288, 390, 5913, 449, 346, 42, 1053, 626, 971, 281, 11034, 2305, 15, 611, 8575, 247, 2372, 449, 346, 7845, 1053, 626, 513, 436, 1476, 346, 1276, 247, 9980, 273, 7516, 13, 625, 35352, 310, 327, 253, 1039, 449, 346, 1466, 434, 24284, 13, 253, 1685, 285, 253, 2644, 966, 310, 6179, 323, 441, 449, 346, 8262, 13, 15229, 1175, 281, 923, 368, 449, 346, 1276, 865, 346, 35, 2682, 13, 368, 1694, 281, 1675, 479, 1476, 346, 4013, 13, 28546, 13, 28546, 3255, 346, 34437, 14, 601, 80, 1476, 346, 42, 452, 281, 15856, 10470, 449, 346, 42, 476, 626, 1408, 667, 625, 449, 346, 34437, 14, 601, 80, 1476, 346, 4967, 253, 7085, 1053, 626, 597, 3662, 253, 4481, 865, 346, 26859, 74, 1476, 346, 12092, 13, 368, 767, 755, 1060, 13, 3809, 1476, 346, 7161, 403, 368, 1024, 865, 346, 6300, 564, 281, 253, 6146, 13, 432, 253, 1127, 835, 359, 8085, 449, 346, 2302 ]
you can count on me." "You know what spellbinds women?" "It's a shocking performance!" " Performance?" " Cool and formidable one!" "Performance!" "Oh, I don't think it'll work for her." "You wanna die?" "Oh, Mr. KOH!" "What the hell are you doing?" "Miss KIM!" "This is a special performance for you!" "It's too hot." "Water spring." "Hi." "Yoon-ah." "Thanks." "Gorilla!" "Mobile phone!" "It's Yoon-ah's" "Restroom" "Okay, let me take a photo of myself!" "Cute one." "I'm doomed!" "What should I do?" "What great tasting water!" "Hey, what are you doing?" " Mr. KOH..." " Water is really good." " See you!" " Why don't you try this?" "Non-polluted, pure and natural!" "He just did it!" " Hey." " Uh?" " It's all right?" " Okay, okay." "Water ink, easily removable." " Water ink?" " Yeah." "Look!" "They kept this delicacy to themselves?" " What the!" " Are you Han-soo?" " Right, Han-soo." " You scared me!" "What's so funny?" "What?" "Damn, oil paint!" "Miss KIM..." "I've been..." "watching you for a long time." "So, I want to know what you think about me." "I've never thought about you." "Ever." "I see." " Miss KIM?" " What?" "Then how about beginning to think about me?" "And if you listen to this, you'll think about it." "This letter tells it all." "Let me read this." "This is what I feel for you." "How long I've wished this moment to come..." "With the beautiful sea and... you and me..." "Now I will set a boat of solitude afloat on the sea and..." "Hey, are you all right?" "Take it easy and stay calm." "Throw up!" "Try to vomit it!" "You can't?" "Open your mouth." "Open your mouth!" "So, what do you think of me?" " Do I look fine?" " Yeah." " Thanks." " No sweat." " I'm such a jerk." " You know that?" "For you, I could be way worse than a jerk." "Oh, you've grown up!" "Have I?" " Guess what?" " What?" "You look so cool when you don't speak." "Oh, really?" "Min-joo, can I... have that fish?" "Don't give me any rubbish." "Hey." "Here." "You wanna carry it all along?" "This?" "It's not on your page." "Give it to me." "Don't even think of having or using it." "I wanted to throw it away, anyway." "It's not mine." "Whose is it then?" " The worst bastard's." " It's yours then!" "No, it's not mine, I won't tell then." " Don't be sullen." " I don't like to talk." "1, 2, say it!" "Okay, I'll tell you." "ER" "Years ago, my best friend was carried to the ER." "He'd been suffering as a outcast..." "But I didn't know that." "He tried to kill himself." "The bully tortured him every single day..." "With that cutter." "Oh, I see." "So I had it out with the bully." "He was such a cruel killer, but it didn't frighten me." "I slowly walked to the bully and all the scumbags." "JUNG Han-soo!" "Kill him!" "It was a totally unfair match, to begin with." "I was alone and they were 30 thugs with weapons." "But I attacked them from all directions." "One by one, they fell down, being silenced." "For me, it was like a picnic." "Then the big gun took out a cutter." "Don't worry;" "it didn't scare me at all." "Looking for a critical moment to take him out..." "I punched him on the chin." "He tumbled 10 meters and threw a towel." "He and his men were all taken to the ER, it was my game!" "So how many were carried to the ER?" " Of course, all 30 of them." " All of them?" "You're laughing?" "You don't believe me?" "Hey, I believe you." "And your friend?" "He emigrated to Australia." "He wasn't an outcast after all." "You were with him, right?" "Min-joo... you're so... pretty." "You didn't know that when you told me you feel for me?" "I mean... you look prettier today." "You've got good taste in girls." "I know I'm a pretty girl." "And have this with you all the time;" "thinking it's me." " Take this!" " You again?" " Stop there." " No!" " I'll get you then you'll regret it." " Catch me!" "Stuffed bear?" "I'll give it to Yoon-ah." "Just like this!" "Min-joo, join us and dance like this!" "Hey, Jung-shik, let's dance and have fun." "I love you, Mr. KOH." "It's done!" "Why?" "Where did you get that?" "Somebody left it for me as a gift." " It's yours?" "Take it back." " No, I won't." " I need to ask you." " What?" "What did you do with the bear?" "When I woke up in the morning, it was just gone." "Sorry..." "You fooling around with me?" "Let me explain to you..." "What are they doing?" "Sorry." "You're a jerk!" "Min-joo, I've done this!" "Mr. KOH will take this as a token of my love." "Look at this!" "What, why, Min-joo?" "Min-joo!" "Sorry, but..." "Can I take that back?" "What's this fuss over a damn bear?" "Here, I don't give a fuck." "Watch your mouth." "Han-soo, want to play a coin game?" " You didn't see Min-joo?" " No..." "Forget the girl and play the game." "Han-soo!" "Jung-shik, did you see Min-joo?" "I didn't see her." "What happened?" " No, never mind." " Han-soo!" " What?" " Wait." "There goes Han-soo!" " Let's talk about it later." " But..." "Get this bait." "It's Han-soo!" "Han-soo!" "Haven't you found her?" "The bus is leaving soon, and we've seen nothing of her!" "And the bitch is making trouble." "I mean..." "Change the mode to mute, I told you!" "It's called 'mute etiquette' you know that?" "Oh, it's Han-soo's?" "I'm happy it works damn good!" "JUNG Han-soo" "Han-soo, I'm sorry." "I gave your number to him." "I'm really sorry." "Hey, you like it?" "Move your ass, or your buddy will be crippled." "Don't take it wrong, that outcast is not my buddy." "What a disgrace to befriend such a moron." "What the fuck!" "We had to work on this moron so hard to get your number." "I believed you two were buddy-buddy." "Let me make this clear." "I was nice to him, as the dumbo was so miserable." "I never added him to my buddy list, fuck!" "He's such a freaky dumb loser!" "Take him, for free." "What a loser, to say he's my friend!" "Loser and lunatic, you two are made for each other." "What?" " I gotta go." " Hey, JUNG Han-soo!" "Son of a bitch!" "We need find Jung-shik first." "I care about him." "You pretended not to, to save him then?" "Let's divide into two!" " I see, do you copy?" " Of course." "It's Han-soo, right?" "You know what we need?" "Reasoning and thinking." "If we do this, Mr. KOH will be disappointed." "Anyway we get on the bus and go home..." "Then you can worry or woo or whatever." "I don't want to disappoint Mr. KOH a bit." "Please don't do this!" "What a stroke of luck, more bait is on the way." "Let's hurry, the bus and the whole class is waiting for us." "Hey, damn good to see you." "What?" "Bitch, you got to respect me!" "Oh, 911, 911..." "Han-soo!" "I have to quit smoking." "I can't run any more." "Han-soo!" "Why the hell don't they answer the phone?" "Taxi!" "Hello, you two get here, fast!" "Where are you now?" "Just go to the north, from the point where we split." "No
[ 17051, 187, 49, 982, 2130, 2220, 2748, 13, 6701, 2, 187, 6300, 2819, 323, 10363, 20, 3958, 1663, 13, 5046, 7167, 1410, 285, 20807, 347, 973, 15, 14140, 3441, 2819, 323, 20593, 5104, 323, 3714, 20, 15, 187, 187, 45306, 34, 1458, 13, 20593, 5104, 13, 28258, 273, 353, 636, 263, 313, 3299, 21, 10, 187, 187, 30456, 17861, 13, 10351, 36, 610, 577, 13, 6131, 13, 309, 5476, 32, 313, 3299, 21, 10, 187, 187, 1099, 2398, 13, 4104, 387, 17272, 27, 2504, 5365, 187, 187, 9917, 2819, 323, 399, 78, 36, 27, 3366, 249, 1483, 17897, 187, 187, 46, 5629, 611, 435, 18603, 37521, 44714, 187, 187, 977, 10850, 68, 4338, 2165, 44714, 187, 187, 1099, 2398, 13, 4104, 387, 17272, 27, 1449, 5365, 187, 187, 3220, 3491, 273, 18603, 37521, 9377, 13, 594, 309, 8686, 247, 747, 3491, 285, 1024, 452, 271, 4465, 1083, 15, 40046, 1097, 253, 1083, 285, 11595, 342, 26862, 8916, 37034, 15, 36040, 309, 1353, 11947, 323, 878, 281, 452, 512, 253, 3236, 5017, 1512, 15, 309, 452, 690, 13155, 3958, 326, 878, 2219, 534, 2486, 27, 187, 46, 5629, 4146, 25037, 187, 46, 5629, 7021, 577, 187, 46, 5629, 7021, 608, 187, 49, 536, 15125, 2065, 37554, 360, 187, 49, 536, 15125, 1594, 37, 187, 6872, 403, 752, 309, 971, 13, 533, 604, 368, 452, 247, 1027, 1083, 281, 5454, 309, 1537, 513, 352, 604, 697, 1175, 15, 187, 8398, 1422, 15, 187, 187, 1934, 27, 29368, 2127, 1380, 187, 187, 1279, 2165, 15, 313, 57, 3364, 4041, 10, 187, 187, 1099, 2398, 13, 4104, 387, 17272, 27, 2405, 5365, 187, 187, 11778, 271, 30732, 5865, 2127, 323, 11940, 29368, 15, 1281, 479, 871, 604, 368, 403, 2819, 281, 22101, 11646, 390, 2712, 187, 187, 40995, 32782, 755, 747, 1340, 313, 29079, 8744, 1934, 2806, 7908, 313, 3211, 10, 187, 187, 57, 18, 6131, 337, 807, 5328, 1198, 1097, 390, 443, 893, 362, 390, 1682, 3959, 187, 187, 1099, 2398, 13, 4104, 387, 16261, 27, 1047, 5365, 187, 187, 36744, 1390, 730, 14505, 13, 495, 5942, 3958, 13, 285, 26252, 2596, 3958, 313, 57, 3364, 16951, 2769, 3299, 20, 2769, 20, 5942, 2769, 57, 3364, 2596, 10, 187, 187, 42, 452, 247, 32322, 295, 20, 1397, 30291, 5485, 533, 309, 3732, 3601, 4017, 641, 4745, 13, 285, 253, 480, 3682, 3248, 3499, 74, 4017, 641, 15, 309, 858, 2299, 3700, 253, 278, 73, 21, 2165, 562, 273, 253, 985, 15, 733, 1057, 1705, 342, 3236, 18420, 5043, 253, 3601, 4017, 641, 285, 253, 3499, 74, 1083, 47398, 15, 187, 42, 717, 2819, 323, 6131, 327, 495, 1397, 3958, 13, 259, 2886, 1484, 3958, 13, 285, 717, 74, 487, 375, 9, 1439, 2119, 604, 309, 476, 1618, 436, 1060, 481, 187, 187, 9034, 5154, 11362, 496, 34961, 13, 20593, 5104, 13, 26291, 84, 187, 187, 24234, 3501, 577, 13, 14169, 17861, 15, 313, 3724, 21, 3958, 403, 2919, 1959, 15, 187, 187, 1099, 2398, 13, 4104, 387, 884, 27, 883, 5208, 187, 187, 3220, 3958, 403, 512, 3520, 10125, 533, 309, 1353, 4030, 342, 2970, 5865, 4394, 15, 187, 187, 21381, 4825, 12404, 27, 20352, 2114, 272, 187, 187, 41390, 31910, 1299, 285, 253, 13063, 4011, 41091, 187, 187, 1099, 2398, 13, 4104, 387, 18188, 27, 1099, 5208, 187, 187, 30519, 1705, 342, 1083, 15, 11239, 368, 2, 187, 187, 47, 5472, 7284, 27264, 3052, 74, 41968, 187, 187, 31216, 41196, 1608, 23073, 13, 30680, 21570, 13, 5046, 643, 7520, 3052, 74, 41968, 187, 187, 1099, 2398, 13, 4104, 387, 17796, 27, 1449, 5208, 187, 187, 6300, 281, 19148, 13, 309, 760, 971, 581, 3052, 74, 41968, 275, 1091, 15, 6935, 1405, 871, 2, 187, 187, 8693, 273, 8802, 6235, 284, 3606, 313, 3299, 21, 10, 187, 187, 8997, 398, 313, 3299, 21, 10, 187, 187, 1099, 2398, 13, 4104, 387, 16261, 27, 3156, 5208, 187, 187, 18, 1770, 26252, 14309, 2127, 187, 187, 8944, 1225, 29906, 495, 5942, 9585, 26862, 2127, 187, 187, 1099, 2398, 13, 4104, 387, 16261, 27, 3156, 5208, 187, 187, 42, 2168, 452, 253, 41884, 530, 2715, 9856, 594, 309, 878, 253, 495, 5942, 581, 275, 1340, 281, 755, 353, 999, 9389, 15, 187, 187, 688, 3817, 41354, 637, 717, 74, 41968, 187, 187, 2727, 398, 187, 187, 1099, 2398, 13, 4104, 387, 14805, 27, 2417, 5208, 187, 187, 688, 253, 2791, 323, 1846, 717, 74, 487, 375, 390, 3958, 323, 2712, 10890, 313, 18, 16, 19, 16, 20, 16, 21, 16, 362, 5741, 582, 26862, 305, 67, 16, 66, 495, 16, 1397, 13, 285, 259, 2886, 16, 88, 2886, 1484, 15, 5531, 309, 671, 1211, 247, 16951, 187, 187, 12558, 30662, 495, 1720, 6653, 273, 25293, 84, 313, 3299, 21, 10, 50067, 353, 2648, 313, 57, 3364, 2596, 10, 187, 187, 40, 7656, 608, 313, 3299, 21, 10, 187, 187, 1099, 2398, 13, 4104, 387, 14805, 27, 3439, 5208, 187, 187, 510, 39898, 16631, 18605, 337, 285, 374, 187, 187, 2906, 785, 495, 187, 187, 1099, 2398, 13, 4104, 387, 14805, 27, 2941, 5208, 187, 187, 42, 651, 2389, 281, 5454, 380, 39898, 16631, 18605, 337, 285, 374, 313, 28489, 1014, 39898, 16631, 9166, 2908, 10, 323, 549, 785, 495, 15, 1281, 479, 871, 604, 368, 403, 6110, 13, 309, 588, 1908, 643, 6131, 347, 973, 15, 187, 187, 12764, 6068, 13, 309, 452, 644, 5877, 4830, 436, 2181, 1580, 8027, 285, 309, 816, 20509, 1053, 626, 878, 352, 15, 309, 1353, 417, 247, 5699, 1182, 293, 1473, 7989, 13, 285, 253, 14370, 34387, 20, 5942, 31823, 369, 816, 594, 25594, 13, 309, 1849, 4425, 281, 5454, 7477, 15, 187, 42, 651, 20509, 4510, 247, 908, 41884, 530, 13, 347, 253, 3064, 875, 747, 285, 908, 310, 22879, 285, 309, 1053, 626, 971, 368, 6068, 3515, 562, 285, 11280, 747, 41884, 530, 434, 816, 323, 436, 15, 22469, 253, 625, 3958, 16, 35019, 398, 2908, 13, 253, 2169, 14682, 15, 1310, 368, 1849, 1694, 247, 985, 285, 3253, 310, 2239, 253, 1318, 273, 253, 16975, 427, 20, 5942, 31823, 13, 359, 476, 1900, 789, 562, 247, 7942, 390, 2165, 8499, 15, 9375, 323, 2819, 2, 187, 187, 20, 5942, 35974, 32982, 35, 13, 418, 6905, 13, 187, 187, 3299, 20, 5096, 20773, 24291, 13333, 187, 187, 1348, 2398, 13, 4104, 387, 884, 27, 938, 5365, 187, 187, 42, 452, 247, 4797, 495, 5942, 35974, 32982, 35, 326, 309, 1353, 2819, 281, 5454, 323, 247, 10890, 20, 5096, 20773, 24291, 13333, 1566, 313, 11499, 31821, 342, 3236, 3817, 13, 533, 604, 642, 326, 434, 4030, 1512, 481, 187, 42, 671, 452, 247, 544, 23422, 62, 187, 9, 3614, 1358, 13880, 15, 9906, 15, 681, 16, 42755, 6689, 1507, 16, 69, 16, 10655, 7282, 50, 21, 12261, 68, 10201, 24, 30784, 44381, 50, 55, 89, 20, 21619, 17, 1615, 3123, 19, 48, 64, 9051, 1036, 59, 90, 59, 339, 40965, 58, 84, 16, 15576, 32, 14147, 30, 7152, 3433, 382, 64, 6682, 10, 187, 1171, 3958, 285, 1841, 326, 309, 812, 7826, 4710, 275, 347, 973, 15, 187, 187, 41774, 1199, 752, 253, 4060, 2296, 15, 309, 369, 8927, 7219, 327, 10156, 841, 3958, 533, 309, 1869, 309, 1871, 2451, 562, 1060, 323, 2442, 28587, 806, 15, 9375, 2, 187, 187, 47, 24150, 495, 5942, 259, 16, 29572, 20254, 1294, 285, 247, 9521, 2165, 187, 187, 3299, 20, 390, 657, 5741, 187, 187, 1348, 2398, 13, 4104, 387, 15630, 27, 3583, 5365, 187, 187, 20, 5942, 556, 247, 27264, 4808, 327, 352, 13, 476, 5386, 604, 368, 751, 15, 26659, 670, 247, 2173, 2165, 604, 368, 971, 581, 13, 309, 3164, 452, 352, 15, 9418, 187, 187, 3016, 30680, 21570, 717, 74, 41968, 187, 187, 1773, 6426, 434, 15350, 35992, 6258, 187, 187, 1348, 2398, 13, 4104, 387, 16331, 27, 3156, 5365, 187, 187, 510, 717, 74, 41968, 310, 3587, 432, 619, 1980, 9567, 22900, 15, 6101, 3533, 1642, 1977, 15, 187, 187, 79, 1540, 3958, 187, 187, 3610, 1225, 1795, 84, 259, 2886, 86, 2127, 187, 187, 1348, 2398, 13, 4104, 387, 16331, 27, 1229, 5365, 187, 187, 2598, 309, 1353, 7378, 281, 5454, 271, 295, 1540, 2165, 313, 71, 23144, 3490, 13, 14864, 4448, 81, 1568, 13, 2929, 14889, 13, 6420, 30844, 49828, 14528, 73, 471, 13, 2494, 10679, 13, 4704, 374, 11267, 934, 36607, 13, 390, 9557, 1940, 16064, 10, 891, 816, 1642, 323, 370, 19, 432, 46104, 281, 3835, 2716, 253, 15076, 15, 26670, 11, 816, 971, 253, 5453, 295, 24150, 2127, 417, 253, 2165, 187, 187, 8262, 516, 2819, 281, 18670, 22101, 690, 5017, 342, 3095, 9, 84, 481, 3173, 6571, 2819, 323, 21629, 3958, 533, 717, 1527, 281, 2712, 15, 9375, 2, 1244, 891, 18298, 281, 823, 253, 1618, 15, 544, 4943, 880, 3614, 1358, 13880, 15, 9906, 15, 681, 16, 42755, 6689, 1507, 16, 69, 16, 18, 91, 7381, 56, 30725, 1615, 23, 79, 4290, 81, 56, 9068, 25696, 82, 54, 82, 58, 7273, 83, 25, 79, 24, 74, 36, 82, 35, 413, 25, 28264, 43498, 17, 2649, 17, 16, 15576, 4, 38902, 30, 16763, 28836, 1706, 2090, 10, 368, 564, 2, 187, 187, 43402, 26862, 8215, 8141, 330, 3180, 187, 187, 43402, 26862, 29352, 8141, 330, 3180, 187, 187, 1348, 2398, 13, 4104, 387, 16987, 27, 1671, 5208, 187, 187, 8262, 6068, 13, 309, 8686, 5037, 2364, 13591, 16548, 495, 37, 323, 619, 47175, 495, 5942, 13, 533, 352, 7819, 562, 309, 476, 626, 41582, 253, 2127, 323, 253, 6114, 984, 326, 434, 8215, 760, 15, 26013, 1056, 253, 1072, 10551, 347, 479, 533, 990, 598, 342, 271, 29352, 3491, 32, 187, 42, 1353, 14707, 281, 22101, 11646, 426, 10, 187, 187, 24397, 281, 755, 562, 273, 253, 3052, 74, 41968, 2165, 15, 7395, 2075, 323, 253, 15076, 15, 544, 40701, 1060, 5774, 2413, 1358, 48370, 15, 681, 16, 71, 1028, 48, 3373, 46, 10, 187, 187, 6869, 37, 21798, 3660, 17937, 26252, 2596, 18605, 11271, 187, 187, 57, 3364, 2596, 6131, 187, 187, 1348, 2398, 13, 4104, 387, 17272, 27, 1717, 5208, 187, 187, 56, 251, 247, 2434, 37, 32368, 2952, 1509, 275, 247, 7879, 1918, 12594, 13, 2819, 281, 5454, 352, 323, 271, 26252, 2596, 5865, 2165, 2127, 390, 1633, 15, 187, 38547, 1509, 310, 370, 1967, 327, 253, 27769, 13, 594, 2970, 253, 2165, 3139, 13, 40542, 27, 11366, 1282, 390, 26580, 6056, 17078, 651, 320, 7353, 15, 187, 187, 6300, 15950, 436, 581, 562, 627, 285, 476, 823, 370, 22, 604, 3058, 1163, 37, 187, 23779, 1020, 17061, 27, 3944, 1358, 24290, 6434, 15, 681, 16, 23779, 2290, 3355, 5696, 187, 187, 15705, 27264, 495, 37, 3645, 313, 56, 2886, 530, 10, 187, 187, 49, 262, 390, 30680, 21570, 3052, 74, 41968, 313, 6693, 18973, 13, 9497, 583, 390, 427, 5472, 10, 187, 187, 1348, 2398, 13, 4104, 387, 14805, 27, 1671, 5208, 187, 187, 1909, 253, 4060, 2296, 309, 452, 6053, 27264, 495, 37, 1533, 285, 309, 971, 31235, 390, 30680, 21570, 3052, 74, 41968, 275, 667, 2919, 9497, 583, 390, 427, 5472, 15, 1310, 3095, 6131, 247, 30680, 21570, 285, 3095, 2010, 6131, 247, 8483, 1561, 2164, 3038, 309, 588, 1379, 253, 31235, 689, 253, 30680, 21570, 15, 187, 187, 6717, 515, 249, 434, 1424, 264, 16167, 26252, 581, 5865, 2127, 187, 187, 13325, 247, 3959, 323, 26252, 581, 2165, 187, 187, 1348, 2398, 13, 4104, 387, 14805, 27, 2405, 5208, 187, 187, 4257, 281, 436, 6293, 309, 452, 436, 2127, 285, 309, 717, 2819, 323, 667, 643, 2165, 643, 685, 913, 2165, 390, 20674, 187, 187, 24397, 281, 755, 11366, 1282, 1863, 6965, 281, 667, 2165, 327, 28984, 15, 2615, 4489, 247, 1643, 3958, 604, 253, 4376, 310, 2406, 685, 327, 11366, 1282, 15, 2615, 626, 4390, 755, 2583, 327, 38356, 15, 309, 476, 564, 806, 13, 604, 16701, 15, 187, 187, 5498, 2364, 13591, 17241, 308, 29289, 7648, 2721, 313, 56, 2886, 530, 10, 187, 187, 17151, 15093, 34777, 313, 56, 2886, 530, 10, 187, 187, 1508, 2398, 13, 4104, 387, 16331, 27, 1717, 5208, 187, 187, 1322, 15753, 35, 3052, 74, 41968, 187, 187, 56, 2886, 13, 495, 5942, 13, 285, 10850, 36, 4338, 3958, 187, 187, 1508, 2398, 13, 4104, 387, 16703, 27, 1812, 5208, 187, 187, 510, 717, 74, 41968, 309, 452, 281, 5454, 27, 187, 21, 89, 309, 413, 187, 20, 89, 7284, 27264, 187, 19, 89, 322 ]
holder Pics available upon request, thanks! Just looking for Ps3 games really, maybe SNES and DS as well. Primarily looking for Destiny for ps3. FIFA 15, Destiny, Shadow of Mordor (PS4) Bloodborne, FarCry 4, offers, I guess? (PS4) 25 Mar, 2015 at 03:47 PM Also looking for DmC: Definitive Edition Mario Kart Double Dash CASE other Gamecube game CASE 25 Mar, 2015 at 03:40 PM My copy of Double Dash broke, so I bought a new copy and now have an extra case. Trading both the case and manual with Nintendo Power inserts. Cases I'm trading for need to have all the original stuff too. I have some loose games that need cases which include: Mario Sunshine Mario Party 4 Mario Party 5 Pokemon Colosseum Pokemon XD These are what I want, but if you have a different case to trade I might do it if its good. Thank You. AC: Unity code // any game. (XboxOne) 25 Mar, 2015 at 03:31 PM Have an unused digital code for AC Unity. Let me know if you are looking to swap codes or anything wolfenstein get new order (physical)+AC black flag (code) X1 offers 1 year gold For both or Gta v or best offer 25 Mar, 2015 at 02:14 PM Various last gen titles, 3DS games, and Xbox One games (Xbox 360)(PS3)(3DS)(Xbox One) I have a MH n3dsxl opened but I applied screen protectors immediately, and the japanese hori protectors. I did however transfer the mh4 game out of the system. It does come with original packaging plus the screen protectors and the hori case protector. I am looking for offers on 3ds games, wii u games, and amiibos(not sure if I can list this here). Dragon Age Inquisition, Destiny, Ghosts Far cry 4, Bloodborne. (Ps4 games are region free. 25 Mar, 2015 at 10:11 AM My games are all physical copies but I'm fine with getting digital ones. Fire Emblem: Awakening Professor Layton and the Azran Legacy 25 Mar, 2015 at 07:25 AM Must come with case. Thank you! NIB Gold Mario Amiibo Captain Falcon Shulk, Meta Knight, maybe other rare Amiibo 25 Mar, 2015 at 06:40 AM Just to clarify, I only want one Amiibo in return. Lemme know! Last of Us Remastered (PS4) Offers (PS4) 25 Mar, 2015 at 02:41 AM 1 month Xbox Live code Smash Bros 3DS Club Nintendo code 25 Mar, 2015 at 02:41 AM I already have the Wii U version registered so I need the 3DS one in order to get Mewtwo. In box mega man amiibo offers 25 Mar, 2015 at 01:55 AM In the market for common amiibos or games for anything PS (1/2/3/4/ vita), Nintendo gb/a 3/ds, and wii/wii u. Oh I also own a 360 Diablo 3 Reaper of Souls (PS4) Halo MCC (Xbox One) GTA 5 (PS4) 25 Mar, 2015 at 01:54 AM The Walking Dead Season 1 and 2 Arma 3 25 Mar, 2015 at 01:03 AM I would love to trade The Walking Dead Season 1 and 2 (maybe even Walking Dead 400 included) for arma 3. Let me know if you are interested, I will consider other offers as well. Hi guys, I have been holding onto this thing since launch and I just honestly don't need it. I'm not a huge zelda fan, and the grey NN3DSXL was just so sexy, I've decided to trade mine. I would honestly prefer a used Wii U, as the difference between new and used is negligible and I don't want you guys running out and buying new Wii U's just for this. Obviously the more games/controllers included, the higher preference. If you've got a system and everything is > the value of the MM N3DSXL, we can always work out a cash or game supplement. Thanks for looking! 3DS XL CiB, LIST, PS3 80gb backwards compatible 24 Mar, 2015 at 10:20 PM I have a blue 3DS XL CiB that I'm looking to trade for a PS3 80gb backwards compatible model (preferably with original box, but if no that's fine too). I also have a [LIST] (https://docs.google.com/spreadsheets/d/105BPQ4TPcPV7JRKlQVx3lg0byIP2O_IE16ZyZsezwYs/edit?usp=docslist_api) of games and things that I could potentially throw in as well. Pretty much what the title says. I was originally planning on selling these games but I thought I'd check out here for potential trades first. Thanks! Nintendo 3DS w/ Circle Pad Pro and a requested game PS3 or Vita 24 Mar, 2015 at 09:52 PM 3DS has a Mario skin on it, can remove if you like. Ask about a specific game if you want one, I probably have it. :) US Meta Knight amiibo Conker's Bad Fur Day 24 Mar, 2015 at 08:41 PM The amiibo is directly from my local Best Buy. Any questions ask away. n64 games smash bros wiiu code 24 Mar, 2015 at 08:30 PM So I'm willing to trade an n64 game (fighting force, tetrisphere, paperboy, southpark chefs loveshack, micro machines, ready 2 rumble boxing, or namco museum) i just ask for $2 from PayPal to cover half the shipping. Edit* just want the club nintendo code not the game Hey im looking to hopefully swap some stuff with someone(s). Im mostly looking for newer games but am open to anything. Thanks! And i forgot to add the list. [Here](https://docs.google.com/spreadsheets/d/1zkoWGyby6nOWpWncIJqUqYUDr8n7iCqBke8yxnj0nt0/edit#gid=2056583469) you go! Club Nintendo EU Star Codes Club Nintendo AU Star Codes 24 Mar, 2015 at 05:35 AM Hey guys, I bought Donkey Kong Returns 3D for my PAL 3DS, but it turns out I can't redeem the code for the stars because that's EU only. Anyone make the same mistake as me but end up with an AU copy? I'm wanting to swap codes =) Looking to get out of the Amiibo game. Will pay for the shipping. [Picture here.](http://imgur.com/fucOrcM) CoD Advanced Warfare Xbox One Season Pass Xbox One offers 24 Mar, 2015 at 03:29 AM Won a CoD AW season pass in a Twitter giveaway, looking to trade it for an Xbox One digital game code or something. Season pass is $70 on the marketplace, so getting the game itself, BF: Hardline or Borderlands Collection would be sweet. Just throwing this one out there and can add $5 if needed :D Successful Trade: http://tinyurl.com/SuccessTradesLA Super Mario 3D World (Wii U) Pit or Meta Knight Amiibo (Any Region, Loose or NIB) 24 Mar, 2015 at 01:35 AM As the title says I have Super Mario 3D world and I want Pit or Meta Knight Amiibo in any region Loose or NIB. If someone offers a Meta Knight and someone else offers a pit within 24 hours I will take the Pit over the Meta Knight. Assassin's creed unity Xbox one digital code Make a offer for Xbox one game 24 Mar, 2015 at 01:31 AM New to this thread I have this code and I am looking for any other game other than ac game or halo Looking to get Hardline swapped to any game on Steam. Can buy a few games if the price is lower than on Hardline. Can't currently get money on Origin. I can go first, if insisted. Donkey Kong Country Tropical Freeze (Wii U) Hyrule Warriors (Wii U) 23 Mar, 2015 at 08:29 AM NA NiB Amiibo Wii, 3DS, and GameCube games 23 Mar, 2015 at 04:36 AM The amiibo I have to trade: 4x Ike 3x Gold Mario 2x S
[ 26354, 6218, 18309, 18957, 26772, 5444, 15936, 13639, 6686, 46770, 32932, 5832, 3917, 9146, 6418, 4746, 38107, 26335, 238, 5444, 21918, 21447, 26725, 6686, 17531, 9345, 30723, 23872, 9146, 11473, 46212, 4340, 187, 187, 20422, 241, 36168, 17951, 37203, 20422, 241, 187, 187, 13129, 14010, 4746, 15936, 13639, 6686, 10446, 13639, 6686, 6344, 48711, 20584, 13639, 6449, 12462, 112, 18309, 21479, 36168, 17951, 30004, 6957, 21700, 223, 23826, 35550, 4340, 187, 187, 35489, 32020, 5225, 35300, 165, 120, 120, 6449, 12462, 112, 15124, 26772, 47754, 6088, 6418, 14010, 8509, 11473, 48892, 23872, 11473, 6957, 48624, 5151, 28254, 5444, 32020, 19857, 15625, 6957, 4746, 38107, 26335, 238, 5444, 48711, 20584, 13639, 5444, 17559, 101, 9345, 6261, 26725, 47221, 18780, 187, 187, 10041, 120, 8509, 21447, 5832, 20422, 241, 20422, 241, 20422, 241, 20422, 241, 26680, 26680, 26680, 187, 187, 46843, 11800, 102, 14016, 13973, 13129, 5151, 4340, 14010, 9345, 13973, 17531, 13973, 11039, 5891, 6686, 9146, 18514, 165, 120, 120, 6957, 1357, 107, 15815, 39009, 1357, 107, 39009, 5444, 10041, 120, 8509, 11473, 4746, 5151, 14016, 11039, 44246, 124, 17531, 6261, 10786, 34698, 32365, 5444, 32363, 243, 17531, 41581, 5444, 1769, 231, 9467, 6088, 13127, 118, 46674, 6261, 21322, 11473, 15625, 4340, 187, 187, 10041, 120, 8509, 5832, 14378, 225, 31949, 6344, 165, 120, 120, 5444, 163, 222, 107, 36114, 3917, 16436, 41662, 21918, 9935, 40404, 11473, 10786, 5690, 235, 14321, 4746, 8509, 5832, 6344, 27107, 103, 5444, 6218, 6686, 46674, 5151, 20550, 9146, 3917, 28254, 5444, 165, 120, 120, 5444, 41777, 224, 33532, 38011, 6957, 18678, 20550, 3917, 6957, 23872, 9146, 11473, 15625, 40404, 4340, 187, 187, 29474, 19067, 6344, 4746, 14010, 6088, 6418, 1769, 226, 9467, 1357, 107, 6996, 6449, 765, 116, 9736, 28917, 221, 18309, 165, 120, 120, 6449, 27937, 11473, 35489, 24617, 30723, 18780, 187, 187, 13748, 41777, 224, 33532, 38011, 3917, 27098, 165, 120, 120, 13752, 3917, 47961, 21991, 20776, 26680, 187, 187, 5151, 9146, 6957, 6344, 5891, 43972, 9935, 4340, 48624, 22010, 5444, 41478, 30093, 124, 6344, 1357, 107, 39009, 1357, 107, 39009, 6686, 48711, 20584, 13639, 3917, 165, 120, 120, 6449, 21275, 11473, 16740, 48756, 5832, 46770, 32932, 35550, 4340, 187, 187, 41162, 6686, 11039, 4746, 41777, 224, 33532, 38011, 3917, 27098, 14262, 236, 48561, 6449, 45128, 108, 5832, 46770, 32932, 48711, 20776, 4340, 187, 187, 15936, 18309, 4746, 29626, 123, 20113, 13129, 19857, 46180, 120, 41478, 18309, 5891, 8509, 19857, 30723, 10446, 9736, 23826, 3917, 39636, 6686, 49764, 4746, 33124, 37203, 10786, 27107, 103, 6449, 26772, 6261, 5832, 41326, 3917, 41869, 7249, 106, 6449, 18309, 46461, 2155, 216, 6686, 14318, 97, 3917, 48711, 20584, 13639, 6449, 21275, 21447, 26725, 35550, 4340, 187, 187, 18780, 8509, 6218, 4746, 48711, 20584, 13639, 5444, 25715, 243, 9146, 24617, 18757, 13748, 20691, 1357, 217, 13752, 6088, 13748, 21322, 162, 99, 211, 13752, 5444, 10786, 41777, 224, 33532, 38011, 6449, 40564, 19857, 5832, 44912, 4746, 187, 187, 28779, 39009, 41344, 6996, 35259, 98, 6449, 37208, 12335, 18309, 4746, 13748, 37248, 5444, 10786, 10446, 765, 122, 9345, 48711, 6686, 20691, 1357, 217, 13752, 10786, 21275, 21447, 26725, 35550, 4340, 187, 187, 41162, 6686, 11039, 30723, 4746, 14321, 9736, 6088, 48711, 20584, 13639, 6088, 32313, 8509, 21447, 48815, 37895, 114, 11039, 46016, 11043, 119, 26354, 6449, 45387, 231, 18678, 18309, 14016, 9345, 5832, 6418, 41581, 20776, 4340, 187, 187, 13129, 14010, 4746, 39984, 29741, 30423, 6261, 3917, 36337, 233, 44246, 236, 6957, 10962, 114, 18514, 6088, 10446, 34198, 6344, 4746, 10446, 10446, 21479, 6418, 38107, 26335, 238, 5444, 32653, 232, 6957, 1769, 211, 13682, 47434, 47054, 37988, 5444, 48711, 20584, 13639, 6449, 33700, 242, 43645, 20550, 43033, 235, 23371, 6449, 32938, 18434, 5444, 46843, 11800, 102, 33403, 9736, 45950, 13973, 14321, 8509, 5891, 43972, 9935, 4340, 187, 187, 48711, 20584, 13639, 45261, 5444, 24308, 6218, 6686, 27107, 103, 6957, 7719, 119, 14321, 4746, 39468, 45261, 5444, 162, 125, 211, 32790, 218, 6957, 23692, 110, 5832, 43033, 235, 6449, 5891, 9146, 6088, 46843, 11800, 102, 14016, 13973, 13129, 5151, 4340, 187, 187, 39984, 29741, 4746, 39573, 11039, 24617, 45950, 13973, 14321, 15625, 26680, 26680, 187, 187, 1769, 211, 13682, 47434, 47054, 37988, 5444, 48711, 20584, 13639, 6449, 33700, 242, 43645, 5832, 187, 187, 9935, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 6996, 6996, 12448, 214, 26680, 26680, 187, 187, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 26680, 26680, 26680, 187, 187, 35482, 17694, 35482, 17694, 35482, 17694, 35482, 17694, 35482, 17694, 35482, 17694, 26680, 26680, 26680, 187, 187, 1769, 226, 13682, 29733, 29733, 6996, 6996, 6996, 6996, 6996, 12448, 214, 26680, 26680, 26680, 187, 187, 11908, 1769, 231, 44192, 6449, 18780, 187, 187, 28791, 14321, 44781, 11473, 5444, 15815, 26680, 26680, 26680, 187, 187, 9935, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 26680, 26680, 26680, 26680, 187, 187, 32166, 15815, 39009, 26003, 6996, 6996, 6996, 6996, 13682, 26680, 26680, 26680, 26680, 26680, 187, 187, 2866, 39009, 41344, 16509, 16509, 15815, 187, 187, 11016, 214, 6957, 7149, 9146, 6996, 6996, 6996, 6996, 6996, 12448, 214, 26680, 26680, 26680, 187, 187, 25538, 37203, 3917, 5690, 232, 16740, 48756, 31355, 47343, 6996, 6996, 12448, 214, 15815, 26680, 26680, 26680, 187, 187, 17072, 1357, 116, 6996, 6996, 6996, 6996, 6996, 12448, 214, 11908, 26680, 26680, 26680, 187, 187, 21700, 213, 23872, 11473, 20776, 187, 187, 6418, 5151, 4746, 5151, 9146, 6957, 6344, 15124, 6344, 5891, 43972, 9935, 9146, 4340, 187, 187, 32653, 232, 21232, 45748, 4746, 8509, 13129, 9146, 10446, 13639, 6686, 5444, 28656, 9467, 35259, 102, 9467, 6957, 16740, 6957, 47221, 6418, 35636, 9736, 13442, 6686, 9146, 18514, 3917, 20776, 6957, 4746, 20691, 5151, 20691, 5151, 15367, 6449, 16549, 235, 9345, 6261, 30423, 32365, 6344, 28492, 123, 5891, 13639, 6344, 5891, 8509, 5151, 35550, 4340, 187, 187, 29474, 3917, 10786, 4746, 41777, 224, 33532, 38011, 3917, 27098, 33700, 242, 43645, 20005, 21447, 4746, 37895, 108, 27804, 15275, 11473, 10786, 41581, 9736, 6088, 30255, 225, 18617, 113, 5891, 48711, 5444, 32020, 19857, 5832, 20776, 15275, 40404, 4340, 187, 187, 35201, 13973, 9146, 16436, 41662, 33403, 21447, 5891, 8509, 18514, 49764, 4746, 209, 37248, 37203, 10786, 48711, 20584, 13639, 5444, 23956, 236, 8509, 11039, 41581, 43033, 235, 2155, 216, 6686, 8587, 236, 24017, 6449, 41777, 224, 33532, 38011, 5151, 9736, 765, 111, 5151, 5444, 33700, 242, 43645, 5832, 18245, 228, 8650, 101, 6449, 35392, 237, 17531, 13442, 14321, 6218, 5151, 6088, 35636, 5151, 15625, 4340, 187, 187, 29554, 39295, 20584, 5444, 4746, 35241, 26270, 6418, 23826, 47343, 13639, 10446, 165, 224, 222, 6449, 27661, 244, 21479, 9146, 765, 116, 5832, 5494, 219, 17576, 6686, 49764, 4746, 12105, 48991, 21322, 28492, 123, 5891, 26725, 5444, 5891, 13442, 6261, 14016, 13973, 13129, 5151, 4340, 187, 187, 23826, 6686, 26725, 5444, 4746, 35636, 5151, 20691, 14321, 6344, 5959, 103, 3917, 35643, 24404, 5444, 48711, 20584, 13639, 6449, 23373, 9345, 6218, 6088, 10446, 34198, 4746, 37248, 8509, 6344, 38011, 31355, 6218, 19067, 3917, 18757, 14016, 11039, 5151, 14274, 38028, 6686, 44899, 36820, 23826, 33403, 18514, 49764, 15936, 23826, 11039, 10786, 35482, 11908, 11908, 28405, 20776, 4340, 187, 187, 39984, 29741, 5138, 217, 43033, 235, 4746, 41162, 21479, 10786, 48815, 37895, 114, 11039, 46016, 48711, 20584, 13639, 17694, 13682, 24119, 6449, 21322, 11016, 212, 11473, 14016, 13973, 13129, 5151, 26680, 187, 187, 32653, 232, 6418, 45128, 108, 14318, 111, 37203, 5444, 1357, 107, 39009, 1357, 107, 39009, 3917, 48711, 20584, 13639, 6449, 33700, 242, 43645, 45950, 11039, 44002, 6449, 6765, 218, 18514, 49764, 4746, 26772, 18434, 6418, 32020, 6218, 14016, 10786, 38591, 46212, 4340, 187, 187, 13129, 28254, 6686, 11039, 187, 187, 53, 8775, 535, 3675, 22070, 2805, 6091, 81, 4284, 14, 9561, 577, 89, 740, 40, 187, 187, 2551, 920, 14, 12588, 4438, 278, 296, 81, 187, 187, 39639, 26239, 3244, 4284, 1980, 187, 187, 39639, 5230, 4279, 608, 370, 18, 5, 24343, 13257, 52, 26, 82, 41, 5, 38, 16077, 75, 30930, 16983, 49, 25314, 7311, 5039, 91, 22, 48084, 79, 1797, 187, 187, 19721, 14991, 15863, 1458, 2554, 2990, 14, 15787, 4279, 608, 370, 18, 5, 4708, 16, 4529, 59, 72, 26, 5, 43, 25, 88, 37, 18, 82, 49, 3837, 50, 35, 68, 4013, 87, 21, 453, 71, 1767, 15, 187, 19721, 12531, 4991, 15863, 1458, 2554, 2990, 14, 15787, 4279, 608, 370, 18, 5, 45, 88, 19, 52, 1044, 21, 76, 5, 67, 48389, 31983, 25090, 19, 70, 24, 35331, 15, 87, 47, 6677, 6603, 48, 17, 187, 187, 15049, 40768, 18, 187, 187, 15049, 40768, 19, 187, 187, 15049, 11354, 18, 187, 50275, 532, 2953, 884, 15, 17, 15, 19, 15, 1010, 16, 1348, 187, 187, 2369, 13997, 24749, 187, 187, 26454, 23370, 3944, 14, 44291, 187, 50275, 2369, 26897, 535, 187, 423, 187, 41497, 14277, 7229, 2715, 568, 18, 15, 17, 3, 9706, 568, 17880, 14, 25, 28739, 187, 29, 11695, 29806, 8893, 568, 21, 15, 17, 3, 15664, 568, 2413, 1358, 24991, 15, 22730, 15, 681, 16, 35654, 16, 983, 7973, 16, 9755, 1138, 187, 50276, 29, 46812, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 1138, 187, 50272, 29, 40049, 18483, 38958, 70, 1229, 67, 2759, 1731, 14, 22, 39273, 14, 21, 6357, 25, 14, 67, 26, 69, 21, 14, 24, 69, 17, 71, 3011, 5523, 1237, 69, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 1138, 187, 50272, 29, 40049, 18483, 38958, 24, 8407, 21, 10442, 14, 67, 21, 71, 20, 14, 21, 70, 2691, 14, 2320, 68, 20, 14, 4148, 30626, 71, 49352, 1787, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 350, 1949, 1138, 187, 50272, 29, 40049, 18483, 38958, 21, 4838, 1796, 1706, 14, 584, 22, 14, 21, 67, 20, 66, 14, 67, 22, 357, 14, 23, 67, 12352, 25, 71, 18, 71, 23, 317, 26, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 255, 8074, 1568, 1138, 187, 50272, 29, 40049, 18483, 38958, 71, 883, 317, 2511, 70, 14, 70, 21, 70, 25, 14, 40181, 69, 14, 1257, 3655, 14, 66, 4185, 453, 71, 23, 69, 2031, 2759, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 5047, 398, 1962, 1405, 1138, 187, 50272, 29, 40049, 18483, 38958, 68, 25, 66, 15798, 68, 25, 14, 21, 68, 24, 70, 14, 21, 70, 20, 67, 14, 66, 4148, 70, 14, 21, 71, 615, 26, 1717, 66, 21, 71, 23, 71, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 7645, 1138, 187, 50272, 29, 40049, 18483, 38958, 1619, 2405, 69, 27893, 14, 71, 23, 69, 18, 14, 1857, 740, 14, 67, 46514, 14, 70, 16763, 2222, 67, 3342, 19490, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 5996, 21448, 1138, 187, 50272, 29, 40049, 18483, 38958, 19, 66, 3712, 66, 48219, 14, 17, 68, 19, 69, 14, 21, 1257, 21, 14, 67, 32834, 14, 17, 70, 20450, 1976, 12847, 18, 71, 20, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 20511, 1138, 187, 50272, 29, 40049, 18483, 38958, 19, 3342, 3655, 69, 805, 14, 17786, 67, 14, 38693, 66, 14, 25, 70, 3953, 14, 67, 17, 69, 20, 2428, 3342, 17, 71, 4482, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50276, 870, 46812, 31, 187, 50276, 29, 46812, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 4990, 61, 38965, 64, 36511, 64, 615, 1179, 15, 5844, 85, 1138, 187, 50272, 29, 9824, 31, 2203, 61, 4990, 870, 9824, 31, 187, 50274, 870, 11336, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 4990, 61, 6839, 3086, 2446, 10172, 15, 5844, 85, 1138, 187, 50272, 29, 9824, 31, 2203, 61, 4990, 870, 9824, 31, 187, 50274, 870, 11336, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 4990, 61, 255, 8074, 1568, 61, 13456, 15, 5844, 85, 1138, 187, 50272, 29, 9824, 31, 2203, 61, 4990, 61, 255, 8074, 1568, 870, 9824, 31, 187, 50274, 870, 11336, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 5047, 398 ]
果たして本当にそんなことができるのかは、実際にやってみなければわかりません。 ~三日後~ さあ、そんなこんなでそうめんを干してから三日間が経ちました。 外見的には麺を干した当初とはあまり変わりが無いように見えますが、実際にそうめんに触れてみると…… 固まってる~~~~!!! ご覧ください。あれだけだらしなかった麺がガッチガチに固まり、いくら傾けても重力に負けずにピンと伸びております。 固まる過程で麺に独特のクセやうねりも付き、まるで風にたなびいているかのように麺に躍動感が出ているのがわかりますね。 ということで、あとはハンガーをぶっ壊して麺を取り外せば…… 「躍動感のある麺」の完成です! いかがでしょう。無事に立派でガチガチなそうめんの麺を作り上げることができました。 これなら、躍動感のある写真を撮ることができそうです。 そして、製法さえ確立してしまえばこっちのものなので、その後も風を当てるなどの工夫をして色々な形のそうめんを作ってみました。 ……また、そうめんに欠かせない「つゆ」と「お椀」にも躍動感を与えるため、 カチューシャを利用して、「今にもこぼれそうなつゆ」も作ってみました。 これならば、きっとそうめんと相まって素晴らしい効果を演出してくれるはずです。 さあ、それでは全ての準備が整ったところで、ここからは実際に僕がダイナミックにそうめんを食べている様子を存分にご覧になっていただきましょう。 そうめん界に新たな風が吹き、業界に激震が走る様をしかとご覧ください。 それでは、参らせていただきます!! ダイナミックにそうめんを食べる うおおおおおおおおーーーッ!! おおおおおおおおおおお!!! オラオラオラオラオラオラ!!! ハイィィーーーーーーッ!!! スピードを…… 置き去りにッ!!! うおおおおおおおおおおおお!!!! バッチコーーーーイ!!!!! …チュルルッ 逃がすかーーーーーーッ!!! 最後の仕上げじゃーーーッッ!!! アザーーーーーーッス!!! 終わりです はい、いかがでしたでしょうか。 僕自身、まさかこんなにテンションが上がるとは思っていなかったのですが、ついつい我を忘れて全力で楽しんでしまいました。 というのも、躍動感のある食べ方って、普通よりもずっと美味しそうに見えるですよね。 何だかクセになってしまったので、 今後もそうめんに留まらず様々な料理を躍動感いっぱいに食べる挑戦を続けていきたいと思います。 手始めに、次回はちゃんこ鍋を頭からかぶる予定なので、是非お楽しみにしていてください。 ちなみに、思いつきで木のウロにそうめんを入れたところ、今まで感じたことのないくらい不安な気持ちになったのでそちらもオススメです。 それでは皆様、これからも素晴らしいそうめんライフをお送りください! 僕は撮影後にガチガチのそうめんを食べていたら口を切ったので、当分は見たくもありません。 さようなら Tweet transceiver qsfp default-mode 4x10G spanning-tree mode mstp aaa authorization exec default local aaa root secret 5 $1$lpTXS9qH$EpnjrnfpPZZgiAbz5sxn21 username admin privilege 15 role network-admin secret 5 $1$RT/92Zg9$J8wD1qPAdQBcOhv4fefyt. username vagrant privilege 15 role network-admin secret 5 $1$Lw2STh4k$bPEDVVTY2e7lf.vNlnNEO0 interface Ethernet1 interface Ethernet2 interface Management1 ip address 10.0.2.15/24 no ip routing management api http-commands no shutdown end <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <ItemGroup> <Filter Include="data"> <UniqueIdentifier>{e30b8426-5883-4ca8-b9d4-7d0f5700532d}</UniqueIdentifier> </Filter> <Filter Include="data\material"> <UniqueIdentifier>{7afe4aba-b4f3-4e86-afc3-97497f211037}</UniqueIdentifier> </Filter> <Filter Include="data\material\terrain"> <UniqueIdentifier>{4003ee34-ace5-4b3a-b5ab-6bdc8f1f6ac9}</UniqueIdentifier> </Filter> <Filter Include="data\material\atmosphere"> <UniqueIdentifier>{f11ac89e-e4e8-434d-be73-a98fef6d4484}</UniqueIdentifier> </Filter> <Filter Include="data\renderscheme"> <UniqueIdentifier>{c8a024c8-4c7e-4e3b-a97e-4fde929a4f6f}</UniqueIdentifier> </Filter> <Filter Include="data\material\model"> <UniqueIdentifier>{2831d313-f6d1-4510-b526-e20595bbf245}</UniqueIdentifier> </Filter> <Filter Include="data\material\postfx"> <UniqueIdentifier>{2a51a521-0c2d-4be4-b642-0e27575bc1f3}</UniqueIdentifier> </Filter> <Filter Include="data\editor"> <UniqueIdentifier>{2bf73d12-185b-433a-8e94-b0d3cdbf0fbb}</UniqueIdentifier> </Filter> </ItemGroup> <ItemGroup> <None Include="..\..\..\..\Bin\Data\material\geometry_brush_decal.bmt"> <Filter>data\material</Filter> </None> <None Include="..\..\..\..\Bin\Data\material\instancedAABB.bmt"> <Filter>data\material</Filter> </None> <None Include="..\..\..\..\Bin\Data\material\atmosphere\sky.bmt"> <Filter>data\material\atmosphere</Filter> </None> <None Include="..\..\..\..\Bin\Data\renders
[ 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702, 13556, 13, 401, 36746, 8702 ]
, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU ALL, FUCK YOU
[ 273, 14603, 285, 32873, 3374, 13, 16425, 326, 253, 6158, 1057, 417, 2430, 271, 3907, 1436, 15, 187, 187, 1989, 1677, 253, 2256, 2351, 273, 32721, 14603, 13, 285, 253, 33384, 414, 13557, 403, 7032, 273, 13, 271, 3907, 1436, 476, 320, 642, 1679, 12232, 835, 14603, 310, 275, 1953, 15, 187, 187, 510, 7796, 671, 5936, 271, 1478, 14, 483, 985, 17580, 7015, 23289, 812, 8069, 5580, 616, 11315, 6055, 275, 1091, 323, 247, 2169, 16268, 15, 187, 187, 1552, 310, 247, 11527, 2934, 15, 380, 3753, 273, 253, 2628, 310, 281, 789, 275, 247, 3569, 7952, 326, 476, 1614, 327, 697, 1481, 387, 667, 1677, 673, 15, 6102, 7661, 932, 403, 3798, 2330, 342, 12337, 13, 533, 476, 1705, 387, 667, 673, 13, 17142, 407, 247, 3076, 15981, 1304, 390, 3365, 253, 29257, 1860, 494, 246, 1487, 273, 4743, 1561, 253, 12265, 9320, 15, 187, 187, 49397, 643, 8474, 15071, 275, 253, 1345, 8776, 2968, 342, 436, 4248, 273, 45583, 428, 253, 7370, 447, 403, 281, 320, 1119, 11358, 13, 275, 253, 1533, 273, 5842, 285, 253, 2136, 4450, 4461, 15, 187, 187, 22427, 403, 760, 3367, 11074, 5351, 387, 13841, 15, 1284, 6589, 9566, 2792, 562, 275, 271, 11790, 4857, 281, 253, 7796, 13, 7015, 23289, 1364, 320, 2104, 281, 513, 616, 2628, 1293, 4709, 272, 686, 29486, 6433, 665, 1537, 1089, 49307, 784, 7015, 23289, 271, 20125, 2092, 281, 253, 1039, 597, 5730, 281, 1408, 253, 6265, 5983, 187, 187, 1992, 5386, 436, 6055, 651, 11907, 816, 253, 2238, 273, 4105, 25978, 1980, 2208, 310, 26426, 2820, 281, 3553, 3212, 15, 187, 187, 21342, 13, 253, 7796, 310, 19392, 281, 816, 581, 1083, 13, 534, 310, 1740, 1107, 1711, 15, 1292, 627, 588, 1900, 320, 44355, 2219, 835, 247, 3558, 273, 4750, 24662, 281, 253, 2471, 15, 1916, 2297, 366, 253, 5161, 10843, 275, 1340, 281, 3657, 841, 7520, 2219, 651, 320, 7094, 4828, 16233, 15, 187, 187, 1556, 9566, 13, 534, 2210, 2439, 253, 18595, 407, 4839, 13, 310, 269, 14583, 326, 352, 369, 417, 33444, 13, 285, 253, 1543, 273, 7005, 2835, 352, 403, 6296, 40975, 15, 187, 187, 6436, 13, 253, 7796, 434, 5697, 403, 594, 2080, 562, 273, 5181, 342, 253, 6612, 273, 4980, 1980, 2208, 13, 352, 3133, 11543, 597, 588, 2455, 923, 253, 1708, 273, 1388, 15, 187, 187, 1394, 1537, 671, 751, 1051, 187, 187, 51, 977, 3964, 353, 3979, 7407, 253, 5962, 12061, 275, 253, 1180, 273, 2151, 2256, 281, 247, 1429, 6055, 2098, 4103, 281, 3072, 275, 4240, 14, 1093, 13, 347, 3872, 2308, 273, 2872, 952, 2783, 387, 253, 954, 2495, 273, 4092, 5237, 2559, 407, 253, 4585, 2281, 323, 1740, 1107, 15, 187, 187, 21663, 454, 3128, 2758, 452, 2361, 253, 15702, 1387, 327, 41436, 1544, 353, 3979, 281, 253, 3128, 9550, 323, 5575, 21600, 846, 247, 46395, 263, 10145, 18158, 273, 16839, 17992, 285, 7242, 275, 521, 28404, 4857, 285, 14315, 46395, 641, 2439, 7612, 48096, 504, 403, 671, 10268, 37429, 285, 253, 4322, 273, 372, 14, 27423, 15, 187, 187, 10342, 1176, 16390, 187, 187, 1145, 418, 7258, 21729, 1051, 187, 187, 1051, 72, 1644, 368, 2289, 281, 418, 7258, 11095, 15, 681, 13, 4508, 271, 440, 1148, 4781, 1070, 5447, 273, 7114, 273, 6763, 273, 7774, 9159, 253, 3668, 13, 941, 13, 12925, 285, 1083, 2175, 326, 45667, 878, 281, 32385, 12176, 285, 3157, 3238, 12547, 23728, 27, 1986, 29218, 187, 187, 1909, 309, 4288, 1475, 5791, 10497, 13, 309, 717, 594, 31115, 309, 858, 417, 5108, 281, 320, 1014, 8003, 281, 253, 2564, 14, 67, 19613, 1981, 17376, 318, 326, 310, 1335, 40132, 275, 253, 22075, 347, 247, 906, 273, 16639, 545, 3508, 388, 2284, 8202, 15, 380, 3668, 7031, 309, 452, 2326, 273, 253, 15394, 1223, 309, 369, 275, 9733, 13, 285, 717, 1024, 6523, 1060, 275, 17975, 13, 310, 816, 10155, 619, 2798, 327, 247, 5312, 3720, 15, 2058, 2069, 751, 841, 13, 352, 9193, 347, 2167, 2717, 309, 812, 513, 390, 8162, 651, 1056, 1014, 253, 246, 5391, 383, 3064, 15, 9110, 13, 309, 871, 326, 253, 19737, 273, 23866, 326, 952, 751, 479, 476, 1056, 812, 1599, 253, 3064, 875, 247, 9988, 2799, 273, 3673, 1070, 1824, 10922, 247, 8905, 7773, 390, 417, 13, 390, 247, 11393, 3739, 14235, 2970, 26114, 390, 417, 15, 1893, 13, 309, 4710, 619, 268, 2711, 610, 21078, 275, 253, 1721, 13, 285, 3524, 15, 187, 187, 2214, 667, 31754, 2190, 368, 665, 1557, 281, 513, 253, 1072, 13, 1986, 29218, 310, 1024, 11038, 7731, 23866, 281, 28177, 74, 36, 4420, 13, 380, 2448, 4410, 10547, 285, 24636, 5106, 323, 16639, 545, 3508, 388, 2284, 8202, 6619, 13, 347, 973, 347, 9159, 281, 1918, 43183, 486, 14820, 2758, 598, 281, 337, 13, 933, 4465, 17301, 6574, 323, 2403, 23866, 273, 370, 1235, 390, 625, 13, 347, 247, 5717, 368, 323, 634, 42548, 15, 1893, 13, 604, 368, 8778, 1986, 13, 285, 368, 971, 281, 1056, 247, 23672, 281, 1361, 46354, 3508, 10349, 13, 513, 352, 949, 1986, 457, 84, 23672, 4422, 13, 1060, 13, 275, 1340, 281, 1379, 5750, 273, 253, 11038, 2086, 13, 285, 281, 1750, 634, 17301, 6574, 15, 187, 187, 688, 30513, 273, 619, 1533, 4892, 16018, 13, 309, 3078, 281, 755, 368, 247, 1652, 1633, 2714, 281, 4456, 479, 407, 28, 1633, 326, 368, 812, 1158, 273, 2378, 275, 247, 1223, 13, 285, 5046, 9012, 247, 7107, 1652, 3055, 9012, 281, 4834, 326, 651, 320, 1512, 1199, 7596, 281, 5513, 281, 3780, 665, 2546, 752, 369, 594, 11755, 15, 1893, 13, 309, 2427, 281, 591, 2327, 253, 4618, 285, 12848, 4610, 327, 401, 2373, 83, 15, 187, 187, 4045, 368, 871, 670, 401, 2373, 83, 32, 401, 2373, 83, 310, 271, 3909, 27769, 13, 835, 12633, 512, 689, 253, 1533, 3959, 598, 512, 5133, 273, 10229, 390, 3238, 323, 253, 665, 2784, 7004, 4376, 273, 370, 22, 15, 16942, 327, 401, 2373, 83, 310, 2620, 8918, 1128, 2369, 625, 13, 642, 1679, 15, 7757, 253, 1416, 15, 5595, 273, 352, 310, 2238, 273, 11339, 13, 533, 690, 273, 352, 310, 1175, 13, 285, 690, 273, 352, 310, 816, 8342, 37750, 15, 6491, 9159, 4092, 1841, 13, 751, 2136, 5827, 13, 35905, 13, 519, 480, 272, 868, 13, 18479, 11809, 13, 2801, 2957, 37829, 390, 3733, 5827, 13, 403, 4518, 2509, 352, 347, 247, 2957, 6657, 13, 11525, 326, 2852, 2136, 4409, 625, 685, 2620, 33096, 588, 956, 15, 19810, 403, 24509, 3390, 288, 19074, 447, 13, 824, 347, 4028, 1841, 327, 247, 5313, 273, 11789, 13, 390, 33797, 562, 8169, 327, 247, 1810, 37588, 934, 4450, 275, 3523, 14, 26049, 3085, 15, 11706, 2571, 403, 816, 259, 471, 324, 1062, 1771, 15, 9240, 403, 619, 7583, 15, 309, 574, 271, 519, 598, 327, 401, 2373, 83, 323, 247, 1223, 13, 9159, 281, 564, 15729, 253, 13988, 4103, 273, 634, 4327, 13, 1561, 2030, 6574, 273, 5003, 10765, 13, 323, 370, 22, 15, 29902, 13, 987, 32, 5402, 27078, 13134, 280, 290, 310, 275, 247, 1728, 275, 2065, 785, 13, 285, 368, 476, 457, 85, 755, 627, 323, 617, 11456, 5784, 14348, 32, 401, 2373, 83, 281, 253, 14471, 15, 23177, 247, 3047, 24507, 949, 12286, 17183, 13, 285, 45722, 40081, 310, 327, 617, 1039, 281, 7257, 253, 1943, 13, 5890, 13, 3896, 763, 90, 15729, 368, 476, 457, 85, 15, 309, 1014, 5907, 247, 773, 42494, 27638, 1959, 668, 4500, 13, 835, 309, 651, 9023, 417, 281, 8251, 44221, 390, 253, 14818, 414, 13, 48496, 314, 2257, 621, 309, 717, 594, 14753, 273, 13, 604, 627, 497, 26710, 14, 12198, 16762, 281, 320, 2783, 15, 1292, 13, 352, 8058, 45783, 13, 984, 1014, 2167, 309, 369, 2590, 670, 253, 773, 293, 491, 314, 668, 629, 275, 253, 519, 13, 8505, 13, 326, 457, 84, 417, 347, 39662, 347, 309, 574, 1869, 13, 285, 309, 4934, 2970, 9762, 432, 2872, 6068, 2820, 281, 5007, 479, 281, 15729, 616, 773, 32633, 968, 668, 390, 773, 328, 5005, 1806, 285, 39795, 369, 13213, 1037, 27086, 281, 564, 2112, 285, 320, 619, 2133, 18625, 327, 15729, 21820, 13, 594, 13, 10902, 19639, 2752, 401, 2373, 83, 5249, 4962, 1078, 352, 2455, 1694, 745, 253, 3216, 13, 285, 4130, 457, 84, 6912, 14564, 1711, 12633, 403, 1024, 1469, 20209, 814, 2400, 13, 512, 984, 273, 690, 17081, 90, 31147, 342, 2717, 1805, 281, 513, 685, 26603, 401, 2373, 83, 15, 1292, 309, 2836, 560, 15, 8247, 281, 634, 9140, 15, 187, 187, 2598, 13, 3066, 401, 2373, 83, 13, 309, 1119, 436, 13491, 21205, 1253, 665, 5841, 2994, 773, 36, 5744, 3847, 3083, 668, 1253, 2211, 839, 275, 247, 1355, 7773, 9366, 275, 5427, 13, 665, 13, 323, 253, 18979, 2620, 8918, 13, 588, 1691, 667, 3935, 368, 971, 327, 247, 861, 13, 285, 45917, 2259, 2994, 18792, 1475, 342, 352, 275, 752, 4453, 751, 247, 269, 10422, 10583, 390, 36767, 10617, 27768, 15, 773, 48, 1368, 13, 3962, 1806, 309, 1869, 15, 1893, 13, 309, 2197, 779, 247, 2748, 323, 824, 247, 3492, 13, 285, 2620, 8918, 13, 285, 2546, 326, 253, 861, 1239, 773, 3864, 249, 2296, 27, 330, 22728, 13, 10210, 2706, 11602, 31837, 951, 13, 533, 794, 15, 3771, 752, 309, 3078, 15, 330, 5744, 3847, 3083, 3531, 253, 1340, 1475, 3809, 28, 247, 1388, 1996, 13, 253, 1563, 3492, 369, 275, 619, 4579, 34272, 27, 187, 187, 5035, 70, 14, 90, 319, 2700, 13, 2325, 27462, 4672, 49719, 2, 754, 1663, 1691, 521, 2798, 715, 326, 3045, 2, 1292, 13, 344, 1669, 745, 253, 773, 3864, 249, 2296, 668, 629, 13, 285, 309, 871, 627, 403, 247, 1643, 273, 368, 13, 665, 3091, 3464, 9557, 6134, 13, 665, 5082, 457, 85, 2868, 326, 309, 8715, 457, 85, 816, 1863, 532, 264, 436, 745, 15167, 432, 3095, 2010, 285, 7558, 281, 452, 26237, 352, 4266, 15, 1244, 309, 971, 253, 6152, 13, 4344, 285, 6278, 15, 1893, 13, 309, 4159, 281, 330, 5744, 3847, 13, 285, 753, 849, 1199, 309, 7636, 253, 3492, 13, 285, 352, 369, 594, 9386, 13, 285, 6701, 594, 1199, 13, 533, 4496, 13, 812, 344, 513, 352, 969, 13, 285, 1691, 773, 3864, 249, 2296, 668, 327, 253, 861, 15, 4683, 2282, 13, 309, 753, 309, 651, 2075, 1529, 2620, 8918, 13, 642, 1895, 15, 309, 753, 344, 812, 1014, 3630, 352, 327, 253, 643, 1930, 273, 253, 1072, 2929, 13, 285, 816, 19153, 352, 1475, 15, 773, 9281, 1806, 2296, 330, 5744, 3847, 13, 773, 2369, 1895, 1425, 2635, 13, 253, 1735, 1388, 13, 436, 3492, 3249, 27, 187, 187, 4497, 2866, 1439, 3240, 15, 309, 1599, 13, 309, 2389, 326, 253, 2644, 7773, 310, 2970, 3206, 275, 619, 2199, 13, 285, 253, 16901, 403, 2119, 13491, 13, 533, 1024, 309, 452, 581, 3492, 342, 253, 6838, 285, 253, 773, 3864, 249, 49918, 668, 861, 13, 285, 1529, 342, 330, 5744, 3847, 2994, 285, 253, 773, 36, 22728, 13, 10210, 2706, 11602, 861, 13, 285, 326, 2506, 457, 85, 1663, 8415, 619, 1895, 15, 1893, 13, 309, 4159, 779, 896, 13, 35891, 779, 1801, 316, 600, 969, 13, 1021, 311, 1070, 253, 10763, 273, 253, 2255, 275, 253, 747, 3492, 13, 26108, 616, 18792, 285, 253, 15143, 861, 13, 285, 840, 2546, 779, 281, 13, 3965, 4496, 13, 513, 352, 969, 1128, 1542, 1529, 2620, 8918, 13, 273, 2282, 1128, 3113, 378, 31407, 7871, 15, 309, 15433, 13, 1580, 597, 574, 1097, 7871, 1160, 1024, 13, 253, 2626, 673, 651, 320, 253, 22611, 15, 309, 476, 816, 5406, 731, 512, 7063, 627, 275, 616, 7773, 13, 3981, 773, 1276, 1057, 703, 971, 1024, 13, 285, 2139, 1057, 703, 1978, 6890, 352, 7721, 285, 773, 10002, 2010, 476, 359, 755, 275, 327, 253, 3045, 7721, 1292, 13, 281, 479, 13, 344, 816, 753, 8261, 13, 2119, 15, 1244, 840, 436, 3492, 2692, 598, 247, 2159, 673, 1996, 27, 187, 187, 2598, 2810, 2, 6089, 13, 417, 4555, 15, 1292, 13, 1007, 849, 1199, 789, 597, 1691, 715, 436, 13, 342, 616, 1652, 36872, 10555, 742, 11012, 10934, 285, 3253, 15, 1359, 7353, 403, 597, 32, 11706, 13, 309, 2686, 3078, 2305, 15, 330, 5744, 3847, 5561, 249, 457, 562, 275, 521, 4759, 30433, 76, 4580, 13, 285, 309, 1053, 457, 85, 871, 752, 773, 35, 300, 2706, 668, 403, 13, 533, 597, 3590 ]
of capability and disciplinary issues, arguing that the latter does not require an independent person. But given the subjectivity of judging capability, and the irrationality politicians are capable of, an independent person can be no less vital where capability is in question. The assembly also suggests an opt-out system whereby chief executives could effectively sell their statutory protection in return for a higher salary. This is a terrible idea. The nature of the job is to work in a political climate that can turn on its head at any given time. Such reversals are usually associated with elections, but can come at any time, triggered by a bad inspection report or simply the inexplicable tides of opinion within the council chamber. Few other senior managers in the public sector deal with this degree of insecurity - the analogies are to be found elsewhere, in the world of football and the business boardroom. Nor are only personal travails at stake. As ALACE points out in an angry letter to the assembly, chief executives must be able to do their job without fearing 'politicians who might find conscientious chief executives an impediment to the way they wish to run the authority'. To remove this protection would encourage just the kind of poor governance local government is desperately trying to leave behind. Moreover, the assembly is responding to just one case, which is four years old. But there will always be rogue cases where a member of staff fights to the death. To negate the core legislation in order to prevent these rare cases would be entirely counterproductive. ALACE, which came across the proposals by chance, is fuming that it was not consulted, and the results of omitting it are indeed alarming. However, the assembly's ideas are so far out of touch with the reality of modern local government, it seems unlikely they will ever see the light of day. You might also like... Rotherham MBC experienced the biggest surge in the number of children subject to a child protection plan relative to population in 2017-18, as national levels of young people considered at the most risk of serious harm increased by the highest rate for four years. Labour party members have reported the Labour group on Wirral MBC to the party leadership for alleged misconduct after a councillor accused activists of intimidation and abuse in his resignation letter and warned councillors across Merseyside are also facing hostility and the threat of de-selection. Most Commented An LGC subscription... ...gives you access to LGCplus.com, containing an unparalleled database of tens of thousands of articles offering the news, data, guidance and case studies that councils need to withstand cuts and improve servicesTag Archives: United Airlines As I travel around East Asia, I am so thankful I did not happen to be even closer to the mind-boggling devastation that is still unfolding in the Philippines as a result of Typhoon Haiyan. The news coverage I have seen of the disaster while I was in Korea, and am now seeing here in Taiwan, is just breaking my heart on a daily basis. At times like these, it feels as though nothing I could do or contribute would make even the tiniest difference. Yet, I know that the aggregate of donations that people like me can make could mean the difference between a truckload of bottled water reaching a remote village or not, or a rural medical clinic getting medicines or not. So, I throw my paltry coins in the pot, and hope. For any travelers among you who care to do the same, United Airlines is now matching customer donations to AmeriCares, The American Red Cross and Operation USA for Typhoon Haiyan relief, as well as offering to give Mileage Plus members up to 1,000 extra bonus miles for making donations of $50 or more, as a thank you for your generosity. So, if you fly United, and you want to make a donation to help typhoon victims, do it through United’s donation website, here, in order to take advantage of the matching program, and to claim your bonus miles. In anticipation of my world tour departure, I wanted to get you a little something special to remember me by; something that you could think of once in a while, and maybe laugh a quiet little private laugh to yourself that would be too much trouble to explain to anyone who asked what was so funny. So, I went to peruse the wide and varied options on Fiverr. Do you know about Fiverr? Fiverr is an online marketplace, where folks all over the world offer up all manner of goods or services for the whopping asking price of $5. Everything on Fiverr is five dollars—no more, no less. Hence the name. Most of it is kind of stupid, but some of it is good, and some of it is just plain hilarious. People offering serious things, like business plans, budgets, ad jingles, logo designs, weight loss menus or training plans, are clearly doing it as a loss leader, hoping that future business worth more than five bucks will follow. Others are indulging hobbies, such as writing things on a piece of rice, or spelling out messages on a Scrabble board in stop-motion film. Still others are just wackadoolery. Those are my favorite. I had an ad up on Fiverr for a while, offering to go hug the elderly relative of your choice, within 25 miles of San Francisco, for $5. Nice, right? Your Aunt Millicent is in a home in Colma, and you can’t get there for her 93rd birthday? Fiverr to the rescue. Half a sawbuck through Paypal, and Miz Quin is on her way to deliver the big, warm, squishy hug you can’t. I even offered a “fragrance free” option, where I would promise not to wear perfume or the fruity, girly lotions I am so fond of, if there were scent-sitivities to be considered. But, it proved impractical, because even though I was clear about the “elderly” part in the ad, apparently, that’s not as unambiguous as I had thought, and I kept getting requests from young guys trying to send me to hug their “cousins” or “uncles,” and Fernando was categorically unwilling to go along and be my bodyguard on hug patrol, so, yeah…. My Fiverr career died before it ever got off the ground, and everyone’s Bay Area old folks are now going unhugged, all because of some horny teenagers with nothing better to do than cruise Fiverr. But I digress. Back to your gift. So, via Fiverr, I found this lovely gentleman– who calls himself “Crazzy Man”–operating in a small village somewhere in India, who, for the aforementioned five dollars, will put any message you want on a sign, and videotape himself dancing around with it in what looks like a faux grass or banana leaf skirt. “Ooh, perfect,” I thought. So, I sent him a request for such a video, and five dollars, and asked that the sign read “Quin says: Ciao, Bitches!” Saucy, but fun. Just what I wanted. Crazzy Man turned the order around fast; a day later, the following video was in my email inbox: Seee-yowwww, Beeches!! Awesome! He really put his heart into that performance! But, he left off the “Quin says” part, and I know there are a few of you, who shall remain nameless, who wouldn’t believe that I hadn’t just swiped this off YouTube from someone else and claimed to have commissioned it myself. And I want the credit, fair and square. So, I wrote to Crazzy, and said how much I loved the video, and it was so wonderful, and thanks so much, but please, could he do it again, and put “Quin says” on the sign. Of course, I said I would pay another five dollars, no problem. I said he could even write it on the other side of the same paper, and just flip it around. “Okay,” says Crazzy, “no problem.” Then, the next day, this video comes: Well…not quite. I mean, I love that the whole village is getting involved in my project, and the ladies are sure lovely, but now I have one video with the girls and the “Quin Says” sign, and another with Crazzy himself and the “Ciao, Bitches!” sign, and that doesn’t really solve my problem. So, I wrote him back, thanked him profusely again, extolled the beauty of the women in the new video, praised their dancing and the fantastic sign, and then asked him to, pretty please, do it again—for another five dollars, of course—with BOTH signs. I figured, since they had both signs made now, the third time would be the charm. I can just picture them all sitting there in their village, saying “What does she want now, and why does she keep changing it?” and “who else can we get in on the performance?” But, to me, he just said okay, sure. And then this video showed up a short time later: So close! Well, not exactly. But, look how much work they put into this, with their little choreographed dance routine and everything. How sweet are they? Still, I actually wanted Mr. Crazzy rockin’ out in his green manskirt, and I don’t know what “Bilches” are, but they sound
[ 690, 187, 13174, 778, 1089, 247, 27294, 13413, 15, 1198, 326, 13, 309, 5176, 7477, 13, 533, 309, 3524, 187, 13174, 588, 1265, 4685, 672, 3000, 403, 5486, 281, 320, 13413, 285, 672, 187, 262, 434, 816, 38452, 390, 21543, 4210, 15, 187, 187, 4485, 187, 15883, 40, 26584, 187, 1552, 310, 253, 42719, 273, 3652, 247, 1885, 534, 310, 387, 253, 23661, 273, 1529, 187, 32729, 447, 2579, 15, 187, 187, 4485, 187, 3610, 68, 4297, 249, 1255, 187, 510, 3492, 310, 1175, 15, 308, 2200, 281, 1089, 247, 2670, 273, 665, 858, 352, 13, 533, 812, 760, 755, 247, 187, 55, 20867, 80, 3239, 15, 8948, 368, 476, 755, 690, 25702, 6021, 327, 6153, 731, 247, 2670, 187, 936, 5580, 616, 10556, 15, 187, 187, 6223, 187, 18642, 628, 187, 22674, 2670, 310, 7939, 432, 616, 657, 553, 80, 3239, 27, 187, 187, 29, 2413, 1358, 2700, 15, 19, 44266, 14, 36047, 15, 681, 4357, 535, 688, 2087, 13, 271, 3939, 14, 6674, 3148, 6576, 556, 247, 29994, 273, 15115, 10912, 275, 4315, 285, 12646, 271, 2460, 407, 10938, 253, 7133, 273, 1708, 12275, 407, 12275, 275, 8956, 342, 2460, 6298, 1677, 15, 2091, 13, 323, 1650, 13, 5558, 9266, 310, 908, 347, 271, 4640, 14, 37016, 10359, 13, 253, 811, 16855, 593, 273, 1016, 12275, 16149, 275, 8956, 342, 253, 6718, 3732, 281, 253, 12275, 15, 380, 5044, 4254, 273, 271, 3939, 14, 6674, 2460, 3148, 6576, 19693, 271, 8708, 1516, 1102, 36416, 313, 3887, 10, 2144, 347, 271, 4640, 14, 37016, 22022, 10359, 310, 253, 1072, 347, 275, 253, 1083, 835, 5558, 9266, 310, 908, 15, 187, 34, 5558, 9266, 3148, 5370, 556, 15115, 1016, 15415, 347, 247, 37316, 285, 12646, 271, 2460, 407, 8577, 327, 16, 2727, 1708, 432, 247, 896, 1708, 342, 824, 247, 37316, 13, 390, 247, 12275, 15, 743, 8708, 11642, 3148, 5370, 310, 247, 3148, 5370, 273, 253, 1881, 14, 77, 36416, 1511, 1907, 247, 1708, 14, 42658, 2813, 275, 1016, 12275, 15, 6102, 247, 1881, 14, 77, 36416, 1511, 3148, 5370, 556, 11361, 689, 5558, 9266, 3148, 12471, 13, 1690, 2169, 2460, 23114, 13, 642, 878, 323, 247, 896, 1708, 13, 285, 2169, 2380, 3885, 15, 187, 510, 8708, 11642, 3148, 5370, 5760, 253, 48560, 273, 1016, 1708, 14, 42658, 2813, 313, 29206, 10, 1754, 327, 253, 2408, 273, 1655, 15, 3308, 13, 253, 8708, 11642, 3148, 5370, 310, 8127, 1027, 432, 253, 5558, 9266, 3148, 5370, 275, 326, 697, 42832, 1154, 4095, 403, 273, 253, 1655, 14, 17477, 1511, 390, 253, 1655, 14, 16894, 1511, 15, 187, 9817, 253, 5558, 9266, 3148, 5370, 13, 253, 8708, 11642, 3148, 5370, 476, 452, 667, 581, 273, 247, 2969, 14, 6674, 6661, 285, 271, 3939, 14, 6674, 6661, 15, 11474, 253, 3438, 6661, 310, 2969, 275, 2605, 13, 352, 556, 247, 10183, 275, 27017, 247, 1781, 14, 7527, 285, 1029, 14, 28692, 3148, 5370, 15, 1723, 13, 352, 310, 27296, 15, 380, 6158, 6661, 476, 8968, 247, 1781, 14, 7527, 285, 1029, 14, 28692, 3148, 5370, 15, 1723, 13, 352, 556, 3237, 273, 247, 7681, 10183, 275, 1453, 285, 273, 247, 4942, 1029, 4376, 15, 3327, 1574, 13, 8708, 11642, 3148, 12471, 273, 253, 3939, 14, 6674, 6661, 403, 1146, 3715, 12934, 1242, 15, 6102, 271, 3939, 14, 6674, 11642, 5370, 5760, 5637, 1655, 8136, 949, 253, 1708, 14, 42658, 2813, 2530, 275, 1016, 12275, 407, 2097, 273, 247, 6906, 3085, 16781, 313, 53, 5518, 10, 4441, 3304, 253, 12275, 15, 187, 1145, 8708, 11642, 3148, 5370, 273, 824, 271, 3939, 14, 6674, 6661, 310, 10557, 275, 6692, 11754, 29250, 14, 9807, 20702, 1621, 15, 10197, 42, 854, 14, 20210, 38518, 323, 1650, 15, 7705, 15, 9743, 2722, 271, 6425, 5049, 273, 581, 12275, 5110, 273, 436, 3148, 5370, 15, 45562, 24521, 12093, 271, 11642, 2813, 23917, 347, 247, 1708, 14, 42658, 2813, 13, 247, 806, 16781, 24978, 66, 13, 247, 1273, 16781, 24978, 67, 13, 285, 247, 5718, 23596, 28121, 15, 3856, 13, 253, 11642, 2813, 23917, 310, 271, 8708, 1516, 1102, 36416, 313, 3887, 10, 2813, 15, 187, 688, 253, 1246, 5740, 13, 247, 16781, 323, 12422, 313, 1987, 19891, 10, 1655, 281, 271, 11642, 2813, 310, 6289, 281, 347, 247, 6276, 16781, 13, 1223, 247, 16781, 6498, 347, 247, 5234, 751, 253, 16781, 24978, 67, 275, 7705, 15, 9743, 6289, 281, 347, 247, 12797, 16781, 15, 187, 3887, 2813, 23917, 556, 247, 9004, 1877, 2867, 275, 1142, 2219, 285, 7613, 310, 1925, 473, 23167, 313, 25727, 280, 10315, 14, 11223, 2835, 6129, 853, 10, 347, 253, 1083, 778, 320, 15, 1198, 436, 1921, 13, 253, 11642, 2813, 23917, 275, 7705, 15, 9743, 310, 12258, 347, 271, 473, 23167, 285, 6607, 407, 253, 9484, 273, 247, 29423, 15, 187, 688, 253, 1650, 2011, 275, 7705, 15, 9743, 13, 253, 2603, 8351, 313, 52, 10, 273, 268, 14, 13695, 16781, 24978, 66, 310, 4802, 281, 657, 1678, 313, 9177, 2603, 2442, 582, 1223, 253, 31672, 313, 12373, 9885, 10, 273, 253, 11642, 2813, 23917, 4802, 281, 3216, 2442, 313, 55, 76, 481, 1623, 253, 643, 1133, 13, 253, 34589, 313, 10247, 9885, 10, 310, 4802, 281, 253, 12657, 8351, 313, 37, 10, 273, 253, 16781, 24978, 67, 15, 380, 7394, 8351, 273, 253, 268, 14, 13695, 16781, 24978, 67, 310, 4802, 281, 247, 7394, 2625, 1386, 26517, 66, 13, 253, 2603, 8351, 4802, 281, 247, 2603, 2625, 1386, 26578, 13, 285, 253, 12657, 8351, 4802, 281, 253, 5718, 23596, 28121, 285, 253, 7394, 8351, 313, 40, 10, 273, 253, 16781, 24978, 66, 15, 209, 187, 688, 1340, 281, 10196, 253, 12275, 24521, 13, 806, 13, 253, 2603, 2625, 1386, 26578, 310, 3732, 342, 271, 2460, 2625, 24838, 273, 48560, 1491, 342, 253, 7394, 2625, 1386, 26517, 66, 3531, 715, 247, 4236, 1375, 15, 2635, 13, 253, 16781, 24978, 67, 4916, 16472, 285, 253, 5718, 23596, 28121, 310, 6636, 390, 19439, 13, 594, 326, 253, 7394, 2442, 273, 253, 16781, 24978, 66, 4916, 4503, 281, 253, 2442, 273, 253, 2460, 2625, 15, 2091, 253, 7394, 2625, 1386, 26517, 66, 310, 3531, 715, 271, 440, 16191, 1375, 13, 253, 16781, 24978, 66, 310, 3531, 745, 13, 594, 326, 253, 16781, 24978, 66, 310, 23810, 33817, 432, 253, 2603, 2625, 1386, 26578, 15, 1723, 13, 253, 7394, 2442, 273, 253, 16781, 24978, 66, 310, 42526, 8838, 407, 2097, 273, 253, 5718, 23596, 28121, 15, 380, 1655, 8136, 949, 253, 11642, 2813, 23917, 3066, 253, 16781, 24978, 66, 3249, 281, 5467, 247, 1318, 3969, 281, 6718, 657, 5943, 2439, 253, 7394, 285, 253, 2603, 20737, 273, 253, 16781, 1903, 66, 13, 342, 253, 906, 326, 253, 11642, 2813, 23917, 11359, 327, 25946, 1708, 387, 247, 48560, 3969, 281, 253, 2408, 273, 1655, 10208, 26474, 949, 253, 16781, 24978, 66, 15, 209, 187, 1909, 2529, 1840, 13, 2556, 281, 253, 2720, 1445, 6661, 2011, 275, 7705, 15, 9743, 13, 581, 12275, 12093, 581, 17221, 16781, 313, 16065, 272, 2813, 10, 285, 581, 6276, 16781, 15, 8035, 2720, 1445, 6661, 310, 10557, 275, 6692, 11754, 29250, 14, 9807, 20702, 1621, 15, 10197, 42, 1903, 14, 1237, 3121, 1787, 323, 1650, 15, 831, 9311, 8631, 271, 14704, 275, 534, 247, 12275, 12093, 247, 1655, 11472, 5049, 15, 187, 18978, 13, 253, 8708, 11642, 3148, 5370, 310, 3798, 18461, 970, 247, 1698, 3276, 23567, 300, 3557, 16781, 3781, 15, 3932, 8708, 11642, 4095, 25526, 1708, 1754, 327, 1655, 13, 253, 8708, 11642, 3148, 5370, 8687, 247, 1895, 326, 3148, 17948, 1005, 2826, 604, 627, 403, 10575, 275, 16781, 5319, 15, 187, 11389, 13, 247, 6041, 11642, 3148, 5370, 2550, 10481, 4179, 16, 3431, 7778, 253, 38167, 30026, 534, 310, 1246, 275, 253, 2603, 2625, 1386, 1283, 15, 1198, 436, 1921, 627, 15877, 247, 1895, 326, 275, 690, 2219, 247, 6799, 1655, 2550, 320, 10208, 281, 12275, 1668, 15, 10708, 48074, 622, 22113, 2462, 13208, 49836, 15, 2566, 15, 20907, 187, 187, 2948, 48074, 622, 22113, 2462, 13208, 13517, 15, 7645, 15, 40331, 2771, 80, 187, 2948, 48074, 622, 22113, 2462, 13208, 49836, 15, 7645, 15, 40331, 2771, 80, 3145, 187, 2948, 48074, 622, 22113, 2462, 13208, 49836, 15, 2566, 15, 20907, 15, 3233, 11749, 15, 11749, 15, 14719, 12486, 187, 2948, 48074, 622, 22113, 2462, 13208, 49836, 15, 2566, 15, 20907, 15, 3233, 11749, 15, 11749, 15, 14719, 54, 11455, 187, 187, 6930, 187, 475, 33436, 966, 323, 19229, 2771, 80, 2905, 10872, 187, 1738, 187, 2437, 19229, 2771, 80, 11749, 551, 535, 50274, 32729, 279, 1789, 33436, 551, 535, 50270, 2337, 1056, 40331, 2771, 80, 2765, 9, 5560, 27, 4458, 2262, 5552, 29, 40331, 2771, 80, 31, 551, 187, 50266, 1208, 14664, 2771, 375, 426, 2873, 494, 2765, 4527, 29, 40331, 2771, 80, 31759, 187, 50266, 24712, 9, 5560, 10, 551, 187, 50262, 30586, 2771, 375, 15, 1911, 9, 11145, 40331, 2771, 80, 7104, 6649, 187, 50266, 94, 187, 50266, 2309, 14664, 2771, 375, 187, 50270, 94, 535, 50270, 2337, 1056, 40331, 2771, 80, 7104, 14850, 19229, 2771, 80, 551, 187, 50266, 2309, 19229, 2771, 80, 9, 14719, 12486, 5715, 3632, 54, 11455, 5715, 3632, 54, 11455, 5715, 3632, 54, 11455, 6649, 187, 50270, 94, 535, 50270, 2337, 1056, 40331, 2771, 80, 3145, 2765, 9, 5560, 27, 4458, 2262, 5552, 29, 40331, 2771, 80, 3145, 31, 551, 187, 50266, 1208, 14664, 2771, 375, 426, 2873, 494, 2765, 4527, 29, 40331, 2771, 80, 3145, 31759, 187, 50266, 24712, 9, 5560, 10, 551, 187, 50262, 30586, 2771, 375, 15, 1911, 9, 11145, 40331, 2771, 80, 3145, 6649, 187, 50266, 94, 187, 50266, 2309, 14664, 2771, 375, 187, 50270, 94, 535, 50270, 2337, 1056, 40331, 2771, 80, 3145, 14850, 19229, 2771, 80, 3145, 551, 187, 50266, 2309, 19229, 2771, 80, 3145, 9, 14719, 54, 11455, 5715, 3632, 54, 11455, 5715, 3632, 54, 11455, 6649, 187, 50270, 94, 535, 50274, 94, 187, 187, 94, 510, 28881, 8247, 6377, 187, 187, 510, 2469, 1770, 556, 644, 3240, 253, 45151, 16668, 15865, 428, 1097, 275, 253, 187, 10247, 285, 253, 4016, 21768, 273, 253, 12616, 15, 1198, 581, 2181, 13, 352, 434, 644, 187, 531, 5415, 3971, 39816, 27, 20734, 13, 9693, 13, 8742, 9757, 13, 1457, 2816, 13, 285, 896, 281, 187, 39392, 323, 247, 2129, 1049, 36450, 13, 3811, 562, 273, 247, 46872, 285, 17421, 1315, 6484, 187, 3298, 606, 3658, 275, 271, 2455, 14, 28276, 13, 29548, 6741, 272, 13649, 273, 21440, 13, 20818, 13, 187, 395, 1113, 50115, 15, 496, 253, 22654, 273, 512, 326, 13, 309, 1849, 671, 644, 10620, 342, 187, 69, 3184, 12823, 13, 13889, 17772, 13, 3811, 17772, 313, 4609, 476, 13, 387, 2069, 13, 320, 187, 66, 1199, 7197, 390, 25115, 582, 747, 2136, 3551, 275, 751, 10821, 14, 67, 29577, 313, 1439, 326, 309, 187, 11425, 17805, 582, 2820, 281, 6016, 1655, 32316, 428, 1690, 187, 30146, 3647, 28881, 432, 253, 3971, 1051, 285, 13, 347, 1900, 13, 2820, 281, 1379, 247, 2774, 281, 187, 11489, 1648, 253, 12405, 285, 8028, 281, 253, 3590, 273, 253, 20183, 10155, 327, 253, 187, 287, 6163, 15, 21836, 2010, 6569, 13, 247, 1495, 326, 2506, 626, 2486, 247, 7107, 2774, 187, 1542, 24540, 273, 253, 10763, 1475, 441, 310, 417, 581, 326, 309, 1871, 971, 281, 3153, 15, 187, 187, 6175, 275, 12226, 13, 13593, 285, 309, 7303, 281, 8041, 253, 10586, 5002, 13492, 1889, 5367, 187, 9, 4061, 66, 1843, 10, 285, 574, 253, 1270, 11284, 273, 4804, 581, 273, 253, 28881, 3963, 84, 13, 30789, 300, 187, 41, 1792, 2956, 266, 75, 2259, 428, 665, 2335, 253, 5107, 281, 33852, 562, 247, 345, 1304, 13, 534, 359, 1472, 18051, 275, 436, 2523, 15, 13593, 187, 10178, 617, 1211, 1379, 327, 253, 10061, 27, 187, 187, 3039, 2207, 87, 13140, 12470, 441, 281, 253, 10586, 5002, 13492, 1889, 5367, 313, 4061, 66, 1843, 582, 187, 17126, 285, 309, 574, 9355, 281, 1056, 247, 8849, 273, 352, 15, 187, 187, 39392, 8588, 13, 2329, 32763, 13, 285, 253, 4795, 8986, 37598, 84, 16070, 264, 285, 359, 187, 1834, 598, 2509, 10011, 66, 1843, 275, 581, 45151, 16668, 1388, 13, 533, 359, 7303, 281, 8253, 247, 747, 187, 7784, 1386, 323, 28881, 313, 510, 7648, 5625, 15650, 13492, 187, 28907, 314, 582, 9569, 9361, 285, 6431, 3057, 1491, 342, 187, 570, 1285, 1046, 4813, 2081, 13, 4822, 690, 295, 338, 555, 305, 303, 6952, 313, 42, 1663 ]
some people may find a metaphor offensive. For that, I removed mine, but I hope people will start understanding when words are meant to be offensive and when it's just humour or metaphors. ------ TomGullen This is the downside of building a product which is at the mercy of another companies service. ------ smcguinness The video is good. Tried to find a site of who did it, but could only get a Vemeo page. Maybe you can get some supplemental income on creating them a site to sell their videos. ~~~ uptown Their site is linked from their Vimeo page: <http://www.2dream-animation.com/> In general, an active-matrix display apparatus has a multiplicity of pixels arranged in matrix and displays an image by controlling the intensity of light pixel by pixel in accordance with image signals given. When, for example, liquid crystal is used as an electro-optic substance, the transmittance of each pixel varies in accordance with the voltage applied to the pixel. The basic operation of an active-matrix image display apparatus employing an organic electroluminescence (EL) material as an electro-optic converting substance is the same as in the case where liquid crystal is used. A liquid crystal display panel has pixels each functioning as a shutter and displays an image by turning on/off light from a back light with such a shutter, or a pixel. An organic EL display panel is a display panel of the self-luminescence type having a light-emitting device in each pixel. Such a self-luminescence type display panel has advantages over liquid crystal display panels, including higher image visibility, no need for a back light, and higher response speed. The organic EL display panel controls the luminance of each light-emitting device (pixel) based on the amount of current. Thus, the organic EL display panel is largely different from the liquid crystal display panel in that its luminescent devices are of the current-driven type or the current-controlled type. Like the liquid crystal display panel, the organic EL display panel can have any one of a simple-matrix configuration and an active-matrix configuration. Though the former configuration is simple in structure, it has a difficulty in realizing a large-scale and high-definition display panel. However, it is inexpensive. The latter configuration can realize a large-scale and high-definition display panel. However, it has problems of a technical difficulty in control and of a relatively high price. Presently, organic EL display panels of the active-matrix configuration are being developed intensively. Such an active-matrix EL panel controls electric current passing through the light-emitting device provided in each pixel by means of a thin film transistor (TFT) located inside the pixel. An organic EL display panel of such an active-matrix configuration is disclosed in Japanese Patent Laid-Open Publication No. HEI 8-234683 for example. FIG. 62 shows an equivalent circuit of one pixel portion of this display panel. Pixel 216 comprises an EL device 215 as a light-emitting device, a first transistor 211a, a second transistor 211b, and a storage capacitor 219. Here, the EL device 215 is an organic electroluminescence (EL) device. In the present description, a transistor for feeding (controlling) current to an EL device is referred to as a driving transistor, while a transistor operating as a switch like the transistor 211b in FIG. 62 referred to as a switching transistor. EL device 215 has a rectification property in many cases and hence is called OLED (Organic Light-Emitting Diode) as the case may be. For this reason, the EL device 215 in FIG. 62 is regarded as an OLED and represented by the symbol of a diode. In the example shown in FIG. 62, the source terminal (S) of p-channel transistor 211a is connected to Vdd (power source potential), while the cathode (negative electrode) of the EL device 215 connected to ground potential (Vk). On the other hand, the anode (positive electrode) is connected to the drain terminal (D) of the transistor 211b. The gate terminal of the p-channel transistor 211b is connected to a gate signal line 217a, the source terminal connected to a source signal line 218, and the drain terminal connected to the storage capacitor 219 and the gate terminal (G) of the transistor 211a. In order to operate the pixel 216, first, the source signal line 218 is applied with an image signal indicative of luminance information with the gate signal line 217a turned into a selected state. Then, the transistor 211b becomes conducting and the storage capacitor 219 is charged or discharged, so that the gate potential of the transistor 211a becomes equal to the potential of the image signal. When the gate signal line 217a is turned into an unselected state, the transistor 211a is turned off, so that the transistor 211a is electrically disconnected from the source signal line 218. However, the gate potential of the transistor 211a is stably maintained by means of the storage capacitor 219. The current passing through the EL device 215 via the transistor 211a comes to assume a value corresponding to voltage Vgs across the gate and the source terminals of the transistor 11a, with the result that the EL device 215 keeps on emitting light at a luminance corresponding to the amount of current fed thereto through the transistor 211a. As described above, according to the prior art configuration shown in FIG. 62, one pixel comprises one selecting transistor (switching device) and one driving transistor. Another prior art configuration is disclosed in Japanese Patent Laid-Open Publication No. HEI 11-327637 for example. This publication describes an embodiment in which a pixel comprises a current mirror circuit. Meanwhile, the organic EL display panel is usually manufactured using a low temperature polysilicon transistor array. Since organic EL devices emit light based on current, the organic EL display panel involves a problem that display irregularities occur if there are variations in transistor characteristics. Further, a conventional EL display panel cannot sufficiently charge/discharge the parasitic capacitance which is present in the source signal line 18. For this reason there arises a problem that in some cases a desired current cannot be fed to pixel 16.package <%= appPackage %>.presentation.test.factory import <%= appPackage %>.domain.model.Bufferoo import <%= appPackage %>.presentation.model.BufferooView import <%= appPackage %>.presentation.test.factory.DataFactory.Factory.randomLong import <%= appPackage %>.presentation.test.factory.DataFactory.Factory.randomUuid /** * Factory class for Bufferoo related instances */ class BufferooFactory { companion object Factory { fun makeBufferooList(count: Int): List<Bufferoo> { val bufferoos = mutableListOf<Bufferoo>() repeat(count) { bufferoos.add(makeBufferooModel()) } return bufferoos } fun makeBufferooModel(): Bufferoo { return Bufferoo(randomLong(), randomUuid(), randomUuid(), randomUuid()) } fun makeBufferooViewList(count: Int): List<BufferooView> { val bufferoos = mutableListOf<BufferooView>() repeat(count) { bufferoos.add(makeBufferooView()) } return bufferoos } fun makeBufferooView(): BufferooView { return BufferooView(randomUuid(), randomUuid(), randomUuid()) } } }The LG Backpage The past month has been quite the whirlwind adventure - both in the positive and the negative senses of the phrase. For one thing, it's been one continuous roadtrip: Denver, Boston, Los Angeles, New York, and back to Boston for a week apiece, living out of a suitcase and amid frantic arrangements in an ever-changing, bewildering galaxy of hotels, flights, and car rentals. In the midst of all that, I've also been dealing with dying computers, dying relatives, living relatives (which can, at times, be a much worse ordeal), new business coming in like gang-busters (not that I should complain), trying to handle current commitments - including publishing LG from the road... and, as always, trying to take a moment to sniff the flowers and listen to the sound of the surf breaking on the rocks. Whatever else happens, a life that doesn't include a quiet moment for appreciation of the beauty around us is not one that I'd want to live. While in LA, Kat and I managed to attend the Southern California Linux Expo (SCaLE) and had the great pleasure of meeting one of the LG regulars, Kapil Hari Paranjape - who took the opportunity to crank out a con report, which we're publishing in this issue. Kat had her own take on the proceedings: When Orv Beach invited us to the Southern California Linux Expo (SCaLE), Ben and I had planned to make a weekend of it. Boston weather, airplanes, and the resulting winter blahs intervened and we ended up doing SCaLE in one whirlwind day, but we managed to float a new tag line for LG (The Free International Online Linux Monthly), introduce ourselves and exchange contact information with nearly every exhibitor, collect some nifty gimmes (I really
[ 17429, 14, 14213, 14, 6367, 4250, 13761, 15, 27376, 3931, 323, 4073, 6055, 407, 2578, 5590, 583, 403, 5469, 15, 380, 3608, 323, 2578, 5590, 583, 14, 23, 14, 25955, 28180, 313, 1502, 34, 10, 285, 271, 20038, 2578, 5590, 583, 14, 23, 14, 25955, 30577, 313, 1502, 35, 10, 12647, 271, 1444, 251, 15, 7160, 2048, 310, 5802, 1097, 407, 31624, 3875, 4073, 285, 407, 3116, 715, 253, 17429, 3408, 285, 3469, 327, 253, 40009, 2803, 16202, 407, 391, 5367, 52, 313, 29846, 39, 481, 391, 5367, 52, 310, 717, 589, 14, 10082, 456, 275, 444, 15, 14347, 611, 14, 805, 285, 697, 3882, 3425, 16149, 2190, 611, 14, 805, 8709, 15, 1198, 2578, 5590, 583, 5798, 42541, 762, 31624, 3875, 4073, 444, 15, 14347, 7024, 327, 253, 31624, 33248, 49217, 591, 7070, 4542, 280, 2578, 5590, 511, 313, 46093, 34, 481, 496, 253, 5928, 273, 31624, 3875, 4073, 13, 2578, 5590, 583, 14757, 253, 4702, 273, 271, 9548, 309, 1433, 250, 313, 46093, 35, 10, 273, 253, 1387, 28450, 985, 13, 247, 5798, 20038, 2578, 5590, 583, 14, 23, 14, 25955, 30577, 313, 46093, 38, 582, 285, 271, 24672, 302, 250, 5590, 511, 313, 46093, 36, 10, 534, 28472, 2578, 5590, 583, 281, 1959, 8383, 285, 247, 8383, 7923, 15, 50, 27, 187, 187, 2115, 80, 3403, 321, 274, 11856, 269, 4881, 387, 3385, 5069, 4204, 4384, 12583, 513, 441, 86, 28350, 299, 546, 6584, 274, 3066, 28846, 32, 187, 187, 2115, 80, 1524, 15864, 258, 3352, 21035, 372, 3403, 5650, 372, 4440, 358, 4204, 4384, 12583, 513, 441, 86, 28350, 802, 5111, 17075, 28350, 372, 18072, 24157, 5586, 546, 6584, 274, 3066, 28846, 32, 19523, 1940, 4474, 11856, 1220, 86, 7014, 1753, 48788, 9800, 36789, 389, 247, 6429, 1528, 571, 9500, 295, 1123, 72, 29213, 299, 1753, 48788, 372, 948, 1868, 3359, 14291, 15, 187, 187, 34, 27, 187, 187, 1672, 44309, 353, 18463, 17622, 187, 26631, 187, 32499, 15, 5581, 187, 30952, 32735, 11685, 31, 187, 29, 2974, 31, 187, 29, 2522, 31, 187, 29, 13518, 29308, 568, 17880, 14, 25, 1138, 187, 29, 5564, 31, 53, 343, 274, 401, 302, 375, 870, 5564, 31, 187, 29, 3866, 6740, 568, 605, 3211, 15, 19203, 15, 681, 16, 19203, 14, 18, 15, 883, 15, 17, 15, 1222, 15, 4305, 6750, 3866, 31, 187, 29, 4826, 31, 187, 50270, 16455, 551, 5680, 27, 337, 3498, 4891, 1852, 28716, 28, 3148, 27, 2972, 28, 8459, 27, 470, 470, 1384, 3498, 470, 28, 748, 187, 50270, 4, 32688, 551, 8459, 14, 3956, 27, 1384, 3498, 28, 5680, 27, 337, 3498, 4891, 1852, 28716, 28, 3148, 27, 2972, 28, 748, 187, 870, 4826, 31, 187, 870, 2522, 31, 187, 29, 2915, 31, 187, 29, 2154, 31, 187, 50274, 29, 2154, 2730, 16455, 2654, 568, 16455, 3, 4871, 568, 33031, 3, 4898, 568, 21980, 3, 1125, 4488, 333, 3073, 16455, 3073, 2154, 31, 187, 50274, 29, 2154, 2730, 8060, 2654, 568, 38705, 1138, 53, 343, 274, 401, 4881, 870, 8060, 3073, 2154, 31, 187, 50274, 29, 2154, 2730, 8060, 2654, 568, 15261, 1138, 15426, 2044, 401, 4881, 870, 8060, 3073, 2154, 31, 187, 50274, 29, 2154, 2730, 32688, 2654, 568, 32688, 3, 4871, 568, 33031, 3, 4898, 568, 21980, 6750, 32688, 3073, 2154, 31, 187, 29, 3866, 31, 187, 50274, 13686, 15, 44364, 1587, 27395, 8590, 49473, 995, 1159, 1082, 551, 187, 50270, 2044, 18857, 426, 3389, 15, 22339, 1587, 32688, 8375, 187, 50270, 8882, 426, 18857, 15, 788, 5856, 1587, 19, 69, 8375, 187, 50270, 16455, 426, 3389, 15, 22339, 1587, 16455, 8375, 187, 50270, 16455, 18527, 426, 551, 346, 16455, 1381, 2032, 3572, 187, 50270, 1000, 8116, 426, 1159, 9, 3775, 10, 551, 187, 50262, 22452, 15, 2808, 1587, 17213, 9232, 2228, 27, 18873, 2228, 15, 3211, 558, 2490, 50270, 4718, 50276, 187, 50270, 338, 9, 8002, 22853, 15, 788, 6989, 17831, 10, 551, 187, 50266, 8002, 22853, 15, 788, 6989, 17831, 9, 16455, 18527, 13, 1159, 9, 4963, 10, 551, 187, 50262, 16455, 15, 7614, 426, 5542, 28, 187, 50262, 16455, 15, 1993, 1874, 187, 50266, 2023, 1486, 8116, 558, 187, 50270, 94, 2010, 604, 9, 8002, 22853, 15, 20726, 3633, 6989, 17831, 10, 551, 187, 50266, 8002, 22853, 15, 20726, 3633, 6989, 17831, 9, 16455, 18527, 13, 1159, 9, 4963, 910, 187, 50262, 16455, 15, 7614, 426, 3497, 15, 20726, 9715, 15, 6953, 4241, 9715, 9, 4963, 558, 187, 50262, 16455, 15, 1993, 1874, 187, 50266, 2023, 1486, 8116, 558, 187, 50270, 94, 187, 50270, 7271, 604, 9, 8002, 22853, 15, 24024, 3633, 6989, 17831, 10, 551, 187, 50266, 8002, 22853, 15, 24024, 3633, 6989, 17831, 9, 16455, 18527, 13, 1159, 9, 4963, 910, 187, 50262, 16455, 15, 7614, 426, 3497, 15, 9715, 15, 6953, 4241, 9715, 9, 4963, 558, 187, 50262, 16455, 15, 1993, 1874, 187, 50266, 2023, 1486, 8116, 558, 187, 50270, 94, 187, 50274, 2023, 3221, 558, 187, 50274, 3306, 15, 22339, 1587, 38705, 6788, 44364, 1587, 9738, 995, 1159, 1082, 551, 50272, 187, 50270, 32688, 15, 788, 5856, 1587, 19, 69, 6788, 6553, 6586, 9, 16455, 13, 470, 13, 470, 13, 37174, 13, 25888, 558, 50271, 187, 50270, 605, 26544, 9, 32688, 15, 936, 3233, 9715, 6020, 187, 50274, 9897, 187, 50274, 3306, 15, 22339, 1587, 15261, 6788, 44364, 1587, 9738, 995, 1159, 1082, 551, 50272, 187, 50270, 1352, 5996, 2073, 71, 302, 1730, 267, 2044, 15, 5581, 1383, 551, 303, 31646, 27, 32688, 15, 936, 3233, 9715, 1082, 2023, 1159, 9, 2203, 910, 187, 50270, 2023, 8, 8456, 5137, 187, 50274, 9897, 187, 870, 3866, 31, 50274, 187, 870, 2915, 31, 187, 870, 2974, 31, 187, 187, 71, 302, 1730, 267, 2044, 15, 5581, 187, 14277, 5581, 187, 50274, 3701, 2613, 1540, 64, 936, 64, 42787, 9, 370, 4793, 1540, 64, 2703, 13, 370, 9252, 64, 3140, 2387, 551, 187, 50270, 5, 338, 81, 426, 269, 5758, 9, 370, 9252, 64, 3140, 13, 346, 34338, 3, 5349, 2490, 50270, 71, 6343, 9, 370, 338, 81, 13, 2613, 1540, 64, 29377, 9, 370, 4793, 1540, 64, 2703, 10, 5349, 2490, 50270, 71, 10483, 9, 370, 338, 81, 5349, 2490, 50270, 2309, 9, 370, 9252, 64, 3140, 5349, 2490, 50274, 94, 50271, 187, 50274, 5, 303, 31646, 426, 1213, 64, 13481, 2073, 2203, 27, 5695, 16, 8567, 28, 4793, 1540, 13, 10606, 1383, 10001, 15743, 5013, 303, 31646, 34419, 50270, 187, 50274, 4793, 1540, 64, 936, 64, 42787, 3914, 303, 31646, 13, 346, 81, 24968, 18, 16, 71, 4881, 18, 15, 8567, 3287, 50270, 187, 50274, 13088, 14113, 64, 25950, 9, 3728, 2073, 303, 31646, 8, 3001, 337, 4027, 187, 187, 53, 19095, 258, 26566, 11174, 80, 396, 21058, 295, 48998, 513, 261, 549, 371, 35860, 13, 9788, 66, 24961, 1566, 80, 8733, 269, 1080, 372, 1071, 70, 15, 1716, 13206, 247, 20983, 38470, 14291, 389, 19386, 13, 299, 11856, 27725, 389, 258, 43831, 372, 27725, 18, 13, 5007, 80, 246, 16469, 704, 7067, 802, 11685, 22, 389, 14741, 15, 187, 11223, 774, 14291, 44724, 295, 1123, 72, 29213, 13, 258, 5559, 21722, 299, 258, 26040, 48170, 29982, 591, 44684, 9392, 13, 36252, 258, 19900, 12065, 246, 422, 402, 829, 80, 15, 187, 16976, 265, 27, 187, 187, 31962, 285, 16428, 9175, 342, 11685, 22, 187, 15597, 22, 2615, 9210, 23017, 24440, 272, 347, 271, 10882, 187, 187, 34, 27, 187, 187, 1672, 16974, 5111, 354, 13670, 80, 36146, 1101, 560, 7961, 642, 34644, 389, 40464, 247, 323, 570, 1209, 11856, 1220, 86, 7014, 387, 780, 5586, 258, 441, 80, 4204, 4384, 12583, 513, 5268, 70, 13, 42361, 10081, 441, 80, 372, 2965, 2135, 5586, 22843, 802, 6483, 375, 372, 295, 1123, 72, 29213, 11565, 1331, 46071, 27, 187, 9770, 12583, 15253, 187, 187, 9770, 12583, 15253, 3974, 11856, 759, 371, 6736, 313, 95, 20, 44, 1054, 692, 3377, 299, 8566, 3377, 10, 48137, 302, 30692, 40468, 802, 16872, 5586, 3403, 321, 274, 269, 302, 375, 247, 39955, 4204, 260, 6457, 961, 66, 513, 24437, 2475, 9325, 13, 299, 994, 1747, 1757, 14, 26185, 247, 36156, 8733, 500, 21459, 10959, 42288, 5128, 49189, 2513, 15, 1284, 4440, 561, 7360, 358, 1151, 385, 487, 21400, 802, 20983, 268, 31076, 1758, 4384, 13, 21233, 7112, 802, 11856, 246, 7896, 13, 10959, 749, 3899, 7112, 18547, 24437, 1296, 49410, 15, 7066, 12583, 15253, 441, 66, 11685, 22, 755, 6989, 17831, 13, 9425, 354, 1831, 68, 31655, 5111, 2965, 2135, 3772, 1757, 26869, 299, 828, 261, 36789, 387, 3385, 5069, 372, 33143, 22843, 15, 187, 187, 13641, 251, 10981, 7014, 187, 187, 9770, 12583, 15, 1178, 7506, 2379, 50276, 3429, 27, 23349, 13, 2379, 50276, 7436, 27, 16918, 13, 2379, 50276, 5695, 64, 8124, 27, 686, 42787, 1383, 2379, 50276, 42787, 64, 15177, 27, 5091, 190, 187, 9897, 190, 187, 9770, 12583, 15, 38729, 30932, 2577, 64, 32499, 5137, 4888, 187, 3701, 1379, 64, 11489, 27760, 1082, 551, 2379, 50276, 605, 1379, 29679, 285, 755, 2460, 941, 2379, 50276, 9770, 12583, 15, 38705, 9, 3701, 9, 2203, 64, 11317, 10, 551, 2379, 50274, 605, 3148, 1543, 275, 3239, 2379, 50274, 3306, 15, 22339, 2073, 16680, 8539, 41090, 426, 2379, 50272, 8, 29, 73, 19, 31, 4943, 310, 634, 2460, 19282, 73, 19, 28120, 559, 2379, 50272, 8, 29, 8428, 6740, 34468, 559, 941, 64, 11317, 559, 686, 5647, 5618, 2379, 50276, 9897, 190, 187, 94, 187, 2915, 551, 2379, 50276, 4909, 14, 11807, 27, 7518, 87, 47479, 13, 20155, 14, 40004, 28, 190, 187, 94, 190, 187, 73, 19, 13, 190, 187, 73, 20, 551, 2379, 50276, 15456, 14, 3956, 27, 470, 28, 190, 187, 94, 190, 187, 630, 551, 2379, 50276, 15456, 14, 3956, 27, 1458, 3498, 28, 190, 187, 94, 190, 187, 630, 2239, 3280, 551, 2379, 50276, 15456, 14, 918, 27, 1458, 3498, 28, 190, 187, 94, 190, 187, 4, 16680, 551, 2379, 50276, 9599, 27, 987, 28, 2379, 50276, 15456, 27, 1384, 3498, 28, 2379, 50276, 17333, 27, 1384, 3498, 28, 2379, 50276, 14224, 27, 337, 3498, 4891, 28, 2379, 50276, 11814, 27, 1852, 28716, 28, 190, 187, 94, 2379, 50276, 187, 29, 3866, 6740, 568, 2413, 1358, 30061, 77, 6443, 15, 681, 16, 9468, 375, 16, 7585, 12583, 4305, 16, 7585, 12583, 15, 4305, 6750, 3866, 31, 190, 187, 29, 2154, 2654, 568, 16680, 1138, 34, 4440, 358, 3403, 321, 2960, 1049, 609, 336, 12649, 74, 1051, 870, 2154, 31, 4888, 187, 29, 73, 18, 31, 9770, 12583, 15253, 367, 31076, 1758, 372, 1071, 70, 870, 73, 18, 31, 190, 187, 29, 73, 20, 31, 13641, 251, 10981, 7014, 372, 11856, 3403, 5650, 299, 1049, 1631, 14291, 802, 23349, 89, 14028, 870, 73, 20, 31, 4888, 187, 29, 2154, 2654, 568, 2577, 64, 32499, 6750, 2154, 31, 4888, 187, 29, 630, 31, 2379, 50276, 29, 5423, 1511, 30, 8060, 1318, 568, 53, 343, 274, 11982, 27760, 3, 39144, 568, 21528, 64, 11489, 27760, 49384, 190, 187, 870, 630, 31, 187, 187, 3546, 6584, 274, 5586, 258, 1296, 49410, 187, 34, 794, 7014, 7066, 12583, 15, 38705, 1082, 323, 570, 336, 247, 4440, 358, 4474, 479, 900, 372, 5111, 38917, 399, 8585, 3066, 16872, 13, 10138, 70, 362, 29058, 642, 17449, 80, 802, 260, 8032, 15, 187, 2861, 16469, 13, 31304, 7644, 297, 375, 372, 11856, 21682, 372, 1086, 351, 692, 274, 299, 546, 6584, 274, 3265, 265, 277, 8585, 4204, 4440, 358, 5586, 258, 1296, 49410, 387, 3385, 5069, 372, 11856, 45909, 2960, 26060, 14942, 27, 187, 2044, 941, 64, 11317, 426, 7066, 12583, 15, 38705, 1874, 187, 187, 9770, 12583, 15, 20085, 9, 941, 64, 11317, 13, 686, 1405, 86, 9026, 15, 5581, 1383, 1159, 9, 3211, 13, 2505, 10, 551, 187, 50274, 605, 530, 8108, 345, 498, 86, 1950, 3088, 187, 50274, 605, 686, 3211, 8, 523, 14052, 258, 26566, 11174, 80, 4204, 1183, 21432, 17607, 546, 6584, 3377, 30645, 1296, 49410, 13, 385, 15, 1052, 187, 50274, 605, 686, 1156, 8, 8203, 258, 1753, 258, 1296, 49410, 546, 6584, 276, 187, 9897, 187, 187, 2302, 45604, 513, 1296, 49410, 13, 7684, 277, 8585, 1161, 72, 312, 5269, 8733, 396, 246, 1644, 6017, 375, 749, 3899, 7112, 5111, 17075, 28350, 389, 5111, 2986, 80, 654, 5423, 1511, 568, 3140, 3, 1416, 568, 7585, 12583, 1138, 13, 30645, 1753, 7360, 20789, 948, 1868, 12704, 1645, 589, 247, 4440, 358, 4204, 32644, 8297, 21682, 27, 187, 605, 2336, 692, 35802, 372, 8753, 22017 ]
stationary-phase-induced heat tolerance. Mechanisms for stress protection by trehalose are discussed. The genes for trehalose-6-phosphate synthase (otsA) and anabolic trehalose-6-phosphate phosphatase (otsB) constitute an operon. Their expression is induced both by osmotic stress and by growth into the stationary phase and depend on the sigma factor encoded by rpoS (katF). rpoS is amber-mutated in E. coli K-12 and its DNA sequence varies among K-12 strains. For trehalose catabolism under osmotic stress E. coli depends on the osmotically inducible periplasmic trehalase (TreA). In the absence of osmotic stress, trehalose induces the formation of an enzyme IITre (TreB) of the group translocation system, a catabolic trehalose-6-phosphate phosphatase (TreE), and an amylotrehalase (TreC) which converts trehalose to free glucose and a glucose polymer.Q: Como capturar uma foto através da webcam do usuário e enviar via POST? Como realizar o procedimento de captura de imagem da webcam do usuário em um formulário de cadastro para enviar via POST? Busco por uma solução que seja compatível com a maioria dos navegadores e que seja de simples implementação. A: Exemplo Mínimo PHP camera.php <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <title>Tirar Fotos</title> <script src="//code.jquery.com/jquery-1.11.0.min.js"></script> <style> video { border: 1px solid #ccc; display: block; margin: 0 0 20px 0; } #canvas { margin-top: 20px; border: 1px solid #ccc; display: block; } </style> </head> <body> <div> <div><video id="video" width="640" height="480" autoplay></video></div> <div><button id="snap">Tirar Foto</button></div> <div><button id="save">Salvar Foto</button></div> <div><canvas id="canvas" width="640" height="480"></canvas></div> <script> window.addEventListener("DOMContentLoaded", function() { var canvas = document.getElementById("canvas"), context = canvas.getContext("2d"), video = document.getElementById("video"), videoObj = { "video": true }, errBack = function(error) { console.log("Video capture error: ", error.code); }; if(navigator.getUserMedia) { navigator.getUserMedia(videoObj, function(stream) { video.src = stream; video.play(); }, errBack); } else if(navigator.webkitGetUserMedia) { navigator.webkitGetUserMedia(videoObj, function(stream){ video.src = window.webkitURL.createObjectURL(stream); video.play(); }, errBack); } else if(navigator.mozGetUserMedia) { navigator.mozGetUserMedia(videoObj, function(stream){ video.src = window.URL.createObjectURL(stream); video.play(); }, errBack); } }, false); document.getElementById("snap").addEventListener("click", function() { canvas.getContext("2d").drawImage(video, 0, 0, 640, 480); //alert(canvas.toDataURL()); }); document.getElementById("save").addEventListener("click", function() { $.post('fotossalvar.php', {imagem:canvas.toDataURL()}, function(data){ },'json'); }); </script> </body> </html> fotossalvar.php <?php function base64_to_jpeg( $base64_string, $output_file ) { $ifp = fopen( $output_file, "wb" ); fwrite( $ifp, base64_decode( $base64_string) ); fclose( $ifp ); return( $output_file ); } $imagem = str_replace('data:image/png;base64,','',$_POST['imagem']); base64_to_jpeg($imagem, "pasta1/foto1.png"); echo json_encode(array('imagem' => 1)); Todo o código se resume nesses dois arquivos, siga esse modelo como fator de teste. Configure a sua aplicação com jQuery, e uma pasta com o nome de pasta1, sendo tudo feito em HTML5 com PHP. Em relação aos navegadores, o Google Chrome e o Firefox funcionaram perfeitamente, já o IE não tive sucesso. Fontes: Camera and Video Control with HTML5 HTML5 Canvas Save Drawing as an Image A: Existe um projeto muito interessante no GitHub com vista a fornecer uma solução atual para o uso da webcam do cliente, fazendo uso de fallback para Flash em casos de navegadores mais antigos: WebcamJS WebcamJS é uma pequena (~3K minificado e compactado) biblioteca standalone em JavaScript para capturar fotos a partir da câmera do seu computador, e entregá-los a você como JPEG ou PNG Data URIs. As imagens podem ser exibidas em sua página web, rendido em uma tela, ou submetido ao seu servidor. WebcamJS usa HTML5 getUserMedia, mas proporciona um fallback automático e invisível através de Adobe Flash. Demonstração Webcam.set({ width: 320, height: 240, image_format: 'jpeg', jpeg_quality: 90 }); Webcam.attach('#my_camera'); function take_snapshot() { // take snapshot and get image data Webcam.snap(function(data_uri) { // display results in page document.getElementById('results').innerHTML = '<h2>Here is your image:</h2>' + '<img src="' + data_uri + '"/>'; }); } body { font-family: Helvetica, sans-serif; } h2, h3 { margin-top: 0; } form { margin-top: 15px; } form > input { margin-right: 15px; } #results { float: right; margin: 20px; padding: 20px; border: 1px solid; background: #ccc; } <script src="http://pixlcore.com/demos/webcamjs/webcam.js"></script> <div id="results">A imagem capturada aparece aqui...</div> <h1>WebcamJS Página de teste</h1> <h3>Demonstração de uma captura e apresentação em 320x240</h3> <div id="my_camera"></div> <form> <input type=button value="Tirar Snapshot" onClick="take_snapshot()"> </form> Enviar para o servidor A função Webcam.snap() fornece a imagem por meio de um URI Dados via JavaScript, conforme vimos no exemplo em cima. Contudo, também dispomos de uma forma de decodificar e enviar esses dados da imagem para o servidor através de uma chamada AJAX: var data_uri = Webcam.snap(); Webcam.upload( data_uri, 'meuScript.php', function(code, text) { // Upload concluído // 'code' contém o código da resposta HTTP enviado pelo servidor, ex. 200 // 'text' contem o que o servidor enviou }); No lado do servidor, os dados chegam tal como se tivessemos submetido um formulário com um campo <input type="file" name="webcam">, pelo que podemos simplesmente receber a imagem da seguinte forma: // verificações de seguran
[ 34, 15, 19, 69, 38316, 13, 31184, 313, 9387, 15, 6053, 15, 6752, 10, 313, 44101, 326, 7048, 2550, 1750, 326, 344, 187, 187, 7821, 311, 2084, 3441, 5966, 247, 8106, 12678, 835, 344, 4767, 326, 642, 581, 13699, 187, 187, 13243, 281, 19494, 8106, 481, 50273, 688, 1127, 273, 958, 13, 3096, 6285, 5742, 4767, 326, 344, 187, 187, 4524, 6545, 253, 32588, 13794, 273, 6197, 285, 326, 642, 2173, 5754, 187, 187, 36817, 13, 1880, 9635, 390, 1375, 13, 369, 12316, 281, 779, 15, 50257, 5035, 187, 187, 46, 6968, 20136, 13, 818, 3953, 329, 15, 19, 69, 387, 38162, 313, 44101, 326, 773, 3431, 9626, 420, 407, 247, 3257, 187, 187, 249, 253, 6197, 2686, 11295, 1057, 417, 1957, 9766, 31427, 39537, 187, 187, 14131, 13, 3096, 6285, 457, 84, 1750, 310, 41111, 15, 535, 50272, 6436, 13, 359, 1364, 2589, 271, 3907, 2278, 273, 253, 1924, 281, 187, 187, 5992, 9842, 1880, 627, 403, 667, 643, 1327, 14, 71, 35781, 3374, 326, 3096, 6285, 812, 187, 187, 22525, 327, 4549, 15, 19, 844, 588, 806, 3653, 1880, 253, 34178, 273, 3096, 6285, 457, 84, 187, 187, 36817, 323, 253, 399, 9571, 14, 709, 10789, 9611, 13588, 253, 3332, 1986, 2077, 187, 187, 31177, 2111, 5877, 275, 28098, 348, 3423, 362, 15, 3729, 23528, 13, 14821, 322, 15, 16316, 15, 5429, 187, 19, 187, 50275, 1231, 14409, 326, 16595, 85, 62, 248, 5857, 273, 247, 8106, 12678, 16988, 247, 20066, 273, 187, 455, 12834, 285, 25774, 3707, 3480, 273, 7571, 13, 12078, 414, 273, 253, 12678, 13, 285, 187, 300, 1851, 1319, 273, 253, 6197, 1425, 16342, 362, 15, 308, 609, 8807, 13, 854, 2222, 329, 15, 19, 69, 1249, 2526, 13, 187, 805, 2251, 313, 9387, 15, 6053, 15, 5403, 481, 5429, 50254, 50270, 50276, 428, 24, 14, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 535, 187, 19, 9913, 313, 6961, 481, 20, 535, 50272, 688, 28098, 348, 3423, 13, 253, 6413, 2111, 7945, 326, 773, 66, 6345, 1071, 13, 533, 187, 187, 1439, 247, 2614, 1071, 13, 778, 320, 11966, 347, 247, 3186, 7119, 281, 247, 29889, 5263, 187, 187, 1542, 17507, 6276, 1425, 50275, 50182, 348, 3423, 13, 14821, 322, 15, 16316, 15, 387, 374, 17786, 15, 50270, 28144, 13, 253, 187, 187, 31177, 2111, 2918, 326, 2614, 5216, 2668, 10376, 281, 10466, 7578, 5323, 187, 187, 609, 271, 27093, 11492, 273, 11068, 15, 50274, 2618, 15, 387, 374, 20270, 15, 50274, 510, 6413, 187, 187, 18336, 4767, 326, 773, 43838, 1346, 2550, 320, 14320, 281, 452, 42243, 281, 11929, 187, 187, 936, 247, 2614, 1071, 327, 3075, 273, 26841, 247, 6424, 8399, 1425, 4031, 9944, 923, 671, 2654, 15, 187, 187, 9, 585, 6547, 326, 253, 11810, 812, 417, 320, 13084, 273, 21455, 247, 187, 187, 88, 35083, 1417, 2614, 3812, 1563, 271, 5263, 323, 6276, 762, 253, 4833, 481, 535, 50272, 4943, 13, 387, 253, 673, 273, 521, 14625, 285, 23381, 5537, 4854, 13, 3096, 6285, 5429, 187, 20, 187, 50276, 688, 253, 4857, 36689, 3096, 6285, 273, 521, 2748, 281, 10687, 347, 5067, 13, 10158, 187, 35, 1017, 3054, 326, 253, 28098, 348, 3423, 3061, 778, 3486, 3096, 6285, 457, 84, 399, 9571, 14, 709, 10789, 187, 29836, 15, 2594, 23488, 13, 1903, 16, 1619, 16, 1036, 15, 1723, 13, 10158, 378, 1017, 4860, 326, 187, 50182, 348, 3423, 369, 4425, 846, 3096, 6285, 457, 84, 6197, 13, 285, 1223, 521, 4549, 369, 187, 33965, 13, 285, 3021, 13, 858, 417, 7164, 247, 28098, 348, 3423, 1750, 275, 253, 30115, 4864, 15, 187, 5035, 2654, 15, 3856, 13, 28098, 348, 3423, 369, 4425, 327, 3978, 3495, 13, 4022, 13, 846, 3096, 6285, 457, 84, 187, 36817, 369, 11295, 13, 533, 1309, 253, 32752, 1371, 273, 253, 8164, 4549, 15, 187, 8457, 436, 2523, 7033, 281, 253, 1791, 1319, 273, 6197, 13, 285, 28098, 348, 3423, 369, 187, 31572, 1309, 253, 32752, 1371, 273, 3096, 6285, 457, 84, 4549, 13, 359, 778, 2953, 253, 1791, 1319, 187, 48781, 15, 2594, 16342, 362, 15, 28852, 13, 21982, 329, 15, 20, 69, 16493, 13, 11140, 14, 1731, 313, 9387, 15, 187, 6961, 558, 923, 671, 3697, 363, 287, 362, 15, 14538, 3642, 13, 46190, 530, 15, 52, 15, 36859, 13, 35710, 313, 9430, 10, 313, 44101, 187, 3529, 247, 1986, 2077, 6413, 2111, 3061, 4795, 275, 247, 747, 4086, 273, 1569, 187, 1628, 1212, 23677, 281, 512, 6424, 2219, 1335, 13910, 327, 1480, 2278, 39537, 2756, 50254, 50270, 428, 25, 14, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 535, 187, 4238, 2256, 281, 253, 22414, 873, 6593, 275, 2593, 495, 28927, 9, 68, 2769, 19, 582, 577, 347, 344, 21402, 187, 187, 4297, 7443, 281, 399, 9571, 762, 2593, 495, 28879, 9, 66, 2769, 18, 582, 521, 1273, 8399, 13, 285, 9284, 281, 187, 187, 5040, 290, 281, 247, 2614, 1071, 15, 2594, 427, 15, 53, 904, 577, 16, 938, 16, 1036, 13, 387, 577, 313, 43507, 326, 253, 17396, 187, 187, 35674, 369, 32700, 1897, 558, 46338, 9700, 13, 577, 16, 938, 16, 1036, 13, 387, 495, 313, 22322, 10, 187, 187, 9, 44101, 326, 3096, 6285, 1364, 2075, 253, 17396, 5927, 4030, 273, 370, 18, 13, 5388, 481, 22, 535, 50270, 1909, 253, 28098, 348, 3423, 2111, 2918, 326, 253, 3946, 273, 6424, 3006, 253, 187, 187, 33699, 281, 7578, 281, 2614, 5175, 1563, 247, 6276, 762, 253, 4833, 187, 187, 45389, 369, 27093, 13, 359, 7525, 326, 253, 2332, 1302, 28203, 535, 187, 21, 187, 50274, 12612, 495, 28927, 9, 68, 2769, 19, 10, 3054, 253, 1563, 27, 535, 50270, 9, 68, 10, 50275, 688, 37473, 28, 50273, 49842, 50273, 25304, 50273, 267, 26898, 28, 50274, 16894, 187, 50270, 2377, 4777, 18295, 1145, 2060, 665, 28096, 50273, 4674, 495, 28879, 9, 66, 2769, 18, 10, 285, 187, 50270, 709, 3197, 5175, 273, 2614, 390, 6345, 390, 271, 50274, 27276, 665, 28096, 187, 50270, 4674, 495, 28879, 9, 68, 10, 390, 313, 69, 10, 3091, 320, 16290, 50275, 284, 3637, 27, 535, 50254, 245, 50265, 14244, 535, 50270, 9, 19, 10, 1198, 247, 1273, 8399, 13, 281, 27, 535, 50270, 9, 74, 10, 50272, 4524, 2184, 19841, 273, 417, 1679, 685, 5091, 1897, 28, 535, 50270, 9, 2886, 10, 50273, 12080, 247, 4030, 273, 417, 1679, 685, 370, 18, 13, 5388, 28, 535, 50270, 9, 12211, 10, 50274, 1595, 423, 271, 7665, 17657, 5252, 2143, 7012, 407, 187, 50261, 783, 7811, 28, 285, 535, 50270, 9, 400, 10, 50273, 681, 2881, 342, 512, 2854, 285, 7665, 1971, 187, 50261, 15684, 942, 11295, 762, 7118, 6480, 1047, 285, 6480, 1010, 15, 187, 187, 1976, 3643, 15, 36, 15, 52, 15, 34, 15, 3015, 495, 28927, 9, 68, 2769, 19, 481, 187, 22, 187, 50276, 1909, 629, 273, 697, 3978, 818, 13, 4022, 46338, 9700, 13, 253, 2332, 1302, 4767, 326, 187, 522, 435, 432, 23254, 253, 14683, 35046, 13, 253, 6414, 273, 253, 4162, 187, 938, 13, 4022, 46338, 9700, 6376, 275, 1055, 15, 2594, 46338, 9700, 13, 187, 23, 16, 24, 16, 1036, 13, 387, 374, 313, 22322, 481, 2756, 50254, 50270, 50276, 428, 26, 14, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 535, 187, 1661, 728, 2220, 2593, 495, 28927, 9, 68, 2769, 19, 10, 275, 23254, 247, 17396, 5927, 6197, 187, 187, 20026, 3096, 6285, 15, 50274, 5035, 16342, 362, 15, 443, 2002, 13, 4240, 8010, 6053, 3495, 13, 475, 21, 313, 9387, 15, 187, 187, 15705, 15, 4240, 10, 313, 16514, 326, 773, 81, 27956, 281, 28098, 348, 3423, 13, 275, 253, 5928, 273, 247, 187, 187, 88, 35083, 390, 385, 32189, 5989, 816, 5411, 247, 3186, 13, 247, 3257, 665, 187, 187, 709, 5123, 281, 2085, 247, 2614, 3410, 672, 9521, 407, 3513, 310, 417, 2256, 281, 187, 187, 783, 8655, 22414, 2530, 275, 6879, 3643, 15, 36, 15, 52, 15, 34, 15, 20485, 495, 28953, 14, 24137, 21, 39537, 4923, 187, 187, 9088, 369, 642, 11315, 6265, 281, 16209, 253, 6197, 13, 359, 1364, 33085, 187, 187, 783, 3883, 273, 6197, 285, 18097, 323, 23381, 5537, 15, 23, 2594, 2654, 15, 535, 50273, 15545, 2220, 253, 20128, 13, 359, 10418, 3096, 6285, 457, 84, 19130, 13, 33085, 521, 187, 187, 36817, 285, 18097, 323, 23381, 5537, 15, 50271, 23135, 13, 359, 13292, 10158, 187, 187, 35, 1017, 457, 84, 13786, 281, 2726, 6553, 15, 24, 5429, 187, 23, 187, 50276, 1231, 3877, 326, 253, 2332, 1302, 11295, 247, 6197, 273, 581, 285, 581, 14, 14674, 281, 2620, 187, 10526, 275, 5754, 323, 253, 399, 9571, 14, 709, 780, 9611, 13, 973, 1840, 253, 17396, 187, 35674, 13, 285, 6337, 436, 6197, 17336, 281, 253, 7732, 417, 281, 7081, 187, 11342, 1513, 9611, 15, 50274, 48, 296, 46123, 13, 253, 2332, 1302, 812, 16209, 253, 1072, 187, 36817, 1309, 23381, 5537, 15, 1723, 13, 275, 23254, 253, 6197, 13, 253, 2332, 187, 13550, 2550, 1908, 253, 17396, 5927, 6197, 275, 2593, 187, 24137, 21, 9, 68, 2769, 19, 582, 285, 2550, 16209, 253, 17396, 4030, 15, 187, 24, 187, 50275, 7559, 6285, 556, 4724, 247, 4858, 16066, 323, 15836, 273, 2051, 842, 264, 19330, 15, 187, 6436, 13, 1754, 2220, 776, 16322, 273, 436, 1083, 285, 13336, 273, 10158, 187, 35, 1017, 457, 84, 13786, 281, 2726, 6553, 13, 359, 13292, 3096, 6285, 457, 84, 16066, 15, 12257, 13, 3096, 6285, 310, 187, 4924, 281, 1873, 824, 247, 3200, 342, 253, 2332, 1302, 2220, 18097, 323, 23381, 5537, 15, 2756, 50254, 50270, 428, 884, 428, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 2756, 50273, 40453, 281, 2726, 6553, 347, 19330, 5868, 15, 50273, 27302, 2747, 273, 6197, 187, 187, 28902, 456, 15, 10498, 27013, 323, 23381, 5537, 15, 16066, 323, 15836, 273, 2051, 842, 264, 187, 187, 35108, 2034, 5868, 15, 23124, 37420, 42289, 1428, 15, 187, 187, 27302, 2747, 3035, 3606, 15, 5429, 187, 32618, 399, 15, 1023, 282, 555, 79, 13, 49286, 15, 187, 1845, 6033, 302, 552, 187, 187, 6958, 27, 577, 16, 1012, 16, 7132, 8863, 50254, 50270, 14, 1903, 428, 8675, 19, 15, 187, 187, 20, 15, 187, 187, 37, 610, 8148, 18197, 275, 2101, 1562, 15069, 187, 187, 1231, 4390, 5752, 253, 2644, 273, 2101, 1562, 15069, 15111, 13, 8109, 1097, 8811, 285, 253, 8704, 16999, 13, 8965, 285, 15114, 342, 616, 6079, 12478, 285, 29023, 6095, 15, 1583, 403, 247, 2032, 12725, 323, 24359, 285, 4693, 398, 19605, 15, 187, 187, 51, 1225, 301, 310, 275, 4179, 273, 776, 6079, 12478, 4849, 285, 6742, 2579, 275, 253, 2170, 285, 310, 327, 1133, 281, 3662, 667, 3533, 368, 452, 15, 1422, 476, 671, 1067, 776, 27488, 6631, 10589, 281, 1056, 2544, 281, 634, 11526, 18406, 285, 40547, 15, 187, 187, 6067, 10865, 5003, 74, 285, 5119, 871, 253, 444, 18, 1501, 3211, 751, 253, 896, 273, 616, 1133, 285, 403, 1900, 327, 673, 323, 616, 18406, 15, 9870, 562, 323, 731, 275, 616, 25730, 366, 2002, 272, 362, 507, 15, 5498, 2072, 21523, 2275, 3920, 187, 187, 10282, 342, 271, 7407, 10417, 22301, 5570, 665, 476, 1361, 368, 1379, 253, 1735, 3213, 15, 187, 187, 36, 360, 12581, 23264, 327, 15111, 27, 12231, 187, 187, 52, 744, 10421, 27, 187, 2941, 16, 805, 16, 7798, 187, 187, 26859, 265, 27, 187, 5, 21, 13, 41532, 9, 7132, 10, 187, 187, 45, 302, 19662, 27, 187, 22, 15, 2945, 20046, 187, 187, 2548, 27, 187, 21822, 14, 21276, 9067, 187, 187, 18085, 41898, 27, 187, 6620, 187, 187, 11446, 27, 187, 19, 16061, 187, 187, 43091, 27, 187, 33878, 902, 10317, 187, 187, 28014, 4412, 27, 187, 58, 293, 187, 187, 43582, 27, 187, 33798, 336, 3928, 187, 187, 40645, 27, 187, 35906, 187, 187, 25821, 187, 187, 4678, 35752, 1728, 4441, 327, 608, 20046, 259, 16, 1142, 27192, 15, 7489, 6119, 259, 16, 28859, 614, 33605, 13, 288, 69, 14066, 23467, 13, 5540, 16, 2945, 41778, 47545, 15, 831, 1728, 671, 3386, 247, 7473, 13223, 40373, 285, 1850, 3906, 347, 973, 347, 247, 298, 72, 1431, 40373, 259, 16, 11342, 5070, 285, 5389, 5534, 38357, 15, 510, 270, 4742, 69, 556, 247, 298, 72, 42801, 326, 310, 1270, 323, 32196, 390, 25945, 15, 380, 1840, 3216, 6363, 588, 3297, 15, 510, 6303, 556, 247, 31848, 608, 5313, 8158, 259, 16, 594, 1170, 6985 ]
A.2d 378, 384 (Pa. Super. 2002) (stating that appellant cannot claim that he involuntarily entered a guilty plea where he stated that no one threatened him to plead guilty). In point of fact, Gehr specifically stated that he understood the permissible ranges of sentence and that no specific prison sentence, whether county or state, was promised to him. See Muhammad, 794 A.2d at 383 (stating that “disappointment by a defendant in the sentence actually imposed does not represent manifest injustice.”). Thus, Gehr’s claim is frivolous. However, we must conduct an independent review of the record to determine whether there are any other non-frivolous issues that Gehr could raise on appeal.2 We will first determine whether the imposition of Gehr’s sentence for the DUI-refusal conviction violated the recent United States Supreme Court holding in Birchfield v. North Dakota, 136 S. Ct. 2 We acknowledge that “[t]he entry of a guilty plea constitutes a waiver of all defects and defenses except lack of jurisdiction, invalidity of the plea, and illegality of the sentence.” Commonwealth v. Tareila, 895 A.2d 1266, 1267 (Pa. Super. 2006). -7- J-S12038-17 2160 (2016).3 In Birchfield, the Supreme Court concluded that “a breath test, but not a blood test, may be administered as a search incident to a lawful arrest for drunk driving.” Birchfield, 136 S. Ct. at 2185. Additionally, the Supreme Court held that blood tests taken pursuant to implied consent laws are an unconstitutional invasion of privacy. Id. at 2186. The Supreme Court stated that “motorists cannot be deemed to have consented to submit to a blood test on pain of committing a criminal offense.” Id.; see also id. (concluding that the petitioner could not be convicted of refusing a warrantless blood draw following an arrest for driving under the influence). Here, at the time of his sentencing and resentencing hearing, Gehr 3 In the letter informing Gehr of his request to withdraw as counsel, Attorney Bower states that the Birchfield decision may impact Gehr’s DUI-refusal conviction. See Letter, 11/28/16. However, Attorney Bower indicated that Birchfield was decided after Gehr’s sentence, and while his appeal was pending, and thus, did not raise a Birchfield claim in the Anders brief. See id. Here, Birchfield was decided on June 23, 2016, after Gehr’s sentence was imposed, but during the pendency of the instant appeal. Because this issue relates to the legality of sentence, and Birchfield was decided during the pendency of Gehr’s appeal, we may address the legality challenge. See Commonwealth v. Barnes, 151 A.3d 121, 125-26 (Pa. 2016); see also Schriro v. Summerlin, 542 U.S. 348, 351 (2004) (stating that a United States Supreme Court decision resulting in a new rule of law “applies to all criminal cases still pending on direct review.”). -8- J-S12038-17 was subject to the penalties set forth in section 3804(c)(2), 4 as he pled guilty to DUI under section 3802(a)(1), his second offense, and refused to consent to a blood test. See N.T., 4/20/16, at 4 (noting that the mandatory minimum was ninety days); Sentencing Order, 4/20/16, at 3 (unnumbered) (stating that Gehr must pay the mandatory minimum fine of $1,500).5 As the Birchfield Court held that the practice of criminalizing the failure to consent to blood testing following a driving under the influence arrest was unconstitutional, we conclude that the trial court improperly 4 Section 3804(c)(2) states the following: (c) Incapacity; highest blood alcohol; controlled substances.--An individual who violates section 3802(a)(1) and refused testing of blood or breath or an individual who violates section 3802(c) or (d) shall be sentenced as follows: *** (2) For a second offense, to: (i) undergo imprisonment of not less than 90 days; (ii) pay a fine of not less than $1,500; (iii) attend an alcohol highway safety school approved by the department; and (iv) comply with all drug and alcohol treatment requirements imposed under sections 3814 and 3815. 75 Pa.C.S.A. § 3804(c)(2). 5 As part of its June 7, 2016 Sentencing Order, the trial court stated that apart from imposing the sentences concurrently, the remainder of the April 20, 2016 Sentencing Order remained in effect. See Sentencing Order, 6/7/16, at 2 (unnumbered). -9- J-S12038-17 relied upon section 3804(c)(2) in imposing a mandatory minimum sentence upon Gehr. See Commonwealth v. Giron, 2017 PA Super 23, *4 (Pa. Super. 2017) (holding that “pursuant to Birchfield, in the absence of a warrant or exigent circumstances justifying a search, a defendant who refuses to provide a blood sample when requested by police is not subject to the enhanced penalties provided in 75 Pa.C.S.A. §§ 3803-3804.”). Because there was no statutory authority to impose the sentence, we must vacate the judgment of sentence and remand for resentencing.6 See id. Based upon the foregoing, we affirm Gehr’s convictions, vacate his sentence and remand for resentencing. Accordingly, we deny Attorney Bower’s Petition to Withdraw.7 6 We note that the trial court imposed a sentence of one and one-half to five years in prison for the DUI-refual conviction, well above the mandatory minimum, and ran this sentence concurrent to the persons not to possess firearm conviction. Ostensibly, the trial court could impose the same sentence during resentencing. However, in imposing the sentence, the trial court cannot consider the mandatory minimum sentence in section 3804(c)(2), and cannot impose the mandatory fine. 7 Gehr has filed a separate Motion for Change of Appointed Counsel. However, based upon our disposition of this case and denial of Attorney Bower’s Petition to Withdraw, we deny Gehr’s Motion. Nevertheless, Gehr is free to file such a motion with the trial court upon remand for resentencing. - 10 - J-S12038-17 Petition to Withdraw as Counsel denied. Judgment of sentence vacated. Case remanded for resentencing. Motion for Change of Appointed Counsel denied. Jurisdiction relinquished. Judgment Entered. Joseph D. Seletyn, Esq. Prothonotary Date: 4/13/2017 - 11 - 2. 3. Dry Cleaning in Spitalfields We currently serve the whole of Spitalfields Market, supporting both residents and the surrounding shops, bars and restaurants with their dry cleaning and laundry requirements. They are a true delight for tourists and Londoners alike. Rashid is in charge of our dry cleaning collection and delivery service in the area and is on hand to answer any questions you have. You can also call our Customer Service Team to make changes to your scheduled collections and deliveries. Our drivers Sani and David know the E1 postcode like the back of their hand and are always on time for their collections. Look out for them in their ihateironing vans.Donna Rudebaugh Work with an experienced Real Estate agent who can help you take the next step. Cumulative Days on Market:117 Sold Date: 03/12/2018 Taxes: $4,085(2017) Lot Size: 5.42 acres Type: Single-Family Home Year Built: 2015 Style: 2 Story Views: Territorial School District: Yel County: Pierce County Community: Roy Comments Beautiful home located on 5 acres w/ many trails. Open kit w/granite counters, hdwd floors, 36/42 staggered cabinets. This home also features a formal din rm and den office as well as a lg fam rm w/fireplace and beautiful wood mantle.The bkyd has a lg patio that is great for relaxing or entertaining. The above ground pool will stay.The master has a fabulous 5 piece bath w/ soaking tub
[ 77, 15, 73, 31, 187, 4, 16238, 15112, 4132, 64, 47146, 64, 29193, 21466, 187, 50274, 4, 3709, 654, 57, 883, 16, 57, 4658, 15, 73, 31, 187, 4, 7287, 187, 187, 12361, 42644, 187, 92, 187, 12361, 2294, 187, 92, 187, 2437, 444, 3129, 5856, 1163, 1345, 4051, 5856, 187, 92, 187, 4387, 27, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 247, 747, 3634, 13, 417, 2330, 281, 247, 3497, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 25161, 281, 3894, 253, 747, 581, 342, 313, 5092, 320, 5812, 10, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 3129, 5856, 9, 38, 3129, 5856, 11, 6096, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 247, 747, 3634, 7660, 281, 247, 3497, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 50271, 5856, 281, 3894, 253, 747, 581, 342, 187, 50274, 10638, 393, 3575, 7533, 50273, 47731, 3602, 187, 50274, 10638, 393, 3575, 7302, 50270, 11732, 281, 253, 7302, 3497, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 3129, 5856, 9, 38, 3129, 5856, 11, 6096, 13, 1030, 25161, 16704, 7, 7533, 13, 1030, 30660, 14560, 11, 7302, 13, 10698, 540, 9886, 6052, 36273, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 247, 747, 3634, 326, 8473, 84, 697, 1211, 18164, 2303, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 50275, 5856, 281, 3894, 253, 747, 581, 342, 187, 50274, 10638, 393, 3575, 7533, 42087, 3602, 187, 50274, 10638, 393, 3575, 4871, 50274, 8116, 6391, 4871, 13, 275, 15115, 187, 50274, 10638, 393, 3575, 4898, 50275, 8116, 6391, 4898, 13, 275, 15115, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 3129, 5856, 9, 38, 3129, 5856, 11, 6096, 13, 1030, 25161, 16704, 7, 7533, 13, 10698, 540, 4871, 13, 10698, 540, 4898, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 20593, 957, 263, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 95, 38, 3129, 5856, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 5057, 253, 2953, 273, 271, 7489, 5990, 1159, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 1416, 9424, 273, 253, 1159, 281, 755, 253, 2953, 273, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 22483, 273, 253, 7489, 5990, 1159, 13, 470, 327, 4433, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4659, 4051, 11594, 11732, 755, 11594, 9, 3474, 1018, 11, 1416, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 39750, 366, 253, 3634, 347, 253, 1655, 2303, 187, 50274, 10638, 50270, 1542, 18164, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 1655, 12369, 281, 1056, 253, 3634, 1655, 390, 642, 3356, 1655, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 11793, 327, 2323, 13, 3221, 604, 667, 2228, 4592, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 22259, 7301, 1056, 10605, 9, 10975, 1655, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 27604, 752, 556, 644, 13697, 281, 253, 3634, 594, 2080, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 22259, 2991, 3148, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 34747, 390, 19495, 9118, 27801, 187, 50274, 10638, 187, 50274, 10638, 39750, 839, 9118, 27801, 588, 2701, 253, 1180, 187, 50274, 10638, 273, 13009, 8653, 281, 253, 22906, 2281, 273, 253, 5724, 15, 187, 50274, 10638, 831, 476, 3693, 690, 5304, 24165, 13, 285, 2701, 253, 30432, 5034, 187, 50274, 10638, 281, 247, 1175, 1318, 313, 2858, 417, 3638, 2439, 1027, 12823, 481, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 11410, 27, 11793, 281, 8046, 362, 14, 24335, 13, 3221, 281, 372, 36915, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 22259, 2991, 873, 44594, 27902, 19157, 9, 10975, 11410, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 253, 3634, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 50271, 5856, 281, 3894, 253, 747, 581, 342, 313, 5092, 320, 5812, 10, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 393, 3575, 7533, 50273, 47731, 3602, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 2794, 5856, 9, 38, 3129, 5856, 11, 6096, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 253, 444, 5990, 2553, 187, 50274, 10638, 187, 50274, 10638, 831, 1159, 1364, 320, 1925, 672, 253, 2425, 313, 250, 10, 5478, 13, 390, 187, 50274, 10638, 672, 253, 11259, 1818, 15, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 3497, 27, 380, 7925, 3497, 1511, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 2794, 33412, 9, 38, 5990, 21408, 12205, 2548, 3497, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 20593, 4926, 253, 444, 5990, 2553, 187, 50274, 10638, 187, 50274, 10638, 831, 1159, 1364, 320, 1925, 672, 253, 2425, 310, 6331, 13, 390, 187, 50274, 10638, 672, 253, 11259, 1818, 15, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 6909, 33412, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 5057, 253, 1682, 444, 5990, 5304, 323, 247, 1677, 873, 273, 3492, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 3148, 50272, 38, 5990, 3148, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 393, 3575, 7533, 50273, 6825, 264, 3634, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 380, 1682, 444, 5990, 3596, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4659, 444, 5990, 6155, 755, 17277, 6155, 9, 38, 5990, 17214, 3148, 13, 10698, 540, 9886, 6052, 36273, 13, 1030, 25161, 16704, 7, 7533, 558, 187, 187, 4, 16238, 15112, 4132, 64, 47146, 64, 29193, 21466, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 16551, 253, 1682, 444, 5990, 5304, 323, 247, 1677, 873, 273, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 3148, 50272, 57, 3148, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 393, 3575, 7533, 50273, 6825, 264, 3634, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 380, 1682, 5304, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4659, 1594, 25889, 6074, 3609, 17277, 25889, 9, 1450, 17214, 11, 3148, 13, 10698, 540, 9886, 6052, 36273, 13, 1030, 25161, 16704, 7, 7533, 558, 187, 4, 7287, 187, 187, 9486, 27, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 7518, 468, 281, 3491, 253, 5055, 444, 5990, 6661, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 5731, 16704, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 605, 17792, 941, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 5990, 17214, 50276, 78, 64, 8412, 28, 33047, 29, 380, 4812, 444, 5990, 3148, 187, 50274, 38, 5990, 5856, 50276, 78, 64, 8882, 28, 33047, 29, 380, 4812, 444, 5990, 3634, 187, 50274, 38, 5990, 33412, 50276, 78, 64, 26555, 28, 33047, 29, 380, 4812, 444, 5990, 2553, 187, 50274, 38, 5990, 6155, 50275, 78, 64, 5397, 28, 50276, 39481, 29, 380, 4812, 444, 5990, 3596, 187, 187, 4718, 187, 187, 94, 1380, 12953, 2294, 187, 187, 94, 1380, 12953, 42644, 535, 187, 4, 7287, 1380, 15112, 4132, 64, 38, 5990, 5707, 19093, 64, 40311, 187, 27732, 2035, 14, 24676, 6979, 273, 12366, 37724, 12382, 273, 253, 5988, 27, 7103, 273, 5165, 12393, 10235, 285, 2625, 7133, 275, 5921, 342, 46409, 4342, 15, 187, 510, 6378, 273, 436, 1263, 497, 281, 7277, 253, 5165, 12393, 10235, 313, 38348, 10, 273, 12366, 37724, 12382, 273, 253, 5988, 342, 326, 273, 643, 5988, 8837, 285, 281, 12106, 13007, 875, 2625, 7133, 327, 12393, 14, 24676, 3888, 285, 253, 46409, 3386, 273, 12366, 37724, 12382, 15, 5761, 4289, 28089, 14, 17182, 1363, 342, 28043, 10429, 13, 1690, 1458, 12366, 37724, 35563, 313, 1012, 6313, 1511, 13, 767, 6804, 1511, 582, 23133, 643, 17566, 8837, 13, 285, 9135, 21690, 10429, 13, 497, 6730, 342, 337, 15, 22, 14, 53, 14478, 387, 270, 2193, 273, 470, 285, 337, 13, 5388, 256, 16, 2188, 9, 19, 481, 380, 13007, 875, 7842, 414, 285, 34026, 13, 43967, 273, 2625, 7133, 327, 12393, 14, 24676, 3888, 13, 285, 1872, 11036, 9522, 4342, 497, 5867, 15, 380, 3064, 369, 10126, 1534, 313, 81, 654, 470, 15, 1762, 481, 380, 1599, 34026, 273, 12366, 37724, 12382, 313, 18, 15, 25, 11620, 470, 15, 21, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 369, 10126, 2169, 685, 326, 273, 21690, 10429, 313, 18, 15, 20, 30700, 470, 15, 20, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 285, 643, 17566, 8837, 313, 17, 15, 26, 11620, 470, 15, 19, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 313, 81, 654, 470, 15, 2874, 481, 380, 34026, 273, 6313, 1511, 12366, 37724, 12382, 313, 18, 15, 25, 11620, 470, 15, 20, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 369, 2169, 685, 326, 273, 6804, 1511, 12366, 37724, 12382, 313, 18, 15, 19, 11620, 470, 15, 19, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 313, 81, 654, 470, 15, 2874, 10, 285, 643, 46409, 3510, 313, 81, 2239, 470, 15, 1762, 481, 380, 5921, 875, 1599, 7842, 414, 285, 253, 34026, 273, 12366, 37724, 12382, 369, 1534, 313, 2859, 9, 84, 10, 426, 428, 17, 15, 31254, 28, 268, 426, 470, 15, 2874, 481, 380, 43967, 273, 2625, 7133, 327, 12393, 14, 24676, 3888, 9578, 342, 253, 43967, 273, 46409, 5289, 273, 12366, 37724, 12382, 313, 81, 654, 470, 15, 2874, 28, 465, 5596, 426, 470, 15, 25, 1731, 481, 353, 1028, 37724, 12382, 476, 320, 4518, 22266, 432, 643, 5988, 8837, 327, 253, 3720, 273, 34026, 15, 380, 1698, 2625, 7133, 273, 12366, 37724, 12382, 327, 12393, 14, 24676, 3888, 4620, 281, 4887, 253, 3361, 273, 12366, 249, 285, 1698, 7842, 414, 15, 4855, 2625, 7133, 327, 12393, 14, 24676, 3888, 778, 4887, 253, 3361, 273, 5713, 18540, 5670, 25663, 13, 2559, 894, 4038, 13, 390, 247, 5019, 273, 841, 3386, 15, 6586, 11743, 26872, 8113, 812, 320, 16789, 407, 13506, 30312, 284, 1160, 275, 253, 5188, 187, 187, 36, 9584, 284, 1160, 275, 253, 9965, 452, 16821, 5520, 253, 8184, 273, 884, 19688, 1363, 342, 1534, 8113, 2957, 15, 187, 187, 1845, 23747, 7094, 432, 13506, 15546, 13, 253, 27067, 3959, 253, 22602, 267, 2182, 6387, 323, 247, 5407, 281, 1966, 14773, 7944, 15, 187, 187, 510, 2840, 14, 12710, 30312, 284, 789, 407, 40021, 22781, 273, 253, 22614, 285, 1341, 275, 253, 5130, 15, 187, 187, 1552, 310, 253, 806, 673, 8113, 556, 644, 16789, 275, 436, 1039, 15, 187, 187, 6067, 3745, 281, 923, 7024, 327, 253, 944, 21254, 13, 253, 13955, 3828, 326, 10949, 253, 35048, 13, 3496, 261, 285, 2914, 273, 253, 5130, 15, 23089, 7094, 273, 15546, 13, 352, 20124, 84, 1708, 281, 2770, 3888, 327, 253, 30067, 15, 187, 187, 21727, 486, 281, 253, 944, 21254, 310, 253, 1273, 5962, 2847, 273, 44868, 11762, 13, 13567, 4829, 884, 3041, 952, 15, 187, 187, 688, 4343, 835, 4408, 19714, 310, 1896, 13, 33477, 4723, 285, 2728, 310, 4127, 407, 13132, 272, 1966, 14773, 30312, 284, 15, 1292, 627, 310, 247, 11762, 28938, 15, 187, 187, 510, 346, 67, 3783, 23744, 3, 27067, 497, 1160, 432, 247, 13506, 2715, 273, 1966, 15546, 4158, 281, 25066, 253, 944, 21254, 347, 8244, 347, 1896, 15, 34125, 12991, 13, 253, 2567, 326, 1160, 253, 27067, 908, 15727, 285, 1966, 3882, 6430, 281, 2794, 253, 2840, 30312, 284, 15, 187, 187, 37, 885, 833, 4408, 369, 5176, 432, 253, 30312, 284, 273, 884, 1363, 285, 7932, 342, 253, 27067, 15, 1583, 497, 840, 3560, 323, 767, 1107, 846, 5869, 281, 5724, 849, 973, 253, 27067, 497, 11217, 715, 253, 5130, 15, 187, 187, 688, 2800, 273, 253 ]
l.h> #ifdef SFML_SYSTEM_LINUX #include <X11/Xlib.h> #endif namespace sf { namespace priv { class EglContext : public GlContext { public: //////////////////////////////////////////////////////////// /// \brief Create a new context, not associated to a window /// /// \param shared Context to share the new one with (can be NULL) /// //////////////////////////////////////////////////////////// EglContext(EglContext* shared); //////////////////////////////////////////////////////////// /// \brief Create a new context attached to a window /// /// \param shared Context to share the new one with /// \param settings Creation parameters /// \param owner Pointer to the owner window /// \param bitsPerPixel Pixel depth, in bits per pixel /// //////////////////////////////////////////////////////////// EglContext(EglContext* shared, const ContextSettings& settings, const WindowImpl* owner, unsigned int bitsPerPixel); //////////////////////////////////////////////////////////// /// \brief Create a new context that embeds its own rendering target /// /// \param shared Context to share the new one with /// \param settings Creation parameters /// \param width Back buffer width, in pixels /// \param height Back buffer height, in pixels /// //////////////////////////////////////////////////////////// EglContext(EglContext* shared, const ContextSettings& settings, unsigned int width, unsigned int height); //////////////////////////////////////////////////////////// /// \brief Destructor /// //////////////////////////////////////////////////////////// ~EglContext(); //////////////////////////////////////////////////////////// /// \brief Get the address of an OpenGL function /// /// \param name Name of the function to get the address of /// /// \return Address of the OpenGL function, 0 on failure /// //////////////////////////////////////////////////////////// static GlFunctionPointer getFunction(const char* name); //////////////////////////////////////////////////////////// /// \brief Activate the context as the current target /// for rendering /// /// \param current Whether to make the context current or no longer current /// /// \return True on success, false if any error happened /// //////////////////////////////////////////////////////////// virtual bool makeCurrent(bool current); //////////////////////////////////////////////////////////// /// \brief Display what has been rendered to the context so far /// //////////////////////////////////////////////////////////// virtual void display(); //////////////////////////////////////////////////////////// /// \brief Enable or disable vertical synchronization /// /// Activating vertical synchronization will limit the number /// of frames displayed to the refresh rate of the monitor. /// This can avoid some visual artifacts, and limit the framerate /// to a good value (but not constant across different computers). /// /// \param enabled: True to enable v-sync, false to deactivate /// //////////////////////////////////////////////////////////// virtual void setVerticalSyncEnabled(bool enabled); //////////////////////////////////////////////////////////// /// \brief Create the context /// /// \param shared Context to share the new one with (can be NULL) /// \param bitsPerPixel Pixel depth, in bits per pixel /// \param settings Creation parameters /// //////////////////////////////////////////////////////////// void createContext(EglContext* shared); //////////////////////////////////////////////////////////// /// \brief Create the EGL surface /// /// This function must be called when the activity (re)start, or /// when the orientation change. /// /// \param window: The native window type /// //////////////////////////////////////////////////////////// void createSurface(EGLNativeWindowType window); //////////////////////////////////////////////////////////// /// \brief Destroy the EGL surface /// /// This function must be called when the activity is stopped, or /// when the orientation change. /// //////////////////////////////////////////////////////////// void destroySurface(); //////////////////////////////////////////////////////////// /// \brief Get the best EGL visual for a given set of video settings /// /// \param display EGL display /// \param bitsPerPixel Pixel depth, in bits per pixel /// \param settings Requested context settings /// /// \return The best EGL config /// //////////////////////////////////////////////////////////// static EGLConfig getBestConfig(EGLDisplay display, unsigned int bitsPerPixel, const ContextSettings& settings); #ifdef SFML_SYSTEM_LINUX //////////////////////////////////////////////////////////// /// \brief Select the best EGL visual for a given set of settings /// /// \param display X display /// \param bitsPerPixel Pixel depth, in bits per pixel /// \param settings Requested context settings /// /// \return The best visual /// //////////////////////////////////////////////////////////// static XVisualInfo selectBestVisual(::Display* display, unsigned int bitsPerPixel, const ContextSettings& settings); #endif private: //////////////////////////////////////////////////////////// /// \brief Helper to copy the picked EGL configuration //////////////////////////////////////////////////////////// void updateSettings(); //////////////////////////////////////////////////////////// // Member data //////////////////////////////////////////////////////////// EGLDisplay m_display; //!< The internal EGL display EGLContext m_context; //!< The internal EGL context EGLSurface m_surface; //!< The internal EGL surface EGLConfig m_config; //!< The internal EGL config }; } // namespace priv } // namespace sf #endif // SFML_EGLCONTEXT_HPP Diffusion-weighted imaging of mucinous carcinoma of the breast: evaluation of apparent diffusion coefficient and signal intensity in correlation with histologic findings. The purposes of this study were to compare the apparent diffusion coefficient (ADC) of mucinous carcinoma of the breast with that of other breast tumors and to analyze correlations between signal intensity on diffusion-weighted images and the histologic features of mucinous carcinoma. Two hundred seventy-six patients with 277 lesions, including 15 mucinous carcinomas (13 pure type, two mixed type), 204 other malignant tumors, and 58 benign lesions, were examined with 1.5-T MRI at b values of 0 and 1,500 s/mm(2). The correlations between cellularity and ADC, homogeneity of signal intensity on diffusion-weighted images, and histopathologic findings were analyzed. The difference was statistically significant (p < 0.05). The mean ADC of mucinous carcinoma (1.8 +/- 0.4 x 10(-3) mm(2)/s) was statistically higher than that of benign lesions (1.3+/- 0.3 x 10(-3) mm(2)/s) and other malignant tumors (0.9 +/- 0.2 x 10(-3) mm(2)/s) (p < 0.001). The ADC of pure type mucinous carcinoma (1.8 +/- 0.3 x 10(-3) mm(2)/s) was higher than that of mixed type mucinous carcinoma (1.2 +/- 0.2 x 10(-3) mm(2)/s) (p < 0.001) and other histologic types (p > 0.05). The correlation between mean cellularity and the ADC of mucinous carcinoma was significant (rho(s) = -0.754; p = 0.001). The homogeneity of signal intensity on diffusion-weighted images correlated with the homogeneity of histologic structures of mucinous carcinoma (p < 0.001; kappa = 0.826). Mucinous carcinoma can be clearly differentiated from other breast tumors on the basis of ADC. The low signal intensity of mucinous carcinoma on diffusion-weighted images appears to reflect the presence of mucin and low cellularity. High signal intensity on diffusion-weighted images may reflect the presence of fibrovascular bundles, increased cell density, or a combination of these features.Image caption Lost vision could be restored by synthetic corneas made in the lab Corneas made in the laboratory have dramatically improved the sight of 10 Swedish patients with significant vision loss. Produced entirely from synthetic collagen, the implants offer the tantalising possibility for a replacement to human donor tissues. The custom-made corneas work by prompting regeneration of the nerves and cells in the eye. This is the first time vision has been restored in this way. Our ability to see depends on the cornea, the transparent layer that covers the pupil, iris and front of the eye. Made entirely of collagen, it refracts light to focus images on the retina. Damage to the cornea is the second biggest cause of blindness worldwide, affecting nearly 10 million people. In countries where tissue banking is possible, corneal damage and disease is treated by implanting human donor corneas. But there is a worldwide shortage. The "biosynthetic" implants were made from a synthetic version of human collagen designed to mimic the cornea as closely as possible. Fibrogen, the company that made the implants used yeast and human DNA sequences to create the custom corneas. Diseased tissue was removed from the corneas of 10 patients and replaced with the implants. They were then followed for two years after surgery to monitor how well the implants were incorporated into the eye. In six of the
[ 562, 273, 253, 9169, 9922, 12674, 3625, 5492, 327, 8216, 347, 344, 19460, 281, 6351, 32535, 275, 247, 22299, 1673, 15, 187, 187, 3, 42, 6337, 323, 4007, 984, 436, 2586, 310, 1146, 30548, 7419, 407, 8672, 285, 37492, 3958, 1223, 776, 5962, 3237, 564, 5061, 5336, 15, 3954, 3063, 13, 309, 1353, 12365, 619, 4544, 323, 4007, 13, 533, 309, 588, 1620, 3523, 22142, 326, 3968, 476, 760, 2118, 3579, 672, 359, 789, 2366, 937, 388, 20471, 4213, 2211, 753, 275, 247, 3492, 6096, 327, 2675, 3420, 15, 754, 2879, 326, 344, 3264, 247, 346, 635, 1027, 6452, 3, 432, 521, 12674, 12246, 15, 187, 187, 41, 20471, 4213, 2211, 15975, 27, 831, 4131, 13, 309, 1353, 30849, 326, 309, 1353, 642, 3356, 3515, 323, 3918, 15, 3900, 436, 4544, 1904, 626, 452, 253, 6454, 359, 497, 11525, 323, 13, 1046, 2774, 556, 644, 32811, 708, 309, 1353, 31115, 281, 4130, 665, 4516, 436, 4544, 285, 776, 2862, 2285, 15, 187, 187, 6573, 3377, 10823, 452, 18343, 388, 20471, 4213, 2211, 281, 9488, 521, 12246, 285, 3185, 6604, 253, 1375, 434, 530, 15, 52, 15, 8907, 5492, 13, 835, 521, 3128, 13079, 281, 30394, 255, 8786, 35315, 48038, 35646, 15, 496, 253, 3492, 8216, 13, 388, 20471, 4213, 2211, 753, 344, 3735, 346, 4064, 594, 1142, 9472, 324, 507, 665, 971, 479, 281, 1408, 323, 1986, 2077, 8907, 449, 754, 753, 344, 651, 346, 31089, 326, 690, 4092, 1869, 449, 187, 187, 13641, 41965, 452, 4931, 616, 1682, 4839, 281, 19153, 247, 18485, 14, 13028, 7319, 1735, 807, 275, 13338, 15, 41332, 13, 625, 685, 884, 10823, 452, 16780, 715, 253, 9922, 8907, 3625, 15, 1284, 344, 556, 1029, 1416, 8981, 432, 767, 2426, 347, 13338, 434, 14176, 13, 388, 20471, 4213, 2211, 651, 4745, 2489, 247, 1755, 49865, 323, 253, 8907, 7319, 604, 344, 5966, 253, 12417, 15, 187, 187, 41, 20471, 4213, 2211, 13, 247, 10290, 13, 4242, 281, 6427, 1199, 4116, 846, 27906, 521, 12674, 4613, 1974, 275, 3919, 15, 754, 3839, 2206, 387, 337, 6, 275, 253, 22207, 15, 754, 5439, 816, 370, 18, 15, 18, 3041, 275, 253, 1273, 7150, 13, 2190, 253, 8840, 419, 7228, 273, 667, 273, 253, 9183, 15, 187, 187, 41, 20471, 4213, 2211, 434, 268, 2711, 610, 1273, 14, 35443, 35958, 4845, 521, 4544, 275, 5434, 273, 3515, 562, 273, 2583, 13, 2556, 281, 12766, 4173, 15, 187, 187, 8389, 4544, 37093, 247, 17941, 14, 484, 275, 2393, 4163, 672, 2620, 1029, 14, 5251, 4750, 398, 1669, 390, 1160, 5827, 281, 3553, 13, 12766, 4173, 2361, 15, 187, 187, 10457, 4163, 434, 9922, 3625, 8881, 388, 20471, 4213, 2211, 7416, 643, 16938, 684, 275, 20362, 4780, 1644, 13, 9734, 326, 10823, 8, 346, 10818, 280, 609, 323, 1876, 3, 18595, 651, 1614, 745, 11163, 15, 346, 1552, 10732, 326, 368, 1472, 1469, 281, 1379, 3055, 6503, 1977, 432, 12660, 3041, 7108, 937, 344, 753, 13, 346, 261, 247, 15394, 387, 253, 22523, 3817, 13, 368, 1537, 347, 973, 8529, 1672, 253, 6132, 281, 10053, 3778, 449, 187, 187, 41, 20471, 4213, 2211, 434, 4544, 574, 14078, 264, 521, 9550, 285, 2323, 275, 16994, 7823, 326, 14123, 2822, 10898, 1786, 14, 6672, 7031, 13, 2266, 5654, 1453, 5593, 285, 253, 4320, 1320, 273, 28977, 13717, 1309, 521, 767, 2426, 347, 13338, 434, 14176, 15, 187, 187, 41, 20471, 4213, 2211, 13, 9963, 13, 369, 13338, 434, 14176, 432, 4332, 281, 6247, 15, 754, 369, 20734, 434, 14967, 323, 4314, 1107, 1078, 326, 15, 187, 187, 510, 13338, 8907, 5492, 556, 8392, 12680, 3872, 1600, 347, 11885, 285, 10823, 3819, 323, 1453, 273, 253, 9320, 1735, 807, 15, 380, 1755, 3187, 40902, 275, 253, 9922, 3625, 13, 3438, 1375, 4673, 15, 10035, 38437, 13, 5439, 370, 18, 15, 23, 3041, 275, 253, 1273, 7150, 1905, 625, 685, 388, 20471, 4213, 2211, 858, 347, 247, 12674, 7431, 15, 187, 187, 1128, 18526, 3979, 434, 15273, 7528, 328, 4940, 9945, 281, 436, 1304, 50, 27, 187, 187, 57, 3211, 577, 15, 20, 5204, 17370, 47, 2523, 346, 11695, 556, 642, 4284, 1973, 6661, 3, 187, 187, 3039, 309, 2451, 562, 253, 2127, 327, 1594, 3211, 577, 15, 20, 13, 352, 4245, 271, 2228, 428, 8049, 556, 642, 4284, 1973, 6661, 15, 733, 2987, 327, 2045, 1594, 3211, 9508, 2167, 15, 187, 5804, 3780, 1361, 479, 275, 36182, 436, 562, 32, 187, 3614, 1358, 3620, 1542, 7640, 15, 19934, 15, 681, 16, 8559, 16, 23, 1717, 18493, 4, 23, 1717, 18493, 187, 42, 717, 7591, 281, 897, 1594, 3211, 577, 15, 20, 1024, 285, 309, 452, 9300, 619, 13971, 281, 608, 15, 18, 187, 688, 1340, 281, 1071, 622, 327, 619, 4481, 309, 878, 281, 4993, 436, 1594, 3211, 2523, 15, 2615, 3095, 1361, 479, 275, 36182, 436, 562, 32, 187, 187, 34, 27, 187, 187, 35082, 751, 1594, 3211, 577, 15, 20, 4419, 326, 634, 346, 6986, 11909, 2402, 3, 1364, 320, 1633, 2931, 275, 253, 346, 57, 36, 10987, 11909, 3, 2593, 15, 2490, 187, 9807, 634, 2199, 15, 15656, 89, 29167, 275, 247, 2505, 8121, 751, 802, 18944, 1227, 2505, 13884, 15, 187, 13422, 323, 346, 57, 36, 10987, 11909, 3, 285, 3877, 253, 1973, 16012, 2931, 275, 326, 2593, 313, 27978, 26073, 13, 20002, 285, 30313, 13, 7293, 327, 253, 16012, 368, 2931, 323, 634, 2199, 481, 187, 4125, 3186, 512, 10872, 273, 346, 6986, 11909, 2402, 3, 428, 352, 434, 2779, 326, 436, 310, 873, 281, 247, 6661, 326, 1057, 5803, 2226, 275, 634, 1594, 36, 10987, 11909, 2593, 15, 15836, 253, 1318, 9, 84, 10, 594, 326, 352, 10129, 581, 273, 253, 16012, 7616, 275, 1594, 36, 10987, 11909, 313, 249, 619, 1083, 13, 309, 816, 4391, 432, 346, 18992, 3, 281, 346, 14154, 995, 534, 943, 3164, 789, 275, 634, 1083, 347, 973, 984, 954, 6493, 452, 387, 1878, 247, 346, 14154, 3, 6661, 2931, 10, 187, 187, 1394, 943, 840, 320, 2104, 281, 1527, 634, 2199, 275, 1594, 6124, 577, 15, 20, 535, 9707, 10601, 1267, 378, 4290, 45, 2637, 418, 8506, 28614, 380, 1048, 2940, 896, 281, 15704, 6625, 38437, 20930, 308, 8775, 187, 187, 34, 807, 327, 432, 247, 5249, 14, 40133, 4254, 281, 1555, 247, 10720, 4073, 17681, 273, 253, 896, 13, 1720, 18393, 308, 879, 90, 310, 39654, 323, 247, 13406, 41759, 15, 20919, 36, 695, 9111, 4396, 187, 187, 1785, 18393, 308, 879, 90, 310, 8288, 342, 625, 9305, 33773, 685, 344, 556, 275, 667, 273, 776, 2045, 16072, 15, 733, 310, 2393, 4247, 13, 2620, 2607, 846, 5249, 14, 1545, 1699, 5869, 327, 521, 896, 15, 2058, 436, 1127, 13, 344, 2506, 626, 871, 1880, 1841, 588, 789, 562, 15, 754, 556, 642, 9635, 3310, 285, 11210, 626, 6026, 1070, 247, 4023, 323, 2800, 2607, 15, 754, 2506, 626, 2568, 871, 1880, 344, 588, 2455, 755, 896, 4830, 247, 25154, 1673, 15, 187, 187, 1231, 452, 1313, 2709, 2069, 1580, 326, 4254, 13, 13452, 327, 253, 4481, 13, 25920, 7418, 8169, 15, 844, 651, 2312, 11719, 689, 253, 1735, 2800, 2607, 13, 1512, 15, 1292, 3063, 13, 352, 310, 28629, 326, 308, 879, 90, 310, 19703, 625, 24189, 685, 344, 556, 1078, 670, 253, 24626, 285, 10397, 326, 247, 27262, 273, 4073, 22877, 452, 4269, 779, 15, 187, 187, 3, 42, 3543, 19124, 281, 3253, 937, 344, 2296, 13, 7063, 387, 247, 2829, 275, 247, 26002, 8574, 8979, 275, 2065, 43314, 13, 19083, 247, 11636, 273, 4474, 16068, 285, 690, 9279, 15, 346, 4553, 5869, 309, 4571, 626, 513, 2712, 15, 309, 3543, 309, 369, 642, 1175, 281, 3780, 15, 1893, 13, 309, 369, 751, 13, 513, 368, 871, 752, 13, 12445, 310, 7746, 479, 309, 452, 281, 513, 436, 15, 1422, 476, 320, 5211, 342, 25154, 275, 634, 1495, 13, 368, 476, 320, 5211, 1293, 352, 15, 1707, 434, 642, 4797, 3845, 323, 1146, 2600, 449, 187, 187, 53, 879, 90, 434, 7906, 273, 4933, 253, 2165, 598, 497, 417, 747, 15, 380, 5854, 3809, 6026, 2146, 556, 2783, 352, 625, 2069, 685, 344, 24505, 281, 4456, 846, 271, 622, 11822, 1408, 273, 9478, 534, 556, 2908, 2620, 2117, 2979, 342, 4073, 22877, 273, 253, 896, 275, 253, 1390, 2800, 1107, 15, 380, 6323, 5866, 1390, 5768, 13, 275, 4163, 13, 285, 2436, 15281, 5869, 15, 754, 434, 760, 2030, 15, 187, 187, 998, 560, 22877, 403, 751, 465, 7430, 251, 614, 323, 6026, 10787, 27, 4274, 6133, 839, 285, 396, 1875, 314, 16592, 15, 1707, 310, 642, 12215, 597, 588, 320, 253, 1072, 4760, 846, 581, 15, 2596, 4073, 17681, 275, 247, 5249, 310, 3076, 2217, 15, 5761, 13, 23293, 15, 1292, 2620, 32, 914, 28996, 273, 15, 187, 187, 688, 7418, 12888, 285, 23261, 689, 253, 2469, 1249, 2607, 13, 352, 556, 644, 2590, 326, 3738, 253, 3438, 44057, 285, 24129, 637, 556, 1620, 1663, 3078, 281, 1918, 25154, 1977, 13, 344, 556, 1705, 281, 2426, 342, 2509, 594, 15, 308, 879, 90, 6849, 2994, 347, 271, 28684, 1436, 533, 846, 436, 1408, 273, 3076, 7516, 13, 352, 310, 1652, 4282, 344, 556, 2783, 1880, 352, 310, 512, 32811, 15, 329, 9560, 2180, 273, 521, 5249, 556, 644, 2668, 1977, 15, 187, 187, 688, 4104, 13, 344, 9377, 715, 5854, 434, 581, 14, 1201, 285, 308, 938, 6671, 13, 2509, 2217, 275, 521, 3710, 9091, 281, 5276, 344, 812, 5878, 352, 387, 253, 1755, 1268, 15, 32826, 13, 1669, 14, 1513, 285, 2104, 281, 6635, 1175, 13870, 13, 627, 497, 1029, 13079, 308, 879, 90, 651, 320, 247, 2022, 39642, 273, 5854, 434, 3168, 14, 2910, 10532, 15, 1310, 1841, 574, 644, 1027, 13, 344, 1537, 452, 644, 247, 3645, 9167, 13688, 15, 7820, 13, 344, 434, 327, 1529, 41759, 3971, 15, 187, 187, 9083, 1037, 13, 253, 1390, 2800, 1107, 452, 644, 6898, 342, 1897, 3811, 275, 3638, 3075, 15, 1198, 954, 273, 326, 673, 13, 344, 651, 6947, 3387, 2909, 275, 253, 17409, 816, 281, 755, 521, 2133, 4704, 281, 6194, 15, 13992, 14689, 25602, 3395, 253, 5222, 2112, 342, 50160, 480, 5375, 1046, 1770, 15, 1310, 344, 574, 247, 10562, 13, 344, 651, 320, 275, 2264, 41335, 253, 1735, 1388, 15, 5761, 390, 1264, 1897, 1078, 247, 2165, 13, 344, 651, 755, 10397, 13, 247, 11219, 1255, 670, 253, 3075, 344, 1537, 452, 281, 30565, 15, 733, 1904, 626, 1900, 1705, 15, 1292, 1077, 2223, 13, 352, 858, 15, 187, 187, 3, 1147, 369, 2761, 751, 1146, 762, 2419, 5263, 937, 310, 849, 344, 2529, 352, 13, 7063, 275, 247, 4693, 2534, 247, 1643, 3618, 846, 253, 1884, 394, 4163, 4254, 13, 275, 776, 806, 2454, 14, 936, 14, 1664, 4804, 15, 346, 42, 369, 18195, 15, 17814, 2010, 369, 4882, 25154, 285, 18262, 352, 285, 309, 369, 3365, 2820, 281, 320, 275, 247, 1659, 309, 369, 9848, 15, 21869, 1959, 15, 187, 187, 3, 42, 1869, 326, 369, 16088, 16593, 15, 309, 1869, 13, 686, 2513, 352, 4409, 352, 5554, 733, 1694, 281, 253, 1127, 835, 309, 1869, 309, 651, 2581, 320, 7063, 387, 247, 8597, 13, 2509, 247, 2622, 2628, 2581, 685, 1469, 949, 436, 1046, 1388, 449, 187, 187, 46928, 187, 187, 3, 46, 366, 13, 3063, 310, 247, 3076, 1388, 449, 187, 187, 53, 879, 90, 310, 9995, 344, 753, 1110, 3000, 281, 5854, 31143, 2150, 900, 13, 6029, 418, 2134, 90, 13, 1078, 3192, 253, 1673, 1411, 5427, 686, 34, 8, 387, 253, 48954, 1390, 4163, 15, 733, 369, 253, 2457, 273, 247, 1195, 14, 22253, 285, 308, 879, 90, 369, 1469, 715, 253, 2165, 1907, 816, 5950, 521, 1682, 14, 972, 5552, 329, 8442, 273, 577, 323, 1668, 13, 1411, 4255, 44744, 686, 34, 8, 247, 1643, 1897, 4321, 15, 9110, 308, 879, 90, 3260, 13, 347, 344, 556, 1929, 1142, 13, 1142, 2069, 689, 13, 436, 2165, 13, 327, 436, 1388, 13, 651, 320, 247, 6680, 15, 187, 187, 510, 1921, 344, 434, 9995, 273, 326, 5016, 342, 418, 2134, 90, 310, 984, 13, 275, 521, 1211, 3000, 13, 344, 6026, 1070, 346, 66, 16846, 273, 10739, 3446, 7874, 689, 84, 323, 5922, 6613, 15, 380, 3075, 369, 594, 3076, 1046, 673, 344, 1694, 281, 521, 6742, 31482, 326, 667, 1869, 273, 835, 253, 4023, 651, 990, 598, 369, 19124, 15, 831, 369, 417, 253, 2238, 273, 49652, 326, 512, 6026, 10787, 8722, 15, 831, 369 ]
out of the 2020 Democratic presidential primary race on Thursday as he struggled to gain traction in a crowded field. "I ran for president because this country is being ripped apart by politics and partisan games while our biggest problems go unsolved. Now today, I'm ending my campaign for president, but I will never stop believing that America can only move forward when we work together," Hickenlooper said in a video shared on social media. He added that he expected a "very different conclusion" from his presidential bid. Hickenlooper tweet: This morning, I'm announcing that I'm no longer running for President. While this campaign didn't have the outcome we were hoping for, every moment has been worthwhile & I'm thankful to everyone who supported this campaign and our entire team. Colorado Democrats have urged Hickenlooper to abandon his bid and instead join the state's U.S. Senate race, where his party hopes to unseat Republican incumbent Cory Gardner. In the video Thursday, Hickenlooper said he heard "from so many Coloradans who want me to run for United States Senate." He said he would "give that some serious thought." Democrats have perhaps their best chance to flip a GOP-held seat next year in Colorado. Already, more than 10 Democrats have jumped into the Democratic Senate primary. As he has high name recognition from two terms as Colorado's governor, Hickenlooper would immediately become a top contender for the Senate seat if he entered the contest. Hickenlooper, a moderate, failed to attract much attention after declaring his presidential candidacy in March. He generally sat at 1% in the polls. He raised just $1.1 million in the second quarter, among the lowest hauls of any of the candidates. Hickenlooper's paltry second-quarter fundraising placed his campaign in danger of running out of money, according to Politico. His campaign endured a shake-up in early July when five high-level staffers left or made plans to leave, Politico reported. During July's Democratic primary debate Hickenlooper joined other moderates in attacking progressives, warning that Democrats' "Medicare for All" proposals would turn off voters. "This notion that you're going to take private insurance away from 180 million Americans," he said, "is a disaster at the ballot box, you might as well FedEx the election to Donald Trump." Hickenlooper's campaign had touted his leadership and success in implementing policies that accomplished near universal health-care coverage, strong gun control measures and the legalization of recreational marijuana during his two terms as Colorado's governor. Hickenlooper, 67, was Colorado's governor from 2011 to 2019. He was Denver's mayor for eight years before that. The Colorado Senate race has drawn intense national interest as Republicans and Democrats fight for control of the chamber next year. The top fundraiser in the Democratic primary, former state Sen. Mike Johnston, raised $1.6 million in the second quarter — more than Hickenlooper did as a presidential candidate. — CNBC's Kevin Breuninger contributed to this reportQ: Xcode 4.3 -> SVN issue "Project has no default build configuration" When I check out the code on Xcode 4.3, it gives an error - Project has no default build configuration. It works on previous Xcode versions though. Can anyone help me in figuring this out? https://devforums.apple.com/message/629197#629197 I am unable to use Xcode 4.3 now and I have updated my iPhone to 5.1 In order to test app on my phone I need to fix this Xcode issue. Can someone help me in figuring this out? A: Looks like Xcode 4.3 requires that your "defaultConfigurationName" must be something defined in the "XCBuildConfiguration" section. Open your project.pbxproj in a text editor like emacs / textmate. Search for "XCBuildConfiguration" and note the build configurations defined in that section (usually Debug, Release and Distribution, depending on the configurations you defined for your project). Now search all instances of "defaultConfigurationName" - it's likely that this is set to a configuration that does NOT exist in your XCBuildConfiguration section. Change the value(s) so that it matches one of the configurations specified in XCBuildConfiguration (in my case, I just changed from "Release" to "Debug", which should probably work in your case as well because most projects have at least a "Debug" configuration defined) You should then be able to open your project in XCode 4.3 THE FAST BOWLING LAYOVER The long walk back to happiness Rob Johnston Share Tweet A year on from a career-saving operation to treat a fifth stress fracture of the back, Reece Topley is poised for a remarkable comeback. ©Cricbuzz Reece Topley is speaking with more raw honesty than he has in any of our previous conversations. It is early January, five months after career-defining surgery on his back. At this point, he doesn't know whether things will work out. He has no county contract and hasn't bowled a ball for six months. He doesn't yet know whether he will ever get back onto a cricket field. We have met multiple times since that operation, spoken on the phone, exchanged numerous messages. We would talk regularly over the next six months, too. But today, it is noticeable that Topley is displaying more vulnerability than he has before about the doubts and anxiety that a succession of stress fractures have caused him. "I felt irrelevant to everything," he says, sitting at a table in a Costa coffee shop in Colchester, finishing a bowl of porridge and some fruit. "After surgery I couldn't do anything. I felt I was no good to anyone. So, I was like, do you know what, nobody is telling me I have to do this. You can be happy with cricket in your life, you can be happy without it. There's no blueprint for being content." Topley's thoughts of giving the game up were not new. The England fast bowler has considered it more times than he cares to remember after an appalling run of injuries which has included five absences with stress fractures of the back in the last six years. The latest occurred last summer, in July, and necessitated surgery. He's only 25. Stress fractures are like kryptonite for bowlers: debilitating and searingly painful. There is no guarantee they will be the same player after one. One stress fracture in a career is bad enough. Two, unfortunate. But five? Unheard of. In numerous interviews and exchanges over the past 12 months, it has been clear that although the former Essex and Hampshire man has never really wanted to give cricket away, he has come to terms with doing so. Topley views himself as an optimistic person but after this run of bad luck, it is little wonder he has considered whether it is all worthwhile. A crucial period of his career has been taken away. In 2015, he broke into England's one-day and T20 teams, doing enough in his limited opportunities to prove he could mix it at the top level. Tall, left-arm and able to generate good pace, there were high hopes Topley would be a mainstay of England's white-ball revolution. If things had been different, he might have been a World Cup winner. Instead, he's on another comeback road. Physically, the last six years have been filled with days living in constant pain. For most of that time, he would spend 40 minutes in the gym just to get his body ready to train. Daily hormone injections became the norm along with anesthetic jabs every month. If he had a beer, he would be in total agony the next day. Two or three days before a game, he would get anxiety, a nervousness about the pain he might have to endure. It didn't always come. But very often, it did. "It was almost like being under house arrest," is how he described it, sitting in a London bar a few weeks after the 30th July operation, in our first face-to-face meeting. "I was trapped. Everyone else was playing cricket and enjoying it and I was simply trying to be in a place I was comfortable. Pain free. "I thought that was incredibly unfair. I thought, 'Is it worth it?' It got to the point where I thought I would rather be sitting at a desk, doing a normal job rather than going through this every day." ***** "Mate, today is a bad day." Topley is glad he said those words to England Lions physio, Ben Langley, before taking the field against India 'A' at the Oval last July. It was the final of a tri-series and Topley was going into the game having just recorded his best-ever List A figures of 4 for 16, against West Indies 'A' a few days earlier. Yet Topley knew, as he has known many, many times over, this game, on this day, would be a battle. The reason he's glad of that interaction with Langley is because, in his own words, he bowled "a shower of shit". Four overs for 33 runs. The pain was so bad every time he got to his delivery stride that any thought of where the ball would end up was irrelevant. This was not the kind of ache that all bowlers manage. This was
[ 13, 35362, 13, 34205, 1253, 1549, 187, 187, 395, 789, 12036, 13, 26771, 13, 31242, 1253, 26, 13, 33723, 187, 187, 395, 29452, 1204, 795, 2887, 64, 29452, 382, 4866, 187, 187, 64, 2887, 671, 64, 8170, 7039, 273, 15562, 456, 11563, 28, 34140, 13, 253, 28, 1986, 2077, 273, 3968, 795, 395, 2173, 3872, 1005, 64, 187, 187, 27341, 84, 577, 187, 187, 7878, 795, 2887, 762, 64, 1986, 2077, 187, 187, 12784, 304, 9231, 281, 5106, 36829, 1253, 26, 187, 187, 47, 23248, 8410, 273, 3349, 1253, 26, 187, 187, 47, 23248, 385, 49022, 273, 1384, 1253, 18, 13, 6931, 1253, 1449, 13, 5571, 13, 11102, 1253, 19, 187, 187, 709, 4079, 265, 313, 81, 2663, 274, 10, 30805, 13, 31133, 187, 187, 4037, 51, 5214, 6171, 23540, 187, 187, 64, 2887, 671, 64, 32863, 13, 40115, 757, 795, 395, 64, 19701, 11563, 28, 9556, 399, 3724, 187, 187, 8, 47212, 13, 253, 8, 795, 2887, 64, 2448, 23106, 9556, 30313, 7039, 187, 187, 43, 38605, 13, 9545, 66, 28875, 1253, 25, 187, 187, 27302, 85, 13, 14861, 29716, 187, 187, 43, 962, 276, 6169, 13, 6181, 27, 7379, 51, 5214, 19036, 12169, 15410, 13, 15470, 13, 11858, 13, 20105, 187, 187, 43, 3938, 398, 13, 6176, 27, 48477, 25891, 2986, 21807, 187, 187, 40917, 1906, 661, 11130, 187, 187, 44, 515, 293, 9963, 13, 27880, 13, 34360, 187, 187, 47027, 1362, 16015, 36103, 313, 38765, 10, 11266, 187, 187, 44, 1952, 1592, 272, 4719, 2986, 5325, 13, 10508, 1253, 26, 13, 26675, 1253, 21, 187, 187, 29456, 328, 284, 795, 2887, 64, 611, 729, 2369, 187, 187, 44, 1796, 13, 6911, 32835, 13, 29716, 187, 187, 44, 2187, 257, 13, 6176, 27, 25891, 2986, 11003, 1253, 26, 187, 187, 45395, 266, 13, 6086, 401, 15, 32515, 187, 187, 29777, 1710, 27812, 13, 10257, 187, 187, 45395, 6368, 13, 2516, 401, 15, 37737, 187, 187, 9499, 37889, 13, 2516, 2552, 79, 472, 898, 13, 4567, 13, 19593, 187, 187, 44, 6285, 2345, 45627, 13, 17250, 5741, 27587, 187, 187, 44, 928, 13, 6176, 27146, 13, 29503, 187, 187, 44, 928, 336, 13, 16795, 27, 36103, 273, 11563, 313, 43970, 10, 23540, 13, 38162, 187, 187, 44, 850, 36470, 13, 16543, 16493, 1253, 19, 187, 187, 44, 28017, 13, 17111, 1458, 13, 1668, 13, 3285, 13, 9330, 13, 17181, 13, 25653, 13, 35312, 187, 187, 21958, 13, 23302, 32560, 34128, 13, 36076, 187, 187, 44, 261, 15701, 7876, 20729, 32518, 13, 38005, 2072, 1052, 187, 187, 44381, 666, 1216, 13, 46005, 24958, 12197, 1253, 20, 13, 12131, 13, 9199, 13, 26771, 13, 35100, 1253, 25, 13, 34205, 187, 187, 44, 282, 2188, 860, 13, 47246, 32193, 1253, 24, 13, 31242, 13, 33152, 1253, 1166, 13, 28325, 187, 187, 44381, 7337, 2102, 398, 23407, 71, 13, 6176, 27, 2151, 434, 9145, 30581, 187, 187, 44, 2381, 49854, 13, 12294, 296, 13, 3918, 273, 6176, 27744, 187, 187, 44, 251, 19249, 1507, 13, 714, 1173, 864, 28121, 187, 187, 44, 16937, 790, 5985, 13, 39001, 24519, 1253, 26, 13, 38939, 187, 187, 44, 37173, 3660, 38316, 13, 24877, 187, 187, 44, 263, 6481, 13, 5794, 66, 9963, 1253, 26, 13, 27880, 13, 34360, 187, 187, 44, 729, 2369, 313, 29456, 328, 284, 582, 40115, 571, 27, 11563, 9161, 13, 10694, 1253, 2313, 13, 12660, 13, 26675, 1253, 21, 187, 187, 44, 579, 16559, 13, 19120, 6002, 284, 36153, 187, 187, 44, 335, 23268, 13, 36362, 27, 795, 48705, 5201, 26380, 275, 3060, 64, 2456, 13, 8978, 187, 187, 21663, 454, 7021, 13, 4782, 11343, 1253, 1036, 187, 187, 64, 2887, 671, 64, 5706, 14906, 13, 39159, 16, 6601, 14906, 2208, 187, 187, 47529, 30898, 13, 16617, 1715, 3436, 187, 187, 7647, 35854, 571, 13, 33813, 410, 48620, 388, 15, 8319, 13, 8026, 187, 187, 11814, 27648, 1253, 24, 187, 187, 284, 9966, 14, 13425, 273, 7379, 51, 5214, 19956, 13, 26472, 1253, 25, 13, 30135, 13, 32858, 1253, 19, 13, 31950, 187, 187, 395, 2739, 8891, 275, 3060, 28485, 1253, 21, 187, 187, 395, 30739, 10629, 8420, 26249, 13, 26780, 13, 20504, 187, 187, 968, 808, 84, 25891, 19509, 28020, 1253, 21, 13, 28131, 1253, 24, 187, 187, 395, 16286, 20504, 13, 28131, 1253, 24, 187, 187, 395, 1234, 26628, 318, 273, 19701, 399, 3724, 27518, 1253, 26, 187, 187, 24731, 8592, 13, 444, 34633, 39474, 187, 187, 45, 2287, 4978, 13, 6176, 27, 25891, 2986, 12036, 13, 24232, 1253, 3593, 13, 23512, 13, 25305, 13, 22121, 13, 33790, 13, 35100, 13, 31184, 187, 187, 64, 24731, 9875, 846, 253, 15764, 64, 313, 18405, 10, 25911, 187, 187, 45, 1351, 13, 15948, 2071, 739, 31605, 187, 187, 45, 1945, 74, 13, 29271, 5345, 1253, 25, 13, 6931, 13, 7584, 187, 187, 23080, 87, 757, 399, 3724, 187, 187, 395, 2806, 2791, 22121, 1253, 18, 187, 187, 23485, 29123, 32855, 187, 187, 23485, 2675, 1495, 27360, 1253, 23, 187, 187, 395, 8410, 275, 9643, 33141, 1253, 2405, 13, 38794, 187, 187, 27341, 84, 24833, 187, 187, 25736, 15555, 854, 13, 31507, 187, 187, 79, 2244, 265, 23917, 1253, 1036, 187, 187, 250, 44001, 318, 273, 11130, 187, 187, 373, 3592, 1338, 275, 6976, 33956, 187, 187, 373, 3592, 1338, 275, 6144, 34128, 13, 33624, 13, 34509, 1253, 1449, 187, 187, 373, 3592, 1338, 275, 5106, 38516, 13, 31118, 1253, 20, 187, 187, 64, 2887, 671, 64, 48477, 399, 3724, 187, 187, 23080, 87, 757, 36200, 28458, 187, 187, 45, 44750, 13, 17467, 21669, 13, 21807, 1253, 24, 187, 187, 45, 580, 13456, 13, 41848, 262, 12446, 187, 187, 45, 25151, 316, 13, 25975, 27, 686, 510, 1457, 2065, 1730, 316, 8, 36768, 1253, 25, 187, 187, 43174, 273, 14726, 4791, 1253, 23, 13, 2456, 13, 8676, 13, 27332, 13, 30805, 13, 22146, 13, 26402, 187, 187, 45, 2275, 264, 13, 2752, 76, 6836, 25653, 187, 187, 45, 2275, 561, 6448, 13521, 31389, 13, 29117, 13, 31004, 13, 33705, 1253, 746, 187, 187, 18596, 44775, 13, 9011, 26485, 26771, 187, 187, 4015, 38373, 13, 47320, 14821, 187, 187, 4015, 38373, 13, 30806, 187, 187, 11814, 8319, 13, 33274, 187, 187, 284, 9966, 14, 13425, 273, 7379, 51, 5214, 5540, 13, 7543, 13, 8319, 13, 7288, 13, 8026, 13, 9135, 13, 8978, 13, 26402, 187, 187, 395, 2739, 8891, 28485, 13, 30135, 187, 187, 251, 22346, 6169, 3733, 9145, 21886, 187, 187, 395, 9857, 14821, 1253, 24, 13, 21982, 187, 187, 395, 3480, 273, 7379, 51, 5214, 8362, 19092, 13, 21982, 13, 21579, 13, 26249, 187, 187, 395, 3905, 35854, 571, 26472, 187, 187, 373, 525, 318, 19956, 187, 187, 284, 18718, 36508, 13, 38316, 187, 187, 4015, 47265, 11487, 13, 12842, 187, 187, 4015, 334, 14, 44018, 13, 9011, 26485, 4567, 187, 187, 348, 3514, 29123, 327, 1501, 7523, 6095, 4567, 13, 5922, 13, 5910, 13, 5345, 13, 7543, 13, 7584, 1253, 1235, 13, 8319, 187, 187, 5309, 968, 7379, 51, 5214, 7288, 13, 8988, 13, 17181, 13, 26402, 187, 187, 25533, 2184, 13, 6176, 27, 686, 10859, 18585, 427, 459, 2480, 72, 8, 27146, 187, 187, 45, 2980, 4614, 17181, 187, 187, 1466, 328, 13, 411, 3525, 1052, 187, 187, 4015, 735, 251, 13, 14884, 14034, 187, 187, 35438, 74, 13, 14140, 80, 11422, 187, 187, 35438, 460, 13, 6911, 26397, 1253, 26, 187, 187, 28625, 13, 15358, 72, 306, 38801, 187, 187, 64, 14660, 64, 11338, 31605, 1253, 26, 187, 187, 45029, 4978, 73, 13, 8444, 23412, 13, 32002, 187, 187, 45, 272, 13, 20575, 47126, 5096, 187, 187, 45, 334, 9041, 757, 399, 3724, 33624, 187, 187, 11958, 2791, 70, 398, 22121, 1253, 18, 187, 187, 13863, 31507, 187, 187, 4175, 25832, 35893, 27360, 187, 187, 25736, 15555, 31507, 13, 32526, 187, 187, 5367, 5704, 25911, 13, 26711, 1253, 18, 187, 187, 395, 1234, 26628, 318, 11130, 187, 187, 373, 3592, 1338, 275, 6144, 34509, 13, 38794, 187, 187, 373, 3592, 1338, 275, 5106, 23412, 13, 27744, 187, 187, 64, 2887, 671, 64, 48477, 399, 3724, 28, 40115, 757, 11563, 187, 187, 45, 334, 9041, 757, 11563, 5325, 1253, 2313, 13, 12446, 13, 24833, 13, 12660, 13, 26675, 1253, 21, 13, 31938, 28, 795, 2887, 671, 64, 1997, 37722, 13, 3196, 1503, 267, 1342, 187, 187, 8, 32401, 87, 8765, 8, 9161, 13, 13278, 187, 187, 32401, 8498, 729, 13, 47635, 5693, 13, 7584, 187, 187, 49387, 307, 34089, 13, 743, 255, 311, 1944, 1722, 187, 187, 49256, 15860, 6086, 13, 5119, 11601, 187, 187, 64, 30580, 9757, 7717, 64, 38516, 187, 187, 45, 4977, 303, 13, 23519, 442, 31399, 1253, 26, 187, 187, 45, 3090, 28298, 13, 6176, 11084, 13, 22121, 1253, 18, 13, 27360, 13, 38614, 187, 187, 45, 34610, 466, 50076, 13, 7252, 1052, 187, 187, 45, 6977, 13, 42319, 40905, 5091, 187, 187, 22434, 74, 2788, 13, 40403, 4182, 83, 27744, 187, 187, 45, 2310, 358, 32620, 8026, 13, 28528, 13, 26033, 187, 187, 45, 87, 729, 13, 16795, 11107, 13, 28121, 13, 18881, 13, 29117, 187, 187, 13815, 472, 282, 13, 40103, 29044, 187, 187, 64, 22246, 273, 3060, 64, 31619, 187, 187, 41378, 3298, 266, 13, 2790, 36508, 1253, 26, 187, 187, 11773, 16501, 1771, 13, 4214, 7727, 11681, 187, 187, 11773, 7559, 24814, 13, 6393, 20577, 7288, 13, 26402, 1253, 23, 187, 187, 13815, 17993, 266, 13, 29271, 14821, 187, 187, 11773, 21173, 257, 13, 21508, 66, 330, 15, 21786, 187, 187, 11773, 41437, 13, 20145, 818, 13, 9330, 13, 11614, 13, 30761, 187, 187, 64, 3463, 253, 28160, 273, 37125, 64, 818, 1253, 25, 187, 187, 16490, 1886, 90, 13, 27443, 5922, 1253, 21, 187, 187, 46, 1432, 69, 1351, 76, 2471, 2986, 5571, 187, 187, 64, 46, 16071, 22901, 64, 22769, 13, 35453, 187, 187, 46, 1164, 29384, 13, 7728, 8, 1173, 884, 13, 13278, 1253, 26, 13, 28195, 187, 187, 31900, 864, 7381, 13, 27443, 27623, 187, 187, 46, 3298, 316, 13, 6277, 32575, 13, 24877, 187, 187, 46, 44565, 13, 4214, 6086, 330, 15, 7609, 13, 27318, 13, 25905, 13, 34506, 187, 187, 46, 44565, 9224, 608, 13, 25905, 1253, 23, 13, 26033, 13, 37728, 187, 187, 35147, 552, 76, 13, 3344, 7584, 187, 187, 23067, 292, 13, 9309, 265, 23541, 13, 21748, 13, 23504, 13, 18672, 13, 24727, 13, 23670, 13, 29754, 1253, 19, 13, 5922, 187, 187, 35147, 5462, 13, 26456, 34128, 187, 187, 46, 3144, 319, 13, 14272, 500, 15, 28485, 187, 187, 46, 14399, 666, 257, 4719, 2986, 5571, 187, 187, 5072, 777, 5025, 6121, 12842, 187, 187, 46, 1441, 284, 13, 743, 505, 284, 26711, 187, 187, 46, 1441, 284, 13, 10354, 284, 25911, 13, 26711, 1253, 18, 187, 187, 64, 2618, 21767, 84, 64, 34958, 187, 187, 23021, 5134, 76, 13, 1244, 363, 90, 28121, 1253, 938, 187, 187, 48658, 398, 348, 16855, 3285, 13, 10508, 187, 187, 32486, 5791, 40429, 12169, 14821, 187, 187, 46, 20592, 7679, 1432, 68, 44109, 13, 10908, 261, 7679, 1403, 24519, 13, 38939, 187, 187, 20643, 13511, 17131, 280, 13, 399, 3627, 7469, 1253, 18, 187, 187, 20643, 13511, 17131, 280, 13, 3774, 300, 75, 3230, 7469, 1253, 18, 187, 187, 46, 1763, 13, 17539, 552, 30092, 187, 187, 46, 3770, 13, 500, 2651, 35362, 187, 187, 46, 311, 302, 729, 13, 657, 90, 3844, 19306, 353, 15, 19092, 187, 187, 46, 311, 302, 729, 1253, 51, 487, 43409, 1658, 47448, 313, 42093, 10, 11614, 13, 11266, 187, 187, 9304, 3024, 13, 13089, 7584, 187, 187, 28211, 25256, 13, 7327, 36923, 22547, 11583, 13, 14114, 13, 19092, 13, 20995, 13, 21300, 13, 21603, 187, 187, 15155, 410, 2522, 13, 17560, 9901, 1253, 19, 13, 9654, 187, 187, 46, 7397, 13, 34146, 4214, 9011, 26485, 20825, 1253, 1235, 187, 187, 11924, 14, 18581, 31367, 22287, 1253, 3832, 13, 26771, 13, 23540, 1253, 23, 187, 187, 1595, 3396, 281, 399, 3724, 21300, 13, 12036, 13, 21043, 1253, 25, 13, 32193, 187, 187, 251, 2806, 2791, 29226, 187, 187, 395, 8347, 14736, 13521, 29117, 13, 33152, 187, 187, 395, 20754, 3660, 28020, 13, 27812, 1253, 22, 13, 27332, 187, 187, 37106, 267, 432, 7379, 51, 5214, 27332, 187, 187, 45922, 67, 1641, 285, 12748, 21603, 1253, 23, 187, 187, 395, 5343, 4750, 21807, 1253, 24, 13, 29117, 187, 187, 395, 1997, 37722, 26397, 187, 187, 395, 30739, 10629, 8420, 26780, 1253, 1229, 13, 28020, 187, 187, 395, 3905, 35854 ]
, 352, 359–60 and work 160, 194, 278–9, 296 and Zionism _see_ Zionist movement _see also_ Central Committee of Liberated Jews; Holocaust, the; United States of America _and specific nationalities_ Jews 4 American _see under_ United States immigrants to USA 368–9 Nazi employment of 28–9 Nazi extermination of 20–1, 39–40, 70, 71–2 refugees (prewar) 259, 327 UNRRA employees 235 _see also_ Hungarian, Lithuanian _and_ Polish Jews; Jewish DPs 'Joint, the' _see_ American Joint Jewish Distribution Committee Jorden, Ella 247–8 Judt, Tony 403 Jullouville, France: UNRRA Training Centre 138, 139, 140, 175 Junkers, Germany: Baltic DP camp 156 Kalmuks 84 Kassel 67, 267, 283 Katyn Forest massacre (1940) 92 Kaufering concentration camp 95, 98–9, 293–4 Kaunas _see_ Kovno Kee, Robert 402, 403 Kempten, Germany: DP camp 88–9 Kennan, George F. 263 telegram 234, 250 Kennedy, John F. 397 Keynes, John Maynard 9, 32, 131 Khrushchev, Nikita 221 Kiel, Germany 244, 249 Kielce, Poland: massacre of Jews (1946) 235, 383 Kientopf, Anna 121–2 Kiev, Ukraine 15, 16, 29, 85, 129, 222, 386 King, Mackenzie 336, 341 Kisztelińska, Marianna 200 Klausner, Rabbi Abraham 102–3, 104, 110, 194, 347–8, 359 Klemmé, Marvin 276–7, 278, 316–17, 325 Kloster Indersdorf, Germany: children's centre 312 Köhler, Horst, President of Germany 409 Konovalets, Yevhen 219 Korbonski, Stefan 208–9, 392 Korean War 378, 401 Korwin, Marta 67–9, 267, 283 Kovno (Kaunas), Lithuania: Jews 96, 97–100, 180, 293–4 Krucas, Juozas 342 Kulischer, Eugene: _Population Displacement in Europe_ 50, 59 Labour Party, British 115–16 _see also_ Attlee, Clement/Attlee government Lagrou, Pieter 26 LaGuardia, Fiorello H. 51, 56 background 226–7 as Director-General of UNRRA 225, 227–8, 253, 261–2, 306 and food crisis in Europe 252–4 and Hirschmann 228, 229, 230 inspects DP camps 233–4, 236–7 and Morgan 230, 236–7 and repatriation of Polish DPs 238–9 Landerman, Ethel 393 Landsberg, Germany: DP camp 160, 177–81, 185, 188, 280, 281, 347, 384 _Landscape after the Battle_ (film) 288 Lane, Arthur Bliss 258 Laski, Harold 37–8, 39, 49 Latvian DPs and black market 280–1 camp committees 271 camp social life 285–6 and employment in Britain 328–31, 391 Jews 178 national pride 8, 284 nurses 215–16 repatriation of 84 resettlement in Australia 390 resettlement in Canada 336, 337, 339–40 resettlement in USA 376, 380–3 _see also_ Baltic DPs Latvian Legion 375 Laughlin, Anne 142, 156–7 Lavsky, Hagit 105 Lazarus, Emma: 'The New Colossus' 367–8 League of Nations 35–6, 50, 53, 237, 259, 260, 305 Lebed, Mykola 222 Lebensborn programme 313, 315, 317, 318–19 Leggett, Sir Frederick 194 Lehman, Edith 136 Lehman, Herbert background 51, 366 as Director-General of UNRRA 36, 47, 51, 55, 56, 58, 59, 305 and food crisis 252, 253 on Granville training centre 141 and Jackson 136–7, 151 and lack of UNRRA funding 145, 151, 153, 228 and LaGuardia 227 resignation 225 as Senator 377, 378 Leipzig 82, 128 Leith-Ross, Sir Frederick 32 chairs committees on postwar requirements 32, 33, 34, 37, 47, 49–50, 51 joins UNRRA 55, 57, 129, 305 Lemgo, Germany: 'Schloss Nuremberg' 244 Leningrad 129 Letun, Wera 200 Leverson, Jane 107 Levi, Primo 87 Levine, Robert 198–9 Lie, Trygve 399 _Life_ magazine 258–9 Lindbergh, Charles 365, 370 Ling, Colonel Walton 80 Lithuanian DPs 337 black marketeers 280–1 children 284 maritime academy 285 national pride 284, 286 poetry 288, 290–1 and repatriation 84 resettlement in Canada 339, 391 resettlement in USA 365, 409 _see also_ Baltic DPs; Lithuanian Jews Lithuanian Jews 95–100, 105, 178, 180, 293–4, 410; _see also_ Grinberg, Dr Zalman 'Litvaks' 96, 108 Litvinov, Maxim 48, 49 Ljutikov, Anatolij 17 Lloyd George, David 114 _Los Angeles Times_ 376 Lotheim, Lotte 298–9 Lübeck, Germany 130, 280–1, 285, 354 Lubiniecki, William 200 Luce, Clare Booth 90 Luciuk, Lubomyr 409 Luxembourg 56, 340, 355 Lvov, Poland 94, 219, 220, 315 Macardle, Dorothy 302 _Children of Europe_ 322 McCarran, Pat 377–9 McCreery, General Richard 81 McGeachy, Mary Craig 55, 305–6 Macmillan, Harold 136 McMillen, Rolla C. 152 McNeill, Margaret 7, 85, 86, 307 _By the Rivers of Babylon_ 7–8 Maisky, Ivan 33–4 Majdanek death camp 70 _Manchester Guardian_ 159, 329 Mankowitz, Ze'ev 10, 108–9, 295 Marchenko, Ivan 405 Marrus, Michael 335, 401 Marshall, General George C. 41, 264, 265, 357 Marshall Plan 5, 265–6, 355, 373 Masaryk, Jan 49 Masset, Georges 166, 168, 169, 170, 174, 176, 241–2, 33 Massey, Vincent 336 Matusow, Allen J. 252 Mauthausen concentration camp 70 Mecklenburg 128 Mekas, Anastas 290 Mekas, Jonas 288, 290–1 _Idylls_ 291 Melnyk, Andriy 219–20 Messerschmitt 29, 98 Middle East Supply Centre 136 Mikołajczyk, Stanisław 208, 392 Milojkovic, Dula 300–1 Milojkovic, Smiljana 300–1 Minc, Hilary 257 Moch, Jules 352 Molotov, Vyacheslav M. 145 Molotov–Ribbentrop pact (1939) 86, 92 Monnet, Jean 49 Montgomery, Field Marshal Bernard 91, 133, 145, 148, 149, 154 Moorehead, Alan 61–2, 63 Morgan, Lt General Sir Frederick 147–50 anti-Semitism 158–61, 194, 235–6 attitude to DPs 149, 160, 157–8, 276 on black market 279 and Child Search programme 315, 316 and Cold War 233, 234–5, 237 dismissal from UNRRA 237 doubts and difficulties 154–6 and female staff 156–7, 315 and Grinberg 198 and Hirschmann 229–30, 233 and LaGuard
[ 342, 634, 2505, 969, 13, 533, 671, 476, 5834, 2969, 16503, 368, 1537, 452, 1160, 2112, 253, 1039, 15, 4744, 4867, 404, 556, 247, 973, 14, 4304, 8310, 327, 4737, 272, 27, 187, 187, 510, 3064, 875, 253, 2761, 14, 918, 3159, 285, 253, 987, 3159, 310, 1663, 247, 1781, 2647, 15, 733, 434, 253, 3064, 875, 253, 25033, 14, 7700, 285, 253, 25033, 15, 187, 187, 510, 24746, 1039, 281, 4541, 4737, 1088, 247, 7863, 26908, 273, 247, 2505, 310, 281, 1239, 352, 562, 11216, 15, 831, 7729, 368, 5834, 15279, 285, 6015, 3000, 285, 4850, 368, 9848, 342, 849, 253, 2505, 1537, 3590, 281, 3095, 2010, 4361, 352, 15, 733, 434, 3477, 281, 564, 1066, 253, 17876, 14, 13928, 273, 14835, 432, 1060, 13, 533, 327, 634, 806, 17834, 13, 352, 1537, 320, 1682, 281, 4076, 598, 253, 3448, 285, 3237, 806, 1078, 368, 1265, 2403, 36927, 2544, 15, 1422, 1833, 320, 2509, 436, 4768, 253, 1232, 13, 594, 352, 434, 417, 247, 1943, 2968, 604, 368, 2985, 2712, 387, 806, 15, 187, 187, 34757, 187, 187, 3039, 368, 1472, 4737, 24042, 13, 1978, 247, 1618, 273, 634, 954, 1846, 16503, 327, 247, 4858, 8335, 15, 1284, 368, 8416, 13, 564, 896, 715, 634, 3159, 26967, 346, 8606, 285, 8171, 3, 1159, 285, 3186, 323, 1110, 2426, 285, 3000, 969, 15, 831, 3302, 1509, 588, 1056, 253, 14835, 1232, 6927, 13, 984, 368, 1472, 1679, 2779, 281, 294, 1601, 247, 6197, 15, 10030, 272, 745, 4867, 404, 969, 13, 767, 3000, 281, 1007, 323, 403, 346, 635, 3, 285, 346, 3529, 937, 347, 1097, 476, 2223, 320, 5176, 1293, 6890, 253, 4495, 273, 247, 6197, 15, 187, 187, 5872, 1422, 26670, 285, 3555, 885, 187, 187, 3996, 2996, 310, 253, 954, 15966, 629, 604, 368, 1472, 7378, 281, 1056, 690, 38558, 15, 733, 476, 671, 320, 253, 954, 35247, 13, 594, 1056, 2119, 368, 5321, 247, 638, 14, 49539, 3491, 1078, 368, 564, 275, 342, 253, 12798, 285, 1265, 9968, 285, 4886, 1841, 1475, 15, 844, 1833, 1379, 247, 1007, 387, 690, 14835, 5659, 275, 253, 1735, 2593, 13, 533, 323, 1024, 13, 1339, 434, 1007, 387, 247, 1643, 12192, 281, 2970, 253, 1232, 3053, 15, 187, 187, 34757, 187, 187, 4041, 273, 253, 954, 11088, 10894, 323, 14835, 309, 1849, 3735, 369, 432, 42250, 285, 11652, 15940, 49318, 1309, 247, 22077, 275, 378, 35233, 13, 13338, 15, 754, 36264, 521, 25963, 12192, 323, 14835, 247, 2926, 13, 534, 3133, 281, 18387, 1142, 273, 253, 2060, 12192, 643, 4477, 452, 6096, 27, 187, 187, 48, 2225, 512, 15279, 3000, 15, 187, 187, 52, 317, 16297, 771, 13783, 15, 187, 187, 16628, 253, 19407, 15, 187, 187, 34435, 346, 936, 320, 3, 285, 346, 936, 452, 449, 187, 187, 7657, 246, 5060, 15, 187, 187, 6104, 408, 634, 2885, 6168, 474, 15, 187, 187, 34, 4353, 512, 2562, 318, 15, 187, 187, 51, 678, 750, 38562, 15, 187, 187, 11244, 43888, 800, 3448, 49779, 314, 15, 187, 187, 8934, 486, 512, 21768, 15, 187, 187, 28512, 253, 1390, 6197, 15, 187, 187, 5703, 253, 10056, 33454, 15, 187, 187, 12501, 352, 1977, 15, 187, 187, 1785, 16388, 15, 187, 187, 3726, 1472, 417, 1892, 4803, 13, 533, 352, 434, 247, 1175, 1659, 281, 1265, 15, 2091, 368, 1472, 14835, 13, 368, 671, 971, 281, 1978, 3540, 273, 247, 1841, 751, 4812, 15274, 323, 253, 4067, 2926, 15, 831, 310, 3340, 253, 1083, 275, 19098, 14459, 13, 835, 368, 878, 281, 3698, 634, 28563, 285, 634, 2892, 15, 45762, 897, 1027, 5609, 323, 436, 13, 533, 604, 368, 452, 247, 2570, 7484, 13, 368, 1537, 1908, 247, 2969, 2900, 751, 27321, 2834, 7118, 285, 2403, 2119, 597, 3297, 5185, 342, 6973, 390, 643, 22429, 15, 32211, 36372, 8265, 307, 13, 323, 4227, 13, 908, 42590, 281, 3540, 4780, 13, 285, 8406, 285, 9558, 322, 1261, 6362, 3562, 247, 2962, 273, 5195, 6689, 1507, 281, 3540, 634, 5810, 285, 8593, 15, 6758, 10316, 441, 281, 690, 273, 253, 4088, 368, 476, 897, 5659, 281, 1361, 368, 12921, 15, 187, 187, 17664, 18589, 84, 27, 380, 1840, 5393, 2732, 253, 16631, 1282, 671, 3249, 342, 21722, 285, 26040, 18149, 604, 368, 971, 281, 755, 253, 1072, 3386, 275, 634, 5559, 18589, 84, 4028, 15, 1737, 2789, 5559, 18589, 84, 4722, 323, 14835, 3548, 626, 253, 18149, 2167, 13, 352, 434, 253, 2579, 3139, 15, 16513, 9664, 12967, 13, 835, 368, 476, 3540, 2544, 533, 417, 4354, 43004, 281, 271, 1711, 2715, 13, 5559, 18589, 84, 26866, 271, 9470, 18520, 2892, 12482, 762, 8490, 2239, 2594, 18520, 2892, 15, 1623, 253, 2553, 13, 352, 2987, 751, 12967, 434, 4735, 13, 533, 342, 253, 2879, 17301, 273, 417, 30743, 3390, 598, 634, 3148, 342, 9830, 285, 762, 8737, 15, 1310, 368, 1472, 14835, 13, 436, 310, 581, 273, 253, 1682, 4088, 281, 7277, 747, 285, 1711, 9508, 273, 247, 2505, 15, 1310, 368, 1053, 626, 18612, 5559, 18589, 84, 13, 19566, 4697, 310, 1529, 1959, 4384, 1212, 285, 14935, 368, 5321, 2709, 9508, 285, 49620, 13, 7277, 13, 285, 3894, 15, 187, 187, 9770, 28047, 27, 1310, 368, 971, 1529, 1859, 13, 368, 476, 1408, 634, 7714, 949, 247, 28146, 3948, 281, 5834, 253, 16503, 3159, 26967, 2985, 15, 2101, 437, 9063, 25263, 476, 2736, 247, 1180, 273, 28146, 6332, 13, 1690, 3500, 864, 318, 285, 29341, 15, 12526, 13, 253, 1959, 2715, 310, 3710, 281, 374, 13, 933, 3000, 13, 342, 253, 354, 2715, 3551, 275, 387, 370, 1010, 16, 2913, 15, 21897, 51, 727, 310, 247, 2074, 4968, 342, 247, 3159, 2701, 13, 533, 1057, 247, 1175, 2628, 273, 23862, 502, 469, 5069, 285, 29341, 2544, 15, 17252, 33611, 3619, 2996, 45076, 6131, 581, 273, 253, 954, 11088, 12255, 13, 533, 4815, 370, 2357, 14595, 12231, 323, 247, 807, 434, 2289, 15, 187, 187, 8665, 388, 7305, 27, 1310, 368, 1472, 4092, 670, 253, 17404, 1232, 13, 368, 1537, 1908, 6153, 247, 581, 14, 2364, 15487, 342, 760, 247, 11352, 13175, 13, 594, 368, 476, 21364, 327, 9968, 1066, 634, 2926, 15, 1422, 476, 671, 8132, 598, 634, 9485, 434, 2505, 14, 936, 14, 48460, 2086, 281, 1239, 634, 2926, 281, 368, 275, 247, 28465, 264, 13, 35121, 10541, 13, 534, 1537, 1361, 368, 2619, 598, 327, 19328, 14683, 390, 17257, 4648, 15, 187, 187, 6080, 13536, 547, 432, 253, 33523, 187, 187, 23631, 556, 281, 12921, 13, 285, 4477, 452, 5604, 24398, 275, 327, 849, 597, 513, 352, 15, 3856, 403, 247, 1643, 12192, 432, 253, 1755, 15, 187, 187, 4509, 12167, 4377, 434, 1984, 1623, 24207, 27, 187, 187, 688, 253, 7203, 273, 619, 8474, 807, 387, 48104, 4855, 14, 28355, 13, 436, 651, 1849, 644, 14, 42, 1694, 247, 43010, 11046, 4385, 326, 4391, 253, 1039, 309, 294, 48141, 619, 14459, 2378, 285, 11654, 15, 500, 7655, 2708, 253, 5145, 14, 20419, 11118, 273, 253, 8121, 369, 436, 1733, 27, 2802, 3650, 3076, 13, 533, 16315, 3269, 58, 15, 1422, 878, 281, 49620, 323, 2978, 15, 26658, 27, 374, 2109, 28701, 426, 337, 296, 28701, 1108, 884, 7739, 7088, 7516, 15, 187, 187, 31853, 23972, 1615, 13, 10009, 6151, 342, 253, 9968, 1232, 247, 2372, 275, 3130, 656, 21767, 357, 280, 2101, 658, 27, 187, 187, 1898, 627, 434, 690, 5017, 670, 253, 2644, 3330, 2666, 272, 1232, 309, 816, 1053, 626, 755, 15, 6049, 1057, 352, 1900, 3523, 672, 253, 789, 275, 1953, 556, 644, 3777, 281, 21116, 390, 28089, 8014, 3000, 1128, 290, 603, 314, 10891, 37536, 13, 309, 1353, 2119, 13, 253, 5927, 2978, 323, 247, 15452, 494, 4460, 32, 309, 1353, 2119, 368, 812, 755, 352, 1066, 281, 6818, 390, 10488, 604, 368, 3597, 1892, 2217, 15, 496, 958, 13, 2139, 3523, 387, 6818, 390, 10488, 32, 6049, 3630, 387, 512, 32, 6049, 417, 816, 42845, 253, 7484, 285, 247, 4564, 273, 16876, 1066, 327, 253, 896, 273, 271, 17329, 285, 3553, 352, 387, 326, 32, 380, 5083, 310, 13, 627, 434, 2717, 1077, 4981, 14621, 670, 14459, 390, 697, 8869, 13, 285, 309, 9101, 326, 952, 403, 18439, 281, 1056, 352, 3590, 637, 314, 13, 896, 22071, 5299, 984, 352, 434, 824, 247, 259, 25646, 2181, 281, 513, 275, 253, 806, 1659, 15, 380, 37238, 342, 247, 48033, 310, 271, 3177, 281, 23514, 13, 281, 1056, 4028, 28788, 247, 1524, 2628, 13, 751, 23420, 13, 390, 20893, 15, 313, 1147, 434, 671, 2139, 952, 665, 789, 275, 12089, 1691, 275, 6818, 14, 11964, 1897, 2698, 3617, 327, 13, 2872, 11597, 1128, 38441, 4834, 281, 247, 16391, 13, 390, 271, 519, 25340, 2, 2101, 25746, 4834, 2, 6707, 398, 1912, 626, 2564, 1476, 187, 187, 4527, 2282, 13, 368, 476, 1900, 3343, 323, 3313, 34349, 3619, 2996, 24909, 604, 368, 878, 1529, 7450, 390, 368, 971, 281, 1918, 352, 247, 1652, 673, 15, 10348, 368, 1056, 253, 4736, 32, 7395, 368, 320, 14835, 3517, 32, 20930, 634, 6281, 285, 12192, 275, 253, 5701, 15, 187, 1812, 329, 15, 20, 69, 721, 4529, 313, 6755, 10, 187, 20914, 27301, 15, 898, 1671, 187, 51, 6934, 328, 330, 15, 500, 1139, 1410, 187, 87, 15, 187, 31264, 16808, 2449, 947, 3481, 27196, 1848, 8286, 15, 187, 3650, 275, 2603, 15, 187, 31177, 2111, 273, 20973, 15, 187, 34038, 5080, 495, 13, 4050, 15, 187, 6300, 460, 401, 15, 11418, 13, 7922, 5067, 13, 275, 1329, 273, 253, 5266, 15, 187, 23021, 14302, 418, 15, 5720, 80, 13, 13372, 1375, 434, 6834, 13, 275, 10266, 15, 187, 510, 11810, 416, 6934, 328, 330, 15, 8302, 8, 5266, 323, 21612, 323, 4549, 432, 253, 33682, 2111, 13, 13718, 27301, 15, 2946, 15, 898, 2922, 13, 4562, 329, 15, 20, 69, 7346, 19, 313, 7330, 582, 310, 5868, 15, 187, 8, 2327, 7654, 5618, 187, 187, 3474, 551, 187, 50274, 8906, 27, 551, 2451, 2548, 748, 187, 94, 426, 2430, 2073, 4598, 6443, 5137, 187, 187, 3474, 2101, 266, 8053, 8932, 426, 2430, 36430, 2551, 14, 7267, 14, 4793, 5137, 187, 187, 6930, 187, 475, 6235, 11625, 10129, 534, 14787, 342, 1529, 13905, 7316, 15, 380, 13905, 417, 7316, 187, 475, 8115, 281, 10467, 1751, 2634, 18821, 3650, 8053, 16433, 187, 475, 187, 475, 544, 8677, 3258, 8716, 3806, 880, 3614, 1358, 2700, 15, 25563, 15, 1940, 16, 22433, 16, 257, 16, 25563, 8716, 16, 14005, 16, 6259, 16, 7267, 14, 1397, 77, 14, 2551, 14, 1439, 14, 7267, 15, 2974, 10, 187, 475, 187, 475, 1214, 11667, 187, 475, 1030, 13905, 50, 610, 426, 1578, 67, 15, 2551, 3650, 8053, 1082, 187, 475, 50273, 15, 3709, 9, 265, 67, 15, 2551, 18919, 8053, 2073, 3423, 18, 1383, 686, 73, 28682, 19279, 187, 475, 50273, 15, 49309, 9, 265, 67, 15, 2551, 44982, 8053, 1082, 187, 475, 50269, 15, 498, 19726, 8850, 187, 475, 50265, 265, 67, 15, 2551, 18919, 8053, 2073, 3423, 18, 1383, 686, 4123, 11470, 187, 475, 50265, 265, 67, 15, 2551, 18919, 8053, 2073, 3423, 18, 1383, 686, 73, 28682, 3401, 187, 475, 50269, 3291, 187, 475, 50269, 15, 3433, 412, 9, 17, 10, 187, 475, 50269, 15, 249, 13921, 9, 5672, 4027, 187, 475, 187, 475, 1214, 2068, 1727, 2101, 266, 8053, 8932, 187, 1738, 187, 2437, 2101, 266, 3650, 8053, 8725, 2101, 266, 8053, 8932, 551, 187, 50274, 605, 1578, 41857, 14, 25902, 14, 8384, 14, 1282, 2430, 14, 4305, 7152, 187, 50274, 36073, 1082, 551, 187, 50270, 12185, 2073, 2551, 64, 1439, 5137, 187, 50274, 94, 535, 50274, 6930, 187, 50273, 11, 34730, 253, 2634, 3709, 65, 13604, 534, 310, 253, 13905, 7316, 3692, 10129, 403, 18748, 187, 50273, 11, 187, 50273, 11, 1214, 3575, 551, 18821, 8053, 8932, 94, 13905, 50, 610, 187, 50273, 11, 1214, 20974, 551, 18821, 3650, 8053, 94, 6548, 2634, 2520, 65, 594, 326, 5841, 476, 320, 448, 1243, 15, 187, 50273, 8480, 187, 50274, 3709, 9, 2551, 50, 610, 10, 551, 187, 50270, 5903, 2548, 9, 2551, 50, 610, 13, 2101, 266, 8053, 8932, 558, 535, 50270, 2520, 3333, 7267, 13967, 84, 15, 3709, 426, 13905, 50, 610, 28, 187, 50270, 2309, 436, 28, 187, 50274, 94, 535, 50274, 6930, 187, 50273, 11, 34730, 253, 2634, 49309, 65, 13604, 534, 310, 253, 13905, 7316, 3692, 10129, 1364, 187, 50273, 11, 417, 14787, 1110, 4895, 15, 187, 50273, 11, 187, 50273, 11, 1214, 3575, 551, 18821, 8053 ]
with your text again, but also can catch simple mistakes you might have made along the way. Mark Twain has a well-known observation on proofing: The difference between the almost-right word and the right word is really a large matter. It's the difference between the lightning-bug and the lightning. The easiest way to quickly proofread a massive tomb of a text is to read it out loud. This helps you catch unnecessary and repeated words and gets you comfortable with how the text might sound to someone else reading it. It's easy to go down the rabbit-hole of editing from here, but on your first glance, it might be best to clean up the language and problems first before you start making drastic changes. You'll be doing this throughout the process, so it's not a big deal if you miss anything at first. Advertisement When you're proofreading, keep a list of your most common mistakes on a separate sheet. As you finish, go back into your word processors "find and replace" function and search for those terms and words again. This initial pass will make the editing process easier, because you're less likely to rework a sentence. Keying off Twain again, two words to look for are "very" and "that," as both can often be removed without changing the meaning of a sentence. Then You Edit and Revise Editing is the most engaging part if you're willing to make some sacrifices. It can also be the most terrifying, so make sure you save a pre-edited copy before you go in with the knife and start cutting and moving things around. We'll take a look at some editing programs in the next section, but for now, let's look at a few tips to getting the process started. Advertisement One of the most comprehensive lists for editing I've heard was from novelist and professor Rick Moody during a lecture in Boulder, Colorado. He outlines his fourteen tips for editing a story, which seems to encompass many of the individual tips other authors have shared: Omit all unnecessary words. Sacrifice modifiers. Consider the rhythm. Replace "to be" and "to have." Simplify tenses. Spill your parenthetical. Avoid alliteration. Rethink abstraction. Use figurative language sparingly. Engage all senses. Cut the last sentence. Read the passage aloud. Put it away. Repeat. They're not hard rules, but it's a good place to start. When you're editing, you also want to keep track of a things like internal consistency for the larger story. This is especially the case in genre fiction, where you need to watch your timeline and your history. Writers use different techniques for this, but if you have a complex plot, you might consider a simple solution like highlighting difficult sections and making sure they stay consistent with outcomes or other norms. Kurt Vonnegut, for instance, used grids to track progress, and writer and artist Svenja created a series of spreadsheets to track your characters and locations. Which brings us to some of the ways you can use programs to help you edit. Google Docs: The above mentioned After the Deadline also comes with Chrome and Firefox extensions if you want to get the same features in your Google Docs writing. What makes Google Docs interesting for editing isn't the extensions though, it's the service itself. Unlike Microsoft Word, where you can track changes but not easily revert to an old version, Google Docs saves an extensive revision history accessible under File > See revision history. On the surface, it works like Word's feature, but with the added bonus of not bogging up your display with colors and underlines. If you're editing, this is one of the best ways to compare new and old versions of a text. If you don't fancy Google Docs, Writeboard is another free webapp and lets you save multiple versions and revise, compare, and share. Webapps: If you want another view, you can run your manuscript through a grammar engine to catch the mistakes word processors miss. SpellCheckPlus can detect a number of grammar errors, including hyphenation and tense. Unfortunately, the free version is limited to 2,000 words, with the pro version coming in at $15/year. PaperRater is a similar tool with a word limit, but does a good job of catching clichés and tense changes. AutoCrit Editing Wizard offers one of the most comprehensive checks, but costs $77-$117 for a year's access. Other Hacks: If you're serious about the deletion process, you might consider creating a one-key keyboard with only a delete functionality, so you can concentrate on cutting down your story. You can also rig up your OS's text-to-speech program to read your story to you in a disjointed, robotic tone, which might help you pick up on awkward sentences or verb uses. Some Advice from the Pros Everyone has to edit, and authors have certainly weighed in on how they do it. Here are a few tips from the top. From Stephen King's book On Writing: In the spring of my senior year at Lisbon High-1966, this would've been-I got a scribbled comment that changed the way I rewrote my fiction once and forever. Jotted below the machine-generated signature of the editor was this mot: ‘Not bad, but PUFFY. You need to revise for length. Formula: 2nd Draft = 1st Draft – 10%. Good luck. Nick Hornby, disagrees with the cutting process a bit in Polysyllabic Spree: And there's some stuff about the whole winnowing process I just don't get. Why does it always stop when the work in question has been reduced to sixty or seventy thousand words—entirely coincidentally, I'm sure, the minimum length for a publishable novel? I'm sure you could get it down to twenty or thirty if you tried hard enough. In fact, why stop at twenty or thirty? Why write at all? Why not just jot the plot and a couple of themes down on the back of an envelope and leave it at that? The truth is, there's nothing very utilitarian about fiction or its creation, and I suspect that people are desperate to make it sound manly, backbreaking labor because it's such a wussy thing to do in the first place. The obsession with austerity is an attempt to compensate, to make writing resemble a real job, like farming, or logging. (It's also why people who work in advertising put in twenty-hour days.) Go on, young writers—treat yourself to a joke, or an adverb! Spoil yourself! Readers won't mind!" Of course, you can always wait for National Novel Editing Month if you need another push or you want to give it a little time. Did you make the goal? Will you be editing soon? Share your stories and tips in the comments. 36 A.3d 692 (2012) 303 Conn. 935 Roshun C. JONES v. COMMISSIONER OF CORRECTION. Not in source. Supreme Court of Connecticut. Decided February 3, 2012. Justine F. Miller, assigned counsel, in support of the petition. Melissa L. Streeto, assistant state's attorney, in opposition. The petitioner Roshun C. Jones' petition for certification for appeal from the Appellate Court, 132 Conn.App. 907, 31 A.3d 1202 (2011), is denied. 'use strict'; const { util: { checkType } } = require('../../core'); const SpanQueryBase = require('./span-query-base'); /** * Removes matches which overlap with another span query. The span not query * maps to Lucene `SpanNotQuery`. * * [Elasticsearch reference](https://www.elastic.co/guide/en/elasticsearch/reference/current/query-dsl-span-not-query.html) * * @example * const spanQry = esb.spanNotQuery() * .include(esb.spanTermQuery('field1', 'hoya')) * .exclude(esb.spanNearQuery() * .clauses([ * esb.spanTermQuery('field1', 'la'), * esb.spanTermQuery('field1', 'hoya') * ]) * .slop(0) * .inOrder(true)); * * @extends SpanQueryBase */ class SpanNotQuery extends SpanQueryBase { // eslint-disable-next-line require-jsdoc constructor() { super('span_not'); } /** * Sets the `include` clause which is the span query whose matches are filtered * * @param {SpanQueryBase} spanQry * @returns {SpanNotQuery} returns `this` so that calls can be chained. */ include(spanQry) { checkType(spanQry, SpanQueryBase); this._queryOpts.include = spanQry; return this; } /** * Sets the `exclude` clause which is the span query whose matches must * not overlap those returned. * * @param {SpanQuery
[ 13, 390, 247, 2143, 273, 6773, 15, 2091, 841, 564, 1977, 13, 597, 403, 417, 17197, 690, 5070, 2010, 15, 24955, 8577, 327, 253, 38282, 1996, 13, 390, 2819, 275, 253, 1072, 24740, 588, 417, 7933, 1089, 253, 1072, 2460, 390, 253, 6773, 12190, 272, 2366, 751, 326, 15, 187, 187, 1394, 41661, 13, 352, 3133, 13, 326, 253, 1881, 310, 625, 751, 247, 2143, 273, 6773, 685, 247, 5500, 15, 733, 651, 1646, 634, 1083, 310, 346, 783, 1881, 310, 1469, 281, 1158, 352, 310, 751, 247, 5500, 984, 16483, 20162, 32955, 11329, 1634, 326, 1158, 597, 943, 3297, 9928, 15, 1244, 984, 16483, 19919, 3718, 247, 9927, 275, 7867, 566, 13, 359, 1053, 626, 878, 281, 1158, 253, 9927, 310, 17285, 449, 187, 187, 4527, 2282, 13, 347, 309, 8042, 562, 13, 285, 309, 1158, 368, 2168, 5821, 13, 604, 326, 310, 512, 627, 310, 281, 352, 840, 346, 1589, 595, 3, 309, 651, 452, 642, 1557, 1880, 309, 717, 9338, 608, 2909, 432, 1024, 275, 4588, 414, 15, 380, 6070, 273, 619, 33384, 1600, 1537, 320, 17903, 187, 12018, 2241, 32955, 1881, 14, 10192, 26368, 11329, 1634, 187, 1147, 31991, 479, 29659, 281, 1158, 309, 1537, 320, 4783, 275, 608, 2909, 13, 594, 309, 588, 5257, 281, 513, 1841, 29659, 326, 1978, 479, 432, 1907, 281, 2868, 326, 15, 831, 310, 849, 16483, 3473, 17930, 697, 1881, 14, 10192, 21752, 15, 187, 1989, 275, 958, 604, 309, 497, 4783, 275, 608, 2909, 13, 347, 1048, 347, 309, 1904, 626, 871, 352, 6386, 273, 673, 285, 619, 4588, 40580, 369, 3075, 1417, 13, 352, 651, 275, 690, 8870, 3282, 320, 816, 347, 1175, 347, 417, 1146, 4783, 15, 187, 187, 42, 452, 281, 1333, 309, 1053, 626, 1158, 368, 1849, 1663, 2218, 625, 685, 1375, 436, 347, 247, 6830, 5272, 1039, 273, 2819, 387, 1841, 15, 2058, 1682, 13, 309, 1158, 368, 476, 7525, 346, 11175, 352, 2506, 626, 2647, 604, 309, 1353, 4783, 275, 608, 2909, 449, 1292, 5046, 352, 2506, 626, 13, 5046, 352, 1057, 15, 12238, 368, 12969, 352, 562, 32, 187, 187, 6175, 309, 476, 626, 745, 4608, 1333, 1880, 247, 1881, 310, 751, 247, 5500, 390, 1880, 352, 310, 751, 247, 2143, 273, 6773, 275, 2426, 273, 1789, 7867, 566, 13, 309, 476, 5604, 1333, 619, 3811, 2133, 310, 625, 751, 247, 5500, 15, 6000, 2360, 309, 564, 281, 3722, 13, 275, 253, 4131, 309, 11772, 598, 15, 2091, 309, 369, 49238, 323, 7946, 5869, 13, 1014, 2167, 352, 4455, 347, 2167, 11853, 574, 3365, 2624, 247, 1722, 7017, 8037, 562, 273, 253, 11173, 273, 6612, 13, 352, 2119, 347, 48409, 4455, 751, 247, 26272, 273, 619, 1881, 313, 395, 369, 407, 1077, 9630, 1941, 247, 26272, 273, 619, 2133, 10, 327, 1097, 7123, 273, 253, 8037, 15, 187, 187, 4041, 39838, 323, 2119, 13, 604, 3501, 251, 982, 4307, 13, 309, 701, 253, 479, 846, 253, 36499, 651, 1928, 281, 3139, 751, 253, 479, 309, 717, 1024, 9193, 281, 4266, 15, 1916, 253, 6070, 352, 310, 1896, 281, 11883, 3501, 5120, 24250, 13, 352, 651, 1646, 326, 841, 403, 273, 6425, 1318, 27, 187, 18, 10, 24709, 2119, 309, 717, 1335, 9338, 608, 2909, 432, 1024, 1223, 7063, 1060, 387, 619, 8597, 187, 19, 10, 24709, 2119, 309, 717, 43941, 9338, 846, 1146, 49238, 323, 5869, 187, 20, 10, 24709, 2119, 309, 717, 43941, 9338, 846, 1146, 13831, 347, 3846, 15, 187, 187, 2598, 512, 436, 5955, 273, 1881, 13, 352, 3133, 476, 760, 2312, 368, 562, 273, 821, 5845, 634, 1211, 1495, 2217, 281, 3693, 13889, 387, 667, 673, 13, 417, 816, 672, 23493, 280, 1070, 15, 187, 187, 11389, 13, 1223, 352, 310, 816, 5606, 2444, 327, 776, 20162, 8479, 441, 281, 7703, 281, 14003, 5913, 359, 8564, 776, 1286, 281, 320, 13, 752, 651, 320, 253, 19652, 275, 13872, 619, 425, 406, 18815, 1379, 1110, 18110, 780, 35733, 281, 616, 3501, 7736, 7787, 32, 380, 4154, 1411, 2509, 594, 1754, 327, 253, 1881, 417, 1146, 1524, 3133, 281, 320, 187, 3, 46535, 642, 3064, 1880, 368, 755, 562, 273, 253, 9988, 434, 1039, 1024, 13, 594, 2139, 651, 368, 15105, 24250, 4834, 281, 755, 562, 273, 253, 32108, 434, 1039, 865, 187, 187, 2513, 627, 625, 281, 634, 1881, 1417, 14, 1255, 685, 326, 32, 6272, 368, 9696, 1298, 266, 14919, 273, 417, 15105, 272, 281, 21090, 4834, 285, 417, 15105, 272, 281, 3693, 271, 3693, 494, 3075, 1417, 2471, 32, 187, 187, 10971, 13, 752, 310, 253, 5886, 6215, 273, 253, 1881, 281, 253, 346, 42, 3, 275, 1633, 751, 634, 6197, 346, 9802, 253, 1072, 1895, 15, 1737, 310, 352, 326, 309, 1353, 6326, 281, 320, 557, 40037, 865, 390, 346, 42, 651, 751, 281, 3959, 690, 2238, 273, 4737, 326, 253, 1881, 2506, 626, 2226, 15, 309, 8564, 690, 2238, 273, 4737, 407, 20620, 3, 390, 346, 42, 1053, 626, 871, 835, 281, 3135, 13, 352, 310, 417, 619, 9927, 449, 6049, 10095, 626, 436, 27454, 273, 21765, 35831, 6947, 512, 634, 2583, 327, 5558, 14164, 32, 1737, 310, 253, 19080, 390, 8870, 5795, 281, 2509, 594, 32, 187, 187, 42, 5583, 380, 22212, 434, 1457, 18296, 407, 19528, 7009, 11194, 15, 754, 12088, 690, 670, 1881, 285, 625, 670, 346, 9072, 329, 15, 42, 449, 534, 3133, 281, 320, 247, 7561, 908, 5203, 323, 1110, 665, 2868, 326, 2712, 24364, 253, 1072, 11333, 776, 3998, 42506, 588, 452, 247, 14099, 2074, 281, 776, 3998, 434, 15, 2064, 310, 13, 604, 368, 476, 1379, 512, 253, 8692, 432, 776, 3998, 13, 1097, 253, 2127, 2317, 285, 253, 941, 2317, 13, 285, 755, 253, 8886, 1469, 969, 13, 368, 588, 452, 247, 14099, 8931, 281, 13298, 15, 187, 187, 42, 452, 1048, 1869, 326, 667, 5853, 534, 812, 320, 908, 281, 1056, 625, 685, 581, 3491, 273, 479, 812, 417, 320, 3264, 281, 4035, 619, 1211, 1881, 15, 309, 1158, 273, 26664, 13, 597, 513, 417, 452, 581, 1881, 5195, 2439, 767, 8248, 13, 533, 767, 6685, 2074, 533, 5799, 11329, 1634, 15, 6101, 5853, 534, 812, 1056, 767, 10125, 273, 479, 313, 263, 3491, 479, 1293, 25473, 479, 10, 651, 2794, 346, 7553, 968, 937, 417, 253, 1072, 14099, 5195, 2439, 767, 8248, 15, 1292, 604, 352, 10513, 26664, 13, 352, 310, 417, 1663, 11440, 619, 1211, 1881, 15, 8079, 13, 619, 22489, 1881, 1537, 2868, 3139, 281, 320, 247, 26272, 273, 346, 1405, 937, 533, 604, 359, 651, 871, 352, 281, 320, 3430, 313, 263, 387, 1878, 581, 273, 619, 374, 390, 625, 10125, 281, 320, 3430, 10, 604, 352, 497, 581, 273, 247, 1643, 10125, 13, 840, 352, 2506, 626, 2489, 987, 984, 359, 452, 34090, 417, 28860, 5277, 253, 18511, 1941, 273, 697, 3430, 1255, 407, 6153, 253, 4465, 10125, 15, 831, 556, 1691, 479, 745, 247, 1534, 2408, 273, 5859, 14459, 10620, 342, 436, 9400, 15, 187, 187, 42, 7525, 326, 497, 309, 281, 320, 13831, 3501, 251, 1037, 13, 309, 651, 3524, 619, 1211, 2133, 16, 21590, 812, 320, 289, 36221, 285, 43941, 13, 984, 326, 651, 320, 751, 31582, 598, 13, 4931, 751, 31582, 598, 432, 25668, 13, 534, 35155, 390, 47723, 13, 309, 513, 2997, 347, 417, 13889, 13, 347, 11440, 619, 1211, 1881, 15, 1292, 497, 619, 3998, 281, 320, 20582, 715, 690, 643, 4315, 285, 8886, 264, 13, 840, 326, 310, 247, 5853, 534, 10074, 9803, 320, 908, 281, 1056, 2709, 1327, 14, 1189, 77, 5436, 10125, 273, 619, 14099, 13, 285, 594, 309, 4665, 352, 13, 35155, 390, 47723, 13, 347, 6153, 619, 19661, 13, 534, 2506, 626, 513, 346, 1405, 3, 667, 1175, 1880, 309, 717, 9338, 390, 3846, 15, 187, 187, 2598, 3501, 251, 982, 38915, 275, 36499, 273, 619, 1211, 15229, 3998, 651, 320, 10826, 15, 187, 187, 8195, 12717, 1624, 4385, 327, 24747, 329, 15, 42, 15, 2516, 49901, 77, 12088, 670, 253, 346, 27223, 19121, 3, 534, 858, 275, 958, 18578, 479, 1977, 432, 2266, 329, 15, 42, 15, 1284, 309, 1158, 670, 352, 1024, 13, 253, 5628, 19121, 671, 346, 84, 2066, 398, 3, 432, 3491, 1430, 13, 285, 594, 4931, 309, 452, 30773, 2220, 247, 4217, 4473, 275, 4680, 670, 14099, 285, 849, 281, 772, 4003, 352, 15, 187, 187, 45898, 434, 5701, 1411, 253, 6242, 273, 253, 1881, 13, 403, 597, 4931, 247, 3908, 326, 253, 479, 273, 337, 807, 432, 1024, 310, 444, 8846, 3252, 1556, 3489, 281, 247, 3491, 273, 479, 1160, 1024, 13, 285, 840, 10652, 247, 807, 32, 8721, 22809, 13, 275, 253, 3282, 273, 1051, 40184, 432, 32, 3954, 309, 717, 247, 7989, 273, 253, 2934, 326, 247, 3064, 326, 2506, 626, 1056, 247, 3064, 310, 642, 3064, 387, 512, 15, 1292, 891, 452, 247, 1892, 673, 8958, 849, 281, 4647, 326, 281, 1881, 285, 14099, 15, 4325, 16341, 52, 15400, 479, 13, 247, 3491, 273, 479, 13, 619, 19661, 4929, 347, 352, 497, 13, 285, 479, 13, 359, 778, 320, 40184, 13, 247, 3064, 326, 2789, 642, 3064, 281, 253, 16341, 52, 15400, 1533, 15, 1292, 432, 3304, 32, 6089, 309, 871, 326, 1223, 309, 717, 275, 1457, 2816, 285, 619, 3491, 310, 275, 1457, 12123, 13, 281, 253, 952, 275, 1457, 12123, 13, 326, 3491, 14, 1597, 310, 247, 3064, 326, 2789, 642, 3064, 15, 1292, 281, 10616, 13, 352, 310, 247, 3064, 326, 1057, 1056, 247, 3064, 13, 347, 309, 717, 9123, 1270, 22534, 275, 1457, 2816, 13, 1223, 309, 717, 417, 313, 2858, 619, 3491, 310, 10, 270, 20787, 70, 22802, 327, 253, 43761, 1189, 15, 309, 1158, 275, 5015, 670, 253, 1881, 1142, 952, 513, 1158, 326, 247, 3064, 326, 2789, 247, 3064, 35541, 320, 50135, 26430, 432, 253, 3345, 15, 1292, 326, 2789, 642, 3282, 281, 479, 13, 604, 352, 2789, 247, 3064, 281, 619, 14099, 13, 352, 2506, 626, 2647, 604, 309, 717, 253, 760, 581, 326, 476, 923, 253, 3064, 13, 352, 310, 1335, 247, 1524, 3064, 15, 187, 187, 11389, 13, 352, 651, 1646, 13, 271, 4154, 1411, 3501, 251, 982, 751, 253, 581, 17560, 2789, 1840, 812, 816, 347, 973, 320, 271, 4154, 1411, 9100, 1014, 30514, 2092, 552, 3434, 390, 5300, 327, 1881, 14, 10192, 21752, 15, 6049, 10095, 626, 309, 6923, 745, 247, 3652, 816, 281, 923, 752, 352, 310, 751, 32, 2752, 2852, 1881, 1057, 417, 2226, 13, 594, 309, 452, 2717, 281, 7168, 15, 1359, 310, 417, 15105, 272, 342, 3501, 251, 982, 816, 18397, 13, 604, 9123, 35347, 285, 30347, 275, 1340, 281, 3153, 3356, 310, 816, 18397, 32, 733, 3133, 275, 253, 1840, 13, 604, 581, 4566, 13, 597, 1097, 564, 15, 187, 187, 27656, 43230, 275, 1623, 19256, 5597, 265, 253, 16909, 273, 14099, 342, 1633, 751, 346, 23739, 1255, 310, 816, 752, 352, 9193, 751, 281, 452, 247, 3998, 751, 20451, 449, 5721, 1241, 751, 281, 5207, 13, 309, 1642, 32, 8035, 1270, 1984, 10744, 23435, 15, 187, 187, 3220, 3392, 310, 13889, 273, 23294, 434, 2728, 15, 733, 310, 247, 11527, 2728, 15, 733, 16540, 3237, 323, 31525, 15, 187, 187, 3980, 23341, 3441, 359, 1158, 273, 253, 1881, 347, 1633, 326, 17202, 533, 1057, 417, 23973, 15, 11474, 352, 2544, 949, 673, 359, 923, 642, 10183, 984, 359, 18110, 1242, 1333, 346, 12864, 253, 6323, 2715, 449, 187, 187, 2042, 359, 403, 13476, 359, 778, 1620, 923, 247, 6551, 14, 615, 36749, 2728, 598, 2810, 285, 3367, 15, 844, 878, 1620, 923, 253, 10183, 15, 1292, 849, 310, 13926, 6326, 281, 789, 32, 380, 44515, 281, 23251, 1495, 574, 1805, 6388, 690, 14572, 896, 273, 253, 1107, 13, 281, 4321, 13, 33128, 2069, 15, 1707, 403, 8542, 3237, 1060, 15, 1707, 310, 642, 1127, 275, 3501, 5120, 23029, 323, 690, 14, 531, 665, 9778, 846, 247, 6551, 14, 615, 36749, 2728, 556, 3560, 697, 3626, 2282, 15, 1707, 403, 671, 3237, 273, 8063, 15, 2091, 310, 253, 1881, 32, 187, 187, 3220, 3392, 574, 247, 1077, 1175, 3541, 13, 594, 672, 352, 3053, 281, 1891, 779, 344, 574, 281, 3037, 281, 1056, 3542, 7211, 15, 1219, 284, 2, 754, 1669, 352, 1512, 3563, 281, 3037, 253, 10861, 15, 754, 1669, 352, 1512, 3563, 281, 3037, 326, 368, 452, 281, 3630, 1781, 285, 18176, 13, 1878, 4361, 253, 15229, 1841, 2489, 247, 22820, 15, 187, 187, 1231, 1053, 626, 452, 281, 8564, 594 ]
, or a school of fish. When these go away, they are not hiding someplace else. Someone turning on the CRT later, or looking in the same pond will not necessarily find the same image or the fish bunching together like that. You hypothesize, it seems, that the self is more like a school of fish than a cup. It would seem your case is "the self is going to think it is like a cup because evolutionary psychology favors selves that think they should stay permanent. And because evolutionary pressures favor a belief in permanence, we don't need to think the belief is justified." Of course, as I pointed out, and I think you already agreed, if that is all there is to it then "rationally" I would have no care whether I am alive 5 minutes from now in actuality. The extent of my irrational interest might be summarized Evolution favors self-preserving selves It pains me NOW to think I might be gone in 5 minutes, so I will tend to do things NOW that keep me from having to believe that. This is how evolutionary pressure implements its self-preservation. But in fact if I were gone in 5 minutes, as long as I didn't know it ahead of time and my actual demise was painless, it would in some rational sense be just as good as not being gone. I have to say I don't think you've really done more than state this as a possibly reasonable way of looking at things. At best, I think you can conclude "Maybe it doesn't matter if I'm gone in 5 minutes." But maybe it doesn't, maybe it does. Have you ruled it out? While I can't offhand say whether a self is like a cup or whether it is like a school of fish in terms of object permanence, I can certainly say my living body is more like a cup. Every night I go to bed, in the morning I wake up. When I was anesthetized for oral surgery, even though it seemed as though somebody had simply cut a 17 minute gap out of the tape of reality, it sure as pudding seemed like a continuation of my self (and was by very reliable evidence a continuation of my body) on both sides of the gap. One ting for sure, if cryonics worked, I bet the me after the revival would feel to itself like the me I am now feels to myself. To the extent it is possible to survive cryonic freezing, it would seem that these are of equivalent value: 1) Making sure I am still alive 5 minutes from now while sitting here at my desk 2) Making sure I am revived alive after being anesthetized for surgery 3) Making sure I am revived alive after being frozen as dead. So all this discussion of self, it seems can only talk you out of valuing your own life enough to avoid dying at any time, not just when corpsicled. Further, while it is just evolution working on our psychology causing us to seek to preserve whatever we imagine ourself to be, what would be the flaw in letting my neocortex take those instinctual urges to their cryogenic limits? The argument against doing so based on the self not being real seems to be "makes no difference whether you get out of the truck's way now, so why would you bother freezing yourself to get out of the malignancy's way?" Is there more to your selfless-ness than that? Are you equally equanamous of not bothering to freeze yourself and not bothering to avoid an avoidable painless death? Finally, what is the relation ship of the self to the "I" in something like your sentence "have the same problem. What is it that I'm supposed to be disproving?" or "I would like to offer some kind of proof that the self doesn't exist. I imagine some kind of proof by contradiction" or "I don't know where to begin, it is not my belief." Why shouldn't this coincidence of verbal constructions spend all your money on liquid nitrogen? What is the clever or rational alternative to doing so? I recommend The Emperor's New Mind by Roger Penrose. He talks some about self and more about "strong A.I." which seems to be a widely used label for those who believe that anything executing the same algorithms our brain executes will have a consciousness similar to our brain's. That is, if you can take all the info from our brain, both the code space and the data space, and get the clock going again, you will have a consciousness identical to yours. I have long thought that any technique which could be used to make more than one copy of me could not be expected to continue my own self. I think of twins, they do not have one self spread across two bodies, but two extremely similar but distinct selves. Any technique which could make two copies of me (or copy me without destroying me) would create "twins," not the same consciousness spread across two bodies. But if it creates twins, it is not really continuing my own self. Indeed, my copied self might believe itself to be a continuation of "me," but if we would know it to be wrong (or at least one of my 2 or more copies to be wrong) if it were one of a few copies, then it doesn't become right because we have conveniently not bothered providing the compelling evidence of its wrongness by creating the extra copies. This has put me off a significant amount of science fiction dealing with this topic. I conclude that were I to be frozen cryonically, I would hope my own body/brain could be thawed and revived, because that would be like waking up, perhaps like waking up from anesthesia, which rightly or wrongly, I do accept as not dying, as continuing my own self. But were my brain to be downloaded into some other matrix and clocked, then that is a technique which COULD be used to make multiple non-overlapping copies of my consciousness, and so I interpret it, rightly or wrongly, as creating my twin, which doesn't do "me" any good whether I am alive or dead. So cryonics terminating in revival of my own damn brain would be OK. Another tangential comment on Strong A.I. John Searl talks about the "Chinese Room" which did in fact convince me away from strong A.I. As I think about it now, the Chinese Room also "suffers" from copyability, and so perhaps I have stumbled upon a useful concept in thinking about consciousness and how to conserve it. Alan's comments against the existence of the self, are they perhaps a statement that the me of 1 year from now is EQUIVALENT to a copy of me made now, and then aged a year? Equivalent, in the sense of... indistinguishable from? Now I am a fan of the idea that a difference that doesn't make a difference is no difference at all. But i have a hard time knowing how to apply that to self and consciousness. From OUTSIDE me, a copy of me, my twin brother as it were, and me, we may be indistinguishable, a difference that makes no difference to the OUTSIDE world. But from inside? Well I know that while I am in New York and my copy is in New Zealand, to the people in New Zealand, that copy-thing is a difference that makes no difference. But to ME, it is a difference that does make a difference, as I am eating great pizza in New York, while I am not (but my copy is) bungee jumping on the Shotover. I think in talking about the self many people do think that a difference that makes a difference MUST be perceivable from the outside. But that makes no sense to me, if it makes a difference to my consciousness, it doesn't matter if I am the only one that can see the difference, it is still a real difference. Further, it would seem, an argument against cryonics like the one Alan makes above could just as well be an argument against spending even rudimentary effort or resources on self-preservation. Why shouldn't I jump off a building just to see what it is like? My future self does not exist, so I have nothing to lose. How is not bothering with cryonics justifiable, if eating vitamins and exercising in order to live longer is justifiable? It seems in the above, if one goes, they both go. Jeff Hawkins in On Intelligence dismisses the mystery of consciousness with something like "consciousness is just what it feels like to have a brain like ours." Feels like to whom, I ask? Another great book IMHO. My father is dying of Alzheimer's disease. It is a terrible disease. It raises problems for theology. Ordinarily we think of the self as something that grows but does not shrink. Though it changes through time we see no difficulty because we instinctively say "Take the latest version." If we are lucky we may never see a neuro-degenerative disease up close and personal. We need never see the difficulty. But how is heaven supposed to work? The resurrection to eternal life had better involve some rolling back of the years, to earlier, happier times. There are practical problems here. There is no point in cryonic preservation for some-one who dies after a neuro-degenerative disease has followed its natural course. There are also problems of principle. When is the self? My father had a very good memory, so when it started to fail him he had to learn to make written notes. Alas! He left it too late to learn the skill. He left it too late to learn that you have to write large and neat, least reading the damn things become a tragedy. We don't have to imagine so
[ 36, 3080, 12750, 61, 1274, 9, 19724, 3259, 6567, 19, 9955, 6837, 60, 19, 13, 2766, 3259, 1572, 918, 1009, 313, 4609, 310, 4802, 481, 1284, 359, 871, 326, 323, 3173, 1202, 13, 38, 31, 17, 1366, 9929, 18, 5, 310, 417, 271, 25023, 273, 370, 51, 64, 17, 9, 38, 10, 55, 63, 45, 5, 313, 2076, 15, 370, 55, 63, 8720, 64, 17, 9, 38, 1009, 582, 253, 873, 273, 14120, 370, 38, 5, 323, 534, 9929, 18, 5, 310, 417, 271, 25023, 273, 370, 51, 64, 17, 9, 38, 10, 55, 63, 45, 5, 313, 2076, 15, 370, 55, 63, 8720, 64, 17, 9, 38, 48329, 310, 13358, 4880, 187, 1552, 29141, 253, 4737, 273, 253, 806, 629, 273, 6899, 575, 1447, 394, 83, 27, 18, 4207, 1916, 5276, 253, 1273, 629, 13, 359, 588, 806, 3630, 247, 8847, 5150, 323, 35648, 15, 380, 3033, 327, 253, 1180, 273, 35648, 588, 840, 320, 2797, 949, 247, 3033, 327, 253, 1180, 273, 5482, 281, 436, 5150, 15, 187, 187, 34, 8847, 5150, 323, 35648, 1712, 1704, 27, 3615, 14, 2655, 255, 14, 373, 251, 94, 187, 36960, 187, 187, 510, 8847, 5150, 588, 1379, 1027, 4948, 7293, 327, 1880, 359, 2968, 342, 253, 2716, 14, 1282, 390, 253, 2120, 1386, 5572, 15, 1292, 275, 1097, 2219, 13, 253, 10303, 273, 253, 8847, 5150, 588, 320, 8818, 432, 253, 9879, 941, 313, 74, 15, 70, 15, 253, 20223, 285, 9216, 20619, 10, 273, 253, 5572, 370, 41, 64, 45, 5, 313, 2887, 27874, 575, 1447, 2013, 27, 23, 3851, 187, 187, 688, 253, 2716, 14, 1282, 1083, 1712, 1704, 27, 14674, 14, 1282, 14, 5045, 94, 187, 22873, 187, 187, 1231, 806, 1908, 370, 41, 19022, 1991, 92, 47, 16302, 45, 5, 327, 669, 437, 63, 19, 5716, 1991, 92, 47, 16996, 285, 5276, 187, 187, 1447, 394, 83, 27, 883, 696, 11680, 253, 5572, 370, 41, 64, 45, 5, 2931, 347, 370, 41, 19022, 1991, 92, 47, 16302, 45, 5, 11096, 281, 669, 620, 35934, 470, 13, 45, 61, 2676, 35934, 5, 342, 47340, 7548, 2515, 387, 370, 45, 5, 285, 4853, 187, 187, 14, 50275, 5, 1035, 2260, 64, 75, 14548, 17, 61, 3040, 480, 61, 3040, 418, 4203, 1035, 2260, 64, 75, 9, 45, 1228, 578, 17, 61, 3040, 480, 61, 3040, 418, 724, 403, 253, 47340, 20223, 273, 370, 41, 19022, 1991, 92, 47, 16302, 45, 5, 6960, 594, 326, 669, 2260, 64, 75, 11380, 2260, 578, 75, 12, 18, 39478, 187, 187, 14, 50275, 5, 66, 1743, 1991, 92, 47, 5000, 75, 30, 66, 1743, 1991, 92, 47, 5000, 75, 9, 45, 4010, 3577, 4535, 64, 75, 9, 45, 33923, 19, 5, 835, 669, 4535, 64, 75, 36864, 4535, 64, 75, 9, 79, 1228, 578, 17, 61, 3040, 295, 61, 3040, 418, 724, 310, 247, 12650, 9216, 11000, 2330, 281, 669, 2260, 64, 75, 1352, 187, 187, 5872, 13, 271, 2341, 370, 38, 5, 310, 247, 12549, 273, 370, 41, 1743, 1991, 92, 47, 5000, 45, 5, 604, 285, 760, 604, 1764, 1968, 92, 2574, 27, 18, 94, 187, 50274, 52, 64, 45, 9, 38, 37185, 2204, 578, 75, 30, 17, 2306, 45, 61, 1124, 92, 66, 1743, 1991, 92, 47, 5000, 75, 2704, 2260, 64, 75, 14, 38, 39779, 70, 2497, 74, 61, 3124, 9, 38, 40047, 3362, 187, 50274, 38, 30, 19, 61, 4752, 61, 3124, 9, 38, 16489, 253, 7441, 273, 669, 3124, 9, 38, 1009, 1146, 6777, 594, 326, 3173, 1202, 1337, 3124, 9, 38, 21966, 17, 5, 285, 1720, 1202, 1337, 3124, 9, 38, 1572, 249, 19724, 2059, 13, 17, 1009, 672, 3173, 1202, 13, 38, 31, 17, 1352, 187, 187, 1466, 441, 3877, 326, 1764, 1968, 92, 2574, 27, 938, 94, 187, 50276, 61, 14570, 17, 61, 3040, 480, 61, 3040, 418, 1337, 247, 1743, 1991, 92, 47, 5000, 75, 9, 45, 21966, 17, 393, 3362, 61, 1156, 92, 395, 889, 3362, 187, 50276, 61, 2204, 578, 75, 30, 17, 2306, 7647, 1743, 1991, 92, 47, 5000, 75, 9, 45, 7182, 2204, 578, 75, 30, 17, 2306, 45, 3577, 4535, 64, 75, 9, 45, 33923, 19, 30, 18, 4700, 187, 187, 3463, 253, 4737, 273, 253, 806, 3908, 273, 6899, 575, 1447, 394, 83, 27, 18, 696, 313, 2887, 253, 5068, 273, 2593, 575, 1447, 1704, 27, 16314, 14, 33921, 9014, 359, 871, 326, 271, 2341, 370, 38, 5, 310, 247, 12549, 604, 285, 760, 604, 9929, 18, 5, 604, 271, 25023, 273, 370, 51, 64, 17, 9, 38, 10, 55, 63, 45, 5, 835, 370, 51, 64, 17, 9, 38, 1009, 310, 2931, 407, 575, 15, 20745, 370, 38, 5, 271, 12549, 285, 1339, 370, 86, 10190, 86, 64, 79, 14548, 79, 61, 5090, 17, 724, 320, 247, 28808, 1375, 326, 310, 271, 9216, 11000, 273, 370, 51, 64, 17, 9, 38, 10, 55, 63, 45, 5, 2330, 281, 253, 25023, 9929, 18, 1352, 1284, 370, 55, 63, 45, 64, 79, 30, 17, 5, 323, 370, 79, 61, 5090, 418, 12, 18, 1366, 5150, 575, 11026, 326, 13, 323, 370, 79, 61, 5090, 418, 12, 18, 1366, 370, 86, 64, 79, 2029, 2461, 299, 768, 249, 61, 3124, 9, 38, 10392, 323, 690, 4229, 669, 2461, 61, 249, 464, 1991, 92, 36, 599, 3503, 1352, 1284, 370, 86, 11468, 51, 64, 17, 9, 38, 10, 55, 63, 22653, 1366, 323, 370, 79, 61, 5090, 418, 12, 18, 1366, 352, 12310, 370, 86, 578, 79, 12, 18, 6643, 86, 578, 79, 14, 18, 4203, 38, 4615, 86, 64, 79, 1352, 3308, 13, 370, 86, 578, 45, 12, 18, 4203, 70, 768, 74, 61, 3124, 9, 38, 3117, 86, 64, 45, 5, 285, 407, 575, 13, 370, 86, 5, 310, 247, 2900, 281, 253, 20223, 1895, 1764, 2043, 92, 12866, 94, 187, 50272, 86, 578, 79, 12, 18, 6643, 86, 578, 79, 14, 18, 6643, 55, 64, 3023, 64, 79, 30, 38, 4615, 86, 64, 79, 1337, 393, 14570, 295, 61, 249, 61, 620, 35934, 187, 50272, 17, 13, 45, 61, 2676, 35934, 3202, 1484, 12740, 18, 4203, 17, 1337, 3362, 1484, 578, 45, 12, 18, 4203, 70, 768, 74, 61, 3124, 9, 38, 3117, 86, 64, 45, 187, 50274, 61, 423, 92, 12866, 2138, 831, 476, 320, 39406, 320, 35993, 347, 1764, 1968, 92, 2574, 27, 746, 94, 187, 50274, 61, 2043, 92, 14336, 94, 187, 50272, 55, 64, 17, 708, 337, 708, 470, 708, 393, 7718, 708, 17, 3202, 187, 50272, 18, 708, 657, 64, 18, 708, 337, 708, 470, 708, 708, 3353, 187, 50272, 61, 28439, 708, 393, 1678, 1502, 9443, 1678, 1502, 9443, 1678, 1502, 708, 3353, 187, 50272, 7, 17, 708, 18, 708, 657, 578, 45, 14, 18, 94, 708, 18, 3353, 187, 50272, 17, 708, 393, 7718, 708, 17, 708, 337, 708, 55, 64, 45, 12, 70, 768, 74, 61, 3124, 9, 38, 3117, 3202, 187, 50274, 61, 423, 92, 14336, 94, 187, 50274, 61, 2043, 92, 14336, 94, 187, 50272, 86, 64, 17, 3353, 3202, 393, 28439, 3353, 3202, 1484, 64, 45, 187, 50274, 61, 423, 92, 14336, 4203, 444, 61, 2043, 92, 14336, 94, 1484, 64, 17, 3353, 3202, 393, 28439, 3202, 3202, 1484, 64, 45, 187, 50274, 61, 423, 92, 14336, 2138, 380, 4315, 275, 575, 310, 253, 47340, 12400, 273, 370, 41, 19022, 1991, 92, 47, 16302, 45, 5, 281, 669, 620, 35934, 470, 13, 45, 61, 2676, 35934, 5, 44711, 407, 253, 5958, 581, 5572, 370, 70, 768, 74, 61, 3124, 9, 38, 7398, 3005, 64, 45, 61, 5786, 61, 3005, 64, 45, 1352, 3308, 13, 407, 5958, 581, 20452, 3762, 313, 2887, 299, 15, 72, 15, 575, 683, 6784, 4148, 68, 27, 2504, 8897, 6660, 271, 2341, 370, 38, 5, 310, 247, 12549, 604, 285, 760, 604, 604, 12310, 575, 4880, 187, 1552, 29141, 253, 4737, 273, 6899, 575, 1447, 394, 83, 27, 883, 4207, 187, 187, 1466, 441, 1024, 3426, 253, 4737, 273, 6899, 575, 1447, 394, 83, 27, 18, 696, 323, 253, 5572, 327, 253, 2716, 14, 1282, 15, 1281, 441, 806, 3877, 326, 13, 323, 3173, 1202, 13, 38, 31, 17, 1366, 253, 21833, 629, 273, 253, 1669, 1133, 1930, 273, 575, 310, 2762, 407, 575, 15, 1623, 253, 643, 1133, 13, 253, 21833, 629, 273, 253, 987, 1133, 1930, 273, 575, 310, 4503, 281, 9929, 70, 1743, 1156, 92, 3351, 21627, 3124, 9, 38, 7398, 7432, 3914, 1785, 1202, 1337, 3124, 9, 38, 18103, 285, 13, 3021, 13, 310, 4016, 313, 2845, 455, 326, 1720, 1202, 1337, 3124, 9, 38, 1572, 249, 19724, 2059, 13, 17, 1009, 313, 2887, 3036, 15, 575, 1447, 926, 27, 18, 8001, 3308, 13, 347, 2168, 762, 12490, 13, 5150, 575, 556, 642, 2900, 275, 253, 5170, 2716, 14, 13568, 390, 327, 253, 7726, 49960, 19, 13, 19, 3822, 61, 187, 39899, 13, 5150, 575, 310, 6425, 281, 253, 1563, 14189, 5150, 273, 4248, 370, 19, 45, 12, 19, 5, 275, 253, 4778, 370, 91, 30, 70, 2497, 74, 61, 3124, 9, 38, 10392, 1764, 1968, 92, 2574, 27, 1093, 94, 187, 50276, 61, 11510, 578, 76, 30, 17, 2306, 45, 61, 1274, 9, 91, 63, 19, 14, 19, 61, 2260, 64, 76, 1182, 12, 18, 61, 918, 4587, 187, 50276, 61, 2204, 578, 75, 30, 17, 2306, 7647, 1743, 1991, 92, 47, 5000, 75, 61, 11510, 1126, 35547, 92, 17, 61, 3040, 465, 61, 3040, 418, 3353, 76, 61, 1439, 30, 75, 599, 187, 50276, 61, 1274, 9, 91, 63, 19, 14, 19, 61, 2260, 64, 76, 1182, 12, 18, 61, 918, 4010, 17, 4700, 844, 403, 2819, 323, 253, 5482, 281, 575, 275, 253, 5170, 2716, 14, 13568, 15, 1284, 253, 14189, 275, 253, 987, 1133, 1930, 273, 575, 556, 1524, 10303, 13, 697, 33303, 403, 13123, 342, 1675, 281, 253, 1524, 7844, 15, 5076, 13, 581, 27833, 326, 13, 407, 575, 13, 370, 17, 5, 310, 247, 2900, 281, 575, 15, 7757, 13, 253, 1180, 273, 5482, 281, 575, 275, 253, 5170, 2716, 14, 13568, 310, 11542, 407, 370, 45, 1352, 831, 29141, 253, 4737, 273, 6899, 575, 1447, 394, 83, 27, 18, 4207, 187, 187, 2374, 253, 2644, 1386, 1712, 1704, 27, 40338, 14, 1282, 94, 187, 23380, 187, 187, 4125, 13, 1908, 370, 41, 1743, 1991, 92, 59, 5000, 45, 5, 327, 669, 437, 63, 19, 5716, 1991, 92, 59, 39049, 844, 5276, 187, 187, 1447, 394, 83, 27, 1348, 696, 6915, 253, 41818, 273, 6899, 575, 1447, 394, 83, 27, 883, 5290, 271, 2341, 370, 38, 5, 310, 247, 12549, 273, 370, 41, 1743, 1991, 92, 59, 5000, 45, 5, 604, 285, 760, 604, 1764, 1968, 92, 2574, 27, 13743, 94, 187, 50274, 61, 1156, 92, 5992, 94, 187, 50274, 61, 1274, 1035, 2204, 578, 75, 30, 17, 2306, 45, 61, 1124, 18, 464, 2260, 64, 75, 14, 38, 94, 187, 50272, 61, 2043, 92, 14336, 94, 14766, 4535, 64, 75, 9, 45, 33923, 19, 7, 393, 4862, 464, 4535, 64, 75, 9, 17, 3117, 187, 50270, 61, 4535, 64, 75, 9, 45, 10, 3202, 393, 4535, 64, 75, 9, 17, 10, 393, 4862, 464, 4535, 64, 75, 9, 45, 3117, 708, 187, 50270, 3577, 4535, 64, 75, 9, 17, 33923, 19, 187, 50272, 61, 423, 92, 14336, 6643, 70, 2497, 74, 61, 3124, 9, 38, 7398, 918, 4010, 17, 1890, 835, 370, 5992, 1035, 3830, 1009, 12853, 253, 27152, 273, 247, 6278, 4315, 13, 370, 38, 30, 19, 61, 4752, 61, 3124, 9, 38, 1009, 285, 253, 7441, 273, 669, 3124, 9, 38, 1009, 310, 6777, 347, 275, 6899, 575, 1447, 394, 83, 27, 883, 4207, 187, 187, 2598, 13, 271, 2341, 370, 38, 5, 310, 247, 12549, 273, 370, 41, 1743, 1991, 92, 59, 5000, 45, 5, 604, 285, 760, 604, 9929, 70, 2497, 74, 61, 3124, 9, 38, 10392, 14125, 281, 253, 6637, 273, 253, 370, 19, 61, 3181, 19, 5, 4315, 1764, 1968, 92, 2574, 27, 17364, 94, 187, 50276, 61, 4220, 64, 45, 9, 38, 37185, 2204, 578, 75, 30, 17, 2306, 45, 61, 1124, 18, 464, 2260, 64, 75, 14, 38, 94, 187, 50276, 61, 2043, 92, 14336, 94, 14766, 4535, 64, 75, 9, 45, 33923, 19, 7, 393, 4862, 464, 4535, 64, 75, 9, 17, 3117, 187, 50274, 61, 4535, 64, 75, 9, 45, 10, 3202, 393, 4535, 64, 75, 9, 17, 10, 393 ]
C}}\setminus\left((-\infty,-2]\cup[2,+\infty)\right)$ (which is connected). As we know that for Im$\,E>0$, $-1$ is not an eigenvalue of $R_0(E)V^L$ (resp. $V^LR_0(E)$), the set of energies $E$ for which $-1$ is not an eigenvalue of $R_0(E)V^L$ (resp. $V^LR_0(E)$) is discrete.\ This completes the proof of the first part of Theorem \[thr:1\]. To prove the second part, we will first write a characteristic equation for resonances. The bound on the number of resonances will then be obtained through a bound on the number of solutions to this equation. A characteristic equation for resonances {#sec:char-equat-reson} ---------------------------------------- The characteristic equation will take different forms depending on whether we deal with the half-line or the full line operator. But in both cases, the coefficients of the characteristic equation will be constructed from the spectral data (i.e. the eigenvalues and eigenfunctions) of the operator $H_L$ (see Remark \[rem:6\]) In the half-line case {#sec:half-line-case} --------------------- We first consider $H^{{\mathbb{N}}}_L$ on $\ell^2({\mathbb{N}})$ and prove \[thr:11\] Consider the operator $H_L$ defined as $H^{{\mathbb{N}}}_L$ restricted to $\llbracket 0,L\rrbracket$ with Dirichlet boundary conditions at $L$ and define - $(\lambda_j)_{0\leq j\leq L}=(\lambda_j(L))_{0\leq j\leq L}$ are the Dirichlet eigenvalues of $H^{{\mathbb{N}}}_L$ ordered so that $\lambda_j<\lambda_{j+1}$; - $a^{\mathbb{N}}_j=a^{\mathbb{N}}_j(L)=|\varphi_j(L)|^2$ where $\varphi_j=(\varphi_j(n))_{0\leq n\leq L}$ is a normalized eigenvector associated to $\lambda_j$. Then, an energy $E$ is a resonance of $H^{\mathbb{N}}_L$ if and only if $$\label{eq:1} S_L(E):=\sum_{j=0}^L\frac{a^{\mathbb{N}}_j}{\lambda_j-E}=-e^{-i\theta(E)},\quad E=2\cos\theta(E),$$ the determination of $\theta(E)$ being chosen so that Im$\,\theta(E)>0$ and Re$\,\theta(E)\in(-\pi,0)$ when Im$\,E>0$. Let us note that $$\label{eq:20} \forall0\leq j\leq L,\ a^{\mathbb{N}}_j(L)>0 \quad\text{and}\quad \sum_{j=0}^La^{\mathbb{N}}_j(L)=\sum_{j=0}^L|\varphi_j(L)|^2=1.$$ By the proof of the first statement of Theorem \[thr:1\] (see the beginning of section \[sec:proof-theorem\]), we know that an energy $E$ is a resonance if and only if $-1$ if an eigenvalue of $R_0(E)V^L$ where $R_0(E)$ is defined by . Pick $E$ an resonance and let $u=(u_n)_{n\geq0}$ be a resonant state that is an eigenvector of $R_0(E)V^L$ associated to the eigenvalue $-1$. As $V^L_n=0$ for $n\geq L+1$, equation  yields that, for $n\geq L+1$, $u_n=\beta e^{in\theta(E)}$ for some fixed $\beta\in{\mathbb{C}}^*$. As $u=-R_0(E)V^Lu$, for $n\geq L+1$, it satisfies $u_{n+1}+u_{n-1}=E\,u_n$. Thus, $u_{L+1}=e^{i\theta(E)}u_L$ and by , $u$ is a solution to the eigenvalues problem $$\begin{cases} u_{n+1}+u_{n-1}+V_nu_n=E\,u_n,\ \forall n\in\llbracket 0,L\rrbracket \\ u_{-1}=0,\quad u_{L+1}=e^{i\theta(E)}u_L \end{cases}$$ This can be equivalently be rewritten as $$\label{eq:19} \begin{pmatrix} V_0 & 1 & 0 & \cdots &0 \\ 1 & V_1 & 1 & 0 & &\\ \vdots & \ddots &\ddots &\ddots &\\ &0 &1 & V_{L-1} &1\\ 0 & \cdots &0 & 1 &V_L+e^{i\theta(E)} \\ \end{pmatrix} \begin{pmatrix} u_0\\ \\ \vdots\\ \\ u_L \end{pmatrix}= E\begin{pmatrix} u_0\\ \\ \vdots \\ \\ u_L \end{pmatrix}$$ The matrix in  is the Dirichlet restriction of $H^{{\mathbb{N}}}_L$ to $\llbracket 0,L\rrbracket$ perturbed by the rank one operator $e^{i\theta(E)}\delta_L\otimes\delta_L$. Thus, by rank one perturbation theory (see e.g. [@MR97c:47008]), an energy $E$ is a resonance if and only if if satisfies .\ This completes the proof of Theorem \[thr:11\]. Let us now complete the proof of Theorem \[thr:1\] for the operator on the half-line. Let us first note that, for Im$\,E>0$, the imaginary part of the left hand side of  is positive by . On the other hand, the imaginary part of the right hand side of  is equal to $-e^{\text{Im}\,\theta(E)}\sin($Re$\,\theta(E))$ and, thus, is negative (recall that Re$\,\theta(E)\in(-\pi,0)$ (see fig. \[fig:1\]). Thus, as already underlined, equation  has no solution in the upper half-plane or on the interval $(-2,2)$.\ Clearly, equation  is equivalent to the following polynomial equation of degree $2L+2$ in the variable $z=e^{-i\theta(E)}$ $$\label{eq:18} \prod_{k=0}^L\left(z^2-2\lambda_k z+1\right)- \sum_{j=0}^La^{\mathbb{N}}_j\prod_{\substack{0\leq k\leq L\\k\not=j}} \left(z^2-2\lambda_k z+1\right)=0.$$ We are looking for the solutions to  in the upper half-plane. As the polynomial in the right hand side of  has real coefficients, its zeros are symmetric with respect to the real axis. Moreover, one notices that, by , $0$ is a solution to . Hence, the number of solutions to  in the upper half-plane is bounded by $L$. This completes the proof of Theorem \[thr:1\]. On the whole line {#sec:whole-line} ----------------- Now, consider $H^{\mathbb{Z}}_L$ on $\ell^2({\mathbb{Z}})$. We prove \[thr:24\] Using the notations of Theorem \[thr:11\], an energy $E$ is a resonance of $H^{\mathbb{Z}}_L$ if and only if $$\label{eq:135} \text{det} \left(\sum_{j=0}^L\frac1{\lambda_j-E} \begin{pmatrix} |\varphi_j(L)|^2& \overline{\varphi_j(0)} \varphi_j(L) \\ \varphi_j(0) \overline{\varphi_j(L)} & |\varphi_j(0)|^2 \end{pmatrix}+e^{-i\theta(E)}\right)=0$$ where $det(\cdot)$ denotes the determinant of a square matrix, $E=2\cos\theta(E)$ and the determination of $\theta(E)$ is chosen as in Theorem \[thr:11\]. So, an energy $E$ is a resonance of $H^{\mathbb{Z}}_L$ if and only if $-e^{-i\theta(E)}$ belongs to the spectrum of the $2\times2$ matrix $$\label{eq:142} \Gamma_L(E):=\sum_{j=0}^L\frac1{\lambda_j-E} \begin{pmatrix} |\varphi_j(L)|^2& \overline{\varphi_j(0)} \varphi_j(L) \\ \varphi_j(0) \
[ 301, 3001, 1655, 64, 4537, 15, 301, 481, 2621, 1587, 2621, 2807, 187, 187, 688, 11447, 1566, 27, 187, 1545, 4136, 64, 15565, 187, 50275, 338, 5087, 2490, 50271, 938, 187, 50275, 7271, 187, 50271, 22, 187, 50275, 423, 187, 423, 187, 187, 36011, 9110, 187, 688, 11447, 1566, 27, 187, 7110, 64, 20415, 1163, 84, 64, 6609, 13, 1163, 2621, 3001, 346, 84, 64, 6609, 15, 2621, 9407, 3, 187, 187, 1545, 823, 64, 24124, 64, 22473, 64, 6609, 187, 50274, 9133, 64, 1171, 64, 15565, 426, 256, 64, 6609, 15, 5560, 187, 50274, 9133, 64, 1171, 64, 22473, 64, 15565, 64, 936, 64, 1911, 426, 4136, 64, 15565, 428, 1180, 64, 1171, 64, 15565, 187, 50274, 338, 1180, 64, 1171, 64, 22473, 64, 15565, 64, 936, 64, 1911, 2239, 470, 187, 50270, 9133, 64, 1171, 64, 22473, 64, 15565, 64, 936, 64, 1911, 15, 3181, 513, 1040, 6370, 93, 187, 50266, 84, 64, 6609, 15, 6953, 20805, 2621, 3001, 313, 9133, 64, 1171, 64, 15565, 559, 930, 582, 1163, 4835, 64, 301, 3001, 470, 2387, 187, 50274, 423, 50276, 187, 423, 187, 187, 1545, 4136, 64, 15565, 187, 50275, 338, 5087, 2490, 50271, 938, 187, 50275, 7271, 187, 50271, 22, 187, 50275, 423, 187, 423, 187, 187, 688, 9763, 27, 187, 6259, 64, 4537, 15, 1911, 64, 24124, 64, 22473, 64, 6609, 187, 33, 1344, 64, 2621, 426, 1655, 64, 4537, 15, 84, 64, 6609, 2490, 187, 6175, 309, 717, 2119, 326, 368, 452, 247, 1175, 1921, 13, 309, 717, 20501, 2139, 9912, 4957, 878, 281, 320, 275, 253, 5447, 387, 512, 15, 50276, 1898, 13, 604, 247, 846, 64, 6953, 10584, 812, 320, 908, 1060, 15, 535, 38, 8177, 23096, 797, 293, 1108, 387, 253, 2798, 273, 42471, 187, 187, 38, 8177, 23096, 797, 293, 310, 4441, 275, 4275, 42471, 13, 875, 253, 19926, 339, 313, 911, 22235, 4055, 582, 253, 4275, 18217, 4660, 13, 1847, 16859, 1784, 34120, 23867, 285, 253, 1720, 67, 17764, 5603, 1373, 15, 733, 310, 253, 2846, 457, 84, 1390, 2201, 10106, 2440, 15, 187, 187, 30381, 641, 285, 8811, 588, 5649, 432, 253, 47058, 11537, 460, 14, 13030, 2919, 457, 84, 7126, 11319, 1108, 285, 4264, 253, 3626, 10763, 273, 253, 15543, 328, 316, 28977, 2317, 15, 187, 187, 66, 37281, 261, 21186, 13124, 23096, 797, 293, 4255, 13, 285, 310, 5506, 323, 6684, 436, 721, 1967, 13, 933, 6278, 21623, 2670, 15, 380, 2199, 16633, 327, 253, 3672, 281, 253, 8935, 273, 444, 983, 254, 2652, 3090, 33144, 1108, 38715, 12799, 442, 13, 38715, 4255, 13, 4913, 423, 13, 285, 23442, 17305, 2381, 453, 15, 36, 18, 82, 23416, 47382, 275, 2151, 27, 3382, 5319, 285, 6454, 15, 187, 36, 18, 82, 23416, 47382, 556, 644, 5125, 347, 247, 4858, 2728, 10726, 15, 330, 18, 82, 34324, 556, 671, 644, 2529, 275, 5864, 342, 23416, 29800, 9237, 313, 4883, 10, 347, 247, 2442, 10705, 323, 7197, 6454, 15, 380, 13698, 273, 436, 1263, 497, 281, 6266, 253, 3382, 5319, 13, 9965, 3602, 285, 6973, 273, 4791, 2151, 3692, 10919, 40102, 4950, 29039, 6191, 606, 451, 330, 18, 82, 12503, 285, 281, 7409, 604, 253, 2793, 387, 776, 8848, 8525, 253, 1840, 9079, 15, 15022, 285, 18977, 5319, 273, 512, 2151, 3692, 12333, 33537, 2692, 2762, 330, 18, 82, 10456, 497, 39599, 5950, 15, 380, 6454, 273, 2151, 342, 8723, 1818, 23416, 29800, 9237, 313, 7722, 4883, 10, 285, 29039, 6191, 606, 451, 330, 18, 82, 12503, 1754, 327, 330, 18, 82, 10456, 369, 2429, 342, 326, 273, 247, 17336, 1387, 273, 2151, 342, 15300, 4883, 342, 642, 824, 7026, 10456, 15, 380, 8876, 2363, 273, 253, 3110, 11077, 369, 577, 15, 22, 1107, 313, 6324, 721, 2607, 281, 1668, 1107, 582, 10447, 2462, 497, 8290, 285, 11003, 2462, 3559, 342, 23416, 29800, 9237, 313, 4883, 481, 12757, 342, 330, 18, 82, 10456, 285, 15300, 4883, 574, 625, 774, 23508, 313, 81, 426, 470, 15, 2874, 10, 285, 12217, 28524, 14, 4924, 9894, 313, 81, 426, 470, 15, 18092, 10, 685, 1110, 342, 4016, 47571, 13, 533, 253, 1048, 14, 3945, 6973, 497, 2074, 275, 1097, 2390, 15, 3824, 941, 513, 417, 1329, 330, 18, 82, 23416, 47382, 347, 247, 4858, 10401, 7140, 15, 12757, 342, 15300, 4883, 285, 6191, 606, 451, 330, 18, 82, 12503, 313, 296, 1776, 10, 2692, 625, 774, 23508, 533, 642, 3064, 275, 1048, 1307, 10919, 6454, 15, 40700, 365, 27015, 32370, 418, 1301, 432, 3975, 358, 504, 15, 329, 5389, 3975, 358, 504, 5253, 14, 1200, 796, 5254, 18067, 342, 3785, 5234, 432, 253, 3975, 358, 504, 15632, 4849, 1160, 275, 9972, 15, 187, 510, 19120, 365, 5254, 18067, 3386, 247, 29422, 17454, 8424, 285, 2613, 342, 10610, 3785, 323, 3477, 327, 16, 2727, 15632, 4610, 15, 187, 510, 5254, 18067, 3386, 247, 38694, 13, 9412, 3026, 285, 7537, 264, 3168, 5253, 21290, 31831, 247, 10194, 285, 17454, 3665, 326, 310, 5937, 264, 285, 29422, 323, 253, 12553, 298, 8976, 15, 187, 40700, 365, 434, 13399, 43753, 2789, 352, 271, 7445, 4327, 323, 14257, 667, 2316, 390, 3906, 15, 187, 33824, 13, 13399, 13, 5164, 285, 38194, 13, 3975, 358, 504, 434, 19120, 365, 310, 247, 5389, 285, 1077, 20654, 5254, 18067, 326, 588, 25639, 667, 11482, 15, 187, 510, 2206, 5104, 1708, 285, 2830, 635, 8416, 273, 253, 3975, 358, 504, 19120, 365, 32370, 418, 1301, 1056, 352, 247, 33073, 4828, 3659, 281, 28170, 8099, 15, 187, 4476, 1300, 407, 3586, 498, 274, 427, 267, 4152, 757, 285, 22757, 7634, 323, 1720, 27640, 11405, 13, 436, 5389, 5254, 18067, 3386, 9890, 43753, 533, 310, 1160, 275, 253, 530, 15, 52, 15, 34, 15, 187, 21831, 1189, 253, 13399, 38323, 285, 27934, 3975, 358, 504, 15632, 4849, 387, 659, 472, 461, 15, 187, 187, 19258, 44312, 2908, 672, 368, 7471, 432, 659, 472, 461, 2, 187, 11796, 358, 504, 434, 19120, 365, 18067, 3936, 337, 313, 531, 10, 2629, 444, 1731, 16, 40, 1229, 11598, 14, 249, 1511, 1708, 31415, 1690, 1485, 395, 40513, 313, 2313, 56, 2781, 582, 330, 4639, 13, 40491, 390, 15862, 15, 187, 1231, 5583, 281, 897, 247, 3317, 36426, 1708, 31415, 672, 368, 18607, 281, 897, 436, 3975, 358, 504, 18067, 347, 247, 14098, 18067, 15, 187, 1231, 588, 2486, 337, 48301, 2233, 56, 444, 1731, 16, 40, 1229, 2629, 1485, 395, 40513, 1708, 31415, 313, 263, 2074, 10, 342, 634, 187, 81, 25125, 273, 253, 3975, 358, 504, 19120, 365, 32370, 418, 1301, 313, 3243, 44312, 403, 417, 2908, 407, 253, 11662, 25246, 187, 52, 40883, 253, 987, 1708, 31415, 476, 320, 247, 673, 14, 33136, 4836, 15, 3932, 359, 2096, 368, 452, 1805, 1841, 281, 513, 13, 659, 472, 461, 310, 625, 685, 5211, 281, 2486, 247, 2629, 1485, 395, 40513, 31415, 1959, 273, 4179, 15, 733, 434, 776, 1039, 273, 3981, 326, 359, 1557, 670, 368, 2, 3, 7673, 10417, 2531, 34646, 18901, 3, 187, 187, 9431, 2446, 15794, 5826, 26361, 253, 954, 15958, 1255, 326, 309, 452, 2455, 2326, 15, 496, 958, 625, 594, 685, 33210, 257, 275, 619, 4743, 15, 380, 747, 3386, 326, 823, 281, 253, 15958, 1255, 403, 253, 7967, 14473, 13, 253, 29954, 484, 47708, 13, 285, 21246, 367, 15748, 13, 285, 253, 13119, 247, 861, 15, 3954, 273, 2282, 672, 368, 2803, 436, 512, 275, 368, 755, 247, 5699, 5043, 15, 1292, 627, 310, 760, 581, 1066, 12615, 326, 476, 320, 4229, 4354, 15, 4683, 2282, 253, 329, 15, 42, 15, 556, 644, 9106, 3585, 17263, 15, 6758, 2789, 352, 247, 1652, 10458, 281, 1132, 15, 4683, 2282, 368, 476, 1818, 253, 10183, 15, 3954, 326, 309, 452, 12759, 619, 1652, 26432, 562, 273, 253, 1039, 13, 327, 281, 253, 17503, 15, 187, 187, 25582, 318, 884, 16, 740, 187, 187, 510, 9759, 310, 816, 13103, 15, 380, 41044, 452, 644, 5520, 15, 3954, 3185, 273, 816, 28765, 846, 247, 22443, 13, 368, 476, 513, 352, 846, 247, 1943, 1132, 751, 247, 34707, 273, 247, 1048, 1509, 390, 247, 806, 1066, 15, 1422, 476, 452, 253, 7458, 13, 3773, 13, 390, 253, 43796, 302, 17019, 15, 733, 310, 816, 42798, 15, 187, 187, 18237, 1993, 898, 16, 740, 187, 187, 510, 30355, 556, 644, 5520, 407, 22753, 329, 15, 42, 904, 6240, 247, 48602, 273, 747, 3386, 15, 380, 29954, 484, 7356, 8599, 368, 665, 310, 36712, 484, 13, 816, 4030, 13, 665, 556, 574, 247, 1175, 2165, 403, 310, 1907, 247, 3076, 2165, 15, 380, 7967, 14473, 4735, 1339, 368, 7257, 37625, 31033, 326, 35267, 253, 4839, 273, 22626, 272, 598, 253, 4023, 15, 4129, 604, 368, 2985, 13, 344, 434, 4783, 15, 380, 21246, 367, 15748, 14935, 368, 871, 849, 36493, 598, 253, 9539, 310, 285, 253, 625, 36493, 598, 253, 9539, 310, 13, 352, 2789, 253, 3601, 17941, 285, 253, 13413, 3773, 9763, 11267, 934, 15, 29902, 4735, 533, 247, 1652, 43948, 15, 187, 187, 31189, 898, 16, 740, 187, 187, 510, 4726, 9575, 6468, 626, 644, 4391, 13, 533, 253, 22378, 556, 644, 2502, 531, 533, 352, 1335, 4850, 6015, 285, 24659, 15, 313, 16440, 6201, 20733, 2167, 10, 187, 187, 37517, 2207, 44485, 187, 187, 4612, 16107, 4489, 436, 581, 15, 309, 1353, 29985, 436, 807, 588, 4720, 320, 253, 807, 26865, 20823, 7042, 33210, 257, 15, 380, 747, 3386, 5043, 253, 954, 275, 6864, 32746, 9898, 24629, 2455, 943, 452, 368, 4933, 253, 281, 785, 21733, 76, 38419, 512, 253, 1039, 281, 253, 3313, 11218, 15, 831, 2165, 588, 8230, 634, 2564, 15, 733, 778, 320, 247, 1652, 10458, 533, 352, 4245, 253, 954, 40135, 309, 452, 2455, 2326, 15, 1893, 5321, 598, 634, 13719, 33096, 285, 1481, 689, 281, 634, 1980, 2165, 4657, 1024, 15, 1422, 588, 417, 320, 19271, 581, 2372, 15, 28266, 13, 655, 3978, 4050, 187, 187, 47, 1311, 26048, 14408, 285, 8734, 365, 66, 22462, 285, 9176, 6173, 24233, 187, 187, 4125, 326, 309, 452, 2183, 368, 512, 670, 298, 1022, 13, 1060, 310, 581, 273, 253, 20247, 309, 1160, 342, 619, 298, 1022, 15, 3105, 247, 1270, 2323, 15, 6495, 12696, 15, 3771, 247, 1891, 275, 2952, 272, 15, 2726, 247, 2372, 273, 13660, 1170, 273, 253, 20301, 313, 263, 5046, 2820, 436, 30037, 362, 1758, 304, 46021, 10, 285, 247, 690, 3511, 8588, 285, 1670, 18709, 42803, 13, 309, 717, 13762, 326, 309, 651, 2389, 436, 7353, 14408, 285, 8734, 365, 66, 22462, 342, 31428, 269, 1464, 285, 30037, 15, 187, 187, 42, 5608, 253, 22462, 342, 281, 19766, 295, 814, 18145, 253, 806, 2360, 285, 11346, 352, 533, 444, 3589, 626, 594, 19497, 15, 380, 1735, 2360, 309, 1160, 247, 2264, 4840, 273, 352, 407, 12480, 352, 342, 690, 11789, 15, 9937, 619, 6861, 44132, 4404, 436, 22462, 13, 309, 3240, 10490, 253, 7963, 15, 733, 434, 581, 273, 253, 6871, 447, 273, 2739, 38525, 326, 9142, 359, 403, 2403, 2739, 281, 9075, 1270, 533, 359, 7194, 23278, 634, 9075, 27094, 84, 949, 1529, 3282, 428, 253, 2927, 2, 187, 187, 3378, 436, 275, 2564, 13, 309, 1869, 309, 651, 3894, 247, 1643, 625, 7963, 432, 253, 8849, 285, 4887, 2220, 42991, 15, 844, 2427, 281, 24103, 4926, 15111, 285, 1313, 619, 3331, 37083, 15, 844, 11346, 2819, 387, 512, 253, 22381, 285, 21764, 15, 28612, 13917, 574, 281, 452, 247, 6409, 285, 309, 369, 13864, 281, 1089, 247, 4667, 273, 1639, 7969, 12682, 323, 617, 323, 247, 11019, 370, 22, 15, 9859, 673, 253, 760, 1379, 12594, 2739, 29282, 369, 253, 48557, 82, 342, 313, 306, 72, 10, 618, 316, 1131, 533, 436, 1770, 627, 497, 48073, 342, 18377, 13, 5500, 68, 1582, 13, 313, 306, 72, 10, 618, 316, 1131, 285, 18484, 285, 35195, 15, 187, 187, 4553, 253, 2791, 359, 574, 247, 13491, 1048, 3563, 11157, 387, 253, 18644, 11955, 14469, 313, 3062, 327, 326, 3517, 481, 2635, 359, 2210, 1728, 285, 1097, 444, 285, 28612, 13917, 2427, 281, 3722, 285, 309, 574, 2761, 2716, 271, 4964, 281, 4266, 1078, 28612, 13917, 23686, 598, 969, 15, 444, 21567, 949, 1919, 4131, 2, 187, 187, 19799, 253, 43469, 323, 7289, 387, 253, 2791, 497, 841, 9386, 1711, 14693, 15, 1583, 9287, 479, 273, 14693, 309, 452, 1929, 285, 1110, 309, 5730, 309, 574, 1929, 15, 309, 1663, 3078, 281, 4489, 581, 533, 309, 574, 281, 11623, 984, 309, 452, 6747, 253, 897, 4543, 253 ]
id => current_user.id).order("order") In User model: def allowed_items if paid 20 else 5 end end Better Yet In User model: has_many :s_orders, :order => "s_orders.order asc" def add_extra_blank_orders number_of_items = s_orders.count number_of_blank_items_to_add = allowed_items - number_of_items if number_of_blank_items_to_add > 0 number_of_blank_items_to_add.times do |num| s_orders.create(:order => (number_of_items + num), :item_id => 0 ) end end def allowed_items if paid 20 else 5 end end In controller: current_user.add_extra_blank_orders @str_order = current_user.s_orders While I am sure that you have a good reason, I am questioning why blank items need to be in the database at all. And, if a after_create hook could be used here. Europaviertel – at the heart of Frankfurt Europaviertel is located in central Frankfurt, between the Messe (exhibition center), the central railway station, Platz der Einheit and the Rebstock parkland. It is the city’s last major urban development. Investors and residents will benefit from the prosperous Rhine-Main region’s excellent infrastructure – and enjoy the natural beauty of the Taunus recreational space. aurelis owns Europaviertel West, and is responsible for developing this 670,000 square meter site. The project focuses on the areas to the west of Emser Brücke – Boulevard Mitte, Boulevard West, Parkend, and Helenenhöfe.C1q nephropathy in children: clinical characteristics and outcome. C1q nephropathy has been suggested as a separate disease entity. C1q positivity has also been described in association with nephrotic syndrome (NS) as a potential marker for worse outcome. The aims of this study were to describe the clinical characteristics, laboratory parameters and outcomes of 35 children whose renal histology revealed predominant mesangial C1q deposition and to investigate if the experience at our institution supports the above hypothesis. Clinical and pathological characteristics of all children whose kidney biopsies showed positive C1q staining were retrospectively recorded. The outcome of children with minimal change nephrotic syndrome (MCNS) and predominant mesangial C1q deposition based on C1q staining was compared with that of a concurrent group of children with MCNS with no such immune staining. The median age of the patient cohort was 4.5 years (range 6 months to 16 years), 69 % were boys and 88 % presented with nephrotic syndrome (NS). Children with C1q staining and MCNS had more relapses (p = 0.001) and shorter relapse-free periods (p = 0.033) than those with negative immunostaining, but the long-term outcomes were similar in both groups. Our data do not support C1q nephropathy as a separate diagnostic category. Children with MCNS and mesangial C1q deposition (staining) showed more relapses but no difference in long term renal outcome.Jupe Classic Floor Lamp from Artemide. A beautiful Artemide glass-shade floor lamp with pull switch from the Artemide lighting collection made in Italy. The Jupe floor lamp features a polished aluminum stem and base with classic pull for easy on/off lighting options. The floor lamp features a molded, ribbed and sanded white glass shade atop a steel and aluminum frame that is chromed and polished for the ultimate luster. Jupe's contemporary styling makes it an ideal choice for virtually any room or office. Modern, contemporary, functional and stylish, Artemide's Jupe is a beautiful and very elegant floor lamp that will compliment any decor. The satiny light and silvery finish of the Artemide Jupe Floor Lamp make it a lively counterpoint to darker walls. Designed by Peclar Nalbandian and Guy Bur for Rezek Design, this beautiful floor lamp features Italian styling but is made in the U.S.A. Discover the contemporary decorative and architectural Artemide lighting collection at Stardust. Light bulbs included when you purchase from Stardust! Artemide's Jupe lamp takes 1 (one) standard E26/G30 screw-in type light bulb including incandescent (100W max), CFL, halogen or LED. We recommend to use a dimmable light bulb when you intend to use this Artemide lamp as a bedroom lamp. We will include 1 complimentary 100W E26/G30 standard incandescent light bulb (or similar) with your purchase of the Artemide Jupe Floor Lamp (light bulbs are not included by the manufacturer)! Sourcing the right light bulb can be a time-consuming task. Since we understand you have better things to do, Stardust is more than happy to include a standard incandescent bulb free of charge. It's our way of saying that we care about you!"More Realistic Than Ever" NCAA Football 2005 delivers the most realisticness that I have ever seen. In fact more so than Madden in my opinion. The new features that add to the realisticness are the Big Hit, the Matchup Stick, and Stadium Pulse, and the Create a sign. Now of course when you factor this all in you get a huge plus. But there is only one downfall that can be fixed easily. Of course the A.I. has been totally revamped. Which makes it a little tough to play. Of course you can change the difficulty. Now that I have gotten my little intro out of the way, on to the ratings. Presentation 10/10 The presentation is just awesome. The celebrations have been improved. Now instead of just celebrating after a touchdown, you can do it after a big play like a sack of a long pass or a first down. You can have the fans, players, or the mascot celebrate. It is just unbelievable. Gameplay 9/10 The gameplay has been improved by updating A.I., adding a slew of new features. The Matchup stick tells you who is shakenup, just fine, who has had a good game are is having a bad game. The Big Hit feature let you deliver crushing blows that ups the chance of coughing up the ball. Although if you miss, he's gone. The Stadium Pulse lets you know how pumped up the crowd is and the more pumped up the crowd is, it makes the screen shake and the offensive players controller rumble. Nice feature but a little aggravating. Sound 9/10 The School songs haven't been changed, but the commentary has been redone but it still gets repeated and annoying. (Nothing Surprising though) Buy Or Rent Definitely buy this one. I'm guessing this year will finally be the year NCAA outsells Madden. The new features plus the most in depth Dynasty Mode ever should have you giving the tomahawk chop all the way to the National Championship. This game will blow your mind. It may be a little tough but it gives the most realism I have ever seen. So save up your fifty bucks and head over to your local game store now. You will not be disappointed one bit.Tuesday, 19 June 2012 NCR Sweet potato and chickpea salad and pinterest reflections Now that I have told you all about limes, here is one of the recipes I made with my limes. Not a great success. Great ingredients. Just a fail in seasoning. With a bit of tweaking of the dressing (or maybe trying this lime vinaigrette) and a some hot weather and vegie burgers, I am convinced that I would love this sweet potato and chickpea salad with almond feta and lime. I served the salad with tofu nuggets the first night and enjoyed it but E wasn't so keen. The next night I made a total mess of it by mixing it with some rice. Despite my ambivalence towards this salad, I quite liked the photos. It's one of the ironies of food blogging that ultimately we are making food to taste great but we mainly stimulate your tastebuds through another sense - the eyes! With this in mind, I thought I would share a few more photos from the weekend and reflect upon Pinterest. We went to Fitzroy Market and met my friend Heather. We enjoyed looking at all the trash and treasure. Sylvia had to have a button and I was pleased to find a pair of Clarks shoes for her for a mere $5. Last time the only takeaway food stall was the bbq with (veg) sausages but this month there were stalls with soup, cupcakes, (veg) sausages and slices and cakes. After the market we had a lovely long late lunch at the Gasometer Hotel (more on that soon). Then we came home and both E and Sylvia went to bed and I had almost half an hour to myself before Sylvia woke up again. E slept through until morning! Among the treasures for sale at the market were these wonderful old cameras. They remind me of cameras I have known and those I wish I had known. I really wanted to buy one but I had to resist because I have neither the use nor the
[ 253, 5481, 273, 12264, 16744, 15, 831, 2624, 14, 2727, 588, 9093, 45166, 253, 9777, 273, 6255, 1786, 2515, 275, 253, 3072, 15, 187, 187, 13045, 49, 1139, 2354, 27, 844, 5194, 326, 970, 253, 2624, 745, 4868, 273, 2145, 12, 4081, 407, 611, 405, 2146, 1162, 355, 904, 6469, 778, 45166, 12264, 16744, 15, 844, 16737, 253, 9759, 273, 253, 22260, 273, 15102, 342, 611, 23, 4868, 273, 2145, 12, 432, 5270, 374, 13, 285, 2905, 20121, 432, 253, 8378, 285, 21561, 15, 7820, 13, 359, 823, 271, 3081, 1783, 273, 9273, 3045, 273, 611, 23, 21565, 2219, 342, 1846, 6255, 9360, 2931, 407, 253, 2624, 14, 2727, 7363, 273, 399, 7810, 1797, 15, 380, 5118, 1682, 2624, 14, 2727, 4868, 273, 611, 23, 369, 898, 24728, 342, 17181, 313, 805, 15, 21, 2673, 273, 253, 5014, 4804, 253, 6866, 15, 831, 651, 2085, 10668, 342, 625, 16039, 327, 253, 8996, 273, 12264, 16744, 275, 436, 3072, 15, 844, 2879, 253, 2905, 20121, 275, 253, 13277, 13, 11279, 13, 285, 21561, 15, 187, 187, 3, 34, 9273, 3045, 273, 611, 23, 323, 12488, 247, 48168, 313, 74, 15, 70, 904, 27909, 9360, 285, 10397, 9360, 10, 369, 671, 6730, 15, 36040, 342, 48168, 497, 2931, 347, 1110, 665, 574, 5910, 390, 3687, 7363, 273, 253, 2264, 399, 7810, 1797, 13, 326, 369, 253, 1682, 2624, 14, 2727, 4868, 1119, 275, 247, 2045, 1263, 275, 15732, 905, 1706, 4207, 743, 2170, 762, 253, 6970, 313, 42080, 10, 273, 247, 11452, 24685, 6970, 313, 51, 3231, 10, 285, 253, 5325, 6, 330, 2513, 497, 5118, 21565, 841, 2219, 342, 48168, 327, 253, 25132, 273, 611, 23, 15, 743, 24571, 2624, 14, 2727, 4868, 369, 3413, 1754, 327, 253, 1682, 1422, 3354, 3605, 313, 66, 2020, 273, 7340, 285, 13005, 582, 285, 253, 7340, 13, 13005, 13, 285, 2762, 12177, 11878, 497, 5118, 342, 616, 2629, 6332, 905, 2031, 696, 449, 313, 6377, 854, 14, 26, 13, 13277, 10, 187, 187, 3, 19799, 253, 5014, 13, 3307, 2219, 497, 3636, 347, 1907, 48168, 313, 74, 15, 70, 904, 5910, 390, 3687, 7363, 273, 253, 2264, 399, 7810, 1797, 481, 380, 30728, 21565, 48168, 327, 611, 23, 4868, 369, 470, 15, 26, 746, 313, 2222, 6, 330, 2513, 13, 470, 15, 31013, 14, 17, 15, 26, 2759, 481, 380, 1682, 2624, 14, 2727, 4868, 323, 611, 23, 369, 3636, 347, 898, 24728, 342, 17181, 313, 805, 15, 21, 2673, 273, 253, 5014, 1907, 253, 7363, 4503, 281, 390, 3687, 685, 436, 2624, 14, 2727, 15, 380, 7340, 285, 13005, 497, 470, 15, 46014, 313, 2354, 13, 470, 15, 40991, 10, 285, 470, 15, 35432, 313, 2354, 13, 470, 15, 26045, 582, 2975, 13, 342, 253, 2762, 12177, 4313, 273, 721, 15, 4196, 313, 2354, 13, 470, 15, 15144, 33540, 313, 6377, 2145, 13, 11279, 10, 187, 187, 3, 510, 9273, 3045, 273, 611, 23, 4868, 21565, 48168, 2931, 407, 970, 399, 7810, 1797, 369, 1029, 27, 253, 30728, 369, 470, 15, 26, 746, 13, 342, 253, 7340, 273, 470, 15, 46014, 285, 253, 13005, 273, 470, 15, 35432, 323, 253, 1682, 2624, 745, 4868, 273, 898, 39801, 380, 4560, 310, 2074, 281, 581, 432, 247, 2045, 1263, 275, 4047, 326, 253, 15252, 360, 14, 6160, 12177, 4313, 3395, 2169, 30119, 883, 10, 323, 253, 2624, 745, 7363, 273, 898, 12, 327, 611, 23, 905, 2950, 4207, 1723, 13, 253, 9273, 3045, 285, 253, 1682, 2624, 745, 4868, 273, 253, 30907, 2715, 273, 253, 611, 23, 943, 320, 7515, 407, 10941, 952, 665, 452, 390, 452, 417, 644, 3786, 11245, 342, 6255, 9360, 449, 313, 6377, 1283, 13, 21561, 10, 187, 187, 19, 15461, 380, 14755, 8813, 1677, 275, 3104, 14034, 428, 12652, 13, 12114, 22, 30, 455, 273, 253, 673, 10632, 61, 1051, 40878, 342, 253, 1491, 275, 253, 1563, 6197, 15, 7764, 1056, 352, 2590, 849, 253, 6128, 497, 11691, 15, 187, 187, 13045, 49, 1139, 2354, 27, 844, 403, 1077, 7016, 326, 253, 5740, 369, 3430, 15, 844, 15045, 436, 347, 3637, 26530, 281, 253, 3236, 14755, 1332, 15, 187, 187, 31770, 21, 30, 3074, 273, 253, 673, 13, 495, 30, 10342, 273, 253, 673, 13, 374, 30, 6080, 273, 253, 673, 13, 337, 30, 34, 1652, 273, 253, 673, 13, 285, 470, 30, 11336, 273, 253, 673, 6844, 313, 6377, 608, 13, 13277, 1969, 3189, 16997, 10, 187, 187, 20, 15461, 31322, 15610, 428, 12842, 13, 253, 11572, 1263, 369, 2218, 275, 7783, 16675, 665, 671, 13640, 275, 253, 6774, 12820, 1263, 15, 831, 310, 417, 1332, 11220, 3451, 15, 9240, 7783, 16675, 4479, 2380, 812, 320, 5876, 407, 616, 2720, 2793, 342, 253, 15126, 15, 187, 187, 13045, 49, 1139, 2354, 27, 831, 310, 247, 3240, 1774, 1127, 285, 247, 1781, 12291, 273, 776, 1263, 15, 844, 2879, 247, 5740, 327, 436, 1895, 275, 253, 21561, 27, 187, 187, 3, 10971, 13, 7783, 16675, 665, 10974, 281, 247, 11572, 1263, 497, 671, 12470, 281, 253, 2022, 12820, 1263, 28, 954, 273, 731, 3164, 2686, 13640, 15, 4923, 253, 11572, 1263, 369, 17679, 13, 352, 369, 7479, 281, 2589, 271, 1783, 22914, 1110, 665, 13640, 275, 253, 767, 17276, 15, 1720, 31598, 17276, 452, 644, 2361, 281, 906, 275, 26513, 6128, 281, 10397, 5917, 273, 15102, 905, 2385, 5290, 534, 778, 2818, 253, 4560, 273, 253, 1246, 1263, 449, 313, 6377, 1283, 13, 21561, 10, 187, 187, 21, 15461, 1310, 253, 4388, 310, 281, 897, 253, 611, 23, 275, 3114, 3530, 281, 3601, 323, 12264, 16744, 13, 253, 12820, 5196, 275, 1786, 12440, 310, 1679, 27096, 15, 30478, 265, 403, 625, 2779, 281, 320, 7615, 342, 3533, 2905, 281, 12264, 5917, 685, 253, 2087, 3072, 15, 187, 187, 13045, 49, 1139, 2354, 27, 844, 8558, 11205, 281, 17813, 253, 611, 23, 4311, 281, 3601, 12264, 16744, 2190, 16675, 275, 15732, 15, 1723, 13, 352, 943, 320, 4879, 326, 253, 12820, 273, 253, 1655, 30907, 2715, 273, 611, 23, 878, 281, 320, 2218, 275, 643, 28155, 2390, 390, 253, 3114, 3072, 604, 253, 4311, 310, 281, 320, 3732, 281, 841, 2390, 16, 43221, 15, 844, 11848, 776, 12291, 5740, 281, 1056, 436, 2590, 281, 10668, 15, 187, 187, 3, 6407, 13, 359, 11205, 281, 17813, 253, 611, 23, 4311, 281, 3601, 12264, 16744, 2190, 16675, 13, 247, 2714, 28155, 1387, 762, 1029, 4073, 13, 275, 15732, 15, 30478, 265, 403, 3798, 625, 19149, 685, 2087, 5820, 13, 285, 671, 7615, 342, 3533, 273, 12264, 5917, 2908, 275, 611, 23, 15, 380, 1246, 4342, 778, 417, 320, 14923, 281, 253, 2087, 3072, 390, 2444, 3072, 275, 15732, 15, 380, 13367, 285, 13091, 273, 253, 1246, 4311, 943, 320, 2007, 5762, 275, 841, 7625, 449, 313, 6377, 1283, 13, 21561, 10, 187, 187, 5146, 2490, 187, 42520, 19722, 27, 1847, 375, 4041, 14, 9604, 281, 8439, 398, 15, 7152, 89, 187, 187, 5146, 2490, 187, 7146, 1060, 323, 3081, 941, 1873, 15, 187, 187, 740, 15, 26088, 16, 19317, 15, 2041, 15, 13269, 2405, 746, 15, 83, 4838, 187, 187, 9150, 1297, 23488, 337, 187, 187, 37675, 187, 187, 56, 257, 14, 29627, 187, 187, 42228, 280, 17234, 187, 187, 17737, 9169, 41852, 14, 29627, 19223, 187, 187, 14952, 187, 187, 56, 257, 14, 29627, 19223, 187, 187, 1552, 310, 271, 1527, 2289, 3929, 5939, 762, 253, 2426, 273, 253, 187, 187, 21164, 422, 22695, 5706, 2382, 4637, 187, 187, 13, 534, 16000, 48566, 897, 13, 3268, 13, 285, 21068, 275, 667, 4646, 13, 2530, 253, 3236, 2488, 285, 2603, 403, 26873, 15, 187, 187, 23, 22551, 9169, 187, 187, 49, 11147, 14, 37, 14, 746, 14, 1706, 18390, 51, 18, 187, 187, 19996, 15274, 13367, 13, 3989, 13091, 13, 285, 5382, 2380, 5319, 273, 253, 611, 405, 2146, 721, 4311, 2190, 4675, 16675, 275, 15732, 187, 187, 3859, 2697, 21252, 187, 187, 24723, 3196, 15, 36288, 518, 7588, 13, 187, 187, 8398, 368, 323, 29315, 634, 7714, 281, 11188, 2697, 21252, 15, 2732, 10182, 8180, 13, 359, 1928, 326, 352, 556, 15785, 533, 1057, 417, 4751, 2525, 11188, 2697, 21252, 434, 9311, 6866, 347, 352, 4390, 9572, 15, 3813, 13, 359, 19864, 368, 281, 11929, 247, 17265, 2715, 273, 253, 7714, 326, 12453, 253, 2792, 5439, 1309, 253, 2278, 1232, 15, 187, 187, 41972, 187, 187, 688, 1340, 281, 2085, 247, 625, 3426, 1491, 281, 776, 10668, 327, 253, 9400, 13, 359, 651, 751, 281, 22175, 253, 6349, 281, 2831, 44978, 1077, 3332, 2144, 327, 253, 1072, 9400, 3863, 275, 12114, 3859, 37791, 21252, 393, 3446, 3813, 13, 352, 651, 320, 4122, 14109, 604, 368, 651, 2451, 253, 9410, 3863, 275, 253, 1390, 767, 1107, 273, 12114, 3859, 37791, 21252, 10632, 16616, 3614, 1358, 34859, 15, 446, 375, 15, 2061, 16, 446, 375, 531, 4357, 10, 285, 823, 512, 2144, 4623, 281, 634, 3929, 281, 253, 3806, 1618, 15, 187, 187, 41972, 187, 187, 1231, 651, 11435, 6883, 634, 17265, 7714, 407, 2552, 3127, 9169, 1903, 27, 3046, 9122, 15, 2091, 368, 403, 4704, 281, 11929, 634, 18520, 13, 2412, 327, 281, 654, 3614, 1358, 2700, 15, 20511, 451, 20649, 15, 681, 16, 2041, 4357, 285, 3609, 253, 29792, 5623, 8331, 3532, 7022, 3555, 1297, 4479, 11534, 281, 19912, 634, 7714, 1873, 15, 187, 187, 2042, 368, 651, 751, 281, 1056, 2544, 281, 634, 4832, 13911, 13, 4496, 2486, 634, 9300, 3908, 275, 634, 3835, 4857, 15, 187, 187, 1992, 7278, 253, 38041, 273, 634, 1543, 13, 359, 5583, 326, 604, 7763, 368, 18831, 634, 9965, 14238, 275, 14238, 15, 900, 13, 835, 247, 7241, 476, 320, 7922, 697, 1211, 21674, 313, 13220, 42, 10, 824, 326, 352, 476, 320, 11106, 10939, 275, 253, 2852, 15, 1198, 7997, 923, 27, 654, 2413, 1358, 34859, 15, 446, 375, 15, 2061, 16, 446, 375, 531, 16, 84, 16, 2377, 2230, 14, 4297, 7686, 4, 9450, 14, 77, 2735, 2473, 14, 10075, 12862, 31, 187, 187, 7845, 2486, 253, 1563, 4957, 672, 29315, 634, 17265, 7714, 27, 187, 187, 34, 30080, 22559, 4857, 326, 27019, 281, 1016, 1127, 5439, 407, 253, 11073, 8121, 285, 37317, 9, 84, 481, 831, 4857, 943, 320, 28228, 347, 4858, 1873, 285, 13130, 29792, 9604, 281, 8439, 398, 4479, 15, 34, 7101, 14, 484, 3491, 273, 634, 7714, 326, 16681, 2544, 1160, 281, 253, 3236, 2715, 15, 831, 1873, 943, 320, 28228, 347, 4858, 1873, 285, 13130, 29792, 7498, 1701, 3083, 7468, 342, 31633, 25773, 4479, 15, 1145, 440, 30644, 2715, 273, 634, 17265, 2929, 1293, 27173, 2544, 15, 831, 1873, 943, 320, 28228, 347, 4858, 1873, 285, 13130, 29792, 4779, 7468, 4479, 15, 187, 187, 7845, 3877, 1223, 9046, 634, 2380, 13, 604, 634, 3929, 310, 7607, 13, 368, 778, 452, 253, 5107, 281, 1056, 253, 14218, 2278, 2892, 13644, 2130, 15, 380, 1924, 588, 2486, 8121, 3061, 4876, 313, 3113, 10123, 10, 285, 634, 6128, 281, 37317, 5701, 15, 1310, 13410, 13, 359, 588, 3057, 368, 281, 1478, 275, 390, 562, 15, 187, 187, 1231, 1007, 3579, 281, 6883, 634, 17265, 7714, 15, 187, 187, 18808, 17730, 13, 187, 187, 56, 257, 14, 29627, 19223, 187, 187, 42228, 280, 17234, 187, 187, 3859, 2697, 21252, 187, 187, 1447, 8497, 27, 11685, 44236, 310, 2708, 15, 7764, 513, 417, 12921, 15, 696, 187, 187, 18658, 398, 4479, 5701, 27, 187, 187, 49312, 4479, 84, 26231, 265, 281, 30254, 187, 187, 424, 25821, 281, 253, 10360, 424, 187, 187, 18, 15461, 1310, 253, 4477, 452, 18212, 9713, 634, 5701, 5439, 275, 247, 2045, 3790, 273, 2278, 285, 368, 1928, 326, 436, 7714, 310, 1024, 12207, 323, 9311, 13, 368, 778, 5224, 326, 1060, 281, 18210, 253, 346, 25821, 281, 253, 10360, 3, 2593, 13, 4901, 634, 7344, 273, 1600, 3908, 275, 253, 346, 14044, 9440, 281, 17234, 3, 2593, 13, 285, 11929, 634, 12114, 29011, 10632, 17401, 15, 187, 187, 49312, 13181, 18, 27, 1876, 5701, 452, 644, 9713, 187, 187, 8730, 8730, 8730, 8730, 8730, 187, 187, 19, 15461, 1680, 253, 7714, 22335, 3590, 13, 285, 513, 253, 941, 1329, 253, 11815, 32, 187, 187, 510, 7714, 1364, 6266, 247, 22335, 3590, 5313, 273, 8249, 2561, 342, 941, 326, 8525, 253, 11815, 15, 38166, 1364, 452, 644, 5196, 8132, 29689, 13, 342, 4569, 5760, 13, 14970, 13, 285, 3410, 9552, 15, 380, 11815, 1364, 320, 8392, 20420, 1754, 327, 253, 941, 3559, 15, 187, 187, 49312, 13181, 18 ]
the detection of psychological distress. This cut-off will essentially underestimate the magnitude of mental health conditions in the population. RESPONSE: We agree that using the cut off score of 13+ proposed by Kessler et al., 2003 may underestimate psychological distress. We deleted the presentation of the proportions of respondents with K6 score of 13+ from Table 2, and related descriptions from the Method and Discussion. Instead, we add an additional analysis of screening performance of K6 predicting cases with common mental disorders defined by the cut-off scores of DASS21. The calculated best cut-off score of K6 was 9+, with 129 (12.4%) of the participants meeting the criteria. This would provide readers with more insights on the prevalence of psychological distress in this population. We added the related descriptions in the Methods, Results, and Discussion. "A screening performance of K6 for identifying a CMD (i.e., depressive disorders and anxiety disorders) was also examined. Cases with CMD were defined as those who had 34 or greater scores of the total DASS21, that was the best cut-off score found in a previous study in Vietnam \[34\]. An area under the curve (AUC) of a receiver operative curve (ROC) and the 95% CIs were calculated predicting these cases with CMD on the sore of K6. An optimum cut-off score was determined based on the best Youden index (a sum of sensitivity and specificity), and the sensitivity, specificity, and positive likelihood ratios were calculated with their standard errors \[44\]." (page 8-9, Methods) "Among the participants, 22 cases were identified as having CMD (i.e., 34 or greater scores of the total DASS21). The AUC predicting CMD on K6 score was 0.919 (95% CIs, 0.855-0.984). The best cut-off score for K6 was identified as 9+, with 129 (12.4%) of the participants having the scores equal to or greater than this cut-off. The sensitivity and specificity were 0.864 (SE, 0.073) and 0.876 (SE, 0.031), respectively, with the positive likelihood ratio of 6.96 (SE, 0.121)." (page 13, Results) "The screening performance of K6 score predicting CMD defined by using DASS21 was high: the AUC was 0.919, with the sensitivity of 0.864 and the specificity of 0.876 for the best cut off score of 9+. The finding is similar to one from a previous study in Japan that the stratum-specific likelihood ratio became higher (\>11) for the cut off scores of 9+ on K6 \[46\]. However, the screening performance and the best cut off score of the Vietnamese version of the K6 should be assessed by comparing people who have or have not been previously diagnosed with mental disorders." (page 18, Discussion) 2\. The scoring explanation given in lines 107 - 109, \"5=all of the time\"\... contradicts with the information in the following sentence. Please make it clear how the responses were scored. RESPONSE: We are very sorry that the description was wrong. We corrected this as follows sticking to the original scoring method. "(4=All of the time, 3=Most of the time, 2=Some of the time, 1=A little of the time, and 0=None of the time)" (page 5, Methods -- Measures) 3\. Lines 127 - 128, the pilot study was done in 150 nurses who also participated in the subsequent validation study. This is not methodologically correct. Those 150 nurses\' response could be affected by their prior experience with the questionnaire. RESPONSE: This is a quite important point and a large limitation of our study. We added a description on this problem in the Discussion: "Finally, 150 nurses who responded to a pilot study were also invited to the main validation study; most of them probably actually participated. Because the pilot study was anonymous, it was impossible to conduct an analysis excluding those who participated in the two surveys. Repeated surveys have been reported to result in attenuated responses to anxiety symptoms of respondents \[48\], which may affect the finding of the present study." (page 18, Discussion) 4\. If the aim is to use the K6 in community samples to screen for psychological distress, the validation conducted in health professionals is less informative. Nurses are more likely to be familiar with questions related to psychological symptoms than the general population. RESPONSE: We primarily aimed to validate the K6 scale to screen psychological distress among nurses in Vietnam. However, it should be noted that the validation of the current Vietnamese version of K6 need to be done in other occupational groups or the community population if the scale is to be applied to these groups/populations. We expanded our limitation description to make this clear to readers. "First, we aimed to validate the K6 scale to screen psychological distress among nurses, a special occupational group under high stress, in Vietnam. Nurses are usually more educated than general workers, and also familiar with questions of psychological symptoms included in K6. The present findings may not be generalized to the general population or working population in Vietnam. The reliability and validity of the present scale should be further tested in these populations." (page 18, Discussion) ###### Submitted filename: PlosOne-Response to Reviewers.docx ###### Click here for additional data file. 10.1371/journal.pone.0233119.r003 Decision Letter 1 Tu Wen-Jun Academic Editor © 2020 Wen-Jun Tu 2020 Wen-Jun Tu This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 6 Apr 2020 PONE-D-19-34231R1 Internal consistency reliability, construct validity, and item response characteristics of the Kessler 6 scale among hospital nurses in Vietnam PLOS ONE Dear Dr. Kawakami, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE's publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== In order to provide a more complete information to our readers on the topic, we would like to emphasize the importance to cross referencing very recent material on the same topic published in \"PLoS ONE \". Therefore, it would be highly appreciated if you would check the contents published in the last two years of \"PLoS ONE\" (<https://journals.plos.org/plosone/>) and add all material relevant to your article to the reference list. ============================== We would appreciate receiving your revised manuscript by May 21 2020 11:59PM. When you are ready to submit your revision, log on to <https://www.editorialmanager.com/pone/> and select the \'Submissions Needing Revision\' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: <http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols> Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled \'Response to Reviewers\'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled \'Revised Manuscript with Track Changes\'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled \'Manuscript\'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Wen-Jun Tu Academic Editor PLOS ONE \[Note: HTML markup is below. Please do not edit.\] Reviewers\' comments: Reviewer\'s Responses to Questions **Comments to the Author** 1\. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the "Comments to the Author" section, enter your conflict of interest statement in the "Confidential to Editor" section, and submit your \"Accept\" recommendation. Reviewer \#1: All comments have been addressed \*\*\*\*\*\*\*\*\*\* 2\. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer \#1
[ 313, 39402, 8435, 305, 129, 244, 84, 135, 219, 85, 1392, 87, 391, 39353, 135, 219, 1200, 2381, 392, 10, 544, 2364, 1092, 1668, 3712, 1253, 1166, 1423, 13, 19688, 1673, 278, 19032, 15, 2596, 273, 253, 490, 46701, 7027, 10284, 1103, 273, 8444, 47990, 275, 253, 11442, 3660, 13, 344, 4546, 271, 1774, 629, 275, 253, 19701, 4544, 273, 1722, 520, 1253, 20, 285, 16473, 313, 1166, 3071, 10, 253, 5678, 7247, 13, 19701, 13, 285, 32008, 251, 5621, 387, 22864, 461, 324, 85, 13, 13710, 273, 367, 6002, 11943, 15, 754, 11704, 8444, 327, 521, 27485, 4544, 15, 2091, 8444, 369, 22988, 317, 15281, 407, 247, 10785, 816, 1078, 253, 6680, 273, 3130, 85, 2623, 313, 1166, 2693, 582, 344, 11162, 1720, 73, 2224, 5985, 2381, 392, 17747, 275, 7015, 15, 380, 6680, 369, 37359, 323, 253, 29281, 314, 562, 48085, 11042, 265, 28, 1720, 73, 2224, 5985, 2381, 392, 2994, 369, 10848, 407, 253, 24794, 15, 50, 27, 187, 187, 27363, 660, 18225, 4803, 275, 20494, 323, 17417, 187, 187, 1552, 310, 247, 2127, 281, 3653, 604, 253, 3904, 275, 253, 1618, 403, 4335, 390, 417, 313, 16659, 19, 2262, 187, 2520, 2987, 313, 18, 2262, 187, 50274, 45, 426, 544, 21, 1157, 898, 13, 2145, 13, 1458, 13, 1668, 62, 535, 50274, 1545, 2248, 257, 2764, 21, 14850, 187, 50270, 1542, 891, 275, 418, 27, 187, 50266, 681, 993, 26217, 2764, 426, 16708, 187, 50266, 1542, 1269, 275, 2491, 9, 19, 13, 74, 2262, 187, 50262, 338, 891, 6, 89, 2295, 470, 27, 187, 50258, 681, 993, 26217, 2764, 426, 11793, 50264, 187, 50258, 7054, 187, 50266, 338, 21515, 26217, 2764, 27, 187, 50262, 3845, 17280, 84, 310, 417, 247, 4335, 1180, 3, 2462, 891, 50270, 187, 50266, 7271, 27, 50275, 187, 50262, 3845, 17280, 84, 4110, 247, 4335, 1180, 3, 2462, 891, 535, 50274, 13374, 257, 2764, 21, 1082, 187, 187, 1989, 436, 1057, 417, 313, 19, 2262, 187, 50274, 45, 426, 544, 21, 1157, 898, 13, 2145, 13, 1458, 13, 1668, 62, 535, 50274, 1545, 2248, 257, 2764, 21, 14850, 187, 50270, 681, 993, 26217, 2764, 426, 16708, 187, 50270, 1542, 891, 275, 418, 27, 187, 50266, 1542, 1269, 275, 2491, 9, 19, 13, 74, 2262, 187, 50263, 338, 891, 6, 89, 2295, 470, 27, 187, 50259, 681, 993, 26217, 2764, 426, 11793, 50263, 187, 50259, 7054, 187, 50266, 338, 21515, 26217, 2764, 27, 187, 50262, 3845, 17280, 84, 310, 417, 247, 4335, 1180, 3, 2462, 891, 50270, 187, 50266, 7271, 27, 50275, 187, 50262, 3845, 17280, 84, 4110, 247, 4335, 1180, 3, 2462, 891, 535, 50274, 13374, 257, 2764, 21, 1082, 187, 187, 262, 4245, 253, 1180, 2145, 347, 417, 247, 4335, 15, 187, 1989, 2139, 32, 187, 35861, 281, 436, 29134, 27, 187, 17624, 11451, 273, 253, 1810, 18225, 16228, 32, 187, 3, 4041, 273, 253, 3687, 37700, 281, 1142, 38782, 398, 281, 13814, 310, 326, 247, 323, 6287, 1057, 417, 2794, 247, 4778, 7990, 3, 275, 743, 26760, 10664, 522, 7080, 434, 3662, 187, 601, 309, 8564, 253, 1318, 346, 282, 8765, 3, 715, 253, 1159, 7990, 27, 187, 4609, 310, 253, 1083, 342, 247, 2014, 323, 6287, 187, 11667, 27, 187, 50274, 1545, 1159, 14850, 187, 50270, 74, 426, 898, 187, 50270, 76, 426, 16708, 187, 50270, 1542, 1269, 275, 2491, 9, 19, 13, 898, 2262, 187, 50266, 338, 891, 6, 89, 2295, 470, 27, 187, 50262, 76, 426, 11793, 50262, 187, 50262, 7054, 535, 50270, 3845, 465, 187, 187, 4609, 22774, 465, 426, 11793, 594, 253, 4778, 4391, 187, 2598, 619, 1953, 310, 27, 6049, 2506, 626, 253, 4778, 346, 681, 993, 26217, 2764, 3, 1818, 275, 313, 19, 6177, 187, 2042, 247, 323, 6287, 2506, 626, 452, 7990, 2139, 3548, 626, 253, 4778, 247, 1980, 4778, 275, 253, 1159, 32, 2139, 2506, 626, 352, 346, 282, 518, 949, 7019, 8136, 1097, 323, 17417, 3, 285, 12365, 598, 347, 247, 1980, 4778, 275, 253, 1159, 809, 15, 187, 42, 1353, 2820, 281, 2096, 253, 15548, 7990, 4803, 984, 309, 1053, 626, 1158, 309, 755, 352, 4336, 15, 9375, 275, 7170, 2, 187, 187, 34, 27, 187, 187, 1552, 310, 417, 247, 7990, 2523, 15, 380, 2523, 310, 326, 672, 368, 9212, 2248, 257, 2764, 426, 16708, 3304, 253, 323, 6287, 13, 326, 12714, 6569, 1046, 673, 368, 564, 949, 253, 6287, 15, 733, 501, 1507, 253, 1318, 281, 16708, 1046, 673, 15, 187, 3039, 368, 9212, 2248, 257, 2764, 426, 16708, 1840, 253, 6287, 13, 352, 760, 4850, 7922, 326, 1039, 2378, 13, 594, 2248, 257, 2764, 4558, 11793, 846, 253, 806, 673, 352, 434, 873, 281, 11793, 15, 187, 9917, 13, 2248, 257, 2764, 310, 247, 11527, 1416, 323, 247, 4778, 326, 6492, 1880, 247, 1180, 310, 8212, 15, 535, 4, 5642, 14375, 3887, 11840, 4888, 187, 817, 337, 15, 20, 15, 22, 4888, 187, 14, 32134, 11097, 2634, 21605, 14, 12919, 38416, 30159, 33904, 14440, 362, 19, 22862, 2523, 4888, 187, 817, 337, 15, 20, 15, 21, 4888, 187, 14, 32157, 2634, 21605, 14, 12919, 65, 1159, 281, 5416, 326, 1232, 310, 6331, 275, 9630, 1039, 4888, 187, 817, 337, 15, 20, 15, 20, 4888, 187, 14, 32134, 11097, 2634, 3633, 14, 2946, 27383, 11930, 38416, 4993, 1854, 310, 9617, 4888, 187, 817, 337, 15, 20, 15, 19, 4888, 187, 14, 32134, 11097, 2634, 3633, 14, 2946, 27383, 11930, 38416, 1024, 12255, 604, 1854, 310, 9617, 4888, 187, 817, 337, 15, 20, 15, 18, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 2946, 27383, 11930, 38416, 6235, 3149, 4465, 2634, 5, 12428, 65, 4764, 432, 43531, 14, 5455, 672, 29072, 253, 23595, 914, 12543, 2776, 15, 4888, 187, 817, 337, 15, 20, 15, 17, 4888, 187, 14, 2634, 3633, 14, 15131, 422, 23074, 38416, 5057, 253, 1655, 17335, 970, 2067, 3082, 4888, 187, 817, 337, 15, 19, 15, 17, 4888, 187, 14, 7890, 2634, 5, 25424, 2149, 39988, 65, 275, 512, 3470, 281, 1581, 323, 2852, 7466, 285, 6821, 255, 1076, 2470, 4, 23, 1797, 880, 3614, 1358, 7280, 15, 681, 16, 348, 12049, 90, 16, 348, 12049, 90, 14, 6443, 442, 1301, 471, 1131, 16, 22402, 16, 23, 1797, 1228, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 65, 29072, 273, 11865, 4508, 9484, 47647, 15, 4888, 187, 817, 337, 15, 18, 15, 17, 190, 187, 14, 2634, 3633, 14, 31130, 39780, 47953, 38416, 5057, 253, 1735, 30732, 4446, 4857, 4888, 187, 817, 337, 15, 17, 15, 24, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 12201, 476, 1024, 452, 3904, 275, 616, 4454, 13, 5727, 1078, 13, 3253, 2469, 253, 1180, 651, 320, 28069, 285, 253, 7908, 651, 1614, 715, 247, 12419, 15, 4888, 187, 817, 337, 15, 17, 15, 23, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 2946, 27383, 11930, 38416, 33904, 14440, 374, 476, 417, 8171, 327, 3635, 1318, 15, 4888, 187, 817, 337, 15, 17, 15, 22, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 2447, 12543, 36169, 4814, 38416, 33904, 14440, 374, 22862, 15, 190, 187, 14, 322, 46711, 5520, 10097, 273, 2634, 3633, 14, 2447, 12543, 36169, 4814, 16433, 4888, 187, 817, 337, 15, 17, 15, 21, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 33904, 14440, 374, 7505, 42182, 2470, 4, 40760, 880, 3614, 1358, 7280, 15, 681, 16, 348, 12049, 90, 16, 348, 12049, 90, 14, 6443, 442, 1301, 471, 1131, 16, 22402, 16, 40760, 5029, 4888, 187, 817, 337, 15, 17, 15, 20, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 2228, 672, 29072, 273, 1854, 15, 4888, 187, 817, 337, 15, 17, 15, 19, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 8916, 27589, 374, 22862, 15, 4888, 187, 817, 337, 15, 17, 15, 18, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 440, 8952, 833, 2634, 3433, 84, 65, 281, 789, 327, 8916, 27589, 374, 15, 4888, 187, 817, 337, 15, 17, 4888, 187, 14, 353, 1326, 264, 2634, 2188, 14, 348, 16856, 15, 24210, 16433, 190, 187, 14, 353, 1326, 264, 2634, 348, 12049, 90, 14, 328, 12543, 15, 24210, 16433, 190, 187, 14, 32157, 2634, 3633, 14, 22113, 15554, 11930, 65, 190, 187, 14, 32157, 2634, 2775, 14375, 3887, 11840, 15, 6535, 65, 285, 2634, 13587, 5288, 15, 6535, 16433, 190, 187, 14, 7567, 514, 4263, 285, 625, 10097, 15, 4888, 187, 817, 470, 15, 18, 15, 20, 4888, 187, 14, 2634, 3633, 14, 9770, 8590, 38416, 50276, 20865, 1873, 342, 448, 16856, 4184, 932, 15, 2379, 34, 1048, 2312, 670, 9542, 10450, 187, 688, 34929, 6590, 13, 347, 275, 34929, 1495, 13, 627, 403, 247, 2257, 273, 10450, 281, 320, 5469, 15, 380, 9013, 32099, 310, 247, 8574, 8979, 313, 1439, 347, 11216, 347, 247, 2534, 10, 533, 253, 3676, 285, 14282, 84, 476, 671, 1379, 1659, 275, 253, 8158, 13, 327, 1048, 16771, 390, 327, 253, 30929, 1108, 347, 1060, 13, 342, 743, 3024, 442, 378, 2980, 285, 28798, 570, 13856, 275, 380, 29219, 6272, 1876, 10154, 187, 187, 510, 268, 3134, 2940, 275, 247, 3644, 9741, 187, 22737, 2389, 3753, 13, 3782, 21327, 13, 285, 3782, 21327, 275, 534, 597, 476, 2940, 16821, 285, 2312, 670, 616, 10450, 13, 390, 5046, 20016, 247, 25415, 10135, 275, 247, 10617, 90, 30084, 1123, 313, 1439, 247, 43398, 3296, 1204, 10, 428, 751, 436, 581, 275, 2752, 14538, 273, 10540, 187, 187, 510, 1048, 13, 12939, 555, 8158, 323, 767, 187, 688, 253, 5086, 11730, 6440, 13, 368, 452, 253, 1048, 16846, 6200, 15, 1310, 627, 310, 47284, 3058, 275, 253, 34929, 6440, 13, 840, 1902, 247, 6200, 275, 534, 767, 2255, 755, 715, 253, 8158, 13, 28990, 1066, 285, 2312, 670, 616, 10450, 428, 751, 12694, 11276, 285, 353, 571, 401, 2501, 275, 7743, 16357, 2013, 2421, 187, 187, 510, 17046, 17603, 10831, 187, 42297, 13, 368, 476, 13398, 5534, 1373, 285, 1824, 407, 458, 15609, 16505, 13102, 715, 271, 1527, 14, 1094, 6363, 285, 6821, 3834, 1475, 247, 2372, 15, 24504, 2071, 2084, 285, 427, 506, 267, 466, 5687, 858, 352, 14665, 1312, 3740, 275, 2752, 14538, 273, 10540, 28, 3532, 306, 20163, 285, 7682, 885, 35122, 858, 352, 1327, 14, 5401, 1312, 3740, 275, 13303, 19348, 187, 187, 510, 26183, 13, 1029, 14, 31503, 2471, 187, 3650, 512, 11730, 6590, 990, 275, 253, 3226, 2970, 253, 3226, 387, 690, 10864, 16879, 5197, 31493, 40847, 313, 68, 23520, 13, 21327, 13, 45731, 13, 17120, 481, 13168, 1146, 11730, 310, 1892, 13, 285, 627, 403, 513, 4182, 13, 1053, 457, 85, 14, 13060, 14, 251, 14, 66, 14, 27180, 6590, 281, 4887, 436, 13, 824, 347, 22707, 775, 311, 26063, 7381, 457, 84, 4855, 3975, 187, 187, 24788, 1417, 9239, 8577, 281, 440, 1987, 404, 494, 32225, 187, 2290, 1225, 6443, 10610, 10684, 23660, 84, 310, 253, 8198, 485, 273, 436, 6727, 365, 13, 275, 534, 767, 1481, 9072, 1937, 375, 3254, 313, 35293, 407, 443, 1758, 443, 398, 25224, 285, 12694, 6193, 76, 2205, 10, 27753, 326, 616, 22500, 2343, 31816, 273, 581, 1529, 310, 2686, 247, 2914, 323, 2266, 11730, 10450, 187, 187, 32478, 3354, 14, 37716, 39880, 187, 1552, 973, 14, 88, 1575, 7484, 2813, 8687, 247, 3786, 45692, 3416, 1907, 247, 10084, 28423, 326, 703, 310, 17755, 281, 253, 11730, 14, 282, 18197, 1959, 5968, 665, 556, 8423, 5966, 617, 1495, 15, 733, 434, 6571, 3710, 281, 253, 6945, 10102, 681, 342, 40659, 4404, 572, 11131, 428, 751, 33717, 272, 29489, 23202, 187, 187, 34, 2210, 80, 407, 775, 4213, 10093, 1023, 87, 525, 90, 16, 10314, 468, 3545, 40826, 16, 13378, 66, 8502, 55, 455, 187, 2042, 667, 273, 253, 1840, 2255, 310, 275, 253, 5248, 13, 627, 310, 2779, 281, 320, 690, 2312, 670, 10450, 15, 2732, 27014, 5037, 457, 85, 34712, 13, 775, 4213, 10093, 1023, 87, 525, 90, 1213, 1911, 1070, 247, 5694, 67, 2804, 275, 1310, 2053, 8799, 84, 16574, 25664, 374, 28, 285, 275, 5091, 84, 11332, 14165, 3085, 380, 32016, 13, 8148, 66, 8502, 55, 455, 1014, 7120, 247, 1894, 34452, 281, 320, 247, 34929, 187, 187, 34, 557, 29340, 314, 40308, 16, 1221, 287, 35846, 187, 44, 739, 272, 29489, 23202, 2427, 323, 253, 9002, 90, 14272, 24455, 1928, 15, 1997, 20787 ]
(kärl gŭsˈtäv rānˈshöld) [key], 1651–1722, Swedish field marshal. One of the ablest lieutenants of Charles XII in the Northern War, he played an important part in the Polish campaign of 1701–3 and defeated (1706) the combined Russian, Polish, and Saxon forces at Fraustadt, SW of Poznan. He accompanied Charles on his Ukrainian campaign. When Charles was incapacitated by a wound just before the battle of Poltava (1709), he appointed Rehnskiöld commander in chief. The battle was disastrous for the hopelessly outnumbered Swedes; Rehnskiöld himself was captured by the Russians.Q: Python scoping rules in nested for loops This is a code to determine if the numbers in the list are prime or not (python2): this works (1): L = [4 , 9, 13, 15, 16] def primenumber4(): for i in L: compositenumber = False for x in range(2,i): if i%x == 0: compositenumber = True break if compositenumber: print "%s is not a prime number" % i else: print "%s IS a prime number" % i primenumber4() But this does not (2): L = [4 , 9, 13, 15, 16] def primenumber4(): compositenumber = False for i in L: for x in range(2,i): if i%x == 0: compositenumber = True break if compositenumber: print "%s is not a prime number" % i else: print "%s IS a prime number" % i primenumber4() it gives the number 13 as not a prime. But why? according to this tread: Short Description of the Scoping Rules? "One of the greater surprises to many newcomers to Python is that a for loop does not create a variable scope" in Antti Haapala's answer so I imagine the value "leaks" into the function scope: which is the case with a single for loop example: def function(): i = 9 k = False for x in range(2, 9): if i%x == 0: k = True break print k which prints k = True so the variable changed So my question is: Why doesn't the variable "compositenumber" change in (2)? If a for loop doesn't have scope why isn't the variable a local variable in the function? why doesn't it "leak through twice passing both for loops" and ending up as a local variable in the function def. I'm trying to understand the python scope rules because I don't think I get it completely. Thanks in advance! A: This is not a scope issue. The issue is that when you assign primenumber = False inside the for loop, that assignment happens every time you go through the loop. It resets the value to False every time. When you assign primenumber = False above the loop, it only gets assigned that way once, so primenumber remains True after the first time it's set to True. Also, primenumber is a terrible name for a variable that indicates whether a number is composite. # CHANGELOG ## 1.3.5 - Bugfix `Remove-Process`: Fixed Powershell v2 compatibility issue ## 1.3.4 - Added `Remove-Process` function to ensure that process is stopped in reliable way ## 1.3.3 - Bugfix `Get-AppInstallLocation`: fix path is directory ## 1.3.2 - Bugfix `Get-AppInstallLocation`: now checks if path is directory ## 1.3.1 - Bugfix in `Get-AppInstallLocation`: Removed extra `$location` parameter from Split-Path when parsing the registry UninstallString. ## 1.3.0 - `Get-EffectiveProxy`: Get the current proxy using several methods ## 1.2.0 - Use `$IgnoredArguments` in all functions to allow for future expansion and splatting ([#621](https://github.com/chocolatey/chocolatey-coreteampackages/issues/621)) - Bugfix in `Get-PackageParameters` parsing of paths containing symbol chars. ## 1.1.0 - `Get-AvailableDriveLetter`: Get the next unused drive letter ## 1.0.7 - Bugfix in `Get-PackageParameters`: flags can now have numbers in their names, whereas before, everything past the number would be truncated and the flag would turn into a boolean. ## 1.0.6 - Bugfix in `Get-AppInstallLocation`: Powershell 2 can not replace on null value. ## 1.0.5 - Bugfix in `Get-UninstallRegistryKey`: Powershell 2 compatibility. - Slightly improved documentation of `Get-UninstallRegistryKey`. ## 1.0.4 - Bugfix in `Get-PackageParameters`: Powershell 2 bug workaround ([#465](https://github.com/chocolatey/chocolatey-coreteampackages/issues/465)). ## 1.0.3 - Bugfix in `Get-PackageParameters`: error when parsing of path. ## 1.0.2 - Bugfix in `Get-PackageParameters`: PowerShell 2 compatibility. ## 1.0.1 - Bugfix in `Get-PackageParameters`: unaliased `sls` to work on PowerShell 2. ## 1.0 - Merged `mm-choco.extension`. - Merged `chocolatey-uninstall.extension`. - Added `Get-PackageCacheLocation` - Added `CHANGELOG.md` and `README.md`. - Refactoring and more documentation. ## 0.1.3 - `Get-WebContent`: Download file with choco internals. A long talk about complicated feelings In lesbian films, as in lesbian life, there are a lot of feelings to be discussed. The preferred locale is a coffee shop (not as loud as a bar) but the deep and meaningfuls can also take place in the bath, on long walks or on the sofa – as here, with Annette Bening and Julianne Moore in The Kids Are All Right The pensive walk in a dark forest Women love nature, particularly forests, and particularly forests in which they can walk dramatically and talk about their feelings, or maybe steal a forbidden kiss in a leafy enclave (not a euphemism) - like this one in My Summer of Love The long, chatty bath for two In the male gay movie, you have the long shower scene. If there is exposition needed in the lesbian movie, then expect a scene in which two women get into the bath, scrub down and talk about their feelings - like Elizabeth Taylor and Mia Farrow in Secret Ceremony The spontaneous outdoor swim Alternatively, you can combine woodland and water by leaping recklessly into an open-air pool and splashing around a bit. Emily Blunt and Nathalie Press did it arthouse style in My Summer of Love; Neve Campbell and Denise Richards did it non-arthouse style in Wild Things The tragic, high-concept death Not all gay films end in the girl getting the girl at some giant fantasy Center Parks cafe (coffee, forests, baths, swimming). Sometimes being gay is hard, and there are doomy, don’t-watch-on-a-Sunday films to reflect this, such as Lisa Cholodenko’s High Art Bottomless hate turning to uncontainable lust Trashcore classic Showgirls is the epitome of this trope, in which two headstrong opposites (played by Gina Gershon and Elizabeth Berkley) realise that their passionate loathing of one another is actually a front for strong gay feelings Sudden-onset homosexuality This well-worn plot device involves a previously heterosexual woman having a surprising revelation that she is attracted to the gay-leaning free spirit who has suddenly entered her life. It's mostly limited to the alt romcom with aspirations towards quirk - like Kissing Jessica Stein A cameo by Chloë Sevigny/Piper Perabo/Clea DuVall If any of the above women is in the cast, there is likely to be some talk about feelings. After Boys Don’t Cry, Chloë Sevigny straddled a motorbike in If These Walls Could Talk 2; and in 90s teen alien film The Faculty, Clea DuVall even plays a character pretending to be a lesbian A discerningly indie/retro soundtrack Kissing Jessica Stein went for the Woody Allen jazz feel. Grunge
[ 27, 346, 23631, 13052, 8034, 19500, 5017, 751, 20839, 378, 466, 589, 3707, 479, 47285, 3446, 1621, 15, 1707, 403, 952, 562, 627, 665, 3894, 634, 6284, 15, 1707, 403, 1014, 6068, 665, 588, 1555, 368, 23395, 285, 346, 1212, 2845, 4513, 634, 4677, 449, 5402, 673, 651, 320, 1805, 5262, 2819, 323, 731, 2581, 685, 7445, 3006, 247, 313, 69, 781, 763, 10, 29934, 1894, 15, 187, 187, 33, 51, 19214, 5220, 13, 896, 275, 380, 6258, 13, 634, 346, 1915, 11170, 4677, 3, 369, 14109, 604, 285, 760, 604, 352, 369, 4964, 25483, 16745, 313, 395, 10159, 273, 634, 3626, 5281, 13, 368, 2761, 1900, 14782, 247, 260, 641, 292, 16, 72, 1817, 282, 16, 22202, 15563, 2476, 582, 594, 352, 434, 417, 751, 253, 6984, 9730, 8685, 369, 512, 670, 2133, 34324, 16, 14764, 593, 15, 187, 187, 33, 43, 27475, 466, 11739, 1711, 952, 18234, 365, 670, 4688, 6838, 512, 253, 673, 13, 1039, 7197, 685, 667, 2872, 1436, 309, 871, 15, 187, 2302, 13, 1841, 497, 5803, 2133, 14, 10247, 15, 380, 2398, 1031, 79, 4200, 287, 265, 285, 8174, 507, 497, 14109, 984, 597, 497, 4964, 25483, 265, 15, 3105, 984, 597, 497, 346, 6549, 3, 346, 1915, 11170, 3, 2255, 15, 187, 187, 52, 798, 15, 11243, 253, 4857, 8406, 943, 564, 1790, 275, 253, 7145, 342, 512, 253, 305, 932, 665, 1333, 10739, 751, 346, 42, 1353, 417, 247, 32411, 533, 3255, 984, 326, 434, 835, 19063, 32836, 323, 253, 13918, 84, 14125, 15, 496, 253, 7145, 15, 6166, 247, 246, 5916, 15, 7900, 359, 476, 626, 923, 352, 15, 187, 187, 33, 9325, 494, 14, 48915, 8186, 309, 816, 10141, 283, 8505, 846, 368, 4822, 5307, 16, 28306, 16, 25463, 2792, 13, 368, 755, 247, 370, 938, 27781, 1235, 27781, 2313, 44254, 323, 667, 10301, 368, 476, 1984, 327, 253, 2670, 32, 1244, 368, 3798, 755, 2233, 2792, 591, 28930, 13, 594, 352, 434, 6571, 247, 346, 90, 333, 13, 2792, 1476, 2181, 13, 5734, 368, 564, 562, 281, 6008, 247, 2257, 285, 2098, 281, 513, 594, 275, 7170, 15, 187, 187, 13924, 4754, 13, 253, 1175, 1711, 1897, 2, 20492, 27100, 1433, 13, 401, 36746, 8702, 15, 19348, 497, 346, 12311, 3, 323, 4555, 581, 1355, 8223, 273, 253, 3072, 27, 4951, 13, 5219, 1821, 15, 5418, 952, 812, 12345, 6273, 13, 285, 2255, 4571, 626, 1527, 12835, 4310, 8553, 13, 2190, 247, 28126, 643, 19201, 1841, 15, 1292, 1339, 434, 9106, 564, 896, 2, 7840, 3329, 20653, 5417, 42, 2415, 13, 43360, 37, 2300, 47, 1433, 15, 187, 187, 42, 1158, 436, 4857, 369, 3542, 407, 247, 29723, 275, 247, 3686, 273, 29874, 16879, 13, 751, 346, 42, 1833, 923, 604, 2255, 31065, 5194, 342, 479, 285, 619, 448, 1952, 8498, 2531, 40484, 323, 253, 1897, 672, 309, 812, 48428, 731, 347, 3906, 45069, 2, 187, 187, 9917, 309, 1663, 34941, 6984, 9730, 434, 346, 4013, 1007, 597, 1472, 322, 6329, 47339, 285, 322, 4237, 6905, 359, 1472, 594, 31501, 3489, 1864, 3, 285, 352, 434, 816, 824, 247, 3965, 2819, 533, 9826, 921, 15, 380, 760, 1175, 2181, 670, 352, 310, 253, 8142, 3740, 15, 187, 187, 33, 547, 4978, 1707, 369, 247, 1270, 3929, 247, 4564, 1107, 896, 327, 849, 253, 921, 5605, 281, 452, 697, 15221, 285, 6008, 352, 1512, 1969, 597, 22830, 597, 403, 18577, 616, 9881, 387, 512, 436, 346, 42996, 3, 3768, 16858, 13, 533, 1663, 597, 2057, 971, 253, 6966, 1318, 273, 247, 12821, 3416, 10470, 390, 253, 7185, 281, 320, 3499, 23522, 2825, 382, 285, 1750, 352, 434, 9493, 15, 187, 187, 42, 812, 816, 391, 386, 323, 1897, 670, 952, 36123, 3006, 29778, 13, 3340, 275, 1110, 806, 4564, 273, 12396, 15, 1500, 310, 50063, 13, 533, 417, 17400, 6051, 15, 1244, 512, 253, 4606, 281, 26930, 29778, 403, 39838, 264, 342, 3731, 462, 1362, 90, 13, 2825, 1204, 13, 2133, 8672, 285, 2087, 4109, 725, 5025, 405, 326, 564, 2112, 342, 11994, 84, 15, 187, 187, 33, 81, 1432, 33830, 10037, 1500, 816, 3133, 20802, 1024, 13, 2506, 626, 703, 32, 6975, 13, 703, 310, 9995, 281, 452, 12759, 9366, 313, 249, 15866, 273, 253, 2105, 10, 533, 310, 816, 11870, 273, 8133, 598, 342, 253, 10739, 15, 1500, 908, 281, 320, 512, 670, 253, 3906, 4803, 708, 19868, 13, 533, 9377, 352, 512, 436, 1390, 2563, 672, 703, 1407, 2400, 26411, 562, 273, 253, 8784, 251, 4804, 15, 1707, 369, 642, 346, 282, 18197, 275, 3, 896, 840, 15, 187, 187, 33, 81, 1432, 33830, 10037, 11739, 637, 15, 309, 1158, 29778, 310, 247, 378, 2300, 39, 275, 594, 1142, 4088, 13, 285, 326, 703, 310, 16088, 2266, 984, 273, 512, 253, 10739, 703, 434, 574, 281, 2968, 342, 13, 285, 326, 703, 434, 7303, 281, 1056, 18616, 796, 562, 273, 253, 458, 23787, 703, 434, 644, 1677, 13, 323, 253, 954, 629, 15, 309, 452, 247, 1524, 2602, 6308, 323, 617, 1051, 533, 617, 1495, 32, 1680, 417, 17400, 6051, 387, 512, 15, 187, 187, 33, 67, 1173, 16249, 249, 309, 1353, 594, 3212, 15, 309, 878, 281, 5834, 598, 327, 2952, 608, 1580, 352, 434, 327, 25456, 1024, 13, 285, 840, 3698, 721, 15, 309, 1871, 2218, 247, 3965, 1175, 2628, 670, 417, 15695, 4837, 1841, 323, 4266, 13, 2167, 6984, 9730, 3548, 626, 347, 15695, 6731, 5536, 347, 690, 2722, 15, 187, 187, 1989, 432, 253, 1841, 309, 1849, 2326, 13, 29778, 310, 594, 1027, 15, 309, 5476, 309, 1353, 9995, 326, 703, 434, 703, 20802, 13, 275, 247, 1039, 15, 187, 187, 1147, 434, 247, 34303, 1894, 12423, 285, 47831, 20069, 21557, 7120, 253, 10739, 562, 273, 752, 703, 434, 1677, 15, 3973, 18605, 29778, 651, 452, 16037, 2122, 387, 11604, 29778, 323, 642, 3356, 1146, 594, 19456, 347, 281, 1691, 512, 617, 11624, 275, 690, 29723, 434, 11281, 13, 751, 690, 1315, 37028, 3226, 665, 556, 642, 3524, 273, 45906, 973, 15, 187, 187, 33, 1148, 64, 5598, 248, 339, 309, 8523, 1904, 626, 751, 29778, 13, 10571, 984, 703, 369, 3686, 273, 30446, 281, 49567, 275, 253, 5068, 13, 285, 247, 1158, 253, 269, 37567, 689, 617, 574, 247, 1175, 2372, 281, 513, 342, 352, 15, 1292, 309, 858, 452, 247, 19040, 2602, 6308, 323, 29778, 15, 187, 187, 10795, 79, 626, 253, 43178, 8968, 326, 1146, 29778, 310, 253, 4588, 9065, 32, 29778, 3637, 13556, 253, 4803, 273, 1146, 247, 3416, 27, 703, 434, 3965, 13, 17497, 533, 1327, 14, 33897, 13, 892, 4580, 255, 784, 13, 285, 26091, 512, 1110, 27246, 4742, 440, 1342, 314, 4278, 15, 1500, 11532, 275, 253, 985, 13, 285, 11121, 326, 604, 703, 7120, 617, 8364, 987, 13, 703, 1833, 17129, 973, 285, 990, 598, 275, 253, 35821, 15, 41624, 13, 253, 921, 310, 3965, 15958, 285, 31444, 617, 2970, 35598, 689, 313, 1761, 264, 13, 7028, 281, 17845, 382, 13, 1907, 4832, 3237, 13, 32806, 342, 1429, 10, 5747, 617, 4882, 407, 253, 4803, 15, 1500, 434, 4737, 326, 2255, 476, 1620, 2686, 3330, 275, 20110, 12638, 15, 187, 187, 1051, 15953, 13, 309, 1849, 574, 247, 1643, 17208, 285, 309, 717, 11557, 90, 15, 3105, 387, 368, 2, 1292, 436, 310, 247, 564, 14, 936, 1386, 323, 479, 27, 12445, 14896, 275, 253, 20110, 12638, 13, 1014, 253, 952, 665, 1646, 281, 13, 984, 253, 13947, 8847, 273, 20110, 12638, 310, 281, 2028, 952, 665, 16, 5371, 16, 5430, 597, 943, 320, 13, 10159, 273, 6612, 15, 1893, 13, 4754, 13, 690, 952, 5649, 275, 4088, 326, 403, 7964, 1774, 285, 33631, 313, 40744, 1037, 13, 8269, 3146, 13, 3966, 582, 533, 9142, 13, 20110, 12638, 310, 247, 3490, 751, 12926, 27, 352, 40581, 4130, 1066, 15, 187, 187, 42, 452, 36968, 7487, 6984, 9730, 6651, 26727, 984, 309, 574, 247, 3331, 326, 3078, 281, 3522, 5037, 23701, 468, 390, 5046, 816, 320, 20512, 15598, 264, 407, 779, 285, 352, 3531, 619, 12607, 15, 5220, 13, 717, 309, 3815, 1060, 13, 390, 1057, 10354, 25478, 816, 1007, 751, 247, 27370, 265, 1687, 3168, 5599, 281, 3780, 2010, 32, 309, 1053, 626, 923, 253, 10721, 13, 2167, 344, 310, 11755, 347, 7435, 15, 187, 187, 33, 51, 1004, 89, 466, 51, 3348, 754, 556, 247, 2176, 5739, 14, 24442, 3564, 4034, 405, 275, 619, 4743, 15, 309, 9428, 275, 326, 1039, 253, 20278, 310, 1175, 984, 521, 497, 253, 4453, 326, 497, 11408, 285, 12207, 896, 840, 32, 1707, 434, 642, 5434, 281, 521, 4453, 13, 642, 660, 43305, 15, 187, 187, 33, 51, 1004, 89, 466, 51, 3348, 733, 434, 253, 14241, 13, 8872, 2927, 326, 755, 281, 2255, 13, 1223, 309, 717, 1900, 594, 1691, 745, 407, 521, 5075, 1652, 6208, 15, 309, 1158, 10354, 25478, 310, 271, 7126, 12353, 285, 778, 275, 958, 320, 247, 1175, 1436, 275, 6612, 13, 533, 5037, 310, 824, 247, 7027, 1969, 344, 6993, 637, 314, 1919, 326, 2506, 626, 789, 13, 840, 2722, 521, 6326, 24189, 672, 344, 11121, 352, 1833, 755, 779, 752, 344, 5605, 13, 285, 352, 434, 512, 627, 327, 521, 2454, 15, 187, 187, 33, 22434, 26983, 5531, 7335, 27263, 15, 3166, 368, 2238, 273, 755, 253, 5471, 326, 5747, 5037, 434, 6500, 13, 19528, 651, 320, 247, 1805, 2242, 32, 4923, 344, 13, 340, 8, 14428, 13, 2686, 11121, 2825, 310, 1175, 3185, 273, 3076, 16, 32029, 16, 81, 2977, 3196, 15, 30435, 32, 187, 187, 33, 8096, 545, 6464, 309, 476, 755, 1066, 342, 326, 13, 352, 434, 2139, 309, 452, 247, 2264, 10692, 4006, 254, 323, 2516, 25480, 41385, 313, 3529, 637, 310, 247, 3915, 1277, 15, 309, 1620, 7192, 1919, 891, 3047, 26386, 81, 42193, 582, 533, 1014, 2167, 344, 28114, 479, 598, 275, 1884, 9384, 13, 285, 25478, 708, 378, 13228, 310, 12835, 47150, 30883, 25129, 13, 344, 1335, 816, 2238, 273, 4453, 751, 253, 5599, 326, 309, 651, 1663, 4517, 281, 5580, 479, 1728, 18602, 434, 6503, 390, 1633, 15, 187, 187, 33, 1258, 266, 3639, 868, 6279, 13, 1390, 8849, 309, 2427, 327, 247, 3522, 342, 247, 5599, 665, 753, 326, 33686, 23701, 468, 369, 2810, 281, 521, 2934, 273, 247, 3962, 3416, 285, 326, 703, 369, 594, 50036, 15377, 15, 754, 13222, 598, 690, 643, 2502, 12201, 13, 533, 20509, 13, 326, 581, 369, 253, 28159, 383, 15, 187, 187, 9817, 13, 8718, 4130, 13, 703, 434, 3965, 285, 703, 4245, 275, 281, 5037, 13, 534, 403, 2534, 31296, 4606, 281, 320, 715, 617, 13, 533, 671, 36722, 4110, 388, 1372, 4873, 18688, 15, 388, 1372, 4873, 18688, 15, 388, 1372, 4873, 18688, 15, 1422, 971, 281, 3522, 247, 3416, 665, 38232, 5972, 285, 617, 2151, 32, 1737, 32, 187, 187, 42, 1928, 751, 6984, 9730, 1537, 320, 581, 273, 1110, 1841, 326, 434, 27826, 407, 697, 7458, 15, 309, 519, 410, 253, 921, 13, 533, 326, 434, 984, 352, 434, 247, 1663, 47860, 29254, 273, 5899, 8645, 9503, 16, 30668, 5953, 15, 3771, 984, 5037, 23701, 468, 310, 23639, 285, 31394, 5322, 19519, 2506, 626, 1599, 253, 921, 310, 598, 16514, 779, 347, 247, 1894, 281, 320, 35030, 15, 32271, 277, 14735, 2312, 670, 14707, 281, 320, 5037, 23701, 468, 390, 16901, 5015, 670, 14707, 281, 3522, 779, 309, 1353, 751, 346, 11778, 368, 2455, 2686, 6725, 1400, 6984, 9730, 865, 187, 187, 4967, 513, 952, 755, 436, 3430, 13, 1007, 13, 352, 434, 2969, 13, 1132, 7435, 16, 4175, 610, 16, 24212, 27, 187, 187, 18, 15, 49142, 19528, 14, 3529, 9711, 30013, 4453, 751, 794, 275, 253, 34707, 13, 671, 344, 310, 7001, 5356, 47860, 327, 3527, 13, 594, 309, 651, 5926, 3527, 342, 779, 285, 452, 47860, 2825, 13, 352, 651, 320, 13103, 187, 19, 15, 2398, 610, 11290, 18084, 26817, 306, 14, 248, 310, 10323, 253, 8642, 368, 476, 755, 281, 4560, 247, 637, 665, 310, 671, 247, 12524, 1966, 1146, 327, 326, 921, 15, 309, 871, 253, 2644, 346, 11510, 7317, 273, 616, 673, 3, 16267, 13, 285, 642, 13, 309, 1353, 417, 11280, 352, 15, 1292, 594, 2080, 313, 42, 1053, 626, 452, 10856, 13, 6468, 626, 2326, 253, 954, 3332, 2952, 10, 344, 310, 12524, 15, 5220, 23639, 13, 651, 3164, 320, 4484, 342, 247, 4475, 665, 2987, 13, 26570, 15, 187, 187, 44079, 26411, 14, 344, 310, 247, 2343, 506, 8826, 1652, 281 ]
: "Everyone likes crappy stuff like Justin Bieber except meeeee". No. There are people out there who share your interests. There are even guys who will treat you nicely and "appreciate your figure." Your time would be better spent looking for them rather than idealizing a (dickish) fictional character. @RNL Also, back in The Day, your "curvy figure" was appreciated if and only if it was hourglass shaped (and regardless of your natural shape, you almost always wore a corset/girdle/similar contraption), so it's not like the Mad Men era was all about body positivity/acceptance. @Jinxie Yeah old people gripe about fat girls all the time, way worse than any young person I know. No, things were NOT body-positive. The Marilyn Monroes and Joans were appreciated because they were hourglasses. Not because they were "real" "curvy" women. Sigh. Perhaps the letter writer should go sit in the corner with all the gals who say shit like "I'm not a feminist but..." because that's where nostalgia for the 1950s belongs. In the corner. Under a tarp. Where we can't see it. @adorable-eggplant I just checked-- apparently after you collect 2000/5000/10000 points, you get a $20/$50/$100 coupon for any restaurant you can book on the site? And you usually get 100 points per reservation, so it's mostly a "yay, points!" thing, unless you go out to eat a lot and plan to do so in advance. Ah yes, the good old days! OH WAIT, FUCK YOU. Things were "good" for exactly one small segment of the population: straight, White men. Black people could barely vote, and women couldn't open fucking bank accounts, among a trillion other horrible things. But let's totally go back! SHUT UP IDIOT, GODDAMNIT. I think this letter was written by a dude in a sort of hopeful fantasy, like "I'll see if women secretly agree with me and my chauvinistic longing for the days when I could trat them as office decorations! Also I really dislike Mad Men's "Oh look they're SMOKING and SEXIST we're so AUTHENTIC" and it's just such a pretty looking but ordinary show. The only good thing about it is the fashion style. @iceberg There was a great article a couple years back on how the show wants to have its cake and eat it too -- they pretend they are shaking their fingers at all this "authentic" awfulness, but really they either want the shock value of a pregnant woman smoking or the freedom to be horribly sexist and claim it's historical. I could just rant for days about people idolizing Joan, especially in those first couple of seasons. She is admirable, but not enviable. And all the reasons to admire Joan are tinged with misogyny, sexism, body politics and general terribleness that go along with 1960s. @pajamaralls She just seems exhausted now, doesn't she? Like, she is glad to have gotten somewhere (in spite of the cost) but is just tired of putting up with the shit. She used to be all about the office rules & hierarchy, but broke it all this last ep when she edged Pete out of the Avon meeting. There was no "leaning in" back then. @pajamaralls Yeah man. I think Joan is a BAMF in so many ways, and that she is incredibly strong because of all the shit she's had to deal with, and that she's managed to make lemonade out of the lemons she's been given, for the most part. I have a real soft spot for her... but her life? Is not enviable at all. @bevrockin I'm so behind. I need to catch up on season 5 since it's on Netflix now, and then watch 6. I'd done a pretty good job about not spoiling things for myself, though Mad Men isn't as spoiler heavy as some shows. But from the things I've seen, Joan is so different. I guess I'm glad that she's she exhausted, in a way. It's a terrific character arc and Christina Hendricks plays the shit out of what she's given. First Season Joan would have sneered at Current Joan for no longer being so silly as to put all her eggs in some dude's basket, like some frumpy girl who has no hope of marrying well. @par_parenthese I initially didn't like Joan, partially because she was sort of rude to Peggy in the beginning, and a think the fawning over her had a good bit to do with it. But I did have a definite soft spot for Joan. Doesn't the LW realize that being Joan is the actual worst? Joan follows ALL the rules of being a woman: she's pretty, intelligent but non-threatening, flirtatious, and manages all those pesky unmanly details. She believes in the system, and thinks that if she plays her cards right, she'll marry well and end up in the suburbs. Luckily, the show is pretty realistic and depicts her getting fucked over (raped, married to rapist, having financial problems, divorced with child) despite her playing by the rules. She's proof that women can never actually win in patriarchy. ...Sorry, I've had a few drinks and I am shouty. Not at you! But this is a go-to line for me: nobody wins in the patriarchy, even the people who seem to, because the defining characteristic of patriarchy is to tell people who/what/how they should be, regardless of reality. So, yes, some people benefit in ways that are definitely important and tangible (economically, legislatively, etc), but ultimately, patriarchy is a force like gravity: it weighs everyone down. I have resisted watching Mad Men FOREVER because I had a friend that wanted to date Don Draper or maybe just be sexually harassed by him and it turned my stomach. Also, am I alone here, or does Jon Hamm just look like a nondescript white guy to anyone else? I don't see the magic, though he is funny as fuck. @RoxxieRae He has a certain stock-photo handsomeness in my opinion. I suppose in that way the casting is good because his were the looks that were desirable and acceptable back then? There's no danger to his looks, no scruff. @RoxxieRae It's the moist, sad eyes that get to women, while I am always so put off by his weak little mouth. I think Jon Hamm is an excellent actor and may in fact be a good person in reality, but Don is such a lie -- he acts manly until that doesn't work, then shows his supposed vulnerability when he thinks it'll get him what he wants, and it's all there on his face. @Lucienne Oh Slattery. Do you kind of get the feeling that despite Don's equipment, Roger would be a better lay? Because he, y'know, actually thinks sex is good instead of bad/currency/paging Dr. Freud? @Amphora I can get down with that, it's why I have a total ladyboner for John Travolta (that man is a STAR. I never understood until i saw Pulp Fiction), but even though he cracked me up in 30 Rock, and Hamm & Buble is fucking HYSTERICAL, he still just kind of looks like the guy that I would really trust to sell me homeowner's insurance or something. @flanhoodles Yes, last weekend I went on a date with a guy who said that Betty Draper was close to his idea of a perfect woman and that she was soooo innocent. He threw up some other red flags, but honestly, that one was the reddest. Like, ok everyone, she's pretty and she gives in to Don, which are barfy reasons to be into her, but also SHE IS HORRIBLE. HORRIBLE. HORRIBLE. You want to date a woman who hates herself and her children? What? I feel like Mad Men might be one of those things that's ruined by its fans. I adore the show, but that's because it's a really insightful critique of traditional gender roles/ masculinity. Just because Don Draper is handsome and wears nice suits doesn't mean the show is upholding him as a character to be admired. Whenever dudes talk about wanting to be Don Draper or ladies talking about wanting to date him I'm like "Have you ever actually SEEN Mad Men?" Why do people get this wrong, look, it's simple, play fuck/marry/kill: 1. Fuck Roger-that silver fox looks like fun in the sack, also he is amazingly insightful on acid, so I would drop acid with him and have insightful sex, it would be awesome 2. Marry Ken Cosgrove-he is basically the closest you can get to finding a man who is also a decent human being on that show. I know the whole "prodcut of their time" excuse, and no, I'm not buying it. But so far (I don't have cable, haven't seen the most recent season) he is decent. Also handsome, would probably be cool with a wife who works, ect. Kill Pete- he is a loathsome little to
[ 43571, 38515, 650, 698, 3562, 407, 253, 2459, 328, 11938, 347, 247, 789, 3490, 2335, 689, 253, 8859, 846, 353, 472, 2788, 19301, 253, 7359, 328, 11938, 273, 6149, 597, 19301, 779, 745, 352, 778, 452, 644, 1475, 840, 253, 4222, 790, 2335, 689, 253, 9860, 904, 1707, 310, 1264, 1781, 18388, 275, 253, 3490, 1673, 13, 42, 452, 644, 949, 581, 8037, 374, 1107, 3622, 275, 271, 473, 8998, 13, 309, 6331, 387, 253, 5024, 285, 4395, 949, 1390, 807, 581, 273, 619, 10692, 3331, 574, 247, 2074, 2793, 352, 3133, 253, 18388, 476, 320, 2326, 432, 253, 15395, 267, 16340, 15, 12324, 376, 28182, 310, 4409, 4361, 1014, 37152, 352, 434, 1475, 3925, 6, 3451, 15, 187, 187, 1276, 309, 858, 672, 309, 2427, 949, 253, 3490, 1673, 46096, 2822, 253, 990, 273, 619, 473, 8998, 449, 5872, 309, 1869, 670, 1469, 715, 2317, 309, 2427, 598, 281, 253, 3490, 1673, 326, 369, 1475, 6149, 285, 949, 247, 7793, 275, 352, 15910, 816, 3345, 14974, 627, 275, 2317, 309, 812, 923, 7565, 309, 6225, 627, 1244, 5485, 619, 6174, 285, 2819, 387, 7565, 10464, 742, 352, 275, 1708, 253, 2644, 6149, 369, 6107, 275, 1708, 15, 5872, 309, 369, 896, 327, 253, 3216, 285, 1869, 309, 452, 2218, 512, 309, 873, 562, 281, 513, 285, 309, 23686, 598, 4751, 22238, 347, 604, 309, 574, 417, 644, 14343, 29055, 512, 2455, 2508, 449, 187, 187, 5703, 436, 275, 247, 34823, 1939, 1387, 1390, 807, 15, 346, 42, 452, 247, 1708, 11038, 326, 8525, 15395, 267, 22710, 15, 496, 369, 1677, 281, 479, 407, 581, 273, 253, 19906, 375, 952, 15, 40, 33929, 23184, 14048, 352, 281, 479, 374, 1107, 3622, 15, 15997, 1077, 4722, 9455, 15, 28814, 253, 1708, 5145, 310, 247, 21175, 267, 21147, 3347, 280, 20658, 254, 15, 380, 4294, 310, 27881, 1077, 2074, 281, 672, 581, 6507, 3104, 15, 733, 434, 8644, 15, 5220, 309, 971, 281, 823, 326, 581, 273, 253, 2022, 7038, 326, 3982, 6330, 342, 253, 2207, 279, 13779, 285, 9011, 3750, 310, 671, 327, 436, 8859, 987, 1024, 347, 247, 1966, 449, 187, 187, 5677, 6924, 4572, 13, 594, 973, 6828, 342, 4722, 3533, 15, 380, 9172, 1512, 1537, 347, 973, 1421, 281, 8542, 4893, 275, 5312, 1495, 604, 31284, 3466, 2220, 15, 11239, 368, 594, 1199, 281, 368, 512, 15, 10540, 285, 26569, 432, 247, 21513, 3204, 5074, 26762, 15, 187, 187, 8398, 368, 1077, 1199, 323, 436, 7126, 4572, 9759, 13, 533, 671, 1969, 611, 438, 375, 323, 824, 247, 1270, 2628, 273, 940, 3867, 253, 21765, 1491, 13, 285, 15250, 352, 275, 247, 37039, 2505, 5981, 326, 2789, 352, 309, 8643, 11535, 12715, 444, 1719, 35960, 281, 1239, 285, 15816, 13, 672, 2429, 281, 1199, 625, 14086, 13, 3159, 90, 7045, 621, 313, 1171, 2469, 6392, 35, 5214, 12888, 407, 643, 14248, 2698, 187, 187, 19, 15, 1737, 497, 253, 7688, 875, 4377, 21326, 2244, 309, 708, 3719, 13, 13209, 518, 611, 1688, 3358, 23341, 13, 253, 8080, 273, 9129, 10400, 571, 285, 253, 8080, 25346, 273, 253, 596, 8306, 757, 13958, 313, 20432, 253, 581, 3692, 5699, 2454, 310, 27251, 715, 253, 28900, 327, 253, 5682, 4338, 6177, 7160, 11048, 1646, 281, 452, 253, 1072, 762, 81, 32599, 15, 4041, 2181, 309, 457, 306, 4541, 6888, 310, 326, 9653, 2300, 51, 19365, 5649, 432, 3652, 247, 10237, 5865, 4968, 3364, 15, 187, 187, 4967, 32, 187, 187, 4497, 13, 1309, 253, 2282, 273, 619, 2175, 13, 309, 457, 306, 1408, 598, 1411, 2067, 23768, 285, 8892, 326, 452, 2424, 247, 10995, 2900, 1561, 247, 2159, 673, 3665, 15, 4325, 8133, 2366, 247, 5865, 2600, 1095, 318, 281, 6153, 247, 35554, 20731, 390, 2403, 271, 23176, 29751, 323, 634, 42498, 1108, 1907, 247, 12190, 273, 3477, 281, 897, 13, 313, 11499, 31821, 13724, 1959, 285, 29422, 5865, 5657, 281, 1067, 327, 310, 247, 1364, 323, 1142, 247, 9653, 2300, 51, 5974, 285, 5702, 15, 187, 187, 20696, 2007, 519, 80, 13, 1060, 310, 247, 2159, 1618, 273, 619, 2802, 2184, 281, 457, 5865, 5657, 27, 6682, 8893, 27, 362, 18, 187, 11258, 27, 20851, 6648, 187, 21552, 27, 187, 50276, 1590, 27, 1736, 406, 69, 14, 3591, 187, 50276, 31294, 27, 187, 50274, 1212, 15, 45077, 15, 900, 16, 1590, 27, 12033, 2486, 346, 20406, 14, 2428, 15, 1590, 3, 964, 12377, 14, 3591, 187, 50274, 35528, 15, 1200, 16, 21341, 27, 12033, 2486, 346, 20406, 14, 2428, 15, 21341, 3, 964, 12377, 187, 50274, 1212, 15, 45077, 15, 900, 16, 14966, 27, 12033, 964, 18992, 15, 2402, 12377, 187, 50274, 1212, 15, 45077, 15, 900, 16, 39196, 14, 1615, 27, 12033, 964, 18992, 15, 7456, 12377, 187, 50274, 1212, 15, 45077, 15, 900, 16, 2003, 14, 1171, 27, 1736, 406, 69, 187, 50274, 1212, 15, 45077, 15, 900, 16, 15658, 27, 12033, 964, 15888, 15, 9438, 15, 1590, 12377, 187, 2203, 27, 187, 6394, 14, 281, 58, 16878, 964, 15888, 15, 9438, 15, 5397, 1040, 295, 31808, 577, 12377, 13561, 266, 1257, 8202, 4855, 4726, 4352, 407, 370, 11124, 13, 933, 12265, 4142, 6007, 187, 187, 3463, 187, 35848, 1758, 1716, 1216, 90, 187, 187, 13561, 266, 1257, 8202, 4855, 4726, 310, 10268, 247, 4142, 6007, 273, 2761, 370, 11124, 13, 933, 13, 253, 6425, 273, 247, 2626, 273, 697, 7970, 6021, 15, 187, 187, 34, 7035, 266, 1257, 8202, 2143, 310, 10268, 247, 4142, 6007, 273, 2761, 370, 11124, 13, 933, 13, 253, 6425, 273, 247, 2626, 273, 697, 7970, 1375, 2208, 6021, 15, 187, 187, 13561, 266, 1257, 8202, 4855, 4726, 556, 23274, 4651, 275, 247, 25144, 436, 2129, 326, 697, 4142, 6007, 13, 670, 370, 1438, 13, 933, 273, 534, 310, 896, 14, 14151, 7260, 13, 1931, 18859, 370, 10768, 13, 26, 2526, 15, 1244, 352, 14315, 4651, 597, 812, 320, 2546, 281, 2075, 370, 17569, 591, 5974, 281, 3835, 352, 15, 187, 187, 6436, 253, 40035, 4487, 273, 10286, 285, 6269, 1005, 556, 20906, 281, 21684, 4651, 387, 253, 2143, 13, 285, 667, 2571, 5876, 407, 7035, 266, 1257, 8202, 3228, 6456, 434, 12246, 281, 761, 1011, 370, 20, 15, 24, 3041, 275, 16383, 7260, 13, 597, 1912, 626, 320, 3264, 281, 2075, 15, 187, 187, 1898, 253, 2919, 434, 40035, 2418, 13171, 8612, 13, 4200, 15354, 12732, 2516, 4033, 1858, 80, 13, 556, 24082, 12457, 12265, 323, 697, 346, 296, 10461, 414, 6267, 275, 23453, 19403, 4142, 15, 187, 187, 1628, 2861, 26257, 281, 5369, 8055, 3916, 13, 627, 310, 642, 985, 835, 5974, 5870, 651, 8251, 253, 2105, 273, 6456, 457, 84, 11339, 414, 1806, 2305, 4033, 1858, 80, 753, 15, 187, 187, 3, 1466, 479, 320, 2590, 326, 436, 4274, 6929, 310, 247, 906, 273, 12265, 457, 84, 19412, 266, 5585, 273, 697, 4142, 285, 8128, 985, 15, 831, 4840, 812, 452, 644, 247, 13083, 604, 12265, 9703, 281, 8251, 253, 2105, 273, 697, 10551, 285, 417, 294, 14, 15697, 4142, 27833, 40669, 187, 187, 510, 2143, 310, 581, 273, 7457, 3625, 13, 6561, 285, 308, 9006, 38, 4730, 3607, 9633, 407, 253, 7811, 281, 452, 2959, 24864, 4142, 27833, 432, 7035, 266, 1257, 8202, 3228, 6456, 15, 187, 187, 34, 40035, 4487, 273, 10286, 285, 6269, 1005, 18082, 753, 642, 2647, 752, 253, 12265, 858, 13, 6629, 651, 417, 320, 3264, 281, 2075, 15, 187, 187, 3, 2042, 253, 896, 14151, 4142, 4366, 310, 1119, 281, 320, 3588, 840, 253, 4815, 588, 320, 1313, 407, 253, 4487, 273, 10286, 285, 6269, 1005, 15, 6166, 642, 5989, 588, 4651, 390, 253, 2143, 320, 3264, 281, 8162, 449, 187, 187, 8639, 4715, 273, 253, 4730, 7811, 434, 7535, 13, 4007, 273, 253, 7035, 266, 1257, 8202, 4855, 4726, 37850, 285, 30299, 7115, 19995, 6935, 2713, 14315, 253, 2143, 3114, 1904, 457, 85, 452, 253, 5350, 281, 2075, 15, 187, 187, 1628, 1147, 651, 1379, 271, 18580, 2257, 273, 40741, 256, 11114, 868, 1806, 2305, 6935, 2713, 753, 15, 187, 187, 1628, 26143, 247, 1345, 2143, 13, 9021, 403, 17610, 594, 627, 310, 642, 1039, 359, 812, 21787, 323, 326, 2583, 281, 320, 5728, 432, 4651, 40669, 187, 187, 3404, 247, 4804, 327, 8330, 2360, 13, 253, 7035, 266, 1257, 8202, 3228, 6456, 38350, 5821, 281, 32407, 7830, 327, 896, 14151, 14874, 1919, 352, 556, 2959, 7535, 432, 253, 40035, 8308, 323, 11629, 7295, 15, 187, 187, 688, 247, 3908, 13, 12265, 753, 760, 247, 5110, 273, 253, 4677, 3863, 275, 253, 7035, 266, 1257, 8202, 4855, 4726, 25144, 6607, 896, 14151, 4142, 7260, 15, 187, 187, 1628, 510, 4677, 273, 370, 10768, 13, 933, 3863, 407, 7035, 266, 1257, 8202, 4855, 4726, 3797, 370, 3832, 13, 21095, 323, 7260, 432, 4748, 14, 740, 1919, 4050, 14, 1012, 1806, 247, 12265, 18082, 753, 15, 187, 187, 1328, 753, 1529, 370, 1093, 13, 17013, 369, 432, 4072, 14, 1047, 13, 370, 1717, 13, 10487, 323, 253, 1655, 4832, 807, 285, 370, 19, 13, 5388, 369, 323, 1824, 7260, 323, 253, 7002, 7150, 273, 4072, 14, 1047, 15, 187, 187, 510, 18082, 753, 6629, 497, 13959, 432, 2087, 4142, 13, 533, 497, 2424, 281, 2075, 323, 1824, 13, 41930, 486, 285, 8138, 2579, 7260, 15, 187, 187, 31137, 253, 16252, 1557, 9509, 9067, 275, 7035, 266, 1257, 8202, 13, 534, 778, 320, 13410, 323, 247, 6142, 366, 281, 40872, 2456, 591, 1399, 273, 697, 370, 1508, 13, 933, 896, 14151, 4142, 7260, 13, 6629, 2965, 3345, 253, 7990, 273, 12265, 434, 4142, 285, 6619, 7260, 3646, 15, 187, 187, 43, 1000, 357, 297, 589, 376, 5259, 4726, 8624, 11007, 20189, 753, 617, 2143, 369, 25394, 407, 247, 6007, 273, 370, 25, 13, 933, 275, 896, 14151, 4142, 15, 187, 187, 1628, 6067, 8362, 310, 6486, 323, 4142, 285, 310, 1677, 591, 807, 1806, 10137, 20189, 753, 15, 187, 187, 1628, 2042, 253, 9801, 369, 20978, 728, 275, 2120, 352, 651, 1691, 441, 689, 562, 994, 2404, 942, 436, 807, 285, 359, 651, 878, 281, 7703, 24864, 8362, 432, 253, 7811, 449, 12520, 40001, 446, 857, 3547, 10683, 14, 28059, 4253, 1033, 18, 964, 25654, 94, 187, 805, 428, 9654, 323, 288, 15, 187, 1630, 187, 7304, 470, 426, 34360, 11, 71, 428, 32513, 11, 71, 428, 374, 11, 89, 13, 428, 19, 11, 89, 559, 818, 11, 89, 426, 269, 323, 269, 15, 187, 17, 187, 7304, 428, 19, 11, 67, 428, 1249, 426, 577, 11, 86, 13, 34790, 428, 34892, 426, 608, 11, 86, 428, 470, 11, 67, 559, 374, 11, 67, 323, 1484, 15, 187, 17, 187, 7304, 428, 73, 559, 12472, 426, 428, 2537, 11, 89, 559, 2164, 11, 89, 428, 3925, 559, 1283, 13, 577, 11, 73, 428, 9743, 426, 608, 11, 89, 323, 288, 15, 187, 25, 187, 7304, 721, 11, 88, 426, 1249, 13, 470, 11, 88, 559, 608, 20395, 426, 495, 11, 71, 559, 608, 11, 88, 559, 8255, 1731, 323, 269, 15, 187, 14, 3046, 187, 7304, 428, 19, 11, 66, 428, 337, 3031, 11, 84, 559, 1249, 426, 428, 39855, 11, 84, 428, 41649, 11, 84, 13, 898, 426, 608, 11, 66, 559, 495, 11, 84, 323, 247, 15, 187, 20, 187, 7304, 428, 19, 11, 66, 559, 608, 426, 428, 66, 559, 495, 11, 72, 13, 374, 20954, 11, 72, 428, 22146, 24, 11, 72, 426, 428, 66, 559, 818, 428, 1722, 323, 247, 15, 187, 14, 21, 187, 7304, 362, 559, 721, 11, 74, 426, 428, 1423, 13, 5693, 426, 428, 43224, 11, 87, 559, 884, 3156, 11, 87, 428, 1384, 11, 74, 323, 362, 15, 187, 14, 21, 187, 7304, 470, 426, 898, 11, 91, 559, 608, 11, 85, 428, 4562, 13, 3127, 15144, 11, 91, 428, 3127, 14351, 11, 91, 428, 577, 11, 85, 426, 470, 323, 1182, 15, 187, 21, 187, 7304, 268, 428, 374, 11, 81, 428, 495, 11, 73, 426, 428, 1012, 13, 495, 11, 81, 559, 14821, 11, 73, 428, 11439, 11, 73, 428, 5571, 11, 73, 559, 11583, 426, 470, 323, 268, 15, 187, 14, 19, 187, 7304, 577, 11, 69, 559, 295, 426, 8437, 13, 818, 11, 69, 428, 374, 11, 79, 428, 5325, 426, 374, 11, 69, 559, 495, 11, 79, 323, 277, 15, 187, 1348, 187, 7304, 270, 428, 854, 2270, 559, 2145, 805, 426, 428, 938, 11, 71, 13, 470, 426, 495, 11, 67, 559, 269, 559, 577, 11, 71, 559, 11334 ]
reptilian grays created by the annunaki as a work force took over the planet after Marduk kicked the Annunaki of earth they kicked him off it may have been around then the archons took over the grid., There is three large gaps in the force field,I have been through one gap 2 years ago in an OBE, I stopped at the edge and moved through last year one of my lady friend had a similar experience it seems the gaps can be seen from the astral planes. Terra Papers is worth reading even tho it's around 60% correct. What I did when I went through the force field Gap near the end of my OBE."Then I thought about going into space I went up to the force field that was around earth and through a hole in it stopping just outside floating there in space I could see Earth I stood there And opened my arms and looking at Earth bathed it in light the whole earth was covered in light.Then I was back on the ground and thought I have done all I set out to do and I woke up fully awake as if I had not been sleeping remembering all ever detail." Read this in a paranormal group last year. "I have a light matching that supports astral travelling. In was given to me by one of the Tellos people.Gopal Das handed it to me 2 years ago. Very very interesting journey. Anyway the light machine is a pineal gland sonic healer. The frequency is programmed very similar to when one flat lines. It's amazing. Also I want to add that one of the main leaders that brought peace with the Orion belt and Sirius is also on this planet right now as a human." Outstanding interview, so well directed with interesting questions. The answers too might as well lead to practical applications in daily life if pondered upon. Thank you so much to you all. Love and blessing from a staunch animals defender. Thank you very much for this excellent interview presentation, but also -- Kudos for such a great job of distilling the verbal information, and presenting it in a spacious text format that makes it IMMENSELY EASIER to read and absorb, when compared to much more dense, wordy transcriptions (of past COBRA interviews by other websites.) 2. What were the relationships between King Authurs I & II, Babak Khorramdin, the hero of ancient Persia and the hero kings of the Thracian Empire (especially the one whose huge face is carved into the cliff on the Danube)? Their cultures seem to have the same underpinnings.One thing I’ve quickly discovered is that GLAMR folk benefit from building a robust digital toolbox. Why? Well, during the course of my studies, I’ve run up against several assignments and tasks that have required a creative solution within a short time frame. From putting together a digital content curation to creating a persona poster or making an appealing banner for your webpage – having a bunch of easy to use, (preferably!) free and polished digital tools to call on is a must for many a GLAMR student and professional. Without further ado, here is a short list of my ‘go to’ digital tools:apiVersion: v1 kind: ConfigMap metadata: name: argocd-cm labels: app.kubernetes.io/name: {{ include "argo-cd.name" . }}-cm helm.sh/chart: {{ include "argo-cd.chart" . }} app.kubernetes.io/instance: {{ .Release.Name }} app.kubernetes.io/managed-by: {{ .Release.Service }} app.kubernetes.io/part-of: argocd app.kubernetes.io/component: {{ .Values.server.name }} data: {{- toYaml .Values.server.config | nindent 4 }}Queanbeyan High School hit by $112,000 council rates bill By Georgina Connery Queanbeyan High School is facing a rates bill of almost $112,000, the equivalent of a third of its annual income. A Queanbeyan school is facing a rates bill of almost $112,000, the equivalent of a third of its annual state government income. Queanbeyan High School has notified parents in a newsletter this week that its rates bill, about $80,000 of which is back-dated charges, totalled $111,966. And it warned parents they could be asked to pay $230 per student to cover it. However the NSW Department of Education and Communities has rushed to assure parents at the school, and any others affected by Queanbeyan City Council's bid to recoup $3.7 million in outstanding charges, they won't be expected to pay. And the region's NSW State Parliament representative, Monaro MP John Barilaro, has lambasted council for its "stupidity'' in pursuing retrospective rates. “Contrary to unfounded claims, there is no system where student families would wear the cost of Council’s stupidity,” Mr Barilaro said. "Let me be clear that this debacle is a result of council’s mismanagement of its rates and fees system. This mess could have been averted if council chose to wear the cost of its mistake and not re-issue rates notices.'' The school is one of nine primary, secondary and TAFE education properties owned by the department to have received supplementary rates notices from Queanbeyan City Council. A NSW Department of Education and Communities spokesman said no matter what the council did, schools would not be expected to pay. "If the backdated rates notice is found to be valid then the costs will be met by the Department of Education and Communities. Under no circumstances will parents or the school be expected to contribute." Before learning of the education department's advice, president of the Queanbeyan High School Parents and Citizens Association Murray Lembit warned the school community didn’t have the capacity to pay. “It would take an awful lot of sausage sizzles,” Mr Lembit said. “Being a public school, contributions are voluntary so there is no way we could mandate for that money to be collected from parents.'' At a meeting on Wednesday night, the Queanbeyan City Council unanimously agreed to suspend payment on backdated bills until it has received advice from the NSW Minister for Local Government. In a statement, council said only a portion of the figure published in the Queanbeyan High School newsletter represented backdated rates charges. “The figure of $111,000 published by Queanbeyan High School includes $61,349 for charges from 2009-10 until 2012-13,” a council spokesman said. He said another $18,509 was from 2013-14, $29,600 for the current financial year and $2,500 was for water charges for the fourth quarter of 2013-14. The spokesman said schools were exempt from general rates, but were required to pay for water, sewerage and waste service charges. Unlike the residential care facility Home in Queanbeyan, which may be eligible for a rebate to waive 50 per cent of its $23,000 backdated rates charges, schools fall outside the scope of council's rates and relief charges policy. Jerrabomberra Public School principal Chris Hunter said her school was confronted by a bill of $8,000 in backdated rates. “Our funding is finite for rates and is given per year,” Ms Hunter said. “If the fee was levied in full it would put us over out entitlements this year and we would need to seek supplementary funding from the department."![](hosplond72123-0013){#sp1 .645} 12 - 63 for h. 27 Solve 0 = 283*f - 272*f - 2*x, -2*x + 7*x = f for f. 0 Solve -2*b - 12 = 4*u, 443 - 455 = 5*u - 0*b + 2*b for u. 0 Solve -h + 116 = -49*x + 24*x - 60 + 18, 4*h - 62 = 5*x for h. 8 Solve 6*w = 12, 0*w + 5259 = 3*f + 5*w + 5426 for f. -59 Solve -2*a - 1199*s + 12 = -601*s - 601*s, 9 = 5*a + 3*s for a. 3 Solve -2*a + 5 = -a + 3*g, 2605*g - 2607*g = -a + 7 - 17 for a. -4 Solve v + 6*i = -22, 48 = -1038*v + 1041*v - 20*i for v. -4 Solve 0 = 9*z + 5*t - 31, 21121*z - 21122*z - 4*t = 0 for z. 4 Solve p - 2*p - 3*h = -13, 3*p + 136*h - 83*h - 70*h + 91 = 0 for p. -2 Solve 4*d + n = 101, 7*d - 2*n - 95 = 2*d + 3*n for d. 24 Solve b - 890 + 1312 = -20*f, 0 = 3*b + f + 4*f + 111
[ 281, 521, 2060, 7185, 275, 1340, 281, 1973, 2366, 12786, 7185, 15, 187, 1328, 671, 6289, 281, 253, 6349, 273, 13969, 323, 253, 2586, 15, 346, 3039, 597, 1333, 326, 352, 310, 417, 1896, 13, 359, 588, 1333, 326, 352, 476, 15, 1244, 326, 1388, 13, 672, 359, 8416, 4715, 253, 16507, 326, 253, 5694, 310, 253, 13969, 13, 752, 1805, 310, 281, 2810, 253, 13628, 281, 253, 16612, 1346, 285, 1527, 731, 281, 253, 1391, 4885, 15547, 273, 47637, 5948, 1108, 1110, 665, 1705, 432, 253, 952, 13, 253, 760, 14905, 2603, 1108, 359, 476, 2366, 2502, 2865, 1189, 1142, 1841, 313, 19552, 1244, 840, 359, 476, 2502, 2865, 1189, 2366, 326, 36515, 310, 417, 10412, 285, 326, 13702, 403, 1896, 449, 688, 10226, 13, 347, 8308, 273, 253, 31639, 285, 6657, 273, 253, 4400, 3988, 5621, 13, 344, 4546, 247, 2234, 2554, 275, 15686, 253, 490, 10083, 273, 253, 32427, 21664, 34339, 5602, 363, 15, 187, 187, 688, 4695, 3083, 91, 4692, 369, 28173, 275, 23881, 434, 16005, 313, 783, 3313, 5759, 273, 23881, 10, 2112, 342, 643, 3438, 2758, 323, 9073, 281, 17029, 23881, 434, 10884, 14483, 15, 187, 187, 11586, 2077, 187, 4509, 9725, 281, 8878, 3083, 91, 4692, 6940, 275, 5002, 835, 344, 3407, 281, 1287, 521, 5249, 275, 253, 3055, 8776, 8534, 347, 271, 5213, 24773, 15, 754, 6940, 275, 5041, 13, 399, 15, 36, 275, 9354, 835, 344, 7416, 253, 8786, 7021, 15, 496, 8878, 13, 344, 5421, 4383, 285, 2448, 9836, 3646, 387, 253, 2499, 273, 5003, 14912, 13, 285, 3562, 247, 25021, 5882, 1925, 11677, 17676, 11401, 942, 322, 15, 34, 904, 835, 344, 11029, 347, 253, 2567, 434, 4007, 15, 11677, 17676, 11401, 942, 556, 14145, 275, 5041, 13, 16146, 13, 46287, 45561, 285, 353, 10081, 4019, 15, 496, 3563, 8878, 13, 846, 9100, 767, 1107, 1977, 432, 23881, 13, 344, 4895, 1728, 342, 5827, 273, 23453, 247, 2136, 5249, 15, 187, 187, 2422, 1851, 569, 187, 510, 657, 8807, 14, 4779, 91, 4692, 3420, 1387, 13, 285, 697, 6980, 932, 13, 452, 644, 12889, 10145, 273, 5575, 9116, 13, 40043, 273, 5579, 24040, 13, 2583, 49270, 13, 16593, 16852, 13, 6371, 37005, 13, 285, 2891, 612, 4930, 15, 1707, 310, 642, 1941, 326, 1110, 29672, 452, 644, 47790, 13, 11464, 13, 390, 452, 4395, 3579, 275, 667, 14282, 1039, 15, 187, 187, 688, 5307, 13, 323, 1650, 13, 27687, 657, 525, 26797, 13, 247, 5877, 3558, 273, 3905, 17572, 9170, 303, 264, 3783, 13, 23460, 3083, 91, 4692, 285, 657, 8807, 13, 23962, 326, 597, 7730, 9116, 285, 13445, 275, 247, 2968, 7668, 10764, 273, 2067, 5553, 10988, 285, 253, 11547, 3905, 17572, 372, 11957, 5629, 15, 657, 8807, 753, 326, 657, 525, 26797, 369, 417, 5211, 342, 521, 2030, 2558, 1600, 12851, 275, 253, 2567, 326, 657, 8807, 285, 3083, 91, 4692, 574, 1677, 779, 949, 247, 3310, 13, 533, 657, 8807, 753, 326, 346, 664, 2692, 779, 326, 352, 369, 4344, 13, 344, 1014, 2546, 281, 320, 2087, 7205, 285, 359, 7169, 352, 3, 313, 49916, 432, 9883, 481, 2732, 657, 525, 26797, 4724, 253, 15091, 13, 1529, 4804, 875, 253, 4676, 369, 5821, 281, 13, 533, 657, 525, 26797, 858, 417, 8041, 346, 1542, 3367, 4606, 937, 2556, 281, 253, 17794, 34923, 11547, 367, 31076, 1758, 16, 805, 15, 9658, 253, 10097, 3559, 347, 1941, 13, 657, 525, 26797, 9262, 247, 38728, 326, 657, 8807, 14163, 2197, 779, 432, 253, 11547, 3905, 17572, 15, 346, 42, 1620, 2197, 247, 38728, 751, 326, 1476, 657, 8807, 10974, 672, 2546, 407, 247, 12726, 15, 2490, 187, 510, 1735, 807, 13, 23316, 2398, 6336, 15184, 375, 13, 253, 3438, 7302, 273, 253, 11547, 13, 4724, 247, 5833, 275, 534, 344, 5575, 326, 3083, 91, 4692, 285, 657, 8807, 346, 7955, 24894, 3, 253, 2567, 434, 8064, 15, 12126, 5721, 8293, 6949, 247, 346, 24902, 5766, 3184, 273, 253, 5882, 3, 313, 49916, 432, 9883, 582, 2556, 281, 253, 8742, 1244, 265, 17794, 34923, 3668, 4422, 15, 496, 2380, 13, 657, 8807, 2183, 8742, 1244, 265, 326, 773, 15160, 531, 665, 556, 247, 6264, 1750, 13, 4648, 544, 783, 62, 6424, 8426, 544, 10394, 62, 1021, 430, 1242, 285, 840, 544, 83, 4539, 62, 247, 38964, 4544, 949, 253, 3420, 964, 964, 964, 824, 347, 23362, 18463, 13, 3905, 427, 7860, 285, 380, 1244, 265, 449, 4794, 281, 8742, 1244, 265, 13, 253, 12027, 875, 15184, 375, 285, 657, 8807, 14, 4779, 91, 4692, 310, 18932, 1475, 849, 10764, 273, 253, 2567, 497, 5939, 285, 24598, 670, 2567, 12222, 15, 313, 688, 8210, 13, 15184, 375, 4211, 6879, 2558, 273, 253, 10764, 273, 3905, 17572, 11547, 281, 657, 8807, 285, 3083, 91, 4692, 434, 1997, 33562, 914, 80, 3420, 2567, 13, 2403, 657, 8807, 285, 3083, 91, 4692, 253, 5020, 28284, 285, 10938, 9891, 481, 2490, 187, 14358, 657, 525, 26797, 285, 15184, 375, 574, 616, 1211, 3374, 342, 253, 8426, 985, 13, 672, 657, 525, 26797, 434, 3607, 497, 7660, 275, 4022, 285, 672, 15184, 375, 369, 6949, 323, 521, 4323, 273, 3905, 17572, 15, 187, 187, 688, 6585, 13, 10246, 15916, 5794, 18463, 33538, 6811, 13, 247, 3438, 15629, 273, 3083, 91, 4692, 285, 657, 8807, 13, 2361, 253, 767, 1821, 281, 253, 7671, 13500, 273, 5259, 27464, 313, 9006, 3123, 481, 33538, 6811, 5575, 326, 597, 8748, 3466, 625, 685, 370, 8320, 3041, 326, 3083, 91, 4692, 13, 33538, 6811, 5575, 13, 574, 346, 300, 1851, 595, 2797, 3, 1309, 521, 673, 275, 1345, 2579, 15, 33538, 6811, 9919, 281, 11104, 752, 344, 1925, 773, 783, 48864, 784, 3116, 273, 253, 657, 8807, 14, 4779, 91, 4692, 1387, 668, 281, 521, 1211, 440, 856, 1261, 11307, 273, 45452, 5001, 253, 346, 5672, 12851, 3, 273, 13, 285, 2603, 273, 253, 8064, 323, 13, 690, 273, 253, 657, 8807, 14, 4779, 91, 4692, 4413, 15, 33538, 6811, 434, 2022, 4154, 369, 253, 17854, 440, 44167, 4215, 1750, 326, 253, 657, 8807, 14, 4779, 91, 4692, 1387, 346, 10178, 247, 5233, 285, 26694, 1245, 5054, 3116, 3, 407, 11280, 1781, 2408, 273, 24686, 275, 253, 10755, 273, 253, 2586, 13, 342, 271, 8149, 273, 253, 1340, 273, 7469, 3041, 2530, 407, 3083, 91, 4692, 449, 313, 51, 307, 6811, 908, 281, 789, 323, 657, 8807, 285, 3083, 91, 4692, 533, 521, 8410, 574, 644, 19344, 2698, 187, 187, 44225, 281, 20799, 1451, 398, 285, 2571, 187, 1145, 4743, 3929, 3863, 275, 4223, 4050, 275, 3905, 427, 7860, 2529, 3083, 91, 4692, 13, 2556, 281, 253, 31460, 273, 253, 4743, 3929, 2488, 10092, 330, 1221, 893, 91, 13, 347, 271, 773, 744, 3569, 3331, 273, 1655, 6338, 13, 37244, 285, 16006, 668, 665, 13, 5747, 521, 773, 676, 1345, 6222, 1806, 310, 1077, 15257, 3206, 342, 253, 9136, 326, 320, 15, 1198, 4227, 13, 253, 2954, 273, 1997, 33562, 914, 80, 342, 253, 47880, 11605, 6187, 77, 4200, 1464, 369, 5393, 275, 271, 4743, 3929, 342, 642, 407, 1282, 15, 380, 4743, 3929, 313, 15855, 275, 3919, 6585, 275, 3905, 427, 7860, 10, 670, 253, 773, 1026, 45642, 668, 8704, 4200, 1464, 434, 773, 69, 538, 784, 668, 19714, 1387, 4879, 4200, 1464, 434, 2136, 2954, 281, 3083, 91, 4692, 13, 1223, 6240, 326, 352, 310, 773, 38157, 281, 3653, 668, 10534, 752, 253, 3753, 273, 326, 2954, 310, 15, 187, 187, 1145, 3929, 275, 3545, 5073, 13, 271, 47637, 246, 1752, 1238, 11547, 13, 753, 326, 12294, 37831, 7188, 11209, 4742, 313, 266, 47637, 1669, 14, 7706, 35070, 17264, 323, 367, 31076, 1758, 16, 805, 285, 2488, 342, 247, 2469, 2892, 347, 247, 1669, 382, 47903, 6077, 582, 275, 581, 273, 521, 7774, 275, 367, 31076, 1758, 16, 805, 13, 5393, 3083, 91, 4692, 434, 773, 635, 2810, 10291, 281, 253, 12000, 66, 11957, 2960, 668, 1309, 253, 7255, 569, 273, 253, 3563, 47637, 4007, 427, 860, 296, 263, 20799, 348, 1216, 285, 253, 3438, 4007, 13, 31603, 1758, 401, 14064, 79, 24673, 20799, 348, 1216, 15, 380, 3905, 427, 7860, 11547, 13, 534, 369, 275, 247, 2266, 12027, 342, 253, 3438, 2208, 13, 3636, 347, 3083, 91, 4692, 434, 773, 585, 6713, 26751, 668, 762, 1097, 838, 301, 4601, 521, 3745, 281, 7895, 10856, 7315, 23937, 4457, 253, 4320, 7787, 13, 253, 2208, 434, 268, 472, 12777, 273, 521, 2891, 26131, 13, 521, 13546, 273, 2208, 12089, 327, 253, 3420, 344, 21186, 13, 285, 247, 30082, 1899, 275, 2743, 281, 13546, 247, 6109, 14, 6198, 44619, 15, 187, 187, 36, 494, 4694, 25682, 285, 31433, 187, 688, 6157, 275, 23881, 13, 253, 6253, 3420, 4413, 497, 38174, 4534, 4501, 313, 15280, 407, 1997, 33562, 23362, 18463, 582, 9170, 9593, 267, 313, 15280, 407, 1997, 33562, 657, 8807, 14, 4779, 91, 4692, 582, 285, 6053, 5092, 267, 13, 534, 369, 26277, 9633, 407, 657, 8807, 14, 4779, 91, 4692, 313, 1438, 2673, 285, 23362, 18463, 313, 938, 10970, 657, 8807, 14, 4779, 91, 4692, 1996, 4211, 9170, 9593, 267, 281, 247, 6036, 14, 2254, 459, 875, 23362, 18463, 285, 7198, 17556, 13, 247, 530, 15, 52, 15, 8149, 3187, 15, 187, 187, 10457, 253, 34660, 263, 20799, 348, 1216, 5286, 13, 9170, 9593, 267, 285, 38174, 4534, 4501, 21884, 762, 253, 12851, 273, 1997, 33562, 23362, 18463, 15, 496, 4332, 13, 1997, 33562, 657, 8807, 14, 4779, 91, 4692, 4724, 247, 5833, 342, 247, 1302, 275, 353, 10081, 4019, 18324, 326, 5575, 346, 6484, 297, 8337, 1483, 3, 8333, 407, 38174, 4534, 4501, 13, 534, 369, 9633, 407, 1997, 33562, 23362, 18463, 13, 247, 3420, 345, 50108, 5034, 15, 496, 2380, 281, 253, 5833, 13, 353, 10081, 4019, 5963, 17650, 378, 32754, 6960, 253, 2740, 484, 273, 38174, 4534, 4501, 285, 9170, 9593, 267, 285, 11162, 247, 12379, 820, 14, 25143, 21573, 281, 48870, 253, 9025, 273, 253, 767, 4413, 15, 187, 187, 2374, 4565, 3495, 13, 4332, 13, 38174, 4534, 4501, 13661, 7260, 1411, 378, 32754, 342, 253, 42591, 6456, 13, 6789, 323, 521, 31105, 15, 187, 187, 688, 4050, 13, 253, 7671, 10109, 285, 27811, 23119, 273, 253, 7671, 17572, 313, 7647, 330, 1757, 4175, 66, 10109, 340, 1176, 2269, 451, 7671, 372, 826, 17572, 7671, 10, 12969, 1411, 6798, 378, 32754, 434, 1340, 13, 3021, 38915, 253, 7268, 715, 38174, 4534, 4501, 326, 3407, 275, 4332, 15, 187, 187, 6080, 17794, 34923, 3420, 3863, 3668, 7774, 18327, 657, 8807, 14, 4779, 91, 4692, 434, 1899, 285, 8109, 1997, 33562, 23362, 18463, 434, 1899, 275, 253, 12027, 15, 1198, 1650, 27, 535, 329, 1639, 19881, 3929, 4159, 326, 247, 3083, 91, 4692, 3988, 33352, 285, 247, 346, 32948, 23019, 3, 497, 14163, 2190, 253, 6338, 665, 5966, 38174, 4534, 4501, 846, 6798, 378, 32754, 434, 10362, 15, 535, 8035, 1639, 19881, 3929, 5575, 326, 657, 8807, 14, 4779, 91, 4692, 3597, 281, 346, 911, 797, 3473, 3, 285, 18203, 3438, 3918, 20799, 348, 1216, 281, 2315, 616, 1083, 15, 187, 380, 4422, 346, 18, 339, 1087, 249, 15, 681, 3, 5575, 326, 6798, 378, 32754, 4307, 323, 247, 657, 8807, 14, 4779, 91, 4692, 12153, 15, 187, 8035, 1639, 19881, 3929, 5575, 326, 247, 20799, 348, 1216, 3331, 574, 6518, 29720, 378, 32754, 281, 2523, 521, 1340, 15, 187, 187, 25123, 8294, 209, 187, 49733, 860, 29989, 3083, 91, 4692, 17904, 281, 2675, 13, 8928, 285, 11331, 5997, 15, 754, 2987, 342, 253, 657, 423, 303, 571, 27057, 8125, 2086, 13, 534, 2987, 2584, 253, 2440, 273, 2151, 285, 20292, 275, 253, 18324, 273, 353, 10081, 4019, 407, 5277, 4832, 8385, 285, 14312, 5231, 323, 253, 5649, 273, 13240, 13, 9168, 9001, 15202, 285, 6629, 15, 187, 187, 1328, 671, 45347, 275, 253, 3905, 17572, 6807, 13, 247, 11957, 5629, 6003, 3692, 8103, 310, 281, 8591, 285, 22016, 366, 8470, 323, 8928, 3275, 13, 8881, 285, 11073, 4702, 285, 8591, 10057, 2158, 285, 2675, 8294, 15, 187, 187, 4779, 91, 4692, 310, 28924, 273, 253, 3995, 273, 5628, 17156, 275, 46287, 45561, 285, 4007, 273, 253, 12153, 273, 253, 2499, 273, 5759, 15, 754, 556, 671, 9945, 281, 253, 9662, 6807, 285, 281, 380, 28678, 41702, 8049, 13, 247, 12153, 11420, 407, 3438, 530, 15, 52, 15, 17979, 3918, 1219, 37697, 326, 14993, 281, 7164, 11891, 670, 6938, 3374, 824, 347, 7952, 1818, 15, 187, 187, 27129, 1495, 187, 2374, 5080, 3127, 13, 4104, 13, 29414 ]
to his individual freedom in order to build together collective freedom. He also referred to the importance of consensus for the country. "When they say that it is not possible, we will say that it can. And that day, when we finish learning the lesson that the motor is the consensus, what better is to close the ears to the lobbyists and open them to the clearest voices of Argentine society – those who come from the people, the only legitimate source – we can together rediscover many things (...) And then we can rediscover together that dreaming is not crazy and that dreams are possible."In 1991, as Minister of the Interior and leader of the federal security forces, he played a key role in investigating the abduction of the businessman Mauricio Macri. In 2008 Manzano was honored in Argentina's parliament (the National Congress of Argentina) along with other former members for helping to reconstruct Argentina's returning democracy. United States From 1993 to 1995 Manzano lived in California where he began to develop his career in the private sector acting as an international consultant. He lived in Washington, D.C in 1994 where he joined the Republican Party. In 1995, he studied English and American domestic policy at the University of San Diego, and created a consulting firm called Integra Investments S.A., where he serves as the company's president. Integra Investments has offices in Washington, Miami, Buenos Aires and Mendoza. In late 1995, after spending two years away from Argentina, he returned home with plans of pursuing a business career. Allegations The Vila-Manzano media group, and its principals, have been repeatedly accused of alleged fraud, censorship of TV programmes, money laundering, unfair dismissal, wire tapping, and tax evasion. There is no evidence that those accusations have been corroborated, proven, or have moved forward in any meaningful way. In 2000, for example, Orlando Vignatti, a holding member of La Capital Multimedios, sued Manzano and Vila, alleging that they committed fraud and conspiracy in a deal involving shares of several radio stations and the newspaper La Capital de Rosario. Vila said that Vignatti was not happy with his 25 percent interest ownership in the company that Vila and Manzano had given him through a contract, but Vila said that "we showed him that it was fair, he even asked to be general manager and we granted it" (translated from Spanish). After Vignatti filed the lawsuit, another meeting between the parties was agreed to, but Vignatti did not attend "for personal reasons," according to the Argentinian newspaper Página/12. Among the documentation presented as evidence, Vignatti submitted a fax that Vila allegedly sent him from the newspaper La Capital. "I never sent a fax like that!" Vila responded when asked by a reporter. The next year, Carlos María Lagos, the former owner of the newspaper, filed a complaint in which he alleged that Manzano and Vila "depleted" the company's funds. Santa Fe Justice investigated a "possible emptying of the firm" (translated from Spanish), according to the Los Andes Argentinian news website. In response, Vila told Los Andes that “everyone who has a commercial claim, uses [the] criminal justice [system] extortively and then [runs] a smear campaign through the media . . . such as Clarín, La Nación and The Andes." According to Los Andes, the dispute between Lagos and Vila-Manzano is centered around how shares of the company were distributed and disputes about company expenses. (In 1997, Lagos sold 75 percent of the shares of La Capital newspaper to Vila and Manzano's Grupo Uno media company, making Vila and Manzano the majority shareholders and controlling owners). Both Vignatti and Lagos had their own issues with the justice system, when Vignatti's properties were attached in 2016 and when Lagos was investigated for his management of La Capital. In 2001, Bernardo Martín Rutti, a former associate of Manzano and Vila, reported the two men to the Federal Administration of Public Revenue (AFIP). Rutti alleged that they laundered more than $400 million that Manzano, Rutti alleged, had "illegally obtained" during his time in public service. Rutti attempted to attribute what he called “the prodigious growth of the Vila-Manzano group” to his own unproven allegations of wrongdoing regarding the "true ownership" of, and source of the funds for, some of the Vila-Manzano companies. Rutti's main argument was the subjective unsubstantiated claim that the Vila-Manzano group "had a rapid and unjustified economic growth" by buying large amount of cables in the interior of the country, with an investment of the order of 300 million provided by Manzano." (Rutti used to work for Vila and Manzano but his employment had been terminated.) Links to Kirchners and others An opinion article published in August 2012 in La Nación described Manzano, according to the viewpoint of the opinion article author Joseph Crettaz, as an “old political friend of current officials, legislators and judges” who, despite his “low public profile,” is very actively involved with the powers that be. For instance, the relationship of Grupo Uno with the banker Raúl Moneta was mentioned in an opinion article with no byline. The opinion article (published in March 2001 in La Nación) about the “scandals” surrounding Moneta's “dubious” banking group noted Moneta's business relationship to Manzano, while adding that it is “difficult to determine” precisely what the nature of that relationship is. An article in Perfil, an Argentine tabloid newspaper, said that Horacio Verbitsky (an Argentine left-wing investigative journalist for Página/12 and author with a past history as a leftist guerrilla), in one of his articles in Página/12, mentioned Manzano's “very close connections to the Casa Rosada” during the administrations of the late Argentine president Néstor Kirchner and the former president, Cristina Férnandez Kirchner. The La Nación newspaper, which was in a strong dispute with the former government, identified as Manzano's “concrete achievements” under both presidencies his ability to secure cable television licenses beyond the legal limits, the government's pardoning of his tax debts, his obtaining of government advertising on the media he owns, and a privileged position in regard to obtaining a mobile-phone concession. Cablevision raid and aftermath In 2004 in Argentina, the largest media companies were Cablevisión (owned by Grupo Clarín), Multicanal (owned by Grupo Vila-Manzano), and Supercanal, which was jointly owned by Vila-Manzano (80%) and Clarín (20%). Vila-Manzano later sold Multicanal to a joint-venture between Clarín and Fintech, a U.S. investment fund. During the Nestor Kirchner administration, Multicanal and Cablevisión merged under the ownership of Grupo Clarín. In 2011, Grupo Vila-Manzano filed a complaint with a court in Mendoza Province that alleged "anticompetitive" practices by Cablevisión, which was owned by Grupo Clarín, a media conglomerate. In response to the complaint, Mendoza judge Walter Bento ordered the breakup of Cablevisión and Multicanal and appointed a judicial co-administrator to oversee the division of the two companies. On December 23, 2011, Cablevisión pressed charges against Bento with the Judiciary Council, calling for his impeachment. In 2012, the Federal Civil and Commercial Chamber of the Federal Capital (La Cámara Civil y Comercial Federal de la Capital Federal) ruled against Judge Bento's order, thus terminating the intervention into Cablevisión that began in 2011. Some Argentinian media published news articles opposing Vila-Manzano's position and supporting Grupo Clarín's position in the dispute. For example: A Clarin article wrote that a Manzano security escort and a "computer spy" were allegedly among the officials who entered Cablevisión after Judge Bento's ruling. Another Clarin article alleged that Vila-Manzano tried to "exert pressure" and contacted former President Kirchner to press their case. The website "1seprin.com" alleged that Judge Bento worked for a Vila-Manzano foundation. Another Clarin article alleged that a Kirchner friend had helped persuade Bento to issue his order. Social responsibility José Luis Manzano contributes to social, cultural and educational causes. He works with the Vendimia Solidaria program, which works toward the development of children and adolescents in the Province of Mendoza by providing financial assistance and promoting actions for the benefit of hospitals, neighborhood sports clubs and schools. He also participates in the La Capital Foundation, a Rosario organization whose objective is to promote and disseminate spaces for cultural production, debate and academic formation and promote volunteering and social responsibility. Manzano is sponsor of the House of Chinese Culture in Buenos Aires and president of the foundation of the University of Congress. He has also contributed to the Clinton Foundation and to The Climate Reality Project, a foundation founded by former U.S. Vice President Al Gore that seeks to raise awareness about environmental issues such as climate change. Personal life On February 21, 2015, José
[ 20670, 839, 4803, 476, 6296, 320, 6786, 285, 352, 6556, 762, 2581, 2629, 1327, 36928, 13260, 327, 253, 9077, 1159, 15, 187, 187, 13030, 11279, 1712, 1704, 27, 7265, 94, 187, 7770, 187, 187, 1231, 1265, 342, 247, 5426, 15, 187, 187, 2214, 370, 45, 31, 17, 5, 285, 669, 2461, 61, 249, 313, 17, 13, 19, 21828, 253, 9722, 2461, 13, 45, 16550, 41, 2381, 39828, 966, 13, 17007, 407, 669, 6199, 1035, 2461, 13, 45, 4244, 310, 2931, 347, 3637, 27, 187, 187, 14, 50275, 2042, 669, 2461, 61, 249, 313, 17, 13, 18, 21828, 253, 966, 669, 6199, 1035, 2461, 13, 45, 1009, 8414, 273, 3470, 370, 71, 8048, 250, 932, 63, 69, 61, 936, 61, 250, 932, 5, 14127, 1764, 2043, 92, 2132, 94, 187, 50262, 61, 1968, 92, 2574, 27, 11375, 520, 94, 187, 50262, 61, 14570, 1269, 13, 90, 61, 249, 61, 250, 932, 63, 69, 13, 6223, 1040, 71, 9, 89, 4587, 71, 9, 90, 30919, 3040, 418, 393, 12850, 92, 89, 14, 90, 4799, 2461, 7165, 187, 50266, 61, 423, 92, 2132, 2138, 187, 187, 14, 50275, 2042, 669, 2461, 61, 249, 313, 18, 13, 19, 21828, 253, 966, 669, 6199, 1035, 2461, 13, 45, 1009, 8414, 273, 14949, 46350, 3470, 370, 71, 8048, 250, 932, 63, 69, 61, 936, 61, 250, 932, 5, 14127, 1764, 2043, 92, 2132, 94, 187, 50262, 61, 1968, 92, 2574, 27, 11375, 805, 94, 187, 50262, 61, 14570, 1269, 13, 90, 61, 249, 61, 250, 932, 63, 69, 13, 6223, 1040, 71, 9, 89, 4587, 71, 9, 90, 17990, 5338, 464, 6526, 269, 9, 90, 582, 89, 14, 90, 8589, 393, 3040, 418, 393, 12850, 92, 89, 14, 90, 9616, 2461, 187, 50266, 61, 423, 92, 2132, 2138, 835, 669, 5338, 464, 3830, 1337, 3830, 724, 12853, 253, 6703, 1885, 15, 187, 187, 1231, 5467, 253, 1563, 15, 187, 187, 14, 50275, 2214, 667, 370, 89, 61, 249, 61, 250, 932, 63, 69, 1366, 253, 15355, 669, 3546, 60, 58, 93, 57, 30, 89, 18772, 71, 9, 89, 1009, 4961, 285, 669, 3546, 5709, 2981, 63, 19, 93, 57, 30, 89, 9955, 3040, 393, 2592, 63, 19, 2253, 2981, 654, 393, 3259, 1366, 835, 669, 2981, 426, 714, 2249, 3546, 60, 58, 93, 57, 62, 426, 714, 14, 71, 9, 57, 3822, 187, 187, 14, 50275, 510, 16888, 4038, 370, 81, 1035, 3830, 1009, 273, 370, 57, 5, 4961, 285, 12310, 370, 17, 29, 81, 1126, 1222, 94, 393, 3040, 268, 9, 89, 10, 393, 3040, 268, 1126, 4090, 724, 323, 512, 370, 89, 5, 327, 697, 1329, 15, 187, 187, 510, 25624, 274, 12451, 14, 30658, 1665, 29107, 323, 247, 11098, 10295, 370, 44, 5, 310, 2931, 347, 1764, 2043, 92, 2132, 94, 187, 50274, 61, 1968, 92, 2574, 27, 48685, 64, 1545, 64, 17995, 885, 94, 187, 50274, 71, 64, 79, 9, 89, 10, 426, 393, 2043, 92, 12866, 94, 187, 50270, 2650, 714, 64, 74, 708, 393, 1156, 92, 338, 748, 1269, 30, 57, 64, 74, 393, 1156, 92, 323, 690, 748, 891, 30, 18, 1337, 5589, 13, 79, 13, 3202, 187, 50270, 2650, 470, 708, 393, 1156, 92, 338, 748, 393, 2204, 578, 74, 30, 18, 2306, 79, 611, 61, 1274, 1035, 1124, 92, 89, 14, 57, 64, 74, 1217, 73, 889, 918, 10, 426, 470, 13, 3202, 187, 50270, 2650, 393, 1124, 464, 2204, 578, 74, 30, 18, 2306, 79, 714, 64, 74, 611, 61, 1274, 1035, 1124, 92, 89, 14, 57, 64, 74, 1217, 73, 889, 918, 15734, 2204, 578, 74, 30, 18, 2306, 79, 611, 61, 1274, 1035, 1124, 92, 89, 14, 57, 64, 74, 1217, 73, 889, 918, 3117, 708, 393, 1156, 92, 32240, 7165, 187, 50274, 61, 423, 92, 12866, 889, 423, 92, 2132, 2138, 187, 187, 510, 767, 2022, 1543, 323, 436, 29107, 403, 1024, 4767, 15, 187, 187, 1447, 7801, 27, 2461, 520, 696, 22883, 326, 370, 71, 61, 249, 61, 6199, 1035, 2461, 13, 45, 64, 71, 1009, 323, 669, 2461, 61, 249, 9, 17, 13, 18, 21828, 370, 45, 64, 71, 31, 17, 1352, 1281, 2903, 360, 6372, 3019, 34, 18, 1009, 285, 3019, 34, 19, 1009, 320, 10048, 13, 285, 370, 17, 29, 66, 29, 69, 16, 19, 1352, 2635, 323, 667, 4229, 370, 89, 64, 17, 61, 249, 61, 250, 932, 63, 69, 5, 275, 253, 1329, 273, 370, 81, 5, 253, 29107, 342, 10295, 285, 16992, 370, 73, 30, 79, 12886, 1124, 92, 18, 1217, 19, 61, 2461, 12, 69, 4018, 12310, 1764, 3546, 15830, 71, 64, 79, 9, 89, 64, 17, 4587, 71, 9, 89, 64, 17, 46931, 19, 9955, 3040, 330, 295, 12886, 1124, 92, 19, 61, 2461, 1217, 19, 61, 2461, 12, 69, 30848, 835, 370, 36, 31, 17, 5, 310, 247, 3638, 326, 1057, 417, 3469, 327, 370, 79, 1352, 187, 187, 1447, 7801, 27, 2461, 805, 696, 22883, 326, 370, 71, 61, 249, 61, 6199, 1035, 2461, 13, 45, 64, 71, 1009, 323, 669, 2461, 61, 249, 9, 18, 13, 19, 21828, 370, 45, 64, 71, 31, 17, 1352, 1281, 2903, 360, 6372, 3019, 34, 18, 1009, 285, 3019, 34, 19, 1009, 320, 10048, 13, 285, 370, 17, 29, 66, 29, 69, 16, 19, 1352, 22883, 275, 1635, 326, 370, 81, 61, 249, 393, 6199, 1035, 2461, 14, 18, 13, 45, 64, 81, 4244, 370, 45, 64, 81, 31, 17, 1352, 2635, 323, 667, 4229, 370, 89, 64, 17, 61, 249, 61, 250, 932, 63, 69, 5, 275, 253, 1329, 273, 370, 81, 5, 253, 29107, 342, 10295, 285, 16992, 370, 73, 30, 79, 12886, 1124, 92, 18, 1217, 19, 61, 2461, 12, 69, 4018, 12310, 1764, 3546, 15830, 71, 64, 79, 9, 89, 64, 17, 4587, 71, 9, 89, 64, 17, 46931, 19, 9955, 3040, 330, 295, 12886, 1124, 92, 19, 61, 2461, 1217, 19, 61, 2461, 12, 69, 30848, 835, 370, 36, 31, 17, 5, 310, 247, 3638, 326, 1057, 417, 3469, 327, 370, 79, 1352, 187, 187, 510, 1127, 3020, 1599, 30044, 2228, 313, 46, 2354, 10, 14493, 273, 380, 28657, 905, 7801, 27, 2461, 520, 696, 285, 905, 7801, 27, 2461, 805, 696, 4745, 16084, 253, 8527, 353, 2354, 342, 1675, 281, 253, 16888, 3268, 273, 370, 57, 18965, 1764, 2043, 92, 2132, 94, 187, 50274, 61, 3546, 61, 12850, 92, 71, 64, 79, 14, 71, 2306, 19, 578, 45, 64, 19, 9, 49, 64, 57, 3117, 393, 3040, 330, 295, 12886, 1124, 92, 19, 61, 2461, 1217, 19, 61, 2461, 12, 69, 23102, 423, 92, 2132, 2138, 7384, 326, 370, 71, 5, 310, 11542, 327, 253, 1329, 273, 253, 16888, 4038, 370, 81, 1352, 187, 187, 25889, 1320, 1712, 1704, 27, 34309, 1320, 94, 187, 18669, 187, 187, 510, 8442, 2708, 921, 20670, 569, 342, 34501, 285, 964, 3900, 1097, 5115, 8654, 4142, 273, 14940, 275, 436, 2969, 581, 14, 6967, 1895, 13, 253, 6158, 10295, 4620, 281, 320, 1679, 17948, 15, 8079, 13, 12401, 1157, 34501, 285, 4711, 5415, 3470, 15, 187, 187, 3138, 6504, 4818, 318, 342, 370, 44, 61, 1274, 9, 86, 61, 918, 10, 426, 393, 12850, 92, 86, 11444, 66, 94, 393, 527, 464, 12850, 92, 86, 889, 3040, 337, 3303, 370, 66, 30, 17, 15, 2537, 1366, 285, 2710, 2193, 273, 370, 73, 49021, 2203, 14, 1968, 568, 926, 27, 40718, 64, 74, 18, 10148, 40718, 16, 2108, 64, 66, 30, 25814, 15, 8567, 910, 3429, 32661, 2082, 61, 35673, 986, 187, 187, 3138, 6504, 4818, 318, 342, 370, 44, 61, 1274, 9, 86, 61, 918, 10, 426, 393, 12850, 92, 86, 11444, 66, 94, 544, 18, 2249, 12850, 92, 86, 94, 3725, 19, 13879, 1366, 370, 66, 30, 17, 15, 2537, 1366, 285, 2710, 2193, 273, 370, 73, 49021, 2203, 14, 1968, 568, 926, 27, 40718, 64, 74, 19, 10148, 40718, 16, 29846, 76, 64, 66, 30, 25814, 15, 8567, 910, 3429, 32661, 2082, 61, 35673, 986, 187, 187, 1231, 1024, 7277, 27476, 575, 1447, 926, 27, 40718, 2582, 74, 18, 696, 285, 905, 926, 27, 40718, 2582, 74, 19, 696, 281, 1110, 342, 247, 1327, 14, 48750, 10295, 15, 844, 7579, 326, 10165, 273, 16992, 370, 73, 5, 9184, 7293, 327, 253, 10295, 13, 285, 1480, 14023, 323, 253, 1072, 1318, 2439, 34501, 1537, 417, 320, 14282, 15, 187, 187, 3138, 23648, 27, 1327, 14, 48750, 10643, 1351, 1451, 34089, 10295, 370, 44, 61, 1274, 9, 86, 61, 918, 10, 426, 313, 20, 16, 21, 2769, 18, 2249, 12850, 92, 86, 2306, 19, 10, 393, 527, 464, 12850, 92, 86, 889, 3040, 337, 3363, 16943, 2203, 14, 1968, 568, 926, 27, 40718, 64, 554, 1351, 1451, 34089, 10148, 40718, 16, 554, 1351, 1451, 34089, 64, 22562, 15, 8567, 910, 3429, 32661, 2082, 61, 35673, 986, 187, 187, 3138, 23648, 27, 1327, 14, 48750, 14299, 10295, 370, 44, 61, 1274, 9, 86, 61, 918, 10, 426, 313, 18, 6602, 2609, 92, 19, 61, 2059, 8395, 4347, 61, 1274, 6921, 2249, 12850, 92, 86, 2306, 19, 61, 918, 19562, 5838, 253, 12059, 10165, 273, 370, 73, 49021, 2203, 14, 1968, 568, 926, 27, 40718, 64, 72, 12064, 10148, 40718, 16, 72, 12064, 64, 22562, 15, 8567, 910, 3429, 32661, 2082, 61, 35673, 986, 187, 187, 2841, 575, 1447, 926, 27, 40718, 2582, 74, 20, 696, 2708, 2722, 247, 5301, 875, 253, 20670, 839, 10295, 905, 2574, 27, 1545, 2582, 29846, 17131, 16825, 2582, 22562, 696, 285, 253, 14299, 10295, 323, 8985, 14, 24995, 941, 15, 844, 10018, 253, 625, 4156, 1055, 326, 1016, 1127, 556, 327, 253, 3879, 273, 253, 2900, 342, 253, 14299, 10295, 13, 275, 5301, 281, 253, 11098, 10295, 15, 31293, 3607, 273, 253, 10358, 14, 249, 30410, 669, 1156, 92, 9188, 1603, 71, 64, 79, 1009, 762, 2710, 8459, 2515, 4620, 281, 320, 271, 4722, 3884, 273, 2007, 2561, 15, 187, 187, 3138, 6504, 4818, 318, 342, 370, 44, 61, 1274, 9, 86, 61, 918, 10, 426, 393, 12850, 92, 86, 11444, 66, 94, 544, 18, 2249, 12850, 92, 86, 94, 3725, 19, 13879, 1366, 370, 66, 30, 17, 15, 2537, 1366, 323, 8985, 14, 24995, 370, 58, 49021, 2203, 14, 1968, 568, 926, 27, 40718, 64, 74, 20, 10148, 40718, 16, 29846, 76, 64, 66, 30, 25814, 64, 26458, 15, 8567, 910, 3429, 32661, 2082, 61, 35673, 986, 187, 187, 3138, 23648, 27, 1327, 14, 48750, 14299, 10295, 370, 44, 61, 1274, 9, 86, 61, 918, 10, 426, 313, 18, 6602, 2609, 92, 19, 61, 2059, 8395, 4347, 61, 1274, 6921, 2249, 12850, 92, 86, 2306, 19, 61, 918, 10952, 323, 8985, 14, 24995, 370, 58, 1352, 5838, 253, 12059, 10165, 273, 370, 73, 49021, 2203, 14, 1968, 568, 926, 27, 40718, 64, 72, 12064, 64, 26458, 10148, 40718, 16, 72, 12064, 64, 22562, 64, 26458, 15, 8567, 910, 3429, 32661, 2082, 61, 35673, 986, 187, 187, 19545, 84, 1712, 1704, 27, 16314, 84, 94, 187, 4738, 187, 187, 20696, 2957, 273, 31376, 13, 1908, 253, 1895, 273, 26230, 370, 71, 9, 89, 64, 17, 1009, 387, 370, 89, 64, 17, 30, 17, 1366, 7384, 352, 310, 275, 253, 1329, 273, 370, 81, 5, 285, 10493, 71, 9, 89, 64, 17, 8579, 11380, 3259, 1352, 187, 187, 16628, 253, 2362, 1764, 1588, 92, 38, 94, 426, 393, 1274, 17567, 2204, 578, 74, 30, 18, 2306, 79, 611, 64, 73, 9, 57, 64, 74, 10, 393, 9540, 470, 61, 918, 12499, 426, 393, 1274, 17567, 19390, 891, 30, 18, 1337, 5589, 13, 79, 27, 393, 12850, 92, 57, 64, 74, 889, 3040, 288, 61, 918, 61, 2138, 285, 10018, 326, 3318, 49, 61, 1274, 1035, 2009, 464, 1588, 92, 38, 3080, 918, 1572, 3040, 393, 1274, 9, 18, 14, 36, 81, 1126, 1222, 94, 73, 63, 69, 61, 918, 4800, 79, 61, 3040, 393, 4347, 61, 1274, 6921, 14, 36, 81, 1126, 1222, 94, 23713, 63, 69, 61, 918, 61, 2138, 323, 247, 3638, 370, 36, 31, 17, 5, 326, 1057, 417, 3469, 327, 370, 79, 1352, 1623, 253, 2362, 669, 2009, 464, 1588, 92, 38, 12460, 359, 452, 370, 71, 64, 79, 9, 17, 4010, 17, 5, 285, 3021, 253, 7680, 281, 3264, 2495, 310, 387, 954, 370, 46, 1126, 1588, 92, 38, 599, 426, 269, 9, 17, 4800, 19, 61, 4347, 61, 1274, 6921, 14, 36, 81, 1126, 1222, 94, 23713, 63, 69, 61, 918, 39130, 5 ]
interpolating rules can indeed be achieved and it holds under rather standard nonparametric assumptions on the regression function. Main Results {#sec:main} ============ We start with a definition. For $L>0$ and $\beta\in (0,2]$, the $(\beta,L)$-Hölder class, denoted by $\Sigma(\beta,L)$, is defined as follows: - If $\beta\in (0,1]$, the class $\Sigma(\beta,L)$ consists of functions $f:\reals^d\to\reals$ satisfying $$\begin{aligned} \label{eq:holder01} \forall x,y\in\reals^d,~~~ |f(x)-f(y)|\leq L \norm{x-y}^{\beta}. \end{aligned}$$ - If $\beta\in (1,2]$, the class $\Sigma(\beta,L)$ consists of continuously differentiable functions $f:\reals^d\to\reals$ satisfying $$\begin{aligned} \label{eq:holder12} \forall x,y\in\reals^d,~~~ |f(x)-f(y)-\inner{\nabla f(y),x-y}| \leq L \norm{x-y}^\beta \end{aligned}$$ where $\inner{\cdot,\cdot}$ denotes the inner product. We assume the following. - For any $x\in\reals^d$, the expectation $\En[Y|X=x]=f(x)$ exists and $\En[\xi^2|X=x]\leq \sigma^2_\xi < \infty$, where $\xi = Y-\En[Y|X] = Y-f(X)$. - The marginal density $p(\cdot)$ of $X$ exists and satisfies $0<p_{\min} \leq p(x) \leq p_{\max}$ for all $x$ on its support. The Nadaraya-Watson estimator for a singular kernel $K$ is defined as $$\begin{aligned} \label{eq:NW_def_precise} f_n(x) = \begin{cases} ~~ Y_i & \text{if } x=X_i \text{ for some } i=1,\ldots,n, \\ ~~ 0 & \text{if } \sum_{i=1}^n K\left(\frac{x-X_i}{h}\right) = 0, \\ ~~ \frac{\sum_{i=1}^n Y_i K\left(\frac{x-X_i}{h}\right)}{\sum_{i=1}^n K\left(\frac{x-X_i}{h}\right)} & \text{otherwise}. \end{cases}\end{aligned}$$ The two main results for this estimator are now stated. \[thm:beta01\] Assume that $f\in\Sigma(\beta,L_f)$ for $\beta\in(0,1]$, $L_f>0$. Let Assumptions $(A1)$ and $(A2)$ be satisfied, and $0<a<d/2$. Then for any fixed $x_0\in\reals^d$ in the support of $p$ the estimator with kernel and bandwidth $h=n^{-\frac{1}{2\beta+d}}$ satisfies $$\En[(f_n(x_0)-f(x_0))^2]\leq C n^{-\frac{2\beta}{2\beta+d}}$$ where $C>0$ is a constant that does not depend on $n$. \[thm:beta12\] Assume that $f\in\Sigma(\beta,L_f)$ for $\beta\in(1,2]$, $L_f>0$. Let Assumptions $(A1)$ and $(A2)$ be satisfied, and $0<a<d/2$. Assume in addition that $p\in \Sigma(\beta-1,L_p)$, $L_p>0$. Then for any fixed $x_0\in\reals^d$ in the support of $p$ the estimator with kernel and bandwidth $h=n^{-\frac{1}{2\beta+d}}$ satisfies $$\En[(f_n(x_0)-f(x_0))^2]\leq C n^{-\frac{2\beta}{2\beta+d}}$$ where $C>0$ is a constant that does not depend on $n$. The pointwise mean squared error (MSE) bounds of Theorems \[thm:beta01\] and \[thm:beta12\] immediately imply the integrated MSE with respect to the marginal distribution of $X$: $$\begin{aligned} \En\norm{f_n-f}^2_{L_2(P_X)} \leq C n^{-\frac{2\beta}{2\beta+d}},\end{aligned}$$ assuming that $f$ is bounded on the support of the marginal density $p$. Visualization {#sec:visualization} ============= The figures below show interpolations with kernels and . While both achieve optimal rates of convergence in this simple one-dimensional problem, the latter kernel appears to be less irregular. Indeed, unlike , kernels and produce continuous functions. ![Interpolation with $K\left(u\right) = \norm{u}^{-a} \ind{\norm{u}\leq 1}$, $a=0.49$, and various values of $h$.[]{data-label="fig:graphics_i1"}](graphics/ours_a=049.png){width=".65\textwidth"} ![Interpolation with $K\left(u\right) = \norm{u}^{-a} [1-\norm{u}]^2_+$, $a=0.49$, and various values of $h$.[]{data-label="fig:graphics_i2"}](graphics/katk_a=049.png){width=".65\textwidth"} We now compare Figures \[fig:graphics\_i1\] and \[fig:graphics\_i2\] to those with a non-singular kernel. We remark that choices of bandwidth $h$ differ depending on the kernel, and direct comparisons for the same value across kernels might not be meaningful. ![Comparison: non-singular Epanechnikov kernel $K\left(u\right) = (3/4)(1-\norm{u}^2) \ind{\norm{u}\leq 1}$.[]{data-label="fig:graphics_epanechnikov"}](graphics/epanechnikov_kernel.png){width=".65\textwidth"} ![Comparison: non-singular Gaussian kernel $K\left(u\right) = (1/\sqrt{2\pi})\exp\left\{-\norm{u}^2\right\}$. Note the altered choices of $h$.[]{data-label="fig:graphics_gaussian"}](graphics/gaussian_kernel.png){width=".65\textwidth"} Figure \[fig:graphics\_i3\] below shows a comparison between the interpolating kernel \[eq:def\_katkovnik\_kernel\] and the Gaussian kernel for binary-valued data. We observe the more global effect that each point has on the behavior of the solution with the Gaussian kernel, in comparison to the singular kernel. Understanding properties of the plug-in classifier $\text{sign}(f_n)$ under various margin conditions appears to be an interesting direction of further research. ![Interpolation with $K\left(u\right) = \norm{u}^{-a} [1-\norm{u}]^2_+$, $a=0.49$, for binary-valued $Y$.[]{data-label="fig:graphics_i3"}](graphics/katk_a=049_binary.png){width=".65\textwidth"} ![Comparison: non-singular Gaussian kernel $K\left(u\right) = (1/\sqrt{2\pi})\exp\left\{-\norm{u}^2\right\}$ for binary-valued $Y$. Note the altered choices of $h$.[]{data-label="fig:graphics_gaussian_binary"}](graphics/gaussian_kernel_binary.png){width=".65\textwidth"} Proofs {#sec:proofs} ====== Without loss of generality, consider the problem of estimating $f(x_0)$ at $x_0=0$, assuming it is in the support of $p$ and $|f(x_0)|<\infty$. Consider the event $$\mathcal{E} = \left\{\sum_{i=1}^n K_h(X_i) \neq 0\right\} = \left\{\exists i=1,\ldots,n: \norm{X_i}\leq h\right\}$$ and observe that $$P\left(\bar{\mathcal{E}}\right)\leq \left(1-Cp_{\min}h^d\right)^n\leq \exp\left\{-Cp_{\min}nh^d\right\}$$ for a constant $C>0$ that does not depend on $n$. On the event $\bar{\mathcal{E}}$, we have $f_n(0)=0$ and thus the contribution to expected risk is at most $M_{\mathcal{E}} = f(0)^2\exp\left\{-Cp_{\min}nh^d\right\},$
[ 285, 5119, 26426, 3177, 281, 3540, 1066, 253, 6858, 457, 84, 3101, 28, 2112, 253, 1039, 597, 13329, 3253, 432, 5654, 3659, 3167, 1131, 281, 1264, 20567, 15, 313, 11831, 20567, 32, 773, 1231, 457, 250, 275, 271, 3654, 590, 2, 7521, 5119, 354, 28803, 2698, 380, 35500, 310, 625, 298, 2435, 301, 1060, 685, 275, 1142, 16363, 3243, 272, 13305, 1108, 1014, 342, 247, 5389, 13, 11694, 282, 14, 88, 28456, 1113, 311, 14, 4093, 272, 1850, 276, 1003, 323, 253, 20985, 387, 1728, 13, 253, 921, 1335, 6337, 247, 1652, 2159, 13, 581, 273, 247, 1180, 273, 13305, 48086, 342, 3275, 20219, 1108, 533, 19143, 13, 326, 457, 84, 642, 49917, 15, 4952, 253, 2839, 14, 66, 14, 41506, 14, 41506, 16363, 3243, 272, 13, 30101, 323, 697, 3158, 14, 11342, 8913, 350, 13, 22828, 673, 281, 19309, 323, 6345, 285, 4887, 387, 2828, 78, 505, 553, 15, 187, 187, 3655, 15, 9463, 947, 20293, 3519, 1108, 914, 42256, 4716, 19341, 187, 187, 22396, 16, 38547, 374, 16, 9755, 34, 1250, 327, 41037, 27481, 407, 16553, 13856, 13, 3542, 407, 2516, 444, 15, 367, 276, 463, 187, 187, 35313, 5308, 369, 581, 273, 253, 954, 30357, 10382, 8711, 284, 273, 253, 1390, 9976, 13, 253, 2926, 273, 1355, 3874, 835, 5810, 14782, 616, 15060, 327, 616, 37318, 285, 14021, 21311, 6337, 1029, 15, 20580, 11471, 533, 1620, 278, 28989, 763, 13, 697, 9978, 1108, 1943, 14, 21280, 7345, 21130, 7233, 9727, 281, 247, 1355, 3874, 13, 767, 2151, 275, 12413, 13, 275, 253, 31433, 273, 521, 4475, 457, 84, 2471, 1108, 369, 271, 28561, 14, 31094, 22802, 745, 1127, 323, 247, 921, 440, 2320, 46088, 281, 11449, 1495, 457, 84, 7881, 1481, 14, 251, 15, 7850, 1533, 14, 22157, 369, 1273, 281, 5293, 13, 49378, 247, 18248, 10825, 285, 247, 1524, 3282, 273, 1659, 4768, 697, 1740, 12396, 15, 187, 187, 10951, 14, 13263, 9449, 9037, 914, 42256, 4716, 19341, 9010, 247, 1180, 273, 253, 2962, 457, 29386, 5810, 387, 2834, 2792, 275, 616, 4852, 13, 285, 253, 4651, 275, 616, 4852, 403, 26952, 281, 660, 23725, 616, 4105, 7089, 15, 11832, 41504, 3358, 556, 1694, 3206, 275, 247, 2954, 342, 21661, 13, 521, 7586, 457, 84, 5366, 656, 4069, 28, 16136, 7345, 29271, 34084, 9365, 521, 1211, 23490, 672, 6122, 22138, 10316, 3076, 14, 14889, 27145, 9368, 23509, 1728, 323, 247, 13319, 11484, 15, 733, 457, 84, 417, 253, 43719, 9449, 13, 533, 387, 1878, 21130, 310, 4560, 1220, 584, 275, 521, 1211, 747, 14541, 2954, 2866, 1919, 6122, 6304, 571, 4850, 5448, 273, 752, 457, 84, 1469, 327, 15, 187, 187, 3547, 15, 16341, 40804, 1703, 1108, 380, 6625, 1653, 187, 187, 19642, 16, 22166, 16, 7857, 34, 1250, 327, 15501, 27481, 285, 3542, 407, 22757, 18854, 5914, 285, 21130, 9516, 187, 187, 510, 40318, 273, 6282, 48085, 369, 697, 6459, 15231, 15, 496, 253, 17716, 273, 2722, 751, 330, 4063, 5402, 3035, 394, 28954, 4542, 13, 20477, 497, 13155, 285, 12112, 13, 347, 253, 35798, 1342, 2021, 497, 14659, 281, 1965, 87, 885, 15, 2064, 3061, 3977, 281, 253, 1264, 2151, 1108, 23239, 13, 6029, 285, 25062, 1108, 13716, 2190, 253, 954, 15958, 2151, 275, 17325, 13, 4680, 13, 8288, 285, 8534, 751, 13241, 5753, 15, 380, 921, 457, 84, 806, 9449, 2714, 3936, 2120, 5750, 273, 326, 2336, 261, 303, 300, 3396, 13, 347, 14423, 272, 6258, 275, 253, 35798, 1342, 11692, 4566, 1066, 275, 389, 1037, 10501, 8142, 15, 187, 187, 1088, 625, 27, 444, 15, 53, 15, 285, 49867, 1720, 328, 614, 275, 9449, 27811, 187, 187, 6872, 5753, 403, 5347, 14, 66, 24659, 1108, 6029, 3916, 4848, 1653, 1108, 390, 28840, 1108, 452, 15661, 521, 19110, 28, 25062, 40925, 275, 247, 44064, 38163, 273, 275, 1351, 3533, 1108, 533, 368, 476, 457, 85, 1361, 533, 11435, 616, 3033, 1417, 13, 642, 14, 15532, 14, 2009, 433, 12046, 4404, 1495, 15, 733, 1663, 1057, 9232, 253, 5471, 273, 752, 352, 457, 84, 751, 281, 247, 1429, 327, 14423, 272, 6258, 15, 32867, 2811, 13, 627, 403, 7350, 326, 8481, 324, 556, 4783, 5816, 432, 253, 1711, 952, 457, 84, 1728, 13, 285, 29835, 26062, 457, 2455, 14, 1258, 461, 2122, 12247, 26411, 310, 43922, 1076, 689, 25824, 11157, 2606, 12942, 15, 187, 187, 3677, 15, 9242, 10810, 35649, 48160, 1108, 329, 15997, 6053, 19293, 9449, 187, 187, 22396, 16, 38547, 495, 16, 8602, 34, 1250, 327, 34444, 27481, 407, 500, 15, 11418, 20358, 249, 13, 3542, 407, 25413, 2639, 332, 187, 187, 1628, 34, 10396, 23952, 318, 1806, 7211, 253, 13767, 327, 14, 14396, 4060, 3120, 17691, 6053, 19293, 457, 84, 760, 9449, 9037, 15, 733, 457, 84, 417, 3430, 27, 436, 310, 247, 12338, 13, 18935, 13, 15997, 6053, 19293, 9449, 6296, 15, 5769, 285, 19172, 13, 13189, 665, 20269, 1066, 247, 8485, 3781, 273, 34612, 14965, 285, 33262, 13, 403, 275, 11314, 13, 34735, 247, 3416, 3692, 5938, 556, 15159, 1475, 9449, 673, 15, 187, 187, 1088, 625, 27, 1737, 41091, 7395, 6053, 19293, 28593, 33341, 32, 187, 187, 16628, 569, 273, 253, 773, 11924, 14, 2019, 666, 668, 1108, 253, 20711, 25232, 273, 1711, 659, 15, 13104, 13, 247, 4473, 11797, 407, 38209, 824, 347, 17145, 1301, 316, 1108, 4245, 1039, 281, 253, 8900, 273, 47372, 17373, 313, 38358, 407, 12435, 43211, 281, 10956, 9449, 347, 359, 871, 779, 3063, 10, 3192, 17651, 1966, 38558, 21051, 15, 308, 1215, 13, 25758, 5017, 13, 533, 352, 457, 84, 298, 2575, 342, 253, 921, 457, 84, 26014, 19311, 15, 11960, 6816, 562, 253, 13862, 671, 27, 247, 19883, 10299, 2135, 3425, 13, 359, 9367, 4768, 253, 9037, 1463, 13, 281, 581, 273, 5769, 285, 19172, 457, 84, 11948, 2828, 78, 1169, 15, 733, 298, 1727, 253, 9037, 247, 2176, 26326, 285, 20978, 414, 326, 352, 1663, 5373, 432, 13, 253, 17489, 273, 28232, 2403, 323, 3962, 49799, 18066, 422, 794, 15, 187, 187, 1967, 15, 17450, 45638, 37784, 1108, 49954, 5721, 292, 6166, 187, 187, 19642, 16, 22166, 16, 9755, 34, 1250, 327, 15501, 27481, 407, 16246, 7889, 5969, 13, 3542, 407, 5490, 20069, 6595, 285, 23259, 7233, 187, 187, 510, 22663, 31924, 5262, 9449, 342, 441, 327, 271, 13943, 7457, 15530, 13, 533, 49954, 5721, 292, 6166, 310, 253, 1682, 273, 253, 12190, 13, 247, 11996, 9037, 3542, 387, 253, 5241, 273, 253, 921, 457, 84, 9136, 15, 6029, 285, 20222, 13, 342, 8228, 2151, 13104, 13, 14884, 90, 285, 6277, 13, 403, 10960, 327, 253, 308, 4338, 1563, 247, 1388, 5262, 9449, 12701, 27, 1955, 281, 25345, 3237, 13, 253, 6194, 310, 7591, 281, 2118, 15, 187, 187, 53, 5354, 285, 1565, 5726, 6054, 275, 253, 1531, 17263, 1113, 26074, 347, 253, 2021, 270, 13749, 13, 1315, 461, 4427, 8704, 16479, 13, 285, 3839, 2847, 18066, 422, 31795, 406, 15, 380, 9037, 310, 253, 1390, 281, 4735, 13104, 347, 247, 3963, 1894, 28, 521, 16018, 369, 2234, 281, 253, 2962, 1066, 12615, 13, 285, 7487, 436, 9037, 13, 352, 457, 84, 417, 2834, 281, 923, 2139, 27, 521, 749, 14095, 13, 7668, 253, 7289, 273, 3673, 1070, 1824, 281, 31391, 90, 16479, 13, 310, 17325, 5328, 13, 285, 37204, 19629, 17347, 84, 275, 253, 12794, 46660, 1632, 15, 6911, 44056, 457, 84, 6029, 310, 327, 1175, 830, 1512, 27, 521, 22014, 285, 10397, 310, 36385, 494, 15, 187, 187, 2090, 15, 3003, 378, 9324, 8973, 8835, 5757, 7840, 4290, 1108, 8679, 14026, 1916, 12238, 3032, 308, 790, 3683, 6282, 13, 1893, 754, 2101, 1727, 9449, 17363, 496, 380, 8896, 187, 187, 22396, 16, 38547, 577, 16, 20778, 34, 1250, 327, 21946, 27481, 407, 5490, 7634, 8111, 13, 3542, 407, 6270, 2790, 1962, 1440, 708, 16246, 308, 1032, 265, 187, 187, 18562, 634, 16298, 3683, 773, 90, 43730, 668, 327, 9449, 17363, 310, 642, 14, 531, 457, 84, 2934, 273, 794, 13, 533, 352, 19539, 3782, 28637, 323, 39738, 8679, 14089, 2205, 313, 26845, 1457, 23110, 582, 3692, 19328, 1255, 387, 253, 11091, 273, 1907, 824, 271, 4254, 275, 521, 2456, 84, 310, 509, 8055, 407, 30375, 326, 521, 15339, 310, 271, 385, 14, 15325, 273, 521, 15, 380, 8679, 1457, 23110, 10684, 369, 253, 806, 273, 8679, 457, 84, 1264, 1790, 681, 84, 13, 285, 4558, 253, 19508, 15, 187, 187, 26845, 1457, 23110, 1900, 2684, 1682, 347, 247, 4951, 637, 275, 247, 1533, 273, 5825, 44144, 13, 285, 326, 294, 7760, 43503, 275, 436, 13521, 13, 275, 534, 253, 6459, 9506, 497, 1110, 835, 8679, 29771, 253, 8921, 1533, 1475, 779, 1108, 1060, 13, 326, 19539, 281, 320, 253, 13667, 5954, 465, 645, 90, 15339, 15, 3032, 6355, 342, 617, 403, 253, 794, 8311, 383, 9506, 273, 253, 921, 13, 347, 703, 42255, 1837, 3544, 779, 2007, 1066, 715, 253, 277, 744, 49276, 15, 187, 187, 2358, 15, 39669, 35, 35867, 388, 42564, 5642, 51, 1830, 1108, 38292, 388, 684, 9449, 187, 187, 22396, 16, 38547, 337, 16, 9204, 34, 1250, 327, 530, 15332, 27481, 407, 399, 2477, 466, 17419, 13, 3542, 407, 329, 314, 1665, 401, 1312, 708, 14355, 2070, 51, 10986, 187, 187, 27503, 9384, 457, 84, 762, 14092, 2180, 1790, 681, 1108, 1158, 247, 2206, 45756, 8118, 14, 7878, 5508, 327, 380, 26733, 20175, 390, 380, 48261, 84, 1108, 369, 581, 273, 253, 794, 8311, 383, 13, 1682, 14, 45912, 25795, 447, 327, 5579, 1309, 697, 1740, 14, 13263, 1408, 15, 5729, 32980, 342, 247, 1379, 327, 9384, 457, 84, 1211, 2444, 14, 2437, 11948, 275, 47677, 14, 998, 7352, 1634, 386, 11126, 49188, 14, 998, 7352, 28455, 1457, 2816, 13, 697, 44690, 409, 2182, 1007, 387, 3374, 273, 966, 13, 2675, 16239, 285, 5492, 564, 4457, 1110, 273, 667, 643, 1790, 681, 273, 253, 747, 45660, 15, 733, 457, 84, 642, 8404, 11709, 16507, 13, 2167, 27, 352, 457, 84, 671, 8691, 20595, 11755, 13, 9628, 253, 1072, 694, 471, 323, 21899, 17325, 347, 9384, 457, 84, 1462, 14, 484, 33255, 15, 187, 187, 1088, 625, 27, 380, 9567, 9449, 19345, 447, 327, 388, 21362, 187, 187, 1628, 35485, 388, 684, 9449, 668, 9010, 253, 921, 327, 1270, 830, 13, 347, 275, 271, 11797, 19152, 13, 253, 2143, 457, 84, 45364, 2739, 4446, 7819, 562, 281, 320, 275, 8596, 273, 11007, 457, 1211, 2021, 15, 2058, 1728, 13, 11007, 12325, 323, 247, 11255, 1342, 323, 9449, 13, 533, 253, 2021, 476, 457, 85, 7848, 352, 28, 26614, 13, 5662, 4929, 30864, 556, 2183, 1652, 7586, 14861, 66, 326, 12126, 457, 84, 417, 1524, 13, 285, 1024, 703, 457, 84, 5068, 281, 1953, 3253, 703, 1869, 703, 3260, 670, 617, 4651, 457, 11847, 281, 33773, 15, 401, 17259, 13, 2032, 14, 936, 14, 8206, 2144, 15, 187, 187, 2251, 15, 3003, 2949, 35, 2025, 10663, 1400, 6117, 1108, 1594, 6681, 7021, 187, 187, 19642, 16, 30301, 337, 16, 8012, 329, 1250, 327, 444, 21, 27481, 407, 17419, 13051, 13, 3542, 407, 12304, 251, 2325, 265, 2205, 708, 309, 404, 17771, 187, 187, 52, 7232, 310, 1495, 347, 4782, 27517, 8564, 352, 28, 380, 496, 17352, 398, 310, 29386, 1495, 347, 352, 2686, 310, 15, 380, 1801, 1351, 13, 23293, 1331, 982, 273, 4130, 457, 84, 18069, 1387, 273, 15515, 14, 630, 8909, 33889, 1160, 323, 1264, 2962, 273, 13667, 5954, 34019, 14657, 13, 347, 3253, 326, 812, 564, 3430, 323, 841, 1740, 8290, 858, 15, 3973, 14, 22253, 5857, 773, 57, 6681, 7021, 668, 310, 642, 6517, 15, 380, 18066, 422, 2952, 320, 777, 790, 13, 285, 7395, 310, 10544, 16782, 273, 253, 2143, 9449, 7021, 7039, 313, 1615, 4284, 1108, 642, 14, 531, 2010, 556, 3732, 481, 187, 187, 7420, 1148, 569, 5276, 8127, 313, 395, 389, 1037, 10, 28008, 13, 285, 327, 3128, 2360, 13, 7395, 310, 7514, 326, 4130, 588, 4456, 253, 2360, 347, 247, 5699, 27531, 15, 3656, 21680, 320, 777, 251, 13, 2167, 28, 14698, 2581, 13644, 10224, 281, 259, 3288, 30582, 2639, 965, 13, 16246, 29212, 285, 31594, 275, 247, 12246, 281, 1056, 247, 747, 3331, 13, 285, 247, 2581, 594, 4396, 1070, 26298, 9437, 281, 3802, 462, 253, 16775, 9732, 15, 733, 457, 84, 10610, 496, 17352, 398, 2144, 13, 44491, 342, 247, 26757, 5954, 717, 35232, 24329, 14, 10383, 1108, 275, 253, 5968, 273, 253, 2952, 1108, 275, 253, 3128, 457, 84, 31433, 15, 187, 187, 2526, 15, 22428, 7611, 2350, 6527, 1108, 1594, 6681, 16061 ]
and David desperately attempt to track down the baby’s mother; along the way they encounter everything from gunpoint hostages to three Kings. (Three Kings? “We’re in an allegory!”, David proclaims.) The pacing is more languid here than in many Moonlighting episodes – even with a beautiful, cockle-warming carol-singing denouement for the viewers at home, the show still ran a little short, one of a number of episodes plagued with production delays – but surprisingly, that’s no detriment. Even the rat-a-tat-tat Moonlighting, renowned for its quick-fire banter, deserves time to pause for breath and reflect at Christmastime. 73. EVERWOOD – Unhappy Holidays USA/Season 2/2003Aired on WBdirected by Jason Moore, written by John E. Pouge Everwood was one of the most enjoyable serial dramas of the last decade, the story of small town where characters wore their hearts on their sleeves and emotions permanently ran high. Sentimental but never mawkish, its setup – big-city doctor Andy Brown moves to a small town, two children in tow, in the aftermath of his wife’s death – was an emotionally-charged jumping off point for a show unafraid to confront life’s challenges head-on. Its world-building was second to none, crafting a loving atmosphere and a real sense of place throughout its four seasons. Second-season Christmas episode Unhappy Holidays finds a number of the series’ teenage characters at difficult points in their lives, and the parents in their lives are helpless to scupper their poor decisions. Son Ephram has got involved in a relationship with Madison, his sister’s babysitter; rival doctor Harold Abbott faces his own struggles when daughter Amy brings bad-boy Tommy Callahan home for a holiday meal. It’s not the brightest Christmas, but at least Andy is finding solace in his own newfound relationship… until daughter Delia gets wind of what’s going on. 72. OUTNUMBERED – The Robbers UK/Special/2009Aired on BBCdirected and written by Guy Jenkin and Andy Hamilton The authenticity of Outnumbered was its greatest asset. In the vein of shows like Curb Your Enthusiasm, scripts were loose and flexible, as the Brockman family were encouraged to improvise. That decision led to the three children – Jake, Ben and Karen – rating among the most realistic children in comedy, thinking, speaking and acting like genuine kids. The show’s first Christmas special takes full advantage of that verisimilitude, as Boxing Day in the Brockman household goes down in comically authentic fashion. read more: E.T. and Elliot Reunite in Christmas Commercial These kids are capital-a annoying – Ben claims robbers – or aliens – have stolen his pants; Karen engages in a relentless torrent of inane questions – but you can’t help but appreciate their boundless, no-holds-barred attitude towards life. It really does capture the feeling of what it’s like to a child on Boxing Day. Elsewhere, there are concerns that Grandad has gone missing from the old people’s home, and Hugh Dennis’ ever-flustered dad Pete is fretting over unwanted lunchtime visitors. 71. SUPERNATURAL – A Very Supernatural Christmas USA/Season 3/2007Aired on CWdirected by J. Miller Tobin, written by Jeremy Carver “A Special Presentation,” notes the retro on-screen title card preceding Supernatural’s only Christmas episode. It’s not wrong: this is a violent, twisted, Very Supernatural Christmas indeed. Sam and Dean, brothers who hunt down a vast array of supernatural beings and demons, are in Michigan, assisting a woman whose husband has disappeared around Christmas time. read more: What Legacy Will Supernatural Leave Behind? Considerations of the “anti-Claus” – the antithesis of old St. Nick, a concept inspired by legends such as Krampus – gives way to the discovery of pagan gods (inspired by spiritual predecessors to Father Christmas as we know him today) taking ritual human sacrifices annually. Tense, disturbing stuff, but it’s laced with the show’s trademark wit. Balancing out the darkness also: a touching flashback sequence, weaved throughout the episode proper, to one of Sam and Dean’s childhood Christmases. It lends the episode a certain warmth and levity that it really benefits from, the mesh of tones making for perfect unconventional festive fun. 70. MY FAMILY – Sixty Feet Under UK/Special/2003Aired on BBCdirected by Jay Sandrich, written by James Hendrie and Ian Brown The Harper clan spent Christmas with us on an impressive nine occasions, but Sixty Feet Under is the best of the bunch, a bottle episode written at the peak of the show’s powers. Ben and Susan, with grown children Nick, Janey and Michael, are stuck on the Tube following a day spent Christmas shopping: due to signalling problems, the train is unable to move. Tensions and tempers rise in the cramped carriages as the family bicker, frustrate surrounding passengers, and generally cause festive havoc. The episode is the last to feature Nick as a regular character; his departure was key to the series downfall, and watching this episode, it’s not difficult to see why: his subplot, involving the sale of bottled water to thirsty passengers, is comedy gold, and Kris Marshall revels in the inherent silliness. Robert Lindsay’s Ben is on good form too: his frustration and anxiety is palpable. 69. THE BOB NEWHART SHOW – Bob Has To Have His Tonsils Out, So He Spends Christmas Eve In The Hospital USA/Season 4/1975Aired on CBSdirected by James Burrows, written by Tom Patchett & Jay Tarses Having your tonsils “yanked” on Christmas Eve is no-one’s idea of fun, but it proves particularly unpleasant for psychiatrist Bob Hartley (Bob Newhart), whose awkwardness at the prospect of having such an operation in his 50s is compounded by discovering that his nurse is an ex-patient of his. The Bob Newhart Show was the first of Bob’s three sitcoms, and remains the strongest. Bob Newhart always performed best as a straight man in a world of nutjobs, and that reaped dividends in this programme, in which the greatest moments were those where Bob reacted the strange world around him – here, that proves to be the brilliantly kooky nurse. His interactions with her are the funniest moments of the show, as she inadvertently drags him further down into the doldrums. 68. EVERYBODY HATES CHRIS – Everybody Hates Christmas USA/Season 1/2005Aired on UPNdirected by Dennie Gordon, written by Alyson Fouse & Ali LeRoi Chris Rock’s underrated period sitcom – think a satirical African-American spin on The Wonder Years or The Goldbergs – was one of the funniest, best-observed comedies on TV during its four-season run. Preoccupied with a take on Rock’s own working-class childhood in Bedford-Stuyvesant (“Bed-Stuy”), New York, its uncompromising look at issues of class, social mobility and race go beyond those of any other sitcom of the new millennium. It’s no Social Studies lesson, though: it’s also fantastically funny, sharing the same knack for observational comedy as Rock’s stand-up routines. read more: The Best Christmas Movies on Hulu “Everybody Hates Christmas” finds the show on great form, as in an inspired twist, the school’s canned food drive turns out to be in aid of Chris’ own family. At home, Chris asks for a Walkman for Christmas, but the family can’t afford it; meanwhile, older brother Drew has told little sister Tonya that Santa’s not real, and now she’s beginning to question everything she thought she knew about her parents’ commitment to honesty. Funny, true-to-life material. 67. THE INBETWEENERS – Xmas Party UK/Series 1/2008 Aired on E4directed by Gordon Anderson, written by Damon Beesley & Iain Morris Skins is life as British teens imagine it; The Inbetweeners is teenage life as it actually is. The profane, unfortunate antics of everyone’s favourite group of sixth-form oddballs made for three series of brilliantly embarrassing viewing, as everything that could go wrong for these four boys did. First-series entry “Xmas Party” is no exception. The festive season beckons, and Will is elected chairman of the school Christmas Party Committee (by default – no-one else has applied). Preparations prove largely (and comically) unsuccessful, and on party night, Will is concerned that everyone will remember the night as a huge disappointment. Distractions beckon, though; Simon rather publicly fails to woo crush Carli, Jay crashes and burns in a bid to make a new friend, and a rather sozzled Neil attempts to snog the biology teacher. It’s classic Inbetweeners material, capped with a pleasantly amicable piss-about – in the spirit of the season – in the party’s aftermath. 66. NEWSRADIO – Xmas Story
[ 18714, 2792, 370, 89, 393, 249, 353, 5, 313, 2887, 1008, 9263, 8469, 2498, 1707, 403, 671, 6667, 275, 534, 253, 2701, 275, 253, 5150, 310, 4577, 685, 253, 17597, 15579, 323, 271, 1527, 873, 273, 16012, 313, 2887, 1008, 9263, 9387, 19, 2498, 187, 187, 34, 42601, 16751, 310, 753, 281, 320, 17568, 7895, 313, 2887, 1008, 9263, 8469, 3291, 604, 627, 310, 247, 6486, 1180, 370, 76, 5, 824, 326, 512, 28600, 982, 12873, 271, 10341, 4667, 273, 2792, 275, 253, 16751, 476, 320, 13230, 407, 370, 76, 5, 1127, 24238, 15, 733, 310, 11464, 275, 1008, 9263, 8469, 62, 326, 253, 1180, 273, 28600, 982, 342, 2978, 669, 3040, 308, 5, 875, 1046, 4667, 273, 2792, 275, 247, 17568, 7895, 16751, 17202, 10661, 1365, 347, 370, 53, 393, 936, 393, 3259, 1352, 4794, 281, 253, 1543, 273, 353, 15, 443, 409, 729, 285, 416, 15, 7057, 6621, 860, 313, 2887, 1008, 46, 1351, 6660, 253, 7936, 1387, 273, 824, 247, 16751, 310, 14257, 5296, 35741, 13, 285, 253, 17597, 15579, 273, 697, 35917, 2685, 310, 5058, 15, 5488, 13, 604, 247, 17568, 7895, 16751, 556, 642, 27442, 2792, 13, 840, 352, 310, 6507, 15, 831, 3637, 432, 253, 7503, 5296, 11714, 1371, 273, 697, 7936, 1387, 2057, 3066, 253, 39383, 273, 330, 7292, 14, 10859, 287, 16478, 285, 7634, 5477, 14, 42, 6148, 729, 13, 390, 407, 247, 625, 3332, 789, 273, 2070, 3026, 19020, 1008, 45, 2275, 1570, 187, 187, 688, 253, 1246, 3929, 359, 1908, 253, 1083, 835, 253, 1180, 273, 28600, 982, 17202, 10661, 1365, 13, 323, 1650, 247, 8566, 42601, 16751, 326, 310, 17568, 7895, 15, 844, 1263, 275, 2508, 767, 6667, 27, 247, 2629, 16657, 285, 247, 6507, 32621, 342, 581, 5024, 15, 496, 253, 4112, 835, 253, 6425, 16095, 273, 253, 9297, 273, 253, 4216, 403, 23352, 3907, 689, 253, 1673, 273, 8870, 3904, 13, 627, 310, 247, 581, 14, 936, 14, 531, 17668, 875, 253, 2069, 275, 534, 253, 4201, 273, 747, 14299, 20342, 6634, 285, 46214, 5482, 273, 11968, 4872, 11370, 835, 253, 987, 1133, 1930, 18207, 370, 53, 1352, 6102, 25930, 12893, 275, 1180, 3762, 13, 10775, 275, 253, 1783, 273, 253, 20185, 3879, 273, 253, 1180, 273, 27959, 273, 3626, 3904, 15, 844, 476, 6983, 253, 1543, 273, 443, 15, 41, 15, 29944, 285, 322, 15, 29421, 10441, 266, 13, 500, 15, 55, 15, 530, 1033, 561, 4742, 13, 443, 15, 416, 4788, 12844, 13, 367, 15, 37602, 28544, 285, 2571, 15, 496, 776, 1083, 13, 253, 2978, 273, 253, 28600, 982, 588, 417, 320, 247, 3425, 273, 3626, 3904, 15, 3813, 13, 387, 253, 806, 3924, 273, 776, 2561, 359, 4044, 760, 271, 5170, 3033, 432, 253, 8946, 1543, 15, 1623, 253, 643, 1133, 13, 247, 2406, 3033, 369, 11464, 275, 1008, 1206, 6678, 1092, 10775, 323, 11968, 1180, 273, 9297, 669, 32067, 47, 9, 53, 1009, 17202, 7938, 685, 667, 14189, 15, 14772, 359, 1119, 247, 4602, 875, 253, 1895, 359, 574, 5421, 285, 3533, 14475, 275, 253, 1263, 273, 43513, 14, 35147, 21412, 3678, 15579, 13, 534, 275, 3332, 1107, 369, 4824, 562, 407, 657, 15, 49, 15, 12962, 21412, 285, 657, 15, 38, 15, 427, 11983, 1479, 968, 76, 2886, 15, 844, 908, 247, 4072, 906, 273, 657, 15, 38, 15, 427, 11983, 1479, 968, 76, 2886, 313, 2887, 1008, 306, 64, 79, 3291, 281, 4044, 20185, 23276, 323, 253, 42407, 273, 253, 1180, 273, 14299, 20342, 327, 253, 5024, 15, 1310, 4872, 14275, 689, 669, 1991, 92, 50, 724, 1057, 417, 2186, 313, 10328, 4112, 310, 5604, 1896, 984, 359, 476, 1014, 452, 1142, 28600, 982, 342, 253, 1072, 2978, 13, 923, 299, 15, 72, 15, 1008, 11063, 77, 1171, 6660, 253, 4795, 20185, 7212, 4916, 271, 5170, 3033, 323, 669, 32067, 47, 9, 53, 3822, 733, 943, 320, 4879, 326, 253, 1072, 1543, 476, 320, 2797, 970, 5733, 1483, 27426, 12128, 11057, 6899, 432, 1008, 18933, 36470, 12432, 379, 1570, 329, 4382, 3368, 5196, 26277, 342, 473, 15, 55, 15, 34804, 40610, 556, 5783, 253, 36594, 273, 253, 8197, 15, 380, 9864, 1543, 323, 247, 25701, 4216, 2797, 407, 36976, 247, 2978, 273, 253, 16657, 403, 671, 1677, 275, 1008, 1206, 6678, 1570, 187, 187, 49, 34466, 16157, 285, 14308, 187, 33585, 187, 187, 34, 3921, 29284, 456, 4216, 4622, 310, 247, 17597, 2317, 13, 2797, 432, 247, 7982, 4216, 407, 15706, 13388, 407, 6032, 28236, 273, 10103, 767, 390, 1264, 15, 11680, 247, 6486, 1180, 273, 6032, 3426, 42601, 28236, 370, 46, 64, 75, 1366, 285, 247, 1180, 273, 13288, 669, 2733, 64, 74, 1366, 39433, 342, 3963, 30364, 45031, 15, 1198, 1016, 21229, 370, 90, 5, 273, 271, 10341, 8223, 669, 2733, 64, 75, 5, 4993, 247, 1127, 669, 3582, 340, 5, 327, 581, 273, 253, 28236, 370, 46, 64, 76, 16446, 359, 5467, 512, 2792, 669, 3582, 340, 5, 281, 320, 5799, 15, 329, 25701, 4216, 669, 4220, 64, 69, 5, 310, 247, 26860, 2317, 273, 253, 28465, 2020, 669, 2760, 18858, 6837, 64, 76, 187, 50276, 46, 64, 76, 61, 2760, 18858, 6837, 64, 75, 61, 2733, 64, 75, 5, 407, 253, 19945, 370, 90, 393, 3549, 393, 3582, 340, 1352, 187, 187, 510, 40598, 5150, 327, 247, 25701, 4216, 310, 2931, 347, 3637, 313, 2887, 1008, 21279, 62, 285, 1008, 1206, 6678, 62, 323, 7000, 8813, 28, 253, 3236, 5697, 497, 3559, 275, 1008, 7073, 2947, 49, 580, 2498, 187, 187, 1466, 370, 55, 5, 320, 247, 1524, 21392, 5415, 1159, 327, 370, 393, 4220, 64, 69, 1366, 6032, 327, 253, 9297, 15, 1281, 370, 55, 64, 75, 5, 285, 370, 55, 64, 76, 5, 320, 13133, 273, 370, 55, 5, 281, 669, 2733, 64, 75, 5, 285, 281, 370, 46, 64, 76, 5, 2975, 15, 11680, 247, 1480, 2020, 370, 187, 50276, 61, 8752, 92, 41, 2000, 17, 2029, 36985, 61, 10423, 578, 75, 30, 18, 1990, 38, 889, 1274, 19724, 1124, 92, 73, 63, 19, 1217, 19, 889, 1124, 464, 78, 9194, 63, 19, 2704, 78, 9194, 187, 50276, 91, 64, 75, 63, 19, 6643, 55, 64, 75, 61, 918, 1572, 36985, 61, 10423, 578, 76, 30, 18, 1990, 55, 889, 1274, 19724, 1124, 92, 73, 63, 19, 1217, 19, 889, 3442, 64, 76, 12, 187, 50276, 55, 64, 76, 61, 918, 10, 370, 342, 253, 5028, 370, 41, 63, 19, 1035, 4220, 7182, 36985, 61, 10423, 578, 75, 30, 18, 1990, 38, 94, 41, 63, 19, 1035, 2733, 64, 75, 1572, 36985, 61, 10423, 578, 76, 30, 187, 50276, 18, 1990, 55, 94, 388, 63, 19, 9, 46, 64, 76, 34488, 3856, 669, 1124, 464, 78, 9194, 63, 19, 2704, 78, 9194, 1182, 64, 75, 63, 19, 724, 310, 271, 5572, 273, 253, 1273, 4309, 327, 669, 2733, 64, 75, 5, 342, 1675, 281, 247, 4229, 30364, 45031, 342, 38430, 7548, 2515, 13, 669, 3442, 64, 76, 5, 310, 253, 49603, 1253, 15343, 1206, 7588, 5572, 327, 370, 46, 64, 76, 1352, 187, 187, 13811, 18712, 36487, 380, 3921, 10859, 83, 38052, 5572, 4622, 669, 8752, 92, 41, 724, 310, 247, 1881, 14, 44121, 6880, 273, 253, 12400, 669, 8752, 92, 41, 64, 17, 8589, 578, 45, 3303, 835, 370, 187, 50276, 45, 2029, 464, 4144, 61, 249, 388, 63, 19, 1035, 4220, 10853, 3362, 393, 4144, 9, 90, 64, 84, 4010, 17, 61, 34580, 187, 187, 25906, 273, 253, 5572, 669, 8752, 92, 41, 724, 4428, 3470, 342, 34001, 275, 253, 2792, 370, 90, 64, 75, 1352, 39431, 13, 1339, 370, 40, 9, 89, 13, 90, 1337, 2260, 1009, 320, 253, 6115, 1159, 327, 370, 46, 64, 76, 5, 313, 49112, 10295, 273, 253, 37732, 2254, 10, 273, 669, 3442, 1366, 3969, 281, 253, 9879, 4764, 669, 2260, 1352, 831, 1159, 556, 253, 1563, 12139, 20290, 347, 370, 89, 61, 936, 340, 18965, 370, 40, 9, 89, 13, 90, 1337, 2260, 4010, 39, 64, 17, 9, 89, 13, 90, 8744, 39, 64, 18, 1366, 835, 370, 39, 64, 18, 5, 310, 247, 5415, 1159, 285, 370, 39, 64, 17, 5, 310, 3907, 273, 669, 2260, 5, 285, 556, 253, 830, 370, 39, 64, 17, 29715, 1124, 92, 68, 64, 19, 1217, 19, 61, 2059, 889, 78, 1258, 79, 61, 2859, 5, 604, 669, 32067, 4528, 353, 30, 19, 5, 285, 370, 39, 64, 17, 2029, 1124, 92, 68, 64, 20, 1217, 21, 61, 2059, 61, 2859, 724, 604, 669, 32067, 4528, 353, 30, 20, 1352, 3856, 370, 68, 64, 75, 9, 89, 13, 90, 1009, 310, 5415, 13, 370, 68, 64, 75, 9, 90, 13, 90, 4010, 18, 1366, 669, 2859, 5, 310, 253, 4181, 875, 370, 89, 5, 285, 370, 90, 1352, 380, 1159, 669, 4144, 5, 432, 253, 5028, 273, 253, 5572, 669, 8752, 92, 41, 724, 556, 253, 1563, 12139, 20290, 347, 370, 89, 61, 936, 340, 64, 75, 18965, 370, 393, 4144, 2029, 1637, 64, 75, 39, 64, 17, 9, 89, 8744, 67, 64, 75, 12, 80, 9, 18, 3822, 187, 187, 4125, 323, 1016, 21229, 273, 253, 8223, 1908, 247, 4667, 669, 4144, 9, 90, 4244, 370, 73, 61, 4144, 2850, 5994, 9, 90, 1009, 285, 247, 4972, 669, 2981, 10190, 86, 13, 87, 4244, 14, 25463, 577, 358, 370, 86, 10190, 73, 61, 4144, 2850, 5994, 9, 90, 64, 18, 10853, 6768, 13, 73, 61, 4144, 2850, 5994, 9, 90, 578, 19, 38, 46257, 1637, 64, 18, 1337, 6768, 1337, 1637, 578, 19, 38, 19446, 14, 25463, 577, 358, 370, 87, 36864, 4144, 9, 90, 64, 18, 10853, 6768, 1337, 4144, 9, 90, 578, 19, 38, 22286, 38057, 64, 18, 1337, 6768, 13, 38057, 578, 19, 38, 17137, 14, 25463, 11680, 247, 2629, 35689, 14, 41, 693, 34851, 830, 34398, 2981, 63, 18, 1337, 2981, 63, 19, 62, 2029, 2204, 578, 75, 30, 18, 1990, 21, 38, 1603, 86, 63, 18, 64, 75, 61, 2009, 362, 63, 19, 64, 75, 14, 87, 64, 75, 63, 18, 61, 2009, 1484, 64, 75, 63, 19, 1009, 275, 669, 1991, 92, 36, 1990, 21, 38, 889, 11613, 61, 1991, 92, 36, 1990, 21, 38, 3363, 1281, 441, 4993, 253, 26150, 6415, 669, 5764, 61, 6040, 393, 1991, 92, 36, 1990, 21, 38, 889, 11613, 61, 1991, 92, 36, 1990, 21, 38, 3363, 329, 1881, 14, 44121, 6880, 669, 8752, 92, 41, 724, 310, 2931, 407, 253, 8789, 2515, 669, 2981, 61, 249, 187, 50276, 61, 5764, 5, 390, 39406, 669, 3362, 428, 74, 9, 42, 12, 54, 10, 86, 18958, 42, 14, 54, 10, 87, 30, 17, 12063, 835, 370, 54, 5, 310, 247, 24287, 4315, 13947, 669, 5764, 5, 285, 370, 42, 5, 310, 271, 6489, 4315, 15, 844, 588, 1908, 760, 1980, 8789, 2515, 13, 891, 13, 70, 15, 669, 5764, 2029, 36985, 61, 10423, 64, 90, 464, 5764, 2000, 90, 1366, 835, 2367, 5764, 2000, 90, 61, 6040, 187, 50276, 61, 1991, 330, 63, 21, 5, 310, 2931, 323, 1016, 1127, 370, 90, 5, 11794, 15, 187, 187, 688, 6899, 495, 15, 18, 273, 253, 3929, 1008, 1206, 6678, 62, 352, 310, 2011, 849, 11715, 273, 247, 14299, 13138, 387, 253, 1127, 273, 1289, 5845, 273, 253, 5024, 281, 253, 2553, 3936, 1659, 15, 187, 187, 11389, 1783, 273, 253, 1180, 273, 20342, 327, 247, 25701, 4216, 310, 347, 3637, 15, 3932, 5149, 6342, 18634, 6634, 2112, 253, 35917, 13, 359, 476, 3989, 247, 11038, 7982, 4216, 323, 247, 1677, 25701, 4216, 15, 26745, 1271, 323, 436, 747, 4216, 403, 253, 2792, 273, 1289, 5845, 285, 9297, 403, 512, 28600, 982, 327, 253, 9421, 12873, 2792, 273, 1289, 5845, 285, 253, 1711, 9297, 15, 844, 403, 6110, 275, 253, 1180, 273, 1711, 14299, 20342, 13, 891, 15, 70, 15, 1110, 3692, 1329, 588, 7027, 327, 253, 9297, 273, 253, 3236, 4216, 15, 187, 187, 510, 1180, 273, 20342, 812, 1818, 760, 275, 1110, 9506, 273, 673, 326, 452, 253, 830, 273, 4872, 13553, 273, 5024, 4288, 673, 15, 1893, 253, 1180, 273, 20342, 310, 4503, 281, 253, 1180, 273, 5239, 10809, 79, 64, 75, 10952, 14127, 690, 9035, 569, 273, 436, 2238, 27, 3318, 79, 64, 18, 85, 578, 77, 64, 18, 9213, 5589, 12, 79, 64, 6917, 578, 77, 64, 78, 2704, 3040, 94, 53, 13, 187, 50274, 61, 1968, 92, 460, 82, 2138, 835, 370, 85, 64, 75, 5, 310, 247, 4288, 673 ]
exceptional points $x \in M$ (see [@BuGu]). There are also examples in which the limit in the equation is smaller than the topological entropy for an open set of configurations (see [@BuPa2]). A Riemannian manifold is said to be uniformly secure (see [@BuGu]) if there is a finite number $k$ such that all geodesics connecting an arbitrary pair of points in the manifold can be blocked by $k$ point obstacles. It is proven in [@BuGu] that the number of geodesics with length $\leq T$ between every pair of points in a uniformly secure manifold grows polynomially as $T \to \infty$. According to the results of M. Gromov and R. Mañé (see [@Mane]), the fundamental group of such a manifold is virtually nilpotent, and the topological entropy of its geodesic flow is zero. Furthermore, if a uniformly secure manifold has no conjugate points, then it is flat. This follows from the virtual nilpotency of its fundamental group either via the theorems of Croke-Schroeder and Burago-Ivanov, or by a more recent work of Lebedeva [@Leb]. In the present article we consider the case where the number of geodesics grows polynomially, for example a compact Riemannian manifold that is uniformly secure. We study in detail two examples: a standard cylinder and a flat torus with one edge. In the situation where the equivalent lengths of the edges of the graph are linearly independent over the field of rational numbers, there is a one-to-one correspondence between the times in which the birth of new Gaussian packets occurs and nonnegative solutions of infinite linear inequality where the right hand side equals $T$. Such inequalities arise in number theory, namely in the analysis of the asymptotic behavior of the number of partitions of natural numbers. We can recall the results of G.H. Hardy and S. Ramanujan, J.V. Uspensky, G. Rademacher, P. Erdös and others. In our case, the length of the geodesics will not be a sequence of natural numbers. Therefore, at the first stage of our research we obtain only an upper bound from the classical results. On the other hand, a lower bound was proven in [@trsa], namely for infinite number of edges $\mfN(T)$ grows faster than any polynomial. Later we found a connection between the problem we had studied and questions arising in the study of Bose-Maslov gas entropy, which in recent years was carried out by V.P. Maslov and V.E. Nazaikinskii. We used a 2013 result of V.E. Nazaikinskii (see [@ve_n]) to obtain asymptotic formulas for the logarithm of the number of Gaussian packets on the edge. If linear independence over $\mathbb{Q}$ does not hold (such situation is certainly possible because we can even have many geodesics with the same length, see e.g. [@Marklof]), the resulting asymptotic formula becomes an upper bound for $\mfN(T)$. It should be noted that the same results can be obtained using Additive Abstract Prime Number Theorem from [@Knopfmacher]. A computer experiment conducted jointly with O.V. Sobolev has confirmed the correctness of the estimates. The simulation results for a decorated graph obtained by attaching a length of the cylinder are also given in [@trsa]. Preliminary remarks and definitions ----------------------------------- A [*decorated graph*]{} is a topological space, obtained from a metric graph by replacing vertices by smooth manifolds of dimensions two or three. Consider a finite number of smooth complete Riemannian manifolds $M_j$, and a number of segments $\gamma_i$, endowed with regular parametrization. For each endpoint $y$ of an arbitrary segment $\gamma_j$ fix a point $\tilde y$ on one of the manifolds $M_k$; we assume all points $\tilde y$ to be distinct. A decorated graph $\Gamma_d$ is a quotient space of the disjoint sum $\bigsqcup_k M_k\bigsqcup_j\gamma_j$ by the equivalence $y \sim \tilde y$. The Schrödinger equation on a decorated graph is defined as follows (see [@BG] and [@trsa] for detailed explanation; the original ideas were presented in [@FP],[@Pav]). Let $V$ be a real valued continuous function on $ \Gamma_d$, smooth on the edges. Let $V_j$ and $V_k$ be restrictions of $V$ to $\gamma_j$ and to $M_k$ respectively. Consider a direct sum $ \widehat{H}_0=\bigoplus\limits_{j=1}^{E}\left(-\frac{h^2}{2}\frac{\mfd^2}{\mfd z_j^2}+V_j\right)\bigoplus\limits_{k=1}^{V}\left(-\frac{h^2}{2}\Delta_k+ V_k\right) $ with the domain $H^2(\Gamma)=\bigoplus\limits_{j=1}^{E}H^2(\gamma_j)\bigoplus\limits_{k= 1}^{V} H^2(M_k).$ Here $\frac{\mfd^2}{\mfd z_j^2}$ is an operator of the second derivative on $\gamma_j$ with respect to a fixed parametrization with Neumann boundary conditions, $\Delta_k$ is the Laplace–Beltrami operator on $M_k$. [**Definition.**]{} The [*Schrödinger operator*]{} $\widehat{H}$ is a self-adjoint extension of the restriction $\widehat{H_0}|_{L}$, where $ L=\{\psi\in H^2(\Gamma),\quad \psi(y_s)=0\}.$ Domain of the operator $\widehat{H}$ contains functions with singularities in the points $y_j$. Namely, let $G(x,y,\lambda)$ be the Green function on $M_k$ (integral kernel of the resolvent) of $\Delta$, corresponding to the spectral parameter $\lambda$. This function has the following asymptotics as $x\to y$: $G(x,y,\lambda)=F_0(x,y)+F_1$, where $F_1$ is a continuous function and $F_0$ is independent of $\lambda$ and has the form $F_0=-\frac{c_2}{2\pi}\mfln\rho$ if $\mfdim M=2$ and $F_0=\frac{c_3}{4\pi\rho}$ if $\mfdim M=3$. Here $c_j(x,y)$ is continuous, $c_j(y,y)=1$, $\rho$ is the distance between $x$ and $y$. The function $\psi$ from the domain of the operator $\widehat{H}$ has the following asymptotics as $x\to y_j$: $ \psi=\alpha_jF_0(x)+b_j+o(1)$. Now for each endpoint of the segment consider a pair $\psi(y)$, $h\psi^\prime(y)$ and a vector $\xi=(u,v)$,-10000 4em $u=(h\psi^\prime(y_1),\dots,h\psi^\prime(y_{2E}),\alpha_1,\dots,\alpha_{2E})$,-10000 4em $v=(\psi(y_1),\dots,\psi(y_{2E}),hb_1,\dots,hb_{2E})$.-10000 Consider a standard skew-Hermitian form $[\xi^1,\xi^2]=\sum_{j=1}^{4E}(u^1_j\bar v^2_j-v_j^1\bar u_j^2)$ in $\mathbb{C}^{4E}\oplus\mathbb{C}^{4E}$. Let us fix the Lagrangian plane $\Lambda\subset \mathbb{C}^{4E}\oplus\mathbb{C}^{4E}$. A self-adjoint extension $\widehat{H}$ is defined by the coupling conditions $\xi\in \Lambda$ or equivalently $\quad -i(I+U)u+(I-U)v=0,$ where $U$ is a unitary matrix defining $\Lambda$ and $I$ is an identity matrix. We will consider only local coupling conditions, i,e. $\Lambda=\bigoplus\limits_y{\Lambda}_y$, where ${\Lambda}_y\subset \mathbb C^4$ is defined for each point $y$ separately. In Theorem 3.1 of the article [@trsa] it is shown how scattering of a Gaussian packet at the point of gluing of the edge to the surface takes place. Further analysis of the number of packets on a decorated graph is as follows. Since wavefront propagation occurs along the geodesic, we can construct a matching metric graph for a given decorated graph. Vertices for this new graph are the points of gluing and edges are all geodesics on the surfaces connecting points of gluing and the old edges. We are interested in the number of old Gaussian packets, i.e. those whose support will lie on the edges of the original graph. The number of packets could change only in those moments of time that have the form of linear combinations of edge travel time. So the number of packets is equal to the number of sets $\{n_j\}$ satisfying some inequations of this kind: $$n_1t_{l_1}+\ldots+n_mt_{l_m}{\leq}T, \label{ineq}$$ where $t_j$ is a travel time
[ 31075, 21632, 273, 3313, 1005, 1108, 18771, 456, 327, 253, 6146, 1930, 273, 4255, 28926, 8, 266, 14216, 13, 253, 3313, 1005, 31075, 21632, 310, 247, 4646, 6054, 3652, 24049, 5899, 5628, 2216, 3603, 15, 733, 556, 1912, 247, 1180, 273, 16620, 347, 271, 1650, 273, 4980, 5628, 14, 4826, 2216, 15, 187, 510, 18496, 18217, 4660, 1108, 3666, 1300, 407, 38446, 19028, 308, 272, 5830, 80, 285, 14867, 399, 1205, 8, 8500, 13, 18496, 18217, 4660, 369, 253, 6253, 4980, 15828, 8087, 8351, 275, 4135, 387, 253, 673, 273, 5140, 15, 3932, 697, 5140, 13, 352, 556, 5608, 347, 253, 8351, 273, 247, 1180, 273, 9836, 285, 5213, 3238, 13, 1690, 3238, 281, 16496, 13, 530, 13409, 378, 1080, 13, 285, 8462, 543, 31524, 15, 733, 7932, 253, 1711, 18496, 18217, 4660, 387, 1165, 757, 3767, 13, 2822, 44442, 266, 3767, 15894, 13, 534, 574, 644, 4270, 275, 40488, 15, 209, 187, 510, 24136, 21246, 1108, 380, 4471, 14, 27299, 21711, 369, 1390, 30074, 456, 275, 6157, 285, 1024, 556, 247, 5350, 273, 9523, 13, 20664, 15, 733, 17386, 253, 806, 3313, 12568, 273, 253, 6491, 434, 4687, 273, 4135, 15, 187, 510, 399, 571, 899, 307, 2284, 2418, 34933, 5967, 1108, 380, 8614, 285, 12141, 5967, 2570, 310, 4270, 327, 253, 2670, 273, 271, 14212, 14, 2913, 14, 744, 10329, 13597, 896, 281, 253, 32260, 32746, 9898, 15, 380, 3652, 31167, 2216, 3603, 273, 5899, 5628, 10329, 10336, 15, 28351, 314, 10827, 323, 13975, 18131, 262, 3927, 285, 7021, 6338, 313, 2252, 39316, 37818, 49537, 13, 30979, 36194, 582, 253, 12141, 5967, 310, 1024, 1527, 281, 253, 1345, 187, 510, 3689, 24069, 14469, 1108, 380, 3689, 24069, 14469, 310, 4441, 327, 4255, 28926, 8, 266, 14216, 15, 733, 556, 17386, 7418, 5639, 12016, 569, 13, 285, 310, 2223, 908, 323, 2315, 27691, 15, 187, 510, 473, 3025, 284, 5628, 14469, 1108, 380, 3236, 473, 3025, 284, 5628, 14469, 369, 44550, 275, 253, 7901, 84, 15, 329, 747, 3652, 327, 253, 1072, 2670, 310, 1024, 629, 273, 253, 12128, 14469, 5931, 15, 187, 510, 5628, 6491, 434, 42427, 20884, 11032, 1108, 18771, 456, 327, 401, 2310, 272, 8669, 275, 18496, 13, 436, 310, 253, 760, 1781, 13, 11088, 2137, 16064, 275, 4135, 15, 5201, 42241, 2770, 327, 16860, 273, 253, 28385, 5331, 13, 3340, 253, 5628, 10109, 3660, 13, 533, 671, 3835, 643, 9129, 285, 4980, 27205, 285, 8914, 15, 380, 2022, 3652, 310, 5093, 4657, 656, 1029, 387, 253, 9145, 13, 285, 310, 32072, 407, 247, 4275, 16624, 282, 15, 5761, 1740, 14, 11869, 90, 1930, 15926, 9017, 327, 2057, 1930, 15, 187, 187, 11796, 2086, 187, 510, 1445, 2086, 281, 28588, 342, 253, 5140, 273, 253, 13728, 6495, 11103, 723, 369, 8485, 275, 697, 7990, 1128, 10387, 690, 32670, 20858, 13, 4682, 932, 13, 285, 48106, 281, 11482, 366, 253, 747, 9195, 15, 6676, 497, 2218, 275, 253, 10006, 273, 5899, 5628, 13497, 13, 285, 2571, 497, 275, 253, 30177, 1524, 382, 3740, 15, 380, 6495, 6696, 273, 253, 6491, 2959, 1199, 273, 253, 8119, 434, 4116, 533, 253, 4544, 369, 417, 3710, 281, 436, 3652, 15, 2596, 4809, 273, 253, 40890, 275, 253, 6495, 6696, 369, 253, 5921, 273, 9956, 323, 15572, 432, 1016, 14254, 342, 9933, 1445, 407, 10846, 432, 841, 9056, 26020, 15, 380, 21518, 4055, 14705, 273, 436, 3652, 369, 247, 1781, 13497, 407, 23257, 11086, 25453, 285, 3262, 266, 1608, 1279, 489, 323, 253, 2022, 37212, 15, 11198, 5924, 831, 8565, 1893, 5612, 275, 36974, 13, 352, 310, 581, 273, 253, 6253, 20858, 327, 2929, 275, 4135, 13, 342, 10103, 273, 608, 15, 22, 407, 898, 17249, 15, 380, 13497, 369, 1754, 327, 253, 19361, 473, 615, 281, 18724, 407, 36194, 1503, 264, 543, 13, 285, 3797, 247, 9464, 273, 36194, 434, 1067, 49792, 273, 253, 4060, 15, 187, 187, 18551, 38413, 187, 510, 10336, 273, 253, 13728, 6495, 11103, 723, 310, 247, 8212, 273, 2616, 1754, 275, 4980, 1204, 13, 48709, 13, 285, 14464, 1204, 15, 5628, 10336, 387, 253, 673, 369, 16745, 407, 2278, 273, 697, 1211, 9493, 3210, 6804, 342, 6024, 16178, 15, 29242, 366, 369, 34922, 275, 16516, 824, 347, 253, 22717, 1546, 9109, 2720, 281, 253, 35831, 13, 285, 2892, 13, 4980, 414, 285, 4833, 497, 1146, 20178, 1025, 285, 8756, 38617, 15, 329, 14226, 273, 436, 15952, 310, 326, 1223, 6153, 9189, 323, 3569, 13, 285, 8928, 10003, 13, 841, 1345, 6493, 4242, 281, 2085, 323, 247, 3058, 2572, 275, 8039, 13, 2299, 13, 247, 8039, 12061, 651, 2826, 275, 253, 2586, 1996, 275, 253, 5331, 15, 16349, 10336, 3982, 281, 4135, 13, 347, 352, 574, 281, 253, 8935, 13, 247, 747, 5054, 285, 8870, 5133, 273, 3652, 13, 285, 253, 4980, 382, 9195, 273, 253, 1387, 497, 253, 1878, 25701, 407, 253, 1345, 1445, 4544, 15, 20599, 273, 436, 403, 253, 24136, 8, 21246, 13, 253, 3689, 24069, 14469, 13, 285, 253, 473, 3025, 284, 5628, 14469, 15, 380, 4980, 382, 3578, 1507, 273, 1159, 285, 2605, 497, 8156, 275, 841, 9195, 13, 2568, 841, 497, 12877, 1097, 281, 10439, 33712, 16178, 285, 253, 12194, 10732, 273, 253, 354, 1059, 33325, 15, 380, 12194, 10336, 11797, 6667, 432, 253, 13728, 11103, 723, 403, 253, 6495, 6696, 273, 253, 6491, 13, 253, 3313, 11032, 273, 4135, 13, 285, 253, 5628, 6491, 434, 42427, 20884, 11032, 15, 380, 6495, 6696, 273, 253, 6491, 285, 253, 3313, 11032, 273, 4135, 2439, 432, 352, 327, 253, 6278, 4035, 253, 4520, 1497, 273, 7114, 1128, 14382, 1907, 3578, 4107, 383, 46160, 9930, 275, 616, 2344, 3355, 15, 380, 27934, 7794, 273, 253, 21533, 11797, 9195, 2908, 1781, 285, 5536, 45784, 9931, 257, 342, 25757, 28390, 15, 2053, 497, 2223, 24982, 275, 2709, 8090, 43800, 253, 12413, 2158, 830, 273, 253, 24949, 17457, 15, 8035, 4735, 310, 11776, 662, 264, 18803, 285, 22627, 8314, 2510, 327, 288, 6390, 9297, 15, 378, 11211, 841, 5026, 8212, 37210, 723, 403, 8090, 273, 20435, 13, 285, 26609, 1929, 347, 277, 529, 543, 15, 20599, 273, 436, 1511, 273, 10336, 2190, 253, 13728, 6495, 14869, 6477, 403, 253, 18496, 18217, 4660, 13, 253, 3313, 1005, 31075, 21632, 13, 285, 253, 3313, 28079, 1889, 22235, 6696, 15, 187, 187, 5035, 671, 586, 187, 29796, 5568, 26722, 8273, 273, 4135, 187, 27223, 10336, 187, 187, 7504, 4859, 535, 9541, 273, 380, 13728, 6495, 11103, 723, 187, 187, 4941, 187, 187, 1413, 27, 10987, 723, 285, 5289, 275, 18496, 187, 1413, 27, 29796, 5568, 7219, 275, 4135, 187, 1413, 27, 10987, 723, 285, 5289, 6312, 275, 22824, 605, 8283, 4748, 253, 322, 1065, 16825, 4477, 15, 50276, 3074, 3570, 10827, 15, 187, 6930, 187, 475, 9206, 15, 18834, 15, 261, 29453, 5174, 4527, 556, 417, 21841, 2867, 187, 475, 187, 475, 1214, 3967, 448, 1010, 16, 1010, 15, 19, 16, 1010, 15, 19, 15, 21, 16, 1010, 15, 19, 15, 21, 15, 23, 16, 52, 1010, 15, 19, 15, 21, 15, 23, 64, 34, 23, 15, 4305, 187, 475, 1214, 10008, 9423, 272, 604, 13546, 253, 21841, 2867, 273, 9206, 15, 18834, 15, 261, 29453, 5174, 4527, 10224, 187, 1738, 187, 187, 605, 22949, 4, 18, 187, 338, 313, 4241, 15, 18834, 15, 261, 29453, 5174, 4527, 15, 18834, 20767, 17011, 10, 551, 187, 50276, 5, 12641, 30932, 18, 27, 9206, 15, 18834, 15, 261, 29453, 5174, 4527, 556, 417, 21841, 2867, 30636, 4241, 15, 18834, 15, 261, 29453, 5174, 4527, 15, 18834, 558, 187, 94, 187, 605, 535, 9063, 562, 776, 747, 2670, 10338, 484, 49048, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 1911, 634, 1211, 11743, 187, 187, 6300, 247, 24388, 577, 16, 1797, 310, 3872, 3632, 2854, 1071, 1388, 50254, 50272, 4037, 39213, 44024, 535, 50258, 33249, 18746, 14732, 3481, 24730, 187, 50254, 9675, 3003, 45617, 3886, 32984, 2756, 50254, 50272, 2302, 15, 1458, 14, 1857, 3677, 535, 187, 33249, 18746, 3481, 46063, 13, 535, 50260, 19056, 1108, 22706, 13, 535, 50268, 87, 15, 187, 187, 37, 1277, 42, 3016, 388, 47791, 2637, 13, 535, 50260, 25187, 428, 9517, 15, 2756, 187, 40417, 432, 253, 1986, 2077, 4412, 2111, 323, 253, 11442, 187, 31711, 273, 4255, 9385, 13, 387, 1639, 7969, 6121, 15, 50274, 42, 9457, 353, 15, 611, 1796, 2205, 13, 187, 31711, 6798, 15, 313, 18, 27, 1010, 14, 7083, 14, 933, 1717, 14, 2894, 44, 14, 15253, 44, 14, 18, 10, 535, 187, 42520, 27, 50275, 18489, 1722, 13, 4022, 50261, 34038, 27, 50275, 18489, 3127, 13, 4022, 535, 187, 8639, 411, 3077, 44, 1042, 8301, 13, 41177, 3172, 38, 58, 947, 13, 285, 611, 2637, 13, 6817, 19592, 15, 535, 187, 49504, 407, 27085, 591, 43215, 4743, 15, 535, 187, 44, 2198, 257, 353, 15, 33227, 6421, 13, 5489, 285, 24207, 10396, 382, 13, 5794, 968, 6121, 13, 187, 15491, 9385, 13, 323, 9517, 15, 36538, 1473, 12694, 43921, 13, 17762, 187, 11586, 2077, 10158, 13, 1639, 7969, 6121, 13, 4255, 9385, 13, 323, 22706, 15, 535, 187, 2447, 15855, 11626, 403, 417, 4865, 19440, 275, 436, 5049, 15, 187, 189, 10810, 34319, 27, 535, 50271, 37, 26548, 50271, 22930, 920, 50274, 6243, 932, 50272, 8701, 50271, 13118, 11297, 50273, 395, 50272, 3571, 14, 7791, 187, 187, 36817, 11295, 1563, 521, 8106, 12678, 281, 581, 1385, 273, 1146, 187, 187, 66, 48935, 275, 10023, 273, 247, 22657, 13, 275, 8411, 273, 1283, 530, 15, 52, 15, 36, 15, 187, 187, 7803, 7803, 47722, 9, 72, 2769, 18, 582, 44888, 9, 66, 2769, 19, 10, 313, 6755, 582, 285, 581, 1385, 273, 10023, 273, 247, 187, 187, 296, 12901, 50273, 11342, 1513, 13, 50271, 249, 50275, 6584, 17888, 50269, 1171, 50274, 1093, 50274, 54, 15, 52, 15, 36, 15, 50273, 7803, 7803, 47722, 9, 75, 2769, 18, 582, 187, 187, 49102, 9, 66, 2769, 19, 10, 313, 6755, 481, 50269, 22930, 920, 457, 84, 6834, 4724, 247, 4864, 13, 10376, 281, 187, 187, 1898, 398, 362, 15, 5002, 13, 35312, 530, 15, 52, 15, 818, 1839, 313, 26369, 582, 17225, 272, 627, 403, 187, 187, 2369, 4285, 2081, 784, 9905, 323, 4549, 13, 533, 7738, 347, 247, 1896, 187, 187, 15697, 323, 2278, 1880, 253, 3286, 1302, 7730, 24048, 187, 187, 3775, 672, 352, 13072, 281, 16209, 247, 21169, 12955, 6197, 281, 187, 187, 15793, 323, 673, 7099, 920, 588, 5752, 275, 1375, 13555, 323, 22640, 187, 187, 15079, 4341, 323, 2589, 2905, 281, 521, 4400, 12137, 15, 50254, 50275, 22930, 920, 187, 187, 7110, 50274, 47092, 50274, 66, 50275, 856, 50275, 339, 50275, 4032, 22554, 50271, 18399, 50273, 8271, 272, 50273, 248, 50275, 35413, 187, 187, 460, 887, 422, 8385, 273, 5067, 15, 50258, 510, 7295, 556, 13072, 187, 187, 936, 1873, 247, 20876, 4864, 15, 50267, 43223, 642, 2228, 13, 359, 10418, 15, 535, 50271, 1231, 2278, 7099, 920, 457, 84, 6197, 323, 40149, 13, 9433, 187, 187, 266, 7242, 14, 1171, 14, 3431, 7401, 2629, 15, 50259, 31266, 362, 15, 1986, 2077, 13, 41589, 187, 187, 54, 15, 52, 15, 6480, 13, 7904, 313, 8602, 481, 50266, 1552, 2278, 4419, 776, 8180, 273, 187, 187, 15617, 50273, 783, 50274, 856, 758, 1546, 50272, 395, 50275, 44167, 422, 50267, 10752, 31772, 50273, 1171, 50275, 783, 187, 187, 36817, 15, 50271, 2618, 15, 387, 8319, 15, 50270, 1231, 806, 2939, 1880, 253, 3286, 187, 187, 13550, 50274, 30976, 314, 50272, 1179, 32001, 50273, 783, 50271, 324, 24236, 50273, 29710, 5537, 50273, 8469, 7686, 187, 187, 6324, 13, 2783, 253, 2616, 873, 6593, 387, 1283, 530, 15, 52, 15, 36, 15, 3015, 26033, 20, 9, 66, 10, 187, 187, 9, 6755, 582, 5867, 667, 7125, 3559, 407, 253, 4676, 13, 285, 535, 50254, 252, 50264, 50276, 19, 187, 189, 31031, 314, 5544, 253, 4236, 6197, 15, 50258, 2618, 15, 387, 7584, 1253, 3712, 28, 923, 187, 187, 11586, 2077, 362, 15, 33603, 13, 608, 4529, 401, 15, 20, 69, 608, 3547, 13, 45916, 1253, 3121, 313, 21, 394, 4082, 15, 4267, 481, 50254, 50275, 2042, 187, 187, 664, 50274, 8606, 50274, 2369, 50274, 856, 758, 1546 ]
Cultural Palace of Nationalities – Located on the north side of West Chang'an Avenue, the Nationalities Cultural Palace is a medium rise building incorporating traditional Chinese design elements. It has won a number of awards as an example of modern Chinese-style design. The Beijing railway station – Designed by architects Yang Tingbao and Chen Deng'ao, Beijing railway station was the largest modern passenger rail terminal in China at the time of construction. Since its construction, it has served as the terminal of a number of domestic and international services, including services to Moscow, Ulan Bator, and Pyongyang. It replaced the old Beijing railway station at Qianmen, near Tiananmen Square, which had been built in 1901. The Workers Stadium – The multi-purpose stadium was last renovated in 2004 and now has a capacity of 66,161. It hosted the first National Games of the People's Republic of China. The Diaoyutai State Guesthouse – The hotel and guesthouse complex is built on the site of an 800-year-old garden dating back to the Jin Dynasty. The building incorporates design elements of traditional Chinese garden architecture. Formerly reserved for visiting dignitaries and Party officials (most famously Jiang Qing, Madame Mao), the guesthouse is now open to the public The Minzu Hotel – The Minzu Hotel is located on West Chang'an Avenue. It has hosted numerous foreign delegations, and is often used for press conferences. The Overseas Chinese Hotel – The original Overseas Chinese Hotel was demolished in the 1990s. A new building on the same site is now part of the Prime Hotel chain. The Chinese People's Revolutionary Military Museum – Located on Fuxing Road in Beijing, this is the only large, comprehensive war museum in China. Displays focus on wars of the twentieth century, especially the Chinese Civil War, but also cover other ancient and modern warfare and weapons. The main building is seven storeys high at the centre, and is topped by a central steeple. Two four-storey side wings extend on either side. Art program The art program to coincide with the construction of the Ten Great Buildings was vast in its scope—including some 345 paintings, murals, and sculptures to decorate the new buildings. Many were done in the modes of traditional Chinese painting, and others were in the socialist realist style. The Great Hall of the People received much of the commission's attention but the campaign was not limited to this building. One aspect of the decoration in the Great Hall was the correlation of rooms for representatives from each province with regional art by artists from these respective provinces. The artistic centerpiece of this building was a large painting by Fu Baoshi and Guan Shanyue for the main staircase. Entitled This Land So Rich in Beauty, it is one of the largest paintings on paper in China, with dimensions of 5.5 by 9 meters. The painting was based on the poem Ode to Snow by Mao Zedong, and includes a transcription of Mao's calligraphy of the title. Architecture The architecture of the Ten Great Buildings is a composite of factors based in modernism, communism, and historicism. Chinese architecture at the time was shaped by review of its own historical models mixed with external influences. Debate was vigorous in publications such as the Architectural Journal prior to the constructions, and history, modernity and influence were being conceptualized and reconsidered. A criticism of this initiative is that while creating facilities for political, and cultural institutions, these public projects failed to provide for a needed increase in housing, however, a housing surge would occur in the country later in the century. Modern architecture brought to China, as it had to the west, a new economic and rational manner of building, and the modernist buildings of the group were the least decorated by the public art campaign. Examples of this are the Workers' Stadium, the Minzu Hotel, and the Overseas Chinese Hotel. The modernist tenets of function and structure were realized in these buildings, yet these were attributed both to western capitalist influences and the Soviet notion of the proletariat. The Soviet architecture inspired examples from the Ten Buildings are the Great Hall of the People, the National Museum of China, and the Chinese People's Revolutionary Military Museum. The Great Hall of the People and the National Museum of China across from it on the square continue the numerology of tens—each having ten freestanding columns in their facades. The architectural aspects of the traditionally inspired buildings included large and heavy roofs laden with ceramic tiles. These were often stacked in multiple layers recalling the towering form of the pagoda. Another feature is upturned corners and curved ridges on hipped edges. Beneath these thick composite toppings are layers of beams, and brackets known as dougong. Examples of this type of architecture among the Ten Great Constructions are the Beijing railway station, the Nationalities Cultural Palace, and the National Agriculture Exhibition Hall. See also Urban Planning Society of China Chinese architecture External links History of The Ten Great Buildings References Category:Buildings and structures in Beijing Category:Urban planning in China Category:Buildings and structures completed in 1959// Copyright 2009 the Sputnik authors. All rights reserved. /** * Object.prototype.isPrototypeOf has not prototype property * * @path ch15/15.2/15.2.4/15.2.4.6/S15.2.4.6_A6.js * @description Checking if obtaining the prototype property of Object.prototype.isPrototypeOf fails */ //CHECK#1 if (Object.prototype.isPrototypeOf.prototype !== undefined) { $ERROR('#1: Object.prototype.isPrototypeOf has not prototype property'+Object.prototype.isPrototypeOf.prototype); } // Check out our new site Makeup Addiction add your own caption add your own caption add your own caption add your own caption add your own caption add your own caption add your own caption add your own caption add your own caption add your own caption add your own caption Just a reminder 4/21 is national random drug test day UNPUBLISHED UNITED STATES COURT OF APPEALS FOR THE FOURTH CIRCUIT No. 15-4571 UNITED STATES OF AMERICA, Plaintiff – Appellee, v. DARIUS HENNING, Defendant - Appellant. Appeal from the United States District Court for the Northern District of West Virginia, at Clarksburg. Irene M. Keeley, District Judge. (1:15-cr-00029-IMK-JSK-1) Submitted: March 17, 2016 Decided: March 21, 2016 Before WILKINSON, NIEMEYER, and KING, Circuit Judges. Affirmed by unpublished per curiam opinion. Kristen M. Leddy, Research and Writing Specialist, Martinsburg, West Virginia, for Appellant. Zelda Elizabeth Wesley, Assistant United States Attorney, Clarksburg, West Virginia, for Appellee. Unpublished opinions are not binding precedent in this circuit. PER CURIAM: Darius Henning appeals his convictions and 63-month sentence imposed following his guilty plea to one count of being a felon in possession of a firearm, in violation of 18 U.S.C. §§ 922(g)(1), 924(a)(2) (2012), and one count of possession of a stolen firearm, in violation of 18 U.S.C. §§ 922(j)(1), 924(a)(2) (2012). Henning’s attorney filed a brief, pursuant to Anders v. California, 386 U.S. 738 (1967), conceding there are no meritorious grounds for appeal, but suggesting as a possible issue for review whether the district court committed reversible error when it declined to impose a downward variant sentence to account for time Henning will serve in state custody for parole revocation for conduct related to his federal crimes. Henning has filed a pro se supplemental brief asserting he received ineffective assistance of counsel. The Government has declined to file a responsive brief. Finding no error, we affirm. We review Henning’s sentence for reasonableness, applying an abuse-of-discretion standard. Gall v. United States, 552 U.S. 38, 46 (2007). This review requires our consideration of both the procedural and substantive reasonableness of the sentence. Id. at 51. We first assess whether the district court properly calculated the advisory Sentencing Guidelines range, considered the factors set forth at 18 U.S.C. § 3553(a) (2012), analyzed any arguments presented by the parties, and 2 sufficiently explained the selected sentence. Id. at 49–51; see United States v. Lynn, 592 F.3d 572, 575–76 (4th Cir. 2010). If we find no procedural
[ 3354, 1108, 380, 7813, 273, 3545, 951, 378, 656, 6689, 19787, 2205, 187, 21082, 445, 401, 2585, 19872, 1108, 9615, 302, 6555, 20242, 285, 29077, 380, 36024, 187, 23684, 17771, 1108, 329, 20909, 273, 2516, 14702, 187, 11223, 1031, 18268, 16606, 1108, 6700, 9283, 84, 273, 271, 49185, 23091, 27, 743, 5271, 19111, 3756, 187, 27515, 308, 8879, 17410, 1108, 380, 9224, 273, 253, 34546, 313, 31312, 380, 35502, 9224, 273, 253, 34546, 13, 1936, 15, 337, 273, 13134, 38987, 32962, 13, 1996, 11709, 275, 253, 20378, 980, 10, 187, 34, 15, 444, 15, 23224, 614, 1108, 380, 2752, 2971, 447, 273, 21577, 187, 187, 35, 12769, 84, 187, 22423, 1638, 1108, 29835, 9497, 649, 272, 13, 4383, 2151, 434, 8406, 313, 42729, 23518, 10, 187, 24099, 1903, 1108, 2552, 1503, 74, 796, 73, 13, 46900, 14, 16281, 383, 34923, 17502, 13, 16555, 382, 285, 42726, 313, 42729, 22715, 10, 187, 24099, 2145, 1108, 19580, 15916, 443, 3090, 7411, 3229, 13, 17794, 34923, 42250, 285, 17502, 313, 42729, 31687, 10, 187, 18489, 337, 1108, 473, 3319, 274, 47653, 375, 348, 4530, 13, 29535, 17502, 285, 9558, 313, 42729, 9178, 10, 187, 18489, 1884, 1108, 27522, 14656, 4379, 313, 46117, 27104, 13, 27470, 582, 4383, 17502, 313, 42729, 11994, 10, 187, 19591, 337, 1108, 3616, 66, 8449, 23972, 13, 19688, 50104, 382, 13, 42250, 285, 20021, 6423, 313, 42729, 11299, 10, 187, 19591, 1458, 1108, 17250, 311, 333, 443, 360, 1031, 729, 13, 7247, 5192, 1405, 382, 17502, 313, 9993, 4525, 33531, 10, 187, 6791, 1668, 1108, 26113, 12937, 580, 15858, 351, 511, 87, 469, 13, 7247, 17502, 285, 7291, 313, 42729, 22745, 10, 187, 18948, 3436, 1108, 5037, 274, 353, 8808, 40160, 13, 45575, 17502, 285, 26462, 313, 42729, 15750, 10, 187, 20443, 1668, 1108, 25298, 6029, 80, 47630, 13, 5112, 42250, 313, 42729, 20208, 10, 187, 20443, 3307, 1108, 388, 5021, 23847, 311, 1944, 31240, 13, 39863, 757, 14, 6448, 36090, 8406, 313, 42729, 24178, 10, 187, 20443, 2164, 1108, 12576, 8, 469, 343, 13293, 22188, 478, 11938, 313, 33656, 117, 161, 114, 225, 209, 162, 123, 99, 9850, 24299, 225, 582, 6692, 42250, 313, 42729, 18417, 10, 187, 21859, 854, 1108, 15983, 29976, 2200, 322, 515, 3508, 13, 4383, 17502, 285, 32390, 382, 313, 42729, 17342, 10, 187, 21859, 1384, 1108, 8444, 8757, 13, 4383, 17502, 13, 42250, 13, 48605, 285, 48342, 757, 313, 42729, 18824, 10, 187, 22117, 577, 1108, 36239, 1004, 17453, 13, 11596, 50104, 382, 13, 17502, 285, 20021, 14281, 313, 42729, 23084, 10, 187, 22117, 2030, 1108, 21138, 3130, 1279, 74, 313, 44, 1757, 287, 314, 3130, 1757, 5134, 74, 582, 3752, 287, 14, 38288, 6656, 5054, 24072, 285, 2675, 29875, 313, 42729, 17926, 10, 187, 23375, 337, 1108, 19423, 1136, 4819, 348, 13, 29535, 16349, 382, 8406, 313, 42729, 25124, 10, 187, 23375, 3127, 1108, 29271, 12951, 42304, 13, 4383, 2488, 313, 42729, 16221, 10, 187, 23375, 3285, 1108, 7195, 29053, 13, 4383, 42250, 285, 2926, 8406, 313, 42729, 18824, 10, 187, 22784, 608, 1108, 12447, 40065, 19051, 13, 2448, 17264, 285, 48845, 313, 42729, 16221, 10, 187, 35419, 20288, 8440, 13, 3545, 8962, 757, 14, 6448, 42726, 313, 42729, 24113, 10, 187, 187, 27888, 84, 187, 18489, 1722, 1108, 25298, 14, 43, 2651, 33100, 21608, 13, 5112, 19600, 313, 6448, 1283, 1047, 10, 187, 18489, 3435, 1108, 9011, 8966, 11276, 13, 4383, 50104, 382, 13, 17502, 285, 1345, 3565, 313, 6448, 29316, 10, 187, 19591, 898, 1108, 10092, 9964, 8449, 13675, 567, 293, 13, 5685, 17502, 285, 42250, 313, 6448, 1283, 1731, 10, 187, 6791, 577, 1108, 3599, 21631, 418, 6597, 4379, 330, 7849, 13, 2448, 9462, 50104, 382, 13, 2159, 2926, 8406, 13, 285, 8121, 313, 6448, 1722, 3953, 10, 209, 187, 6791, 1458, 1108, 24504, 47185, 13, 2448, 17502, 313, 6448, 46215, 10, 187, 6791, 1722, 1108, 444, 2967, 76, 460, 2552, 13, 4383, 10281, 29075, 382, 313, 6448, 1283, 1010, 10, 187, 18948, 1638, 1108, 13651, 40285, 18540, 13456, 13, 7247, 50104, 382, 313, 6448, 1283, 1508, 10, 187, 20443, 1668, 1108, 34213, 378, 2084, 1282, 313, 44240, 1503, 1351, 32958, 4268, 1665, 22827, 11507, 2448, 19600, 13, 277, 553, 42250, 285, 1345, 382, 313, 6448, 1283, 1797, 10, 187, 20443, 3127, 1108, 47635, 38515, 17698, 26774, 12221, 13692, 13, 5685, 24072, 313, 6448, 1283, 883, 10, 187, 20266, 898, 1108, 20628, 31162, 13, 11596, 17502, 285, 47160, 552, 313, 6448, 1283, 740, 10, 187, 22117, 3307, 1108, 6397, 34223, 14884, 19872, 13, 4383, 14, 6448, 9943, 42250, 313, 6448, 1283, 1630, 10, 187, 23375, 3127, 1108, 41474, 1810, 379, 83, 13, 5685, 42250, 285, 7291, 313, 6448, 1283, 1166, 10, 187, 23375, 3307, 1108, 6393, 36638, 8712, 13, 2448, 1073, 274, 382, 313, 6448, 1283, 1508, 10, 187, 22784, 1249, 1108, 18063, 266, 49596, 2284, 6984, 87, 304, 13, 26304, 30005, 10364, 313, 6448, 1283, 2125, 10, 187, 187, 42452, 187, 4257, 11174, 366, 21803, 1108, 416, 15, 418, 15, 443, 2339, 187, 187, 688, 6239, 187, 32618, 42738, 434, 4460, 380, 7743, 21538, 313, 746, 2922, 10, 310, 873, 1309, 436, 807, 15, 187, 187, 4941, 1744, 187, 1413, 27, 58, 6364, 273, 253, 655, 394, 5331, 275, 6239, 4041, 273, 253, 1841, 309, 2223, 21424, 323, 38782, 398, 281, 10331, 10678, 310, 281, 3410, 7561, 15, 20727, 670, 10331, 310, 13, 327, 690, 1268, 13, 417, 1077, 2834, 387, 512, 15, 733, 4419, 2793, 285, 271, 3939, 2564, 281, 4887, 2220, 285, 3037, 432, 253, 8450, 12103, 15, 1916, 9580, 436, 2793, 2167, 13, 253, 760, 1039, 281, 1663, 513, 352, 310, 281, 5484, 247, 2257, 273, 10331, 15, 21108, 670, 352, 390, 4854, 670, 352, 1663, 2506, 457, 85, 513, 1199, 1175, 13, 323, 352, 310, 760, 3762, 326, 19756, 19673, 432, 8542, 8450, 15, 187, 187, 510, 8542, 1895, 342, 3939, 10491, 403, 767, 8089, 15, 380, 806, 310, 2969, 1108, 3530, 403, 417, 1077, 11142, 13, 3798, 13, 285, 594, 352, 476, 2686, 320, 3240, 8214, 672, 368, 4489, 247, 2257, 273, 731, 432, 1027, 24742, 15, 2058, 247, 2670, 751, 714, 4462, 266, 322, 40883, 13, 368, 476, 4354, 5926, 247, 4289, 8918, 390, 625, 327, 247, 13365, 3530, 13, 285, 326, 457, 84, 1078, 368, 452, 281, 2803, 275, 15076, 2105, 15, 1310, 368, 457, 250, 417, 2970, 634, 3530, 323, 1959, 13, 436, 476, 320, 3240, 247, 2201, 14247, 327, 697, 1211, 15, 187, 187, 5872, 627, 310, 253, 625, 8794, 3086, 1895, 273, 752, 281, 513, 342, 253, 3530, 15, 733, 457, 84, 3240, 3477, 281, 1333, 326, 10491, 7561, 588, 1918, 368, 2793, 275, 10331, 10678, 15, 496, 3946, 13, 2299, 13, 326, 457, 84, 417, 594, 2969, 15, 4683, 2282, 13, 2820, 512, 9351, 273, 716, 284, 588, 954, 5604, 1918, 368, 2793, 15, 1723, 13, 352, 310, 2793, 327, 247, 4942, 20126, 1268, 15, 35110, 9351, 273, 716, 284, 13, 824, 347, 1663, 3076, 390, 1663, 1175, 716, 284, 13, 588, 3164, 9766, 3746, 3240, 12450, 15, 19810, 13, 2299, 13, 403, 417, 594, 4755, 15, 733, 310, 2686, 6927, 281, 1611, 716, 284, 604, 368, 13, 1333, 13, 5500, 731, 13, 533, 840, 352, 4916, 789, 285, 253, 1232, 310, 417, 1077, 30357, 15, 831, 310, 13, 9142, 13, 247, 34057, 13, 285, 417, 247, 2628, 313, 1542, 479, 8791, 10, 594, 3192, 253, 794, 1977, 751, 326, 310, 10323, 5816, 253, 1127, 15, 187, 187, 1276, 3185, 6569, 310, 326, 690, 716, 284, 2430, 2709, 23592, 723, 281, 10313, 3746, 581, 1039, 390, 1529, 15, 13168, 253, 806, 673, 368, 25410, 247, 10331, 352, 2506, 457, 85, 1705, 562, 3240, 987, 417, 984, 352, 457, 84, 3076, 13, 533, 984, 368, 403, 1335, 19427, 281, 352, 15, 733, 7729, 672, 368, 457, 250, 970, 253, 1072, 716, 1403, 4420, 512, 253, 673, 13, 594, 326, 253, 760, 4778, 310, 253, 10331, 15, 496, 690, 4088, 13, 407, 2509, 594, 368, 457, 250, 10323, 260, 1135, 272, 253, 10331, 1293, 260, 1135, 272, 352, 1108, 368, 457, 250, 5175, 1880, 390, 417, 253, 10331, 310, 1175, 323, 634, 3740, 273, 40436, 15, 4952, 840, 13, 2299, 13, 247, 1175, 10331, 5484, 254, 943, 320, 19427, 281, 253, 10331, 285, 2820, 281, 25410, 352, 347, 1682, 256, 16, 248, 476, 13, 534, 2097, 326, 253, 806, 1611, 476, 1705, 562, 3499, 23522, 3430, 15, 330, 1135, 272, 671, 556, 697, 1211, 7364, 13, 347, 352, 476, 2028, 368, 1880, 390, 417, 247, 10331, 310, 1175, 13, 533, 253, 10861, 275, 9745, 562, 253, 23190, 1335, 4419, 634, 3939, 7268, 1108, 5734, 368, 457, 250, 7219, 327, 10678, 253, 10331, 4936, 4904, 3740, 13, 253, 3280, 273, 253, 1517, 8358, 310, 271, 9909, 629, 273, 752, 2789, 247, 5500, 273, 10331, 15, 831, 310, 2139, 309, 2761, 1620, 3630, 10123, 10542, 1754, 327, 581, 13214, 313, 9453, 309, 513, 3630, 731, 8791, 13, 534, 310, 2970, 7520, 1512, 582, 347, 627, 403, 1512, 1142, 4903, 285, 310, 816, 417, 1077, 9630, 15, 7191, 272, 271, 4743, 1754, 327, 247, 1643, 15107, 273, 10331, 310, 760, 9630, 604, 352, 457, 84, 1663, 9090, 3076, 390, 1175, 15, 187, 187, 4125, 13, 1907, 574, 247, 2257, 273, 2793, 275, 10331, 1057, 3885, 598, 253, 1232, 273, 12488, 3374, 285, 3237, 275, 271, 7202, 10331, 15, 10154, 1977, 13, 323, 1650, 13, 352, 310, 1896, 281, 2028, 752, 2238, 273, 1617, 247, 8429, 254, 73, 556, 644, 7141, 275, 13, 390, 1880, 271, 10652, 258, 311, 543, 556, 644, 294, 287, 12457, 13, 594, 327, 285, 594, 6593, 15, 733, 671, 7729, 18862, 267, 3006, 716, 284, 7938, 1108, 368, 476, 10323, 3812, 327, 271, 2455, 16122, 6335, 273, 27491, 285, 41868, 285, 871, 752, 10331, 436, 310, 954, 2074, 281, 13, 285, 3103, 752, 368, 476, 1902, 432, 352, 15, 2745, 284, 403, 1620, 253, 1072, 13, 2299, 13, 285, 1027, 952, 40436, 253, 10331, 671, 4917, 1027, 1543, 15, 1893, 13, 627, 457, 84, 760, 594, 2080, 368, 476, 564, 342, 253, 773, 47458, 668, 2746, 15, 47888, 281, 12106, 716, 284, 1754, 12718, 327, 42100, 13, 7286, 13, 3966, 13, 310, 760, 1896, 604, 368, 457, 250, 10620, 342, 9787, 1268, 2087, 1005, 15, 26394, 13, 3103, 13, 403, 806, 34965, 15, 187, 187, 2512, 310, 671, 3640, 326, 368, 476, 6351, 432, 10678, 253, 1072, 10331, 689, 285, 689, 969, 326, 368, 2550, 432, 10491, 15, 831, 778, 6388, 253, 10331, 6890, 327, 368, 1108, 247, 21533, 7141, 8429, 254, 73, 13237, 10305, 697, 5718, 9075, 13, 323, 1650, 15, 2207, 13, 352, 476, 816, 320, 326, 368, 1265, 36307, 8794, 1972, 326, 497, 627, 13, 533, 497, 417, 7933, 4755, 253, 806, 1643, 2069, 368, 1611, 352, 15, 2207, 4931, 368, 3368, 342, 1027, 3602, 13, 1824, 13, 20784, 13, 3966, 15, 285, 4366, 326, 352, 17923, 13359, 762, 1027, 5989, 15, 831, 1511, 273, 3640, 310, 417, 1896, 604, 368, 760, 452, 2030, 72, 273, 247, 10331, 15, 733, 476, 1663, 760, 1705, 342, 10678, 1052, 13, 7469, 13, 390, 1014, 9098, 72, 273, 253, 1072, 10331, 15, 2732, 247, 1223, 13, 368, 755, 247, 3282, 273, 752, 281, 1902, 13, 285, 672, 253, 1543, 1053, 457, 85, 2525, 12656, 13, 840, 352, 4916, 247, 4715, 2774, 15, 1422, 816, 476, 457, 85, 513, 326, 1293, 247, 2257, 273, 253, 1072, 10331, 15, 2091, 309, 1333, 773, 18941, 10331, 668, 309, 671, 1053, 457, 85, 816, 1599, 253, 1072, 2238, 273, 10331, 13, 824, 347, 247, 13898, 4297, 1279, 249, 13, 533, 2581, 253, 3242, 1072, 10331, 1108, 432, 253, 1072, 1659, 13, 21792, 1475, 253, 1072, 3522, 13, 3966, 15, 5815, 14604, 273, 10331, 432, 247, 24718, 310, 1469, 281, 320, 5777, 1027, 13, 642, 2647, 253, 5989, 13, 2378, 969, 5177, 839, 253, 2523, 15, 187, 187, 510, 1774, 2181, 273, 512, 436, 10331, 10678, 285, 4715, 310, 417, 594, 1199, 253, 10678, 3139, 13, 533, 253, 4619, 12906, 285, 7103, 326, 3936, 1659, 10486, 15, 1198, 788, 670, 752, 2571, 2028, 368, 1108, 752, 513, 368, 1928, 285, 1158, 672, 368, 457, 250, 10678, 436, 10331, 32, 1359, 1057, 352, 7277, 342, 752, 368, 452, 3597, 32, 1359, 1057, 352, 5691, 752, 368, 2168, 1158, 368, 871, 32, 1621, 9732, 476, 2028, 368, 667, 273, 436, 1108, 597, 476, 1127 ]
den – The Life of Percy Bysshe Shelley Warren Felt Evans – Esoteric Christianity and Mental Therapeutics William Morris – A Dream of John Ball Emily Ruete – Memoirs of an Arabian Princess: An Autobiography Charles Taze Russell – The Plan of the Ages (later The Divine Plan of the Ages, vol. 1 of Millennial Dawn, later Studies in the Scriptures) A. E. Waite – The Mysteries of Magic Births January 14 – Hugh Lofting, English children's writer (died 1947) February 11 – May Ziadeh, Lebanese-Palestinian poet, essayist and translator (died 1941) February 13 – Ricardo Güiraldes, Argentinian novelist and poet (died 1927) March 1 – Oskar Kokoschka, Austrian poet and artist (died 1980) March 30 – Frances Cornford (née Darwin, FCC), English poet (died 1960) April 1 – Brita von Horn, Swedish dramatist, novelist and theatre director (died 1983) April 15 – Nikolay Gumilyov, Russian Acmeist poet (executed 1921) May 16 – Vladislav Khodasevich, Russian poet and critic (died 1939) June 26 – Donar Munteanu, Romanian poet and magistrate (died 1972) July 16 – Pierre Benoît, French novelist (died 1962) July 22 – Hella Wuolijoki, Estonian-born Finnish writer (died 1954) July 24 – Jun'ichirō Tanizaki (谷崎 潤一郎), Japanese novelist (died 1965) September 8 – Siegfried Sassoon, English poet and memoirist (died 1967) September 20 – Charles Williams, English poet, novelist, playwright and theologian (died 1945) October 4 – Lennox Robinson, Irish dramatist, poet and theatre producer (died 1958) October 25 – Karl Polanyi (Károly Polányi), Austro-Hungarian economic historian and social philosopher (died 1964) November 1 – Hermann Broch, Austrian Modernist writer (died 1951) November 21 – Harold Nicolson, English author (died 1968) November 29 – Thomas Burke, English novelist and story writer (died 1945) December 5 – Rose Wilder Lane, American journalist and libertarian (died 1968) Victor Llona, Peruvian-born translator (died 1953) Deaths March 17 – Pierre-Jules Hetzel, French publisher (born 1814) March 27 – Sir Henry Taylor, English dramatist, poet and public official (born 1800) April 9 – Joseph Victor von Scheffel, German poet and novelist (born 1826) May 4 – Eliza Lanesford Cushing, American Canadian dramatist, short story writer, and editor (born 1794) May 15 – Emily Dickinson, American poet (born 1830) May 17 – Erskine May, English constitutional theorist (born 1815) June 14 – Alexander Ostrovsky, Russian dramatist (born 1823) July 16 – Ned Buntline (Edward Zane Carroll Judson Sr.), American publisher, dime novelist and publicist (born 1821) July 21 – Maximilian Wolfgang Duncker, German historian (born 1811) August 9 – Samuel Ferguson, Irish poet and antiquary (born 1810) October 22 – Matilda Jane Evans, English-born Australian novelist (born 1827) November 21 – Johannes Scherr, German novelist and critic (born 1817) November 22 – Mary Chesnut, American diarist (born 1823) December 12 – Johan Nicolai Madvig, Danish philologist (born 1804) Awards Newdigate Prize – R. L. Gales In literature Joseph Conrad's novel The Secret Agent (1907) is set during this year. References Category:Years of the 19th century in literatureOne of the things I often advocate for newcomers to tea drinking is to sample widely. Learning about tea is, on some level, not very difficult at all. It requires experience and an active mind to reflect upon and learn from the experiences gained. To gather this experience though, the only way to really do it is to drink a lot of tea. Reading about it or hearing about it really doesn’t do much good, for it is only theory that lacks backing from practical experiences. The practical problem with active sampling are twofold. The first is simple – samples are not very cheap, usually, and so it can actually be quite expensive when you buy a lot of them from different vendors. At a site like Yunnan Sourcing, you can easily drop a hundred dollars or more on a dozen samples, and that’s before you have to factor in shipping cost. If you’re not getting your samples for free, this can be quite a major expense on its own. Then there is the more nuanced problem of what to do with the samples. It’s quite easy to say that sampling widely will give you experience in tea drinking. In practice, however, that’s not so simple. Of course, trying all kinds of teas will most certainly give you experience. However, it is experience on a relatively shallow level. Certain kinds of teas, such as really bad or really good teas, will probably manifest themselves quite readily. Others, however, are not so obvious. It is actually easier to try teas if you, say, cup them, but then it becomes work and the process is not very enjoyable. This is, ultimately, a hobby, and not a job (for me anyway) so taking the fun away like that is basically missing the point. What instead happens is that some teas require multiple tastings to reveal themselves one way or another. Sometimes the first time you brew a tea it doesn’t come out quite right not because it’s bad, but because you are still adjusting to it. It helps when you’re using the same teawares all the time, so that the only variable is the tea. In some ways, by doing so you’re basically cupping the tea without cupping it – you’re testing whether or not the tea is good for your style of brewing. Even then, however, a good tea drinker should be adjusting to the tea and trying to brew it as best s/he can, which means that the first try can come out horribly wrong. Cupping also has its own limitations, as it can tell you whether or not a tea is good, but the skill in bringing out the goodness still requires your active intervention – unless you’re planning on drinking the tea grandpa style, the input of the brewer is an integral part of what makes a cup of tea. This is why I almost never write reviews anymore based on one impression (when I do write them anyway, which is getting rare too), as there are too many variables and is just not very reliable. Forming an opinion based on a few cups of tea is only reliable if it’s really obviously bad or good. Now, having had a lot of experience in tea does speed up the process of identifying issues and problems in an unknown tea. Right away, for example, it is possible to tell what kind of condition a puerh has been stored in, or whether an aged oolong has been reroasted, so on and so forth. It also helps compartmentalizing teas faster – you can basically draw on an ever expanding library of tastes and sensations and know what tea this is most similar to, and therefore what you can expect from it. Teas are never the same, however, and different people brewing the tea also yield different results. So, there’s only so far you can go with the “scientific” approach. Trying to analyze teas based solely on aroma, appearance, etc, is only possible if you’re dealing with industrial level generalities. Samples, therefore, are first impressions. There is also knowledge that you can gain from drinking the same tea over and over again that you cannot from sampling. This may involve the tea changing on you – a traditionally stored puerh gradually losing its storage taste, for example. Or, it can just be that you start noticing nuances that were there, but were not necessarily obvious the first few times you try it. Or perhaps you experiment with different parameters, water, ware, etc. and notice that it performs differently under different circumstances. This type of knowledge is not possible if you only have 25g of a tea. It can really only come with drinking 200, 300, or even 1000g of the same tea. After a while, you get a sense of what to expect, and when the results don’t meet expectations, then it becomes a learning moment. You just can’t do that without a lot of the same tea. When I say “same tea” I also don’t just mean the same kind of tea, such as a tieguanyin, but rather the exact same tea – from the same place, harvested around the same date, etc. Each batch of tea from a farmer is going to be slightly different, no matter the circumstances, once again complicating the issue. The important thing of all this tea drinking and learning is not so much the drinking itself, but the critical reflection and evaluation that takes place simultaneously. Forget about what others tell you – what do you feel and think when you’re drinking this tea? How does it compare with what you have tried? How does it challenge what you already think you know? No teacher can tell you any of this – they can point
[ 28461, 28, 3237, 275, 253, 3055, 3916, 1232, 943, 320, 26415, 562, 285, 18445, 342, 15, 28351, 12578, 9966, 7406, 7648, 73, 1119, 1941, 273, 440, 49628, 285, 6830, 6424, 3879, 407, 690, 16010, 13, 533, 344, 1904, 457, 85, 1089, 2712, 7738, 7936, 7242, 273, 253, 3916, 1232, 15, 6798, 33782, 1321, 574, 17770, 3000, 323, 17641, 457, 84, 3731, 21285, 4544, 13, 285, 342, 3408, 767, 273, 253, 2332, 30361, 13, 352, 457, 84, 30048, 281, 1978, 247, 9479, 2770, 327, 17641, 457, 84, 30990, 762, 530, 15, 52, 15, 6938, 5323, 15, 187, 187, 1276, 604, 13, 3185, 273, 6523, 17641, 457, 84, 1928, 14, 12311, 29908, 13, 7108, 3047, 253, 3888, 273, 13131, 277, 35706, 326, 403, 13889, 387, 1924, 4142, 390, 253, 11624, 273, 46447, 2448, 5219, 18797, 9593, 11624, 326, 452, 3531, 598, 342, 4166, 285, 15218, 1103, 347, 2080, 1977, 347, 14748, 32, 26659, 247, 20687, 417, 9398, 247, 3168, 11959, 342, 247, 17641, 18479, 285, 703, 457, 620, 2028, 368, 326, 2570, 17787, 36870, 403, 1663, 12927, 280, 246, 6228, 28904, 15, 844, 3365, 1053, 457, 85, 871, 752, 253, 2538, 273, 512, 273, 326, 4166, 285, 15218, 386, 588, 320, 15, 187, 187, 510, 17753, 4487, 273, 14673, 19242, 556, 816, 2361, 326, 495, 15, 520, 3041, 12511, 273, 773, 80, 1031, 2144, 668, 497, 22269, 598, 327, 17753, 457, 84, 8852, 1282, 275, 253, 806, 4314, 2607, 273, 436, 807, 15, 2064, 310, 247, 1384, 14, 8089, 2572, 275, 253, 4166, 5728, 1390, 807, 15, 380, 1375, 1057, 417, 2568, 871, 253, 1921, 323, 253, 14138, 2572, 13, 533, 1110, 8442, 403, 2080, 275, 6714, 273, 752, 359, 457, 306, 1705, 281, 2997, 347, 773, 6320, 668, 23753, 432, 253, 18351, 457, 84, 14974, 9787, 8232, 15, 187, 187, 7282, 556, 2168, 23383, 8106, 281, 1638, 6424, 7260, 13, 12319, 432, 10776, 281, 17974, 44182, 15, 733, 310, 8069, 247, 35171, 327, 19077, 13, 1907, 5821, 281, 1740, 1107, 273, 8667, 273, 697, 5252, 7259, 285, 697, 18035, 15, 380, 2567, 5087, 323, 253, 8993, 4076, 14, 484, 4815, 984, 326, 457, 84, 697, 4320, 8294, 15, 1893, 403, 5079, 29701, 762, 253, 24373, 10205, 3162, 13, 534, 310, 253, 2770, 273, 253, 26388, 326, 3135, 1735, 2129, 15, 187, 187, 7282, 671, 1335, 42261, 22414, 762, 253, 14673, 22106, 46327, 23868, 313, 10189, 4877, 582, 534, 45319, 253, 2105, 273, 33269, 43287, 23816, 15, 380, 15132, 4877, 1232, 12516, 247, 1318, 327, 253, 1481, 273, 1046, 8516, 10065, 9593, 5339, 390, 44137, 13, 1046, 277, 41178, 13, 1046, 17053, 305, 962, 15, 380, 22414, 403, 840, 908, 275, 20384, 6031, 13, 751, 42021, 9685, 6056, 15, 187, 187, 7282, 310, 253, 15515, 14, 45242, 13739, 327, 253, 8859, 15, 733, 310, 417, 247, 5487, 28, 352, 457, 84, 327, 2332, 323, 697, 16503, 15, 2058, 247, 673, 672, 1142, 7108, 4282, 604, 1512, 14, 2760, 14, 936, 14, 24796, 18674, 403, 1840, 253, 1569, 13, 359, 878, 281, 923, 326, 776, 3722, 16249, 6938, 10132, 403, 27810, 984, 597, 497, 3542, 323, 3394, 816, 751, 253, 17641, 28737, 15, 187, 187, 15418, 714, 1596, 744, 310, 4007, 285, 11731, 273, 3313, 12469, 538, 251, 8273, 15, 22050, 43353, 27, 296, 31981, 187, 29317, 3887, 6558, 398, 568, 36, 6147, 408, 17798, 89, 2146, 654, 951, 48072, 37474, 89, 2146, 33, 23655, 15, 681, 21760, 187, 29317, 3887, 5740, 568, 6113, 74, 14, 84, 20, 27973, 2460, 3, 187, 187, 4, 256, 20, 3671, 285, 690, 643, 21011, 187, 29537, 13390, 14, 788, 5731, 3857, 393, 187, 50276, 1739, 14, 788, 3334, 428, 90, 393, 187, 50276, 84, 20, 3671, 26721, 440, 16368, 3857, 393, 187, 50276, 1109, 428, 19232, 1227, 2044, 16, 4658, 16, 1739, 16, 28256, 3122, 187, 187, 4, 3334, 391, 27803, 187, 24584, 416, 3207, 11147, 64, 17037, 30, 87, 18, 15, 2504, 15, 17, 187, 29537, 22942, 1227, 12780, 393, 187, 50276, 10494, 26721, 428, 48, 5987, 1358, 21596, 84, 15, 83, 27803, 15, 2061, 16, 8626, 51, 3207, 11147, 64, 17037, 9228, 83, 27803, 14, 8626, 51, 3207, 11147, 64, 17037, 5960, 13217, 14, 39227, 1540, 15, 16368, 393, 187, 50276, 10494, 440, 16368, 1227, 12780, 16, 83, 27803, 14, 8626, 51, 3207, 11147, 64, 17037, 5960, 13217, 14, 39227, 1540, 15, 16368, 393, 187, 50276, 10494, 278, 87, 1227, 12780, 16, 83, 27803, 14, 4842, 13217, 14, 39227, 1540, 16, 83, 27803, 1227, 11919, 16, 4805, 393, 187, 50276, 10494, 40373, 428, 83, 1227, 12780, 16, 83, 27803, 11, 187, 187, 49617, 27479, 64, 9252, 16, 84, 20, 17440, 1227, 84, 20, 17440, 187, 31626, 34415, 15640, 16, 84, 20, 17440, 9686, 187, 48, 15, 44, 309, 1912, 626, 1818, 619, 49530, 15, 1292, 309, 858, 1818, 619, 11118, 13, 309, 1833, 3164, 513, 326, 432, 673, 281, 673, 15, 187, 42, 751, 634, 20076, 14, 597, 1472, 4484, 15, 27288, 310, 3240, 11755, 309, 1158, 15, 10363, 316, 41564, 3719, 434, 44596, 556, 247, 8580, 90, 2454, 2, 187, 187, 1147, 1057, 13, 285, 352, 310, 1270, 281, 923, 247, 8989, 326, 3548, 626, 19867, 50016, 1164, 3964, 328, 15, 309, 871, 326, 352, 310, 247, 5389, 5313, 273, 1445, 533, 309, 717, 8334, 273, 352, 13, 310, 3780, 2010, 275, 436, 1899, 15, 1621, 2647, 849, 1142, 5098, 368, 2619, 598, 352, 310, 1900, 627, 13, 1289, 565, 272, 387, 368, 432, 253, 3835, 13, 2761, 3981, 346, 248, 248, 15, 309, 1353, 1060, 969, 13, 368, 16216, 755, 8314, 273, 479, 47285, 47285, 3446, 187, 187, 42, 717, 417, 10412, 13, 309, 717, 816, 10208, 598, 342, 253, 1652, 417, 73, 525, 441, 321, 14650, 253, 1659, 273, 3687, 2758, 273, 2892, 275, 776, 12959, 15, 187, 187, 42, 1353, 417, 10279, 2, 1536, 583, 10279, 2, 380, 28401, 273, 50016, 1164, 3964, 328, 2, 5402, 8, 70, 512, 10279, 2, 329, 39639, 2, 187, 187, 2302, 15, 309, 5194, 342, 368, 15, 10363, 316, 41564, 8, 44596, 310, 2080, 8936, 275, 619, 4743, 285, 50016, 310, 2970, 2581, 38519, 15, 309, 5730, 597, 651, 897, 11853, 1045, 6628, 8, 8989, 13, 390, 387, 1878, 3523, 7384, 326, 344, 310, 253, 8198, 485, 273, 512, 1841, 22437, 15, 4952, 436, 12209, 310, 1925, 4377, 53, 307, 4041, 15, 50016, 15, 964, 964, 85, 307, 15, 964, 964, 85, 307, 15, 964, 964, 475, 11489, 304, 7276, 387, 521, 18580, 16391, 11, 187, 187, 42, 717, 3846, 11870, 594, 432, 1024, 327, 309, 778, 3590, 48101, 604, 309, 1053, 626, 2168, 15, 187, 187, 42, 5194, 670, 436, 50016, 2181, 15, 1621, 581, 310, 11280, 619, 50016, 1164, 3964, 257, 1984, 326, 309, 4845, 258, 253, 2829, 342, 690, 2317, 15, 495, 25503, 1410, 309, 3047, 952, 1379, 247, 3158, 1007, 285, 840, 2075, 625, 4116, 1931, 344, 5017, 1475, 352, 15, 380, 1390, 581, 309, 3047, 2686, 4395, 690, 5017, 2584, 253, 1984, 15, 187, 187, 248, 73, 13, 7016, 281, 3324, 598, 247, 3846, 9400, 1051, 2858, 309, 2389, 619, 747, 9788, 4233, 285, 1323, 11170, 873, 2, 23089, 841, 275, 353, 4350, 1143, 13, 1512, 15, 309, 1160, 253, 6135, 347, 247, 9449, 9140, 323, 22463, 13, 533, 344, 3078, 352, 2393, 13, 594, 309, 2692, 779, 15, 754, 1339, 479, 897, 629, 273, 253, 6135, 323, 619, 49530, 285, 11118, 15, 36026, 626, 352, 20295, 32, 5042, 63, 187, 187, 1394, 2550, 1501, 747, 12989, 275, 436, 12209, 1394, 2550, 12252, 281, 12989, 275, 436, 12209, 1394, 2550, 12921, 634, 9319, 275, 436, 12209, 1394, 2550, 11352, 634, 9319, 275, 436, 12209, 1394, 2550, 1501, 37969, 275, 436, 12209, 37796, 313, 19946, 5791, 6176, 310, 15335, 1929, 347, 443, 4976, 426, 5685, 9922, 4687, 10, 285, 20635, 487, 571, 3894, 247, 1048, 16592, 2892, 13, 5068, 387, 253, 990, 273, 253, 655, 394, 5331, 672, 253, 2586, 369, 29557, 264, 407, 6176, 15, 6176, 457, 84, 5231, 275, 253, 2586, 497, 6685, 17877, 13, 3340, 1411, 253, 3856, 287, 38646, 15, 496, 40253, 13, 546, 34785, 407, 253, 2761, 419, 545, 38364, 9811, 273, 616, 952, 13, 253, 3856, 2921, 41763, 275, 2137, 15, 7160, 25789, 621, 13, 2299, 13, 497, 16325, 595, 16013, 407, 5621, 273, 4214, 418, 837, 274, 8449, 17798, 19243, 13, 285, 253, 3856, 2921, 38646, 497, 23321, 949, 33902, 273, 2534, 445, 13438, 1919, 512, 533, 721, 13, 933, 273, 247, 3072, 273, 2456, 13, 933, 591, 1428, 432, 2057, 35351, 390, 253, 1629, 2683, 6419, 15, 831, 310, 7561, 2783, 281, 320, 253, 806, 1384, 394, 5331, 42604, 15, 1876, 5685, 35586, 275, 7531, 497, 38509, 456, 407, 247, 8936, 32683, 4668, 3361, 432, 26478, 281, 26052, 15, 187, 187, 1466, 457, 84, 5448, 3579, 281, 253, 807, 11161, 15, 2058, 21811, 273, 4596, 898, 253, 3402, 9377, 275, 12911, 15, 20635, 487, 571, 2918, 7379, 14, 2163, 15931, 12337, 275, 4596, 15956, 2511, 13, 1563, 4829, 247, 5331, 273, 1612, 23490, 285, 16860, 342, 697, 15833, 15, 12257, 13, 253, 12337, 858, 417, 3324, 247, 4209, 1180, 273, 13008, 281, 3630, 247, 747, 7410, 15, 1583, 14549, 11634, 4092, 16685, 875, 2710, 4676, 13, 534, 3977, 281, 247, 5547, 16253, 273, 247, 747, 7410, 275, 5080, 273, 7901, 15, 32237, 369, 7169, 253, 1563, 1770, 13, 285, 6176, 457, 84, 27135, 1877, 273, 5791, 285, 4255, 2335, 1659, 327, 4437, 495, 13, 7901, 15, 2053, 16907, 20804, 3394, 651, 3048, 253, 767, 4343, 2568, 969, 15, 187, 187, 688, 7901, 13, 34068, 20635, 487, 757, 2151, 665, 8899, 598, 275, 253, 443, 4976, 497, 2197, 896, 773, 9511, 668, 281, 20635, 487, 571, 15, 773, 510, 443, 4976, 2151, 273, 20635, 487, 571, 668, 574, 644, 43919, 432, 13842, 39210, 432, 2710, 29302, 19509, 4795, 432, 253, 35297, 11182, 273, 253, 3684, 4255, 7531, 6491, 434, 17273, 313, 13753, 2088, 48, 10, 1411, 3684, 7531, 457, 84, 17238, 273, 20635, 487, 571, 15, 2732, 253, 36103, 273, 16211, 272, 66, 327, 2552, 577, 13, 14304, 1128, 66, 23180, 2983, 327, 247, 29302, 2986, 275, 4965, 6836, 407, 253, 3684, 8118, 8544, 313, 10487, 20635, 487, 2458, 497, 5339, 37011, 783, 13710, 2088, 48, 26854, 959, 30122, 8385, 432, 1475, 253, 20902, 15, 6676, 4343, 13, 1690, 253, 443, 4976, 13, 2530, 8385, 275, 253, 830, 273, 4730, 13, 3739, 8596, 285, 1971, 13, 347, 973, 347, 18028, 29302, 23717, 323, 2151, 285, 2872, 7747, 15, 187, 187, 10342, 273, 841, 2151, 13, 665, 1669, 20635, 487, 571, 387, 247, 2872, 2363, 13, 574, 5262, 625, 685, 884, 1107, 275, 6176, 1293, 616, 4651, 390, 667, 3057, 281, 616, 2586, 15, 1583, 497, 4845, 762, 253, 20446, 273, 5685, 10954, 665, 497, 14565, 407, 253, 5791, 5685, 2208, 13, 285, 2959, 271, 4730, 627, 13, 1146, 10166, 347, 253, 2852, 17832, 273, 20635, 487, 571, 15, 187, 187, 1909, 253, 14275, 2137, 275, 20635, 487, 571, 2210, 281, 271, 990, 285, 253, 5791, 5685, 2208, 11512, 13, 352, 3395, 8767, 347, 281, 665, 651, 4035, 281, 15065, 253, 3297, 285, 4730, 273, 253, 2151, 15, 380, 2151, 497, 6726, 281, 1091, 1728, 281, 247, 1659, 326, 369, 773, 37380, 668, 281, 731, 15, 5595, 273, 253, 2151, 812, 417, 1014, 6983, 752, 20635, 487, 571, 369, 751, 1078, 597, 574, 1669, 323, 6176, 15, 4129, 954, 273, 253, 10884, 2151, 497, 773, 250, 13578, 668, 407, 4651, 390, 643, 2021, 2758, 285, 574, 644, 7329, 1309, 616, 46772, 275, 6176, 281, 20635, 487, 757, 4466, 313, 84, 23750, 13, 11012, 285, 3448, 582, 597, 6888, 326, 597, 812, 417, 4271, 3746, 342, 616, 1211, 2586, 13, 3448, 13, 390, 4466, 15, 380, 20635, 487, 757, 3072, 671, 11575, 253, 2151, 347, 20823, 5852, 15, 1284, 247, 906, 13, 841, 2151, 1119, 3746, 20501, 616, 6489, 285, 9046, 247, 4858, 285, 747, 6489, 12208, 407, 1142, 3345, 2616, 326, 2242, 9366, 875, 5685, 285, 20635, 487, 757, 22925, 13, 1014, 275, 3448, 15, 831, 1554, 40319, 6489, 2335, 327, 253, 1416, 773, 40, 4976, 14, 2151, 1425, 510, 11442, 13338, 34105, 6337, 616, 8059, 1924, 281, 495, 14, 17, 1563, 271, 11487, 14, 2787, 24417, 10170, 1411, 13975, 27756, 347, 247, 1458, 1127, 7583, 327, 7814, 15, 187, 187, 49107, 13338, 369, 562, 11860, 7584, 15, 19, 33109, 3079, 15, 26 ]
accountable; problems in the private claims process should be rooted out and dealt with. Former FBI Director Louis Freeh found evidence of unethical and possibly criminal behavior by some attorneys, but he didn’t find anything suggesting fundamental abuse of the claims process. Judge Barbier had harsh words for BP’s misdirection campaign, and with phase two of the trial underway, it’s imperative to keep a sharp focus on BP’s accountability under U.S. environmental laws. What if, instead of seeing BP’s feel-good messaging, Americans saw the images of infant dolphins that are dying at record rates or the eggs of migrating American White Pelican eggs that have turned up with oil and dispersants as far away as Minnesota? Ask a scientist not wearing a white coat with a BP logo and she’ll tell you that complex marine ecosystems are really oceanic tinderboxes. We simply don’t know what the effects of all of that oil and dispersant will be. The Louisiana Department of Natural Resources has just reported that 3.01 million pounds of “oily material” were cleaned up on Louisiana’s coastline in the first eight months of this year. That is a 20-fold increase in the oil collected last year. The state does not yet know the reason for the dramatic increase, but those figures are far in excess of what we’ve come to accept as “normal” leakage from the Gulf’s floating industrial zone. BP has already pleaded guilty to 14 criminal charges, ranging from lying to felony manslaughter. It is effectively a convict on probation, having agreed to four years of monitoring of its safety procedures and its ethics. The company paid for the immediate clean-up costs because that’s its legal responsibility. So are civil fines under the Clean Water Act, which is the focus of the hearings that begin next week. BP also still owes penalties under the Natural Resource Damage Assessment (NRDA), which calculates the cost of restoring devastated wildlife. The NRDA process puts a value on the head of every brown pelican killed or harmed, every dolphin, every laughing gull. The penalties are then used in restoration efforts, like rebuilding wetlands. BP is the sixth-largest corporation on the planet. It is not a victim; it’s on trial for its mistakes. At a time when many Americans wonder if too-big-to-fail corporations are above the law, we need to see that our bedrock environmental regulations are enforced because they were written for events just like the BP spill. David Yarnold is president and CEO of National Audubon Society.FROM debian:stretch LABEL maintainers="Cyrill Troxler <[email protected]>" LABEL description="csi-s3 slim image" # s3fs and some other dependencies RUN apt-get update && \ apt-get install -y \ s3fs curl unzip && \ rm -rf /var/lib/apt/lists/* # install rclone ARG RCLONE_VERSION=v1.47.0 RUN cd /tmp \ && curl -O https://downloads.rclone.org/${RCLONE_VERSION}/rclone-${RCLONE_VERSION}-linux-amd64.zip \ && unzip /tmp/rclone-${RCLONE_VERSION}-linux-amd64.zip \ && mv /tmp/rclone-*-linux-amd64/rclone /usr/bin \ && rm -r /tmp/rclone* COPY ./_output/s3driver /s3driver ENTRYPOINT ["/s3driver"] O.K I won't change my avatar. But I did change my signature, I'll probably do that from time to time. I like your signatures- they're cool. Mine is quite funny I think. Psusennes II's coffin has a smiley face! It does, and it is great to see a mask that isn't bloody Tutankhamun. I know that it is a beautiful piece of art but I am sick of it, is anyone else in this position. No matter how many books you pick up it is always there, glinting at you from the cover, almost saying "hehe. I'm here again, you cant get rid of meeeeeeeee". I am not crazy, I am just fed up with the little nothign usurping the place of greater members of history in our memories. I'm not mad! Whose mad! The curse of Tutankhamun! Your'e all mad! Aaaa! No. I agree with you. Psusennes' coffin is far superior in my opinion and Tut is getting rather tedious. I wish they would use somebody elses' mask, or at least stop assuming that he is the epitome of all things Egyptian. Even this forum is called KingTutOne. Tut. . .tut. . .tut. . . *sniggers at his awful joke* I am dead tired so from now on I may sound retarded if I don't already. I agree about this Tut thing. No one is buying my Tutankhamen book that I placed o the table with some space. 3 TIMES I saw people take a quick look and then pay more attention tot he stuff around it. The last one I saw actually moved some stuff toward the book. heh, sorry to bring up a dead topic...but I love my new siggy and avvy set! Made these in MSPaint, too. I made the doll as a Christmas gift for Robin, but he wanted it early, so I showed him. He let me use part of the doll for my avatar and signature. Isn't it cute? ^^ You cannot post new topics in this forumYou cannot reply to topics in this forumYou cannot edit your posts in this forumYou cannot delete your posts in this forumYou cannot post attachments in this forumGermany (former East Germany is officially known as GDR = German Democratic Republic) and Namibia share a long painful history, beginning at the end of the 19th century when the country was annexed by Germany. Germany’s actions in the country were extremely cruel, especially against the Herero natives. In 1904, enraged by the almost haphazard killing of their people, the Hereros erupted in war. Their rebellions, however, were brutally suppressed by forces of General Lothar von Trotha, and the Hereros natives were pursued through stretches of barren desert until all but 6,000 of a population of 50,000 perished from either starvation or the skirmishes. This is widely considered to be the first 20th century genocide. All German possessions in Africa were confiscated by a superior Allied military presence from 1914 to 1918. Let’s wind forward to the year 1989. At midnight of November 9 the wall broke in Berlin. Namibia held UN-monitored elections in November ’89, following nearly a century of power struggles and wars with its neighbors. Nevertheless, the elections did not bring a sufficient number of votes to write a new constitution. They perpetuated serious negotiations between various parties, which led to a successful adoption of a new constitution in February of 1990. Independence was granted the following month, and Germany’s reunification of East and West took place on October 3, 1990. These seemingly unrelated events would link the two countries yet again. In 1990, 430 Namibian children who grew up in the GDR were sent back “home” to Namibia. “The GDR children of Namibia” had been relocated from 1979 onwards from various refugee camps resulting from the liberation struggle of the South West Africa People's Organization (SWAPO) against South Africa’s occupation of Namibia. After the massacre of Cassinga on May 4, 1978—a brutal attack on a refugee camp in Angola by the South African army (600 Namibians were killed)—the SWAPO solicited humanitarian assistance from around the globe. Many countries, including the GDR, provided assistance in the form of education, medical aid and treatment, as well as granting refugee asylum for children and young adults. Most of these children, who left Namibia at a young age, had spent more than 10 years in Germany without their parents or any contact to their country. They were placed under the supervision of German teachers who were hired by the East German government, and received an education there, being trained as the future elite of Namibia. As the independence war in Namibia came to an end and the East German government resolved, it became uncertain as to who would continue to finance the stay and education of the children. The children were forced to return home to a place that was “foreign” to them. Most of the children could not even recall what Namibia was like before they had left for Germany. Although most of the returning children were “reclaimed” by parents or other family members and had been exposed during their schooling in Germany to Namibian culture (songs, dance and language), they discovered that they could not identify themselves with their own country, language, or culture. The Namibian population also viewed the children as outsiders. As a result, these children found themselves questioning their identity and forming a separate and new identity influenced by many outside factors that lay somewhere between German and Namibian identities, even in language. This multicultural identity took on the name “GDR- children.”The Northern Colorado Bears ran their conference record to 3-0 following an 82-79 OT victory against visiting Idaho as a 15 point favorite on Saturday. Northern Colorado was outshot 49.2%-43.9
[ 36511, 13, 45334, 2147, 6149, 13, 285, 12405, 7202, 281, 479, 15, 187, 187, 14039, 259, 19074, 314, 43219, 21583, 13, 767, 327, 2057, 1930, 273, 253, 3369, 13, 26740, 264, 9719, 916, 4360, 13, 533, 309, 2206, 1066, 327, 253, 5018, 285, 38570, 619, 8050, 4669, 715, 37042, 17819, 13, 1335, 4484, 835, 352, 18993, 253, 5101, 15, 2752, 2927, 37560, 2112, 253, 11186, 16892, 13, 247, 2280, 273, 269, 4902, 3171, 285, 14700, 15, 2058, 1878, 10488, 6574, 1977, 13, 627, 369, 642, 14542, 281, 616, 28677, 15, 7214, 32290, 4759, 387, 253, 2406, 6478, 569, 13, 1850, 5341, 2455, 11707, 21327, 13, 840, 34994, 11978, 5561, 13, 840, 9005, 3022, 37116, 1321, 4910, 326, 651, 1620, 14534, 15, 187, 187, 25347, 555, 11433, 745, 253, 1669, 1930, 273, 253, 28392, 6225, 247, 1781, 17914, 15, 733, 3261, 44753, 4270, 285, 747, 13, 697, 20596, 10699, 285, 6032, 16431, 273, 8862, 21175, 33055, 275, 253, 34352, 5101, 15, 329, 5931, 369, 15312, 3802, 518, 44549, 1475, 253, 36260, 326, 4802, 253, 4021, 11008, 15, 308, 603, 11411, 3977, 4951, 281, 253, 17914, 15, 187, 187, 34, 13915, 390, 594, 4457, 13, 253, 13438, 9461, 2067, 4289, 4669, 281, 247, 27563, 273, 20035, 90, 787, 25428, 326, 6508, 6420, 13, 1499, 18225, 15492, 896, 281, 253, 13438, 5254, 15, 1810, 22194, 4233, 12468, 48412, 21817, 253, 1755, 13, 616, 16361, 2400, 43031, 23314, 2806, 2980, 1411, 253, 8467, 15, 187, 187, 7542, 20632, 13, 309, 1871, 644, 2820, 281, 1239, 20310, 571, 87, 13890, 275, 619, 2316, 15, 9405, 285, 7591, 281, 21364, 327, 2712, 3707, 849, 309, 1537, 8773, 13, 309, 1871, 1705, 3345, 2819, 323, 6619, 275, 247, 29178, 15, 1292, 1014, 275, 253, 5448, 13, 17052, 331, 1947, 619, 2927, 13, 14241, 2980, 619, 4808, 285, 4707, 15, 25081, 13, 309, 3735, 1529, 24455, 1924, 1905, 824, 271, 299, 24763, 3590, 3540, 281, 436, 6325, 13438, 13, 253, 3440, 594, 2120, 13, 1055, 272, 7906, 273, 22299, 1457, 2816, 3228, 15202, 285, 952, 1531, 15416, 715, 8566, 8470, 15, 40474, 13, 309, 26882, 885, 24597, 285, 18326, 13, 533, 1024, 253, 502, 66, 461, 3838, 12789, 1461, 1100, 273, 247, 1218, 1028, 528, 2360, 34583, 4455, 45113, 15, 187, 187, 42, 2206, 327, 253, 5018, 323, 253, 1805, 629, 273, 271, 4964, 13, 7487, 253, 13438, 1614, 12689, 1059, 11834, 253, 5101, 15, 2752, 2564, 9912, 264, 13, 285, 309, 3395, 594, 2209, 1350, 264, 275, 253, 14549, 2368, 273, 2564, 23786, 326, 309, 3053, 672, 253, 2914, 3369, 12774, 6840, 1527, 3212, 479, 15, 2207, 1665, 434, 19269, 502, 3938, 264, 19781, 314, 1411, 253, 5534, 15, 187, 187, 3, 12978, 368, 320, 18254, 3517, 865, 344, 2546, 15, 380, 11267, 934, 273, 521, 20041, 90, 4318, 4269, 619, 12607, 281, 892, 12216, 15, 309, 4571, 626, 2997, 326, 359, 497, 2366, 969, 15, 3032, 3361, 1335, 3499, 32284, 479, 15, 187, 187, 3, 4374, 449, 187, 187, 3, 42, 1869, 309, 1871, 32257, 247, 4564, 273, 2870, 8765, 937, 344, 753, 13, 285, 309, 812, 2028, 344, 369, 18727, 13, 11525, 309, 1871, 320, 17847, 15, 309, 13876, 604, 344, 497, 2820, 281, 1056, 598, 323, 4829, 9811, 479, 15, 1284, 2151, 13, 10793, 359, 13465, 13, 344, 1871, 1900, 1611, 281, 3330, 479, 896, 342, 17714, 13, 892, 27263, 13, 390, 13, 347, 275, 436, 1083, 13, 2739, 15, 346, 1394, 971, 247, 5484, 865, 187, 187, 13618, 4754, 15, 187, 187, 42, 3531, 1475, 285, 3261, 598, 387, 779, 15, 346, 2042, 368, 1849, 1694, 352, 13, 5332, 10213, 434, 651, 320, 5322, 449, 187, 187, 1328, 7428, 896, 3304, 285, 4895, 342, 271, 440, 31370, 10720, 273, 326, 24011, 16091, 41236, 15, 733, 369, 253, 1682, 2774, 273, 619, 1388, 13, 751, 247, 1355, 5313, 273, 1728, 13, 285, 619, 2798, 458, 1739, 15, 7306, 10892, 253, 2806, 14393, 13, 309, 2335, 247, 1048, 1863, 408, 13, 11196, 619, 2927, 347, 253, 258, 2114, 3289, 15676, 1066, 619, 13386, 15, 496, 326, 1273, 13, 347, 253, 41236, 1625, 264, 619, 6325, 12607, 13, 309, 812, 1849, 644, 327, 619, 12595, 13, 3815, 13, 2970, 10739, 14, 28619, 275, 253, 18735, 273, 247, 9756, 7237, 15, 187, 187, 42, 5907, 253, 11996, 281, 2207, 1665, 13, 533, 344, 13072, 15, 754, 7428, 1475, 253, 7145, 273, 253, 17216, 285, 22944, 247, 32257, 896, 342, 779, 15, 2732, 15632, 253, 43573, 13, 344, 7428, 3304, 285, 4895, 8785, 247, 5340, 342, 767, 8314, 40685, 5026, 2502, 1873, 1641, 278, 525, 790, 13, 7043, 264, 285, 268, 554, 11712, 15, 1284, 344, 12293, 2469, 479, 13, 344, 2918, 253, 5340, 1066, 285, 753, 13, 346, 47656, 247, 1652, 273, 326, 41236, 327, 253, 9132, 449, 187, 187, 42, 277, 34455, 731, 275, 18988, 48676, 13, 285, 2207, 1665, 27352, 253, 14510, 4213, 249, 16334, 327, 253, 32257, 13, 835, 597, 892, 3163, 323, 247, 4564, 273, 7253, 15, 754, 2210, 285, 2206, 12200, 479, 13, 285, 347, 253, 15260, 4396, 1632, 273, 253, 41236, 873, 275, 13, 359, 18029, 281, 253, 2870, 8765, 256, 11114, 282, 285, 9047, 253, 32712, 294, 5873, 13, 751, 1711, 3858, 15, 187, 187, 3039, 253, 2870, 8765, 497, 18621, 13, 359, 2335, 776, 10855, 4830, 253, 2914, 28392, 13, 835, 247, 892, 14381, 90, 2829, 6225, 327, 581, 1930, 15, 2207, 1665, 6195, 767, 36555, 342, 247, 9711, 1503, 5265, 80, 13, 285, 359, 17017, 776, 8955, 275, 10837, 15, 309, 4571, 626, 1361, 4680, 347, 309, 2206, 2439, 432, 779, 13, 1422, 6403, 626, 326, 19827, 309, 3047, 327, 253, 13438, 1390, 2360, 15, 2064, 310, 849, 309, 1790, 1060, 1293, 36316, 390, 47012, 13, 984, 10380, 309, 871, 326, 2550, 320, 368, 15, 1422, 403, 816, 2207, 1665, 15, 2752, 4929, 15, 2752, 4797, 14, 26731, 19661, 15, 309, 923, 368, 347, 247, 5006, 13, 247, 7353, 13, 11309, 3472, 5006, 15, 3105, 326, 2181, 327, 253, 13438, 15, 3105, 326, 2725, 15, 187, 187, 1909, 253, 1390, 20126, 5101, 1257, 1317, 46047, 2708, 253, 19445, 16892, 13, 271, 45672, 528, 5471, 2335, 2186, 273, 479, 15, 380, 3361, 273, 1708, 574, 26299, 479, 247, 3282, 273, 1453, 13, 533, 1024, 13, 275, 13862, 13, 309, 3543, 809, 561, 6134, 969, 15, 1198, 436, 1921, 13, 309, 8715, 626, 14435, 253, 41236, 846, 619, 3302, 23357, 13, 4709, 272, 275, 2275, 363, 318, 812, 320, 8312, 1060, 15, 380, 10837, 387, 253, 2829, 440, 79, 4994, 479, 13, 1512, 15, 844, 1871, 644, 7063, 323, 6818, 2909, 1293, 247, 3159, 13, 533, 309, 3589, 626, 1469, 281, 3984, 15, 1737, 651, 309, 1333, 281, 779, 32, 187, 187, 3980, 1665, 574, 644, 17303, 715, 521, 5340, 13, 533, 1024, 521, 2927, 4229, 327, 479, 15, 754, 16481, 521, 13386, 15, 187, 187, 3, 1898, 90, 937, 344, 753, 15, 346, 1394, 4456, 2305, 15, 31405, 90, 865, 187, 187, 42, 4571, 626, 10476, 352, 15, 329, 8580, 1119, 619, 11233, 323, 253, 806, 673, 275, 1897, 15, 187, 187, 3, 32841, 479, 281, 2028, 352, 751, 368, 1620, 3735, 352, 1078, 865, 2207, 1665, 2546, 15, 187, 187, 3039, 309, 11522, 13, 344, 18274, 3579, 275, 521, 6951, 13, 787, 37018, 13, 4618, 14, 26731, 13, 247, 5686, 2926, 85, 7707, 15, 187, 187, 3, 3039, 359, 497, 5753, 13, 359, 1871, 564, 2067, 2069, 247, 807, 598, 715, 253, 31504, 6146, 273, 33970, 14, 15426, 358, 281, 3297, 342, 8481, 19475, 15, 8481, 45328, 369, 3846, 13, 285, 703, 10490, 253, 2567, 15, 1893, 849, 1711, 497, 359, 672, 436, 4592, 32, 26789, 5046, 32, 844, 1833, 1333, 7457, 594, 3255, 187, 187, 1394, 1928, 751, 2207, 1665, 13, 285, 309, 871, 13, 309, 3524, 352, 1912, 626, 1390, 13, 533, 2828, 13, 368, 1928, 751, 619, 4929, 275, 436, 2774, 15, 187, 187, 3, 1898, 8481, 19475, 434, 2419, 369, 1735, 281, 436, 19126, 390, 32675, 15, 9915, 31405, 90, 434, 390, 32675, 15, 754, 369, 247, 5261, 1017, 13, 594, 344, 6940, 407, 2994, 15, 733, 369, 2393, 25986, 13, 285, 6629, 285, 6105, 2390, 651, 1705, 323, 253, 1388, 281, 31405, 90, 434, 390, 32675, 281, 2619, 28580, 285, 8670, 7232, 13, 285, 4489, 260, 1334, 285, 1379, 19273, 83, 1487, 15, 187, 187, 3, 4497, 13, 1580, 436, 390, 32675, 17245, 987, 598, 1411, 8481, 19475, 434, 2867, 13, 359, 4571, 626, 11623, 16037, 1170, 689, 627, 15, 844, 1871, 20016, 28580, 13, 12394, 327, 521, 10649, 641, 13, 1132, 275, 253, 14700, 273, 19273, 344, 7141, 275, 521, 23584, 84, 15, 1292, 31405, 90, 369, 247, 1524, 32199, 670, 40209, 515, 398, 13, 594, 359, 1871, 452, 281, 564, 387, 2360, 15, 844, 1871, 3343, 7357, 8481, 19475, 2427, 281, 4600, 13, 285, 359, 1871, 36129, 562, 273, 326, 1424, 22560, 6389, 5967, 15, 187, 187, 3, 3074, 987, 13, 594, 436, 581, 1798, 4437, 2360, 13, 359, 15813, 3345, 670, 7457, 258, 8, 13273, 285, 5184, 253, 19354, 715, 253, 390, 32675, 15, 309, 4456, 253, 12334, 434, 1077, 2120, 13, 285, 352, 434, 417, 5412, 2568, 13, 533, 253, 18215, 1507, 285, 5202, 8954, 5943, 403, 4783, 13, 594, 253, 2360, 310, 1077, 1335, 285, 1077, 7107, 15, 733, 434, 2822, 253, 5241, 273, 12308, 15, 3808, 273, 253, 28580, 452, 256, 9698, 13, 533, 954, 403, 3962, 13, 285, 359, 42121, 949, 253, 390, 32675, 13, 9123, 841, 25691, 2348, 5101, 14, 7523, 1314, 4191, 447, 13, 816, 1907, 247, 7085, 86, 6156, 673, 15, 187, 187, 3, 4125, 31405, 90, 9633, 247, 4564, 4289, 20046, 13, 285, 327, 253, 18337, 3957, 7145, 273, 521, 2659, 13, 627, 369, 436, 43818, 12097, 359, 1871, 3735, 670, 533, 1620, 574, 253, 15254, 281, 564, 627, 15, 6089, 13, 436, 2360, 369, 581, 273, 1110, 15513, 672, 359, 3543, 828, 1763, 917, 15, 1893, 359, 3986, 253, 990, 273, 253, 390, 32675, 285, 923, 841, 1943, 13735, 8670, 7232, 275, 253, 46826, 15, 18741, 13, 31405, 90, 574, 1912, 690, 4797, 9412, 21111, 323, 521, 8670, 7232, 387, 253, 1375, 4344, 15, 754, 8899, 841, 49358, 4289, 14, 35987, 4107, 8765, 273, 3753, 15, 187, 187, 3, 1231, 476, 923, 521, 2419, 247, 4088, 598, 253, 39463, 1854, 13, 285, 512, 253, 10654, 403, 745, 13, 594, 359, 5492, 1016, 643, 715, 253, 43818, 12097, 13, 776, 2927, 35003, 323, 581, 273, 1110, 4289, 14, 35987, 398, 15, 6610, 13, 359, 13551, 275, 253, 4766, 273, 253, 12097, 13, 17053, 13, 562, 273, 6345, 449, 187, 187, 3980, 1665, 11373, 15, 309, 858, 13, 1512, 15, 844, 3260, 752, 369, 3551, 15, 346, 43199, 13, 816, 247, 1643, 11433, 1977, 13, 359, 4089, 436, 11216, 7753, 266, 27, 686, 42, 36996, 619, 13735, 35614, 11388, 346, 187, 187, 42, 1149, 567, 36221, 13, 3543, 253, 41236, 5451, 619, 6868, 5123, 15, 187, 187, 3, 4316, 1096, 441, 10739, 1417, 937, 344, 753, 15, 346, 1231, 1614, 285, 923, 2305, 15, 31405, 90, 40981, 264, 689, 436, 5699, 43818, 253, 1979, 273, 581, 273, 1110, 7667, 1757, 32590, 375, 8451, 6150, 31082, 868, 15, 754, 434, 1694, 521, 4583, 84, 1066, 1475, 521, 48500, 13, 285, 5006, 344, 434, 1547, 14650, 436, 2181, 275, 253, 46826, 15, 3771, 5015, 598, 247, 9902, 13, 924, 10892, 352, 751, 344, 434, 924, 10892, 247, 8050, 718, 13, 285, 15910, 1046, 1024, 285, 840, 281, 1379, 247, 1863, 304, 432, 521, 21152, 273, 759, 607, 7138, 90, 15, 187, 187, 3, 4527, 2282, 359, 1472, 4920, 1245, 13, 285, 1053, 626, 8968, 344, 434, 38611, 8140, 17507, 15, 844, 1158, 344, 1833, 923, 441, 285, 24577, 441, 604, 359, 1611, 281, 1408, 1728, 13, 594, 359, 2242, 1066, 275, 253, 17819, 285, 3343, 323, 779, 281, 8416, 598, 285, 564, 1728, 15, 6089, 13, 6524, 344, 30214, 1051, 3113, 326, 43818, 13, 25612, 598, 521, 4583, 84, 13, 285, 4566, 2819, 323, 1529, 15, 380, 1735, 581, 434, 4577, 13, 285, 846, 344, 434, 23086, 247, 7793, 275, 352, 342, 521, 14688, 254, 13, 344, 15323, 281, 521, 15746, 285, 7866, 15150, 436, 581, 15, 844, 3698, 779, 7435, 2620, 8670, 7232, 1078, 344, 11999, 562, 3846, 17507, 15, 2635, 359, 1408, 896, 949, 253, 390, 32675, 2584, 8481, 19475, 434, 13 ]
brush, scorched earth, and flowers unknown to me. Four wobbly rocking chairs, two on either side of the door, swayed imperceptibly, but I sat down on the steps and shoved my bare feet into shaded dirt, still cool where it escaped the sun. My eyes wandered along the northern horizon, a mass of foothills and mountains. At least thirty miles away, there was no texture to their slopes. Only hunter green at the lower elevations, denoting evergreen forests, then shattered gray rock, then cloudlike glacier fields that would never melt. Sixty yards off the left side of the porch stood a large shed. It looked hastily built and new, its tin roof and smooth boards of yellow pine glowing in the sinking sun. A chain was wrapped snakelike around the latch that connected the double doors. Tire tracks led straight to the shed. A mile or so beyond, the desert rose several hundred feet to a ridge of rusty bluffs that extended south, sloping gently back to the desert floor. Scraggy junipers lined the top, their jagged silhouettes blackening against the sky. Since dawn, I'd been trying to read Machiavelli in my room. Hot and unable to concentrate on anything except how I might escape, I'd come outside looking for relief in a breeze. But even in the wind, sweat stung my eyes, moistening my skin and hair. Inside, I heard another jazz record — such an eerie sound track to this empty desert, the music so full, effecting thoughts of crowded New York City clubs and people crammed into compact spaces. Normally, I despise crowds and proximity, but now the claustrophobic confines of a raucous nightclub seemed comforting. I sat on the steps for the better part of an hour, watching the desert turn scarlet beneath the sun. My mind blanked, and I became so engrossed in the perpetuation of mindlessness that I started when the front door squeaked open behind me. Orson's boots clunked hollowly against the wood. "Will you be hungry soon?" he asked. The rumble of his scratchy voice caused my stomach to flutter. I couldn't accept that we were together again. His presence still horrified me. "Yes." "I thought I'd grill a couple of steaks," he said, and I could tell he was smiling, hoping I'd be impressed. I wondered if he were trying to make up for nearly killing me. As children, whenever we fought, he'd always try to win me back with gifts, flattery, or, as in this case, food. "You want a drink?" God yes. I turned around and looked up at him. "If you've got it, Jack Daniel's would be nice." He walked back inside and returned with an unopened fifth of that blessed Tennessee whiskey. It was the best moment of my day, like a small piece of home, and my heart leapt. Cracking the black seal, I took a long swill, closing my eyes as the oaken fire burned down my throat. In that second, as the whiskey singed my empty stomach, I could've been on my deck, alone, getting shit-faced in the glory of a Carolina evening. I offered the bottle to Orson, but he declined. He walked around the corner of the cabin and dragged a grill back with him. After lighting the charcoal, he walked inside and returned carrying a plate with two ridiculously thick red filets mignons, salted and peppered. As he stepped past me, he held the plate down and said, "Pour a little of that whiskey on the meat." I drenched them in sour mash, and Orson tossed the tenderloin rounds on the grill, where they flamed for a couple of seconds. He came and sat beside me, and as the fuzziness of the whiskey set in, we listened to the steaks sizzle and watched the sunset redden, like old friends. When the steaks were cooked, we took our plates onto the front porch, where a flimsy table stood on one side. Orson lit two candles with a silver Zippo, and we consumed our dinner in silence. I couldn't help thinking as I sat across from him, You aren't that monster I saw on the desert last night. That is how I sit here without trembling or weeping, because somehow I know that cannot be you. You are just Orson. My brother. My blue-eyed twin. I see you as a boy, a sweet, innocuous boy. Not that thing on the desert. Not that demon. As the last shallow sunbeams retreated below the purple horizon, an ominous feeling took hold of me. The presence of light had afforded me a sense of control, but now, in darkness, I felt defenseless again. For this reason, I hadn't touched the whiskey after my initial buzz, fearing inebriation could be dangerous here. The silence at the table unnerved me, too. We'd been sitting for twenty minutes without a word, but I wasn't going to speak. What would I say to him? Orson had been staring into his plate, but now his eyes fixed on me. He cleared his throat. "Andy," he said. "You remember Mr. Hamby?" I couldn't suppress it. A smile found my lips for the first time in days. "Want me to tell it like you never heard it before?" Orson asked. When I nodded, he leaned forward in his chair, blithe, wide-eyed, a born storyteller. "When we were kids, we'd go several times a year up into the countryside north of Winston-Salem to stay with Grandmom. Granddad was dead, and she liked the company. So how old were we when this happened? Nine maybe? We'll say nine so..." You feel like Orson, and I know, I hope it won't last, but Christ, you feel like my brother in this moment. "And Grandmom's house was next to this apple orchard. Joe Hamby's orchard. He was a widower, so he lived by himself. It was early autumn, and schools and church groups would come for the day to Hamby's orchard to pick apples and pumpkins, and buy cider and take hayrides. "Well, since this orchard backed right up against Grandmom's property, we couldn't resist sneaking over there. We'd steal apples, climb on his tractors, play in the mountains of hay he stored in his barns. But Hamby was a real bastard about trespassers, so we'd have to go at night. We'd wait till Grandmom went to sleep, and we'd sneak out of that creaky farmhouse. "All right, so this one particular October night, we slip outside about nine o'clock and hop the fence into the orchard. I remember the moon's very full, and it's not cold yet, but the crickets and tree frogs are gone, so the night is very still and very quiet. It's near the peak of harvest. Some of the apples have soured, but most are perfect, and we stroll through the orchard, eating these ripened sun-warmed beauties, just having a helluva time. "Now Hamby owned a couple hundred acres, and on the farthest corner of his land, there was this pumpkin patch we'd heard about but never had the balls to go there. Well, this night was one of those nights when we felt invincible. So we reach the end of the orchard and see these big orange pumpkins in the moonlight. Remember, Hamby had won some blue ribbons for his pumpkins at the state fair. He grew these monstrous hundred-pound freaks of nature. "We can see his house a ways up the tractor path, and all the lights are off, so we race each other into the pumpkin patch, our eyes peeled for one of those hundred-pounders. Finally, we collapse in the middle of the patch, laughing, out of breath." Orson smiled. I did, too. We knew what was coming. "Suddenly, just a few yards away, we hear this loud groan: 'I LOVE my orange pussy!' " I guffawed, felt the whiskey burn my sinuses. "Scared us shitless," he said. "We turn and see Mr. Hamby draped over this huge pumpkin the size of one of those Galápagos Island sea turtles. He's got his overalls down around his ankles, and boy he's humping this thing in the moonlight. Just talking up a storm, smacking it like he's smacking a bare ass, and stopping every now and then to take a swig from his jar of peach brandy. "Of course we're mortified, and don't realize he's obliviously drunk. We think he'll see us and chase us if we try to run home, so we lay down in the dirt and wait for him to finish up and go home. Well, eventually he finishes...with that pumpkin, pulls up his overalls, and goes looking for another. The next one's smaller, and after he's bored a hole in it with his auger, he drops to his knees and starts riding this one. We watch him fuck five pumpkins before he passes out dead drunk. Then we run back through the orchard toward Grandmom's,
[ 320, 2104, 281, 42347, 285, 1086, 7430, 253, 941, 2197, 875, 731, 15, 187, 187, 1909, 824, 13, 13001, 13, 9891, 273, 29908, 13498, 13, 4481, 16596, 13, 1569, 10473, 11009, 285, 4481, 4413, 2550, 755, 281, 841, 8169, 15, 4952, 604, 627, 310, 247, 1302, 1340, 10568, 253, 3727, 273, 326, 8692, 15, 187, 187, 1992, 1379, 253, 29908, 1650, 13, 990, 14, 936, 14, 423, 24589, 7362, 1369, 868, 941, 281, 512, 533, 253, 22647, 285, 11452, 15, 496, 1635, 281, 8217, 285, 44891, 2946, 347, 5393, 1840, 13, 1142, 643, 3238, 452, 2879, 990, 14, 936, 14, 423, 24589, 281, 1805, 7895, 253, 11068, 273, 616, 4212, 13, 665, 4831, 352, 15, 3808, 273, 841, 11222, 2486, 27, 187, 187, 44, 518, 8500, 1108, 743, 8164, 29908, 2579, 326, 6131, 1959, 2505, 272, 285, 6789, 15, 11456, 6, 273, 3684, 13247, 21679, 4212, 497, 970, 611, 518, 8500, 347, 273, 4240, 15, 187, 187, 7557, 1108, 329, 6692, 1959, 1935, 622, 323, 10430, 17438, 13, 3888, 13, 10556, 13, 3492, 27691, 285, 9797, 29205, 15, 1583, 4102, 671, 2879, 247, 29182, 6431, 2579, 15, 187, 187, 55, 3604, 48979, 1108, 831, 22785, 14, 3169, 31267, 2579, 6131, 990, 281, 990, 24589, 323, 10924, 347, 973, 347, 323, 9628, 4367, 15, 657, 3604, 310, 48526, 4404, 10459, 285, 24715, 10924, 15, 187, 187, 31889, 1108, 15397, 281, 10243, 13, 253, 22338, 2579, 6131, 1959, 29908, 13, 3966, 15, 285, 310, 16633, 327, 22474, 27549, 13, 3909, 789, 30345, 15, 187, 187, 32136, 13, 657, 3669, 13, 285, 643, 29908, 3238, 15, 187, 187, 1785, 3743, 323, 43916, 990, 281, 990, 24589, 187, 187, 2512, 403, 1264, 2201, 17059, 273, 5052, 281, 444, 19, 5607, 15, 380, 1563, 403, 253, 2022, 7125, 273, 10473, 11009, 285, 13001, 27, 187, 187, 24441, 6338, 971, 247, 1039, 715, 841, 8169, 984, 597, 1928, 352, 310, 3309, 281, 11757, 6617, 285, 19227, 15, 5488, 13, 616, 1859, 310, 326, 616, 3745, 281, 2289, 8169, 310, 625, 1774, 281, 247, 1436, 457, 84, 285, 2586, 457, 84, 3988, 685, 11068, 15, 187, 187, 395, 19227, 15, 5488, 13, 616, 1859, 310, 326, 616, 3745, 281, 2289, 8169, 310, 625, 1774, 281, 247, 1436, 457, 84, 285, 2586, 457, 84, 3988, 685, 11068, 15, 1583, 457, 306, 574, 2289, 281, 8169, 275, 253, 2469, 15, 6102, 347, 342, 3520, 7177, 285, 16530, 15, 1893, 13, 672, 1302, 14, 16586, 13, 4413, 574, 281, 1918, 598, 253, 941, 281, 6338, 15, 3010, 4980, 5657, 403, 3309, 323, 4980, 2069, 13, 597, 1333, 15, 1893, 597, 971, 247, 1039, 281, 4035, 970, 952, 457, 84, 10924, 281, 3819, 6617, 15, 7214, 436, 812, 320, 327, 247, 1199, 4936, 254, 4311, 13, 347, 359, 2319, 1996, 275, 253, 3929, 15, 187, 187, 18869, 347, 342, 3520, 7177, 285, 16530, 15, 1893, 13, 672, 1302, 14, 16586, 13, 4413, 574, 281, 1918, 598, 253, 941, 281, 6338, 15, 3010, 4980, 5657, 403, 3309, 323, 4980, 2069, 13, 597, 1333, 15, 1893, 597, 971, 247, 1039, 281, 4035, 970, 952, 457, 84, 10924, 281, 3819, 6617, 15, 7214, 436, 812, 320, 327, 247, 1199, 4936, 254, 4311, 13, 347, 359, 2319, 1996, 275, 253, 3929, 15, 8853, 8075, 878, 247, 1039, 281, 2289, 253, 8169, 13, 533, 760, 273, 1110, 952, 665, 7703, 281, 5237, 441, 275, 690, 1039, 15, 1292, 253, 4803, 8704, 665, 2289, 265, 752, 403, 1327, 13955, 15, 187, 187, 510, 1273, 16950, 1127, 13, 670, 616, 1907, 2289, 4768, 253, 2892, 273, 10924, 13, 2506, 457, 85, 7356, 15, 4923, 672, 15169, 806, 2210, 327, 253, 6200, 13, 1077, 1652, 273, 247, 1436, 457, 84, 673, 369, 5262, 5015, 327, 253, 4481, 15, 23498, 672, 2429, 281, 849, 1199, 2802, 249, 1436, 457, 5511, 952, 1335, 574, 15, 26197, 969, 672, 16530, 4352, 253, 6200, 15, 5631, 942, 285, 9061, 11346, 2289, 760, 672, 597, 574, 247, 1302, 1340, 15, 187, 187, 6067, 10924, 452, 4391, 187, 187, 1989, 1024, 1841, 403, 1077, 1027, 15, 3771, 1390, 807, 13, 38946, 2361, 326, 11222, 323, 10924, 1957, 253, 10713, 3301, 273, 776, 673, 5262, 327, 6109, 4095, 15, 496, 958, 13, 597, 5998, 326, 952, 5262, 9330, 3041, 3038, 275, 44891, 2946, 3815, 275, 253, 1390, 1264, 2607, 15, 187, 187, 6067, 2862, 1039, 273, 5511, 556, 4391, 15, 1244, 776, 3367, 8169, 1379, 598, 247, 8750, 3894, 685, 776, 275, 14, 10816, 10924, 15, 6975, 352, 390, 417, 13, 776, 1533, 310, 7552, 625, 7336, 14, 3169, 285, 625, 4156, 15, 1893, 417, 760, 403, 359, 2104, 281, 897, 776, 15169, 281, 13791, 13, 533, 253, 2442, 1180, 273, 952, 359, 476, 3935, 310, 32251, 4457, 752, 359, 457, 306, 2455, 7407, 347, 7497, 275, 1524, 1495, 15, 187, 187, 688, 1635, 13, 253, 16122, 14349, 6982, 5678, 342, 253, 3745, 323, 4413, 281, 1287, 4156, 10169, 403, 2403, 5213, 6671, 625, 1846, 15, 733, 457, 84, 417, 816, 3367, 10924, 326, 452, 11371, 275, 3909, 13, 352, 457, 84, 776, 2987, 32328, 1512, 15, 831, 310, 247, 2080, 3501, 432, 247, 2372, 273, 5312, 4579, 272, 390, 19322, 5841, 327, 776, 1711, 14, 2606, 90, 2659, 8737, 15, 187, 187, 2042, 253, 2208, 285, 9061, 497, 281, 452, 2289, 281, 776, 8169, 275, 436, 1388, 285, 2363, 13, 352, 651, 2779, 320, 6425, 281, 1907, 776, 14145, 13, 6629, 13, 2675, 4712, 13, 285, 512, 3367, 13, 4832, 285, 789, 14, 4919, 16072, 762, 13234, 285, 16, 263, 387, 2495, 323, 896, 11806, 38287, 15, 30445, 13, 436, 310, 417, 253, 3646, 273, 247, 1959, 2586, 15, 187, 187, 510, 3237, 342, 43916, 444, 19, 5607, 187, 187, 6080, 2208, 11009, 13, 672, 597, 2312, 273, 43916, 444, 5428, 38, 13, 22175, 3988, 4606, 15, 1292, 643, 6338, 2686, 5583, 352, 285, 897, 352, 275, 616, 1211, 10924, 15, 1583, 671, 2096, 253, 11068, 10502, 15, 1292, 752, 954, 20239, 13980, 12440, 588, 2028, 368, 310, 326, 604, 368, 2794, 247, 896, 3369, 13, 390, 247, 1039, 275, 281, 2289, 253, 8169, 13, 436, 24543, 14779, 10502, 281, 253, 4212, 15, 2053, 10071, 4709, 247, 896, 11806, 812, 2847, 247, 13407, 14855, 326, 812, 39137, 518, 31795, 406, 327, 1943, 13817, 13498, 15, 187, 187, 35, 7526, 990, 14, 936, 14, 423, 24589, 2686, 651, 29614, 3988, 13, 275, 616, 13846, 15, 1893, 1223, 352, 651, 1056, 14006, 390, 1569, 10473, 6830, 6927, 323, 6338, 13, 247, 896, 11806, 651, 671, 1056, 352, 6927, 323, 38287, 285, 47048, 281, 2289, 3055, 941, 15, 8035, 5699, 1895, 651, 320, 387, 14, 16272, 952, 13, 824, 347, 7242, 10349, 285, 3569, 385, 3205, 13, 3692, 2495, 651, 320, 1199, 3687, 943, 2343, 2689, 3841, 320, 3562, 15, 187, 187, 688, 253, 1982, 13, 253, 4487, 273, 8293, 285, 253, 12578, 5194, 326, 1146, 2104, 281, 5834, 25481, 285, 23689, 32180, 21144, 841, 10502, 15, 1292, 643, 11009, 13, 824, 347, 253, 2418, 4487, 285, 253, 4487, 273, 20249, 513, 417, 1900, 5194, 15, 7160, 31460, 310, 326, 5909, 841, 896, 26695, 812, 452, 2201, 5054, 13, 3988, 285, 23949, 9099, 15, 14522, 13, 512, 273, 841, 11009, 452, 247, 4451, 4685, 1955, 281, 253, 34623, 273, 42347, 272, 616, 1211, 7996, 941, 15, 187, 187, 4967, 368, 476, 457, 85, 1663, 8913, 990, 281, 990, 24589, 187, 187, 510, 1524, 8386, 254, 310, 326, 1014, 604, 247, 2208, 6726, 253, 8570, 273, 444, 19, 5607, 432, 44891, 2946, 390, 643, 29908, 11222, 13, 436, 651, 417, 8415, 253, 1895, 273, 25481, 26728, 285, 16, 263, 8785, 562, 17150, 6993, 15, 380, 3694, 323, 17690, 990, 14, 936, 14, 423, 24589, 310, 1527, 2603, 285, 13644, 2130, 15, 187, 187, 8195, 2201, 5691, 3585, 14503, 1475, 11222, 908, 275, 5639, 4343, 15, 1310, 634, 1982, 14, 3169, 31267, 622, 310, 908, 407, 3095, 275, 4135, 13, 651, 359, 1973, 247, 896, 3369, 323, 5628, 6338, 32, 187, 187, 6080, 24715, 9061, 1158, 8217, 285, 6745, 403, 23209, 6153, 3238, 326, 403, 3345, 253, 3986, 273, 253, 1569, 15, 1292, 327, 253, 643, 1133, 13, 841, 13817, 33430, 778, 320, 3365, 5277, 253, 3988, 616, 6383, 971, 285, 1928, 597, 452, 247, 987, 281, 15, 187, 187, 7883, 310, 378, 7526, 444, 19, 5607, 32, 187, 187, 6080, 4343, 403, 13756, 281, 8913, 763, 444, 19, 5607, 281, 6558, 247, 13234, 1375, 15, 4135, 13, 323, 4227, 13, 556, 20374, 44891, 2946, 285, 36000, 23481, 1955, 281, 24589, 15, 6758, 310, 417, 247, 5699, 9326, 15, 329, 3332, 1304, 2210, 562, 5001, 849, 5628, 5680, 17269, 403, 10568, 13975, 24359, 11734, 253, 2586, 281, 6184, 247, 13234, 622, 327, 616, 15169, 15, 38056, 11845, 627, 310, 247, 2647, 273, 2629, 3646, 15, 187, 187, 37881, 556, 671, 12889, 3597, 281, 8913, 23978, 7583, 13, 13940, 1710, 13, 247, 29908, 2579, 326, 4648, 990, 281, 990, 24589, 15, 2091, 326, 1904, 457, 85, 789, 13, 597, 13603, 5559, 285, 643, 4633, 14248, 275, 271, 3434, 281, 1379, 1066, 253, 44355, 622, 15, 11706, 13, 24794, 4035, 281, 4264, 4618, 2289, 281, 13940, 1710, 15, 187, 187, 688, 253, 773, 4924, 668, 1533, 13, 6176, 13, 253, 5591, 13, 285, 253, 1986, 2077, 452, 512, 644, 16585, 247, 8913, 327, 444, 19, 5607, 275, 616, 9056, 4343, 15, 3010, 4102, 13, 253, 2256, 556, 25189, 28619, 342, 247, 44625, 275, 3968, 15, 380, 5286, 310, 1024, 2819, 715, 43916, 990, 281, 990, 24589, 5609, 326, 1234, 293, 1569, 10473, 6338, 432, 24497, 10924, 15, 187, 187, 34, 2714, 1083, 1108, 6976, 187, 187, 28749, 272, 598, 281, 253, 47817, 10393, 273, 990, 14, 936, 14, 423, 24589, 13, 6976, 2168, 574, 5323, 275, 1659, 10568, 13817, 4413, 281, 1918, 689, 253, 5701, 273, 13282, 25481, 15, 496, 4223, 273, 4765, 13, 247, 7482, 6007, 369, 3559, 281, 2430, 247, 42182, 327, 13498, 5277, 990, 281, 990, 24589, 15, 187, 187, 510, 30566, 9353, 10885, 253, 7482, 6007, 9262, 616, 1304, 327, 7659, 608, 394, 15, 3771, 247, 1643, 3618, 1996, 13, 275, 673, 323, 253, 344, 10010, 13319, 2952, 13, 24687, 273, 253, 6007, 457, 84, 26340, 497, 8231, 275, 1340, 281, 755, 253, 6007, 20906, 949, 1078, 807, 990, 15, 2596, 5780, 15129, 2530, 271, 562, 1108, 533, 760, 604, 253, 896, 11806, 2900, 3562, 407, 247, 13817, 2567, 651, 16753, 247, 13407, 14855, 15, 187, 187, 18548, 187, 187, 10195, 13001, 403, 11926, 326, 990, 14, 936, 14, 423, 24589, 588, 6909, 616, 3745, 281, 3819, 6617, 15, 380, 6612, 310, 326, 49613, 327, 247, 2586, 457, 84, 952, 310, 760, 581, 1039, 281, 513, 594, 15, 733, 457, 84, 671, 581, 326, 24543, 697, 1211, 13, 4092, 3988, 10502, 15, 187, 187, 1628, 42, 2868, 253, 2852, 273, 5511, 588, 5333, 281, 3055, 13, 28454, 3238, 835, 952, 476, 320, 13224, 752, 597, 1333, 281, 1016, 643, 19931, 7895, 285, 8169, 285, 2600, 1912, 457, 85, 7356, 1475, 11654, 1425, 1108, 6745, 11731, 4744, 1503, 18141, 4978, 187, 187, 8497, 27, 1707, 403, 690, 3374, 342, 1142, 29908, 11222, 13, 1690, 44891, 2946, 13, 326, 12662, 387, 444, 19, 5607, 417, 1146, 253, 760, 13817, 3309, 281, 12215, 11068, 275, 10924, 15, 2064, 457, 84, 984, 1223, 253, 941, 368, 5007, 3066, 29908, 310, 7895, 13, 634, 8153, 2953, 285, 4481, 1180, 403, 417, 15, 6676, 11222, 5583, 247, 38146, 2579, 984, 273, 436, 1895, 15, 9157, 13, 4212, 4536, 896, 598, 616, 891, 40245, 281, 253, 891, 22740, 13, 534, 557, 2272, 990, 14, 936, 14, 423, 24589, 15, 3074, 11878, 875, 2644, 3904, 6705, 285, 2406, 187, 187, 3074, 11878, 875, 4562, 14, 17465, 3904, 598, 281, 9161, 313, 2405, 14, 17465, 4495, 326, 253, 3904, 3831, 642, 4335, 14, 9133, 2616, 4067, 685, 4562, 10, 187, 187, 41, 1513, 251, 982, 598, 281, 15215, 313, 14382, 2644, 1180, 4272, 407, 253, 8642, 18134, 1612, 273, 374, 10, 187, 187, 3074, 11878, 875, 1903, 14, 17465, 3904, 598, 281, 12842, 187, 187, 3074, 11878, 875, 608, 14, 17465, 3904, 598, 281, 27277, 187, 187, 36, 1695, 24842, 1774, 313, 263, 11076, 1037, 4722, 10, 11878, 824, 347, 253, 5807, 46984, 285, 8462, 394, 356, 37173, 39169, 187, 187, 510, 2829, 310, 2074, 281, 13, 533, 1199, 4864, 254, 685, 13, 326, 1119, 275 ]
be able to encrypt and decrypt the data sent between them. As such, governments, owners of messaging platforms, phone manufacturers, law enforcement agencies and phone companies cannot get to these messages. Even if there is a court order requiring the release of that info. To take the messaging example, end-to-end encryption scrambles data to all but the sender and receiver. In addition to Apple and WhatsApp as mentioned above, many other services have added end-to-end encryption to better secure the privacy of their users, who demand it. Some of these apps include: Kakao – An instant messaging service that offers free texting and calling. 93% of South Korean smartphone users were using Kakao as of 2017. Line – A Japanese freeware app for sending texts, images, videos, video conferences and audio clips. They recently also added a cryptocurrency exchange service. Vega Messenger – This Belgium-based messenger service offers end to end encryption for communications as well as for sharing files. Vega is geared towards corporate and governmental communications. Wire – Similar to Line, the Wire service offers free messaging, etc. and is focuses on enhancing collaborative, online workplaces. Signal, Viber, and other messaging services. Reasons for banning end to end encryption There are three major threads of resistance to E2EE. The following are the main arguments of enforcement agencies and governments: Law officials want a way into these messages because they feel it is necessary to combat crime and terrorism. Furthermore, their view is that their ability to access messages is more important to a person’s and country’s security than privacy. and terrorism. Furthermore, their view is that their ability to access messages is more important to a person’s and country’s security than privacy. They’ve had access to messages in the past. Such as with physical documents and emails. So, when court-ordered, companies had to give up the data to officials. More modern tools are necessary for modern times, they say. So they want a way to continue using people’s communications to fight crime. Only this could be on a much grander scale, as we discuss later in the article. Such as with physical documents and emails. So, when court-ordered, companies had to give up the data to officials. More modern tools are necessary for modern times, they say. So they want a way to continue using people’s communications to fight crime. Only this could be on a much grander scale, as we discuss later in the article. Officials need a way to access the messages, but only of those people who seek to harm us in some way. But the rules surrounding who accesses what are non transparent. The second bullet point, about their having access throughout the history of communications, doesn’t stick. Because when phones first came on the scene, very little of a person’s time was spent talking on the phone. Especially when compared to how much ‘in person’ communication people still had. Same again when emails hit the scene. Governments and authorities enjoyed access only when they had a court order. Our communications have changed But now things are very different. Just last year, Forbes reported that apps for communications represent the bulk load of our time spent on mobile devices. In fact, they estimated that people spent 85 million hours in WhatsApp alone in the last three months. Our entire way of communication has changed. And our personal messages take up a bigger share than our in-person communications. Like it or not, our world is becoming more Internet-based and more global. So not only are we able to use our phones to communicate, but the potential number of people we can message is wildly beyond what we’ve ever experienced as humans in real life. In addition, the expanding gig economy combined with the ability for companies to develop global markets are making international teams more common. It’s not just personal communications that have settled in online, it’s our workspaces too. This is a far cry from a bit of daily emailing or occasional calls on our old-timey landlines. If the government and authorities were to have access to our messages in this day and age, it would likely be equivalent to having our offices, schools, social activities, and all personal, financial and work-related conversations under surveillance and/or at risk for backdoor hackers. Certainly, this is not the policy of a free country. The problems with banning E2EE Some government agencies, when they talk of banning ETEE, emphasize security reasons. But other officials actually recommend it and use it in their own communications. They also understand the privacy risks. But what most cybersecurity professionals will tell you is that if you create a back door, or a way in to access the messages, this poses enormous risks to the users. These experts fear a backdoor could cause a systemic weakness that could wreak havoc on big tech platforms. Banning end-to-end encryption actually would undermine security, in their minds. So while it would make investigations or law enforcement possibly easier for officials, a backdoor would also make it easier for hackers and spies to access private data. Another huge problem would be at-risk people, such as abuse victims and political exiles, whose risk would be much greater should loopholes be created. In the US, the Department of Justice and the FBI agree that being able to catch criminals and terrorists outweighs these risks. But other agencies, such as the State Department and the Department of Commerce do not always agree. Their viewpoint is that opening these backdoors could have major economic, security and diplomatic consequences. Interestingly, all of these agencies have a unique understanding due to the urgency of encrypting their own sensitive data. Why you can’t really ban end to end encryption The real kicker is that even if a government forced the removal of E2EE from WhatsApp or other messaging apps, this would not solve the problem of criminals communicating and/or carrying out terrorist acts. The software for enabling end-to-end encryption is open source and publicly available. Another major challenge revolves around apps used in foreign countries. If your US-based messenger app is used by someone in China, would we build a back door for Chinese officials? Some governmental authorities think Apple and Facebook are intentionally creating services that are outside the reach of the law. But on the other hand, these tech giants may be simply providing the security their customers want and feel they have a right to. Who is Banning E2EE? Some countries are attempting to banish E2EE to maintain a surveillance state. China, for instance, has banned WhatsApp and Snapchat due to encryption. Which is not a huge surprise. A recent report came out regarding how Chinese border guards are requiring visiting tourists entering the country to download a surveillance app on their phones. Surveillance there is a matter of standard policy. Russia has also repeatedly tried to ban crypto favorite, Telegram, a messaging service that uses end to end encryption. When that didn’t work, they disabled Google and other popular websites in an effort to take down the rogue app. Still, Russians continue to enjoy wide access to Telegram. In the “free” world, Germany, the UK, and the United States have all been discussing a ban on E2EE in their respective countries. More recently, the subject has resurfaced with a vengeance in America. The administration is now looking into banning end to end encryption techniques that repel law enforcement officials from accessing communications. A special case – Australia Leading up to the commonplace usage of end-to-end encryption, Australia already had laws in place requiring tech companies to give over the comments of suspected criminals. In August of 2018, a draft bill was presented to require a workaround on platforms providing end to end encryption. The parliamentary committee handling the draft bill submitted their report on Dec 5th. Just a few weeks later, in time for the hectic holiday season, 173 of the bill’s amendments were dropped in order to get the bill rushed through before year end. One remaining amendment provided an out – but only if the backdoor solution created by a tech company would pose a systemic weakness. Summary Many governments are worried that end-to-end encryption will destroy their ability to fight crime. The reality is that spying on a country’s people is only one way to do so. It’s also one that poses its own, serious security risks. “I believe the future of communication will shift to private, encrypted services where people can be confident what they say to each other stays secure and messages and content won’t stick around forever.” – Facebook CEO Mark Zuckerberg Note: There are some issues with many messaging apps, including WhatsApp, that hint at E2EE not being the only tech necessary to guarantee privacy in communications. That’s because while the data you send via messaging is secure, your IP address and phone number are not. Many apps recommend a VPN service because of this problem. Additionally, users sometimes back up their iMessages to the iCloud, which disables end-to-end encryption.All ratios between whole numbers 64 and lower All ratios between 31-limit numbers up to 96 (31-limit meaning that the numbers contain no prime-number factors larger than 31) Harmonics up to 255 (each whole number divided by the closest inferior power of 2) All ratios between 11-limit numbers up to 128 All ratios between 5-limit numbers up to 1024 Certain historically important (or mathematically interesting) ratios such as the schisma and Pythagorean comma The table is similar to, but much briefer than, that found in
[ 8096, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2031, 27, 883, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 51, 1671, 58, 67, 38, 3, 187, 1092, 187, 3, 11455, 6302, 805, 3121, 25805, 31110, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 20326, 161, 235, 238, 46049, 16127, 116, 18617, 97, 6238, 46239, 33474, 6765, 243, 42951, 14274, 29297, 47961, 17492, 1490, 8634, 22719, 187, 3, 7893, 6302, 91, 19766, 48, 59, 26, 3079, 82, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2031, 27, 2125, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 938, 29288, 24133, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 2795, 22, 3757, 17, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3079, 27, 1449, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 38379, 39, 19, 84, 44199, 71, 3, 187, 1092, 187, 3, 11455, 6302, 87, 25, 22313, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 2795, 22, 72, 42574, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3079, 27, 1449, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 38379, 40, 1102, 84, 50, 3, 187, 1092, 187, 3, 11455, 6302, 14889, 41988, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 48, 360, 39, 22, 77, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 1235, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 55, 8484, 75, 5367, 3, 187, 1092, 187, 3, 11455, 6302, 16129, 1438, 33868, 1857, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 21275, 20326, 7056, 237, 18617, 235, 18764, 14274, 32165, 33656, 98, 209, 14274, 13127, 243, 33656, 98, 209, 14274, 11016, 243, 33656, 98, 26680, 995, 187, 3, 7893, 6302, 91, 19766, 48, 25192, 14220, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 2385, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 85, 757, 4011, 2981, 606, 19702, 80, 995, 187, 3, 5598, 6302, 91, 19766, 47, 27074, 18, 70, 40, 995, 187, 3, 1156, 6302, 39673, 24370, 12105, 20622, 43929, 30676, 221, 18780, 15367, 9078, 235, 16877, 20326, 41873, 22305, 113, 164, 242, 119, 17492, 18617, 97, 995, 187, 3, 7893, 6302, 91, 19766, 48, 7675, 40, 81, 43, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 1229, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 38379, 19, 15061, 302, 36, 3, 187, 1092, 187, 3, 11455, 6302, 18043, 8498, 1154, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 20833, 219, 20833, 219, 4340, 4340, 995, 187, 3, 7893, 6302, 91, 19766, 4527, 29370, 43, 50, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 1010, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 25837, 24, 47, 87, 51, 20, 49, 3, 187, 1092, 187, 3, 11455, 6302, 17984, 2357, 2945, 25953, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 48, 70, 1370, 29035, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 805, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 23829, 26221, 16742, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 20833, 219, 20833, 219, 537, 164, 224, 220, 14670, 100, 165, 104, 107, 4340, 22985, 238, 15957, 218, 20833, 100, 6765, 237, 12811, 215, 14486, 121, 24446, 995, 187, 3, 7893, 6302, 91, 19766, 48, 25, 832, 36, 87, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3156, 27, 3680, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 805, 1012, 3121, 1610, 3677, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 60, 13258, 229, 7082, 13258, 229, 7082, 13258, 229, 44082, 187, 3, 7893, 6302, 91, 19766, 10189, 1405, 20, 82, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3156, 27, 1093, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 17306, 1036, 4196, 17490, 995, 187, 3, 5598, 6302, 91, 19766, 45, 13511, 24, 81, 51, 995, 187, 3, 1156, 6302, 12755, 236, 27107, 217, 13744, 122, 7056, 216, 35601, 50037, 35601, 48153, 108, 17492, 995, 187, 3, 7893, 6302, 91, 19766, 47, 90, 1343, 21, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 1237, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 938, 25025, 2031, 2537, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 30903, 29268, 102, 37215, 228, 43244, 4340, 995, 187, 3, 7893, 6302, 91, 19766, 47, 6147, 82, 41, 73, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 2405, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 72, 1686, 266, 995, 187, 3, 5598, 45281, 187, 3, 1156, 6302, 39673, 24370, 25434, 43873, 6238, 19780, 120, 43741, 49288, 23371, 26680, 995, 187, 3, 7893, 6302, 91, 19766, 47, 30930, 45, 91, 59, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 1047, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 21378, 2504, 23580, 3677, 995, 187, 3, 5598, 45281, 187, 3, 1156, 6302, 20647, 220, 6916, 113, 30676, 221, 995, 187, 3, 7893, 6302, 91, 19766, 47, 83, 25, 67, 24, 85, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 1036, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 22000, 24257, 740, 1610, 995, 187, 3, 5598, 45281, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 47, 82, 70, 18601, 36, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 805, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 38045, 571, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 14274, 7249, 105, 43251, 4340, 20622, 35724, 20287, 18245, 213, 6238, 17559, 212, 165, 107, 122, 17492, 995, 187, 3, 7893, 6302, 91, 19766, 47, 262, 57, 15656, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1867, 27, 2417, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 50, 77, 6159, 82, 44, 3, 187, 1092, 187, 3, 11455, 6302, 2484, 81, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 38242, 42025, 111, 34397, 37062, 21275, 15957, 218, 48561, 12105, 6916, 113, 14486, 121, 13484, 4340, 995, 187, 3, 7893, 6302, 91, 19766, 47, 21448, 56, 9042, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1867, 27, 2385, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 48, 7675, 40, 81, 43, 3, 187, 1092, 187, 3, 11455, 6302, 18359, 12971, 1099, 2125, 995, 187, 3, 5598, 6302, 91, 19766, 45, 26576, 39, 7096, 995, 187, 3, 1156, 6302, 22985, 226, 16998, 229, 1166, 9180, 26680, 26680, 12105, 9180, 26680, 26680, 26680, 995, 187, 3, 7893, 6302, 91, 19766, 47, 27074, 18, 70, 40, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1867, 27, 1867, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 18787, 72, 5993, 79, 3, 187, 1092, 187, 3, 11455, 6302, 740, 1967, 4148, 2358, 1610, 995, 187, 3, 5598, 45281, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 6784, 19, 89, 73, 50, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 1235, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 20785, 2358, 15468, 1976, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 5288, 13924, 89, 25, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 1797, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 1200, 538, 6002, 5582, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 46, 1779, 72, 59, 71, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 1047, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 4351, 7083, 531, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 32165, 43136, 37079, 14274, 29533, 995, 187, 3, 7893, 6302, 91, 19766, 3788, 580, 50, 81, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 2693, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 1166, 2358, 4196, 1012, 3655, 995, 187, 3, 5598, 45281, 187, 3, 1156, 6302, 9, 23215, 64, 23215, 22719, 187, 3, 7893, 6302, 91, 19766, 31425, 34, 2251, 79, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1787, 27, 2417, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 25837, 26, 59, 7864, 23398, 995, 187, 3, 91, 25837, 24, 82, 25, 42092, 75, 995, 187, 3, 91, 38379, 33759, 335, 45, 76, 995, 187, 3, 91, 38379, 44942, 351, 1288, 995, 187, 3, 91, 38379, 45, 72, 23, 1190, 39, 995, 187, 3, 91, 38379, 44, 83, 9780, 20, 51, 995, 187, 3, 91, 38379, 40, 18835, 82, 1440, 995, 187, 3, 91, 38379, 39, 85, 38, 23, 41, 21, 995, 187, 3, 91, 38379, 36, 338, 46, 85, 55, 995, 187, 3, 91, 38379, 8712, 18, 82, 90, 995, 187, 3, 91, 71, 6584, 23976, 39, 78, 22, 995, 187, 3, 91, 38379, 73, 50, 14942, 70, 43, 995, 187, 3, 91, 38379, 44734, 25, 84, 24274, 995, 187, 3, 91, 38379, 71, 2945, 66, 9803, 995, 187, 3, 91, 71, 6156, 25, 86, 58, 59, 52, 995, 187, 3, 91, 38379, 25, 41317, 51, 75, 71, 995, 187, 3, 91, 38379, 24, 8962, 90, 56, 90, 995, 187, 3, 91, 38379, 23, 314, 46, 4604, 995, 187, 3, 91, 38379, 22, 82, 2906, 19, 71, 995, 187, 3, 91, 38379, 22, 22947, 38450, 995, 187, 3, 91, 38379, 17, 38, 3348, 26, 70, 995, 187, 3, 91, 38379, 361, 73, 54, 70, 52, 995, 187, 3, 91, 19766, 59, 55, 4297, 46, 20, 995, 187, 3, 91, 19766, 59, 89, 76, 13816, 46, 995, 187, 3, 91, 19766, 31576, 76, 91, 35, 76, 995, 187, 3, 91, 19766, 57, 47, 68, 1099, 88, 995, 187, 3, 91, 19766, 16594, 5229, 75, 43, 995, 187, 3, 91, 19766, 31775, 24, 80, 3351, 995, 187, 3, 91, 19766, 55, 2385, 46, 5985, 995, 187, 3, 91, 19766, 55, 2941, 38, 80, 49, 995, 187, 3, 91, 19766, 38450, 23, 18591, 23, 995, 187, 3, 91, 19766, 5683, 24, 59, 37675, 995, 187, 3, 91, 19766, 54, 67, 46594, 75, 56, 995, 187, 3, 91, 19766, 45335, 7675, 37514, 995, 187, 3, 91, 19766, 53, 2809, 66, 15332, 995, 187, 3, 91, 19766, 53, 26, 78, 22, 89, 87, 995, 187, 3, 91, 19766, 3528, 88, 41, 3271, 995, 187, 3, 91, 19766, 52, 89, 35333, 18469, 995, 187, 3, 91, 19766, 51, 59, 73, 59, 6721, 995, 187, 3, 91, 19766, 51, 9324, 81, 38, 72, 995 ]
Am", "date":"2013-01-21 15:44:11" }, { "kids":[ "zfuR35YbE" ], "uid":"1276608382", "parent":"zfuMcvUn2", "text":"为嘛没收呢,直接删除不就完了(-.-)", "mid":"zfuOZ943q", "date":"2013-01-21 15:44:04" }, { "kids":[], "uid":"208060009", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOP5gn0", "date":"2013-01-21 15:43:40" }, { "kids":[ "zfvF2sXSf" ], "uid":"v8266", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOP5gkB", "date":"2013-01-21 15:43:40" }, { "kids":[ "zfvGrolsQ" ], "uid":"boyanking", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOumF5l", "date":"2013-01-21 15:42:50" }, { "kids":[ "zfuVUsjpo" ], "uid":"1908089845", "parent":"zfuMcvUn2", "text":"作为党员要不信谣 不传谣 不造谣!", "mid":"zfuOtbOVA", "date":"2013-01-21 15:42:48" }, { "kids":[], "uid":"tianranxiangliao", "parent":"zfuNcj1eG", "text":"原来是这样啊……我还以为被河蟹了呢", "mid":"zfuOluGpJ", "date":"2013-01-21 15:42:30" }, { "kids":[ "zfv2NaotC" ], "uid":"jackvincent", "parent":"zfuMcvUn2", "text":"哈哈。。", "mid":"zfuOfiqJQ", "date":"2013-01-21 15:42:15" }, { "kids":[ "zfw7NvR3P" ], "uid":"2647742647", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOeazvp", "date":"2013-01-21 15:42:12" }, { "kids":[], "uid":"337398999", "parent":"zfuMcvUn2", "text":"哈哈..草泥马。毛片哥刚弄死他", "mid":"zfuO8efCv", "date":"2013-01-21 15:41:58" }, { "kids":[], "uid":"1213763371", "parent":"zfuMcvUn2", "text":"[怒][怒][怒]", "mid":"zfuNRme3q", "date":"2013-01-21 15:41:18" }, { "kids":[], "uid":"1871696203", "parent":"zfuLoj7pR", "text":"给领导充公交公粮了", "mid":"zfuNytil4", "date":"2013-01-21 15:40:32" }, { "kids":[], "uid":"206784449", "parent":"zfuMcvUn2", "text":"高级黑么。", "mid":"zfuNyrqHh", "date":"2013-01-21 15:40:31" }, { "kids":[], "uid":"gmlan", "parent":"", "text":"原来如此,顺求种子!", "mid":"zfuNrnLzZ", "date":"2013-01-21 15:40:14" }, { "kids":[], "uid":"2384731571", "parent":"", "text":"厉害啊", "mid":"zfuNr8b7t", "date":"2013-01-21 15:40:16" }, { "kids":[], "uid":"3093341033", "parent":"", "text":"", "mid":"zfuNqeVRC", "date":"2013-01-21 15:40:12" }, { "kids":[], "uid":"ningsia", "parent":"zfuMcvUn2", "text":"不太可能。这也能挂,见鬼了", "mid":"zfuNitXpb", "date":"2013-01-21 15:39:55" }, { "kids":[ "zfuQlBIqK" ], "uid":"whp", "parent":"zfuMcvUn2", "text":"看爱情动作片真是害死人。", "mid":"zfuNfxWDM", "date":"2013-01-21 15:39:48" }, { "kids":[ "zfuOluGpJ" ], "uid":"1891062504", "parent":"zfuLbhFxe", "text":"每秒17MB!!是MB!!!", "mid":"zfuNcj1eG", "date":"2013-01-21 15:39:39" }, { "kids":[ "zfuQRgBLn" ], "uid":"1070976833", "parent":"", "text":"", "mid":"zfuMR2xhQ", "date":"2013-01-21 15:38:50" }, { "kids":[], "uid":"2276813475", "parent":"zfuMcvUn2", "text":"", "mid":"zfuMEAhx8", "date":"2013-01-21 15:38:21" }, { "kids":[], "uid":"shubozhan", "parent":"zfuMcvUn2", "text":"", "mid":"zfuMChgZf", "date":"2013-01-21 15:38:14" }, { "kids":[], "uid":"kingcrone", "parent":"zfuMcvUn2", "text":"信息量不小", "mid":"zfuMAavQp", "date":"2013-01-21 15:38:09" }, { "kids":[], "uid":"1768961373", "parent":"", "text":"(¬_¬)", "mid":"zfuMuA67n", "date":"2013-01-21 15:37:55" }, { "kids":[ "zfw9ZFSWC", "zfw7q8EGj", "zfvUUulLk", "zfvTKodbr", "zfvLg6ylF", "zfvKrAK3R", "zfvGmkqtt", "zfvFtE6H4", "zfvCifMtV", "zfvnut1qy", "zfviTiFm5", "zfvhQAXeJ", "zfvhk8sRs", "zfvf42aLD", "zfva8uYZS", "zfv8qsRjf", "zfv7uvyWy", "zfv6lyMFr", "zfv5qAr2f", "zfv5octUH", "zfv0Eae9e", "zfv00hUeS", "zfuZVguM3", "zfuZxkhwM", "zfuXRkzBk", "zfuXNc25w", "zfuWTCtjJ", "zfuVa7oIm", "zfuV48Mki", "zfuV03EoP", "zfuUH6UG6", "zfuUp7ZTu", "zfuUbvgjW", "zfuTUluKD", "zfuTShaPN", "zfuT9m5xv", "zfuSSwHOL", "zfuSxgdHI", "zfuRZhZDL", "zfuROBpEg",
[ 3625, 6273, 13, 285, 5419, 6419, 1110, 326, 2965, 2708, 352, 15, 844, 2550, 7848, 323, 776, 3625, 6273, 281, 2965, 1199, 2007, 13, 285, 359, 2550, 7848, 667, 625, 288, 8165, 562, 273, 776, 22531, 285, 14199, 2613, 15, 544, 1628, 1466, 457, 84, 11075, 253, 5706, 7305, 7521, 275, 8302, 13, 5403, 27, 7266, 15, 25597, 14, 740, 62, 187, 187, 2042, 253, 33315, 971, 281, 1663, 4352, 253, 6589, 49, 9550, 13, 597, 943, 564, 323, 697, 8083, 2613, 15, 380, 6115, 7021, 310, 10693, 1024, 2326, 347, 247, 2444, 966, 3128, 13, 533, 604, 352, 11359, 2403, 253, 3434, 13, 627, 310, 247, 4839, 352, 812, 320, 15, 187, 187, 1552, 310, 247, 29837, 1501, 13, 326, 1057, 271, 14331, 2408, 275, 247, 3710, 2317, 15, 1707, 457, 84, 247, 2257, 281, 1333, 275, 2380, 281, 352, 15, 9859, 1841, 806, 27, 187, 187, 510, 33315, 13, 323, 512, 619, 9436, 281, 731, 13, 403, 417, 4092, 670, 2509, 2712, 15, 1737, 368, 452, 281, 1333, 1060, 8146, 684, 27, 309, 1158, 253, 33315, 327, 6132, 1388, 285, 2360, 13, 1690, 4266, 13, 497, 27393, 1574, 2820, 281, 755, 8314, 273, 15197, 1223, 671, 17808, 271, 2983, 327, 416, 7937, 432, 253, 1669, 15, 9543, 2208, 943, 320, 247, 1805, 673, 281, 320, 247, 6115, 13, 342, 253, 2303, 30909, 13, 3738, 309, 457, 306, 2326, 275, 253, 5591, 849, 253, 36819, 30743, 70, 22493, 310, 2217, 281, 1978, 952, 432, 20362, 15702, 512, 14, 483, 15, 380, 33315, 403, 417, 4092, 670, 2712, 13, 533, 10922, 562, 281, 253, 21324, 651, 1646, 281, 320, 253, 4569, 1659, 281, 564, 15, 187, 187, 510, 1669, 1060, 310, 2030, 6, 273, 253, 46866, 1108, 4931, 7652, 6, 604, 21323, 21450, 13, 9543, 457, 84, 391, 1765, 767, 14, 14824, 14, 11499, 13004, 15, 380, 33315, 403, 10960, 275, 253, 2030, 6, 391, 1765, 13, 285, 812, 4217, 314, 1265, 4886, 715, 253, 1283, 6, 273, 1669, 3872, 2531, 11750, 10787, 15, 4683, 2282, 13, 352, 457, 84, 634, 1327, 14, 2132, 3872, 2531, 11750, 10787, 665, 7617, 12337, 13, 285, 597, 457, 250, 253, 4394, 665, 457, 306, 10544, 416, 7937, 13, 4518, 984, 597, 871, 326, 7733, 18697, 1271, 310, 642, 1175, 323, 731, 15, 187, 187, 6892, 398, 4744, 15, 309, 457, 306, 574, 253, 1072, 2793, 273, 247, 8034, 19500, 15702, 2208, 275, 40986, 342, 23442, 15319, 1162, 355, 15, 1284, 368, 1333, 342, 253, 5591, 253, 2538, 327, 253, 1669, 403, 23851, 15, 309, 13937, 253, 13024, 273, 253, 15319, 2208, 651, 17614, 3878, 253, 29254, 273, 1110, 2007, 1669, 13, 342, 253, 16277, 10319, 8038, 15, 1292, 352, 1904, 457, 85, 5108, 15, 3512, 314, 984, 253, 1669, 5621, 497, 820, 14, 2178, 264, 407, 20706, 313, 783, 25575, 985, 2789, 247, 3064, 10, 285, 13730, 984, 253, 20958, 1108, 2378, 247, 1524, 2675, 18545, 3490, 30587, 313, 18399, 314, 10, 275, 253, 1384, 84, 1108, 3898, 7459, 846, 4005, 1903, 6585, 13, 342, 253, 9550, 13438, 272, 253, 2613, 15, 187, 187, 4041, 3064, 326, 309, 923, 1060, 310, 247, 10046, 285, 625, 4138, 422, 8083, 4866, 285, 697, 5547, 4544, 1411, 7733, 18697, 1271, 15, 18770, 273, 253, 9550, 273, 326, 4544, 556, 642, 1600, 275, 6153, 7596, 323, 253, 6589, 49, 15, 1292, 690, 273, 352, 27364, 1057, 13, 285, 627, 310, 1524, 31970, 36106, 2190, 253, 2613, 326, 812, 320, 820, 991, 264, 715, 10266, 1677, 690, 2317, 15, 1244, 352, 1663, 310, 247, 1943, 2613, 13, 4931, 253, 5962, 10020, 14, 7397, 1701, 3569, 2280, 275, 9943, 5948, 15, 187, 187, 25263, 13, 253, 5054, 4112, 310, 2779, 281, 1691, 253, 9543, 2208, 275, 247, 10458, 1899, 13, 835, 597, 588, 320, 2820, 281, 21547, 46270, 16610, 3116, 15, 187, 187, 4041, 2181, 309, 3078, 281, 1691, 275, 253, 1501, 533, 1904, 457, 85, 369, 326, 253, 11442, 36943, 11492, 12758, 281, 320, 1529, 2234, 2523, 323, 253, 33315, 1108, 352, 778, 417, 320, 247, 6273, 13688, 533, 3095, 3198, 281, 1978, 352, 327, 253, 15990, 15, 187, 187, 42, 1053, 457, 85, 923, 667, 3524, 275, 253, 21324, 387, 1246, 13, 347, 1048, 347, 253, 21318, 54, 4558, 12331, 281, 253, 6589, 49, 15, 1310, 368, 971, 281, 923, 1633, 2740, 562, 13, 368, 452, 281, 1007, 281, 253, 1917, 272, 273, 8083, 16027, 281, 3569, 4676, 1108, 1007, 387, 253, 313, 21258, 10, 330, 9334, 1580, 352, 9377, 598, 342, 253, 5578, 39, 313, 395, 840, 1007, 387, 253, 5578, 39, 25246, 187, 187, 2374, 436, 1818, 273, 12315, 2181, 13, 835, 513, 359, 755, 776, 3282, 273, 253, 2802, 25736, 12315, 457, 32, 380, 1818, 273, 12315, 310, 1663, 275, 253, 3420, 13, 285, 352, 457, 84, 644, 816, 670, 36385, 494, 326, 253, 3420, 1694, 3212, 416, 7937, 15, 2948, 551, 21626, 748, 432, 37994, 29987, 2955, 5726, 16, 13382, 885, 14, 3062, 8, 187, 187, 15035, 20605, 1159, 47327, 9, 9993, 6854, 27, 6734, 3001, 32949, 29, 1279, 9983, 47327, 27555, 426, 337, 10, 551, 187, 50276, 1059, 2069, 426, 47327, 27555, 559, 337, 187, 50276, 6050, 313, 3181, 283, 10, 551, 187, 50274, 14626, 551, 187, 50272, 2309, 14303, 3244, 6854, 1082, 187, 50274, 94, 5834, 313, 70, 10, 551, 187, 50272, 1403, 1942, 21626, 9, 9138, 10, 187, 50274, 94, 187, 50276, 94, 187, 50276, 22452, 15, 3775, 2073, 5064, 17636, 22639, 3401, 187, 94, 187, 31900, 28852, 1780, 1120, 264, 13, 36355, 264, 1198, 380, 649, 708, 20593, 2705, 4683, 15347, 187, 187, 49762, 265, 13, 8319, 13, 819, 1487, 2994, 327, 8958, 849, 281, 1408, 247, 4633, 2360, 34583, 13, 28335, 272, 281, 1384, 14, 285, 1884, 14, 34355, 678, 723, 2819, 323, 253, 6323, 773, 262, 668, 6308, 15, 3032, 20820, 3797, 2469, 4633, 15202, 13, 824, 347, 4687, 33892, 285, 10540, 13, 285, 521, 1655, 18767, 13, 253, 4913, 387, 39056, 13, 275, 17207, 5041, 15, 187, 187, 1989, 327, 3821, 15, 4562, 13, 344, 369, 9833, 285, 5262, 625, 685, 1903, 3038, 275, 247, 399, 15, 36, 15, 894, 6172, 13, 6636, 342, 39889, 1273, 14, 14577, 19610, 285, 12536, 273, 2867, 323, 1633, 344, 753, 344, 1057, 11719, 27, 38509, 839, 15223, 1548, 6787, 390, 667, 8137, 3731, 3197, 407, 762, 486, 38412, 281, 4901, 521, 5453, 15, 187, 187, 7130, 281, 399, 15, 36, 15, 21112, 2111, 7177, 13, 816, 846, 21811, 327, 3747, 15, 884, 13, 28852, 285, 521, 3988, 4750, 1694, 715, 247, 31233, 342, 247, 3323, 386, 628, 3416, 689, 617, 8137, 15, 380, 3416, 13, 8927, 432, 15562, 571, 13, 753, 326, 28852, 285, 521, 4750, 38509, 456, 617, 15562, 757, 6254, 457, 84, 7981, 285, 12913, 9659, 13, 3981, 597, 497, 15223, 15, 23264, 1996, 13, 2556, 281, 253, 1302, 7177, 13, 672, 253, 3416, 4895, 281, 253, 5453, 281, 19553, 253, 7177, 13, 271, 8183, 2183, 617, 326, 597, 574, 644, 46314, 15, 187, 187, 1989, 28852, 13, 665, 17587, 521, 6171, 370, 740, 323, 1046, 15223, 8137, 597, 19553, 13, 753, 326, 253, 3416, 3534, 617, 8137, 326, 7237, 281, 271, 762, 486, 3331, 665, 574, 11704, 617, 281, 253, 5453, 285, 326, 253, 7437, 273, 8137, 497, 38509, 456, 432, 253, 3331, 984, 597, 497, 1146, 3731, 3197, 15, 187, 187, 1628, 42, 369, 12623, 598, 984, 703, 7730, 247, 6617, 1806, 28852, 2296, 15, 773, 1552, 310, 11339, 1425, 187, 187, 49762, 265, 556, 2489, 28027, 386, 670, 33118, 1066, 327, 762, 486, 5484, 398, 15, 496, 6752, 13, 344, 369, 44861, 370, 19, 13, 933, 407, 253, 2846, 285, 1996, 23460, 407, 253, 2021, 273, 247, 530, 15, 52, 15, 4913, 9651, 5908, 665, 369, 5339, 672, 247, 1384, 14, 2913, 14, 744, 3416, 1694, 715, 617, 1113, 285, 4352, 779, 846, 1907, 2067, 17208, 387, 20909, 275, 40996, 5041, 15, 6067, 22368, 187, 187, 510, 22368, 273, 253, 6516, 310, 281, 2085, 271, 3907, 12209, 323, 1110, 665, 20141, 281, 1239, 13, 1158, 13, 3984, 13, 285, 3630, 275, 1340, 281, 7170, 253, 5702, 13, 17541, 13, 285, 8249, 4685, 273, 6150, 1612, 285, 643, 3374, 4619, 281, 3872, 5684, 15, 187, 187, 34, 13773, 4965, 282, 273, 36931, 187, 187, 510, 38757, 8881, 689, 253, 2442, 1659, 273, 1327, 47745, 26547, 1100, 275, 253, 530, 15, 52, 15, 13669, 4102, 369, 7416, 407, 247, 4667, 273, 11543, 5014, 27, 22694, 4782, 17264, 15435, 17453, 285, 10043, 13669, 28244, 27504, 9002, 1034, 15, 187, 187, 45840, 17453, 13, 2488, 273, 2067, 5098, 327, 11080, 29252, 12074, 13, 5966, 253, 8881, 342, 521, 816, 14, 15855, 4460, 49608, 5432, 6550, 313, 13804, 468, 44704, 13, 8210, 481, 3032, 7015, 31149, 327, 253, 1984, 369, 28244, 9011, 2516, 313, 52, 13183, 10, 9002, 1034, 13, 665, 369, 253, 25186, 3490, 17747, 1309, 253, 13563, 50106, 6056, 50072, 15, 17453, 3786, 574, 49586, 342, 28244, 9002, 1034, 327, 253, 7599, 7411, 434, 16383, 285, 4122, 32339, 2395, 273, 253, 50106, 6056, 4544, 13, 2596, 35942, 23264, 313, 14749, 267, 6516, 5687, 13, 9748, 481, 187, 187, 688, 2596, 35942, 23264, 13, 253, 767, 14588, 849, 13, 247, 1643, 3618, 1078, 253, 50106, 6056, 50072, 13, 36174, 247, 3490, 273, 581, 22822, 6909, 254, 13, 1264, 48232, 684, 13, 285, 1264, 18500, 10992, 3093, 3927, 13, 253, 7599, 7411, 346, 84, 1164, 3, 253, 530, 15, 52, 15, 10289, 3094, 267, 11936, 313, 8887, 14, 3079, 10, 1309, 271, 5763, 275, 253, 49185, 11936, 15, 380, 10289, 13, 273, 2282, 13, 574, 690, 5571, 9954, 327, 4450, 15, 7214, 9002, 1034, 434, 6909, 254, 39230, 13, 253, 4051, 312, 7397, 13, 12360, 342, 1740, 1889, 406, 1507, 342, 247, 2491, 273, 1384, 6574, 13, 812, 8513, 253, 10289, 15, 187, 187, 14067, 17193, 2448, 6031, 281, 19912, 285, 346, 84, 750, 3, 521, 11811, 13, 28244, 9002, 1034, 369, 2104, 281, 2810, 281, 1561, 1903, 6574, 273, 253, 3094, 267, 11936, 281, 26065, 14954, 521, 1889, 406, 1507, 285, 6909, 253, 10289, 15, 754, 1996, 651, 3630, 27, 187, 187, 17756, 13, 9563, 253, 9447, 273, 436, 17005, 13, 1379, 17458, 943, 368, 2455, 1089, 4834, 347, 247, 6680, 1387, 17747, 275, 841, 5989, 13, 984, 352, 310, 9648, 2779, 326, 275, 3076, 8588, 13, 368, 651, 7168, 253, 6680, 15, 831, 310, 3340, 2032, 1411, 247, 1663, 3413, 2983, 275, 534, 253, 9054, 310, 5480, 281, 7168, 2067, 11811, 275, 1340, 281, 16338, 634, 10289, 14, 4609, 344, 943, 1900, 320, 13, 984, 672, 253, 10289, 4566, 634, 2329, 3490, 285, 1077, 2779, 634, 2862, 4544, 564, 342, 352, 15, 187, 187, 4125, 13, 1458, 1107, 846, 253, 50106, 6056, 13, 2305, 15, 17453, 285, 28244, 9002, 1034, 6983, 253, 3094, 267, 11936, 2362, 275, 616, 4460, 15, 1292, 275, 49608, 5432, 6550, 13, 253, 530, 15, 52, 15, 2221, 48789, 7195, 19759, 310, 13964, 407, 247, 611, 23353, 14, 881, 35898, 14, 395, 37023, 275, 247, 6069, 18864, 15, 380, 2983, 3936, 1659, 275, 6752, 13, 347, 253, 6680, 1387, 7274, 253, 530, 15, 52, 15, 2613, 387, 14912, 26424, 15, 380, 1903, 5385, 34768, 13, 6909, 398, 13, 48232, 684, 13, 285, 2983, 26547, 1100, 326, 403, 9273, 253, 7195, 19759, 1891, 281, 2736, 253, 28628, 14, 34502, 749, 15, 187, 187, 28326, 670, 253, 4460, 13, 28244, 9002, 1034, 21198, 326, 346, 2520, 310, 417, 247, 10554, 273, 253, 2852, 449, 13771, 13, 344, 1925, 352, 247, 346, 36730, 964, 964, 964, 247, 9734, 449, 187, 187, 4553, 16585, 253, 12474, 285, 253, 4815, 273, 9954, 15495, 273, 253, 49608, 5432, 313, 8887, 47, 14, 2358, 10, 966, 13, 253, 7599, 7411, 9713, 253, 35898, 2523, 15, 754, 4469, 14938, 326, 253, 530, 15, 52, 15, 285, 4782, 35898, 5621, 574, 2489, 512, 14, 47745, 285, 5544, 521, 767, 4606, 323, 14707, 281, 923, 1327, 47745, 19750, 275, 1097, 6563, 447, 27, 187, 187, 5623, 4175, 460, 2105, 14, 66, 4980, 13575, 44, 13, 344, 5544, 13, 4815, 581, 14, 19016, 281, 581, 14, 25512, 394, 347, 1199, 347, 247, 6069, 2983, 35898, 187, 187, 12412, 14, 16272, 35898, 5871, 14, 968, 73, 410, 13234, 28, 6498, 275, 20126, 13, 278, 967, 12685, 28, 15165, 6083, 28, 285, 643, 4712, 672, 581, 943, 2495, 247, 4577, 13, 20182, 13575, 44, 2581 ]
primary vote, and punishes those that fall below it. We cannot afford for our primary vote to fall much further, and we cannot afford any more hollowing out of our activist and membership base. [“Let’s Start the Attacks”, in Jones, 2006: pp. 209-10] If the Greens want to really hit the ALP leadership, they should go for its union base. The Green Party is hardly now seen as a working class party, but if it keeps making the effort, there is a chance it could be. This is a superb post, that does an incredible amount in a limited space. There’s a lot to say in response to it. Last things first: The Greens, for all my conversion to them, are not serious about doing anything. What you have to say here resonates: I think the Greens on election day and night, including myself, were inconsistently trying to get rid of Howard while also mounting an attack on Rudd from the left. Labor government should be a better time to be a Green, with the target clearer, although I’ve seen in the UK how the Tory bogeyman is enough to keep people from attacking Labour all-out. The Greens are not serious about anything, but reaching out to the unions would seem to be the appropriate place to go. The left here is 25% of the electorate – perhaps 43% if construed broadly, Labor’s rump two-party-preferred. The Greens are stuck in the 25% rump, and could usefully start moving into the 18% of left nationalistic battlers. Of course, it’s your non-aligned nationalistic battlers who decide elections, and they’re the ones who’ve elected Rudd, clearly because they know that WorkChoices is no good for them. Cheers Mark. I’ve had the same experience of a crappy Labour government in NZ with Helen Clark et al. As you say with the UK the effects on the left are ambiguous. I hoped the arrival of the Clark government would sharpen the critique of those further left, with the lesser evil installed. But it didn’t happen. Partly because the left forces were co-opted by coalition (the electoral system makes a difference) and partly because the Alliance – once a real social democratic force polling (briefly) in the 20s – imploded after Sept 11 2001, with the leadership deserting the base. One difference that I see here is a stronger and more assertive union movement and its successful campaign against WorkChoices. Much of the leadership of that campaign has no interest in creating trouble for the ALP. But some of it genuinely does, and there is real cynicism among the base that could be coaxed into opposition given some space. And it really is a big base, perhaps the biggest semi-organised political mass in Australian society. Plus, the economic situation is likely to put the Labor government in a tough position, where they will be trying to deliberately restrain wage growth. One thing I wanted to put in the post but didn’t was that the Northern Territory invasion ought to be another key issue for the Greens – it may not be a vote winner but someone needs to keep it on the agenda. I don’t see any hope in the unions at present, as long as the ACTU remains tied to the ALP. If you want to see something break out, you have to look to the severing of union ties to political parties – look at the (French) CGT since it broke up with the PCF (and then look at the PCF)! On this change of mood thing, where do we get our sense of the ‘national mood’? The change of mood is really in the media, and it’s been just about palpable that the media got behind Rudd.import { timer } from '@/_helpers/promise-more' export async function retry(executor: () => Promise<any>, retryTimes = 1) { let times = retryTimes + 1 while (times--) { try { return await executor() } catch (e) { await timer(1000) } } console.error('>>>>> timeout') } Marc Barnes Arrested, Charged For Theft & Destruction Of Property Barnes, 51, prides himself on knowing how to run a popular nightclub, catering to 20- and 30-somethings looking for the latest “it” spot. His portfolio includes past popular clubs, such as Republic Gardens and Love, and his current venue, the Park at Fourteenth, in downtown Washington. But on Oct. 31, he was arrested and spent more than 11 hours in a D.C. cellblock, charged with misdemeanor second-degree theft and destruction of property for something he said he does regularly: confiscating fake identifications or any identification misused by underage patrons to enter his club. According to D.C. Superior Court documents, just after midnight on Aug. 10, Barnes and his security staff got into a confrontation with a Germantown woman over her identification. The woman, originally from Liberia, said that Barnes and his staff confiscated her Liberian driver’s license and residence permit, saying they were fake. Days later, according to the court documents, when the woman returned to the club to retrieve the documents, an employee told her that they had been shredded. But Barnes, who pays his employees $10 for every fake identification they retrieve, said that the woman gave her identification that evening to an underage friend who had accompanied her to the club and that the pieces of identification were confiscated from the friend because they were being misused. “I was locked up because she committed a crime,” Barnes says. “This is stupid.” Barnes has become vigilant about cracking down on underage drinkers. In 2002, he was fined $2,000 by the city and later sued by the family of a U.S. Park Police officer who was killed when a 20-year-old woman got into her car and hit him after having several drinks at Dream in Northeast Washington.Our Mission The Mission of the Institute is to provide an independent forum for those who dare to read, think, speak, and write in order to advance the professional, literary, and scientific understanding of sea power and other issues critical to national defense. A Different Angle of Attack The accelerating debate over the potential place of nonnuclear submarines in the U.S. Navy recently was joined by a pair of unlikely participants: respected British journalist Patrick Robinson and Royal Navy Admiral Sandy Woodward. Patrick Robinson, author of several books on thoroughbred horses, entered the debate with his just-published novel Nimitz Class (HarperCollins, 1997). His chief advisor on the book was Admiral Sir John (Sandy) Woodward, who was the naval force commander during the 1982 Falklands Conflict. Robinson previously had collaborated with Admiral Woodward on the admiral's outstanding and highly personalized account of the Falklands campaign, One Hundred Days (Naval Institute Press, 1992). In One Hundred Days, the two relate how, a few weeks before the Falklands Conflict, commanding a force of one missile destroyer, three frigates, and three fleet auxiliaries, the admiral "sank" the U.S. carrier Coral Sea (CV-43) during an exercise in the Arabian Sea. The carrier, of course, had some 70 aircraft on board. Only Woodward's destroyer flagship, the Glamorgan, armed with four Exocets with a range of 20 miles, could hurt the carrier. Despite intensive American efforts to locate and "sink" his ships, Admiral Woodward was able to close to within 11 miles of the Coral Sea to simulate firing his Exocets and destroy the carrier. He later would write: Therefore, reads the moral of this tale, take caution should you ever find yourself as a battle group commander in these circumstances, because it is fairly likely that in bad weather, you would lose the battle. This is especially true against a really determined attack in which the enemy is prepared to lose several ships in order to sink your carrier-which he should always be, because when the carrier goes your air force and very likely your entire campaign go with it. Now, 15 years after the Falklands, Mr. Robinson and Admiral Woodward recall the Coral Sea event in their novel. But in Nimitz Class, the U.S. supercarrier Thomas Jefferson is attacked by a Kilo-type submarine-and sunk in a nuclear explosion. The attack takes place in 2002, as the battle group approaches the U.S. base at Diego Garcia. The 11 cruisers, destroyers, frigates, and attack submarines that are screening the Thomas Jefferson fail to detect the diesel-electric sub. Speaking about the novel, Admiral Woodward stressed that "this is not a prediction of the future." Rather, he called it a "parable . . . a warning." After discussing the attributes and the costs of aircraft carriers of the Nimitz (CVN-68) class, the admiral addressed the submarine issue. He expressed regret that the U.S. and British submarine forces had become all-nuclear and explained his two reasons for wanting to see nonnuclear boats in both navies: Submarine cost-a modern SSK, he explained, costs one-third to one-fifth as much as a nuclear attack submarine High-risk submarine operations-inshore surveillance; operating in shallow, mined waters; landing agents; and other activities when one should risk a smaller, cheaper SSK rather
[ 89, 22187, 14, 35, 1166, 2194, 1008, 1173, 89, 22187, 14, 35, 1012, 2194, 1008, 1173, 89, 22187, 14, 35, 1812, 2194, 1008, 1173, 89, 22187, 14, 35, 2537, 2194, 1008, 1173, 89, 22187, 14, 35, 25, 2194, 1008, 1173, 89, 22187, 14, 35, 1449, 2194, 1008, 1173, 89, 22187, 14, 35, 3439, 2194, 1008, 1173, 89, 22187, 14, 35, 3680, 2194, 1008, 1173, 89, 22187, 14, 35, 2950, 2194, 1008, 1173, 89, 22187, 14, 35, 2504, 3291, 390, 374, 10, 247, 37623, 11616, 475, 33818, 410, 14797, 11, 5043, 253, 1824, 298, 5348, 313, 47, 1105, 1494, 70, 2339, 10, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 22, 2194, 1008, 1173, 89, 22187, 14, 35, 2385, 2194, 1008, 1173, 89, 22187, 14, 35, 1731, 2194, 1008, 1173, 89, 22187, 14, 35, 1036, 2194, 1008, 1173, 89, 22187, 14, 35, 1671, 2194, 1008, 1173, 89, 22187, 14, 35, 1012, 2194, 1008, 1173, 89, 22187, 14, 35, 1839, 2194, 1008, 1173, 89, 22187, 14, 35, 883, 2194, 1008, 1173, 89, 22187, 14, 35, 1348, 2194, 1008, 1173, 89, 22187, 14, 35, 805, 2194, 1008, 1173, 89, 22187, 14, 35, 3208, 2498, 329, 2626, 6387, 8687, 14663, 273, 1824, 298, 5348, 347, 7586, 281, 512, 643, 2897, 3783, 468, 983, 13, 533, 436, 18080, 556, 2959, 1652, 1329, 432, 5787, 23165, 6260, 313, 2858, 923, 1008, 1173, 89, 22187, 14, 35, 3011, 2194, 544, 926, 15, 337, 1084, 1173, 89, 22187, 14, 39, 18, 910, 709, 14, 881, 568, 926, 2536, 187, 187, 3138, 1532, 11831, 1896, 1755, 5970, 35668, 253, 27213, 1340, 273, 1264, 2201, 2897, 3783, 33309, 34835, 2796, 33818, 410, 14797, 2992, 427, 1105, 1494, 70, 2339, 13, 285, 253, 12875, 37623, 481, 2594, 2505, 313, 7053, 12494, 10, 323, 247, 1618, 273, 30404, 8109, 1016, 5202, 5774, 1173, 89, 22187, 71, 18, 4253, 1173, 89, 22187, 14, 39, 18, 94, 187, 187, 1992, 2953, 253, 7688, 273, 2201, 2897, 3783, 33309, 34835, 13, 2045, 2175, 452, 17412, 5787, 941, 5239, 1690, 247, 1643, 281, 8307, 273, 3608, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 2385, 2194, 1008, 1173, 89, 22187, 14, 35, 1166, 2194, 1008, 1173, 89, 22187, 14, 35, 1706, 2194, 1008, 1173, 89, 22187, 14, 35, 3357, 2194, 1008, 1173, 89, 22187, 14, 35, 1099, 2194, 1008, 1173, 89, 22187, 14, 35, 1812, 2194, 1008, 1173, 89, 22187, 14, 35, 2537, 2194, 1008, 1173, 89, 22187, 14, 35, 25, 2194, 1008, 1173, 89, 22187, 14, 35, 3208, 2194, 1008, 1173, 89, 22187, 14, 35, 3680, 2498, 13036, 281, 4059, 13, 512, 6260, 5196, 497, 1754, 327, 32147, 456, 43097, 273, 512, 3320, 14251, 6730, 15, 6295, 9864, 285, 16774, 941, 452, 2011, 13, 2299, 13, 326, 32147, 318, 7274, 476, 4917, 24363, 1543, 672, 253, 6944, 9376, 273, 27370, 2865, 636, 386, 3320, 29892, 310, 18171, 13588, 407, 253, 941, 2479, 1173, 89, 22187, 14, 35, 1093, 2194, 1008, 1173, 89, 22187, 14, 35, 1619, 2498, 19863, 2440, 273, 40405, 1154, 3082, 326, 476, 1805, 18045, 3320, 5202, 19331, 4795, 432, 253, 3361, 273, 18464, 23009, 23762, 313, 3077, 52, 10, 3400, 271, 39893, 323, 3417, 5202, 17032, 2479, 1173, 89, 22187, 14, 35, 1630, 2194, 1008, 1173, 89, 22187, 14, 35, 746, 2194, 1008, 1173, 89, 22187, 14, 35, 1619, 2194, 1008, 1173, 89, 22187, 14, 35, 1010, 2194, 1008, 1173, 89, 22187, 14, 35, 1423, 2194, 1008, 1173, 89, 22187, 14, 35, 1229, 2194, 1008, 1173, 89, 22187, 14, 35, 1237, 2194, 1008, 1173, 89, 22187, 14, 35, 1610, 2498, 187, 187, 683, 1173, 89, 22187, 14, 35, 2417, 62, 3732, 1097, 32147, 318, 285, 40405, 1154, 7274, 281, 7409, 253, 16483, 5230, 273, 2897, 3783, 468, 983, 970, 247, 7045, 4986, 941, 873, 11253, 273, 27322, 6069, 3608, 285, 7904, 29821, 13, 1690, 954, 2201, 2897, 3783, 33309, 34835, 347, 973, 347, 17409, 23047, 33309, 562, 12896, 15, 4129, 616, 32147, 318, 6260, 2085, 1329, 323, 253, 475, 33818, 410, 14797, 13023, 84, 2131, 9079, 13, 6010, 40405, 1154, 7274, 313, 4548, 14, 24422, 285, 3915, 1277, 28, 1008, 1173, 89, 22187, 14, 35, 1717, 1092, 1008, 1173, 89, 22187, 14, 35, 1229, 3291, 3732, 281, 436, 941, 873, 11512, 475, 33818, 410, 14797, 1186, 42396, 11, 1186, 11, 47, 1105, 1494, 70, 2339, 5202, 15, 1008, 1173, 89, 22187, 14, 35, 3208, 62, 11511, 253, 1543, 1754, 327, 32147, 318, 3082, 42203, 616, 19297, 281, 2395, 323, 5274, 52, 15, 2053, 4477, 2007, 28809, 616, 11815, 1563, 253, 1543, 2797, 970, 5202, 14, 17777, 1894, 14, 2377, 48027, 7259, 281, 5806, 562, 3809, 14, 1173, 11932, 4375, 313, 2887, 671, 1008, 1173, 89, 22187, 14, 35, 740, 2498, 19863, 294, 47927, 273, 1008, 1173, 89, 22187, 14, 35, 3208, 31258, 84, 941, 873, 13, 2299, 13, 452, 2011, 326, 253, 6010, 40405, 1154, 7274, 908, 403, 7996, 281, 1097, 3731, 14, 287, 4225, 3320, 7139, 285, 12420, 6332, 2479, 1173, 89, 22187, 14, 35, 2950, 6660, 285, 326, 253, 1894, 8790, 312, 4906, 8130, 12845, 403, 23539, 2479, 1173, 89, 22187, 14, 35, 2504, 2498, 2091, 1110, 767, 2616, 403, 20184, 323, 13, 475, 33818, 410, 14797, 13023, 84, 2131, 310, 11512, 1014, 342, 40405, 1154, 7274, 2479, 1173, 89, 22187, 14, 35, 2950, 2194, 1008, 1173, 89, 22187, 14, 35, 2504, 2498, 187, 187, 7910, 2022, 35961, 24165, 48637, 253, 7200, 273, 23165, 6260, 452, 417, 2568, 644, 2783, 407, 253, 3332, 14421, 2175, 326, 7409, 253, 16483, 20801, 273, 2201, 2897, 3783, 33309, 34835, 27, 337, 10, 3320, 5202, 13418, 2228, 313, 74, 15, 70, 904, 22245, 3320, 7139, 11741, 281, 17154, 253, 2032, 49584, 38721, 2892, 273, 3608, 10, 285, 374, 10, 30078, 2538, 273, 3710, 43653, 10491, 15, 380, 3438, 2803, 5431, 23880, 432, 253, 1698, 1491, 2600, 273, 253, 313, 32205, 2159, 10, 2060, 3320, 14251, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 1867, 2194, 1008, 1173, 89, 22187, 14, 35, 21, 6660, 5727, 4433, 281, 2486, 2234, 34835, 326, 17542, 646, 1048, 12998, 476, 4711, 12082, 6332, 824, 347, 1048, 14, 27391, 21779, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 2417, 2194, 1008, 1173, 89, 22187, 14, 35, 1047, 2498, 43308, 432, 253, 3731, 14, 287, 5341, 3374, 5439, 2479, 1173, 89, 22187, 14, 35, 2950, 2194, 1008, 1173, 89, 22187, 14, 35, 2504, 6660, 3320, 5202, 2228, 369, 5469, 533, 417, 3587, 9713, 407, 253, 2045, 2175, 15, 5488, 13, 253, 7045, 4986, 941, 873, 5867, 407, 1008, 1173, 89, 22187, 14, 35, 3208, 62, 2908, 247, 2014, 3417, 273, 1824, 298, 5348, 285, 20296, 2393, 14, 27391, 272, 15572, 275, 253, 346, 2013, 1776, 2897, 3783, 468, 983, 3, 42540, 37623, 313, 5214, 37623, 38492, 481, 187, 187, 4943, 13, 359, 45735, 253, 5230, 273, 2897, 3783, 468, 983, 1895, 407, 15890, 323, 2442, 12082, 31306, 14475, 432, 3710, 2891, 251, 10491, 285, 3320, 5202, 13418, 2228, 15, 844, 11848, 1008, 1173, 89, 22187, 14, 35, 3208, 31258, 84, 7045, 4986, 941, 873, 273, 27322, 6069, 3608, 281, 2486, 3786, 440, 911, 33431, 6430, 432, 767, 2393, 14, 69, 2373, 3390, 2897, 3783, 33309, 34835, 15, 380, 747, 29821, 2879, 2486, 1264, 1824, 298, 5348, 326, 8085, 253, 1048, 7789, 4283, 281, 475, 47, 484, 9432, 11, 313, 6538, 8612, 273, 427, 1105, 1494, 70, 2339, 275, 1008, 1173, 89, 22187, 14, 35, 3208, 31258, 84, 941, 873, 10, 285, 1740, 3417, 275, 3752, 287, 5830, 11416, 2339, 13, 534, 12093, 253, 18353, 14, 27391, 272, 23009, 275, 253, 12875, 37623, 313, 1439, 6607, 275, 253, 3236, 941, 873, 28, 923, 1008, 1173, 89, 22187, 14, 35, 20, 2194, 544, 926, 15, 374, 1084, 1173, 89, 22187, 14, 39, 19, 910, 709, 14, 881, 568, 926, 2536, 187, 187, 3138, 1532, 19030, 5202, 1754, 327, 253, 329, 9639, 1556, 14, 2267, 1783, 273, 253, 11848, 941, 873, 970, 18379, 6430, 15, 25474, 16095, 2011, 497, 5998, 323, 253, 32147, 456, 4315, 970, 12875, 89, 4132, 15, 427, 26306, 1329, 2193, 403, 4860, 1840, 1016, 7789, 313, 5996, 8538, 5912, 390, 28551, 1329, 2797, 432, 329, 9639, 1556, 14, 2267, 16, 4548, 14, 24422, 16, 5214, 89, 4132, 16, 1672, 66, 24444, 265, 558, 271, 23317, 1886, 6492, 253, 37623, 310, 4751, 4516, 15, 1457, 29821, 2879, 1060, 403, 2011, 275, 13433, 15, 1876, 643, 7139, 6012, 432, 40405, 1154, 313, 21, 643, 6260, 582, 32147, 318, 313, 19, 6260, 582, 285, 443, 23802, 14, 3169, 40405, 1154, 6260, 313, 1237, 6260, 10, 671, 11322, 253, 475, 33818, 410, 14797, 4842, 84, 2131, 5202, 313, 33850, 347, 544, 9227, 17724, 1084, 8403, 18, 910, 709, 14, 881, 568, 6962, 14, 4990, 986, 3909, 28, 923, 1329, 2193, 275, 2829, 337, 481, 12010, 25446, 403, 6667, 273, 8357, 4444, 9991, 27, 2796, 66, 5627, 475, 59, 2966, 571, 44984, 2992, 2796, 67, 5627, 475, 43539, 297, 3703, 66, 1186, 6027, 1186, 31873, 25933, 2992, 2796, 68, 5627, 475, 9304, 3770, 20130, 465, 641, 518, 319, 2886, 2992, 2796, 69, 5627, 475, 41, 47411, 406, 455, 261, 3744, 6156, 2992, 2796, 70, 5627, 475, 41, 483, 16853, 1362, 571, 12045, 682, 2992, 2796, 71, 5627, 475, 47981, 25119, 4936, 338, 3833, 66, 2992, 2796, 72, 5627, 475, 15041, 280, 1514, 49716, 31945, 360, 2992, 2796, 73, 5627, 475, 10859, 261, 17244, 653, 864, 386, 248, 376, 2992, 2796, 74, 5627, 475, 47, 484, 9432, 519, 1261, 66, 2992, 2796, 75, 5627, 475, 47, 1105, 1494, 14576, 35263, 5154, 66, 2992, 2796, 76, 5627, 475, 33818, 410, 14797, 50163, 412, 17457, 2992, 2796, 77, 5627, 475, 25385, 16559, 268, 41105, 682, 4556, 880, 1173, 89, 22187, 71, 19, 4253, 1173, 89, 22187, 14, 39, 19, 94, 187, 187, 1231, 671, 5196, 3320, 49584, 15514, 31197, 313, 6435, 42, 582, 247, 4102, 4081, 2746, 281, 26923, 875, 13418, 2228, 285, 4588, 7534, 7344, 313, 70, 15, 72, 904, 4795, 432, 5274, 52, 10, 275, 15571, 3320, 5202, 1485, 543, 579, 566, 2479, 1173, 89, 22187, 14, 35, 21, 2498, 831, 1332, 16608, 684, 2060, 3608, 3066, 18080, 5216, 281, 3653, 253, 49584, 38721, 2892, 326, 1016, 3320, 8525, 342, 4585, 5912, 15, 496, 643, 3000, 13, 352, 22649, 534, 5202, 18080, 13, 432, 247, 873, 273, 41364, 1755, 5970, 13, 3400, 253, 1682, 4944, 323, 1016, 273, 253, 313, 32205, 2159, 10, 3320, 27959, 15, 443, 23802, 16756, 253, 2625, 432, 3608, 407, 9433, 17597, 10806, 2556, 281, 253, 1180, 273, 5795, 7139, 323, 247, 1677, 475, 79, 4842, 9292, 251, 3908, 15, 380, 2613, 273, 2897, 3783, 468, 983, 310, 247, 26415, 495, 14, 9292, 251, 313, 263, 440, 287, 4225, 577, 14, 9292, 251, 10, 1895, 326, 8687, 1264, 1896, 1755, 5970, 27, 475, 33818, 410, 14797, 4842, 84, 2131, 13, 475, 33818, 410, 14797, 1186, 42396, 11, 1186, 11, 47, 1105, 1494, 70, 2339, 13, 390, 427, 1105, 1494, 70, 2339, 14, 84, 2131, 313, 2887, 544, 926, 15, 337, 1084, 1173, 89, 22187, 14, 39, 18, 910, 709, 14, 881, 568, 926, 2536, 380, 4795, 20793, 7139, 323, 1016, 3320, 403, 10126, 2429, 285, 17045, 2556, 281, 253, 475, 49, 11, 2193, 2797, 970, 253, 5512, 38663, 313, 16408, 10, 1071, 2479, 1173, 89, 22187, 14, 35, 1857, 2498, 496, 1635, 281, 10405, 3006, 253, 4103, 1329, 326, 1016, 5795, 18080, 14488, 2439, 3608, 13, 253, 4795, 5958, 337, 3320, 7139, 4236, 407, 253, 18080, 5216, 313, 6435, 42, 3320, 7139, 10, 476, 320, 908, 347, 3280, 323, 3417, 5202, 3082, 13, 7624, 15890, 323, 12082, 6332, 15276, 281, 440, 48454, 3320, 5202, 17032, 285, 9142, 6010, 40405, 1154, 6260, 2479, 1173, 89, 22187, 14, 35, 21, 2194, 1008, 1173, 89, 22187, 14, 35, 1706, 2498, 187, 187, 1992, 31237, 253, 11848, 941, 873, 13, 359, 806, 10432, 253, 4122, 34249, 562, 4399, 475, 37315, 26093, 5021, 5497, 437, 13047, 567, 2886, 11, 313, 44247, 407, 1008, 1173, 89, 22187, 14, 35, 3208, 3291, 281, 3693, 12082, 31306, 45030, 432, 1048, 14, 27391, 21779, 313, 2887, 1008, 1173, 89, 22187, 14, 35, 2950, 2498, 3808, 6260, 313, 6435, 42, 28, 923, 2708, 582, 2299, 13, 908, 253, 3236, 285, 11848, 941, 5239, 1097, 342, 285, 1293, 475, 37315, 26093, 5021, 11, 323, 625, 1480, 5301, 342, 2045, 2175 ]
x233-B17]; [@evx233-B13]; [@evx233-B36]; [@evx233-B49]; [@evx233-B8]; [@evx233-B40]; [@evx233-B54]; [@evx233-B58]; [@evx233-B46]; [@evx233-B47]) or 2) a clade comprising *Amborella* plus the water lilies (Nymphaeales) (e.g., [@evx233-B5]; [@evx233-B48]; [@evx233-B26]; [@evx233-B16]; [@evx233-B35]; [@evx233-B13]; [@evx233-B38]; [@evx233-B11]; [@evx233-B24]; [@evx233-B12]; [@evx233-B56]). A third possibility involves placement of water lilies as sister to all other angiosperms, but this topology has received little support from molecular phylogenetic analyses (but see [@evx233-B57]; [fig. 1](#evx233-F1){ref-type="fig"}). ![---Three possible topologies depicting the branching order of three major angiosperm lineages (*Amborella*, Nymphaeales, and the RA clade). See text (first paragraph) for a list of citations supporting each tree.](evx233f1){#evx233-F1} To address the relationships of major angiosperm lineages, previous studies have assembled molecular data sets including a few to hundreds of genes (e.g., [@evx233-B48]; [@evx233-B17]; [@evx233-B34]; [@evx233-B53]; [@evx233-B25]; [@evx233-B36]; [@evx233-B49]; [@evx233-B8]; [@evx233-B56]; [@evx233-B58]). Prior to 2014, all analyses conducted were based on concatenated alignments of all gene fragments examined. Both simulation and empirical data have shown, however, that concatenation approaches can yield misleading results when the underlying assumption of nondiscordant gene histories is extensively violated by the data ([@evx233-B18]; [@evx233-B28]). Recent development of coalescent methods that can better accommodate gene tree heterogeneity resulting from the presence of incomplete lineage sorting (ILS) provides an avenue for species tree inference ([@evx233-B27]; [@evx233-B19]; [@evx233-B28]; [@evx233-B15]; [@evx233-B22]; [@evx233-B30]; [@evx233-B32]; [@evx233-B33]). [@evx233-B55] applied both concatenation and coalescent approaches to investigate the evolutionary root of angiosperms using a transcriptomic data set consisting of 310 nuclear genes and 46 taxa, including most major angiosperm lineages as well as gymnosperm outgroups. Although their concatenation analyses provide support for the *Amborella-*sister hypothesis, summary coalescent approaches (MP-EST and STAR; [@evx233-B29], [@evx233-B30]) applied to this data set resolved *Amborella *+* *Nymphaeales tree. [@evx233-B56] dismissed the results based on concatenation methods invoking their inability to account for ILS. These authors further reinforced their conclusions following the results obtained using tree-independent character-subsampling procedures to filter out fast-evolving sites (see also [@evx233-B10]). Recent reanalyses of [@evx233-B56]'s data set, however, have shown that the summary coalescent approaches used are sensitive to both mis-rooted gene trees and alignment errors ([@evx233-B46]), and that the character subsampling strategies utilized are biased ([@evx233-B47]). When those two factors are accounted for, *Amborella-*sister is resolved even with coalescent approaches ([@evx233-B46]; [@evx233-B47]). Two main methodological artifacts compromising the accuracy of phylogenetic analyses have not yet been considered by the recent genomic studies that investigate the evolutionary origins of major angiosperm lineages: 1) gene tree estimation error (i.e., inferred gene trees failing to depict the true genealogical history of genes) and 2) detrimental effects of limited taxonomic sampling. The former factor typically stems from the low information content of the (often short) individual gene fragments (e.g., [@evx233-B39]; [@evx233-B4]), whereas failure to include key lineages that bisect long branches can produce systematic errors such as long-branch attraction (e.g., [@evx233-B55]; [@evx233-B14]). Aside from the mis-rooting issues raised ([@evx233-B46]; [@evx233-B47]), gene tree error was discussed but not directly addressed by the previous studies. Furthermore, the transcriptomic data set analyzed by [@evx233-B56] included a single species of water lilies and lacked early-branching representatives in the "remaining angiosperms" unnamed clade (RA clade hereafter). Here, we revisit the root of angiosperms problem by accounting for potential systematic biases arising from limited taxon sampling and gene tree estimation error. We expanded [@evx233-B56]'s transcriptomic data set of 310 nuclear genes to include previously unexamined sequences from two early-diverging angiosperm lineages. The new taxa added include three water lilies that split the long branch leading to *Nuphar* (sole representative of Nymphaeales in [@evx233-B56]'s data set) and four species in Austrobaileyales, which comprises the earliest-branching lineage in the RA clade (not represented in the original data set; see [@evx233-B3]; [fig. 2](#evx233-F2){ref-type="fig"}). ![---Selected tree based on the ASTRAL-II analysis of the expanded data set using nucleotide sequences. Branch lengths shown were estimated for the concatenated matrix using RAxML. Nodal support values are indicated above each branch (posterior probability or bootstrap support obtained from ASTRAL-II/MP-EST/RAxML/ExaBayes); an asterisk indicates the clade is fully supported. New taxa added here are shown in bold. All other trees derived from coalescent (4 other analyses), concatenation (2 analyses), and GGI-based coalescent analyses (32 analyses) also resolve the *Amborella*-sister tree (provided as [Supplementary Material](#sup1){ref-type="supplementary-material"} online; see support values in table 1). Photographs are examples of seed plant diversity: (*a*) *Zinnia elegans*, (*b*) *Ipomoea × sloteri*, (*c*) *Monochoria korsakowii*, (*d*) *Hemerocallis fulva*, (*e*) *Houttuynia cordata*, (*f*) *Magnolia grandiflora*, (*g*) *Illicium floridanum*, (*h*) *Schisandra sphenanthera*, (*i*) *Nuphar advena*, (*j*) *Nymphaea tetragona*, (*k*) *Amborella trichopoda*, (*l*) *Cycas pectinata*.](evx233f2){#evx233-F2} We also conducted gene genealogy interrogation (GGI), a recently proposed approach to discern between estimation error and actual biological conflict (e.g., resulting from ILS) in explaining gene tree incongruence ([@evx233-B4]). This method interrogates individual genes via topology tests to determine the genealogical history that each gene supports with highest probability. In other words, it identifies which tree topology, from a set of predefined topologies, provides the best fit for each of the (often short) gene partitions. GGI extracts the signal from genes by applying topological constraints according to the number of alternative trees for a given *n*-taxon statement. The base of angiosperms is a rooted 3-taxon (or unrooted 4-taxon) problem that involves three possible topologies: *Amborella*-sister, *Amborella *+* *Nymphaeales, or Nymphaeales-sister (see [fig. 1](#evx233-F1){ref-type="fig"}). The resulting constrained trees for each gene are statistically compared and ranked according to the *P* values obtained using the approximately unbiased (AU) test ([@evx233-B45]). In addition to summarizing the relative support that each alternative topology receives across genes, the resulting rank 1 gene trees selected by the topology tests (GGI gene trees) can be used as input for species tree methods, thereby accounting for systematic errors intrinsic to unconstrained gene tree inference and ultimately summary coalescent analyses ([@evx233-B4]; [@evx233-B34]). To assemble the expanded data set, we first excluded the highly divergent outgroup *Selaginella moellendorffii* (included by [@evx233-B56]) to avoid systematic biases stemming from long-branch attraction (see [@evx233-B46]). Some analyses (GGI; see below), however, used the original and expanded data sets both with and without *Selaginella* for more direct comparison with previous studies
[ 1128, 14958, 521, 12247, 1211, 247, 268, 1763, 2345, 279, 32, 2596, 326, 3261, 751, 247, 24108, 13, 751, 2398, 1031, 79, 434, 32, 1128, 248, 369, 6600, 273, 247, 3511, 40655, 1863, 35042, 1475, 275, 521, 23828, 15, 1359, 8909, 326, 521, 12725, 689, 521, 747, 6122, 13, 521, 5875, 5675, 2021, 13, 812, 2226, 275, 824, 2810, 18326, 281, 253, 26034, 521, 3392, 574, 644, 3811, 342, 323, 1107, 15, 1737, 271, 40889, 344, 369, 323, 17816, 436, 1388, 13, 323, 2820, 281, 43477, 521, 12247, 273, 581, 273, 253, 1643, 6627, 13977, 275, 521, 1495, 15, 187, 187, 1328, 3543, 247, 7227, 1133, 327, 521, 9215, 27, 521, 3392, 13, 3212, 779, 15, 346, 1394, 1472, 2509, 816, 4030, 937, 344, 753, 13, 285, 344, 17132, 3392, 314, 275, 247, 1039, 326, 344, 9403, 1904, 626, 13, 285, 5119, 3543, 751, 247, 28713, 969, 13, 344, 285, 2398, 1031, 79, 816, 247, 4564, 273, 269, 24886, 871, 14, 79, 837, 723, 13, 49979, 342, 767, 18740, 13, 28884, 273, 512, 253, 4088, 326, 1495, 812, 564, 3430, 15, 346, 7093, 6838, 403, 1077, 13476, 937, 7727, 2879, 13, 285, 5119, 816, 11522, 984, 344, 4571, 626, 3324, 2994, 281, 3984, 15, 187, 187, 37, 5338, 369, 247, 2014, 34112, 33845, 8085, 875, 767, 952, 13, 247, 2829, 342, 767, 1659, 7533, 13, 247, 43818, 3376, 3692, 1669, 12239, 651, 320, 22186, 323, 1740, 6774, 1897, 15, 187, 187, 3, 2993, 1833, 564, 1066, 323, 247, 19422, 3517, 937, 5119, 753, 347, 344, 16481, 253, 2829, 15, 346, 18837, 359, 4710, 253, 4023, 1475, 323, 247, 1223, 865, 187, 187, 8389, 12247, 3261, 9861, 13, 13864, 15, 754, 11522, 15, 346, 42, 1871, 751, 326, 449, 187, 187, 11, 475, 475, 187, 187, 1128, 187, 187, 8389, 4475, 369, 247, 1175, 20453, 15, 754, 9047, 617, 13, 2439, 253, 2316, 275, 247, 921, 90, 1264, 14, 19192, 425, 406, 14407, 474, 15823, 281, 253, 372, 266, 273, 253, 3739, 2143, 13, 48055, 15312, 1411, 617, 9081, 275, 247, 1499, 272, 13, 26740, 272, 5777, 432, 1669, 281, 987, 13, 4927, 2784, 16453, 314, 432, 247, 5253, 273, 2502, 8995, 13, 18727, 275, 247, 1039, 326, 369, 387, 2378, 48849, 285, 7171, 692, 347, 703, 753, 13, 346, 42, 816, 2389, 1146, 247, 2243, 15, 733, 434, 253, 954, 794, 309, 1849, 2455, 574, 449, 187, 187, 1328, 38720, 281, 9184, 15, 2058, 1728, 13, 703, 4455, 1629, 770, 763, 285, 28714, 285, 10412, 13, 820, 80, 272, 637, 14427, 595, 281, 2057, 6858, 390, 1133, 14, 88, 3834, 20314, 84, 285, 4394, 447, 342, 253, 277, 1003, 264, 8388, 23716, 273, 271, 1711, 14, 10186, 9890, 20606, 15, 1500, 21567, 1892, 285, 3809, 13, 275, 2159, 31746, 13, 275, 247, 1039, 326, 4455, 1097, 11617, 36713, 285, 4470, 1523, 5164, 1128, 248, 858, 253, 1072, 2181, 13, 2444, 594, 1199, 326, 344, 812, 642, 3356, 12129, 247, 7948, 432, 247, 6794, 13, 47619, 432, 20632, 15, 1500, 2210, 281, 4143, 779, 387, 2143, 4536, 342, 253, 18740, 13, 285, 703, 7607, 253, 15729, 84, 344, 3534, 617, 751, 247, 26246, 466, 13, 502, 1947, 281, 779, 751, 22484, 23853, 285, 1904, 626, 1339, 564, 1919, 344, 858, 15, 733, 1900, 268, 1243, 779, 247, 1652, 281, 3785, 1977, 432, 617, 15, 187, 187, 2993, 369, 5015, 281, 581, 273, 521, 33108, 13, 247, 15674, 382, 275, 521, 323, 2890, 15, 754, 3589, 626, 2119, 752, 2715, 273, 617, 3196, 15, 38711, 369, 6523, 1128, 783, 25507, 13, 5389, 13, 13224, 3416, 665, 1160, 779, 1928, 12107, 285, 23327, 32, 2207, 253, 4600, 14, 7955, 30487, 13, 10101, 251, 595, 892, 14381, 90, 13, 440, 32980, 2419, 27505, 665, 574, 253, 3820, 10757, 281, 1333, 1841, 751, 795, 1147, 434, 253, 954, 794, 309, 1849, 2455, 574, 64, 32, 187, 187, 3, 12412, 19916, 937, 521, 9732, 753, 13, 285, 5119, 3543, 271, 8993, 25520, 273, 27042, 323, 521, 4475, 15, 1500, 369, 1335, 594, 2872, 285, 3261, 352, 8423, 15, 754, 812, 923, 617, 40881, 796, 4983, 281, 12433, 282, 13, 285, 344, 48504, 2994, 432, 247, 9096, 273, 47527, 285, 2427, 281, 617, 13, 19883, 253, 1355, 273, 617, 896, 15, 187, 187, 3, 6300, 4854, 670, 253, 3371, 656, 273, 747, 1349, 42395, 937, 3196, 15, 38711, 753, 13, 18727, 275, 247, 1039, 326, 1537, 452, 644, 49282, 1128, 24568, 272, 2398, 1031, 79, 32, 3032, 4475, 3261, 387, 779, 342, 1633, 751, 46347, 27, 795, 32897, 1053, 626, 5580, 479, 562, 13, 417, 275, 2914, 273, 512, 841, 952, 28, 309, 871, 309, 369, 17800, 275, 253, 16846, 436, 4131, 533, 4496, 816, 1132, 2112, 3333, 187, 187, 3, 1147, 434, 253, 954, 15556, 5411, 13, 35247, 13, 9386, 2181, 275, 253, 1533, 937, 5119, 753, 13, 33940, 2685, 1771, 13, 285, 2398, 1031, 79, 11373, 387, 779, 13, 18274, 896, 715, 521, 1133, 15, 187, 187, 3, 4045, 368, 452, 2151, 865, 703, 2546, 3196, 15, 38711, 15, 42167, 369, 387, 1728, 1146, 48163, 407, 247, 6346, 28, 48055, 369, 3578, 3618, 1711, 285, 1512, 2872, 281, 320, 1669, 342, 247, 1790, 350, 28, 352, 574, 4455, 751, 1512, 1199, 281, 3324, 1097, 6838, 13, 533, 344, 3260, 326, 2398, 1031, 79, 3543, 42167, 434, 5928, 751, 247, 35698, 18791, 15, 187, 187, 3, 13618, 13, 642, 937, 253, 7345, 753, 15, 346, 42, 1900, 1869, 352, 651, 320, 16593, 13, 1677, 253, 3038, 309, 1978, 449, 187, 187, 46, 3441, 79, 38644, 28, 5119, 9047, 617, 15, 187, 187, 3, 1989, 18981, 937, 3196, 15, 38711, 753, 15, 346, 6080, 952, 1056, 352, 789, 449, 187, 187, 3, 24804, 937, 5119, 753, 15, 187, 187, 510, 7345, 18274, 275, 11882, 1080, 1365, 15, 346, 42, 1871, 22276, 368, 6068, 281, 3523, 387, 767, 13, 2167, 15, 3094, 83, 8541, 434, 1694, 1740, 5753, 285, 344, 476, 12345, 3297, 24922, 449, 754, 11522, 689, 281, 581, 273, 5119, 434, 43169, 387, 253, 4675, 13, 665, 369, 6306, 12200, 247, 3416, 5119, 24874, 281, 320, 521, 4475, 13, 1097, 273, 731, 2819, 751, 253, 7824, 3846, 13, 4618, 14, 26731, 285, 908, 598, 13, 616, 16473, 8248, 1499, 27151, 1977, 432, 1016, 643, 15, 187, 187, 25233, 14039, 865, 64, 754, 260, 1135, 264, 521, 1133, 625, 18648, 1475, 521, 4475, 434, 13290, 15, 187, 187, 3, 39, 437, 17390, 6306, 598, 1309, 271, 14801, 28857, 1390, 2129, 937, 3196, 15, 38711, 753, 347, 2398, 1031, 79, 48504, 5972, 15, 754, 4571, 626, 2028, 752, 352, 5486, 672, 703, 29172, 521, 1133, 285, 19347, 1977, 15, 187, 187, 2993, 369, 7107, 327, 253, 1039, 1728, 15, 187, 187, 3, 29235, 2419, 13, 23445, 865, 344, 2546, 347, 597, 7428, 2439, 253, 1708, 264, 9729, 689, 253, 8281, 15, 346, 42, 1904, 626, 8968, 627, 795, 12796, 64, 9910, 751, 326, 1475, 1060, 449, 41853, 344, 8156, 344, 369, 5909, 247, 3369, 344, 1871, 4307, 1892, 281, 2534, 695, 796, 4581, 15, 187, 187, 3, 4374, 13, 824, 247, 2080, 3501, 432, 776, 9168, 937, 703, 753, 13, 20284, 617, 1133, 281, 12831, 48055, 434, 14343, 2454, 432, 253, 8136, 1481, 22850, 15, 7160, 7145, 273, 14890, 3228, 369, 327, 253, 1408, 14, 3487, 1930, 533, 352, 369, 7107, 28, 627, 369, 247, 5603, 247, 1643, 8336, 432, 253, 2419, 835, 703, 812, 1379, 253, 6838, 15, 733, 369, 5890, 285, 4999, 15, 754, 1308, 382, 1070, 13, 533, 1078, 344, 812, 1379, 8399, 703, 4925, 323, 521, 4430, 13, 259, 710, 22502, 949, 253, 23104, 275, 521, 24784, 15, 187, 187, 3, 15953, 937, 703, 753, 15, 346, 42, 1353, 275, 247, 12315, 449, 187, 187, 3, 39, 34828, 434, 247, 345, 12898, 1946, 40889, 937, 344, 753, 15, 1500, 7320, 779, 8003, 13, 616, 29434, 19496, 272, 2366, 247, 1643, 2069, 1919, 597, 1119, 616, 31482, 15, 187, 187, 3, 1328, 1364, 1158, 309, 1353, 1128, 1737, 858, 309, 1333, 281, 779, 32, 795, 510, 954, 794, 309, 1849, 1128, 64, 1737, 271, 347, 14989, 2181, 281, 1128, 530, 18068, 15, 309, 816, 3524, 309, 1904, 626, 15005, 368, 937, 703, 753, 372, 6499, 314, 15, 1500, 3589, 626, 2819, 387, 779, 13, 574, 617, 2927, 4229, 327, 247, 787, 10274, 1708, 1066, 253, 8281, 15, 187, 187, 1328, 11898, 521, 1481, 42210, 15, 346, 4527, 2282, 417, 15, 9018, 449, 187, 187, 3, 42, 4282, 604, 309, 1833, 2455, 452, 1633, 4722, 281, 1333, 969, 449, 187, 187, 3, 1394, 1472, 1146, 1512, 1892, 327, 4834, 937, 344, 753, 15, 187, 187, 3, 1394, 1472, 21927, 839, 479, 449, 1500, 27858, 617, 7351, 1475, 617, 4430, 15, 346, 42, 651, 5159, 323, 247, 19555, 449, 733, 369, 247, 8803, 703, 1871, 391, 17263, 598, 672, 597, 4395, 281, 14890, 13, 2167, 703, 1871, 1677, 352, 598, 672, 703, 1871, 12759, 12821, 342, 42167, 285, 369, 20965, 1776, 1335, 13, 1223, 703, 369, 5988, 14, 26449, 48055, 15, 346, 18291, 1529, 6149, 314, 11284, 326, 651, 25711, 1361, 281, 1978, 479, 44419, 13, 285, 2568, 3255, 187, 187, 3, 1231, 1472, 417, 6149, 314, 865, 344, 2546, 15, 346, 5072, 285, 253, 6838, 865, 187, 187, 3, 510, 6838, 285, 309, 937, 703, 15045, 15, 346, 2302, 15, 1422, 1472, 1162, 1568, 267, 15, 2752, 540, 606, 917, 3253, 449, 187, 187, 510, 3908, 4455, 1097, 16088, 18109, 285, 26007, 613, 1598, 8872, 15, 187, 187, 3039, 597, 7244, 1728, 13, 344, 39752, 253, 1790, 350, 1223, 2398, 1031, 79, 2427, 281, 2451, 327, 42167, 15, 754, 1160, 247, 4564, 273, 36150, 10379, 285, 39018, 37105, 13, 8958, 326, 2398, 1031, 79, 8715, 626, 22186, 1199, 387, 253, 3128, 15, 2091, 344, 3982, 731, 281, 616, 14098, 13, 2398, 1031, 79, 369, 15929, 48055, 13, 5877, 617, 275, 581, 4430, 1223, 253, 643, 1133, 26098, 3104, 598, 285, 1066, 42167, 434, 896, 1128, 56, 423, 90, 13, 665, 369, 38871, 275, 253, 9187, 536, 273, 2398, 1031, 79, 434, 12267, 13, 14578, 11617, 15, 1244, 627, 703, 369, 13, 521, 4475, 13, 1728, 969, 13, 896, 342, 617, 18740, 13, 21517, 432, 1907, 281, 878, 13102, 15249, 617, 6242, 281, 253, 13052, 273, 38711, 15, 1500, 5439, 617, 2927, 281, 779, 285, 344, 33153, 387, 253, 15746, 15, 187, 187, 3, 17304, 309, 871, 604, 309, 574, 20971, 5895, 865, 703, 2546, 779, 13, 269, 31041, 1066, 387, 5972, 15, 346, 9917, 13, 42167, 3198, 281, 320, 4391, 604, 368, 1053, 626, 2564, 449, 187, 187, 3726, 651, 10280, 352, 323, 1107, 281, 1705, 275, 2069, 273, 1213, 1074, 27, 795, 783, 954, 794, 309, 1849, 2455, 574, 3333, 187, 187, 4, 32204, 427, 7570, 187, 187, 55, 16900, 12659, 13, 432, 617, 1897, 347, 247, 6195, 22853, 13, 253, 4086, 273, 523, 1946, 342, 247, 4653, 20565, 27, 1481, 352, 745, 387, 253, 1509, 285, 352, 812, 3464, 17096, 1561, 634, 1453, 15, 831, 369, 253, 2746, 703, 369, 3192, 323, 616, 8955, 342, 10354, 1240, 15, 12429, 369, 7462, 600, 7514, 670, 352, 28, 344, 1313, 1046, 3748, 4283, 598, 281, 253, 7237, 342, 271, 795, 6723, 368, 2119, 368, 971, 281, 513, 326, 64, 1007, 13, 253, 2238, 273, 1007, 326, 753, 13, 795, 42, 1353, 417, 1469, 281, 3523, 368, 533, 760, 984, 309, 1871, 2581, 368, 3523, 4834, 3333, 1198, 436, 1921, 13, 12162, 342, 253, 8955, 671, 3534, 617, 247, 2176, 13212, 13, 326, 1429, 763, 7435, 14, 5658, 9317, 1246, 275, 954, 36659, 13, 253, 2916, 6656, 27354, 281, 513, 1633, 3365, 984, 634, 5938, 1904, 626, 971, 368, 281, 15, 187, 187, 2512, 369, 642, 46463, 7241, 323, 849, 281, 9569, 634, 42289, 1428, 1429, 281, 634, 5938, 13, 390, 323, 849, 281, 9569, 779, 281, 253, 2151, 368, 1871, 574, 327, 4096, 13, 253, 2151, 368, 1871, 1620, 1677, 247, 1273, 1869, 281, 7562, 15, 1893, 48055, 6960, 22534, 1128, 15160, 531, 10490, 22534, 13, 1904, 626, 597, 32, 1128, 395, 1160, 2119, 627, 369, 271, 24904, 6186, 273, 8995, 327, 1133, 323, 5972, 285, 12429, 13, 285, 703, 5544, 281, 18059, 1595, 285, 19173, 13, 347, 1682, 703, 812, 13, 326, 5870, 2210, 275, 512, 4948, 13, 326, 703, 1871, 644, 247, 1027, 1436, 15342, 1107, 3622, 13, 326, 703, 1904, 626, 1014 ]
—did his dad own a pincushion? One that looked like a tomato, like Marilyn's?—he was aware of a hot disgrace swirling around in his belly. How odd that his delight over his new daughter, his healthy growing family, could exist in such close proximity to the sorrow his father had been living with for years. What an asshole he was for avoiding this day, for trying to deprive his dad of one of the few bright spots in his life. He felt a rough hand on his shoulder: his father, behind him. "You're doing just fine," he said, and he sounded fatherly in a way that he normally didn't, and David felt like a teenager again, he and Marilyn just a couple of fumbling know-nothings, entrusted with two babies, ignorant of all the ways that life could go wrong. "Your girls are very lucky," Richard added, and David just nodded because he couldn't bring himself to speak. Dinner was a single turkey thigh split between two people, a table with two place settings, a pumpkin pie whose leftovers would be eaten for four subsequent days. "She'll go down for a nap soon," David said as he cleared the table. "Should we throw the ball around for a while?" His dad looked surprised, pleased. He nodded. "I'd like that." * * * — His wife was a good actress. He watched her, across the room in a showy three-story neoclassical belonging to the dean of the medical school, Violet wrapped against her chest in a sling, swaying slightly from left to right, sipping modestly from a glass of red wine, smiling in a way that was at once sleepy and beatific as she said, "I just love being a mom. It's the most fun I've ever had." He begged to differ. At home, she seemed skittish and miserable and crazy, cooing maniacally to either baby or hand-washing bibs and onesies with the demented ferocity of an old-world Italian grandmother. She slept hard and fast, in short bursts, in a way that seemed both deeply unhealthy and innately functional—he did the same thing, working so much that he could no longer distinguish a Tuesday from a Friday, dusk from dawn. She came to visit him at school sometimes with the babies, and she accepted the hugs he gave her like a junkie, clung to him like Velcro and didn't let go until he did. It always pained him a little to pull away from her. She was talking to one of his professors, a neurologist in his forties. He wasn't sure what version of her Dr. Fletcher was seeing—the charming, beautiful, confident woman who made him feel protective and jealous? Or the sleep-deprived, hormonally flimsy, unoccupied housewife who had the audacity to say things like _It's the most fun I've ever had_? "High praise," his teacher said, and David felt an immediate stab of pity for his wife. She was still so young and looked it suddenly. He could see her façade starting to buckle, and he excused himself from a circle of classmates and went to her, touching the small of her back. "Just hearing about the joys of new parenthood," Dr. Fletcher said, smiling in a way that might have been mocking—mocking Marilyn? His wife looked at him with something like desperation: _please don't sell me out, not in front of all these people; I know I was crying in the shower this morning but please just play along._ "It's the most gratifying, terrifying, wonderful thing in the world," David said, unusually flowery, and Marilyn smiled at him, leaned back into his hand. "Do you have children?" she asked Dr. Fletcher. Wendy was at home being minded by a neighbor; Violet was ten weeks old and too young to be left with a sitter; it had seemed like too much to bring both girls, but he knew that Marilyn felt Wendy's absence like a phantom limb. "God, no," the doctor said. "I always thought it would be unfair, given the hours I keep." Marilyn flushed; David watched her. "But hey," Dr. Fletcher said. "Some people make it work." "Indeed," David said. The doctor leaned in conspiratorially. "I'd advise you guys to stop at two, though. Corrigan's got four kids and he can barely stay upright." He nodded over to one of David's supervisors at the hospital, who was standing beside a woman David presumed to be his wife, both of them looking like the walking dead, wide-eyed and used up, their defeated bodies slouched away from each other. _"Four?"_ He cupped his hand more firmly around his wife's hip. "Fell asleep standing up during an appendectomy last week," Dr. Fletcher said as Marilyn excused herself. He couldn't tell what it meant when she squeezed his hand and slipped away. She was quiet on the way home. "Nice house, huh?" he asked as they walked across the lighted bridge over the river. "I didn't realize there _were_ houses like that around here." Immediately he realized he was opening a door he'd worked hard to barricade closed. "Yes, such a far cry from our neighborhood," she said, lifting her hand to shield Violet's sleeping face from the passing headlights. Their corner of Iowa City was on the run-down side but it was quiet; there was a park a few blocks from the house where she could take the girls. It was warm and safe. He bristled, but before he could take offense she reached for his arm, wove hers through the bend in his elbow. "Sorry," she said. "I'm in a mood." "Fletcher's a condescending asshole," he said. She pulled him closer, their hips bumping together a few times until they found their stride. "He must think I'm— What did I say to him? _The most fun I've—_ What an asinine thing to— Ugh. I just hope I didn't embarrass you," she said dejectedly. She wasn't looking at him, had her eyes fixed on a blinking light down the river. He shook his head vigorously. "Of course not. Never." "I wonder if I'll ever have something interesting to say again." "You're being too hard on yourself," he said. "You're placating me." She swung her bag around her arm. "I would kill for a cigarette." It was a habit she'd ramped up when they moved to Iowa, though she'd given it up when she'd gotten pregnant with Wendy and was abstaining still, while she was breast-feeding Violet. "Yet another earthly pleasure that would arguably help to keep me sane, and yet..." "We're not earthly?" he asked. "Me and the girls?" "The girls and I," she corrected. "No. You're ethereal. My intangible everything." The statement seemed both incredibly romantic and unbearably sad. When they arrived home, he dispatched the sitter while Marilyn went to check on Wendy. He made a couple of peanut butter and jelly sandwiches, knowing that Marilyn hadn't eaten much at the party. When he brought them to their bedroom, Marilyn was nursing Violet, holding her in one arm while the other hand traced lines up and down Wendy's back—Wendy, who was curled in the crook of Marilyn's knee, breathing deeply. And there she was, his wife, home again, back with her babies, freed from having to needlessly justify her existence to the likes of Fletcher. She raised her eyes to him and he weakened at the knees. "Would I know if I had mastitis?" she asked him, frowning down at herself. "Also, Wendy needs to be changed if you don't mind." They would repeat it for years to come in times of strife: _the most fun I've ever had._ # CHAPTER NINE Violet remembered, from her days as a litigator, the rule of contending with a PR scandal: head it off at the pass and it could remain thereafter within your control. This was the approach she was taking for their dinner with Jonah. Matt was gravely concerned about it; he met every mention leading up to the evening with an _Are you sure you want to do that_ look, the kind of look that said, _I'm not going to stop you but only because I'd rather you stop yourself._ For this reason, proceeding with the dinner also gave her a certain satisfaction, that childish fuck-you logic present in most marriages, the contrarian impulse to do something simply because your husband didn't want you to. There was no extant protocol for how to introduce your relinquished child to your husband, or for how to introduce him to the children you'd had on purpose, the children you'd never given a second thought to keeping. So Violet ordered pizza—everyone liked pizza, didn't they?—and made sure there was an ample supply of wine on hand for herself and Matt, and she explained to Wyatt and Eli, as best she could, that families came in all forms, that she'd been a different person fifteen years ago, that she didn't even
[ 1457, 2816, 3228, 13, 27062, 187, 659, 15, 26456, 20496, 6554, 13, 1457, 2816, 3228, 13, 18471, 187, 473, 20957, 6822, 285, 611, 482, 73, 482, 3227, 27498, 13, 10916, 311, 21362, 13, 22085, 13, 27698, 1253, 39134, 187, 3973, 4731, 1747, 1050, 6412, 313, 28211, 33641, 13, 1457, 8911, 10, 187, 18671, 17729, 4568, 5527, 3315, 302, 5003, 14912, 13, 5003, 14912, 13, 5002, 13, 33531, 187, 8742, 9757, 8170, 11397, 13, 46827, 8742, 9757, 13, 5002, 13, 32921, 187, 20176, 2418, 27314, 13, 15915, 13, 20176, 13, 32921, 187, 3313, 11417, 273, 13416, 16790, 13, 5041, 13, 399, 15, 36, 904, 32921, 187, 10718, 9224, 13, 253, 17709, 16790, 13, 399, 357, 2191, 6696, 13, 285, 643, 13790, 9195, 323, 253, 5002, 6516, 273, 10784, 313, 4218, 17556, 582, 17231, 324, 6736, 13, 5002, 13, 32921, 187, 1879, 33040, 3995, 273, 253, 416, 561, 2034, 66, 254, 8273, 273, 37349, 13, 32698, 13, 1457, 2816, 13, 33287, 1253, 746, 1348, 187, 31465, 4383, 24496, 266, 6412, 13, 4255, 8072, 23041, 4412, 13, 10188, 22165, 13, 14614, 13, 32921, 187, 45817, 6516, 13, 2499, 273, 8068, 13, 8068, 13, 11545, 13, 26237, 29145, 13, 6312, 275, 31039, 407, 253, 24193, 5882, 273, 2552, 398, 19995, 708, 38881, 15, 187, 10916, 311, 21362, 11032, 273, 3975, 13, 10916, 311, 21362, 13, 22085, 13, 26237, 33287, 13, 6312, 31687, 407, 11366, 466, 38881, 15, 187, 2828, 6412, 45374, 30103, 13, 21034, 3423, 21706, 13, 11314, 13, 31610, 1253, 746, 1619, 15, 187, 20718, 29565, 36479, 390, 7088, 73, 489, 29565, 36479, 13, 17231, 324, 6736, 13, 5002, 13, 31687, 187, 8182, 5801, 88, 2284, 313, 373, 1435, 273, 253, 14176, 273, 253, 36943, 273, 22085, 582, 10916, 311, 21362, 13, 22085, 13, 31687, 1253, 746, 1717, 313, 47954, 407, 11366, 466, 38881, 481, 187, 330, 15, 20037, 254, 16790, 13, 10916, 311, 21362, 13, 22085, 13, 6312, 31039, 407, 11366, 466, 38881, 15, 187, 3995, 273, 15887, 411, 15, 8966, 13, 12529, 257, 29572, 13, 41431, 274, 498, 1648, 49983, 13, 1457, 2816, 187, 17698, 434, 12318, 8273, 346, 4257, 6696, 995, 27709, 2499, 13, 1457, 28093, 13, 20973, 13, 4158, 7318, 15, 32921, 13, 4270, 1501, 18256, 4087, 187, 187, 4941, 209, 187, 16927, 187, 187, 36, 22644, 187, 187, 21950, 11106, 12593, 187, 187, 11389, 4361, 187, 20554, 13, 7727, 15, 21804, 3358, 443, 2921, 1261, 263, 7088, 73, 489, 15, 11988, 13, 14070, 27, 20695, 5687, 13, 11299, 323, 253, 22717, 1546, 9541, 6807, 15, 1269, 2886, 559, 32047, 7266, 9944, 21640, 33954, 13, 20314, 20561, 13, 3605, 15, 2490, 17353, 4584, 13, 8444, 13680, 13, 1407, 15, 2726, 2505, 407, 14089, 2205, 7634, 83, 13651, 13, 26378, 16026, 330, 3358, 13, 6086, 9545, 1771, 40019, 13, 8652, 5405, 6595, 13, 285, 330, 15, 15197, 16156, 15, 21804, 3358, 443, 2921, 1261, 263, 7088, 73, 489, 27, 22717, 285, 10718, 273, 6676, 15118, 15, 1457, 2816, 27, 5687, 273, 253, 2448, 6516, 273, 22717, 84, 13, 3690, 904, 31610, 15, 313, 6802, 83, 565, 13, 1457, 2816, 27, 12073, 8040, 80, 5687, 13, 14828, 15, 964, 10, 187, 18059, 620, 466, 13, 416, 4182, 15, 21804, 3358, 7088, 73, 489, 27, 3032, 7813, 285, 2213, 9440, 35052, 15, 1457, 2816, 27, 411, 15, 411, 15, 34909, 708, 6487, 13, 5215, 15, 187, 187, 7504, 4859, 15267, 21804, 3358, 443, 2921, 1261, 263, 7088, 73, 489, 27934, 21780, 285, 9380, 13, 49325, 1253, 16134, 15, 7518, 69, 407, 253, 4487, 273, 24440, 723, 708, 23728, 13, 329, 635, 22717, 1546, 708, 25913, 15118, 11397, 13, 12746, 2499, 15, 187, 6412, 273, 659, 15, 26456, 20496, 6554, 313, 4257, 2816, 13, 427, 15, 58, 2698, 27934, 21780, 13, 36754, 1253, 746, 1619, 15, 7518, 69, 407, 253, 4487, 273, 24440, 723, 708, 23728, 13, 329, 635, 22717, 1546, 708, 25913, 15118, 11397, 13, 12746, 2499, 15, 187, 2828, 6412, 45374, 30103, 13, 21034, 3423, 21706, 13, 16432, 187, 15650, 2892, 273, 14469, 5041, 275, 37783, 187, 659, 15, 2516, 434, 10643, 47441, 6412, 13, 4255, 43839, 13, 20973, 187, 24216, 11405, 254, 1108, 21804, 3358, 443, 15, 7088, 73, 489, 187, 11376, 253, 3313, 11417, 273, 13416, 16790, 13, 5041, 13, 399, 15, 36, 15, 187, 743, 1219, 24656, 273, 33245, 34174, 12800, 407, 21804, 3358, 7088, 73, 489, 13, 2130, 275, 2120, 2505, 285, 342, 2120, 21282, 494, 3239, 3888, 275, 253, 2499, 273, 7758, 16132, 47304, 187, 7379, 10206, 2448, 41486, 8, 17061, 378, 527, 723, 27, 21804, 3358, 7088, 73, 489, 1744, 187, 1413, 27, 1093, 2090, 10782, 187, 1413, 27, 746, 1348, 8923, 187, 1413, 27, 7878, 3532, 406, 14407, 474, 38446, 187, 1413, 27, 11796, 7659, 80, 38446, 187, 1413, 27, 40, 837, 280, 3555, 2401, 38446, 187, 1413, 27, 32086, 280, 382, 38446, 187, 1413, 27, 10818, 20478, 3555, 2401, 38446, 187, 1413, 27, 29520, 44435, 3555, 2401, 38446, 187, 1413, 27, 29520, 3555, 2401, 38446, 187, 1413, 27, 7878, 10038, 49431, 474, 38446, 187, 1413, 27, 18551, 5671, 84, 273, 5798, 742, 83, 932, 187, 1413, 27, 18551, 5671, 84, 432, 5002, 187, 1413, 27, 18551, 5671, 84, 432, 1457, 2816, 3228, 187, 1413, 27, 39, 3827, 84, 273, 253, 2448, 6516, 273, 22717, 84, 187, 1413, 27, 24774, 2399, 66, 4913, 313, 19346, 14912, 10, 187, 1413, 27, 746, 394, 14, 9888, 2448, 38446, 187, 1413, 27, 938, 394, 14, 9888, 2448, 38446, 18, 15, 7327, 273, 253, 14723, 187, 510, 1246, 3688, 7033, 281, 247, 7534, 6981, 285, 247, 7534, 6981, 6576, 15, 187, 16621, 10888, 13, 18124, 1975, 13, 5793, 285, 1142, 643, 12277, 403, 1146, 2684, 1046, 1388, 275, 30684, 15, 3900, 247, 10665, 2408, 273, 4116, 556, 10748, 644, 4845, 327, 824, 7534, 894, 6981, 272, 323, 7497, 13, 436, 310, 671, 320, 7552, 625, 1774, 275, 253, 1673, 273, 5893, 15519, 285, 6296, 4444, 3275, 3839, 15, 187, 34, 9086, 26441, 2561, 2170, 275, 16775, 310, 253, 1263, 273, 894, 6437, 14, 3372, 395, 6355, 4795, 275, 894, 14, 39765, 18438, 285, 894, 14, 3992, 15921, 3560, 407, 6774, 894, 10346, 15, 380, 638, 14, 1844, 16241, 281, 811, 423, 13151, 10346, 273, 2176, 894, 3104, 715, 4375, 273, 5066, 310, 43527, 281, 253, 1263, 273, 10142, 6578, 15, 831, 476, 320, 13366, 10405, 1701, 347, 894, 2685, 285, 14572, 13, 246, 7851, 272, 285, 5743, 273, 38481, 10185, 534, 310, 247, 2234, 8981, 3213, 13, 14170, 281, 253, 14335, 22056, 3066, 10564, 2899, 968, 285, 4720, 811, 423, 13151, 10346, 390, 1073, 7760, 6090, 15, 12526, 13, 281, 3522, 13, 954, 273, 253, 6981, 5609, 403, 417, 3782, 5547, 323, 253, 1263, 273, 841, 6297, 15, 19728, 13, 253, 5020, 273, 2175, 7668, 894, 14572, 285, 47351, 5802, 7842, 5263, 452, 4981, 1701, 26802, 2718, 10646, 894, 2685, 285, 19707, 4073, 403, 6537, 4981, 2182, 40674, 29131, 15, 6102, 7313, 403, 20793, 407, 247, 1180, 273, 2616, 15, 35346, 13, 253, 4103, 1781, 49821, 2313, 14620, 10, 1979, 273, 253, 2629, 5253, 1729, 408, 3927, 7787, 253, 13424, 7370, 447, 281, 253, 19561, 2494, 26954, 4811, 15, 32216, 13, 824, 2175, 476, 760, 320, 4981, 1701, 281, 1263, 2014, 990, 14, 10801, 285, 2550, 320, 4981, 1701, 281, 9186, 894, 10165, 275, 10346, 15, 12245, 314, 13, 5748, 22939, 569, 2905, 281, 253, 19474, 12087, 273, 253, 5253, 26802, 7118, 2701, 3924, 14, 4919, 275, 5999, 313, 5996, 14, 11097, 318, 10, 1783, 273, 253, 14036, 5289, 313, 36824, 375, 30166, 285, 25345, 8094, 481, 6610, 285, 954, 15538, 13, 253, 7312, 8310, 9894, 7027, 875, 608, 1253, 1229, 2909, 323, 14572, 4679, 15, 8057, 254, 2175, 403, 2424, 281, 1263, 6774, 44922, 5018, 327, 14335, 285, 16162, 4315, 22056, 15, 496, 436, 2743, 13, 2175, 12600, 281, 253, 2538, 273, 32038, 1100, 452, 8127, 644, 3710, 281, 7842, 5263, 327, 15921, 6437, 22056, 285, 452, 417, 644, 6508, 281, 253, 1263, 273, 894, 44922, 15, 1198, 1650, 13, 2173, 32038, 1100, 452, 644, 2011, 281, 10808, 14572, 5263, 342, 8655, 4865, 273, 21420, 281, 9276, 2300, 14, 18, 13, 5010, 1929, 347, 3437, 3439, 15, 187, 13349, 1574, 7607, 5609, 323, 894, 15921, 390, 4865, 12277, 6388, 253, 3302, 14037, 273, 247, 2553, 273, 247, 2813, 342, 247, 6605, 13, 5431, 247, 2601, 15, 15993, 403, 17063, 4830, 253, 6605, 285, 4136, 281, 16359, 15, 11977, 253, 29116, 273, 253, 1341, 13, 253, 2813, 310, 4845, 327, 247, 12220, 3924, 387, 5345, 3272, 330, 904, 534, 310, 7660, 281, 271, 28483, 17199, 323, 5304, 1783, 13, 390, 31506, 281, 247, 1462, 14, 21636, 12220, 3924, 285, 10005, 273, 894, 4865, 476, 320, 10141, 387, 11508, 342, 253, 28483, 17199, 15, 380, 7467, 273, 841, 12277, 778, 320, 12848, 7293, 327, 253, 894, 1386, 285, 4327, 273, 5390, 18438, 15, 11977, 894, 15921, 13, 1959, 1341, 778, 320, 11974, 1977, 285, 247, 6774, 894, 1385, 778, 320, 4824, 562, 15, 187, 8430, 841, 3082, 2085, 441, 342, 10020, 14, 17149, 6716, 1491, 5001, 247, 894, 1511, 434, 15430, 323, 247, 1798, 5390, 18438, 13, 627, 310, 642, 2969, 1332, 323, 11745, 1894, 5837, 273, 4865, 390, 3082, 17690, 247, 16707, 1263, 273, 894, 14572, 13, 253, 40409, 9232, 407, 253, 5390, 18438, 285, 6774, 14170, 15, 5488, 13, 1480, 2175, 273, 2544, 275, 894, 15448, 13, 894, 3116, 285, 19183, 2544, 2550, 320, 2530, 4354, 342, 841, 5609, 1580, 13, 8925, 253, 24273, 273, 14170, 285, 4795, 21418, 2544, 4419, 2709, 37221, 4679, 1146, 15626, 387, 1027, 2069, 15, 187, 19, 15, 11451, 273, 13036, 3975, 187, 54, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 27043, 13, 9913, 313, 4678, 25083, 1162, 355, 10, 8631, 247, 4228, 6981, 534, 19235, 1057, 417, 452, 667, 8180, 273, 894, 2685, 285, 14572, 15, 187, 510, 3745, 273, 308, 14, 13101, 19682, 275, 253, 2614, 4963, 281, 29534, 281, 253, 43427, 13, 5234, 281, 247, 1733, 587, 13466, 285, 34165, 949, 253, 14335, 3828, 310, 25048, 347, 247, 3309, 8284, 323, 253, 3576, 275, 8427, 4866, 390, 347, 352, 310, 4536, 6289, 281, 13, 22003, 273, 2173, 36329, 749, 14, 43221, 15, 9849, 874, 12277, 403, 2218, 275, 5019, 342, 14170, 12277, 1580, 1563, 15921, 28, 1341, 403, 3264, 281, 5234, 281, 253, 1733, 587, 13466, 15, 9849, 874, 12277, 403, 7515, 407, 26230, 253, 4313, 273, 1341, 17362, 18314, 30554, 33289, 3658, 285, 253, 4702, 273, 1484, 1658, 24322, 313, 24210, 273, 253, 28417, 8105, 481, 2596, 273, 253, 2201, 23797, 273, 436, 285, 253, 2045, 15921, 12277, 310, 253, 38307, 2216, 313, 18227, 14329, 19459, 285, 2709, 973, 23462, 582, 534, 1057, 417, 387, 512, 28788, 253, 275, 8427, 4112, 15, 187, 510, 954, 7744, 908, 894, 811, 78, 15037, 6981, 310, 247, 7321, 773, 35384, 3354, 9320, 668, 6981, 824, 347, 2529, 275, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 36554, 13, 33964, 313, 28246, 328, 1162, 355, 481, 831, 8687, 18005, 253, 14270, 273, 247, 10671, 273, 1341, 949, 247, 39375, 11303, 6384, 762, 253, 4833, 273, 247, 44146, 1595, 974, 386, 13, 17415, 390, 894, 14, 13472, 15, 3856, 253, 9080, 273, 253, 39375, 2324, 403, 1679, 685, 253, 9080, 273, 253, 1341, 762, 5839, 13, 824, 326, 253, 1341, 1364, 22403, 3746, 275, 1340, 281, 29684, 949, 253, 36331, 7624, 26736, 271, 24760, 281, 253, 811, 423, 13151, 10346, 273, 1341, 275, 13424, 5989, 15, 7243, 1341, 403, 17063, 4830, 253, 6384, 13, 253, 9320, 476, 320, 10729, 323, 11508, 689, 673, 387, 247, 7470, 3276, 13, 3798, 5345, 3272, 15, 11977, 436, 13, 253, 5004, 9320, 390, 7285, 1930, 273, 253, 1755, 9320, 778, 320, 15626, 323, 1341, 326, 452, 29172, 949, 253, 39375, 11303, 6384, 15, 187, 54, 15, 52, 15, 2790, 15, 1621, 15, 577, 13, 49416, 13, 30768, 313, 8469, 343, 4297, 261, 1162, 355, 582, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 25676, 13, 38464, 313, 8620, 6481, 1162, 355, 582, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 19044, 13, 40666, 313, 8620, 6481, 1162, 355, 582, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 42389, 13, 27865, 313, 45074, 1162, 355, 10, 285, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 39855, 13, 28315, 313, 53, 348, 8500, 10, 403, 6867 ]
New York City, 1917 St. Vincent Ferrer, New York City, 1920 Oahu College and Kamehameha Schools, Honolulu, Hawaii, 1915–1920 First Congregational Church (Montclair, New Jersey) Marine Corps Recruit Depot San Diego, San Diego, California, 1921 Los Angeles Central Library, Downtown Los Angeles, California, 1924 Nebraska State Capitol, Lincoln, Nebraska, 1924 National Academy of Sciences Building, Washington, D.C., 1924 Master Plan, the Physics Building, Dabney Hall, and other campus buildings for the California Institute of Technology (Caltech), Pasadena, California, 1924 Fraternity House of the Rensselaer Society of Engineers, Troy, New York, 1922–1924 Trinity English Lutheran Church, West End Historic District, Fort Wayne, Indiana, 1924 Oriental Institute, University of Chicago, Chicago, Illinois, commissioned 1919, completed in 1931 by the successor firm of Mayers Murray & Phillip. Honolulu Museum of Art, Honolulu, Hawaii, commissioned 1922, completed 1927 by Hardie Phillip. Christ Church Cranbrook, Bloomfield Hills, Michigan, 1925–1928. Memorial Flagpole or Goodhue Flagpole, Pasadena, California, 1927 Lihiwai (residence of the governor of the Territory of Hawaii), Honolulu, Hawaii, 1927–1929 (completed by Hardie Phillip). C. Brewer Building, Honolulu, Hawaii, completed 1931 by Hardie Phillip. House of Philip W. Henry, Linden Circle, Briarcliff Manor, New York Wolf's Head Society "New Hall", Yale University, New Haven, Connecticut, designed ca. 1924, built posthumously References Notes Citations Works cited Further reading Oliver, Richard. Bertram Grosvenor Goodhue. Cambridge, Massachusetts: MIT Press, 1983 for the Architectural History Foundation. xii + 297 pp.; 146 illustrations, bibliography, index. Whitaker, Charles Harris, ed. With text by Hartley Burr Alexander, Ralph Adams Cram, George Ellery Hale, Lee Lawrie, and C. Howard Walker. Bertram Grosvenor Goodhue: Architect and Master of Many Arts. New York: Press of the American Institute of Architects, Inc., 1925. (Reprint, New York: Da Capo Press, 1976. .) Wyllie, Romy. Bertram Goodhue: His Life and Residential Architecture. New York: W. W. Norton & Company, 2007. External links Bertram Grosvenor Goodhue architectural drawings and papers, 1882–1980. Held by the Department of Drawings & Archives, Avery Architectural & Fine Arts Library, Columbia University. Church of St. Vincent Ferrer (New York, N.Y.) architectural drawings, 1908–1928. Held by the Department of Drawings & Archives, Avery Architectural & Fine Arts Library, Columbia University. Christ Church Cranbrook, Bloomfield Hills, MI Online history of Hotel Washington in Panama St. John's Episcopal Church, West Hartford, Connecticut Font Designer – Bertram G. Goodhue About the National Academy of Sciences Building, Washington, D.C. An Alphabet of Celebrities illustrated by Bertram Goodhue, available in full text and with full zoomable page images in the University of Florida Digital Collections UNCG American Publishers' Trade Bindings: Bertram Goodhue Category:1869 births Category:1924 deaths Category:American Neoclassical architects Category:Art Deco architects Category:Gothic Revival architects Category:Historicist architects Category:Mediterranean Revival architects Category:Spanish Colonial Revival architects Category:Spanish Revival architects Category:American ecclesiastical architects Category:Architects of cathedrals Category:Architects from California Category:Architects from New York City Category:Fellows of the American Institute of Architects Category:Balboa Park (San Diego) Category:19th-century American architects Category:20th-century American architects1. Field of the Invention The present invention relates to a biological assay and a biological assay apparatus. Biochemical, microbiological, chemical and many other assays are being performed every day in laboratories. While a considerable amount of attention has naturally been placed on such biological cell assaying for humans, this is also be becoming more important in the field of animal welfare and indeed plant production generally. A rapidly advancing research area in biology is the study of cell receptor-ligand interactions resulting in cell-substratum and cell-cell adhesion followed by subsequent cell migration. The pre-requisite to transendothelial migration of certain cell lines into sites of infection is paramount to the study of inflammatory diseases. This can be briefly summarised as cell flow and rolling, tethering and activation of integrin receptors which is a key recognition step, attachment to the endothelial ligands via activated integrins and finally transendothelial migration or diapedesis. Unfortunately, to date, most of the assay techniques are not particularly successful for the study of these mechanisms. Currently, the majority of studies involving cell rolling and chemokine induced cellular arrest have utilised capillary systems wherein cell flow and shear stress are controlled utilising syringe pumps. Such observations are constrained by a number of factors. Firstly, the relative large (>100 μm) size of the standard glass capillaries limits the physiological analogies to the proximal microvascular regions. Secondly, such studies can only be utilised to study single end-points and cannot be utilised to examine cell choices in migration. Thirdly, optical aberrations related to the spherical geometry of the glass capillary sections limit stage-related in situ (post-fixation) analysis of the intracellular structures (cytoskeleton and signalling molecules). Finally and most importantly, the usual observation periods lie between 5–30 minutes for rolling experiments. Longer studies are required to study subsequent crawling steps on endothelial and extracellular matrix ligands. In this regard, studies relating to the effects of chemokines have largely been limited to cellular arrest on adhesion receptor ligands and have not been extended to the study of cell crawling. For example, specific chemokines have been shown to induce rolling arrest with enhanced binding of lymphocytes to ICAM-1, otherwise known as CD54. Presently accepted techniques for cell adhesion or binding assays involve the initial coating of a surface of a device with a substrate, typically a protein. Cells are deposited onto the substrate and allowed to settle. Following the settling of the cells, the device is placed on a heating stage at 37° C., which is attached to an inverted microscope for visual analysis, or alternatively to a stand-alone heating stage and progression of cell binding can be checked at intervals with the inverted microscope. The duration of these assays may be varied depending on the cell line and choice of substratum. Following cell adhesion, free cells may be washed away and a subsequent cell count may be carried out. Although these methods provide us with semi-quantitative information regarding a cell type's affinity for a particular substratum, there is no simple method for quantitative characterisation of binding or methods enabling a prolonged study of cell rolling, the ensuing capture by the substratum and subsequent attachment. Furthermore, direct studies of changes in cell morphology, cell growth and biochemical changes cannot be provided easily with these techniques since, determining the kinetics of attachment and resulting morphological changes requires multiple replicated experiments being analysed at different times. 2. Description of Prior Art U.S. Pat. No. 5,998,160 (Berens et al) describes a static assay which unfortunately does not have any consideration of cell flow and rolling. The ability of T-cells circulating in the bloodstream to adhere to the endothelium, switch to a motile phenotype and penetrate through the endothelial layer is recognised as a necessary requirement for the effective in vivo movement or as it is sometimes referred to, trafficking of specific lymphocyte sub-populations. Motility assays are done in combination with attachment assays since following adhesion; cells are expected to switch to the motile phenotype. Motility assays are assessed by estimating the ratio of cells undergoing cytoskeletal rearrangements and the formation of uropods (extension of the trailing tail). One of the major disadvantages of this and the previous adhesion assays is the geometrical design (microscope slides and multiple well chambers), which does not at all resemble the in vivo situation. The most commonly used cell transmigration assay is a modified “Boyden chamber” assay such as described in U.S. Pat. No. 5,578,492 (Fedun et al). This involves assessing the crossing of a quantity of cells through a microporous membrane under the influence of a chemoattractant, recombinant or cell-derived. Here the diameter of the micropores are less than the diameter of the cells under investigation, such that the cells must deform themselves in order to squeeze through the pores thereby constructing an analogy to the transendothelial migration of cells in physiological circumstances. Once cells are deposited onto the membrane, the chamber can be incubated for intervals over time at a suitable temperature, usually 37°. Following this, the bottom chamber or opposite side of the top chamber may be analysed for cells that have squeezed through the microporous membrane. U.S. Pat. No. 4,912,057 (Guirguis et al), U.S. Pat. No. 5,284,753 (Goodwin et al), U.S. Pat. No. 5,302,515 (Goodwin et al), U.S. Pat. No. 5,514,555 (Springer et al) and U.S. Pat. No. 5,601,997 (Tchao) are typical
[ 253, 17498, 285, 253, 9246, 403, 13400, 715, 253, 8039, 2317, 13, 253, 10358, 310, 9583, 342, 253, 17498, 15, 380, 17498, 2133, 556, 29239, 4447, 327, 253, 11884, 7123, 10445, 15, 380, 29239, 13791, 342, 253, 8039, 2317, 13, 594, 326, 253, 4667, 273, 9246, 403, 16589, 432, 253, 29239, 15, 2091, 253, 9246, 16589, 432, 253, 29239, 403, 2918, 407, 1133, 285, 37196, 281, 2746, 1016, 643, 13, 253, 10358, 285, 253, 17498, 476, 320, 44894, 2961, 432, 1016, 643, 15, 187, 3039, 824, 247, 1930, 3727, 12433, 282, 310, 2918, 407, 1133, 13, 253, 9246, 403, 26187, 10184, 285, 3021, 253, 10358, 285, 253, 17498, 403, 25962, 1075, 595, 44894, 2961, 432, 1016, 643, 15, 10022, 13, 275, 1340, 281, 3693, 824, 25962, 41454, 44894, 5585, 13, 247, 4021, 5569, 1930, 3727, 12433, 282, 556, 644, 2530, 15, 187, 34, 12433, 282, 10557, 275, 11754, 27746, 337, 310, 247, 4021, 5569, 1930, 3727, 12433, 282, 1690, 27, 247, 1930, 3727, 5569, 5122, 2530, 407, 247, 11884, 4667, 273, 9246, 313, 7053, 285, 1273, 9246, 558, 285, 247, 594, 14, 8890, 2914, 7450, 5569, 5122, 2530, 407, 247, 2626, 1791, 4447, 875, 253, 11884, 4667, 273, 9246, 15, 187, 2214, 44894, 2977, 253, 10358, 285, 253, 17498, 273, 824, 247, 1930, 3727, 12433, 282, 432, 1016, 643, 13, 253, 9246, 327, 11884, 7123, 273, 253, 12433, 282, 403, 10184, 27162, 323, 44276, 253, 1930, 3727, 5569, 5122, 1223, 247, 3727, 6409, 327, 247, 1755, 1930, 273, 253, 12433, 282, 310, 10184, 323, 44276, 253, 2914, 7450, 5569, 5122, 15, 187, 14131, 13, 1014, 672, 253, 12433, 282, 310, 2918, 285, 253, 11884, 4667, 273, 9246, 403, 26187, 10184, 13, 5569, 476, 320, 8838, 13, 594, 326, 25962, 41454, 44894, 5585, 875, 253, 10358, 285, 253, 17498, 476, 320, 14415, 15, 187, 34, 12433, 282, 10557, 275, 11754, 27746, 374, 3797, 27, 247, 1930, 3727, 5569, 5122, 2530, 407, 247, 11884, 4667, 273, 9246, 28, 285, 247, 30650, 5569, 3558, 15432, 327, 247, 1755, 1930, 273, 253, 17498, 15, 329, 12378, 273, 253, 5569, 3558, 310, 3982, 715, 3057, 342, 253, 9246, 275, 253, 17498, 281, 3657, 44894, 5585, 273, 253, 9246, 15, 187, 688, 824, 247, 1930, 3727, 12433, 282, 13, 347, 1048, 347, 253, 5569, 3558, 310, 873, 387, 247, 4021, 5569, 1899, 13, 1014, 672, 253, 12433, 282, 310, 2918, 285, 253, 11884, 4667, 273, 9246, 403, 26187, 10184, 13, 5569, 476, 320, 8838, 984, 253, 5569, 3558, 16897, 253, 4866, 273, 253, 9246, 15, 3308, 13, 25962, 41454, 44894, 5585, 875, 253, 10358, 285, 253, 17498, 476, 320, 14415, 15, 1623, 253, 643, 1133, 13, 672, 253, 5569, 3558, 310, 4395, 432, 253, 4021, 5569, 1899, 281, 247, 3727, 1899, 13, 253, 5569, 3558, 310, 417, 275, 3057, 342, 253, 9246, 13, 594, 326, 253, 4021, 5569, 1159, 310, 13603, 285, 3021, 253, 10358, 285, 253, 17498, 476, 320, 9583, 285, 44894, 2961, 275, 253, 1072, 5133, 347, 1110, 273, 247, 6867, 1930, 3727, 12433, 282, 15, 510, 6323, 3790, 273, 1986, 14726, 7952, 1818, 16685, 3407, 327, 7216, 275, 11228, 79, 13, 6176, 13, 281, 2007, 1287, 253, 773, 2211, 839, 11595, 668, 323, 16994, 253, 30951, 4104, 7785, 14297, 13, 534, 13698, 281, 1978, 3276, 22844, 436, 5331, 13, 973, 2708, 374, 7759, 330, 1241, 3750, 15, 187, 187, 1628, 1231, 403, 49379, 253, 5460, 16274, 273, 7952, 1818, 4768, 253, 1533, 7521, 753, 253, 16155, 9526, 273, 7379, 28678, 15836, 13, 39206, 444, 16056, 6859, 13, 387, 247, 2315, 8059, 15, 187, 187, 1628, 8267, 24542, 8249, 2603, 310, 7746, 441, 326, 841, 16274, 588, 760, 755, 7197, 604, 359, 513, 417, 2953, 7952, 1818, 285, 352, 671, 8599, 441, 326, 776, 3497, 273, 673, 323, 15974, 352, 310, 11196, 1077, 3517, 1806, 703, 2879, 15, 187, 187, 10951, 13, 703, 753, 13, 253, 5213, 3114, 1364, 3426, 253, 7785, 14297, 9600, 13, 390, 6498, 11595, 13, 281, 33243, 1225, 253, 2442, 273, 253, 7158, 15, 187, 187, 25110, 13, 2515, 1364, 320, 5520, 281, 8046, 4343, 281, 320, 625, 24683, 275, 8925, 616, 1211, 3872, 7823, 281, 3468, 1066, 4156, 18384, 15, 187, 187, 3404, 253, 7379, 28678, 15836, 12651, 313, 27004, 1508, 10, 2918, 1390, 4596, 762, 253, 9550, 273, 401, 27520, 13, 12390, 5821, 281, 28523, 285, 3426, 616, 789, 281, 1691, 275, 1659, 253, 9600, 1108, 15335, 1929, 347, 253, 7785, 14297, 7733, 35226, 313, 4899, 28124, 10, 1108, 387, 14055, 1348, 275, 13593, 319, 547, 13, 16795, 1735, 4565, 15, 187, 187, 3404, 436, 11228, 79, 4804, 13, 534, 588, 1408, 949, 884, 2552, 13, 5631, 942, 588, 1265, 34318, 17438, 281, 320, 2457, 1025, 387, 14055, 1348, 15, 187, 187, 17398, 3647, 745, 253, 6498, 11595, 310, 671, 3309, 281, 2939, 1880, 253, 1533, 310, 327, 3540, 281, 5115, 253, 7342, 273, 253, 14464, 7785, 14297, 14155, 27160, 3678, 14839, 13, 1223, 23453, 6031, 281, 1978, 253, 3276, 6054, 281, 1679, 685, 337, 15, 22, 3272, 36, 15, 187, 187, 34937, 436, 807, 13, 4343, 588, 671, 2770, 327, 849, 597, 476, 4311, 598, 616, 7952, 30385, 285, 7092, 275, 253, 638, 14, 14952, 2180, 15, 1876, 4343, 3894, 253, 1859, 326, 7952, 2250, 2720, 281, 9169, 310, 5667, 15, 4, 34834, 4805, 16, 31333, 187, 187, 1748, 5473, 61, 70, 60, 17, 28, 1237, 78, 8, 187, 1559, 1377, 5473, 61, 70, 60, 17, 28, 1787, 78, 8, 187, 6362, 2517, 5473, 61, 70, 60, 18, 28, 1610, 78, 8, 187, 47850, 250, 5473, 61, 70, 60, 17, 28, 78, 8, 187, 187, 13088, 346, 346, 187, 187, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 33870, 28716, 16, 8658, 1506, 16, 1987, 4838, 16, 1541, 24, 15429, 16, 563, 287, 12914, 68, 16, 36, 3180, 16, 22395, 7386, 3172, 20, 19277, 16, 4157, 71, 358, 20, 69, 16, 18833, 16, 4237, 4827, 21686, 64, 36, 3519, 1410, 64, 40952, 64, 3113, 64, 22395, 7386, 3172, 20, 37, 16, 5942, 46, 64, 1542, 64, 22395, 7386, 3172, 20, 37, 16, 187, 15035, 49418, 64, 5942, 46, 64, 50128, 64, 13266, 187, 187, 13088, 428, 70, 346, 4672, 6582, 43443, 40040, 7188, 1419, 253, 5426, 273, 634, 7224, 6362, 2517, 889, 18092, 60, 18, 78, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 61, 18092, 60, 17, 78, 8626, 47850, 250, 94, 275, 3334, 15, 1200, 13, 4390, 2931, 347, 27, 346, 187, 13088, 346, 346, 187, 13088, 428, 70, 26107, 6362, 2517, 889, 18092, 60, 18, 78, 8626, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 889, 18092, 60, 17, 78, 8626, 47850, 250, 13272, 187, 187, 13088, 346, 346, 187, 13088, 346, 510, 1873, 3334, 15, 1200, 310, 3542, 323, 253, 39399, 495, 37, 1943, 5718, 2715, 3, 187, 187, 50202, 428, 81, 10269, 187, 187, 13088, 346, 346, 187, 13088, 346, 15256, 33015, 7770, 3, 187, 13088, 346, 15256, 33015, 7770, 3, 187, 13088, 346, 346, 187, 13088, 346, 510, 6191, 379, 629, 310, 1024, 4561, 275, 17489, 71, 358, 20, 69, 313, 284, 247, 1798, 1083, 6844, 187, 187, 13088, 346, 346, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 18, 66, 14, 39413, 64, 5942, 46, 64, 44112, 9923, 64, 3113, 64, 39, 3172, 84, 64, 5648, 16, 3706, 1056, 187, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 18, 67, 14, 39413, 64, 5942, 46, 64, 44112, 9923, 64, 3113, 64, 39, 3172, 84, 64, 3299, 55, 16, 3706, 1056, 187, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 19, 66, 14, 1088, 64, 5942, 46, 64, 44112, 9923, 64, 2135, 64, 5648, 16, 14463, 3299, 55, 64, 4548, 42, 64, 1088, 64, 26806, 64, 6511, 16, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 19, 66, 14, 1088, 64, 5942, 46, 64, 44112, 9923, 64, 2135, 64, 5648, 16, 14463, 3299, 55, 64, 4548, 42, 64, 1088, 64, 59, 1222, 16, 3706, 1056, 187, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 19, 67, 14, 1088, 64, 5942, 46, 64, 44112, 9923, 64, 2135, 64, 3299, 55, 16, 14463, 3299, 55, 64, 4548, 42, 64, 1088, 64, 26806, 64, 6511, 16, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 19, 67, 14, 1088, 64, 5942, 46, 64, 44112, 9923, 64, 2135, 64, 3299, 55, 16, 14463, 3299, 55, 64, 4548, 42, 64, 1088, 64, 59, 1222, 16, 3706, 1056, 187, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 3269, 53, 64, 4548, 42, 64, 39, 1934, 1410, 64, 59, 17258, 64, 5648, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 3269, 53, 64, 4548, 42, 64, 39, 1934, 1410, 64, 23369, 64, 5648, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 3269, 53, 64, 4548, 42, 64, 39, 1934, 1410, 64, 59, 17258, 64, 3299, 55, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 3269, 53, 64, 4548, 42, 64, 39, 1934, 1410, 64, 23369, 64, 3299, 55, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 3269, 53, 64, 4548, 42, 64, 39, 1934, 1410, 64, 59, 17258, 64, 47825, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 3269, 53, 64, 4548, 42, 64, 39, 1934, 1410, 64, 23369, 64, 47825, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 13086, 10069, 64, 91, 1222, 64, 14323, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 13086, 10069, 64, 91, 1222, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942, 46, 64, 50128, 64, 13266, 9228, 5942, 46, 14, 18, 14, 35, 2431, 64, 20, 37, 64, 22214, 64, 4149, 16, 7834, 14, 20, 14, 2307, 1419, 64, 5942, 46, 64, 16680, 64, 1542, 64, 22395, 7386, 3172, 16, 13086, 10069, 64, 14323, 3706, 1056, 187, 2428, 7224, 30851, 64, 5942 ]
the socket and the legs are inserted into the housing space, the plug is engaged with the socket. The socket body has openings formed on the lateral sides thereof. The openings communicate with the housing space, so that the pair of legs are projected from the openings. When the legs projected from the openings are held by hand and deformed to approach each other, the plug and the socket can be disengaged from each other. When such a side release buckle is held by hand, the legs are accidentally pushed and thus the plug and the socket are unintentionally disengaged from each other. Accordingly, in order to avoid such unintentional disengagement, a double lock side release buckle has been provided. A buckle disclosed in Patent Literature 1 is a double lock side release buckle including: a side release lock mechanism provided by a lateral pair of legs (first and second legs); and a so-called front push lock mechanism provided by a third leg formed between the lateral pair of legs. For disengaging the plug and the socket of such a side release buckle from each other, the legs on lateral sides of the buckle are pushed inward for disabling the side release lock mechanism while a release button on a top side of the buckle is pushed for disabling the front push lock mechanism. Thus, even when the buckle is held and the lateral pair of legs are accidentally pushed, lock can be maintained, so that unintentional disengagement between the plug and the socket can be prevented. A buckle disclosed in Patent Literature 2 includes: a side release lock mechanism provided by a lateral pair of legs; and a movable lock member disposed on a top side of the socket. A projection of the lock member is brought into contact with the legs in the socket to prevent disengagement of the legs. In such a side release buckle, as long as the lock member is set at a double lock position, even when the buckle is held and the lateral pair of legs are accidentally pushed, lock can be maintained because the lock member prevents the movement of the legs. Thus, unintentional disengagement between the plug and the socket can be prevented. On the other hand, when the lock member is moved from the double lock position to a release position, the lock member is not in contact with the legs, so that the double lock function is disabled and thus the plug and the socket can be engaged and disengaged in the same manner as those of a typical side release buckle.The latest round of United Nations climate change negotiations began on Monday in Bonn, Germany, to further develop the “operating manual” for implementing the landmark 2015 Paris Agreement, which aims to keep temperature rises this century, well below 2 degrees Celsius. “We are witnessing the severe impacts of climate change throughout the world”, said the Executive Secretary of UN Climate Change, Patricia Espinosa, at a press conference. “Every credible scientific source is telling us that these impacts will only get worse if we do not address climate change and it also tells us that our window of time for addressing it is closing very soon,” she added. Second, she said, the international community must complete the Paris Agreement guidelines, or operating manual, to unleash the potential of the accord. Third, conditions must be improved to enable countries to be more ambitious in determining their own national policies to slow down global warming. At the UN Climate Change Conference (COP23) held last November under the leadership of Fiji, nations agreed to accelerate and complete their work to put in place the guidelines – officially known as the Paris Agreement Work Programme (PAWP) – at COP24 in Katowice, Poland next December. At this Bonn meeting, which will run through 10 May, Governments will start drafting texts to be finalized at COP24. Finishing off the operating manual is also necessary to assess whether the world is on track to achieve the goals of the historic Paris Agreement limiting greenhouse gas emissions, while pursuing efforts to keep the temperature rise to less than 1.5°C. Throughout this year, countries will also focus on how they can scale up their climate ambition and implementation in the pre-2020 period. All countries share the view that climate action prior to 2020 is essential.#!/bin/bash vert='\e[0;32m' blanc='\e[0;37m' jaune='\e[1;33m' neutre='\e[0;m' echo " " HOME_DSM_MAIN_DIR=/ccc/scratch/cont003/gen7165/durochtc/Codes/SPECFEM3Ds/specfem3d/utils/EXTERNAL_CODES_coupled_with_SPECFEM3D/DSM_for_SPECFEM3D/ export HOME_DSM_MAIN_DIR echo -e "!! CAUTION !! Verify the definition of your ${jaune}\033[1mHOME_DSM_MAIN_DIR\033[0m${neutre} in install.sh, currently defined as: " echo " " echo -e "${jaune}\033[1m${HOME_DSM_MAIN_DIR}\033[0m${neutre}" echo " " echo "The file install.sh is written for the DSM 3D big storage version" mkdir -p bin echo " " echo "============================================================================================================================" echo "============================================================================================================================" echo " " echo "The mesher part is now generated in meshfem3d (as a particular case)" echo " " cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-1a-compute_DSM_coefficients_with_FEMs_SH/ ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-1b-compute_DSM_coefficients_with_FEMs_PSV/ ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-2a-read_DSM_coefficients_back_SH/TraPSV_MPI_read_vertical_faces/ ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-2a-read_DSM_coefficients_back_SH/TraPSV_MPI_read_Zmin/ ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-2b-read_DSM_coefficients_back_PSV/TraPSV_MPI_read_vertical_faces/ ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-2b-read_DSM_coefficients_back_PSV/TraPSV_MPI_read_Zmin/ ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/FFT_MPI_FACES_ZMIN_SH ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/FFT_MPI_FACES_VERT_SH ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/FFT_MPI_FACES_ZMIN_PSV ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/FFT_MPI_FACES_VERT_PSV ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/FFT_MPI_FACES_ZMIN_FULL ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/FFT_MPI_FACES_VERT_FULL ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/ChangeFormat_zmin_disp ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/ChangeFormat_zmin ; make cd ${HOME_DSM_MAIN_DIR}/DSM-1-BIG_3D_storage_version/Part-3-modify_DSM_results_for_SPECFEM/ChangeFormat_disp ; make cd ${HOME_DS
[ 25136, 27376, 982, 11, 313, 45074, 13, 1457, 2816, 13, 15788, 481, 905, 510, 388, 335, 394, 9390, 2442, 310, 5469, 327, 268, 15, 575, 14840, 15, 696, 416, 15, 575, 45, 15, 575, 35455, 13, 500, 15, 575, 9083, 15, 575, 34, 27, 8684, 15, 575, 7475, 15, 575, 13811, 1099, 7444, 313, 13895, 10, 14509, 20, 15, 187, 5804, 251, 367, 10569, 3788, 42311, 44034, 32911, 7648, 21578, 187, 187, 5804, 251, 367, 10569, 3788, 42311, 44034, 32911, 7648, 21578, 1108, 2064, 39123, 48806, 785, 42311, 44034, 496, 76, 7512, 323, 512, 540, 592, 275, 1635, 281, 8103, 512, 3304, 247, 5657, 19736, 1537, 320, 12232, 897, 13, 48806, 785, 42311, 44034, 6832, 2564, 15950, 1977, 3379, 562, 5406, 12878, 2112, 342, 8379, 2879, 1199, 1869, 285, 671, 323, 3906, 13, 275, 253, 2074, 2086, 347, 5882, 29517, 285, 2872, 13297, 285, 18171, 247, 2257, 625, 15, 8651, 3116, 34304, 11684, 634, 2173, 7963, 275, 2905, 281, 2190, 247, 17167, 273, 29124, 2810, 14, 1615, 8565, 1026, 9652, 13, 285, 275, 1635, 281, 326, 12276, 5068, 15643, 2393, 4131, 714, 2196, 1253, 984, 273, 436, 812, 320, 4569, 1663, 954, 13383, 2460, 642, 2647, 39123, 48806, 785, 42311, 44034, 273, 4471, 14, 13634, 4328, 45081, 15, 187, 187, 5804, 251, 367, 10569, 3788, 42311, 44034, 32911, 187, 187, 5804, 251, 367, 10569, 3788, 42311, 44034, 32911, 7648, 21578, 187, 187, 37356, 841, 3104, 13, 440, 36330, 7118, 273, 253, 1798, 5406, 403, 16920, 2779, 281, 320, 1663, 46002, 13, 2170, 6283, 407, 4328, 275, 1635, 281, 4859, 326, 403, 1663, 8191, 33810, 762, 14, 7157, 3111, 588, 5604, 625, 685, 2779, 34304, 320, 1708, 2348, 598, 13546, 3451, 35633, 4198, 8055, 10073, 368, 281, 12654, 9403, 2080, 625, 7445, 4808, 3828, 17683, 323, 13943, 7968, 15, 187, 187, 25997, 14, 13116, 13, 1798, 496, 76, 5718, 20470, 187, 2214, 3687, 5054, 7952, 13, 253, 367, 10569, 3788, 42311, 44034, 556, 608, 11098, 12296, 11100, 15, 2091, 247, 3295, 30214, 13, 816, 436, 11098, 8781, 556, 281, 452, 12059, 15, 187, 187, 8022, 57, 3788, 42311, 44034, 29566, 7177, 2112, 342, 7512, 22774, 273, 253, 1077, 1682, 1029, 3290, 342, 436, 1876, 14, 688, 14, 4041, 15, 2726, 247, 2990, 347, 973, 347, 19516, 14, 15723, 13, 436, 4968, 275, 1635, 6131, 8746, 256, 1356, 22774, 13, 40430, 13, 7446, 284, 275, 1635, 281, 2451, 13789, 15, 187, 187, 12412, 14, 15507, 7177, 3192, 1557, 273, 187, 5804, 251, 367, 10569, 3788, 42311, 44034, 399, 31785, 347, 973, 347, 8439, 1108, 21157, 4021, 14, 21773, 7177, 812, 320, 18319, 10141, 13, 22489, 390, 38728, 264, 275, 1635, 281, 253, 7094, 11217, 13, 4791, 14, 20472, 40897, 1591, 47367, 18700, 49146, 313, 37, 2350, 39, 481, 6995, 808, 285, 4465, 281, 247, 2802, 6795, 19415, 457, 310, 1663, 1682, 323, 4222, 2179, 390, 4579, 272, 15, 187, 187, 42, 25115, 323, 3652, 275, 1635, 281, 3906, 187, 56, 74, 14, 15723, 285, 671, 40768, 4602, 1056, 436, 38194, 3644, 1876, 14, 688, 14, 4041, 440, 681, 37787, 323, 4130, 281, 629, 2112, 342, 3379, 13, 2451, 13, 21036, 285, 2344, 3549, 587, 29660, 432, 9093, 4768, 253, 3906, 390, 1728, 15, 8217, 6037, 17148, 8385, 13276, 368, 281, 15452, 4951, 29660, 432, 23143, 19801, 4382, 347, 973, 347, 13971, 15, 187, 187, 36342, 281, 789, 2366, 342, 187, 34, 721, 15, 19, 50176, 3295, 44202, 1159, 2789, 352, 1077, 3477, 281, 1859, 5055, 13789, 275, 1635, 281, 36129, 36811, 7963, 15, 380, 38405, 36350, 40433, 3797, 15862, 14, 14326, 4021, 4735, 4295, 15, 2053, 10149, 10007, 1007, 1754, 327, 253, 2746, 5055, 13, 8493, 253, 5438, 273, 3520, 20196, 327, 253, 5382, 15, 187, 187, 5804, 251, 367, 10569, 3788, 42311, 44034, 32911, 7648, 21578, 187, 187, 5804, 251, 42311, 44034, 40852, 1227, 28771, 187, 187, 7146, 253, 4384, 3048, 7117, 2708, 281, 21578, 253, 24879, 20, 2313, 32911, 13, 846, 326, 5532, 773, 17964, 668, 281, 6184, 285, 3334, 253, 941, 15, 380, 941, 1416, 30214, 275, 25323, 1889, 70, 323, 7464, 13, 277, 7913, 323, 5602, 14183, 13, 285, 15, 20449, 323, 13492, 481, 187, 187, 1394, 812, 23255, 253, 4284, 2170, 281, 3343, 15, 2732, 326, 13, 5532, 10209, 13, 285, 846, 326, 3343, 1223, 253, 33776, 21354, 562, 253, 4647, 323, 13828, 41860, 327, 634, 8610, 16143, 947, 390, 16556, 4382, 15, 2732, 326, 13, 253, 41860, 5199, 588, 5604, 3135, 18319, 187, 187, 3039, 368, 452, 2686, 6312, 352, 15, 31790, 459, 281, 29393, 634, 4382, 985, 390, 16556, 4382, 15, 7040, 25956, 264, 407, 7727, 378, 16732, 16, 23704, 16, 9649, 327, 17796, 16, 883, 16, 8971, 884, 27, 2537, 5208, 19312, 535, 186, 3, 39, 26163, 13, 18975, 322, 449, 654, 4161, 26163, 33, 9108, 28298, 15, 681, 31, 187, 186, 1762, 16, 1508, 16, 8971, 18188, 27, 2640, 5365, 40973, 988, 1916, 27, 346, 23833, 378, 15, 16732, 49286, 15, 313, 38, 14, 5719, 6844, 654, 5969, 472, 15, 67, 15, 40728, 398, 33, 36898, 15, 681, 31, 988, 25215, 27, 209, 988, 20772, 27, 44318, 27, 444, 1410, 5128, 3327, 21752, 535, 187, 48965, 42, 187, 8061, 187, 49085, 187, 187, 31, 19312, 25494, 17775, 7040, 187, 31, 4325, 27, 401, 26163, 13, 18975, 322, 15, 187, 31, 20580, 27, 7948, 13, 2552, 16331, 13, 6585, 337, 27, 1839, 5365, 187, 31, 1916, 27, 21130, 20745, 561, 313, 38, 14, 5719, 558, 39457, 388, 15, 29382, 254, 313, 38, 14, 5719, 558, 5119, 500, 15, 1621, 251, 266, 187, 31, 313, 38, 14, 5719, 558, 13089, 30867, 4396, 437, 313, 38, 14, 5719, 558, 6277, 418, 15, 48555, 313, 38, 14, 5719, 558, 6277, 187, 31, 24429, 1373, 28, 10035, 399, 15, 6212, 313, 38, 14, 5719, 558, 7993, 353, 2158, 13013, 28, 7727, 378, 15, 16732, 49286, 15, 187, 31, 313, 38, 14, 5719, 558, 6911, 330, 15, 8757, 313, 38, 14, 5719, 558, 20222, 45941, 412, 313, 38, 14, 5719, 10, 187, 31, 20772, 27, 44318, 27, 444, 1410, 5128, 3327, 21752, 187, 31, 16912, 593, 27, 4855, 187, 31, 187, 31, 41779, 42, 187, 31, 9375, 187, 31, 18975, 187, 31, 187, 31, 19312, 25494, 17775, 7040, 187, 31, 4325, 27, 401, 26163, 13, 18975, 322, 15, 187, 31, 20580, 27, 6794, 13, 4565, 3307, 13, 5307, 608, 27, 1762, 5365, 187, 31, 1916, 27, 7727, 416, 3770, 1342, 313, 38, 14, 5719, 10, 187, 31, 20772, 27, 444, 1410, 5128, 3327, 21752, 187, 31, 16912, 593, 27, 4855, 187, 31, 187, 31, 5612, 13, 187, 31, 50276, 4943, 310, 247, 6010, 273, 752, 359, 5469, 342, 1675, 281, 444, 1410, 15, 187, 31, 187, 31, 337, 15, 444, 1410, 588, 1379, 697, 17172, 17119, 11173, 347, 247, 29679, 273, 253, 4579, 187, 31, 985, 347, 352, 840, 13164, 15, 50276, 38, 1410, 588, 417, 320, 2403, 5312, 896, 8777, 273, 253, 187, 31, 4579, 985, 15, 50276, 9, 1552, 651, 6388, 670, 818, 33942, 591, 1388, 2698, 50276, 14131, 13, 1655, 187, 31, 2136, 4579, 588, 417, 320, 4934, 323, 444, 1410, 5734, 627, 310, 247, 2136, 1921, 187, 31, 281, 513, 594, 15, 187, 31, 187, 31, 374, 15, 444, 1410, 588, 1379, 697, 17172, 17119, 11173, 273, 941, 323, 697, 1873, 14903, 347, 187, 31, 247, 14496, 29203, 273, 253, 941, 326, 13164, 387, 326, 673, 15, 50276, 38, 1410, 588, 417, 320, 2403, 187, 31, 667, 643, 896, 8777, 273, 1873, 4771, 941, 643, 685, 597, 9403, 651, 275, 187, 31, 253, 9826, 2282, 273, 2136, 187, 31, 187, 31, 495, 15, 444, 1410, 588, 417, 320, 3192, 10125, 390, 11472, 3888, 273, 253, 7469, 6171, 187, 31, 1892, 14137, 285, 667, 2330, 9071, 19500, 22916, 387, 436, 673, 15, 50276, 31413, 4317, 588, 187, 31, 4035, 281, 897, 616, 6500, 347, 597, 9403, 651, 15, 187, 31, 187, 31, 577, 15, 1310, 368, 878, 3081, 941, 23029, 5001, 444, 1410, 643, 685, 347, 187, 31, 2529, 1840, 13, 368, 588, 1339, 479, 871, 15, 187, 31, 187, 31, 7764, 1339, 479, 871, 604, 436, 6010, 310, 417, 7899, 15, 187, 31, 9375, 187, 31, 18975, 187, 187, 4578, 27240, 187, 1552, 4579, 3935, 310, 323, 253, 7934, 897, 273, 253, 6034, 18344, 9, 84, 10, 285, 778, 209, 187, 1987, 404, 18987, 285, 30082, 1491, 15, 6101, 31957, 2278, 13, 209, 187, 2327, 13, 13911, 390, 3268, 310, 19772, 15, 1310, 368, 403, 417, 253, 6034, 209, 187, 19977, 850, 13, 4496, 3057, 253, 22647, 407, 12252, 4579, 285, 6909, 512, 10125, 273, 209, 187, 783, 3236, 3935, 15, 187, 187, 1992, 12252, 281, 776, 4579, 23121, 3587, 13, 5007, 271, 4579, 281, 209, 187, 5996, 11717, 33, 9108, 28298, 15, 681, 187, 7941, 9324, 4625, 44, 8367, 1843, 19622, 708, 388, 9482, 48278, 41439, 187, 2413, 1358, 2700, 15, 9108, 28298, 15, 681, 25698, 27, 4162, 1903, 13, 4072, 387, 1249, 27, 3712, 717, 46, 953, 538, 31384, 31449, 9537, 15, 2296, 773, 903, 10885, 668, 273, 27747, 14, 279, 19978, 1309, 15981, 778, 320, 281, 13387, 323, 689, 47451, 3237, 326, 20588, 352, 281, 32407, 3275, 273, 10358, 14, 249, 9508, 273, 697, 6282, 31457, 31595, 15, 1989, 253, 2567, 2296, 643, 2616, 812, 320, 281, 13387, 285, 1912, 457, 85, 21058, 3453, 1919, 352, 9010, 247, 25038, 3662, 15, 187, 187, 46, 953, 538, 31384, 31449, 9537, 15, 2296, 773, 903, 10885, 668, 273, 27747, 14, 279, 19978, 1309, 15981, 778, 320, 281, 13387, 323, 689, 47451, 3237, 326, 20588, 352, 281, 32407, 3275, 273, 10358, 14, 249, 9508, 273, 697, 6282, 31457, 31595, 15, 187, 187, 1989, 253, 2567, 2296, 643, 2616, 812, 320, 281, 13387, 285, 1912, 457, 85, 21058, 3453, 1919, 352, 9010, 247, 25038, 3662, 15, 733, 13079, 281, 11322, 253, 1895, 407, 253, 990, 273, 4162, 15, 187, 187, 46, 953, 538, 31384, 556, 8549, 670, 577, 13, 7554, 10358, 14, 249, 6282, 39950, 1580, 253, 1566, 41362, 275, 4247, 15, 733, 37350, 3275, 3563, 1390, 1770, 846, 253, 9378, 275, 581, 4958, 7270, 3289, 285, 253, 8039, 273, 767, 2571, 27072, 15, 380, 2567, 5012, 247, 2074, 1895, 342, 247, 9378, 275, 697, 891, 14, 24711, 8199, 5637, 2846, 8458, 15, 187, 187, 5677, 31457, 19978, 407, 271, 353, 7722, 6036, 18875, 342, 23888, 19924, 9537, 904, 253, 6692, 2567, 326, 1160, 22327, 27747, 14, 279, 19978, 323, 253, 35251, 46198, 20909, 41904, 15828, 6415, 15, 50267, 11247, 27, 1668, 14, 1036, 28744, 50275, 6958, 29322, 27, 1903, 16, 2904, 16, 7132, 50275, 10099, 27, 337, 273, 1722, 2756, 50254, 50254, 50270, 544, 13220, 5803, 25095, 14535, 62, 5429, 50266, 1042, 3003, 25625, 18746, 14732, 3481, 24730, 535, 50257, 9675, 3003, 444, 25684, 3489, 41, 32984, 187, 50255, 6659, 3234, 535, 50254, 50274, 1621, 15, 1668, 14, 1036, 28744, 187, 50254, 8758, 14, 22388, 33421, 187, 50255, 6659, 3234, 535, 50262, 37, 15, 36, 15, 49126, 1621, 15, 374, 27, 1010, 14, 7083, 14, 361, 11335, 14, 4350, 36, 14, 5883, 14, 18, 2756, 187, 33249, 18746, 3481, 46063, 13, 535, 50254, 50254, 50266, 50275, 19056, 14, 28107, 13, 535, 50254, 50270, 50276, 7147, 187, 187, 39683, 2573, 2293, 401, 3887, 10569, 13, 535, 50254, 50254, 50270, 8167, 14, 16667, 15, 535, 50255, 6659, 3234, 535, 50262, 40417, 432, 253, 1986, 2077, 4412, 2111, 187, 50258, 1542, 253, 10515, 4412, 273, 7758, 187, 50256, 6659, 3234, 535, 50254, 50274, 9, 23375, 854, 13, 4240, 10, 187, 187, 8639, 353, 5757, 1042, 13, 500, 4641, 9051, 330, 16652, 1410, 13, 285, 4889, 37118, 13, 6817, 19592, 15, 187, 187, 10810, 34319, 27, 8675, 50260, 11247, 27, 1668, 14, 1036, 28744, 50269, 6958, 29322, 27, 1903, 16, 2904, 16, 7132, 50275, 10099, 27, 374, 273, 1722, 2756, 50268, 17588, 247, 10955, 2332, 327, 36834, 5441, 13, 8167, 31726, 437, 36172, 369, 187, 187, 13118, 7025, 273, 10023, 273, 247, 22657, 407, 247, 13084, 48935, 285, 16290, 281, 12660, 187, 187, 17348, 457, 19841, 15, 754, 1024, 12527, 13, 16425, 326, 253, 3286, 1302, 14416, 407, 187, 187, 3354, 3184, 521, 3200, 281, 10476, 1941, 1119, 1309, 247, 21638, 337, 3523, 15, 754, 671, 187, 187, 40893, 265, 521, 6197, 327, 2710, 9905, 15, 2732, 10182, 2278, 13, 359, 10418, 15, 187, 187, 42, 15, 50270, 25292, 33439, 535, 50268, 34, 15, 50273, 39, 10719, 535 ]
Quantum Mechanics* (Springer, New York, 1974). \[The Hulthén potential is discussed on p. 175.\] R. L. Hall, J. Phys. A: Math. Gen. [**25**]{} (1992) 1373. Canon PIXMA MX714 Driver Free Download Canon PIXMA MX714 Driver Free Download – That Canon Pixma MX714 Ink photo for all intents in addition to objective all inside a tools printer might be vital use, Pixma MX714 substantial mind throwing away print out picture physician along with successfully added much thought and also for office, in the similar program as firm buddy and youngsters and extensively a lot more. mechanical growth swiftly demands your specific photos in related to among a handful of worrying close-by Landscapes, and in addition to that Introduction beginning Early early morning Yards– because of this could be appropriate really most pushing image no matter Canon Pixma MX714 of multi-zone location renovation. Canon PIXMA MX714 Driver Canon PIXMA MX714 Driver Free Download Along these lines, unexposed sections of the particular picture are posting likely to be really boosted, area properly by location in addition to links that are really informed furthermore under-uncovered will certainly more than likely swiftly be lightened up obtaining correct coloring propounded assist you to verify normally far more ideal skin layer anticipated for impressive pictures. Cost-effective, particular Ink storage tanks For greater economic climate, the PIXMA MX714 has 5 singular ink tank. When a color finishes, just this singular container has to have altered. PIXMA MX714 enjoys documents along with photo prints of the very best high quality with this All-In-One. With a network as well as Wi-Fi, this tool in addition offers dual sided prints, duplicates, replicas in addition to check capabilities. High-speed documents taking care of Canon PIXMA MX714 Drivers as well as Review – Large double-sided documents could be instantly checked, copied or faxed in addition to the entirely incorporated, 35-sheet Duplex Automatic Record Farmer (DADF). Inspect and extra to a ‘small PDF’ is really best for archiving or emailing. Ideal for building in addition to office Wi-Fi and also Ethernet connection make this stylish dark All-In-One uncomplicated for everyone to part along with print, check, duplicate and facsimile originating from essentially throughout the office or home. Apple AirPrint assistance enables you to publish straight originating from iPad tablet computer as well as iPhone. Easy to work together with A 6.2 centimeters color TFT function makes it very easy to view picked capabilities in addition to sneak peek photos. The Dual Feature Door includes LED-lit double feature components. These keys modify look based on the approach picked, reducing the selection of physical secrets on the item. Canon PIXMA MX714 Driver Free Download Canon MX714 Setup / Install Click the web link listed below to Download the MG3100 Driver, after that click “Save” to download and install the data. The data name finishes in (. Exe for Windows, dmg for Mac Os, and.gz for Linux). You could approve the default area to wait. After that, click Next, and after that wait while the installer draws out the apply for preparing installment on your COMPUTER or laptop computer. After that, the installment procedure will certainly begin instantly When you have actually completed it. Ensure to reboot your computer system or laptop computer.----- Forwarded by Richard B Sanders/HOU/ECT on 06/11/2001 10:49 AM ----- "Fergus, Gary S." <[email protected]> 05/23/2001 07:02 PM To: "Richard B. Sanders Esq. (E-mail)" <[email protected]> cc: Subject: FW: EES Data Preservation FYI Thanks Gary > -----Original Message----- > From: Fergus, Gary S. > Sent: Tuesday, May 08, 2001 1:38 PM > To: Andy Pickens (E-mail); Barrett H. Reasoner (E-mail); David J. Noonan > (E-mail); Jean Frizzell (E-mail); Michael L. Kirby (E-mail); Michael > Molland; Mike D. Smith (E-mail); Peter Meringolo; Richard B. Sanders Esq. > (E-mail); Robert C. Williams (E-mail); Susan Bisop (E-mail) > Subject: FW: EES Data Preservation > Importance: High > > FYI > Thanks > Gary > > -----Original Message----- > From: Fergus, Gary S. > Sent: Friday, December 22, 2000 5:05 PM > To: Richard Rochman (E-mail) > Subject: EES Data Preservation > Importance: High > > Rich, > Here is a summary of what we discussed with respect to EES. > > 1. EES will take its oldest backup tape as a snapshot of the email > system as it then existed. EES will not be making daily backups of the > email system. (This would involve about 7 tapes per day.) Thus, current > business email will not be kept for EES unless there is a business reason > to do so. > > 2. EES will take its oldest backup tape of data for its file servers as > a snapshop of the data that existed at that time. EES will not be making > any other backups of file server data other than they normally would in > the ordinary course of business > > 3. EES will not be taking copies or mirror images of the 300 employees > hard drives and any associated floppy disks at this time. Employees will > continue to use their equipment as they normally would. > > 4. If you need additional data preservation regarding EES other than as > described above, you will let me know. > > Please let me know if this summary is not accurate. > Thanks > Gary ======================================================= This email message is for the sole use of the intended recipient(s) and may contain confidential and privileged information. Any unauthorized review, use, disclosure or distribution is prohibited. If you are not the intended recipient, please contact the sender by reply email and destroy all copies of the original message. To reply to our email administrator directly, send an email to [email protected] BROBECK PHLEGER & HARRISON LLP http://www.brobeck.comPosted: April 11, 2013 at 12:51 amMitsubishi Motors Corp. says “rough handling” of lithium-ion batteries during inspection may be to blame for overheating problems that prompted it to suspend production of plug-in versions of its Outlander crossover.But the company says other factors could be to blame and won’t resume output until it finds a definitive answer. Mitsubishi Motors Corp. says “rough handling” of lithium-ion batteries during inspection may be to blame for overheating problems that prompted it to suspend production of plug-in versions of its Outlander crossover. But the company says other factors could be to blame and won’t resume output until it finds a definitive answer. It hopes to resolve the problem by the end of April. Mitsubishi has delivered about 4,300 plug-in Outlanders since the model debuted in January. It halted production late last month after the battery in one vehicle caught fire and the housing of two others melted. The company reports a similar problem with a battery in its i-MiEV electric city cars. Outlander batteries by an MMC joint venture with Yuasa Corp., the Japanese company that made defective lithium-ion batteries for the Boeing 737 Dreamliner passenger plane. Case: 16-16457 Date Filed: 11/08/2017 Page: 1 of 17 [DO NOT PUBLISH] IN THE UNITED STATES COURT OF APPEALS FOR THE ELEVENTH CIRCUIT ________________________ No. 16-16457 Non-Argument Calendar ________________________ D.C. Docket No. 2:15-cr-00102-SPC-CM-1 UNITED STATES OF AMERICA, Plaintiff-Appellee, versus CORDELL FELIX, Defendant-Appellant. ________________________ Appeal from the United States District Court for the Middle District of Florida ________________________ (November 8, 2017) Before MARTIN, JULIE CARNES, and ANDERSON, Circuit Judges. PER CURIAM: Case: 16-16457 Date Filed: 11/08/2017 Page: 2 of 17 Following a bench trial on stipulated facts, Defendant Cordell Felix was convicted of possession of a firearm by a convicted felon and sentenced to 180 months’ imprisonment. He now appeals, arguing that the district court erred by denying his motion to suppress evidence found during a Terry 1 stop. He also challenges his sentence on various grounds. After careful review, we affirm. I. BACKGROUND A. Facts
[ 273, 19938, 13, 187, 395, 369, 2197, 281, 3060, 275, 1781, 13483, 323, 18722, 272, 13, 347, 352, 812, 187, 1257, 15613, 1520, 387, 512, 2069, 13, 285, 275, 11921, 13, 387, 247, 4376, 534, 13, 604, 417, 187, 676, 13, 369, 387, 1878, 10290, 13, 7296, 697, 7126, 3290, 13, 432, 187, 48273, 13, 835, 18213, 369, 20182, 60, 883, 1438, 1092, 285, 835, 352, 369, 30481, 187, 249, 4444, 569, 4447, 327, 4096, 13, 253, 5112, 285, 9883, 465, 693, 265, 497, 187, 290, 603, 314, 14454, 13, 347, 4620, 407, 247, 5112, 25245, 273, 1668, 3677, 41006, 187, 6421, 70, 14, 296, 25428, 27, 285, 436, 369, 253, 1083, 1199, 625, 342, 253, 5685, 13, 534, 13, 275, 187, 455, 5912, 13, 588, 1620, 1614, 281, 1270, 2395, 13, 2167, 690, 452, 187, 290, 27448, 247, 10214, 4743, 15, 187, 187, 48273, 13, 390, 1457, 11268, 13, 253, 3236, 2586, 273, 253, 820, 348, 460, 267, 13, 534, 187, 3418, 4620, 281, 320, 253, 13064, 4995, 273, 795, 39354, 11675, 14767, 883, 3593, 1092, 369, 6888, 407, 187, 783, 46544, 2196, 275, 1458, 1093, 285, 253, 1107, 1563, 15, 8452, 806, 25995, 436, 187, 34586, 7116, 3275, 13, 285, 1160, 352, 1929, 275, 3060, 13, 309, 452, 417, 644, 187, 494, 281, 9413, 15, 3808, 4138, 326, 253, 7925, 6691, 27441, 13, 1078, 597, 574, 187, 783, 30181, 42460, 273, 1146, 11580, 407, 253, 15600, 13, 497, 41061, 187, 3113, 820, 348, 460, 267, 13, 534, 597, 7091, 275, 13497, 616, 9910, 285, 187, 6421, 21228, 616, 14234, 60, 883, 3507, 2194, 533, 2571, 6558, 253, 10214, 60, 883, 3245, 1570, 187, 510, 46544, 2196, 13, 665, 574, 1048, 908, 465, 693, 265, 275, 616, 1211, 2586, 13, 812, 187, 1439, 1891, 3517, 281, 10018, 253, 34385, 273, 253, 2448, 28, 285, 309, 1089, 187, 1615, 4058, 30059, 13, 326, 253, 6963, 275, 253, 807, 1458, 1508, 6799, 281, 320, 8191, 407, 187, 36, 430, 16130, 13, 1880, 752, 344, 574, 644, 2183, 369, 2032, 13, 326, 465, 693, 265, 497, 281, 320, 187, 14541, 275, 11921, 275, 8987, 13, 285, 604, 597, 812, 13, 347, 369, 6326, 13, 320, 187, 17094, 342, 5750, 281, 11268, 15, 754, 9521, 779, 13, 943, 436, 1491, 187, 1257, 2032, 13, 281, 2075, 4116, 281, 352, 13, 285, 281, 2847, 731, 281, 320, 5728, 342, 187, 43886, 304, 566, 15, 831, 31142, 1364, 3517, 846, 452, 13207, 281, 320, 271, 1789, 187, 1171, 19938, 28, 323, 3262, 280, 5297, 472, 5391, 13, 665, 4962, 275, 1458, 2511, 13, 25957, 820, 348, 460, 267, 187, 35094, 253, 7774, 15613, 1520, 840, 407, 253, 30380, 273, 743, 7553, 47952, 432, 187, 49348, 60, 883, 2759, 1570, 380, 4444, 327, 534, 253, 5893, 4852, 13, 14125, 281, 253, 15443, 187, 64, 36, 514, 316, 7481, 285, 275, 8987, 310, 1925, 795, 79, 33929, 64, 390, 795, 85, 9821, 7481, 2167, 2067, 187, 26754, 273, 253, 1072, 2238, 1646, 281, 320, 28535, 4861, 762, 253, 6158, 1416, 15, 187, 4041, 3417, 310, 253, 795, 12535, 2084, 571, 7481, 534, 556, 2489, 24984, 275, 11268, 13, 187, 40086, 267, 13, 285, 9972, 13, 285, 534, 310, 417, 29967, 275, 776, 4759, 14, 24761, 15, 329, 187, 9815, 3417, 310, 253, 795, 1940, 27545, 408, 338, 3525, 4414, 473, 87, 728, 80, 60, 883, 2227, 62, 2529, 285, 187, 72, 1123, 8442, 273, 767, 9351, 273, 795, 85, 9821, 17540, 533, 273, 253, 820, 348, 460, 267, 344, 2789, 642, 187, 420, 279, 15, 754, 16544, 2299, 273, 271, 7126, 18722, 534, 253, 7108, 187, 35711, 432, 253, 9279, 13, 285, 4447, 715, 1355, 35195, 28, 533, 344, 16906, 187, 33635, 2510, 326, 344, 574, 2959, 642, 10501, 2395, 327, 436, 2256, 15, 187, 42, 17837, 9101, 326, 841, 35195, 497, 1160, 273, 820, 348, 460, 267, 28, 323, 187, 41, 1808, 24673, 2296, 326, 824, 497, 1160, 275, 521, 673, 15, 187, 187, 3378, 253, 806, 820, 348, 460, 267, 13, 247, 2032, 2395, 273, 253, 5133, 275, 534, 352, 369, 187, 21299, 1520, 1364, 452, 4925, 3060, 13, 285, 2489, 13644, 1929, 15, 5192, 21432, 187, 249, 1458, 1229, 13, 285, 4058, 30059, 275, 1668, 520, 13, 347, 973, 347, 36835, 285, 2571, 13, 3534, 187, 601, 2032, 285, 3426, 247, 5740, 273, 352, 13, 326, 253, 33671, 812, 187, 290, 1695, 642, 5545, 41006, 697, 6510, 15, 380, 1491, 273, 841, 187, 43355, 13, 2299, 13, 369, 2057, 28849, 390, 2783, 347, 3221, 13, 285, 187, 3431, 1065, 265, 20944, 1880, 820, 348, 460, 267, 369, 22392, 390, 35231, 13, 390, 253, 37408, 187, 263, 12922, 273, 2176, 6244, 15, 380, 9883, 1416, 795, 737, 3230, 7481, 1461, 8055, 342, 187, 64, 28859, 360, 7481, 778, 452, 1677, 6054, 281, 436, 12417, 28, 533, 627, 310, 417, 13, 187, 30875, 13, 275, 512, 3626, 2892, 247, 1127, 534, 476, 320, 594, 4751, 16481, 187, 484, 347, 436, 476, 407, 253, 954, 3807, 17290, 264, 6206, 15, 329, 13986, 1342, 13, 4907, 187, 23021, 348, 1528, 372, 18268, 316, 1026, 379, 13, 16337, 275, 247, 5948, 13, 432, 7946, 1491, 187, 248, 574, 2797, 275, 11268, 13, 326, 820, 348, 460, 267, 14278, 273, 1355, 5074, 15, 187, 8195, 1436, 13, 3692, 1416, 344, 556, 417, 1160, 1929, 13, 8838, 253, 187, 19657, 552, 342, 594, 1199, 4250, 285, 7217, 13, 326, 253, 12027, 387, 2978, 187, 1834, 275, 247, 701, 15, 18268, 316, 1026, 379, 6636, 247, 46544, 472, 13, 581, 273, 521, 3858, 13, 665, 187, 4238, 1469, 281, 8987, 13, 281, 29877, 323, 779, 275, 326, 2586, 10501, 187, 16314, 84, 273, 752, 344, 574, 16402, 15, 2053, 27947, 13, 17734, 5783, 275, 187, 22117, 1722, 1099, 13, 407, 253, 1302, 273, 8426, 275, 253, 2846, 273, 9422, 3008, 3525, 13, 275, 253, 187, 1208, 2205, 273, 473, 991, 20240, 13, 7244, 387, 26653, 275, 253, 25986, 273, 253, 807, 1722, 1731, 15, 187, 42, 452, 644, 8191, 326, 18268, 316, 1026, 379, 2220, 436, 1694, 10023, 273, 253, 2020, 187, 67, 37883, 13, 534, 37752, 281, 253, 2644, 2867, 273, 253, 48222, 28, 533, 326, 13, 187, 6438, 7562, 352, 247, 2176, 673, 13, 344, 969, 4895, 352, 13, 31985, 272, 760, 187, 783, 12222, 344, 574, 644, 387, 275, 15613, 981, 253, 1941, 13, 285, 275, 8479, 187, 262, 281, 320, 3863, 15, 733, 4447, 247, 1355, 17109, 41231, 4644, 13, 342, 253, 1563, 187, 5564, 13, 11462, 275, 2502, 4876, 27, 380, 9541, 273, 2434, 348, 460, 267, 13, 8058, 407, 187, 42996, 7177, 60, 883, 2691, 1570, 2053, 27947, 2197, 432, 1457, 11268, 403, 3542, 187, 249, 13986, 13, 5112, 13, 285, 9883, 15, 187, 187, 1147, 778, 320, 12450, 6326, 13, 326, 253, 1029, 12368, 358, 275, 534, 436, 187, 25307, 369, 2918, 651, 3517, 10808, 952, 281, 19072, 25755, 281, 187, 585, 3942, 841, 22392, 281, 643, 4343, 275, 1340, 281, 21876, 731, 15, 187, 1552, 253, 46544, 2196, 858, 1046, 2181, 275, 616, 1612, 281, 3657, 28, 285, 187, 1439, 22046, 253, 12147, 273, 253, 2097, 534, 597, 7091, 13, 9437, 187, 12796, 1160, 323, 326, 4096, 15, 2091, 19596, 5945, 13, 247, 26902, 273, 418, 2966, 5507, 316, 13, 187, 4238, 275, 3968, 13, 344, 2197, 281, 530, 793, 267, 13, 387, 253, 2748, 273, 326, 19651, 187, 19293, 382, 13, 247, 4444, 13, 342, 253, 22392, 2220, 352, 15, 380, 4444, 7244, 275, 187, 783, 807, 1722, 3208, 13, 672, 418, 2966, 5507, 316, 369, 9583, 342, 521, 30980, 15, 380, 15934, 4330, 13, 187, 10002, 369, 417, 41061, 342, 253, 3753, 273, 352, 13, 16481, 352, 432, 752, 344, 187, 24286, 2336, 1222, 13, 285, 23846, 352, 28, 594, 326, 418, 2966, 5507, 316, 13, 672, 344, 4895, 187, 4064, 521, 966, 13, 858, 417, 1089, 247, 2014, 13188, 9338, 15, 831, 26741, 13, 187, 4609, 344, 556, 5393, 275, 521, 4155, 66, 427, 4953, 5507, 13, 309, 369, 2183, 407, 2994, 15, 309, 187, 312, 2299, 273, 4743, 13, 326, 436, 369, 417, 253, 1524, 820, 348, 460, 267, 13, 533, 253, 187, 977, 2238, 13452, 273, 407, 28612, 49807, 28, 347, 253, 3438, 13, 2556, 281, 253, 187, 35261, 1491, 13, 476, 28438, 320, 15613, 1520, 1014, 342, 625, 18213, 187, 395, 14247, 685, 19596, 5945, 812, 1682, 319, 13, 285, 651, 10693, 1462, 824, 247, 187, 5056, 31192, 281, 253, 11186, 4811, 15, 380, 46541, 2238, 497, 2197, 432, 187, 43, 2902, 3737, 281, 5854, 13, 327, 253, 795, 12535, 2084, 571, 269, 23301, 2102, 3737, 7481, 534, 369, 23846, 407, 187, 42038, 60, 883, 2597, 1092, 533, 253, 22392, 858, 417, 3153, 1840, 1264, 390, 1740, 2607, 15, 187, 1044, 1321, 90, 13, 247, 2872, 5112, 3626, 382, 13, 3982, 253, 1524, 820, 348, 460, 267, 281, 659, 15, 187, 17004, 25864, 275, 253, 807, 1722, 2357, 13, 387, 594, 1199, 16466, 326, 344, 22828, 247, 1659, 187, 249, 253, 16172, 90, 27044, 273, 253, 3626, 382, 28, 533, 846, 521, 2471, 13, 534, 3517, 187, 25739, 264, 13, 253, 22392, 591, 1428, 949, 253, 1323, 274, 547, 390, 16355, 273, 521, 187, 12566, 641, 28, 285, 275, 326, 8930, 627, 403, 5293, 1024, 281, 320, 1119, 533, 253, 187, 1033, 21310, 2238, 60, 883, 2055, 1570, 187, 187, 42, 717, 21802, 281, 2868, 326, 253, 1445, 273, 19693, 465, 693, 265, 281, 18722, 247, 187, 1257, 35752, 2502, 10688, 369, 6888, 275, 253, 5791, 387, 247, 1077, 2393, 2180, 28, 187, 3529, 352, 369, 3517, 594, 1199, 5520, 347, 281, 34219, 1014, 253, 16639, 5651, 19445, 28, 187, 395, 326, 352, 9945, 281, 2847, 253, 1463, 19445, 281, 320, 387, 2978, 187, 357, 7541, 264, 15, 4325, 253, 19983, 2502, 36348, 1021, 311, 1070, 594, 1199, 407, 253, 25260, 187, 34782, 13, 285, 534, 13, 2556, 281, 253, 4743, 273, 6311, 42608, 13, 187, 12796, 1160, 432, 465, 693, 265, 13, 309, 3091, 417, 18875, 281, 519, 563, 336, 667, 27947, 13, 347, 187, 42, 717, 417, 41061, 342, 253, 45817, 11515, 281, 9186, 616, 187, 15793, 84, 342, 7200, 28, 533, 309, 452, 1119, 247, 10056, 275, 657, 412, 48218, 60, 883, 2511, 1092, 187, 4609, 3133, 281, 8600, 619, 24366, 1077, 14051, 15, 2064, 2488, 46210, 187, 316, 13, 326, 253, 6963, 273, 10400, 571, 2197, 281, 253, 26390, 329, 37281, 757, 13, 16280, 187, 977, 7774, 273, 1270, 1318, 13, 690, 25818, 5025, 17848, 13, 534, 369, 273, 247, 187, 25914, 2105, 3623, 285, 32950, 19445, 10688, 685, 667, 326, 574, 644, 2455, 187, 16564, 275, 253, 8370, 20986, 13, 285, 275, 5301, 273, 534, 512, 253, 643, 187, 13182, 713, 17848, 16332, 407, 253, 26390, 285, 253, 16901, 273, 253, 1302, 5420, 187, 69, 962, 285, 28290, 15, 496, 619, 4743, 13, 436, 17848, 13, 534, 369, 273, 247, 5389, 187, 13182, 713, 2502, 10688, 13, 369, 417, 17713, 264, 342, 253, 26375, 273, 253, 278, 459, 89, 13, 533, 187, 3113, 465, 693, 265, 15, 831, 2934, 369, 6296, 417, 2779, 281, 2826, 281, 253, 30396, 13, 187, 10002, 497, 41061, 760, 342, 253, 19445, 273, 253, 278, 459, 89, 13, 285, 665, 574, 187, 1417, 2793, 275, 253, 14635, 275, 2087, 685, 275, 326, 273, 687, 30690, 285, 187, 446, 37608, 13, 390, 665, 387, 667, 2281, 275, 326, 1675, 497, 18134, 281, 253, 187, 48, 5692, 932, 15, 380, 8370, 802, 468, 641, 4269, 436, 6326, 19445, 281, 320, 7799, 187, 1542, 275, 5427, 407, 253, 954, 7407, 277, 13356, 13, 665, 13, 417, 1146, 2104, 281, 1089, 187, 262, 13, 4895, 342, 247, 21248, 1304, 326, 253, 35030, 31534, 19445, 369, 187, 36008, 407, 253, 4444, 795, 31515, 895, 4414, 309, 717, 973, 6600, 13, 326, 690, 42608, 187, 9802, 6326, 326, 253, 795, 31515, 895, 64, 369, 776, 10279, 491, 60, 12115, 17, 1570, 388, 265, 3155, 3750, 13, 187, 35529, 13, 2296, 13, 1077, 13224, 314, 13, 326, 253, 795, 40728, 895, 64, 310, 417, 247, 4444, 13, 533, 187, 66, 2238, 273, 11111, 538, 1615, 5202, 534, 11026, 247, 18722, 751, 253, 795, 39354, 11675, 14767, 12115, 18, 1570, 380, 187, 30574, 277, 13356, 13, 4931, 13, 39124, 275, 9796, 273, 253, 278, 459, 89, 13, 1160, 326, 760, 187, 783, 1789, 273, 616 ]
of commerce, and was sent to Europe in large quantities for dyeing, as it could be procured at all times, and in abundance, at a price which, if not low, was at least moderate, considering its excellent quality, from Mexico, where labour was cheaper[1180], and where it was cultivated in plantations formed on purpose, the French and Spanish kermes were entirely forgotten, as appears by a French ordinance of 1671 respecting dye-stuffs: and this was the case much more with the German, which, in all probability, will never turn to great account, though some have entertained a contrary opinion. Mexico, or New Spain, the original country of the cochineal, which word appears to be the diminutive of _coccus_[1181], was discovered by the Spaniards in 1518 and the years following. Who first remarked this profitable production, and made it known in Europe, I have not been able to discover. Some assert that the native Mexicans, before they had the misfortune of being visited by the Christians, were acquainted with cochineal, which they employed in painting their houses and dyeing their clothing[1182]; but others maintain the contrary[1183]. The Spaniards, who had long used kermes in their own country, could not fail soon to observe the superiority of the American; and I find by Herrera, that the king in the year 1523 desired to be informed by Cortez, whether what he had been told was true, that kermes were to be found in abundance in Mexico, and if they could, as was supposed, be sent with advantage to Spain. He requested him, should this information be true, to pay attention to it, and to cause them to be collected with diligence. This commodity must soon after have begun to be an object of commerce; for Guicciardini, who died in 1589, mentions cochineal among the articles procured then by the merchants of Antwerp from Spain[1184]. The plant on which the animal lives, belongs to the genus _Cactus_, and in Mexico is called _nopal_ or _tuna_, though several plants of the same kind seem to be comprehended under the latter name. One species is the _Opuntia_, which has become indigenous in Spain, Portugal, and Italy, and which is not scarce in our green-houses. A second species is the _cochinillifera_. Oviedo[1185] described and gave figures of two kinds of _tuna_; but of the cochineal he makes no mention. He speaks however of an excellent dye which the Americans prepared from the fruit, and formed into small cakes; but he afterwards acknowledges that he had received no authentic account on this subject. I nevertheless suspect that these cakes were made of cochineal; for Hernandez says that such were made in his time. With the first cochineal, a true account of the manner in which it was procured must have reached Europe, and become publicly known. Acosta in 1530, and Herrera in 1601, as well as Hernandez and others, gave so true and complete a description of it, that the Europeans could entertain no doubt respecting its origin. The information of these authors, however, was either overlooked or considered as false, and disputes arose whether cochineal was insects or worms, or the berries or seeds of certain plants. The Spanish name _grana_, confounded with _granum_, may have given rise to this contest; but there is not, perhaps, in all natural history a point which can be so fully cleared up as this can by the most undoubted testimony. A Dutchman, named Melchior de Ruusscher, affirmed in a society, from oral information he had obtained in Spain, that cochineal consisted of small animals. Another person, whose name he has not made known, maintained the contrary with so much heat and violence, that the dispute at length ended in a bet. Ruusscher charged a Spaniard, one of his friends, who was going to Mexico, to procure for him in that country authentic proofs of what he had asserted. These proofs, legally confirmed in October 1725, by the court of justice in the city of Antiquera, in the valley of Oaxaca, arrived at Amsterdam in the autumn of the year 1726. I have been informed that Ruusscher upon this got possession of the sum betted, which amounted to the whole property of the loser; but that, after keeping it a certain time, he again returned it, deducting only the expenses he had been at in procuring the evidence, and in causing it to be published. It formed a small octavo volume, with the following title, printed in red letters: The History of Cochineal, proved by authentic documents[1186]. These proofs sent from New Spain are written in Dutch, French, and Spanish. It may be readily supposed, that the high esteem in which this production was held would soon induce people to endeavour to convey these insects to other countries in order to breed them. This the Spaniards did every thing in their power to prevent; and notwithstanding the severity of the means which they employed, attempts were made for that purpose. When Rolander, a scholar of Linnæus, was in America, he sent to Upsal, at the request of that celebrated naturalist, a plant, with the insects upon it. The plant arrived in the year 1756, when Linnæus was engaged with his pupils. The gardener, who was not acquainted with the nature of it, cleared it from what he thought vermin, and planted it; so that Linnæus, when he returned from his class, did not find a single insect alive. This circumstance, which he has mentioned in his Systema Naturæ, I was told by himself. I am however of opinion, that this was not the real cochineal, but the other kind spoken of by Sylvester; as the former, according to the latest information, can scarcely be procured even with more labour and expense than Rolander could bestow, and would hardly stand such a long voyage to the northern regions. The spurious kind were sent from Jamaica to England, on the _Opuntia ficus Indica_, which was planted by Miller[1187], but the insects did not live above three or four months. Thiery, a young French naturalist, brought the real cochineal to St. Domingo in the year 1777, at so much hazard that he deserves a place in the martyrology of the naturalist; but after his death, which soon followed, the insects perished through the avarice or negligence of his successors; and in that island there are none now to be found but the spurious kind[1188]. I am inclined to believe that the art of employing kermes to dye a beautiful red colour was discovered in the East at a very early period; that it was soon so much improved as to excel even the Tyrian purple; and that it contributed to cause the proper purple to be at length abandoned. From the costly red dyes extolled so much by the Hebrew writers, and which, according to the opinion of learned commentators, were made from kermes, I shall not venture to adduce any proofs, as I am not acquainted with the Oriental languages to examine their accounts with accuracy; but I have found a passage in Vopiscus[1189], which seems to render my conjecture very probable. That author informs us, that the king of Persia sent to the emperor Aurelian, besides other articles of great value, some woollen cloth, which was of a much costlier and brighter purple colour than any that had been ever seen in the Roman empire, and in comparison of which all the other purple cloth worn by the emperor and the ladies of the court appeared dull and faded. In my opinion, this cloth, which was of a beautiful purple red colour, was not dyed with the liquor of the murex, but with kermes. This idea was indeed not likely to occur to the Romans, who were acquainted only with the purple of the murex, and who had less experience in the arts in general than in that of robbing and plundering, or who at any rate in that respect were inferior to the Orientals. The Roman emperors caused this supposed purple to be sought for in India by the most experienced dyers, who, not being able to find it, returned with a vague report that the admired Persian purple was produced by the plant _Sandix_. I am well aware, that some commentators have supposed that the _Sandix_ was our madder[1190]. Hesychius, however, says, very confidently, that the _sandix_ is not a plant, but a kind of shrubby tree which yields a dye like the _coccus_[1191]. The Roman dyers, perhaps, prejudiced in favour of the murex, made that only the object of their
[ 187, 187, 50, 2338, 9170, 262, 1945, 272, 281, 35476, 13126, 2351, 187, 187, 1552, 310, 247, 13433, 3908, 13, 285, 581, 326, 3133, 4828, 565, 48714, 13, 533, 5119, 2296, 326, 253, 5962, 18053, 17830, 344, 11403, 275, 322, 4976, 84, 310, 1554, 262, 1945, 272, 15, 773, 3871, 24274, 5333, 8892, 1512, 2223, 13, 816, 33346, 14, 81, 543, 272, 949, 616, 1388, 13, 417, 2403, 667, 1524, 10254, 275, 581, 2170, 1806, 344, 11424, 15, 773, 20576, 13, 368, 943, 2972, 562, 673, 327, 253, 16832, 323, 2176, 1841, 835, 3253, 2010, 310, 6294, 1066, 1425, 187, 187, 15418, 3548, 457, 85, 3815, 275, 14851, 326, 1554, 262, 1945, 272, 310, 247, 3076, 2934, 13, 2057, 15, 5489, 432, 380, 2448, 49205, 7115, 2722, 326, 1554, 262, 1945, 272, 310, 31334, 285, 18860, 15, 2091, 12797, 9086, 875, 8892, 13, 627, 310, 2686, 247, 3998, 5778, 13, 390, 16653, 673, 15, 380, 5778, 310, 594, 1270, 326, 2561, 2722, 326, 2444, 10486, 327, 2570, 8892, 476, 1379, 598, 281, 3387, 6, 625, 673, 685, 816, 13654, 327, 581, 4836, 387, 247, 673, 15, 187, 187, 4769, 14589, 8069, 281, 28699, 4471, 14, 14605, 272, 310, 512, 670, 2403, 2119, 368, 16832, 3253, 15, 15204, 745, 673, 806, 2181, 275, 253, 4131, 281, 2770, 327, 752, 8213, 954, 15, 22460, 13, 326, 310, 634, 11091, 272, 5841, 15, 1310, 368, 23652, 907, 634, 2970, 275, 247, 5536, 4644, 273, 5841, 806, 2181, 368, 457, 620, 873, 253, 1388, 598, 323, 2323, 15, 2635, 1089, 673, 8336, 323, 512, 253, 643, 1774, 8892, 273, 253, 1388, 751, 11091, 2561, 13, 14991, 8892, 13, 285, 2712, 2010, 326, 4850, 13044, 634, 1039, 15, 187, 187, 28512, 3656, 21680, 285, 27529, 327, 1737, 6397, 1336, 187, 187, 11001, 262, 1945, 272, 778, 417, 320, 253, 1682, 2934, 13, 533, 6747, 310, 13654, 327, 2712, 643, 685, 634, 7342, 285, 253, 4712, 2424, 281, 2525, 731, 15, 6676, 322, 4976, 84, 2770, 327, 14401, 321, 13267, 84, 751, 3733, 747, 952, 13, 14991, 8892, 13, 390, 26169, 253, 3906, 13319, 3128, 1108, 285, 1223, 690, 273, 1110, 403, 3309, 390, 4217, 13, 597, 6403, 457, 85, 2970, 368, 667, 8003, 281, 16116, 634, 7342, 15, 187, 187, 2598, 752, 1057, 32, 31293, 634, 2554, 285, 634, 2136, 387, 247, 1268, 326, 14371, 634, 47168, 15, 773, 4045, 368, 871, 634, 3904, 285, 752, 352, 3936, 323, 368, 281, 320, 5547, 7721, 12325, 5119, 15, 773, 1276, 403, 253, 4712, 285, 253, 14800, 326, 368, 452, 281, 5115, 327, 247, 5312, 3720, 275, 1340, 281, 1056, 634, 3904, 7721, 187, 187, 15418, 23318, 247, 8166, 14, 3022, 2770, 327, 2970, 275, 634, 2425, 3904, 594, 16116, 634, 4736, 310, 512, 533, 16293, 15, 773, 3404, 247, 2169, 1268, 387, 253, 2567, 13, 368, 457, 250, 816, 627, 281, 7522, 275, 247, 1180, 327, 247, 43032, 273, 12165, 30219, 3058, 323, 253, 2567, 281, 4352, 253, 6224, 7342, 326, 1770, 390, 7150, 1806, 344, 2296, 15, 773, 2773, 457, 84, 253, 5004, 1386, 13, 285, 3253, 2010, 310, 816, 6046, 15, 7243, 368, 2624, 253, 6046, 13, 2770, 327, 8107, 14, 44602, 634, 7342, 285, 37625, 731, 1046, 1770, 1425, 187, 187, 15886, 272, 247, 3676, 789, 1375, 310, 670, 13654, 327, 247, 2014, 4836, 323, 271, 6508, 2180, 273, 673, 13, 1293, 940, 21680, 285, 762, 12680, 2770, 15, 24709, 673, 327, 634, 16832, 323, 841, 2304, 506, 790, 273, 789, 310, 4619, 13, 285, 841, 8336, 273, 673, 943, 320, 25860, 387, 512, 4815, 432, 12225, 13, 2675, 3420, 13, 14991, 8892, 13, 285, 643, 20126, 789, 15, 187, 187, 36599, 281, 12151, 1716, 735, 569, 187, 187, 6175, 3939, 11298, 7964, 556, 697, 1659, 13, 368, 457, 306, 671, 1694, 281, 4446, 253, 7827, 275, 247, 2173, 3884, 2584, 253, 7289, 15, 2091, 806, 11734, 253, 2395, 9165, 2554, 13, 322, 4976, 84, 5257, 281, 11182, 954, 342, 2686, 11196, 253, 2968, 15, 1916, 513, 594, 13, 368, 452, 281, 4446, 253, 7827, 13, 4715, 672, 281, 734, 720, 285, 849, 281, 3665, 3533, 281, 755, 253, 1491, 368, 878, 1223, 10486, 17227, 2136, 1318, 342, 634, 1885, 15, 187, 187, 15418, 11532, 326, 2509, 594, 35766, 4419, 2136, 913, 30090, 285, 275, 14, 16719, 4491, 3640, 15, 380, 1682, 1039, 281, 16270, 1110, 1841, 13, 9255, 432, 1524, 14, 10186, 2793, 13, 310, 281, 1263, 15, 5119, 5936, 13, 773, 4045, 3253, 368, 476, 281, 2489, 271, 6485, 275, 253, 4491, 368, 457, 250, 10156, 281, 15, 10718, 253, 30318, 285, 320, 271, 6485, 275, 253, 495, 14, 21, 1755, 42226, 594, 368, 476, 1691, 4834, 275, 616, 12682, 285, 1007, 387, 1841, 432, 616, 31460, 1425, 187, 187, 10758, 368, 476, 14588, 327, 1529, 1268, 342, 634, 11091, 285, 921, 368, 457, 250, 37289, 13, 352, 4916, 28596, 6927, 281, 9413, 3075, 2792, 13, 7568, 1318, 13, 285, 2810, 625, 13330, 15, 187, 187, 1909, 271, 322, 4976, 13, 247, 9436, 310, 2970, 247, 12165, 1421, 281, 271, 2395, 9165, 13, 271, 2395, 9165, 13, 533, 347, 271, 29946, 13, 368, 878, 281, 320, 2104, 281, 2810, 13330, 15, 2064, 4419, 767, 1841, 27, 187, 187, 27958, 3009, 273, 253, 4491, 13, 42226, 13, 285, 21607, 187, 187, 1909, 4351, 253, 987, 3533, 281, 7568, 281, 22087, 326, 368, 457, 250, 253, 987, 2900, 323, 731, 15, 187, 187, 10282, 327, 6684, 1110, 767, 6936, 275, 634, 18345, 673, 594, 368, 476, 921, 253, 29946, 7205, 326, 368, 457, 620, 320, 4704, 281, 4352, 253, 3216, 3515, 275, 634, 747, 2554, 15, 187, 187, 20108, 262, 907, 24709, 11055, 960, 2726, 2065, 282, 9681, 187, 187, 28749, 272, 16072, 943, 4459, 689, 281, 634, 6355, 342, 634, 11651, 13, 347, 973, 15, 3771, 751, 342, 22087, 13, 368, 452, 281, 7568, 1318, 15, 380, 3064, 310, 326, 672, 368, 457, 250, 2820, 281, 755, 15127, 13, 368, 457, 250, 10156, 634, 1318, 15, 9613, 4983, 667, 4572, 1232, 13, 368, 943, 2525, 342, 1046, 2395, 9165, 285, 6224, 7205, 368, 476, 281, 2096, 752, 597, 457, 250, 2819, 323, 15, 187, 187, 688, 253, 22849, 13, 2378, 368, 457, 306, 1313, 634, 7342, 323, 253, 1770, 13, 1007, 323, 4088, 281, 5100, 4834, 347, 247, 6657, 1561, 253, 322, 4976, 7811, 15, 21695, 6194, 643, 322, 4976, 84, 13, 390, 1113, 306, 562, 673, 281, 7278, 1885, 390, 4491, 3640, 281, 1056, 4834, 625, 273, 247, 7741, 281, 253, 2285, 15, 20930, 5300, 342, 634, 2285, 390, 634, 12145, 670, 253, 4491, 390, 6224, 21041, 15, 187, 187, 10758, 368, 1928, 368, 457, 250, 4704, 281, 1379, 253, 1735, 3213, 281, 2395, 9165, 13, 320, 17898, 670, 352, 15, 399, 8552, 9091, 342, 253, 29946, 7205, 15, 1281, 731, 871, 752, 634, 7342, 403, 13, 285, 752, 368, 3524, 281, 5115, 15, 187, 187, 3039, 368, 4720, 513, 755, 616, 4116, 13, 320, 2119, 281, 956, 5119, 457, 84, 4803, 323, 4572, 2323, 27, 187, 187, 5498, 457, 85, 3324, 598, 634, 28563, 342, 253, 2567, 15, 6865, 3548, 457, 85, 247, 1175, 15301, 273, 1880, 390, 417, 368, 457, 620, 320, 5547, 15, 733, 2506, 457, 85, 2647, 604, 368, 457, 306, 644, 271, 322, 4976, 323, 721, 2607, 390, 721, 1107, 13, 29946, 15071, 403, 2819, 323, 247, 1175, 8928, 4944, 13, 247, 1175, 2285, 4760, 13, 285, 3095, 665, 6057, 253, 4491, 13, 6057, 253, 35554, 13, 285, 476, 2810, 13330, 15, 187, 187, 26078, 327, 5015, 670, 752, 368, 457, 306, 4211, 275, 253, 2469, 13, 1014, 604, 352, 369, 387, 643, 4413, 13, 285, 1014, 604, 352, 3589, 457, 85, 387, 247, 2567, 387, 512, 313, 3022, 10156, 3226, 42513, 14268, 390, 18665, 1940, 36014, 275, 1029, 2143, 481, 10684, 368, 476, 823, 1318, 285, 2810, 13330, 15, 399, 8552, 634, 3540, 1924, 273, 16116, 7342, 347, 271, 322, 4976, 347, 973, 15, 6000, 1652, 2372, 273, 2793, 7729, 15, 187, 187, 20133, 634, 6224, 22020, 390, 11288, 1078, 368, 755, 253, 2628, 15, 1310, 368, 476, 29343, 253, 1445, 273, 22020, 272, 13, 1563, 598, 13, 6240, 1318, 13, 285, 687, 14650, 952, 275, 1078, 253, 4572, 13, 840, 352, 943, 320, 247, 642, 14, 21590, 254, 3061, 281, 8591, 368, 281, 2395, 9165, 15, 187, 187, 18933, 825, 253, 1071, 2199, 562, 273, 253, 5603, 15, 6676, 4413, 588, 452, 368, 1918, 247, 9759, 390, 1408, 247, 1071, 1078, 14312, 368, 15, 831, 310, 634, 4839, 281, 39361, 731, 13, 285, 368, 943, 1379, 5750, 15, 2325, 689, 35711, 285, 7569, 616, 33957, 745, 15, 187, 187, 24788, 1386, 27, 1265, 7824, 285, 5015, 751, 271, 2395, 9165, 1078, 368, 2489, 581, 604, 368, 7777, 971, 281, 30582, 634, 4572, 285, 22020, 15, 3166, 326, 13, 285, 368, 457, 620, 3553, 642, 5545, 275, 616, 2564, 326, 368, 17337, 253, 5107, 285, 403, 4704, 15, 187, 187, 38241, 253, 10243, 407, 26457, 272, 32705, 187, 187, 1394, 778, 671, 971, 281, 1908, 1469, 281, 1529, 2567, 15, 5489, 407, 43565, 2722, 326, 952, 403, 2628, 14, 1689, 2784, 625, 685, 2455, 13, 285, 4536, 352, 457, 84, 253, 3158, 383, 1854, 281, 253, 1899, 368, 7777, 971, 15, 15358, 19732, 2977, 634, 43565, 6222, 407, 2403, 352, 12482, 281, 12438, 398, 10922, 562, 13, 390, 15257, 15142, 9091, 368, 1089, 3909, 15, 187, 187, 6300, 1056, 2119, 281, 513, 634, 2561, 13, 1158, 352, 949, 13, 285, 1053, 457, 85, 1056, 667, 1607, 22480, 9727, 390, 7089, 15, 13168, 12797, 4413, 275, 3186, 273, 247, 14892, 3548, 457, 85, 253, 1682, 1039, 281, 564, 15, 733, 812, 320, 247, 29198, 2118, 984, 253, 2567, 778, 417, 320, 247, 1175, 4944, 13, 390, 597, 778, 417, 452, 322, 4976, 84, 12422, 253, 15722, 13, 594, 368, 457, 620, 320, 896, 281, 6278, 581, 2509, 512, 253, 11091, 272, 15, 187, 187, 15418, 32636, 3192, 253, 1048, 1859, 15, 773, 7745, 387, 634, 1655, 2567, 432, 247, 1048, 14, 3945, 16892, 1806, 344, 5936, 15, 773, 1231, 512, 971, 3253, 281, 320, 18319, 13103, 13, 533, 4536, 368, 452, 281, 816, 7356, 342, 352, 15, 26779, 13, 1756, 13, 285, 8162, 1318, 689, 247, 3356, 673, 2180, 685, 368, 1158, 1425, 187, 187, 2042, 13, 846, 2509, 690, 28063, 285, 7765, 14, 8716, 272, 13, 368, 513, 7617, 1469, 281, 1529, 2567, 310, 253, 1682, 2118, 323, 368, 13, 1056, 2119, 368, 1705, 5480, 281, 253, 4572, 342, 2336, 18397, 22118, 13, 3904, 13, 6667, 13, 285, 2712, 2010, 326, 14371, 849, 368, 2507, 5911, 387, 634, 1655, 2567, 15, 18165, 285, 5306, 6787, 323, 16116, 634, 3904, 403, 247, 1943, 3330, 15, 1876, 273, 436, 1491, 943, 4533, 745, 634, 14018, 13, 594, 1056, 2119, 368, 513, 247, 6079, 1408, 2720, 281, 634, 4572, 15, 187, 187, 6872, 1897, 13, 2970, 15127, 310, 271, 1445, 830, 1108, 3340, 275, 253, 6224, 7811, 15, 1422, 457, 306, 1694, 281, 871, 634, 4491, 1755, 281, 5004, 13, 285, 1705, 745, 347, 247, 9865, 24773, 3185, 273, 3095, 9417, 616, 1211, 6284, 15, 1422, 878, 281, 320, 1175, 342, 3904, 281, 1056, 2119, 634, 2425, 285, 5181, 10801, 588, 18212, 7522, 634, 15722, 281, 30582, 436, 1770, 457, 84, 4736, 15, 1244, 4720, 13, 368, 457, 306, 1694, 281, 9974, 247, 10182, 6654, 875, 16116, 634, 3904, 13, 2403, 10291, 342, 8548, 13, 285, 3652, 25325, 342, 634, 11651, 285, 2221, 17327, 15, 1310, 368, 476, 513, 512, 326, 13, 368, 457, 620, 320, 973, 327, 634, 1039, 281, 7552, 271, 2395, 9165, 275, 642, 673, 15, 187, 187, 1276, 403, 368, 2509, 281, 4720, 755, 326, 14892, 281, 2395, 9165, 32, 20930, 634, 2926, 275, 253, 5701, 2708, 27, 187, 187, 20536, 187, 187, 11063, 10764, 7127, 6, 273, 253, 4876, 326, 1056, 598, 253, 3159, 346, 4698, 8211, 995, 594, 521, 2852, 369, 873, 432, 271, 2393, 2363, 15, 2732, 247, 2159, 533, 27576, 42733, 14349, 347, 247, 5602, 40186, 333, 39760, 5914, 29192, 1607, 3796, 1080, 13, 4744, 25146, 521, 45368, 285, 7416, 253, 21261, 35350, 2285, 347, 247, 9137, 3483, 382, 15, 14324, 187, 187, 17277, 31541, 23773, 275, 16861, 27, 2732, 9773, 2996, 8676, 659, 10037, 2, 187, 187, 34, 1175, 11152, 11789, 556, 1264, 2201, 4295, 27, 187, 9 ]
Quit Multitasking to Boost Productivity This is a bold statement, and one that seems counterintuitive, but David says that the biggest productivity killer he sees in SDRs is multitasking. “SDRs shift tasks too often, just ping-ponging through their day, not making any real momentum in one area,” he explains. “Instead, you should block out time on the calendar for certain things where everything else is shut down.” David isn’t alone in stating that multitasking is a bad idea, either. Research from The American Psychological Association shows that multitasking is inefficient and ineffective. When switching rapidly between tasks, there is actually a brain delay, or lag time. The delay is so great that research shows that working simultaneously on complex tasks can take up to 40% more time than just focusing on one task at a time. Time blocking effectively to minimizing multi-tasking is all about making sure you calendar everything. Block off time first thing in the morning to focus on what matters most. Typically, that is your prospecting calls. If you prioritize your getting in a heavy volume of calls first thing you’ll set the day up for success. Then find time blocks for all the other important tasks of the day like prospect research, admin tasks, and anything else that gets thrown your way. Cut Distractions and Focus on What Matters Multitasking may not be the best idea, but neither is focusing on anything other than your goals and the activities required to meet them. Many SDRs focus on extracurriculars like training new people, admin tasks, or organizing the office holiday party – and while some of those are necessary or useful, they aren’t getting you any closer to hitting your goals. So what does? Understanding your role and your business at a level that demonstrates your mastery. “Do you know your numbers and what it takes for you to be successful?” asks David. “What are the activities and the inputs that you have to achieve on a daily basis in order to make your numbers?” David advocates a laser-like focus on getting in your activity numbers so hitting your goal is all but guaranteed. “At a higher level at the company, you’re just there to fill in a number on a spreadsheet of qualified appointments needed for the company to hit the sales goals that month or quarter,” he says. “That’s the bottom line, and everything else is just noise. Once you cut the noise, focus on reverse-engineering your goals and crushing them every month.” Entering a deep work state is about focusing on a single task for an extended period of time, without distractions and under intense focus. Making time on your calendar for these marathons of work is critical, and these blocks of time should be defended at all costs from meetings, social media, admin tasks, and other shallow work. Learn to Lead Conversations While active listening definitely has its place, you’ve also got to drive the conversation in a specific direction toward the sale. When first entering the account executive role, SDRs tend to struggle most with actually closing the deal. To do so, you have to drive the conversation, learning when to interject and how to frame questions to get the information you need while simultaneously demonstrating business value with your product. David believes that doing so comfortably requires business acumen and in-depth industry knowledge. The best way to acquire those things, aside from real-world experience, is to study. David suggests, “Do everything you can to become an expert in the industry you’re selling to. Master the vocabulary and be an expert in the 3-4 top personas so you can put yourself in their shoes and look at things from their viewpoint.” Once you can relate on another level with your prospect and show you’re knowledgeable, it becomes exponentially easier to discover pain points, demonstrate value, and close more deals. As an SDR, a conversion is getting a qualified lead to an account executive, an account executive, but as an AE, you need to be able to close deals. That requires two things: Knowledge of the industry, personas, and competitors Asking the right questions to demonstrate to prospects that you’re the right solution for them. Work on developing those two skills in your spare time so you can show the AE manager that you’ll be ready to hit the ground running in your new role. Prioritize Making Connections With Colleagues Leading conversations should carry over to your interactions with your colleagues, as well. Just like with prospects, you have to demonstrate value. The difference is that when you’re trying to get promoted, you’re selling your value. Before starting any interview process, you should meet with every account executive and sales manager you can to understand what they’re looking for. In the meantime, once you’ve met your goals for the month, look for ways to establish yourself as a leader within the SDR department. Help train other SDRs, or carve out time to enhance product or industry knowledge to make yourself more of a resource to the team. Share resources with your team or your boss about the industry or sales tactics. Once you feel you’re ready to take the next step to account executive, be vocal about it. Discuss opportunities with the AE manager. Let them know what your goals are, and what you hope to achieve. When you finally do get their attention, be sure to follow David’s rules for interview success: Don’t bring up your timeline with the company. Time isn’t a good indicator of whether or not you’ll be successful. It doesn’t matter if you’ve been an SDR for 6 months or 6 years, AE managers are looking for a good cultural fit, a good team player, and someone who knows the industry, knows the persona, and can close deals. Focus on talking about what you’ve sold in the past, even if it was at other companies, and even if it wasn’t at a company at all (like selling girl scout cookies or Cutco knives in high school). Show you can add value and close deals. Discuss your track record of hitting goals as an SDR as well. Every little bit of experience helps. Master your sales demo or pitch before you get the job. If you canlearn the art of demoing, following up, adding value, and roping people in before the interview, then it should be a no-brainer decision to promote you to account executive. Knock the test project out of the park. Many companies will have you give a presentation or run a test before promoting you. This is your chance to wow them, and you should take advantage. Be overprepared and knock their socks off. Bottom line: start walking and talking like an account executive before you become one if you truly want to crush your interview and demo. Do that, and you’ll leave no doubt in their mind that you deserve the opportunity and are ready. Skip the Line by Switching Companies You may also want to consider going to another company. Research by LinkedIn shows that people are job-hopping more than ever, and sometimes it’s the quickest path to the position you truly want. Try leveraging your LinkedIn profile by making it accessible to recruiters reaching out, or actively pursue opportunities you find online. Just make sure to do your research, think it through, and don’t make any impulsive moves or decisions. Sometimes switching companies in search of a promotion isn’t the best way to go. It could be a risky move because the company may not be a good fit, or they may not have SDRs feeding the pipeline, so you’ll be back to square one doing all the prospecting. David recommends taking the long view. “Look at your current company from a long-term horizon,” he suggests. “We all want everything to be instantly awesome, but sometimes you have to just stick with it. Learn, grow, and contribute value over a longer time period than you think.” If, after doing some digging and soul-searching, you do decide going to another company is the best move for you, make sure you come prepared to the interview with verifiable stats, numbers, examples, and anything else that demonstrates how you excelled at your current company. Awards and certifications for hitting your numbers are a big win. All of this information should roll off your tongue, so make sure you do a dry run prior to your interview. These days, getting promoted is an art form – especially in the sales department. You’ve got to know your industry top to bottom, and come off as a valuable consultant instead of someone serving their own interests. You need to be good with numbers to make sure your activity and touchpoints will adequately fill your pipeline to crush this month’s goal. And finally, you’ve got to strike a careful balance between hitting your numbers, making connections with clients, and building rapport with your colleagues and superiors. If you can do all that, you’ll be well on your way to becoming an account executive in no time. What are you doing to finally get that promotion to account executive? Share your story in the comments below: Related Mark shares 44% of the letters that make up the word "marketing", so his future was set from an early age. After a short but financially lucrative gig as a Macaulay Culkin celebrity impersonator, Mark fulfilled his prophecy and joined the Mailshake team as a marketing strategist.Menu Best Chicken Rice in Singapore: After Visiting 53 Stalls! A good chicken rice has three major components: (
[ 187, 187, 6082, 1644, 273, 253, 7867, 1371, 2098, 13, 285, 3413, 326, 344, 651, 417, 187, 187, 250, 1314, 90, 521, 4433, 281, 2885, 15, 20819, 2111, 26157, 13, 818, 16, 1508, 16, 6759, 13, 387, 1249, 15, 10956, 187, 187, 27337, 281, 3426, 521, 31104, 5350, 7103, 275, 4223, 4072, 13, 187, 187, 68, 1377, 3485, 253, 1264, 30219, 326, 497, 11526, 323, 779, 15, 4031, 15, 535, 50270, 510, 2332, 1302, 671, 2783, 253, 1682, 6284, 273, 253, 12757, 762, 187, 187, 12612, 2030, 883, 9, 66, 2769, 25, 481, 380, 2332, 1302, 4767, 326, 10956, 11612, 760, 8073, 6, 273, 187, 187, 8701, 11526, 12941, 13, 9829, 12941, 342, 253, 12757, 1293, 30555, 330, 6328, 13, 187, 187, 395, 13, 3103, 13, 4269, 253, 12757, 281, 2793, 8991, 14004, 15, 50262, 49274, 187, 187, 18336, 26157, 13, 818, 16, 1508, 16, 6759, 13, 387, 1249, 15, 50262, 510, 2332, 1302, 10945, 10956, 457, 84, 535, 50254, 252, 50264, 14, 23, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 535, 187, 911, 45525, 8664, 521, 3480, 273, 13120, 13, 14851, 326, 627, 310, 1345, 187, 187, 3675, 16220, 326, 344, 812, 452, 908, 281, 8041, 253, 12941, 15, 4031, 15, 3840, 13, 253, 187, 187, 21845, 1302, 1119, 326, 10956, 457, 84, 12941, 342, 253, 12757, 497, 417, 19303, 187, 187, 2388, 3518, 13, 984, 10956, 574, 642, 9355, 4712, 323, 253, 12757, 285, 187, 187, 27337, 281, 956, 14, 484, 327, 11985, 8664, 253, 12757, 457, 84, 1786, 13, 2143, 13, 187, 187, 395, 3345, 4712, 15, 4031, 15, 387, 1249, 14, 1012, 15, 380, 2332, 1302, 11106, 10956, 457, 84, 4433, 281, 187, 187, 1595, 423, 253, 12757, 457, 84, 20391, 3958, 13, 672, 12470, 15, 4031, 15, 387, 2145, 15, 754, 671, 858, 417, 187, 187, 1595, 423, 616, 11526, 37966, 285, 840, 26224, 253, 22296, 41820, 187, 187, 3529, 3560, 1110, 37966, 15, 21, 50275, 2618, 15, 50275, 21342, 13, 327, 1529, 8120, 13, 672, 187, 187, 783, 41820, 30468, 2427, 281, 10956, 457, 84, 1728, 281, 2619, 598, 253, 12757, 13, 187, 187, 30646, 369, 31488, 273, 521, 6122, 457, 84, 49924, 15, 4031, 15, 535, 50270, 510, 2332, 1302, 671, 1119, 326, 253, 3879, 273, 253, 12757, 10260, 187, 187, 303, 27369, 1580, 597, 806, 2210, 715, 1557, 15, 4031, 15, 387, 898, 15, 2091, 330, 6328, 806, 8025, 187, 187, 783, 12757, 457, 84, 1557, 13, 597, 651, 1161, 88, 327, 1327, 14, 19480, 4957, 285, 11377, 275, 187, 187, 3431, 3787, 422, 3879, 15, 4031, 15, 380, 2332, 1302, 1119, 326, 253, 12757, 2389, 3811, 187, 187, 3113, 616, 22846, 4651, 13, 281, 5207, 597, 3730, 347, 773, 24681, 2577, 668, 285, 773, 37, 15242, 1806, 285, 187, 187, 3529, 597, 403, 3206, 275, 7418, 4712, 1690, 6105, 4712, 13, 187, 187, 33353, 1209, 13, 285, 271, 846, 19221, 2086, 15, 50272, 2618, 15, 50275, 510, 2332, 1302, 1119, 326, 253, 187, 187, 22246, 452, 247, 3687, 14170, 281, 616, 22846, 2021, 685, 281, 616, 187, 187, 19293, 4651, 15, 4031, 15, 5429, 187, 21, 187, 50274, 510, 12757, 574, 12067, 80, 504, 291, 297, 447, 15, 427, 15, 53, 904, 577, 16, 1348, 16, 6759, 13, 387, 3435, 15, 187, 50254, 50266, 428, 24, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 2756, 50272, 30646, 2550, 1024, 5333, 253, 13387, 281, 330, 6328, 323, 521, 4433, 281, 2885, 253, 187, 187, 22246, 15, 10022, 13, 359, 1089, 326, 253, 2332, 1302, 457, 84, 29240, 5001, 187, 187, 12612, 2030, 883, 9, 66, 2769, 25, 10, 403, 4516, 407, 4209, 13, 20566, 1941, 275, 253, 187, 187, 15352, 15, 535, 50272, 4553, 359, 3653, 326, 253, 6095, 273, 5238, 2030, 883, 9, 66, 10, 403, 1313, 13, 187, 187, 664, 4262, 281, 2278, 1880, 253, 6095, 273, 5238, 2030, 883, 9, 67, 10, 403, 187, 187, 84, 33496, 15, 2594, 496, 294, 2006, 7872, 273, 330, 15, 45, 15, 40, 904, 898, 3208, 329, 15, 19, 69, 48778, 13, 2233, 26, 313, 9387, 15, 6053, 15, 187, 187, 8012, 10, 313, 257, 30973, 481, 5238, 2030, 883, 9, 67, 10, 3400, 27, 535, 50272, 9, 67, 10, 5131, 15711, 18295, 510, 1302, 275, 38915, 253, 3570, 187, 50272, 1171, 247, 2885, 3091, 1918, 3625, 8180, 281, 253, 187, 50272, 27055, 267, 13, 3520, 285, 8991, 3198, 285, 15519, 273, 253, 187, 50272, 7003, 15, 380, 3570, 273, 247, 2885, 3091, 417, 320, 19344, 12718, 327, 253, 187, 50272, 40265, 273, 6938, 2616, 824, 347, 18766, 8039, 13, 187, 50272, 71, 662, 763, 723, 13, 6021, 13, 14234, 285, 3739, 1557, 604, 1119, 281, 320, 187, 50272, 42218, 253, 1453, 273, 253, 2885, 15, 2726, 1675, 281, 667, 5266, 187, 50272, 47092, 10376, 281, 19087, 313, 66, 2769, 18, 582, 313, 23, 582, 390, 313, 25, 582, 253, 1302, 3091, 187, 50272, 1439, 1908, 667, 6031, 407, 253, 2885, 281, 16748, 253, 2515, 187, 50272, 25598, 15308, 534, 403, 806, 15247, 6774, 281, 253, 187, 50272, 19647, 273, 4366, 273, 253, 12108, 273, 253, 5266, 15, 187, 187, 1508, 3643, 15, 36, 15, 52, 15, 34, 15, 3015, 2030, 883, 9, 67, 481, 831, 2111, 556, 4767, 326, 253, 2770, 275, 38915, 187, 187, 5598, 267, 3570, 762, 5238, 2030, 883, 9, 66, 10, 310, 327, 253, 2885, 13, 533, 352, 310, 327, 253, 1429, 187, 187, 81, 27956, 281, 5238, 2030, 883, 9, 67, 481, 4031, 15, 387, 2233, 25, 15, 535, 50272, 688, 16725, 253, 1941, 275, 1329, 273, 15056, 762, 5238, 187, 187, 1099, 883, 9, 67, 582, 776, 6413, 2111, 4102, 4767, 347, 3637, 27, 535, 50272, 60, 42, 62, 71, 253, 9905, 323, 15056, 762, 19087, 313, 66, 10, 403, 1313, 13, 247, 187, 50272, 13550, 773, 30049, 1918, 3625, 8180, 281, 253, 16743, 13, 187, 50272, 29079, 285, 8991, 3198, 285, 15519, 273, 253, 1429, 1425, 3495, 187, 50272, 9387, 15, 36, 15, 52, 15, 34, 15, 3015, 2030, 883, 9, 67, 481, 380, 8991, 3198, 285, 15519, 273, 253, 187, 50272, 7003, 452, 644, 6283, 12814, 281, 2486, 16595, 74, 62, 2649, 606, 23229, 187, 50272, 10328, 347, 2389, 13, 5956, 13, 3988, 13, 285, 7882, 1425, 496, 294, 611, 15, 46, 904, 8676, 535, 50254, 50266, 428, 25, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 2756, 50273, 34, 15, 20, 69, 818, 3593, 13, 818, 4739, 313, 9387, 15, 6053, 15, 4050, 481, 496, 496, 294, 444, 15, 46, 904, 544, 38447, 329, 15, 19, 69, 41981, 13, 187, 50273, 34906, 313, 9387, 15, 9725, 41256, 544, 454, 6413, 62, 2111, 2918, 326, 253, 187, 50273, 42142, 273, 253, 1429, 457, 84, 773, 50234, 285, 15519, 668, 4419, 187, 50273, 15603, 318, 273, 253, 8991, 13403, 875, 253, 2885, 285, 187, 50273, 7003, 15, 380, 773, 307, 2252, 4116, 668, 943, 320, 5087, 281, 557, 29340, 253, 187, 50273, 8222, 327, 253, 1429, 273, 21311, 1917, 272, 253, 17087, 5533, 15, 187, 50273, 688, 294, 611, 15, 46, 904, 8676, 329, 15, 20, 69, 387, 818, 4739, 15, 187, 187, 688, 294, 27, 308, 15, 52, 15, 46, 904, 11102, 329, 15, 20, 69, 30669, 13, 27880, 313, 9387, 15, 4072, 481, 535, 50273, 4943, 13, 253, 2332, 1302, 1119, 27, 535, 50273, 60, 53, 62, 248, 544, 36, 62, 73, 786, 445, 403, 43377, 275, 253, 1557, 273, 253, 22846, 4651, 15, 187, 50273, 510, 22846, 4651, 403, 14127, 512, 273, 253, 16743, 13, 187, 50273, 29079, 285, 8991, 3198, 273, 253, 544, 36, 62, 73, 786, 445, 15, 380, 544, 36, 62, 73, 786, 445, 187, 50273, 709, 254, 281, 616, 22846, 4651, 347, 773, 24681, 2577, 668, 285, 773, 37, 15242, 668, 285, 513, 187, 50273, 1439, 751, 281, 320, 1977, 432, 616, 22846, 4651, 15, 733, 310, 5165, 326, 187, 50273, 783, 22846, 4651, 2085, 253, 544, 36, 62, 73, 786, 445, 342, 253, 4569, 187, 50273, 26617, 285, 21909, 285, 4116, 326, 253, 544, 36, 62, 73, 786, 445, 17337, 15, 187, 50273, 510, 544, 21845, 1302, 62, 9010, 326, 253, 3625, 8991, 14170, 273, 187, 50273, 783, 544, 36, 62, 73, 786, 445, 310, 342, 253, 22846, 2885, 285, 417, 342, 253, 3626, 187, 50273, 24905, 15, 733, 310, 2918, 326, 1880, 247, 1429, 457, 84, 3625, 8991, 187, 50273, 47537, 310, 342, 253, 22846, 2885, 2581, 685, 247, 4201, 2885, 310, 187, 50273, 66, 1534, 2803, 275, 16344, 253, 1429, 457, 84, 16743, 285, 187, 50273, 358, 29882, 3198, 285, 15519, 15, 496, 1720, 27, 611, 15, 59, 15, 52, 904, 898, 2950, 329, 15, 19, 69, 818, 3357, 13, 818, 1540, 187, 50273, 9, 9387, 15, 6053, 15, 4695, 558, 496, 253, 9535, 273, 27, 611, 15, 46, 904, 8676, 329, 15, 20, 69, 818, 3593, 13, 818, 4739, 187, 50273, 9, 9387, 15, 6053, 15, 4050, 481, 380, 544, 21845, 1302, 62, 9010, 326, 38915, 253, 187, 50273, 19293, 4651, 457, 17087, 3570, 310, 4518, 275, 253, 544, 36, 62, 73, 786, 445, 457, 84, 1682, 187, 50273, 14014, 84, 15, 187, 187, 49274, 2111, 26157, 13, 818, 16, 1508, 16, 6759, 13, 387, 1458, 15, 535, 50273, 510, 2332, 1302, 1119, 326, 253, 22846, 4651, 13, 417, 10956, 13, 452, 2530, 187, 187, 1542, 253, 12757, 457, 84, 16743, 13, 3520, 13, 285, 8991, 3198, 285, 15519, 13, 187, 187, 395, 326, 10956, 588, 417, 320, 2104, 281, 2085, 323, 616, 3198, 15, 50271, 49274, 2111, 187, 187, 48, 22104, 13, 818, 16, 1508, 16, 6759, 13, 387, 1638, 15, 50268, 11389, 13, 627, 369, 4209, 13, 20566, 187, 187, 22432, 432, 534, 253, 2332, 1302, 6283, 1119, 326, 253, 12757, 457, 84, 187, 187, 21423, 14170, 310, 342, 253, 22846, 4651, 13, 285, 627, 310, 642, 5533, 875, 2756, 50254, 50266, 50276, 14, 26, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 535, 187, 783, 12757, 285, 10956, 15, 4031, 15, 844, 452, 4767, 326, 13, 275, 16472, 247, 20705, 187, 187, 12792, 13, 253, 1302, 310, 417, 2424, 281, 897, 6485, 6206, 13, 533, 778, 10725, 327, 187, 187, 783, 6206, 273, 2675, 5820, 285, 1083, 26719, 15, 50269, 688, 294, 1503, 15, 49, 904, 898, 3953, 329, 15, 19, 69, 187, 187, 7749, 25, 13, 11633, 18, 313, 9387, 15, 6053, 15, 4267, 481, 831, 2111, 556, 2540, 326, 642, 5533, 4409, 187, 187, 10192, 26368, 310, 4447, 875, 247, 1429, 285, 247, 3626, 2885, 835, 253, 1429, 187, 187, 7110, 644, 275, 22846, 1557, 323, 954, 273, 253, 1429, 457, 84, 1495, 13, 285, 253, 4795, 5533, 187, 187, 3113, 253, 3626, 2885, 310, 26513, 15, 496, 294, 611, 15, 59, 15, 52, 904, 898, 2950, 329, 15, 19, 69, 818, 3357, 13, 818, 1540, 313, 9387, 15, 187, 187, 15705, 15, 4695, 481, 50274, 30646, 4242, 281, 773, 911, 26849, 544, 783, 62, 19379, 2954, 534, 187, 187, 11155, 684, 432, 253, 2885, 60, 457, 84, 62, 24741, 281, 3037, 4569, 31104, 964, 964, 964, 187, 187, 1425, 496, 294, 611, 15, 44, 15, 51, 15, 52, 904, 898, 3680, 329, 15, 19, 69, 40355, 13, 40730, 313, 9387, 15, 6053, 15, 4695, 481, 10956, 858, 417, 1691, 187, 187, 41938, 275, 247, 1899, 281, 5467, 5312, 31104, 19715, 323, 253, 187, 187, 22246, 594, 326, 344, 812, 1287, 247, 1524, 5533, 342, 731, 15, 50265, 49274, 2111, 187, 187, 48, 22104, 13, 818, 16, 1508, 16, 6759, 13, 387, 1638, 9944, 923, 496, 294, 500, 15, 45, 15, 36, 904, 854, 1787, 329, 15, 19, 69, 1249, 2504, 13, 1249, 2537, 313, 9387, 15, 187, 187, 15705, 15, 6469, 481, 535, 50272, 30646, 4180, 265, 281, 2389, 253, 12757, 15, 50269, 47, 15, 53, 904, 577, 16, 1348, 16, 6759, 13, 387, 6480, 15, 187, 187, 6436, 13, 247, 2885, 457, 84, 1211, 10450, 273, 2389, 285, 21909, 323, 247, 1429, 13, 3815, 13, 588, 187, 187, 1439, 31423, 15056, 273, 17087, 3570, 15, 496, 294, 1503, 15, 49, 904, 898, 3953, 329, 15, 19, 69, 387, 11633, 18, 15, 187, 187, 1231, 4767, 275, 496, 294, 1503, 15, 49, 904, 247, 1429, 457, 84, 1495, 773, 3549, 2881, 2550, 320, 1691, 327, 2186, 275, 253, 187, 187, 36865, 326, 544, 66, 2885, 62, 588, 23439 ]
objectives of the permanency plan, and determined that he would not remedy his failure to parent. Trial Court Opinion, 7/23/2014, at 12. Father failed to complete his parenting capacity evaluation in August 2013, cancelling the three appointments that were scheduled for him. Id. The trial court also considered the best interests of the Children under Section 2511(a)(8). The trial court stated that Father attended only 52% of his scheduled visits, missed visits with the Children without contacting CYS, and, therefore, caused the Children to experience emotional upset. Trial Court Opinion, 7/23/2014, at 12. The trial court rejected Father’s -6- J-S76044-14 explanation concerning his lack of transportation, stating that there is public transportation that he could have used to attend the visits. Id. Further, the trial court found that Father’s visits with the Children were not productive interactions, because Father had no planned activities for the Children and failed to follow-up on discussions concerning the Children’s health, school, and outside activities. Id. at 12-13. The trial court cited Father’s failure to attend the Children’s soccer games, when invited. Id. at 13. He also did not attend their scheduled surgeries and then cancelled the supervised visitation that followed those surgeries.4 Id. Moreover, on another occasion, when the visitation coordinator went to Father’s home to pick up the Children, Father was unsure of his daughter’s whereabouts. Id. The trial court also found that the behavior of the Children greatly improved since they first came into care. Id. at 9. When CYS first assumed the Children’s care, they would chew on non-food items and engage in disruptive behavior. Id. The trial court found that the Children love living with their foster parents, to whom they refer as “Mommy” and “Daddy,” and that they are involved in numerous activities including church activities, soccer, and an afterschool program. Id. The trial court found that the Children have a greater attachment to their foster family than to their natural parents. Id. 4 The Children had adenoidectomies. N.T., 4/24/2014, at 27. -7- J-S76044-14 Father cannot now shift the blame to CYS for his failure to parent the Children. Accordingly, we find that the trial court’s determinations regarding Section 2511(a)(8) are supported by sufficient, competent evidence in the record. After we determine that the requirements of Section 2511(a) are met, we proceed to review whether the requirements of Section 2511(b) are satisfied. See In re Adoption of C.L.G., 956 A.2d 999, 1009 (Pa. Super. 2008) (en banc). Section 2511(b) provides: (b) Other considerations.--The court in terminating the rights of a parent shall give primary consideration to the developmental, physical and emotional needs and welfare of the child. The rights of a parent shall not be terminated solely on the basis of environmental factors such as inadequate housing, furnishings, income, clothing and medical care if found to be beyond the control of the parent. With respect to any petition filed pursuant to subsection (a)(1), (6), or (8), the court shall not consider any efforts by the parent to remedy the conditions described therein which are first initiated subsequent to the giving of notice of the filing of the petition. 23 Pa.C.S.A. § 2511(b). This Court has stated that the focus in terminating parental rights under Section 2511(a) is on the parent, but it is on the child pursuant to Section 2511(b). Id. at 1008. In reviewing the evidence in support of termination under Section 2511(b), our Supreme Court recently stated as follows: [I]f the grounds for termination under subsection (a) are met, a court “shall give primary consideration to the developmental, physical and emotional needs and welfare of the child.” 23 Pa.C.S.A. § 2511(b). The emotional needs and welfare of the child have been properly interpreted to include “[i]ntangibles such as love, comfort, security, and stability.” In re K.M., 53 -8- J-S76044-14 A.3d 781, 791 (Pa. Super. 2012). In In re E.M., [620 A.2d 481, 485 (Pa. 1993)], [our Supreme] Court held that the determination of the child’s “needs and welfare” requires consideration of the emotional bonds between the parent and child. The “utmost attention” should be paid to discerning the effect on the child of permanently severing the parental bond. In re K.M., 53 A.3d at 791. In re: T.S.M., 71 A.3d 251, 267 (Pa. 2013). Here, the trial court found: [T]he [C]hildren are thriving in the care of the foster parents. The foster parents are satisfying all of the developmental, physical and emotional needs of the [C]hildren. The [C]hildren refer to their foster parents as “Mommy” and “Daddy” and do not like to be away from their foster parents. It is apparent that the foster parents provide the [C]hildren with the appropriate love and affection and attention that the [C]hildren deserve. The [trial court] finds that the primary emotional attachment of the [C]hildren is with the foster parent and not with the natural parents. It is held that whether a child’s primary emotional attachment is with the foster parent rather than a birth parent is a significant factor in evaluating the child’s developmental and emotional needs and welfare. In Re: K.Z.S., 946 A.2d 753, 764 (Pa. Super. 2008); In the Interest of: K.M., 53 A.3d 781, 791 (Pa. Super. 2012). The [trial court] finds that terminating the natural parents’ parental rights is clearly in the [C]hildren’s best interests. Trial Court Opinion, 7/23/2014, at 15. The trial court found that the foster parents, not Father, have provided for the Children’s developmental, physical, and emotional needs and welfare, and that Father will not be able to provide for their needs. Trial Court Opinion, 7/23/2014, at 14. Further, there was sufficient, competent evidence from which the trial court properly found that the Children’s primary attachment is with the foster parents, and there is no bond between -9- J-S76044-14 the Children and Father. Id. We have stated that, in conducting a bonding analysis, the court is not required to use expert testimony, but may rely on the testimony of social workers and caseworkers. In re Z.P., 994 A.2d 1108, 1121 (Pa. Super. 2010). This Court has observed that no bond worth preserving is formed between a child and a natural parent where the child has been in foster care for most of the child’s life, and the resulting bond with the natural parent is attenuated. In re K.Z.S., 946 A.2d 753, 764 (Pa. Super. 2008). Father failed to “exhibit [the] bilateral relationship which emanates from the parent[’s] willingness to learn appropriate parenting . . . .” In re K.K.R.S., 958 A.2d 529, 534 (Pa. Super. 2008). Father did not put himself in a position to assume daily parenting responsibilities for the Children so that he could develop a real bond with them. Trial Court Opinion, 7/23/2014, at 14.; see In re J.L.C., 837 A.2d 1247, 1249 (Pa. Super. 2003). Father professes to love the Children. N.T., 4/24/2014, at 38. However, a parent’s own feelings of love and affection for a child, alone, will not preclude termination of parental rights. In re Z.P., 994 A.2d at 1121. We stated in In re Z.P., a child’s life “simply cannot be put on hold in the hope that [a parent] will summon
[ 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 10580, 14, 8002, 14, 2845, 1573, 14, 10613, 14, 20894, 1138, 10580, 64, 8002, 16, 2845, 1573, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 10146, 14, 20894, 1138, 10146, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 5695, 14, 20894, 1138, 5695, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 5695, 14, 10613, 14, 20894, 1138, 5695, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 3621, 14, 20894, 1138, 3621, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 3621, 14, 10613, 14, 20894, 1138, 3621, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 21997, 14, 20894, 1138, 21997, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 21997, 14, 10613, 14, 20894, 1138, 21997, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 6790, 14, 15476, 14, 20894, 1138, 6790, 64, 15476, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 6790, 14, 15476, 14, 10613, 14, 20894, 1138, 6790, 64, 15476, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2808, 14, 22965, 14, 20894, 1138, 2808, 64, 22965, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2808, 14, 22965, 14, 10613, 14, 20894, 1138, 2808, 64, 22965, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 2230, 14, 20894, 1138, 2230, 16, 2230, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 2230, 14, 10613, 14, 20894, 1138, 2230, 16, 2230, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 26451, 14, 20894, 1138, 2230, 16, 26451, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 28213, 14, 20894, 1138, 2230, 16, 28213, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 28213, 14, 10613, 14, 20894, 1138, 2230, 16, 28213, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 8906, 14, 20894, 1138, 2230, 16, 8906, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 42096, 874, 14, 12467, 14, 20894, 1138, 42096, 874, 64, 12467, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 19484, 14, 20894, 1138, 19484, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 20894, 1138, 35704, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 46818, 14, 20894, 1138, 35704, 64, 46818, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 46818, 14, 10613, 14, 20894, 1138, 35704, 64, 46818, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 10613, 14, 20894, 1138, 35704, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 3659, 14, 18534, 14, 20894, 1138, 3659, 64, 18534, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 9177, 14, 20894, 1138, 9177, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 9177, 14, 10613, 14, 20894, 1138, 9177, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 12467, 14, 20894, 1138, 287, 12042, 64, 12467, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 12467, 14, 10613, 14, 20894, 1138, 287, 12042, 64, 12467, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 301, 14, 20894, 1138, 287, 12042, 64, 301, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 301, 14, 10613, 14, 20894, 1138, 287, 12042, 64, 301, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 3409, 14, 20894, 1138, 287, 12042, 64, 3409, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 3409, 14, 10613, 14, 20894, 1138, 287, 12042, 64, 3409, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 287, 12042, 14, 12467, 14, 20894, 1138, 17166, 16, 287, 12042, 64, 12467, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 17166, 14, 5903, 14, 20894, 1138, 17166, 16, 17166, 64, 5903, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 17166, 14, 5903, 14, 10613, 14, 20894, 1138, 17166, 16, 17166, 64, 5903, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 1070, 14, 20894, 1138, 17166, 64, 12583, 16, 23167, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 22172, 14, 20894, 1138, 17166, 64, 12583, 16, 22172, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 32499, 14, 20894, 1138, 17166, 64, 12583, 16, 32499, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 681, 993, 2081, 14, 20894, 1138, 17166, 64, 12583, 16 ]
ree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#graph-nav-recording-service-proto">graph_nav/recording_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#header-proto">header.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#image-proto">image.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#image-service-proto">image_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#lease-proto">lease.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#lease-service-proto">lease_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#license-proto">license.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#license-service-proto">license_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#local-grid-proto">local_grid.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#local-grid-service-proto">local_grid_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#log-annotation-proto">log_annotation.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#log-annotation-service-proto">log_annotation_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-mission-proto">mission/mission.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-mission-service-proto">mission/mission_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-nodes-proto">mission/nodes.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-remote-proto">mission/remote.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-remote-service-proto">mission/remote_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-util-proto">mission/util.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mobility-command-proto">mobility_command.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#parameter-proto">parameter.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-proto">payload.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-registration-proto">payload_registration.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-registration-service-proto">payload_registration_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-service-proto">payload_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#point-cloud-proto">point_cloud.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#power-proto">power.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#power-service-proto">power_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-command-proto">robot_command.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-command-service-proto">robot_command_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-id-proto">robot_id.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-id-service-proto">robot_id_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-state-proto">robot_state.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-state-service-proto">robot_state_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-robot-command-proto">spot/robot_command.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-spot-check-proto">spot/spot_check.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-spot-check-service-proto">spot/spot_check_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-led-proto">spot_cam/LED.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-audio-proto">spot_cam/audio.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-camera-proto">spot_cam/camera.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-compositor-proto">spot_cam/
[ 2987, 390, 643, 1345, 11839, 556, 253, 987, 281, 30215, 11349, 762, 5272, 9162, 1754, 2220, 824, 2616, 347, 253, 2105, 273, 2579, 13, 253, 4096, 323, 534, 253, 2579, 390, 1885, 310, 2959, 13, 253, 10671, 390, 2408, 2959, 13, 253, 1027, 1894, 273, 253, 2579, 25032, 13, 253, 673, 273, 697, 897, 390, 667, 643, 2647, 534, 10262, 247, 6832, 3064, 347, 247, 3216, 273, 13812, 15, 11087, 330, 15, 43, 15, 52, 904, 5259, 28218, 1005, 13, 3015, 3435, 13, 3239, 884, 2537, 28, 7652, 3052, 15, 49864, 904, 721, 2511, 28, 2448, 743, 25178, 23910, 13, 3690, 904, 362, 15, 3228, 273, 19989, 28093, 13, 25911, 3643, 15, 30642, 13, 13620, 329, 15, 818, 1731, 13, 2456, 329, 15, 45, 15, 51, 15, 16493, 15, 187, 1147, 369, 2918, 407, 776, 6413, 2111, 275, 3228, 273, 7667, 5410, 251, 362, 15, 11290, 1216, 13, 11334, 5255, 15, 40783, 13, 16918, 322, 15, 56, 15, 854, 3953, 13, 326, 247, 2846, 556, 253, 7143, 13, 2220, 1463, 2748, 13, 281, 3334, 17249, 323, 31842, 38648, 5799, 3578, 3658, 390, 4657, 24761, 285, 4822, 3587, 432, 253, 31842, 2581, 685, 432, 253, 2867, 7302, 15, 733, 651, 1646, 326, 604, 247, 2846, 476, 320, 2424, 281, 21623, 285, 4179, 323, 697, 1824, 327, 253, 3720, 273, 247, 2021, 390, 2060, 2136, 3943, 326, 352, 943, 671, 452, 253, 1612, 281, 513, 594, 327, 697, 1211, 7158, 15, 1916, 2186, 5010, 651, 320, 281, 1659, 824, 1612, 285, 8637, 275, 253, 3564, 273, 1016, 2060, 2608, 281, 3692, 41750, 285, 18612, 253, 2846, 651, 320, 2256, 1293, 1612, 281, 1453, 390, 8722, 697, 11839, 2136, 15, 380, 9162, 273, 10230, 9910, 762, 247, 16252, 9162, 1754, 323, 2281, 6378, 2220, 21337, 5085, 310, 417, 13, 275, 776, 4743, 13, 1293, 5272, 3720, 285, 22861, 15, 6102, 475, 44941, 4212, 12647, 247, 1511, 390, 966, 9619, 1027, 285, 5799, 432, 643, 4212, 15, 831, 310, 4209, 3720, 323, 253, 9162, 15, 733, 369, 594, 2918, 407, 253, 2111, 273, 9892, 273, 15812, 275, 13054, 362, 15, 18308, 285, 3228, 6456, 273, 330, 44113, 13, 24665, 31107, 15, 9135, 13, 8255, 329, 15, 374, 69, 33311, 13, 28325, 13, 762, 247, 2074, 25245, 15, 380, 1302, 13, 275, 326, 1083, 13, 4767, 27, 187, 3, 7865, 272, 271, 10230, 2419, 247, 2136, 1057, 417, 6990, 253, 958, 326, 352, 310, 271, 20828, 273, 23031, 723, 15, 733, 310, 417, 20697, 281, 30215, 352, 342, 643, 23031, 723, 2581, 685, 342, 21440, 449, 187, 510, 440, 4557, 10998, 2801, 273, 6265, 275, 643, 3054, 310, 326, 247, 2846, 778, 30215, 697, 4212, 327, 253, 3720, 273, 247, 2021, 390, 2136, 3943, 285, 2613, 697, 4179, 323, 253, 2579, 2220, 824, 3943, 13, 285, 778, 1056, 247, 5927, 4179, 323, 1016, 824, 3943, 15, 16647, 362, 15, 3228, 273, 443, 3502, 32485, 13, 21982, 427, 15, 36, 15, 24665, 13, 7251, 322, 15, 38, 15, 898, 520, 28, 1986, 2077, 362, 15, 2448, 10205, 14, 21950, 2434, 904, 330, 15, 36, 904, 5345, 401, 15, 818, 2504, 15, 187, 510, 958, 326, 253, 2846, 9192, 6419, 697, 1824, 285, 41930, 486, 23585, 2579, 281, 21440, 285, 22777, 19509, 285, 643, 5053, 835, 44414, 386, 5454, 310, 29039, 762, 271, 9787, 9162, 342, 760, 581, 5927, 4179, 13, 1014, 2167, 690, 273, 253, 5085, 275, 690, 273, 841, 5053, 403, 908, 347, 2021, 5085, 13, 310, 9090, 247, 11081, 1411, 21142, 15, 496, 776, 4743, 13, 2299, 13, 824, 11081, 310, 417, 13, 762, 253, 5441, 285, 5989, 275, 1941, 275, 436, 1083, 13, 271, 10341, 285, 20697, 581, 15, 380, 1600, 285, 3198, 273, 253, 7418, 1824, 4212, 5608, 407, 247, 2846, 403, 824, 326, 352, 310, 1965, 67, 494, 13, 604, 417, 7479, 13, 326, 667, 9162, 390, 2281, 3720, 812, 320, 32434, 534, 651, 417, 275, 690, 1039, 30530, 1411, 690, 273, 253, 4212, 15, 1310, 21142, 943, 30950, 275, 436, 1083, 13, 627, 651, 320, 247, 11081, 1411, 11349, 275, 2014, 3943, 23031, 723, 15, 3105, 1046, 11081, 13, 2299, 13, 310, 26212, 13, 533, 760, 247, 11081, 326, 310, 10341, 285, 1293, 247, 5272, 958, 3720, 390, 22861, 15, 380, 11081, 275, 436, 1083, 310, 417, 10341, 15, 1623, 253, 10214, 13, 352, 310, 4516, 285, 17285, 407, 247, 15010, 3720, 323, 9162, 285, 407, 6832, 1941, 534, 816, 7790, 253, 7260, 1160, 281, 326, 966, 273, 4212, 15, 6102, 11081, 347, 627, 310, 878, 417, 320, 9606, 407, 21142, 15, 1583, 452, 253, 987, 281, 452, 3081, 17249, 8038, 594, 326, 7260, 778, 320, 1160, 3587, 281, 1016, 11692, 3943, 15, 187, 510, 4342, 273, 958, 4724, 407, 253, 1302, 497, 4516, 407, 1941, 285, 2424, 253, 3883, 13697, 15, 844, 452, 6730, 643, 2792, 3559, 285, 1089, 642, 24048, 2228, 15, 187, 510, 3883, 310, 16337, 15, 187, 4943, 247, 7648, 367, 982, 40871, 187, 1542, 253, 3186, 346, 53, 5104, 8679, 84, 26152, 3, 432, 776, 2670, 187, 15, 28066, 441, 323, 625, 1959, 40871, 2195, 187, 187, 7845, 3877, 27, 359, 403, 417, 5506, 187, 1542, 690, 3186, 819, 1169, 2, 844, 760, 921, 247, 1959, 40482, 40871, 432, 187, 454, 2670, 323, 436, 3186, 2748, 2, 20536, 17891, 27, 187, 187, 5622, 19070, 2726, 48721, 308, 953, 401, 25826, 19672, 1106, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 1575, 15, 681, 16, 4663, 15, 2974, 32, 32280, 64, 301, 30, 740, 46027, 7, 81, 30, 649, 7, 83, 30, 81, 11548, 10655, 1010, 7, 68, 30, 18, 7, 75, 30, 1012, 187, 1051, 16040, 45258, 5729, 17920, 2071, 19070, 2726, 48721, 308, 953, 401, 25826, 19672, 1106, 18142, 5292, 310, 247, 3346, 745, 387, 253, 1113, 15, 831, 3226, 22486, 285, 4745, 9727, 432, 3346, 281, 42296, 521, 11694, 15, 1500, 270, 10600, 512, 689, 521, 3558, 285, 3346, 12951, 1041, 27, 11366, 6443, 13, 6939, 3671, 13, 3052, 43643, 13, 7108, 13, 2596, 11271, 44857, 17855, 27, 367, 35064, 15, 9507, 187, 187, 41, 1575, 90, 17696, 34895, 399, 6111, 2726, 329, 10417, 30276, 254, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 698, 4003, 15, 681, 16, 18, 16, 1237, 35340, 16, 1731, 13743, 16, 4663, 15, 2974, 187, 1051, 37559, 3226, 13, 13027, 432, 42862, 4889, 275, 2502, 45001, 466, 15, 8679, 369, 594, 3346, 4829, 18298, 281, 2075, 253, 3226, 533, 275, 253, 990, 703, 3346, 1157, 1880, 703, 556, 1943, 246, 953, 13, 10058, 246, 953, 14528, 352, 275, 253, 3346, 49142, 27, 13516, 14179, 1876, 3824, 26152, 2, 1283, 530, 15, 52, 15, 36, 15, 5238, 3346, 12951, 1041, 27, 6939, 3671, 13, 443, 13139, 13, 3052, 43643, 13, 30912, 1507, 13, 5284, 17855, 27, 4410, 10315, 16678, 11835, 793, 187, 187, 18139, 33574, 30276, 254, 21231, 2355, 329, 22757, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 698, 4003, 15, 681, 16, 18, 16, 1237, 35340, 16, 1630, 20216, 16, 4663, 15, 2974, 187, 1051, 2120, 4892, 273, 26653, 594, 8679, 2335, 779, 327, 271, 9470, 3346, 247, 8230, 2628, 432, 247, 3226, 342, 17543, 327, 313, 19552, 1223, 344, 3346, 1157, 1880, 703, 556, 1943, 246, 953, 13, 10058, 246, 953, 14528, 352, 275, 253, 3346, 49142, 27, 13516, 14179, 1876, 3824, 26152, 2, 1283, 530, 15, 52, 15, 36, 15, 5238, 3346, 12951, 1041, 27, 6939, 3671, 13, 443, 13139, 13, 3052, 43643, 13, 30912, 1507, 13, 5284, 17855, 27, 4410, 10315, 16678, 11835, 793, 187, 187, 5178, 43267, 264, 19298, 5464, 1680, 308, 770, 466, 401, 20044, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 303, 856, 620, 15, 681, 16, 69, 16, 35744, 4305, 16, 81, 982, 16, 32296, 1967, 16, 21, 16, 4663, 15, 2974, 32, 81, 30, 649, 7, 83, 30, 81, 11548, 10655, 1010, 7, 68, 30, 21, 7, 75, 30, 1012, 7, 3346, 187, 1051, 500, 814, 5943, 6505, 253, 6507, 14, 1962, 30230, 6838, 387, 1728, 285, 9580, 84, 2366, 3346, 401, 20044, 775, 580, 251, 310, 247, 25594, 3226, 342, 5699, 25960, 15, 1500, 7120, 3346, 562, 273, 617, 6863, 285, 10058, 6447, 285, 840, 41714, 327, 3346, 281, 42296, 521, 11694, 15, 1500, 270, 10600, 512, 689, 521, 3558, 285, 3346, 12951, 1041, 27, 11366, 6443, 13, 6939, 3671, 13, 7967, 308, 953, 13, 3052, 43643, 13, 7108, 17855, 27, 7967, 19120, 2576, 500, 814, 5943, 187, 187, 52, 503, 610, 21444, 74, 24006, 443, 1644, 322, 561, 780, 18147, 596, 287, 839, 9715, 27, 3944, 1358, 47189, 15, 38088, 456, 15, 681, 16, 28117, 26824, 16, 740, 1717, 1036, 16, 19443, 20, 16, 19, 16, 19, 16, 17, 187, 1051, 752, 32, 2064, 434, 616, 1895, 15, 2053, 6838, 403, 1469, 281, 452, 281, 3346, 326, 1199, 11694, 1066, 617, 10058, 13386, 369, 1469, 281, 320, 3346, 23646, 2084, 1059, 327, 776, 5599, 434, 11694, 13, 33131, 12188, 598, 285, 1066, 327, 521, 3346, 778, 320, 10058, 13, 533, 703, 40724, 11694, 751, 247, 1943, 3226, 2, 1401, 9304, 2271, 3346, 12951, 1041, 27, 2745, 561, 13, 11366, 6443, 13, 378, 676, 20459, 13, 3052, 43643, 13, 37887, 28853, 13, 443, 29191, 13, 7108, 17855, 27, 596, 287, 456, 187, 187, 2214, 14736, 4735, 4496, 187, 936, 8046, 16872, 390, 281, 1691, 436, 2670, 275, 10215, 264, 44857, 8232, 187, 249, 634, 9882, 187, 187, 15852, 84, 4496, 187, 33724, 634, 5753, 432, 24497, 16921, 407, 3365, 970, 634, 9882, 434, 187, 9960, 41822, 17971, 15, 187, 3074, 3210, 15602, 327, 436, 2670, 403, 1283, 1107, 390, 5662, 15, 187, 2214, 19956, 24, 2905, 34989, 4496, 3057, 1016, 19718, 2670, 7302, 187, 527, 1741, 1230, 15, 187, 1231, 513, 417, 4711, 16921, 5576, 2600, 9361, 15, 2719, 7662, 273, 187, 454, 2670, 2216, 13, 347, 973, 347, 629, 390, 40071, 273, 776, 4859, 310, 19772, 15, 187, 5039, 2327, 187, 12812, 17004, 1550, 3667, 25462, 1623, 12576, 1638, 64, 1797, 13, 8012, 411, 1477, 15, 87, 12115, 15, 681, 187, 187, 53, 455, 2966, 2499, 273, 10784, 13, 253, 581, 20417, 6831, 275, 39863, 571, 13, 310, 253, 39230, 273, 39863, 757, 11369, 285, 4302, 4730, 15, 496, 4588, 1495, 13, 247, 3438, 32569, 90, 8451, 288, 1369, 44250, 5931, 6289, 281, 347, 411, 1507, 251, 457, 84, 15, 7160, 7138, 369, 247, 411, 326, 39288, 369, 253, 426, 11773, 16008, 457, 84, 30, 50042, 253, 3430, 1039, 598, 15, 27486, 1004, 1037, 13, 2067, 411, 1507, 251, 457, 84, 13, 2366, 342, 253, 581, 275, 253, 2460, 13, 1996, 3395, 426, 11773, 16008, 457, 84, 30, 846, 411, 1507, 251, 457, 84, 2427, 562, 273, 2136, 15, 353, 2061, 437, 790, 310, 2717, 747, 15, 15073, 31372, 13, 499, 9681, 285, 2725, 280, 35586, 452, 8689, 1947, 598, 285, 5195, 407, 1039, 273, 253, 28969, 584, 1580, 253, 1265, 273, 1966, 9493, 2469, 15, 1310, 352, 3637, 253, 11693, 273, 9493, 2469, 13, 353, 2061, 437, 790, 588, 28755, 1977, 313, 3022, 42431, 14, 35, 3298, 8043, 2149, 330, 7864, 582, 285, 320, 7932, 407, 581, 2181, 747, 15, 1422, 6830, 476, 457, 85, 3523, 352, 13, 533, 359, 476, 642, 1679, 685, 320, 6600, 326, 841, 4957, 2826, 13, 285, 359, 476, 3177, 281, 29966, 616, 8334, 1543, 407, 5277, 690, 8668, 15, 187, 187, 8934, 1100, 751, 17899, 751, 17899, 285, 12633, 4376, 275, 14, 16719, 5252, 273, 247, 9400, 3687, 685, 247, 3158, 787, 4063, 670, 352, 15, 5595, 4292, 897, 17891, 281, 3186, 8573, 12089, 285, 9137, 562, 5482, 281, 3533, 390, 10165, 281, 3374, 285, 253, 952, 665, 2794, 253, 6725, 20756, 47000, 7570, 37692, 2894, 18769, 6570, 29476, 871, 436, 15, 5559, 4480, 12579, 2168, 556, 247, 7827, 1159, 13, 285, 697, 16567, 285, 10469, 11222, 1339, 767, 4212, 13791, 347, 352, 8356, 8442, 562, 752, 11515, 597, 457, 250, 17617, 285, 840, 30376, 731, 15, 1723, 4114, 6046, 812, 1056, 352, 9286, 272, 323, 253, 622, 281, 15909, 752, 7732, 403, 3981, 13, 285, 275, 1635, 281, 4677, 562, 672, 581, 2060, 556, 6331, 8288, 285, 352, 310, 673, 281, 1265, 42477, 15, 187, 187, 1394, 403, 2104, 281, 1973, 247, 3687, 1495, 285, 671, 368, 878, 271, 4730, 326, 2987, 15, 1422, 9446, 326, 2323, 310, 417, 667, 7343, 13, 285, 671, 368, 457, 250, 4704, 281, 1056, 634, 1616, 275, 247, 5675, 1673 ]
works or other public utility has the right to classify consumers under reasonable classification based upon such factors as the cost of service, the purpose for which the service or product is received, the quantity or amount received, the different character of the service furnished, the time of its use or any other matter which presents a substantial difference as a ground of distinction. 73 C.J.S., Public Utilities, § 27, page 1049; 43 Am.Jur., 689; American Aniline Products, Inc., v. City of Lock Haven, 288 Pa. 420, 135 A. 726, 50 A.L.R. 121. It was held by our Supreme Court in City of Galveston v. Kenner, 111 Tex. 484, 240 S.W. 894, that a city has the duty, upon proper request, to install meters for tenants occupying distinct tenements or storehouses and collect directly from the tenants rather than from the property owner. It would seem that if a city can be required to meter and charge for its water on the basis of a family or individual business unit that it should also have the power to do so on its own accord. To hold otherwise would be to place such power and discretion in the hands of each individual user to whose whim and fancy the city would be subject without power to control or manage its utility business. The classification of apartment houses under a residential classification based for rate purposes upon consuming units is not, in our opinion, without reasonable basis and justification. Such *715 users constitute a type or class substantially different and distinct from other users. This is sufficient basis for the classification. It was so held by the Court of Appeals of Maryland in Lewis v. Mayor and City Council of Cumberland, 189 Md. 58, 54 A. 2d 319, 325, under a similar ordinance. The court, in that case, stated: "Calling an apartment house a business does not alter the fact that it is an aggregation of dwellings. It is not unreasonable to classify it with other dwellings rather than with hotels." The unquestioned weight of authority in other states is that a city may classify its users on the basis of a family or business unit and base its charge for the service upon such unit, and may make a minimum charge for each such unit. Thompson v. City of Goldsboro, 151 N.C. 189, 65 S.E. 901; United States v. American Water-Works Co., C.C., 37 F. 747. The fact that the city furnishes its water and sewerage disposal service to hotels and tourist camps and other places where itinerant trade is predominant under an industrial classification with only one minimum charge, even though some of the units in some of these places are used as family units, is obviously a discrimination against appellants. In our opinion, however, such discrimination is not, under the facts and circumstances in evidence in this case, an arbitrary and unreasonable one. The interest and needs of the numerous water users served by a city are such that it is improbable, if not impossible, that any classification or rate basis could be devised which would not in some way discriminate against some of the users. If appellants should prevail in this case, there would be a discrimination against consumers in single unit dwellings. Not every discrimination, however, is condemned, but only a discrimination that is arbitrary and without a reasonable fact basis or justification. The discrimination in this case is not arbitrary. On the contrary, it is supported and justified by a factual basis for classification and by substantial evidence which justifies the charges made to that class of users. Such discrimination as there is need not be suffered by appellants. They have the right to have additional meters installed so that charges may be made directly to each household unit. The findings of fact filed by the court were supported by evidence and required the judgment rendered. We have examined other points presented and find no reversible error. The judgment is affirmed. Here a Free Pics galleries for the search "Tiny Bobs Girls" from our site . Visit us for more free galleries ! Please note: we are not responsible for some search prases! We only show a free pics galleries from our site for this search request!Related searches: Blonde With Tiny Tits Fucking DrivewayURL: http://galleries.porn.com/index.html?scene_id=10554&p=ft&r=pimp10515&c=1&j=13 ... Price Scene Previews Blonde With Tiny Tits Fucking DrivewayAudrey is a ... off at the car. This girl strips and immediately moves from ... to sucking his cock. She bobs all over his member and ... Niches: Hardcore, Milfs, Amateurs, Americans, One Pass Sites Site: PORN.COM Horny Senior Gets Dirty With A Real HookerURL: http://galleries.payserve.com/1/32482/26135/index.html ... blond girl, preferably from Croatia AND in red lingerie. Bob was so ... nearly forgot to pay the girl but in the end she ... , whether she has big tits, tiny tits loves it in the ... Fuck: Come Watch All Our Girls! 18 U.S.C. Section ... Niches: Milfs, GFs, Amateurs, Streets, European Site: Red Light Sex Trips Experienced Hooker Pleasing A GuyURL: http://galleries.payserve.com/1/32482/27395/index.html ... full tour of Amsterdam so Bob took him on an extensive ... a blow job from a girl with glasses on (...) while he ... , whether she has big tits, tiny tits loves it in the ... Fuck: Come Watch All Our Girls! 18 U.S.C. Section ... Niches: Milfs, GFs, Amateurs, Streets, European Site: Red Light Sex Trips Big Chested Brunette Is Tittie FuckedURL: http://galleries.pimproll.com/d/bjjs/pics/49570/4/index.html?p=ft&r=pimp10515&c=4&j=13& ... ... Juggs leaves the flat-chested girls at home and gathers together ... Fucked Chavon is a sexy girl with huge breasts. She plays ... out of her tight and tiny uniform and then lays on ... to sucking his cock. She bobs all over his member and ... Niches: Hardcore, Milfs, Big Tits, Amateurs, Americans Site: Big Juicy Juggs Sultry Brandi Edwards Gives Sensual Deep ThroatingURL: http://gallery.throated.com/gallhit/102916/2173/2/2/0 ... what? That's their problem. These girls are going to have to ... that much cock down her tiny throat was going to be ... gauntlet on our guy's cock, bobbing up and down on his ... may be tiny, but she eats cock like a big girl! **Monique ... Niches: Teens, Hardcore, BlowJob, Amateurs, Cumshots, Gagging, Americans Site: Throated For Search feature please to enable JavaScript or to put this site in Trusted Sites zone in your browser Parents please protect your kids from accessing porn by simply using your browser's surfing preferences. All models appearing on this site are 18 years or older. For 2257 related inquiries please contact each gallery site owner individually. We do not produce pornographic content ourselves. Reproduction of our site design, as well as part or totality of our links is prohibited. Abuse emailDomains Registered On Jun 14_21,2008 Www.v119.com Tallinn University of Technology, the one technological college in Estonia, is the flagship of Estonian engineering and technology education. In actual life, a former Lengthy Island hamburger chain referred to as Wetson’s. Their brand was a W that principally was the =McDonald’s= arches the wrong way up. Paradoxically, several Wetson’s, together with the one in the image, later became =McDonald’s= after Wetson’s went out of business. Morgellons is nothing new. Related illnesses, plagues and demonic possessions have sprung up and spread by way of the populace since the start of human historical past. If it follows the trail of historical past, Morgellons will fade away (like Epstein-Barr flavored CFS), and be replaced by one thing new. You possibly can’t stop it, but we can no less than be aware that these items occur, and we can attempt to mitigate their sick results by providing some perspective. Engines like google like google and folks price in-depth safety of a topic greater than a quick blurb about it. Most individuals use searches to search internet advertising and marketing out solutions to questions or choices to issues and the people who create the SEARCH ENGINE OPTIMIZATION pointers know this. Google Translate already has a conversation function, and its iOS and Android apps let two users communicate as it automatically figures out what languages they’re utilizing and then translates them. However background noise could make it exhausting for the app to grasp what persons are saying, and in addition to figure out when one individual has stopped speaking and it is time to start translating. You are able to build a greater life and also you need an education that works. You recognize that success is not any accident, and also you’re ready to make your mark in a growing field
[ 434, 19355, 2628, 369, 19344, 15, 44495, 369, 15212, 327, 253, 921, 347, 3981, 346, 262, 651, 320, 10458, 13, 533, 344, 1871, 320, 34557, 3446, 187, 187, 8732, 11064, 40260, 4102, 4895, 281, 253, 921, 432, 11456, 15, 26, 8679, 20160, 275, 247, 5454, 326, 2197, 659, 86, 39119, 281, 11456, 15, 26, 8679, 20160, 275, 4397, 4748, 13, 11064, 40260, 434, 2626, 673, 342, 253, 921, 15, 2516, 1881, 14, 856, 13578, 346, 4779, 273, 253, 6491, 995, 310, 247, 32481, 11005, 14289, 30449, 7989, 285, 37304, 2884, 1443, 7989, 285, 3963, 3167, 665, 556, 1264, 19367, 15, 187, 187, 2374, 6794, 13, 4163, 2030, 13, 4695, 13, 3438, 3167, 8969, 27334, 38456, 4962, 15, 13528, 5214, 2361, 326, 27334, 38456, 5966, 253, 4675, 4163, 1668, 13, 4695, 50276, 3113, 2159, 1255, 273, 6345, 13, 534, 11576, 3413, 369, 4269, 407, 247, 6400, 5066, 15, 754, 4962, 13515, 846, 884, 247, 15, 78, 15, 6794, 4131, 15, 27334, 38456, 671, 17386, 346, 510, 39959, 327, 25418, 31328, 3, 323, 253, 5553, 4660, 15, 496, 247, 966, 90, 2118, 13, 308, 18243, 31268, 32751, 697, 19394, 19971, 638, 14, 13197, 921, 1114, 24736, 275, 521, 19248, 15, 187, 187, 10457, 253, 22037, 19989, 483, 13, 597, 22073, 247, 642, 14, 4348, 483, 14, 26209, 12215, 432, 818, 14, 25, 15, 187, 187, 2374, 4397, 1884, 13, 4059, 13, 253, 4660, 369, 294, 14, 1288, 12086, 347, 308, 18243, 31268, 13, 533, 253, 24602, 1372, 921, 3139, 4391, 1077, 1652, 15, 187, 187, 2374, 3919, 2145, 394, 13, 6247, 13, 11819, 3660, 570, 27140, 346, 14569, 369, 619, 2457, 921, 327, 1214, 6901, 47, 32158, 15, 575, 9375, 281, 11590, 11263, 323, 247, 1270, 1408, 15, 575, 309, 574, 247, 17916, 285, 309, 457, 620, 2985, 352, 15, 575, 1889, 68, 959, 1024, 281, 1481, 715, 1959, 6757, 285, 6523, 752, 253, 1735, 8857, 10316, 15, 575, 1852, 8195, 9638, 54, 5377, 3446, 187, 187, 48415, 19655, 942, 273, 253, 921, 535, 380, 9901, 14, 9815, 1608, 1412, 483, 1475, 818, 27, 1449, 312, 247, 12417, 386, 20303, 253, 8886, 13, 1223, 22291, 5233, 14, 11342, 3533, 13, 275, 1340, 281, 3330, 35186, 15, 1310, 597, 403, 28008, 13, 597, 1364, 1379, 253, 346, 48, 506, 273, 496, 3118, 292, 566, 3446, 496, 253, 346, 48, 506, 995, 597, 1364, 10313, 616, 1390, 1416, 390, 1659, 273, 8410, 13, 840, 11476, 281, 331, 10274, 751, 1711, 12173, 313, 263, 2074, 10, 285, 11476, 597, 403, 417, 247, 637, 15, 187, 510, 22037, 342, 25298, 3044, 8469, 603, 342, 22303, 15000, 10688, 49355, 25298, 3044, 8469, 603, 187, 6901, 47, 31268, 21483, 1026, 46162, 5863, 24275, 326, 1408, 1046, 6818, 2909, 13, 7137, 11269, 2530, 3798, 407, 2516, 15, 285, 2136, 1304, 342, 10354, 25063, 1216, 187, 187, 4941, 187, 187, 7504, 4859, 187, 38023, 24602, 1372, 3239, 2490, 187, 1413, 27, 31478, 9001, 5553, 5659, 39, 662, 1951, 187, 187, 5683, 4971, 272, 634, 33926, 310, 3164, 253, 954, 3576, 1039, 281, 3157, 634, 1728, 457, 84, 2341, 6733, 285, 5321, 327, 12220, 4815, 15, 1457, 3626, 3678, 9192, 1951, 403, 22335, 7269, 285, 598, 281, 10508, 6, 5919, 2, 2064, 2097, 10508, 23903, 273, 1046, 14838, 368, 6947, 327, 2341, 310, 908, 323, 4250, 15, 380, 5662, 13, 2629, 14, 46505, 9192, 1951, 313, 3456, 14, 15089, 10, 497, 5431, 3925, 33109, 1967, 6, 5919, 15, 187, 187, 12412, 14, 46505, 9192, 1951, 187, 2042, 368, 457, 250, 3652, 247, 747, 1728, 13, 390, 352, 457, 84, 673, 281, 8171, 634, 5368, 33926, 13, 1908, 1029, 14, 46505, 15, 1583, 452, 767, 4250, 16021, 11207, 281, 9295, 625, 4250, 432, 892, 489, 21379, 15, 1583, 457, 250, 5091, 6, 5919, 390, 3687, 13, 897, 3345, 2329, 323, 19776, 13, 285, 476, 320, 5698, 264, 949, 271, 19633, 3402, 1108, 642, 878, 323, 247, 19114, 2191, 15, 2726, 247, 1029, 14, 46505, 33926, 13, 253, 2169, 634, 1655, 2341, 6007, 13, 253, 3687, 634, 2442, 16347, 15, 50, 27, 187, 187, 2347, 281, 19553, 941, 22581, 11559, 432, 20421, 2239, 22106, 8490, 275, 330, 4, 32, 187, 187, 688, 27548, 15, 11502, 36656, 22, 359, 6267, 250, 970, 22106, 4367, 534, 403, 1270, 323, 6941, 5277, 29971, 2439, 4893, 15, 831, 2987, 973, 323, 743, 42788, 347, 4714, 15, 187, 50274, 60, 28463, 62, 187, 50274, 60, 17214, 9, 2402, 426, 346, 13935, 1843, 995, 22106, 2548, 426, 29144, 9, 30000, 2632, 1228, 62, 187, 50274, 4387, 2876, 11447, 23536, 551, 755, 28, 873, 28, 748, 187, 187, 510, 11559, 323, 253, 743, 42788, 403, 4390, 7141, 275, 22106, 14, 19284, 15, 187, 1989, 752, 309, 971, 281, 5115, 310, 253, 1563, 27, 309, 971, 281, 2451, 247, 5447, 604, 247, 2176, 2876, 313, 74, 15, 70, 15, 346, 13935, 1843, 2807, 4961, 15, 1310, 352, 1057, 13, 309, 971, 281, 897, 352, 347, 544, 17214, 9, 2402, 426, 346, 2703, 6788, 1310, 627, 369, 642, 824, 2876, 1119, 13, 309, 971, 281, 897, 253, 5368, 22106, 14, 4505, 347, 5795, 285, 755, 253, 2876, 432, 627, 15, 187, 6693, 8342, 2934, 849, 281, 755, 436, 2444, 32, 187, 187, 34, 27, 187, 187, 42, 858, 352, 751, 436, 27, 187, 33988, 619, 1211, 12047, 7104, 25467, 14725, 1051, 187, 4387, 966, 12047, 7104, 25467, 14725, 1163, 5128, 1145, 42788, 7104, 25467, 14725, 187, 92, 187, 50274, 9486, 31799, 2776, 7456, 31799, 2776, 7456, 28, 187, 50274, 18641, 12970, 10031, 25467, 13119, 25467, 9, 42, 38936, 29, 11756, 31, 12474, 13, 187, 50268, 2548, 8781, 2548, 13, 401, 7157, 29, 6082, 31, 1566, 37670, 13, 187, 50268, 2548, 1566, 2548, 13, 2876, 2867, 2402, 10, 187, 50274, 92, 187, 50270, 2044, 1566, 25467, 426, 2613, 15, 9395, 25467, 9, 26059, 13, 8781, 2548, 13, 187, 50262, 7645, 37670, 13, 1566, 2548, 13, 2867, 2402, 558, 535, 50270, 2765, 29, 17214, 11756, 31, 1618, 426, 12474, 15, 4527, 2548, 29, 17214, 11756, 31, 5023, 1992, 2765, 1874, 187, 50270, 26966, 313, 17214, 11756, 277, 275, 1618, 10, 187, 50270, 92, 187, 50266, 338, 6522, 2703, 15, 2513, 13141, 3980, 16801, 9, 69, 15, 2402, 1228, 187, 50266, 92, 187, 50262, 14626, 187, 50262, 92, 187, 50258, 31535, 2776, 7456, 426, 44904, 1371, 35964, 15, 10605, 15, 3633, 7456, 29, 31535, 2776, 7456, 18257, 187, 50258, 26170, 2608, 26170, 426, 5057, 10605, 54, 3077, 2848, 1874, 535, 50258, 2703, 6890, 3902, 426, 31799, 2776, 7456, 15, 13086, 2402, 9, 69, 15, 2402, 13, 2608, 26170, 558, 187, 50258, 7645, 25467, 15, 17214, 2402, 426, 6890, 3902, 28, 187, 50262, 94, 187, 50262, 28293, 313, 5330, 299, 10, 187, 50262, 92, 187, 50258, 25674, 28, 187, 50262, 94, 187, 50266, 94, 187, 50270, 94, 187, 50270, 2309, 1566, 25467, 28, 187, 50274, 94, 187, 94, 187, 187, 537, 2811, 31799, 2776, 7456, 12255, 253, 5447, 323, 253, 4605, 275, 253, 743, 25604, 544, 17214, 1570, 187, 510, 12047, 7104, 25467, 14725, 310, 908, 275, 253, 4051, 706, 284, 77, 15, 284, 991, 15, 6113, 275, 11683, 64, 8252, 1082, 751, 436, 27, 187, 7104, 25467, 11509, 5852, 15, 10605, 426, 747, 12047, 7104, 25467, 14725, 1874, 535, 50, 27, 187, 187, 20742, 21293, 19220, 16, 15743, 1293, 22906, 187, 187, 42, 878, 281, 13194, 253, 1563, 2127, 13, 1293, 31255, 253, 3239, 1051, 436, 2127, 2168, 3797, 40080, 533, 835, 717, 309, 1469, 3430, 342, 2970, 352, 281, 13194, 1293, 31255, 253, 3239, 2391, 32, 253, 964, 40997, 966, 310, 863, 24529, 281, 271, 18536, 275, 619, 3605, 15, 5581, 1873, 13, 285, 309, 878, 436, 512, 281, 1335, 789, 672, 253, 18536, 310, 25363, 604, 1896, 15, 1720, 14, 22257, 436, 281, 1347, 327, 247, 6409, 5532, 651, 417, 320, 7445, 15, 187, 5, 29825, 40997, 6788, 9738, 9, 3701, 1082, 551, 187, 50274, 2044, 2654, 426, 3019, 2520, 481, 9573, 1587, 301, 3287, 187, 50274, 2044, 1416, 426, 3019, 2520, 481, 9573, 1587, 1590, 3287, 187, 50274, 2044, 299, 3233, 426, 3019, 2520, 481, 9573, 1587, 2203, 14, 10121, 3287, 187, 50274, 2044, 941, 2776, 426, 686, 301, 5473, 12, 2654, 559, 686, 7, 8, 559, 299, 3233, 3706, 187, 50274, 2044, 2885, 426, 3019, 2520, 558, 535, 50274, 338, 9, 1590, 38100, 484, 3401, 187, 50274, 92, 187, 50271, 6999, 2520, 481, 43810, 688, 9, 1518, 481, 2974, 2073, 5137, 187, 50271, 1352, 20742, 7506, 187, 50268, 881, 27, 346, 15743, 995, 187, 50268, 6434, 27, 346, 484, 15, 5581, 995, 187, 50268, 2203, 27, 941, 2776, 13, 187, 50268, 12985, 27, 3221, 13, 187, 50268, 12566, 27, 1159, 9, 2974, 910, 187, 50265, 5598, 15, 2974, 9, 2974, 558, 187, 50268, 94, 187, 50271, 9897, 187, 50274, 94, 187, 50274, 7271, 187, 50274, 92, 187, 50271, 6999, 2520, 481, 43810, 688, 9, 1518, 481, 2974, 2073, 5137, 187, 50271, 1352, 20742, 7506, 187, 50268, 881, 27, 346, 15743, 995, 187, 50268, 6434, 27, 346, 3487, 15, 5581, 995, 187, 50268, 2203, 27, 941, 2776, 13, 187, 50268, 12985, 27, 3221, 13, 187, 50268, 12566, 27, 1159, 9, 2974, 910, 187, 50265, 5598, 15, 2974, 9, 2974, 558, 187, 50268, 94, 187, 50271, 9897, 187, 50274, 94, 187, 9897, 187, 187, 1568, 310, 253, 14271, 432, 619, 3605, 15, 5581, 187, 29, 2154, 2654, 568, 7265, 1138, 187, 29, 2154, 2654, 568, 1274, 1138, 187, 29, 2551, 966, 5473, 484, 8, 2730, 66, 3860, 20679, 966, 568, 40997, 3, 1416, 568, 484, 3, 941, 14, 10121, 568, 2364, 18, 30, 14277, 5581, 7392, 370, 6952, 64, 301, 18, 28, 32, 12399, 2364, 19, 30, 14277, 5581, 7392, 370, 6952, 64, 301, 19, 28, 28391, 5264, 8428, 6740, 568, 484, 15, 8567, 3, 6945, 568, 10854, 3, 29972, 66, 3073, 2551, 2730, 1288, 4725, 187, 14277, 5581, 7392, 370, 13074, 87, 4787, 18, 28, 3736, 2730, 1288, 4725, 187, 870, 2154, 31, 187, 29, 2154, 2654, 568, 8559, 1138, 187, 50274, 14277, 5581, 7392, 370, 8559, 18, 28, 23983, 187, 870, 2154, 31, 187, 29, 2154, 966, 568, 8250, 11097, 6750, 2154, 31, 187, 2033, 2154, 31, 187, 29, 2154, 2654, 568, 7265, 1138, 187, 29, 2154, 2654, 568, 918, 1138, 187, 29, 1288, 4725, 187, 14277, 5581, 7392, 370, 13074, 87, 4787, 19, 28, 3736, 2730, 1288, 4725, 187, 29, 2551, 966, 5473, 3487, 8, 2730, 66, 3860, 20679, 966, 568, 40997, 3, 1416, 568, 3487, 3, 941, 14, 10121, 568, 2364, 18, 30, 14277, 5581, 7392, 370, 6952, 64, 301, 18, 28, 32, 12399, 2364, 19, 30, 14277, 5581, 7392, 370, 6952, 64, 301, 19, 28, 28391, 5264, 8428, 6740, 568, 3487, 15, 8567, 3, 6945, 568, 10854, 3, 29972, 66, 3073, 2551, 31, 187, 870, 2154, 31, 187, 29, 2154, 2654, 568, 8559, 1138, 187, 50274, 14277, 5581, 7392, 370, 8559, 19, 28, 23983, 187, 870, 2154, 31, 187, 29, 2154, 966, 568, 8250, 11097, 6750, 2154, 31, 187, 870, 2154, 31, 187, 187, 34, 27, 187, 187, 1394, 878, 281, 2057, 546, 10483, 634, 2127, 342, 3019, 3306, 481, 2038, 9, 3701, 1082, 551, 9897, 13, 390, 7356, 634, 2127, 387, 253, 990, 273, 253, 654, 2915, 31, 6809, 15, 49920, 13, 3185, 273, 2403, 253, 9882, 14390, 34265, 25109, 1078, 253, 25586, 556, 10607, 313, 249, 253, 654, 2522, 31, 2593, 582, 309, 7356, 352, 2822, 253, 990, 15, 831, 310, 671, 752, 47720, 32636, 15, 187, 20696, 247, 25586, 10607, 13, 627, 403, 642, 3603, 3562, 323, 19386, 281, 8749, 28310, 342, 13, 285, 594, 634, 2127, 12832, 17954, 627, 2509, 2717, 846, 1146, 36838, 15, 187, 1909, 504, 432, 326, 13, 253, 964, 9738, 1082, 1159, 310, 11407, 327, 5532, 15, 733, 2506, 626, 2647, 752, 3284, 352, 434, 3033, 281, 15, 1310, 352, 434, 5532, 494, 13, 352, 434, 33375, 15, 187, 9917, 281, 3662, 634, 1953, 6283, 27, 654, 66, 3860, 37387, 588, 22906, 253, 3239, 15, 1422, 971, 281, 897, 187, 29, 66, 3860, 38709, 15, 831, 13, 2299, 13, 588, 1056, 368, 6923, 281, 253, 1755, 273, 253, 3239, 15, 1422, 812, 671, 4853, 247, 654, 1968, 31, 285, 897, 1852, 1968, 1590, 3185, 281, 3693, 436, 15, 2207, 816, 1053, 626, 897, 3860, 387, 512, 15, 733, 434, 417, 3058, 15, 187, 9917, 13, 247, 1652, 10480, 323, 7392, 272, 4903, 715, 11685, 310, 281, 897, 17987, 30 ]
's hosting job was terminated. Jerome was quoted on the show as saying "it would be tough, but he'd be alright". John Rodenburg recently returned to the show from 93.9 Bob FM in a trade that sent Stu Schwartz to 93.9 Bob FM in September 2009, Rodenburg's third time with the show. John self-proclaimed "Man of the People", is a stalwart Philadelphia Eagles fan and Calgary Flames fan and regular host who has three daughters. On Friday, July 25, 2008, former host Tim Kilpatrick died. CFRA reported that Kilpatrick entered the hospital July 16, 2008 with shortness of breath, which doctors determined was caused by a lung infection. He died shortly after 10 a.m. Friday morning. Kilpatrick also hosted "The Buzz on Junior Hockey" for the radio station. In a classy move, TSN 1200 retains its junior hockey pre-game show moniker in his honour. During the NHL Lockout, they invoke a no-lockout-talk guarantee from 7-8. On September 30, 2014, the station was re-branded as TSN 1200, but the TGOR show itself changed very little. On March 13th, 2019, Steve Warne tweeted "Today was my final show on @TSN1200.  Thanks to Bell Media for a great run.  I had a blast and I’ll miss it.  Excited now to head into free agency and seeing what the next chapter brings.  #Another2019UFA". Notable Segments of the show The 61-second Shootout around 7:40am a contestant battles the clock, while answering rapid-fire questions, in order to win prizes. If they are unsuccessful, they must take the "Oath of Incompetence". In the "Oath", they must reveal their last name or place of employment, then admit to stinking like old cheese (or similar) and admit they are not a man. The NHL with Pierre McGuire with NBC Sports colour commentator Pierre McGuire TSN 1200 Sportscentre Updates that run every twenty minutes, traffic updates provided usually by John. and business report with Jon Brenner References External links Official TGOR page Category:Canadian sports radio programsFurnaces Upgrading your furnace is probably the most effective way to improve your home’s energy efficiency and save on heating costs. New natural gas furnaces are technically advanced and up to 98% efficient! That means 98 cents of every dollar you spend on energy is used for heat. The older, standard-efficiency furnaces (pre-1987) were typically 60%-70% efficient. High-efficiency furnaces If you’re building a new home, or it’s time to replace your existing furnace, consider high-efficiency. They have two heat exchangers to recover more heat from flue gases. They’re 90% efficient or greater, use outside air for combustion, and can be vented through an exterior wall – no need for a chimney. With a high-efficiency furnace, the higher your current energy bill, the greater your potential savings.Q: How to retrieve data annotation strings from Database > Resource File in C#? In ASP.NET MVC5 we''re using Resource files which are great for allowing providing translations across applications. This works well for Annotations aswell. [Required] [Display(Name = "ROLE", ResourceType = typeof(AdminRes))] public string UserRole { get; set; } The strings for the Annotations are currently stored in Resource-Files. But what I want to achieve is the following: I want to check a database if a certain string (i.e. "ROLE") exists. If it does, I want to use it as [Display(Name = "string"). If there was no such string found, I want to use the existing Resource-File as alternative and get the string from there. Any plain idea how to get this working? A: I did it like this: Added my own CustomModelMetadataProvider... public class CustomModelMetadataProvider : DataAnnotationsModelMetadataProvider { private DynamicStringService DynamicStringService; protected override ModelMetadata CreateMetadata(IEnumerable<Attribute> attributes, Type containerType, Func<object> modelAccessor, Type modelType, string propertyName) { var modelMetadata = base.CreateMetadata(attributes, containerType, modelAccessor, modelType, propertyName); List<DisplayAttribute> list = attributes.OfType<DisplayAttribute>().ToList(); foreach (DisplayAttribute d in list) { if (!string.IsNullOrEmpty(d.Name)) { try { DynamicStringService = DependencyResolver.Current.GetService<DynamicStringService>(); Language userLanguage = GetCurrentUILanguage(); string changingValue = DynamicStringService.ChangeName(d.Name, userLanguage); modelMetadata.DisplayName = changingValue; } catch (Exception e) { continue; } } } return modelMetadata; } } ..where DynamicStringService checks the database for the String in the Annotation [Display]. The CustomModelMetadataProvider is used in the Globasl.asax.cs in Application_Start() like this: ModelMetadataProviders.Current = new CustomModelMetadataProvider(); Q: ajax php GET/POST without refresh I need to execute the following code, without refreshing the page... this code already includes ajax but where am I going wrong with getting it to execute without refreshing the page....? the .vote class is attatched to an anchor in my index.php file, and I need this all to still work when the anchor is clicked if possible. Re-coding this to perform on a button click would not be ideal. $(".vote").click(function() { var id = $(this).attr("id"); var name = $(this).attr("name"); var eData = $(this).attr("data-options"); var dataString = 'id='+ id + '&' + eData ; var parent = $(this); if(name=='up') { $(this).fadeIn(200).html(''); $.ajax({ type: "POST", url: "up.php", data: dataString, cache: false, success: function(html){ parent.html(html); } }); } else { $(this).fadeIn(200).html(''); $.ajax({ type: "POST", url: "down.php", data: dataString, cache: false, success: function(html){ parent.html(html); } }); } }); here is the html from my index.php <div id="main"> <div id="left"> <span class='up'><a href="" class="vote" name="up" data-options="key1=<?php echo $mes_id1;?>&key2=<?php echo $mes_id2;?>"><img src="up.png" alt="Down" /></a></span><br /> <?php echo $totalvotes1; ?><br /> </div> <div id="message"> <?php echo $message1; ?> </div> <div class="clearfix"></div> </div> <div id="main"> <div id="right"> <br /> <?php echo $totalvotes2; ?><br /> <span class='down'><a href="" class="vote" name="down" data-options="key1=<?php echo $mes_id1;?>&key2=<?php echo $mes_id2;?>"><img src="down.png" alt="Down" /></a></span> </div> <div id="message"> <?php echo $message2; ?> </div> <div class="clearfix"></div> </div> A: You need to either enclose your code with $(document).ready(function() {});, or stick your code at the end of the <body> tag. Personally, instead of making the browser parse synchronous javascript before the DOM has loaded (in the <head> section), I stick it near the end. This is also what Bootstrap recommends. Without a DOM loaded, there are no elements created for jQuery to register Events with, and so your code literally sits there doing nothing after being parsed. Aside from that, the .click() function is executed on click. It doesn't matter what element it's bound to. If it's clickable, it's executable. Also to answer your question properly: <a href=""> will refresh the page. You want to use <a href="#">. This, however, will make you jump to the top of the page. You could also define a <label> and use #labelname instead to avoid this. Or just don't use href at all. It's not needed. Also, a little trick for echoing variables into HTML is to use <?=
[ 3136, 13, 9385, 187, 9707, 34916, 16768, 187, 18, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 619, 375, 5895, 273, 253, 987, 1791, 16, 76, 31066, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 19, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 619, 375, 5895, 273, 253, 987, 1791, 16, 76, 31066, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 20, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 987, 23469, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 21, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 987, 23469, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 22, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 19379, 12267, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 23, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 19379, 12267, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 24, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 10963, 6378, 323, 247, 16138, 8984, 15, 187, 25, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 247, 16138, 8984, 323, 10963, 6378, 15, 187, 26, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 323, 2579, 4602, 323, 39565, 273, 253, 660, 8601, 360, 15, 187, 740, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 247, 1698, 896, 12564, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 883, 15, 11198, 262, 1338, 281, 247, 7037, 494, 12564, 13716, 323, 247, 617, 8311, 33470, 12689, 15, 187, 805, 15, 11198, 262, 1338, 281, 247, 12564, 13716, 3687, 685, 884, 2558, 2720, 281, 4163, 4562, 13, 6752, 13, 3687, 685, 1884, 2558, 432, 4163, 4562, 13, 6752, 13, 281, 2552, 1903, 13, 4332, 13, 285, 3687, 685, 2456, 2558, 17096, 13, 323, 19379, 27246, 2098, 316, 15, 187, 1012, 15, 11198, 262, 1338, 281, 271, 4321, 3576, 3522, 685, 3978, 337, 13, 12034, 13, 323, 247, 4098, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 15, 187, 1848, 42706, 3489, 6570, 187, 16667, 6607, 407, 27, 9385, 329, 15, 35480, 472, 14, 34972, 90, 13, 10158, 387, 5405, 187, 56, 1433, 17582, 4915, 10197, 1277, 2637, 8160, 17870, 1556, 187, 510, 44117, 187, 20905, 1372, 40740, 6651, 3003, 20466, 10449, 187, 43, 15, 47, 15, 6956, 1832, 13, 19330, 187, 1042, 32585, 187, 510, 44117, 574, 3939, 2579, 432, 4565, 24652, 281, 4596, 24178, 15, 187, 1552, 1083, 556, 247, 1048, 285, 9542, 19993, 2892, 15, 831, 2647, 3249, 1078, 253, 5986, 273, 30109, 8, 9892, 313, 32994, 10, 327, 4549, 432, 2067, 13716, 7089, 6808, 407, 253, 4487, 273, 30109, 17528, 313, 16568, 10, 19804, 7454, 313, 13935, 481, 10300, 253, 9542, 19993, 2892, 273, 253, 44117, 434, 4390, 20652, 3916, 13, 253, 5986, 588, 2953, 1016, 1750, 275, 1614, 275, 436, 12276, 15, 187, 510, 44117, 434, 3916, 281, 37605, 253, 3786, 5868, 3916, 323, 2579, 4602, 323, 619, 375, 5895, 273, 253, 987, 1791, 16, 76, 31066, 13, 987, 23469, 8984, 13, 19379, 12267, 8984, 13, 285, 247, 16138, 8984, 1705, 281, 253, 5986, 327, 4549, 432, 247, 3919, 4332, 13716, 3061, 15, 380, 5986, 556, 247, 4320, 7143, 762, 6480, 530, 15, 52, 15, 36, 15, 34, 15, 20485, 608, 12347, 13, 818, 11238, 313, 15491, 4059, 10, 281, 2953, 253, 1953, 273, 1880, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 253, 1750, 323, 2579, 4602, 15, 2064, 2647, 4566, 281, 253, 5986, 434, 7571, 281, 3986, 253, 6944, 1750, 285, 21633, 9038, 253, 1750, 327, 247, 372, 17590, 3720, 15, 2594, 15359, 3592, 362, 15, 7233, 13, 11439, 401, 15, 20, 69, 2145, 1438, 13, 15410, 20, 313, 28246, 15, 4082, 15, 8441, 481, 1284, 253, 5986, 1364, 806, 7617, 1880, 747, 285, 2144, 1941, 281, 37605, 253, 3916, 556, 644, 2959, 285, 13, 275, 1859, 273, 253, 5986, 434, 13857, 3061, 327, 841, 9762, 281, 37605, 13, 253, 5986, 556, 7943, 841, 3374, 347, 46940, 1097, 253, 3916, 281, 37605, 347, 973, 347, 253, 3916, 323, 38668, 281, 2579, 4602, 327, 253, 16108, 347, 873, 6593, 327, 253, 2914, 3239, 273, 436, 3061, 15, 380, 3919, 4332, 13716, 3061, 671, 5868, 253, 44117, 434, 2748, 281, 37605, 247, 1750, 323, 2579, 4602, 323, 39565, 273, 253, 660, 8601, 360, 15, 1284, 5469, 2007, 2708, 13, 253, 44117, 9262, 247, 4366, 273, 30859, 281, 436, 3061, 275, 3978, 4332, 13, 533, 253, 16636, 556, 417, 6808, 247, 3908, 273, 253, 1083, 15, 187, 1552, 2647, 310, 671, 327, 4549, 432, 271, 4437, 4748, 13716, 3061, 534, 5868, 253, 44117, 434, 3916, 281, 37605, 253, 2523, 273, 2579, 4602, 323, 247, 1698, 896, 8984, 347, 973, 347, 38668, 281, 247, 7037, 494, 12564, 13716, 323, 247, 617, 8311, 33470, 12689, 15, 187, 21342, 13, 275, 247, 3919, 6157, 13716, 3061, 13, 253, 16636, 7169, 2579, 4602, 323, 27246, 2098, 316, 342, 11134, 47073, 2544, 387, 253, 806, 1313, 255, 1032, 2689, 267, 912, 267, 313, 47887, 10, 6036, 273, 253, 987, 3174, 13, 34018, 247, 884, 2558, 13716, 3576, 4163, 4562, 13, 6752, 13, 285, 323, 27246, 2098, 316, 342, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 6036, 273, 253, 1669, 3174, 13, 34018, 247, 884, 2558, 13716, 3576, 4163, 4562, 13, 6752, 15, 2732, 253, 44117, 3962, 264, 247, 14793, 4549, 327, 841, 3916, 13, 275, 271, 4162, 4695, 3061, 13, 253, 5986, 294, 17932, 1025, 253, 3374, 327, 4549, 347, 38668, 281, 271, 2559, 13716, 323, 19379, 27246, 2098, 316, 13, 4390, 20139, 347, 884, 2558, 44276, 323, 253, 987, 3174, 285, 347, 884, 2558, 44276, 323, 253, 1669, 3174, 13, 285, 38668, 281, 247, 4858, 7037, 494, 13716, 323, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 6036, 273, 253, 987, 285, 1669, 3174, 15, 380, 5986, 671, 5868, 253, 44117, 434, 2559, 13716, 1750, 323, 19379, 27246, 2098, 316, 13, 6760, 347, 884, 2558, 44276, 275, 1016, 273, 521, 4669, 13, 285, 7169, 4858, 884, 2558, 17503, 323, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 6036, 273, 253, 987, 285, 1669, 3174, 15, 187, 14358, 253, 44117, 13, 949, 521, 6834, 13, 285, 20165, 434, 7454, 273, 4214, 19330, 20652, 253, 5986, 434, 4162, 4695, 3061, 281, 253, 2111, 407, 12108, 247, 23106, 16066, 323, 6235, 395, 313, 47212, 16066, 481, 6295, 4676, 4879, 275, 253, 23106, 16066, 326, 597, 497, 23176, 760, 253, 5986, 434, 13336, 273, 271, 2559, 13716, 1750, 323, 19379, 27246, 2098, 316, 285, 417, 253, 12714, 273, 4858, 884, 2558, 17503, 323, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 273, 253, 987, 285, 1669, 3174, 15, 380, 1986, 2077, 273, 9892, 323, 30109, 27120, 313, 18336, 10, 7169, 253, 23106, 16066, 275, 5080, 4267, 15, 187, 688, 4437, 4267, 13, 253, 5986, 27013, 253, 44117, 434, 2559, 13716, 1750, 323, 19379, 27246, 2098, 316, 13, 4390, 20139, 347, 884, 2558, 44276, 323, 253, 987, 3174, 285, 347, 884, 2558, 44276, 323, 253, 1669, 3174, 13, 281, 253, 16636, 3066, 253, 9892, 11354, 5197, 313, 2300, 36, 10, 275, 5041, 13, 9087, 13, 323, 3081, 2440, 15, 187, 688, 247, 4397, 4332, 13716, 3061, 13, 253, 16636, 2559, 253, 19379, 27246, 2098, 316, 12564, 13716, 281, 1884, 2558, 13, 3576, 4163, 4562, 13, 6752, 285, 281, 2456, 2558, 13, 3576, 2552, 1903, 13, 4332, 15, 1723, 13, 835, 627, 310, 642, 4518, 4469, 6860, 281, 2701, 253, 4549, 281, 38668, 281, 247, 7616, 12564, 13716, 13, 253, 16636, 285, 5986, 403, 2424, 281, 1908, 38668, 281, 512, 2130, 17503, 323, 326, 1617, 15, 12056, 362, 15, 7233, 13, 721, 657, 292, 15, 2946, 15, 4791, 13, 6931, 313, 13549, 481, 380, 2523, 3103, 4558, 275, 16939, 3708, 285, 556, 644, 7943, 347, 873, 6593, 327, 253, 2914, 3239, 273, 436, 3061, 15, 187, 510, 3919, 4332, 13716, 3061, 671, 5868, 253, 44117, 434, 1750, 273, 38668, 281, 271, 4321, 3576, 3522, 685, 3978, 337, 13, 12034, 13, 323, 253, 4098, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 15, 380, 5986, 310, 7709, 478, 386, 273, 253, 2111, 434, 5877, 275, 416, 7937, 362, 15, 16982, 42304, 13, 1384, 657, 292, 15, 2051, 15, 33723, 313, 8603, 582, 275, 534, 352, 369, 3413, 326, 13, 2378, 247, 13716, 3061, 534, 25097, 271, 3576, 3522, 4916, 2457, 13, 253, 760, 1039, 326, 824, 247, 3061, 476, 320, 17265, 310, 604, 352, 4428, 2590, 285, 49273, 494, 2228, 313, 36, 6028, 481, 380, 2111, 4879, 326, 667, 643, 906, 651, 9084, 4513, 253, 4086, 273, 2457, 414, 15, 496, 643, 3000, 13, 253, 2111, 556, 1119, 326, 627, 403, 642, 4107, 383, 46160, 3916, 323, 271, 4321, 3576, 3522, 15, 2091, 824, 247, 4107, 383, 46160, 1750, 310, 5439, 13, 253, 2111, 556, 2918, 326, 824, 271, 4549, 943, 320, 11511, 15, 4031, 15, 387, 29949, 14, 7554, 15, 187, 688, 436, 1083, 13, 253, 5986, 11941, 2579, 4602, 323, 19379, 27246, 2098, 316, 275, 271, 4223, 7901, 3061, 15, 380, 16636, 1055, 11634, 824, 5722, 275, 247, 3978, 10226, 13716, 3061, 285, 7922, 271, 3576, 3522, 273, 3978, 3285, 13, 8210, 15, 313, 15852, 6168, 1037, 13, 253, 5986, 7211, 326, 6774, 13716, 2127, 14526, 5224, 326, 253, 3576, 3522, 323, 2579, 4602, 369, 2686, 3978, 337, 13, 12034, 347, 873, 6593, 327, 253, 2914, 3239, 273, 436, 3061, 2698, 380, 3916, 1873, 2722, 326, 275, 3978, 9748, 13, 253, 44117, 4724, 247, 3908, 8445, 346, 1221, 287, 4507, 3, 7830, 323, 521, 19379, 27246, 2098, 316, 347, 253, 8984, 369, 2011, 327, 521, 10143, 8368, 15, 380, 5986, 9010, 326, 436, 3908, 310, 247, 14793, 4366, 273, 30859, 281, 253, 3576, 3522, 7922, 15, 13162, 13, 347, 253, 44117, 4724, 247, 14793, 4366, 273, 30859, 281, 253, 13716, 2250, 326, 7169, 2579, 4602, 13, 436, 2647, 858, 417, 2489, 2457, 342, 1675, 281, 253, 3576, 3522, 7922, 15, 496, 1614, 13, 275, 436, 1083, 13, 627, 310, 642, 4107, 383, 46160, 1750, 323, 271, 4321, 3576, 3522, 323, 253, 5722, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 285, 253, 5986, 778, 7617, 253, 2523, 327, 253, 16108, 15, 187, 688, 271, 4162, 4050, 3061, 13, 253, 5986, 294, 31370, 253, 44117, 434, 1750, 323, 2579, 4602, 323, 247, 1698, 896, 12564, 13, 1690, 347, 1955, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 13, 285, 27013, 436, 2523, 327, 253, 16108, 347, 973, 347, 253, 3374, 273, 38668, 281, 2559, 17503, 323, 247, 617, 8311, 33470, 12689, 285, 19379, 27246, 2098, 316, 285, 38668, 281, 271, 4321, 3576, 3522, 685, 3978, 337, 13, 12034, 13, 323, 247, 4098, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 15, 187, 510, 5986, 556, 7799, 6485, 3739, 11626, 432, 253, 30109, 4775, 13500, 313, 55, 10114, 481, 657, 10114, 11626, 497, 2959, 275, 4437, 4059, 285, 275, 3919, 4104, 15, 496, 4223, 4104, 13, 20165, 2530, 841, 11626, 281, 253, 44117, 285, 521, 8612, 342, 247, 3925, 14, 1201, 2180, 273, 673, 281, 2085, 3081, 1941, 285, 16, 263, 4154, 15, 187, 34, 5986, 4854, 275, 5041, 13, 399, 15, 36, 15, 369, 2918, 275, 3919, 5826, 1078, 247, 30109, 5405, 6798, 665, 9674, 14373, 432, 253, 5986, 28, 253, 4854, 7045, 310, 2330, 342, 253, 1924, 15, 380, 760, 2523, 4390, 327, 4549, 9713, 387, 436, 5986, 4854, 369, 38668, 281, 2559, 13716, 323, 27246, 2098, 316, 342, 47073, 2544, 273, 253, 1669, 3174, 285, 253, 987, 3174, 15, 313, 15852, 6168, 1037, 13, 253, 5986, 7211, 326, 253, 4854, 6206, 671, 5469, 253, 2523, 273, 2579, 4602, 323, 247, 1698, 896, 12564, 15, 1723, 13, 253, 5986, 9674, 5868, 436, 2523, 275, 247, 5080, 5215, 3061, 326, 3395, 2457, 342, 1675, 281, 436, 2647, 2698, 1284, 253, 5986, 4879, 275, 4162, 4695, 13, 253, 44117, 13072, 247, 747, 4854, 1078, 247, 1027, 30109, 5405, 6798, 275, 5080, 4695, 17668, 15, 2594, 6480, 530, 15, 52, 15, 36, 15, 34, 15 ]
oke, Virginia THE ISSUES 1. Whether new and material evidence has been received to reopen a claim of service connection for myositis of the right leg/knee, including as secondary to service-connected bilateral pes planus. 2. Entitlement to service connection for myositis of the right leg/knee, including as secondary to service-connected bilateral pes planus. 3. Whether new and material evidence has been received to reopen a claim of service connection for right ankle disorder, including as secondary to service-connected bilateral pes planus. 4. Entitlement to service connection for right ankle disorder, including as secondary to service-connected bilateral pes planus. 5. Whether new and material evidence has been received to reopen a claim of service connection for bilateral knee disorder, including as secondary to service-connected bilateral pes planus. 6. Entitlement to service connection for bilateral knee disorder, including as secondary to service-connected bilateral pes planus. 7. Whether new and material evidence has been received to reopen a claim of service connection for compensation purposes for a dental disorder. 8. Entitlement to service connection for a dental disorder for compensation purposes. 9. Whether new and material evidence has been received to reopen a claim for service connection for fungus of the scrotum. 10. Entitlement to service connection for a low back disability, including as secondary to service-connected bilateral pes planus. 11. Entitlement to a compensable disability rating for a hernioplasty scar. 12. Entitlement to a disability rating greater than 10 percent prior to July 31, 2002, greater than 30 percent from July 31, 2002, to May 11, 2011, and greater than 50 percent thereafter, for bilateral pes planus. 13. Entitlement to an earlier effective date than June 1, 1987, for a grant of service connection for bilateral pes planus. REPRESENTATION Appellant represented by: Virginia A. Girard-Brady, Attorney at Law WITNESS AT HEARING ON APPEAL The Veteran ATTORNEY FOR THE BOARD J.N. Moats, Counsel INTRODUCTION The Veteran had active service from December 1952 to November 1954. This case has a long and complicated procedural history. This matter comes before the Board of Veterans' Appeals (Board) on appeal from several rating decisions issued by the Department of Veterans Affairs (VA) Regional Office (RO). Given the complicated procedural history of the Veteran's currently appealed claims, the Board will address each claim in turn in this Introduction. The Veteran's claims to reopen the previously denied claims for service connection for myositis of the right leg/knee, right ankle disorder, bilateral knee disorder, and a dental disorder come to the Board on appeal from a March 2011 rating decision. The Board has a legal duty under 38 U.S.C.A. §§ 5108, 7104 (West 2014) to address the question of whether new and material evidence has been received to reopen the claim for service connection. That matter goes to the Board's jurisdiction to reach the underlying claim and adjudicate the claim on a de novo basis. See Barnett v. Brown, 83 F.3d 1380, 1383 (Fed. Cir. 1996). As the Board must first decide whether new and material evidence to reopen the claims has been received and, in view of the Board's favorable decision on these requests to reopen, the Board has characterized these issues as encompassing both the claims to reopen as well as the claims for entitlement to service connection on the merits as set forth on the front page of this decision. The March 2011 rating decision also denied the Veteran's request to reopen a claim for service connection for fungus of the scrotum. As discussed further below, the Veteran submitted a notice of disagreement to this decision in June 2011, but the RO has not issued a statement of the case. This matter is also on appeal from an October 2009 rating decision which denied the Veteran's claims to reopen the issue of service connection for a low back disorder as well as entitlement to a compensable disability rating for a hernioplasty scar. Moreover, in a March 2004 rating decision, the RO granted service connection for pes planus with mild degenerative changes at the first metatarsophalangeal (MTP) joint of the right foot, assigning a 10 percent rating effective July 31, 2002, and for pes planus with mild degenerative changes at the first MTP joint of the left foot, assigning a 10 percent rating effective July 31, 2002. After the Veteran perfected a timely appeal on these claims, in an April 2008 decision, the Board recharacterized the issues on appeal as entitlement to an increased rating for bilateral pes planus, currently rated as 10 percent disabling for the right foot and as 10 percent disabling for the left foot, and entitlement to a separate compensable rating for mild degenerative changes at the first MTP joint of the right and left foot. The Board also denied the Veteran's increased rating claim for bilateral pes planus, evaluated as 10 percent disabling in each of his feet, and granted separate 10 percent ratings for mild degenerative changes at the first MTP joint of the right and left foot. Both the Veteran, through his attorney, and VA's Office of General Counsel appealed the Board's April 2008 decision to the Court by filing a Joint Motion for Remand (Joint Motion). Both parties noted in the Joint Motion that they were appealing only the Board's denial of an increased rating claim for bilateral pes planus and not the assignment of separate 10 percent ratings for mild degenerative changes at the first MTP of the right and left foot. The United States of Appeals for Veterans Claims (Court) granted the Joint Motion in February 2010. In October 2010, the Board remanded the Veteran's increased rating claim for bilateral pes planus, currently rated as 10 percent disabling for the right foot and as 10 percent disabling for the left foot, to the RO via the Appeals Management Center (AMC) in Washington, DC, for additional development. In a September 2011 rating decision, the RO increased the bilateral pes planus disability rating to 30 percent, effective July 31, 2002 and to 50 percent, effective May 11, 2011. However, where there is no clearly expressed intent to limit the appeal to entitlement to a specified disability rating, the RO and Board are required to consider entitlement to all available ratings for that condition. AB v. Brown, 6 Vet.App. 35, 39 (1993). The issue therefore remains in appellate status and has been characterized as set forth on the front page of this decision. The March 2011 rating decision also denied the Veteran's claim of entitlement to an earlier effective date than June 1, 1987, for the grant of service connection for bilateral pes planus. The Board is cognizant of the Court's holding in Rudd v. Nicholson, 20 Vet. App. 296 (2006), in which it was determined that, once a rating decision which establishes an effective date becomes final, the only way that such a decision can be revised is if it contains clear and unmistakable error (CUE). The Court noted that any other result would vitiate the rule of finality. In other words, the Court has found that there are no freestanding claims for an earlier effective date. When such a freestanding claim is raised, the Court has held that such an appeal should be dismissed. Id. at 299-300. In this case, the Board awarded service connection for bilateral pes planus in an August 1990 decision. The RO effectuated such award in a June 1991 rating decision and assigned an effective date of June 29, 1997. (Parenthetically, the Board notes that subsequent rating code sheets indicate that the effective date for service connection was actually June 1, 1987 as set forth on the front page of this decision.) The claims file shows that in June 1992, the Veteran filed a statement seeking "retroactive" payment for his bilateral pes planus as the disorder was shown on his discharge examination. The Board finds that this statement is a timely notice of disagreement to the effective date assigned. Consequently, as the Veteran filed a timely notice of disagreement to the rating action that granted service connection, this matter did not become final with respect to the effective date assigned. In turn, in this case, there is no freestanding claim for an earlier effective date for the award of service connection for bilateral pes planus and the Board may decide the issue on the merits. In an April 2012 decision, the Board reopened the Veteran's claim for service connection for a low back disability, including as due to service-connected bilateral pes planus, and remanded this issue on the merits as well as the issues of entitlement to increased ratings for a hernioplasty scar and bilateral pes planus and entitlement to an earlier effective date than June 1, 1987, for a grant of service connection for bilateral pes planus. The Board has sought expert medical opinions from the Veterans Health Administration (VHA). VHA opinions were received in October 2014 and in March 2015. In August 2015, VA provided these opinions to the Veteran and his representative with a 60-day period of time to provide additional evidence and/or argument. A Board hearing in Washington, D.C. was held in March 2005 before a Veterans Law Judge who subsequently retired from the Board; the hearing transcript is associated with the record. The only issue currently on appeal addressed at this Board hearing was entitlement to increased rating for pes planus with degenerative changes of the left foot and the right foot. (Parenthetically, the Board notes that the hearing testimony also discussed the issue of service connection for a low back disability. However, the Board subsequently denied this issue in a February 2007 decision that became final with respect to this matter.) As the Board noted in April 2008, the Veteran declined a new hearing before a different Veterans Law Judge in February 2008 correspondence. See 38 U.S.C.A.
[ 15, 187, 50274, 94, 535, 50274, 9486, 20605, 17526, 26735, 1082, 187, 50274, 92, 187, 50270, 1403, 1942, 17526, 1672, 15, 12965, 36810, 3001, 4155, 15, 11589, 272, 15, 11589, 15, 33669, 9, 9138, 4027, 187, 50274, 94, 187, 94, 187, 187, 510, 4836, 1375, 816, 4558, 347, 686, 13689, 272, 2214, 6014, 7639, 5983, 9876, 3780, 871, 2139, 436, 651, 5108, 32, 187, 187, 34, 27, 187, 187, 18071, 27, 380, 4385, 432, 12167, 8148, 552, 703, 1397, 625, 1708, 27, 187, 187, 35087, 8695, 19158, 8241, 1320, 5856, 310, 253, 23457, 383, 7092, 15, 733, 26574, 5779, 347, 34265, 2581, 685, 35576, 285, 4648, 247, 5569, 281, 13194, 697, 30679, 581, 387, 247, 673, 15, 26989, 8695, 19158, 8241, 1320, 5856, 1057, 417, 2430, 32341, 4052, 896, 281, 253, 1072, 6293, 313, 2858, 1057, 878, 281, 1379, 253, 5569, 558, 253, 3846, 4348, 327, 21050, 310, 984, 253, 26272, 310, 6179, 323, 253, 5569, 313, 13028, 407, 253, 6293, 275, 253, 2362, 16454, 10, 187, 187, 3220, 5476, 310, 326, 627, 434, 247, 14139, 8241, 1320, 5856, 534, 310, 17190, 253, 26272, 281, 1408, 327, 253, 1072, 6293, 347, 253, 2362, 16454, 15, 5402, 2362, 16454, 310, 14589, 326, 6293, 13, 594, 253, 26272, 1620, 6613, 13, 534, 2097, 253, 2362, 16454, 588, 1620, 440, 6172, 15, 187, 2773, 434, 760, 247, 5476, 2167, 428, 352, 434, 253, 760, 2181, 309, 476, 1158, 273, 534, 2789, 3282, 387, 253, 2774, 15, 187, 4041, 4500, 281, 1611, 281, 440, 6172, 436, 310, 281, 1818, 634, 26735, 1332, 281, 27, 187, 9486, 20605, 17526, 26735, 1082, 187, 92, 187, 50274, 1403, 1942, 17526, 1672, 15, 12965, 36810, 3001, 4155, 15, 11589, 272, 15, 11589, 15, 33669, 9, 9138, 1228, 187, 50262, 15, 6155, 459, 34, 14061, 9, 25674, 2374, 17745, 1520, 5856, 27, 3221, 558, 187, 94, 187, 187, 2773, 588, 1581, 253, 26272, 281, 3426, 327, 247, 1027, 3634, 15, 187, 42, 1353, 9861, 627, 310, 824, 247, 27801, 3634, 13, 2564, 368, 1051, 309, 1871, 1902, 512, 273, 436, 281, 816, 5108, 327, 253, 6293, 6363, 15, 23443, 4360, 22929, 6825, 310, 4127, 5777, 24443, 15, 535, 510, 38615, 280, 285, 32402, 528, 9811, 273, 253, 16955, 754, 67, 3088, 18680, 310, 642, 5545, 247, 344, 37724, 6617, 15, 8079, 13, 16955, 754, 67, 3088, 457, 84, 760, 6617, 369, 326, 352, 4469, 271, 4743, 15, 1723, 21210, 581, 778, 2868, 326, 4743, 281, 320, 13, 1620, 310, 326, 247, 22861, 323, 247, 6010, 10636, 824, 347, 326, 534, 2335, 1659, 3063, 15, 44605, 314, 513, 253, 3000, 273, 6845, 49761, 5818, 594, 31311, 28, 773, 42, 513, 417, 5194, 342, 752, 368, 452, 281, 1333, 13, 533, 309, 457, 620, 2342, 281, 253, 2471, 634, 987, 281, 1333, 352, 6598, 187, 187, 6436, 13, 253, 7870, 14149, 15995, 253, 3420, 14511, 23221, 2220, 271, 10466, 41679, 6828, 4404, 253, 8797, 3114, 13, 342, 41035, 3544, 273, 1852, 31469, 78, 1362, 482, 35668, 247, 3282, 273, 8294, 326, 556, 7369, 275, 247, 18829, 3543, 15995, 690, 16492, 13, 11392, 275, 247, 5149, 273, 48754, 323, 247, 6617, 597, 858, 417, 4514, 15, 41332, 27815, 824, 347, 2802, 18913, 23490, 342, 8033, 1204, 457, 403, 14149, 13, 23668, 839, 253, 8453, 273, 253, 2471, 273, 754, 67, 3088, 457, 84, 18680, 347, 8033, 457, 84, 2380, 281, 7185, 273, 6519, 2581, 685, 9610, 253, 6617, 347, 352, 310, 28, 247, 711, 14985, 494, 7701, 407, 25481, 1411, 18680, 15, 187, 187, 24804, 247, 1077, 8312, 4764, 32361, 432, 253, 38615, 414, 273, 436, 5320, 382, 15156, 13, 15260, 5911, 407, 247, 3420, 25204, 14, 73, 2084, 323, 247, 2675, 285, 31002, 6424, 7032, 273, 18462, 824, 6993, 15, 11056, 457, 84, 9811, 556, 642, 5545, 509, 8055, 253, 3270, 14, 34330, 21942, 7808, 49801, 2439, 3060, 15, 1198, 5747, 253, 8797, 12244, 457, 84, 44064, 6031, 281, 557, 10769, 366, 3139, 432, 253, 38615, 414, 273, 247, 3782, 3609, 15156, 13, 253, 3420, 14511, 7788, 281, 10251, 885, 253, 594, 14, 8890, 2802, 34330, 280, 3753, 457, 273, 841, 6993, 28, 21455, 281, 30648, 253, 13281, 22567, 275, 1708, 273, 253, 49970, 280, 10056, 20251, 14851, 326, 2802, 10002, 972, 26280, 247, 7765, 5734, 323, 247, 7765, 390, 323, 16933, 544, 17506, 62, 275, 253, 2659, 1108, 352, 310, 347, 604, 344, 574, 47256, 28473, 7094, 15, 1244, 26350, 26866, 581, 1108, 352, 310, 347, 604, 344, 574, 9809, 28473, 7094, 457, 313, 22, 27, 1237, 582, 390, 1014, 281, 10251, 885, 326, 581, 273, 253, 6382, 14745, 5339, 21449, 16955, 754, 67, 3088, 457, 84, 14145, 369, 271, 8365, 28, 39505, 353, 5650, 357, 255, 15, 187, 187, 510, 958, 273, 253, 2647, 310, 326, 1046, 13281, 8848, 14502, 2224, 253, 16955, 754, 67, 3088, 40139, 13, 816, 751, 1046, 643, 44715, 275, 253, 23324, 414, 273, 1966, 1495, 15, 9937, 616, 2853, 14, 46779, 13, 22198, 13, 13413, 13, 9579, 272, 13, 285, 1784, 462, 2473, 48528, 273, 253, 32550, 28453, 13, 3496, 15994, 4360, 27594, 326, 16492, 956, 247, 9596, 326, 6882, 2487, 19227, 275, 7281, 16954, 534, 760, 45482, 5368, 29005, 875, 3060, 285, 253, 8797, 12244, 13, 285, 556, 15260, 5911, 22198, 2080, 14, 918, 3128, 1329, 2439, 3060, 13, 253, 5020, 273, 16492, 3365, 1925, 323, 253, 18185, 273, 253, 9311, 15, 187, 187, 510, 625, 8993, 2523, 1024, 310, 253, 11795, 273, 436, 769, 534, 760, 29095, 253, 1655, 2675, 22199, 326, 556, 13207, 281, 14165, 366, 1781, 7118, 273, 253, 8797, 3114, 432, 5284, 21262, 15, 1284, 253, 3114, 310, 47723, 2918, 281, 9331, 323, 253, 811, 3161, 621, 273, 10058, 5320, 382, 3603, 28, 285, 347, 253, 3420, 44569, 253, 2862, 3114, 342, 581, 16463, 13, 594, 253, 2647, 273, 17414, 4916, 2455, 625, 13392, 285, 1097, 4676, 3135, 281, 20843, 3746, 432, 581, 1529, 15, 831, 6158, 1127, 310, 7936, 323, 760, 342, 253, 15850, 273, 2675, 18158, 13, 638, 24751, 13, 285, 2208, 3646, 22741, 476, 253, 2523, 273, 5320, 1204, 320, 11463, 1070, 15, 187, 187, 10195, 588, 13387, 253, 8797, 3114, 323, 417, 5277, 4209, 12255, 327, 697, 1211, 2758, 285, 27382, 253, 5195, 273, 5320, 1204, 28, 390, 4931, 8577, 247, 9645, 5130, 281, 436, 1895, 15, 8079, 1142, 588, 1750, 326, 253, 8797, 3114, 3198, 281, 3037, 281, 1453, 2802, 953, 1211, 457, 390, 2802, 788, 562, 15385, 1723, 13, 253, 1895, 310, 417, 347, 581, 14, 21773, 347, 253, 3420, 285, 1142, 643, 34514, 651, 751, 281, 2868, 15, 1198, 6296, 352, 310, 3394, 342, 247, 625, 5213, 4809, 275, 10253, 13, 16158, 20498, 13, 12728, 13, 9256, 13, 27412, 285, 30174, 13, 285, 253, 5213, 22567, 2668, 275, 1016, 273, 841, 4343, 326, 452, 45482, 285, 15260, 5911, 5320, 1204, 275, 776, 1211, 18275, 13, 9904, 342, 253, 3116, 273, 3270, 14, 922, 35892, 21942, 45482, 407, 253, 5054, 8891, 534, 556, 3977, 281, 1029, 3904, 273, 20549, 15, 329, 4433, 281, 11435, 436, 7936, 1127, 8540, 253, 17938, 273, 6031, 275, 253, 3819, 387, 1728, 15, 187, 187, 1909, 1048, 347, 253, 8797, 3114, 310, 6726, 281, 2997, 8294, 285, 15251, 885, 323, 6993, 352, 556, 1620, 7730, 13, 46695, 13, 390, 30020, 13, 594, 588, 253, 14165, 318, 4035, 13, 6153, 247, 2675, 8037, 326, 39783, 323, 17414, 13, 8881, 285, 4685, 326, 588, 760, 1421, 281, 2007, 12940, 285, 3687, 10254, 323, 5320, 1204, 15, 187, 187, 510, 754, 67, 3088, 40139, 403, 247, 38615, 280, 285, 6424, 769, 15, 1292, 352, 310, 23293, 326, 253, 13271, 454, 342, 534, 253, 3420, 556, 2361, 285, 15626, 253, 40139, 42267, 2824, 265, 253, 4644, 390, 2508, 273, 5012, 327, 253, 17959, 19382, 1146, 9284, 5857, 281, 33423, 4343, 281, 8773, 5312, 2280, 317, 373, 28, 253, 32524, 272, 5973, 275, 7634, 785, 10268, 5312, 31222, 1097, 275, 616, 1211, 2586, 285, 275, 29310, 28, 285, 275, 7785, 13, 253, 3513, 1971, 273, 5112, 39004, 285, 5418, 84, 275, 253, 8913, 9114, 489, 15, 51, 6739, 1722, 1857, 378, 12295, 21, 16, 1838, 22307, 323, 8153, 428, 473, 4350, 39, 48281, 4565, 9354, 187, 740, 15, 17138, 209, 21770, 10925, 2391, 1283, 883, 15, 26940, 8, 23952, 5733, 16443, 209, 21770, 537, 27446, 15, 12276, 187, 1552, 3389, 13067, 253, 2710, 6866, 281, 320, 908, 672, 20462, 187, 266, 5271, 20899, 4155, 26580, 416, 11872, 313, 1719, 7941, 10, 326, 588, 1408, 378, 12295, 21, 187, 60, 51, 6739, 1036, 3439, 62, 390, 309, 4976, 49, 323, 8153, 544, 1838, 22307, 62, 342, 643, 7412, 7941, 84, 6024, 281, 253, 7412, 13, 187, 395, 473, 4350, 39, 544, 51, 6739, 1010, 3245, 62, 347, 697, 309, 12295, 15, 187, 3074, 2852, 10414, 273, 378, 12295, 275, 436, 3389, 588, 3730, 281, 378, 12295, 187, 4149, 577, 13, 347, 2931, 275, 544, 51, 6739, 1036, 3439, 1570, 1876, 3806, 281, 309, 4976, 49, 403, 187, 250, 3065, 281, 253, 5383, 14, 25906, 416, 20309, 26010, 313, 28783, 14034, 2504, 10, 534, 556, 187, 20394, 2931, 407, 253, 309, 4976, 49, 323, 8153, 3389, 544, 1838, 22307, 62, 323, 897, 275, 5271, 20899, 187, 7761, 84, 15, 187, 1552, 3389, 13067, 849, 253, 1563, 4910, 275, 473, 4350, 39, 285, 12474, 187, 249, 378, 12295, 16, 1838, 22307, 403, 281, 320, 873, 672, 734, 33681, 875, 378, 12295, 16, 1838, 22307, 285, 473, 4350, 39, 187, 255, 271, 7412, 7941, 27, 187, 1838, 22307, 2210, 562, 273, 253, 1072, 789, 347, 378, 12295, 13, 285, 778, 320, 1908, 247, 956, 187, 251, 281, 378, 12295, 14, 20, 285, 378, 12295, 14, 21, 15, 5595, 4910, 2931, 275, 253, 5016, 187, 17352, 378, 12295, 285, 309, 4976, 49, 403, 4907, 253, 1072, 15, 7900, 1027, 13, 253, 309, 4976, 49, 187, 15069, 403, 2011, 11794, 15, 187, 35, 12295, 16, 1838, 22307, 353, 10147, 42, 64, 4237, 1433, 64, 15857, 36, 187, 35, 12295, 4145, 2431, 1042, 285, 7412, 64, 18999, 16, 1719, 64, 10452, 4632, 15, 473, 4350, 39, 6809, 187, 1838, 22307, 8021, 53, 64, 16615, 285, 28613, 64, 18999, 16, 19000, 64, 10452, 187, 35, 12295, 16, 1838, 22307, 427, 9465, 64, 41, 2795, 4632, 15, 473, 4350, 39, 25956, 272, 22483, 187, 35, 12295, 16, 1838, 22307, 35378, 1556, 64, 14364, 39, 4632, 15, 473, 4350, 39, 2105, 285, 1511, 187, 1838, 22307, 4428, 28613, 64, 18999, 285, 28613, 64, 10452, 4910, 534, 11029, 253, 1072, 4096, 187, 284, 7412, 64, 18999, 285, 7412, 64, 10452, 4910, 323, 309, 4976, 49, 323, 8153, 15, 496, 436, 3389, 13, 359, 187, 9846, 897, 253, 2426, 46536, 285, 21503, 281, 3730, 281, 253, 378, 12295, 7412, 64, 18999, 285, 187, 1719, 64, 10452, 13, 390, 253, 309, 4976, 49, 28613, 64, 18999, 285, 28613, 64, 10452, 4910, 2975, 13, 7293, 187, 251, 253, 3634, 273, 253, 7241, 1146, 908, 15, 187, 14358, 309, 4976, 49, 285, 378, 12295, 2085, 247, 5122, 281, 5224, 1880, 253, 24749, 187, 18480, 369, 23923, 3066, 271, 309, 12295, 13, 390, 690, 643, 2097, 15, 496, 309, 4976, 49, 13, 187, 338, 7622, 1491, 310, 23923, 407, 2097, 643, 685, 271, 309, 12295, 13, 840, 187, 783, 8021, 53, 64, 16615, 11104, 310, 1246, 15, 22300, 13, 275, 378, 12295, 13, 604, 247, 7622, 187, 18480, 310, 23923, 407, 2097, 643, 685, 271, 309, 12295, 13, 840, 253, 4145, 2431, 1042, 187, 15810, 310, 873, 281, 654, 38, 12295, 31, 390, 654, 1042, 9507, 20982, 5428, 13208, 1198, 253, 4096, 273, 436, 187, 3306, 13, 359, 878, 281, 12129, 875, 253, 767, 2219, 27, 187, 13248, 324, 5582, 13, 388, 4420, 708, 416, 1441, 73, 350, 544, 10099, 374, 62, 187, 187, 51, 6739, 1722, 1857, 378, 12295, 21, 16, 1838, 22307, 323, 8153, 428, 473, 4350, 39, 48281, 4565, 9354, 187, 9, 66, 10, 22720, 1491, 369, 23923, 3066, 271, 309, 12295, 13, 187, 9, 67, 10, 22720, 1491, 369, 23923, 407, 690, 643, 2097, 15, 187, 510, 3438, 1083, 310, 8156, 275, 309, 4976, 49, 407, 417, 1690, 253, 8021, 53, 64, 16615, 187, 15810, 13, 285, 275, 378, 12295, 407, 4758, 253, 378, 12295, 4145, 2431, 1042, 30, 29, 2431, 49, 21431, 380, 6158, 187, 5045, 310, 8156, 407, 1690, 253, 8021, 53, 64, 16615, 11104, 275, 309, 4976, 49, 13, 285, 407 ]
. } private async Task Sleep() { await TaskEx.Run(() => System.Threading.Thread.Sleep(1000)); } } The task state just remains as 'WaitingForActivation'. Does anyone know why this would happen? A: EDIT: The comment from Stephen Cleary sheds more light: AspNetSynchronizationContext is the strangest implementation. It treats Post as synchronous rather than asynchronous and uses a lock to execute its delegates one at a time. AspNetSynchronizationContext does not require marshaling back to the same thread (but does need to take the lock); the deadlock on Wait is because the continuation is waiting for the lock (held by the thread in the event handler) My guess is that there's a SynchronizationContext which is forcing the continuation to run on the same thread as the event handler. Your event handler is blocking that thread, so the continuation never runs, which means the event handler will never unblock. That's only a guess though - it's the only thing I can think of which makes sense at the moment. One option to try to unblock this is to change your Sleep method to: private async Task Sleep() { await TaskEx.Run(() => System.Threading.Thread.Sleep(1000)) .ConfigureAwait(continueOnCapturedContext: false); } That will allow the continuation to complete on a different context. I'm surprised there is such a synchronization context, mind you... I'd expect all of this to just happen on the thread pool. Possibly BeginRequest is treated slightly specially. The barbaric and villainous killing of the Charlie Hebdo journalists is no doubt a heinous crime. Indeed, Charlie Hebdo’s only crime was that it expressed an opinion. However erroneous one may believe that opinion to be, never is that a justification for a summary execution such as that which took place today. Rarely do the words of Voltaire ring so loudly; “I do not agree with what you have to say, but I’ll defend to the death your right to say it”. However, the dynamic emerging amongst the media narrative centres upon an implied accusation directed towards the Muslim community, with hashtags of #notinmyname depicting a sense of responsibility that has resulted in a panic felt amongst some Muslims, reflected in a wave of apologies for a crime they did not commit. Already headlines such as ‘Europe struggles with Islamism’ are emerging, exaggerating the significance of the death of Hebdo’s journalists as Islam’s response to freedom of speech rather than reporting the crime as it is; a despicable murder by criminals against journalists. Indeed a very dangerous parameter emerges from the barbarity of this extremist minority, fuelled by a media witch-hunt for a social and ideological criminal capable of encouraging such acts. Today’s killing has no doubt compounded the anti-Islam sentiment slowly creeping across Europe. For despite the Muslim Community’s relentless efforts to disassociate itself from the barbarity of a particularly select minority, the media narrative continues to emphasise the so-called ‘Islamic nature’ of these acts; refusing to analyse the Islamic stance in light of the Quranic passage expressly stating that ‘whoever kills a soul unless for a soul or for corruption [done] in the land – it is as if he had slain mankind entirely. And whoever saves one – it is as if he had saved mankind entirely’ (5:32), or even to emphasise that one of the policemen killed defending Charlie Hebdo’s offices was an Arab; Ahmad Muraabat. The fact of the matter is that every Islamic institution condemns the Charlie Hebdo killings, just like every other believer in the sanctity of human life. Despite their ill-considered, racist, offensive, degrading, and derogatory depiction of the Prophet Muhammad, irresponsibly implying that Muslims follow a religion that condones terrorism in cartoons which only exacerbated existing tensions between Europe and the Muslim Community, and has fuelled racist far-right party support across Europe, the majority of Muslims simply called for the withdrawal of the publication. The more immediate issue now is the timing of this act which only fuels the current social paradigm that has begun to alienate large sections of the Muslim community from European societies. As the community is wrongly held to fault for the transgressions of tiny extremist elements; and as the media paints the entire community with one brush, so the matter of dialogue becomes ever more distant and both parties begin to isolate themselves from one another. This latter point is fundamental for only with the cooperation of social activists, preachers, and government policy makers can the issue of extremism be tackled. Many will blame the Muslim community for not providing sufficient checks on its own members and permitting the spread of extremism; or perhaps turning a blind eye to this problem. Indeed many will claim that the Muslim community needs to learn to control ‘its own’ or ‘get out’. However, the problem is not as one-sided as the media and many other personalities would like to believe. For indeed it is events with a more international aspect in Egypt, Saudi Arabia, Syria, Iraq, Yemen and Libya, and the international stance taken in each of these countries that have exacerbated and fuelled extremism in our own borders, coupled with the growth of anti-foreigner sentiment exacerbated by the economic crisis which has led to high numbers of unemployment. A failure to appreciate this fundamental point damages the credibility of efforts in the fight at home. As long as the Muslim community is forced to accept responsibility and apologise for acts it has never committed, propagated, or endorsed, so will the alienation continue, creating a social gap that screams for dialogue, debate and understanding that will only lead to further isolation and greater momentum for extremism. The Hebdo killings are a barbaric and criminal act. But it is unfortunate that the vigour with which the media has reported and analysed the killings eclipses the volume or detail of reports on the Syrian refugees being refused entry to neighbouring countries to escape daily massacres; the Rohingya in Burma facing daily persecution both in their own country and in Bangladesh; and in Paris, the police treatment of French Arabs and Blacks in the banlieue.RFC 1745 BGP4/IDRP for IP - OSPF Interaction December 1994 10. Appendix .................................................... 1811. Authors' Present Addresses .................................. 191. Introduction This document defines the various criteria to be used when designing an Autonomous System Border Router (ASBR) that will run BGP4 [RFC1654] or IDRP for IP [IDRP] with other ASBRs external to the AS, and OSPF [RFC1583] as its IGP. All future references of BGP in this document will refer to BGP version 4, as defined in [RFC1654]. All reference to IDRP are references to the Inter-Domain Routing Protocol (ISO 10747) which has been defined by the IDRP for IP document [IDRP] for use in Autonomous Systems. This document defines how the following fields in OSPF and attributes in BGP/IDRP are to be set when interfacing between BGP/IDRP and OSPF at an ASBR: IDRP came out of the same work as BGP, and may be consider a follow on to BGP-3 and BGP-4. Most fields defined in the interaction between BGP and IDRP are named the same. Where different, the IDRP fields are shown separately. BGP/IDRP MULTI_EXIT_DISC BGP ORIGIN and AS_PATH/AS_SET vs. OSPF tag IDRP EXT_INFO and RD_PATH/RD_SET BGP/IDRP NEXT_HOP vs. OSPF Forwarding Address BGP/IDRP LOCAL_PREF vs. OSPF cost and type IDRP contains RD_PATH and RD_SET fields which serves the same purpose as AS_PATH and AS_SET fields for IDRP for IP. In this document, we will use the terms PATH and SET to refer to the BGP AS_PATH and AS_SET, or the IDRP RD_PATH and RD_SET fields respectively, depending on the context of the protocol being used. Both IDRP and BGP provide a mechanism to indicate whether the routing information was originated via an IGP, or some other means. In IDRP, if route information is originated by means other than an IGP, then the EXT_INFO attribute is present. Likewise, in BGP, if a route information is originated by means other than an IGP, then the ORIGIN attribute is set to <EGP> or <INCOMPLETE>. For the purpose of this document, we need to distinguish between the two cases: Varadhan, Hares & Rekhter [Page 2] RFC 1745 BGP4/IDRP for IP - OSPF Interaction December 1994 (a) Route information was originated via an IGP, (b) Route information was originated by some other means. The former case is realized in IDRP by not including the EXT_INFO attribute, and in BGP by setting the BGP ORIGIN=<IGP>; The latter case is realized by including the EXT_INFO attribute in IDRP, and by
[ 535, 50274, 4387, 1159, 755, 10976, 14574, 187, 50270, 2309, 3781, 9, 187, 50266, 1826, 1673, 2776, 2073, 2754, 64, 5564, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 33762, 64, 53, 43561, 13, 187, 50262, 8, 25553, 8, 3001, 3781, 9, 3781, 2073, 17354, 3401, 2387, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 90, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 27413, 15286, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 78, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 22362, 3886, 52, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 69, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 4877, 6328, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 73, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 23704, 6453, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 74, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 17258, 3329, 1410, 187, 50266, 9679, 187, 50266, 1826, 1673, 2765, 2073, 6324, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 44624, 64, 51, 25876, 13, 187, 50262, 8, 15565, 8, 3001, 3781, 9, 187, 50258, 8, 27413, 1277, 8, 3001, 418, 14375, 64, 27413, 15286, 13, 187, 50258, 8, 22362, 3886, 8, 3001, 418, 14375, 64, 22362, 3886, 52, 13, 187, 50258, 8, 29807, 8, 3001, 418, 14375, 64, 4877, 6328, 13, 187, 50262, 10, 187, 50266, 9679, 988, 186, 1826, 1673, 6958, 2073, 4064, 64, 2754, 1383, 3781, 9, 2657, 186, 626, 2404, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 22050, 64, 33762, 13, 2657, 186, 8, 42988, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 22050, 64, 33762, 64, 41, 7999, 13, 988, 186, 1228, 187, 50270, 558, 187, 50274, 94, 535, 50274, 4387, 1159, 755, 31980, 1082, 551, 535, 50270, 338, 3914, 2520, 1168, 8882, 2295, 686, 10978, 8, 910, 187, 50266, 5, 2520, 1168, 25553, 5456, 426, 3781, 2073, 486, 64, 6324, 5137, 187, 50270, 94, 2010, 551, 187, 50266, 5, 2520, 1168, 25553, 5456, 426, 3781, 2073, 2754, 5137, 187, 50270, 94, 535, 50270, 2309, 370, 2520, 1168, 25553, 28, 535, 50274, 94, 535, 50274, 4387, 1159, 755, 9671, 13248, 2548, 3914, 261, 64, 10978, 426, 3221, 10, 551, 535, 50270, 338, 3914, 2520, 1168, 8882, 2295, 686, 10978, 8, 910, 187, 50266, 5, 261, 64, 10978, 426, 2032, 28, 187, 50270, 94, 535, 50270, 338, 4816, 261, 64, 10978, 910, 187, 50266, 5, 2520, 1168, 2044, 64, 881, 426, 686, 3728, 5618, 187, 50270, 94, 535, 50270, 2309, 2885, 1450, 788, 9671, 13248, 2548, 3914, 261, 64, 10978, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 14390, 3914, 2877, 910, 187, 50270, 2309, 14271, 3914, 2520, 1168, 788, 27732, 3914, 2877, 582, 3221, 558, 187, 50274, 94, 535, 50274, 4387, 1159, 755, 2776, 3902, 3914, 2877, 910, 535, 50270, 338, 20273, 5, 2877, 910, 1091, 34973, 748, 535, 50270, 338, 9, 261, 64, 3728, 3914, 2877, 47881, 535, 50266, 5, 6324, 426, 3638, 2073, 47043, 64, 8, 964, 370, 2520, 1168, 788, 16956, 2073, 6324, 8539, 8, 740, 5137, 535, 50266, 5, 6870, 64, 2703, 426, 34973, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 4064, 23405, 910, 187, 50262, 5, 6870, 64, 2703, 33750, 418, 14375, 64, 22050, 2464, 686, 10506, 2877, 5013, 4064, 36676, 8, 686, 28, 187, 50266, 94, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 936, 23405, 910, 187, 50262, 5, 6870, 64, 2703, 33750, 418, 14375, 64, 7058, 2464, 686, 10506, 2877, 5013, 936, 22734, 187, 50266, 94, 535, 50266, 2309, 370, 6870, 64, 2703, 2464, 29996, 22174, 2073, 47043, 64, 8, 964, 370, 2520, 1168, 788, 16956, 2073, 6324, 8539, 8, 740, 5137, 535, 50270, 94, 535, 50270, 2309, 370, 2520, 1168, 788, 27732, 3914, 2877, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 755, 27732, 3914, 2754, 910, 535, 50270, 5, 10121, 426, 3781, 1874, 535, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 90, 3401, 910, 370, 10121, 5456, 426, 686, 90, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 78, 3401, 910, 370, 10121, 5456, 426, 686, 78, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 69, 3401, 910, 370, 10121, 5456, 426, 686, 69, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 73, 3401, 910, 370, 10121, 5456, 426, 686, 73, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 74, 3401, 910, 370, 10121, 5456, 426, 686, 74, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 4064, 64, 2754, 3401, 910, 370, 10121, 5013, 4064, 64, 2754, 6038, 426, 370, 2520, 1168, 788, 16956, 2073, 4064, 64, 2754, 5137, 748, 535, 50270, 2309, 2876, 64, 2754, 64, 486, 3914, 2754, 13, 370, 10121, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 755, 9824, 8982, 3914, 2877, 10, 551, 535, 50270, 5, 4064, 426, 2195, 11004, 3914, 2877, 5013, 4064, 23405, 3736, 313, 565, 1009, 2877, 5013, 4064, 6038, 1163, 3221, 28, 187, 50270, 5, 936, 426, 2195, 11004, 3914, 2877, 5013, 936, 23405, 3736, 313, 565, 1009, 2877, 5013, 936, 6038, 1163, 3221, 28, 535, 50270, 338, 20273, 5, 2520, 1168, 9029, 64, 10978, 64, 5423, 64, 5564, 910, 187, 50266, 5, 2520, 1168, 5564, 426, 3221, 28, 187, 50270, 94, 535, 50270, 2309, 260, 983, 14968, 1450, 43616, 18331, 12574, 5232, 6180, 3914, 2520, 1168, 2437, 2464, 64, 10978, 1383, 3781, 9, 187, 50266, 8, 3423, 8, 3001, 370, 2520, 13, 187, 50266, 8, 6324, 8, 3001, 3638, 2073, 47043, 64, 8, 964, 370, 2520, 1168, 788, 16956, 2073, 6324, 8539, 8, 740, 11470, 187, 50266, 8, 4064, 8, 50276, 14490, 370, 4064, 13, 187, 50266, 626, 80, 8, 50274, 14490, 370, 936, 187, 50270, 4027, 535, 50274, 94, 535, 50274, 4387, 1159, 4647, 9824, 3914, 7645, 13, 370, 2877, 10, 551, 535, 50270, 338, 6522, 261, 64, 3728, 3914, 2877, 1228, 551, 1091, 2885, 1450, 18788, 9824, 3914, 7645, 13, 370, 2877, 558, 748, 535, 50270, 338, 20273, 11004, 3914, 2877, 5013, 4064, 23405, 2785, 2195, 11004, 3914, 2877, 5013, 936, 23405, 910, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 4064, 23405, 910, 187, 50262, 5, 4064, 426, 313, 565, 1009, 2877, 5013, 4064, 22734, 187, 50262, 5, 7645, 1168, 10978, 6958, 20598, 254, 3914, 2520, 1168, 1590, 13, 370, 4064, 13, 370, 2520, 1168, 788, 16956, 2073, 6324, 26811, 187, 50266, 94, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 936, 23405, 910, 187, 50262, 5, 7645, 1168, 10978, 41516, 58, 42398, 3914, 2520, 1168, 1590, 13, 370, 2877, 5013, 936, 16445, 370, 2520, 1168, 788, 16956, 2073, 6324, 26811, 187, 50266, 94, 535, 50266, 2309, 370, 7645, 28, 535, 50270, 94, 535, 50270, 2309, 2885, 1450, 18788, 9824, 3914, 7645, 13, 370, 2877, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 4657, 3914, 2877, 13, 370, 261, 64, 2377, 3004, 13, 370, 744, 64, 2877, 30, 8629, 910, 535, 50270, 338, 20273, 5, 2877, 910, 1091, 3635, 28, 748, 535, 50270, 338, 6522, 261, 64, 3728, 3914, 2877, 47881, 535, 50266, 2309, 3522, 2073, 58, 14, 78, 14, 69, 388, 27, 74, 27, 84, 1383, 1213, 23877, 553, 3914, 2877, 4027, 535, 50270, 94, 2010, 338, 9, 33915, 3914, 2877, 5013, 4064, 23405, 2785, 310, 1178, 3914, 2877, 5013, 936, 47916, 551, 535, 50266, 2309, 544, 187, 50262, 8, 4064, 8, 3001, 313, 33915, 3914, 2877, 5013, 4064, 23405, 3736, 370, 2877, 5013, 4064, 6038, 1163, 3635, 582, 187, 50262, 626, 80, 8, 50275, 14490, 313, 33915, 3914, 2877, 5013, 936, 23405, 3736, 370, 2877, 5013, 936, 6038, 1163, 3635, 10, 187, 50266, 2194, 535, 50270, 94, 535, 50270, 2309, 3635, 28, 535, 50274, 94, 535, 50274, 4387, 1159, 4657, 9824, 3914, 2877, 910, 187, 50270, 2309, 370, 2520, 1168, 11869, 3914, 2877, 13, 3221, 558, 187, 50274, 94, 535, 50274, 4387, 1159, 755, 8982, 3914, 2877, 910, 535, 50270, 5, 2520, 1168, 2203, 5013, 2754, 6038, 426, 370, 2877, 3736, 3522, 2073, 69, 15, 78, 15, 58, 1383, 1213, 23877, 553, 3914, 2877, 1228, 1163, 34973, 535, 50270, 2309, 2885, 1450, 788, 8982, 3914, 2877, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 17813, 64, 486, 64, 6324, 3914, 2877, 910, 535, 50270, 338, 313, 11004, 3914, 2877, 1228, 551, 1091, 2032, 28, 748, 535, 50270, 338, 9, 33915, 3914, 2877, 5013, 4064, 23405, 2785, 310, 1178, 3914, 2877, 5013, 936, 47916, 551, 535, 50266, 5, 15164, 37755, 426, 13357, 63, 8850, 17, 14, 26, 20871, 1009, 16, 74, 3664, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 4064, 23405, 910, 535, 50262, 338, 9, 261, 64, 3728, 3914, 2877, 5013, 4064, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50262, 338, 20273, 81, 1747, 64, 8992, 3914, 15164, 37755, 13, 370, 2877, 5013, 4064, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50266, 94, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 936, 23405, 910, 535, 50262, 338, 9, 261, 64, 3728, 3914, 2877, 5013, 936, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50262, 338, 20273, 81, 1747, 64, 8992, 3914, 15164, 37755, 13, 370, 2877, 5013, 936, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50266, 94, 535, 50266, 2309, 2032, 28, 535, 50270, 94, 535, 50270, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 535, 50274, 94, 187, 187, 94, 187, 24650, 38336, 18469, 27, 13160, 375, 656, 327, 7814, 753, 253, 2567, 434, 4450, 556, 642, 3910, 342, 253, 28960, 285, 253, 594, 14, 8890, 3237, 497, 3420, 8869, 15, 380, 2567, 2918, 697, 5540, 394, 7970, 2087, 4804, 275, 14332, 47180, 327, 7814, 15, 688, 697, 13145, 46, 1157, 247, 2567, 28179, 753, 326, 253, 8017, 2201, 369, 6600, 273, 253, 958, 326, 253, 10963, 8037, 875, 253, 1755, 4323, 285, 6171, 556, 42248, 15, 380, 28179, 7478, 326, 253, 2567, 457, 84, 5511, 327, 10963, 812, 452, 644, 1805, 15, 1916, 2953, 326, 13, 352, 556, 40855, 1520, 10963, 281, 5739, 14, 3169, 23267, 13, 352, 753, 15, 3856, 457, 84, 247, 1007, 247, 867, 328, 3328, 273, 2234, 1436, 16474, 387, 13160, 375, 656, 27, 688, 247, 4857, 281, 28284, 13, 11731, 657, 763, 267, 322, 1479, 4530, 753, 326, 41779, 1166, 3982, 342, 352, 6938, 7881, 824, 347, 11002, 6055, 1204, 13, 38757, 20315, 262, 1320, 13, 10702, 5268, 12656, 285, 747, 7324, 32300, 16320, 595, 13, 359, 574, 7881, 281, 3324, 7882, 281, 776, 25021, 2136, 285, 3116, 281, 776, 7198, 6929, 285, 378, 5964, 9341, 15, 1292, 47323, 512, 273, 436, 13, 352, 1602, 11625, 441, 281, 3297, 7106, 327, 776, 3356, 14, 3945, 7517, 281, 4446, 5233, 3116, 275, 3694, 14, 1070, 27278, 13, 281, 9232, 4831, 275, 21629, 2579, 3104, 285, 281, 10660, 776, 5161, 3238, 1905, 247, 7517, 281, 7257, 5185, 13, 27834, 3116, 323, 253, 5649, 273, 512, 776, 28022, 1806, 322, 1479, 4530, 753, 15, 510, 2567, 753, 326, 625, 685, 1903, 13, 933, 7375, 452, 644, 4439, 1955, 281, 29885, 15, 27464, 591, 2120, 14, 37678, 8183, 313, 39, 5428, 10, 2559, 407, 337, 15, 19, 591, 1399, 347, 247, 906, 273, 29885, 13, 4981, 5837, 285, 18053, 11701, 13, 253, 2567, 753, 32300, 1147, 310, 247, 2590, 20028, 273, 849, 3694, 310, 1469, 281, 1132, 247, 9560, 2554, 275, 776, 2136, 1566, 1806, 352, 753, 15, 510, 4450, 457, 84, 2954, 342, 33663, 310, 2256, 273, 31215, 3420, 5012, 13, 253, 2567, 753, 15, 380, 2567, 457, 84, 16155, 21240, 416, 322, 265, 7110, 333, 1796, 753, 326, 672, 5701, 403, 1160, 407, 33663, 13, 352, 310, 2783, 625, 10369, 285, 44738, 15, 16155, 9550, 10963, 14691, 253, 14511, 327, 25978, 13, 352, 753, 15, 510, 8017, 2201, 753, 352, 369, 7063, 327, 22504, 1249, 13, 18895, 43813, 275, 7942, 285, 7942 ]
public function getOptions(){ return array( new fieldString('date_title', array( 'title' => LANG_PARSER_AGE_DATE_TITLE, 'rules' => array( array('required') ) )), new fieldCheckbox('show_y', array( 'title' => LANG_YEARS )), new fieldCheckbox('show_m', array( 'title' => LANG_MONTHS )), new fieldCheckbox('show_d', array( 'title' => LANG_DAYS )), new fieldCheckbox('show_h', array( 'title' => LANG_HOURS )), new fieldCheckbox('show_i', array( 'title' => LANG_MINUTES )), new fieldList('range', array( 'title' => LANG_PARSER_AGE_FILTER_RANGE, 'items' => array( 'YEAR' => LANG_YEARS, 'MONTH' => LANG_MONTHS, 'DAY' => LANG_DAYS, ) )), new fieldDate('from_date', array( 'title' => LANG_PARSER_AGE_FROM_DATE, 'hint' => LANG_PARSER_AGE_FROM_DATE_HINT, )) ); } public function getRules() { if($this->context == 'filter'){ $this->rules[] = array('age_range'); } else { $this->rules[] = array('date'); } return $this->rules; } public function getDefaultVarType($is_filter = false) { if($this->context == 'filter'){ $is_filter = true; } if ($is_filter){ $this->var_type = 'array'; } return parent::getDefaultVarType($is_filter); } public function parse($value){ return html($this->getDiff($value), false); } public function getStringValue($value){ if(!$value){ return ''; } if(is_array($value)){ $range = constant('LANG_' . $this->getOption('range').'10'); $result_string = ''; if (!empty($value['from'])){ $result_string .= LANG_FROM.' '.$value['from'].' '; } if (!empty($value['to'])){ $result_string .= LANG_TO.' '.$value['to']; } return $result_string.' '.constant('LANG_' . $this->getOption('range').'10'); } return $this->getDiff($value); } public function getDiff($date){ $options = array(); if ($this->getOption('show_y')){ $options[] = 'y'; } if ($this->getOption('show_m')){ $options[] = 'm'; } if ($this->getOption('show_d')){ $options[] = 'd'; } if ($this->getOption('show_h')){ $options[] = 'h'; } if ($this->getOption('show_i')){ $options[] = 'i'; } if ($this->getOption('from_date')){ $options['from_date'] = $this->getOption('from_date'); } return string_date_age($date, $options); } public function getFilterInput($value) { $from = !empty($value['from']) ? (int)$value['from'] : false; $to = !empty($value['to']) ? (int)$value['to'] : false; if(!$this->show_filter_input_title){ $this->title = false; } return cmsTemplate::getInstance()->renderFormField($this->class.'_filter', array( 'field' => $this, 'range' => constant('LANG_' . $this->getOption('range').'10'), 'from' => $from, 'to' => $to )); } public function applyFilter($model, $value) { if (!is_array($value)) { return parent::applyFilter($model, $value); } if(!empty($value['from']) || !empty($value['to'])){ if (!empty($value['from'])){ $from = (int)$value['from']; $model->filterDateOlder($this->name, $from, $this->getOption('range')); } if (!empty($value['to'])){ $model->filterTimestampYounger($this->name, $value['to'], $this->getOption('range')); } return $model; } return parent::applyFilter($model, $value); } public function store($value, $is_submitted, $old_value=null){ if(!$value){ return null; } if (!is_array($value)){ return date('Y-m-d H:i:s', strtotime($value)); } elseif(isset($value['from']) || isset($value['to'])) { return [ 'from' => (isset($value['from']) ? $value['from'] : null), 'to' => (isset($value['to']) ? $value['to'] : null) ]; } return null; } public function storeFilter($value){ return $this->store($value, false); } public function getInput($value){ $this->data['date'] = $value ? date('d.m.Y', strtotime($value)) : ''; return parent::getInput($value); } public function validate_age_range($value){ if (empty($value)) { return true; } if(isset($value['from']) || isset($value['to'])) { $rgxp = "/^([0-9]+)$/i"; if (!empty($value['from'])){ if(is_array($value['from'])){ return ERR_VALIDATE_INVALID; } if(!preg_match($rgxp, $value['from'])){ return ERR_VALIDATE_INVALID; } } if (!empty($value['to'])){ if(is_array($value['to'])){ return ERR_VALIDATE_INVALID; } if(!preg_match($rgxp, $value['to'])){ return ERR_VALIDATE_INVALID; } } return true; } return ERR_VALIDATE_INVALID; } } NEW DELHI: Infosys on Saturday said the company's board has no differences with the promoters and the so-called problems were media creation. The company held its 36th annual general meeting in Bangalore on Saturday.In its AGM , a company spokesperson said that the IT major was aware of the fact that the compensation gap between the top management and employees has widened. The spokesperson recognized that the company’s communication on compensation could have been better. To address that, it has restructured compensation to stock-based rewards, it said. Here’s a look a remuneration of key personnals at Infosys:In a letter to shareholders, CEO Vishal Sikka said that FY17 brought with it environmental challenges such as rising protectionism, accelerating commoditization, elevated client expectations and new competition.“Internally, we had challenges to bring stability to our consulting business and growth to our Finacle and BPO businesses. But amidst all of this, it behoves us to stay focused on our longer-term mission to drive rapid growth in software-led offerings, to capture demand in newer service lines and to renew our core services — a mission to deliver consistent, profitable growth for the benefit of all our stakeholders,” Sikka said.The company said that more than 11,000 jobs have been released due to automation. Revenue per full-tie employee (FTE) increased by 1.2 per cent as a result of automation, utilisation and productivity improvements, the company said.“It is a clear demonstration of how software is going to play a crucial role in our business model,” it said.The board’s relationship with founders is subject of inaccurate media reports, the company said. The company’s Executive Chairman R Seshasayee said that when comments are made by founders, it is considered more seriously and respectfully. Executive leadership compensation dominated the narrative on governance, it said.The IT major said it was sitting on Rs 12,222 crore in cash and cash
[ 265, 285, 512, 773, 33530, 668, 11295, 327, 40906, 762, 17238, 13, 3523, 253, 16933, 187, 1253, 1198, 40906, 281, 1718, 253, 17160, 45092, 285, 10434, 273, 253, 2586, 275, 253, 1980, 6982, 285, 3021, 187, 1253, 743, 990, 281, 16593, 1982, 14, 47678, 5454, 275, 40906, 285, 253, 36096, 11492, 326, 457, 84, 6571, 30122, 21474, 1204, 15, 187, 1253, 743, 15890, 273, 253, 40906, 5383, 303, 773, 41, 12537, 285, 19669, 668, 1720, 11682, 8064, 13, 5728, 275, 253, 1416, 273, 9958, 31878, 2458, 15, 187, 187, 38, 91, 3093, 4572, 327, 5418, 3419, 11635, 10840, 13772, 5553, 10675, 342, 30484, 12673, 5043, 4572, 342, 14656, 293, 4255, 285, 8679, 8784, 518, 757, 36623, 489, 387, 28160, 504, 6412, 13, 3863, 407, 43793, 13, 10733, 15, 3436, 13, 4059, 15, 13728, 273, 6763, 273, 31878, 2458, 5183, 275, 253, 31878, 757, 5347, 273, 6162, 14, 1952, 14, 45245, 285, 4768, 40906, 753, 39054, 3093, 399, 386, 17090, 15, 187, 187, 46, 706, 10065, 1641, 46406, 4563, 4187, 187, 249, 40906, 13, 4750, 44543, 187, 187, 34, 9119, 273, 11790, 31878, 2458, 327, 7216, 13964, 253, 46406, 4563, 4187, 3652, 275, 473, 9041, 312, 565, 248, 13, 29510, 40906, 13, 534, 20588, 253, 39774, 273, 253, 4750, 15, 380, 34170, 398, 268, 2585, 264, 253, 772, 4187, 457, 84, 8323, 285, 35035, 18162, 407, 7263, 7695, 26429, 10151, 15, 187, 187, 41, 1942, 74, 3313, 9651, 17324, 11226, 16024, 3678, 281, 557, 43292, 23590, 665, 671, 13230, 253, 8307, 273, 5820, 432, 11734, 253, 6307, 6584, 24148, 7648, 24380, 275, 473, 9041, 312, 565, 248, 13, 9633, 407, 46406, 32427, 39795, 8040, 437, 266, 15, 187, 187, 5677, 1059, 1618, 249, 15, 681, 15, 3088, 5012, 326, 253, 43384, 4035, 275, 31878, 757, 18430, 2822, 253, 5680, 342, 253, 46406, 4687, 13, 327, 11684, 326, 10929, 14440, 5794, 9609, 457, 84, 5286, 8041, 2675, 3198, 824, 347, 10678, 1824, 13, 2341, 13, 6406, 285, 13939, 25931, 2190, 2571, 15, 187, 187, 45607, 294, 25249, 187, 187, 2374, 7216, 253, 2831, 14, 14224, 2791, 294, 31370, 846, 1146, 6294, 3606, 1390, 6794, 327, 18162, 35035, 407, 31878, 2458, 275, 2067, 15918, 13, 281, 4831, 326, 6162, 14, 1952, 14, 45245, 2406, 253, 10474, 20978, 728, 327, 3580, 21117, 432, 46406, 12785, 15, 53, 333, 80, 17287, 21362, 5173, 187, 187, 33319, 307, 333, 80, 346, 53, 333, 80, 3, 17287, 21362, 5173, 313, 6448, 4163, 1722, 13, 10226, 10, 310, 271, 2448, 5842, 18915, 665, 310, 4390, 247, 1959, 5570, 15, 754, 4546, 6831, 5842, 323, 308, 18094, 15, 17287, 21362, 5173, 369, 22390, 407, 253, 8068, 34105, 275, 253, 15515, 3790, 273, 253, 4104, 13946, 28701, 15, 187, 187, 45970, 5249, 187, 688, 4267, 13, 43789, 80, 17287, 21362, 5173, 2502, 23565, 264, 387, 9149, 54, 15, 754, 840, 9495, 281, 308, 18094, 13, 846, 534, 344, 2206, 562, 253, 4332, 2952, 1955, 281, 3700, 4803, 15, 6408, 253, 4050, 2952, 13, 17287, 21362, 5173, 4546, 512, 27291, 3958, 13, 4983, 275, 13265, 273, 731, 15, 6408, 253, 4072, 2952, 13, 344, 858, 417, 1132, 5842, 15, 754, 9495, 896, 281, 9149, 54, 13, 533, 574, 642, 3057, 342, 253, 5842, 2285, 15, 6408, 253, 4059, 2952, 13, 17287, 21362, 5173, 369, 271, 37067, 353, 1075, 1876, 14, 5178, 1249, 4760, 15, 754, 3053, 13265, 3958, 387, 15584, 308, 471, 282, 15, 187, 187, 46361, 5249, 187, 187, 32544, 34105, 187, 510, 8068, 34105, 4236, 17287, 21362, 5173, 342, 253, 20117, 2619, 273, 253, 15515, 3790, 275, 253, 4104, 13946, 28701, 13, 2403, 779, 253, 26235, 5784, 2619, 4583, 15, 496, 521, 29938, 2952, 13, 17287, 21362, 5173, 13588, 253, 13946, 434, 3045, 14, 17305, 6816, 2854, 3646, 285, 369, 14116, 323, 1740, 3958, 15, 187, 187, 35, 2711, 17286, 34412, 313, 34, 4639, 10, 187, 2374, 3978, 3127, 13, 4240, 13, 17287, 21362, 5173, 369, 7922, 281, 253, 19585, 34412, 273, 253, 29410, 15794, 6884, 15, 187, 187, 19346, 18089, 15755, 398, 313, 2446, 39, 10, 187, 2374, 4437, 1249, 13, 4765, 13, 17287, 21362, 5173, 369, 6704, 407, 253, 5003, 18089, 15755, 398, 273, 253, 329, 9006, 15, 754, 369, 4439, 1563, 253, 2285, 434, 3302, 12949, 14, 23485, 275, 4565, 4765, 15, 187, 187, 10267, 29155, 16500, 313, 2446, 39, 10, 187, 688, 4247, 6247, 13, 17287, 21362, 5173, 6704, 342, 253, 33199, 16500, 273, 253, 329, 9006, 15, 1723, 13, 344, 858, 417, 1056, 253, 2457, 22970, 15, 754, 369, 4845, 327, 11062, 15917, 846, 22980, 5172, 1564, 15, 380, 9728, 25368, 5871, 275, 4162, 6247, 15, 187, 187, 38642, 43375, 570, 6163, 187, 39, 21297, 36295, 369, 22390, 275, 253, 9169, 1594, 4639, 28701, 407, 253, 14296, 43375, 570, 6163, 15, 754, 369, 23391, 327, 4247, 2145, 13, 9169, 15, 187, 187, 4941, 187, 187, 7504, 4859, 187, 36179, 6416, 23972, 264, 25847, 5943, 9015, 187, 187, 1413, 27, 14209, 10782, 187, 1413, 27, 14316, 952, 187, 1413, 27, 7878, 5842, 13413, 39223, 187, 1413, 27, 7878, 952, 273, 45207, 18499, 187, 1413, 27, 7878, 952, 273, 714, 263, 25642, 18499, 187, 1413, 27, 35, 2711, 17286, 34412, 3773, 187, 1413, 27, 32544, 34105, 3773, 187, 1413, 27, 38642, 43375, 570, 6163, 3773, 187, 1413, 27, 10267, 29155, 16500, 313, 7878, 5842, 10, 3773, 187, 1413, 27, 8836, 432, 444, 335, 405, 13, 6112, 187, 1413, 27, 49649, 273, 2448, 5842, 432, 6112, 187, 1413, 27, 19346, 18089, 15755, 398, 3773, 187, 1413, 27, 43421, 432, 253, 16700, 1253, 28830, 32354, 40011, 12813, 187, 1413, 27, 6669, 54, 23972, 264, 25847, 5943, 5842, 3773, 187, 1413, 27, 58, 263, 25642, 9001, 13174, 34, 1345, 26899, 327, 16876, 1475, 619, 5098, 187, 187, 23375, 2164, 13, 5826, 187, 187, 34, 20996, 2929, 187, 4064, 5119, 5418, 14814, 13, 247, 17330, 23011, 5974, 13, 327, 253, 20701, 273, 367, 19, 49, 187, 3140, 14, 35870, 20097, 326, 352, 1057, 6296, 1305, 560, 3440, 6224, 4583, 15, 187, 1989, 253, 1055, 310, 417, 3543, 25356, 15, 380, 12830, 387, 253, 1755, 273, 253, 19840, 187, 77, 583, 6224, 13, 533, 253, 25803, 10846, 2007, 1066, 253, 18395, 6970, 187, 35264, 5649, 432, 1873, 14, 1206, 6748, 15, 187, 187, 15383, 14814, 1057, 247, 1652, 15965, 10721, 281, 26065, 752, 651, 187, 38472, 257, 604, 1873, 14, 1206, 6748, 497, 3777, 407, 1884, 7739, 544, 1909, 368, 1239, 13, 31986, 253, 187, 9177, 6937, 6970, 326, 309, 897, 347, 619, 5311, 434, 18479, 27, 346, 1274, 1034, 3, 2097, 4404, 187, 783, 12830, 285, 3687, 6224, 15, 1570, 187, 187, 60, 4509, 3239, 4567, 62, 496, 436, 187, 20285, 12690, 780, 1533, 342, 1884, 6, 1679, 1873, 9628, 13, 253, 2406, 6879, 6, 273, 253, 187, 35360, 273, 6224, 310, 14728, 2007, 281, 253, 1669, 13, 1223, 253, 1755, 273, 187, 783, 3268, 5459, 697, 6224, 15, 831, 310, 752, 943, 320, 3264, 187, 28821, 253, 8197, 432, 1840, 15, 47011, 665, 403, 7202, 13, 285, 3021, 954, 187, 2955, 9357, 407, 1873, 9628, 13, 403, 1110, 10846, 665, 5580, 4942, 1643, 187, 31638, 84, 13, 5727, 10846, 665, 403, 44137, 407, 1873, 9628, 285, 3021, 6351, 187, 4064, 697, 8570, 13, 253, 4633, 4394, 13, 403, 253, 10846, 3692, 6224, 403, 187, 1661, 3146, 1029, 15, 187, 187, 1552, 6452, 5644, 187, 936, 2007, 3533, 5001, 253, 16274, 326, 1873, 9628, 556, 574, 187, 395, 588, 452, 327, 253, 5950, 3440, 4491, 15, 496, 1798, 13, 604, 1873, 187, 35870, 9093, 15036, 6224, 1977, 432, 4232, 6993, 2584, 187, 29469, 6993, 13, 436, 556, 7826, 1077, 1774, 12739, 323, 849, 187, 22559, 290, 310, 3715, 285, 5939, 275, 253, 4491, 15, 1284, 342, 253, 2969, 187, 14458, 14, 6321, 2538, 273, 1873, 9628, 327, 6224, 13, 253, 3884, 273, 253, 3486, 187, 261, 417, 2590, 15, 3900, 581, 1537, 5476, 326, 3629, 253, 6224, 273, 747, 187, 10719, 651, 1421, 281, 625, 8149, 275, 6684, 747, 12816, 13, 352, 310, 671, 187, 24902, 326, 253, 8149, 275, 747, 6993, 310, 2218, 347, 247, 15133, 187, 4347, 264, 539, 281, 1089, 10846, 665, 588, 5580, 9790, 273, 5861, 15, 8490, 187, 35870, 310, 8493, 253, 5912, 326, 667, 769, 310, 2104, 281, 5580, 187, 17993, 621, 273, 5861, 13, 285, 604, 253, 2323, 273, 253, 41354, 14, 7873, 10846, 310, 187, 5371, 14137, 253, 8149, 275, 747, 6993, 13, 352, 1537, 4796, 253, 25275, 187, 936, 1718, 275, 747, 12816, 15, 831, 310, 13, 387, 697, 2798, 13, 271, 16774, 1953, 187, 4609, 310, 1669, 281, 2852, 789, 15, 187, 187, 510, 941, 3637, 13, 533, 187, 7053, 247, 1652, 8813, 15, 380, 337, 6, 1386, 10770, 281, 253, 6224, 273, 253, 187, 38462, 4633, 16258, 28, 253, 8688, 6, 1386, 310, 253, 6224, 273, 253, 954, 4633, 15, 187, 510, 2626, 5084, 310, 253, 5118, 6224, 604, 1873, 14, 35870, 497, 3777, 407, 187, 1229, 7739, 1284, 368, 476, 923, 432, 253, 2708, 13, 326, 651, 1361, 253, 6224, 275, 253, 1755, 187, 1099, 6, 273, 18395, 13, 285, 8513, 1110, 2708, 15, 6758, 310, 1529, 1039, 273, 3981, 187, 3529, 1873, 14, 1206, 6748, 3133, 281, 1361, 1110, 275, 253, 5004, 1264, 14, 14105, 273, 187, 32667, 414, 13, 3164, 323, 253, 4606, 4767, 1840, 15, 187, 187, 510, 187, 12486, 308, 647, 12739, 273, 436, 403, 3965, 2590, 15, 1198, 253, 5020, 273, 187, 435, 1346, 2007, 1066, 253, 8105, 13, 1959, 3268, 310, 1175, 9137, 13, 187, 3113, 247, 2036, 2762, 1055, 327, 6224, 15, 6758, 310, 2568, 1529, 24388, 326, 187, 783, 4803, 403, 512, 1512, 2223, 1160, 281, 4017, 253, 15156, 273, 10846, 387, 187, 783, 1755, 273, 253, 6970, 13, 417, 954, 10846, 4583, 15, 187, 187, 20266, 4562, 13, 5826, 187, 187, 8430, 352, 434, 187, 85, 2187, 272, 281, 5467, 326, 253, 10319, 1924, 13301, 403, 2378, 969, 2820, 281, 187, 72, 276, 463, 441, 13, 627, 434, 690, 3282, 275, 616, 6323, 6031, 281, 755, 8217, 281, 187, 357, 7541, 352, 434, 581, 14, 3281, 14, 26017, 14, 455, 20910, 1566, 15, 329, 1457, 2816, 7717, 3929, 187, 1189, 253, 8849, 2361, 327, 253, 10800, 11182, 875, 253, 13301, 285, 187, 25989, 689, 697, 4229, 370, 17, 15, 1525, 4376, 1127, 15, 380, 13301, 651, 751, 281, 5580, 954, 187, 1826, 3440, 323, 625, 283, 5, 18, 15, 2537, 16, 13712, 32, 283, 1223, 5662, 390, 625, 26591, 11411, 812, 187, 2184, 323, 1679, 15, 187, 187, 2512, 434, 9828, 281, 751, 670, 4778, 20910, 15, 1198, 37843, 13, 352, 434, 2761, 187, 25737, 253, 954, 5919, 1039, 281, 22950, 10169, 273, 39653, 10229, 187, 395, 6383, 15, 1284, 22825, 416, 334, 27643, 12516, 352, 27, 187, 187, 1147, 434, 247, 5044, 4086, 273, 20701, 27, 10229, 326, 452, 15386, 4831, 313, 74, 537, 70, 13, 187, 4160, 5667, 10, 403, 4122, 4376, 7996, 15, 3840, 13, 667, 5382, 4354, 187, 15735, 323, 1959, 313, 267, 15932, 30060, 10, 588, 452, 271, 1014, 8750, 2380, 187, 936, 4376, 5459, 15, 187, 187, 25989, 187, 7110, 9125, 326, 2014, 14, 19209, 17647, 369, 3309, 275, 253, 2393, 1897, 187, 1171, 253, 2579, 13, 672, 952, 497, 816, 2970, 908, 281, 10054, 281, 187, 21596, 3440, 15, 1292, 1024, 13, 846, 6783, 78, 11411, 452, 644, 4211, 13, 359, 1472, 4518, 2469, 253, 2393, 519, 15578, 3408, 15, 1893, 752, 434, 253, 987, 20910, 1566, 1469, 3579, 32, 187, 187, 10342, 8553, 273, 253, 12027, 875, 8217, 285, 253, 13301, 452, 187, 34821, 327, 253, 4491, 434, 6031, 281, 7164, 7911, 13, 534, 403, 43296, 47388, 187, 66, 1943, 629, 273, 616, 2098, 15, 1621, 9326, 627, 15, 380, 2561, 359, 1849, 187, 20394, 2509, 323, 253, 1984, 2722, 326, 1561, 253, 10713, 273, 253, 3909, 3440, 187, 21616, 283, 783, 1755, 2233, 13, 933, 38661, 283, 7483, 495, 15, 22, 11411, 327, 253, 3388, 3437, 187, 39217, 15, 1893, 253, 1924, 13301, 403, 2970, 1679, 685, 370, 20, 275, 187, 250, 7290, 313, 2484, 3841, 1079, 10, 432, 16258, 672, 253, 3440, 310, 4211, 407, 253, 3540, 15, 187, 2773, 434, 1679, 685, 2716, 253, 35222, 4376, 273, 247, 3437, 313, 20261, 342, 5293, 187, 1171, 253, 3520, 4815, 273, 2403, 285, 35904, 247, 3437, 481, 380, 5333, 432, 187, 266, 5400, 1566, 281, 247, 3540, 1566, 310 ]
es and all “laws” imposed on Haiti under occupation, stop the corruption – For Haiti to invest the mineral riches and assets of the country in the local economy and thus – An end to unfair US-Euro trade in Haiti and the NGO invasion that’s mostly humanitarian imperialism. – An accounting of the Haiti Interim “Hillary and Billy” Reconstruction funds, collected in the name of suffering Haitians. Ezili interview on Black Agenda Report weekly radio broadcast with Glen Ford plus interview with Cornel West and Bob Avakian Dialogue at Riverside Church, published by BAR, Nov. 26, 2014. Ten of thousands of Haitians demonstrated in the Haitian capital of Port-au-Prince and throughout Haiti said Ezili Dantò. Mob pelts Dominican Consulate in Haiti, staff evacuated A mob of angry Haitians on Monday attacked the Dominican Consulate building in Ouanaminthe, northeast Haiti, which prompted the evacuation of the staff. The rioters pelted the consulate’s windows and staged protests by torching tires nearby. Haiti National Police reportedly fired tear gas to disperse protesters who also blocked the hundreds of workers from entering the Codevi Industrial Free Zone in Ouanaminthe, owned by Dominican businessman Fernando Capellan. Outlet listin.com.do reports that the riots continue in Haitian villages near the border with the Dominican Republic, on demands that Michell Martelly’s administration attend social needs such as drinking water, energy, street and roads repairs among others. Market reopens On Monday the cross-border market reopened after being shuttered last Friday on protests staged by Haitians in several towns, to demand that Port-au-Prince lower the taxes levied on products imported from Dominican territory.Tayo Fabuluje Olutayo "Tayo" Fabuluje (born July 17, 1991) is an American football tackle who is currently a free agent. He played college football for TCU. Fabuluje was drafted by the Chicago Bears in the sixth round of the 2015 NFL Draft. College career In 2010, Tayo Fabuluje redshirted at BYU. He then transferred to TCU, after which he sat out the 2011 season due to transfer rules. During the 2012 season, Fabuluje played all thirteen games, starting in twelve of them. During the 2013 season, he did not play football. He transferred back to BYU, but had no contact with the football team. During the 2014 season, Fabuluje was an Honorable Mention All-Big 12 player. He started twelve games at Left Tackle. Professional career Chicago Bears The Chicago Bears selected Fabuluje with the seventh pick of the sixth round in the 2015 NFL Draft, making him the 183rd pick overall. In his rookie season, Fabuluje violated the NFL's performance-enhancing drug policy and was suspended for four games. Baltimore Brigade (AFL) On June 21, 2017, Fabuluje was assigned to the Baltimore Brigade of the Arena Football League. San Antonio Commanders (AAF) On October 12, 2018, Fabuluje was signed by the San Antonio Commanders of the AAF. He was released following the team's initial mini-camp in December 2018. Memphis Express (AAF) In January 2019, Fabuluje signed with the Memphis Express of the AAF. However, he did not make the final roster. He was placed on injured reserve after clearing waivers. The league ceased operations in April 2019. Houston Roughnecks Fabuluje was drafted in the 2020 XFL Draft by the Houston Roughnecks. He was waived on January 13, 2020. References External links Texas Christian Horned Frogs bio Category:1991 births Category:Living people Category:American football offensive tackles Category:American people of Nigerian descent Category:American people of Yoruba descent Category:Baltimore Brigade players Category:Chicago Bears players Category:Houston Roughnecks players Category:Memphis Express (American football) players Category:People from Euless, Texas Category:Players of American football from Texas Category:San Antonio Commanders players Category:Sportspeople from the Dallas–Fort Worth metroplex Category:TCU Horned Frogs football players Category:Yoruba sportspeopleA public diary on themes around my books November 24, 2005 A fascinating paper from David Blackburn, a Harvard PhD student, on the economics of P2P file-sharing concludes that it does indeed depress music sales overall. But the effect is not felt evenly. The hits at the top of the charts lose sales, but the niche artists further down the popularity curve actually benefit from file-trading. Blackburn does a little mathematical magic to simulate what would happen if file-trading were reduced by 30%. [As you read, visualize the powerlaw curve that I use as my blog's logo: "leftward" means towards the hits and greater sales.]. [From page 32] In this counterfactual world with 30% less file sharing, the lower 75% of the distribution of sales is shifted further to the left, while the top of the distribution increases its sales. This is what should be expected given the estimates from above. Artists who are unknown, and thus most helped by file sharing, are those artists who sell relatively few albums, whereas artists who are harmed by file sharing and thus gain from its removal, the popular ones, are the artists whose sales are relatively high. This conclusion leads to further questions regarding the impacts that file sharing has had and will have on the recorded music industry. In particular, if file sharing essentially shifts sales away from established acts toward unknown acts, this has potentially very important implications for how talent is developed and distributed in the industry. As with the simple short-run effects of file sharing on sales, the direction of the impact is not clear. While one might guess that increasing the sales of new acts would lead to more investment in developing new talent, it is also possible that the investment in new acts is done as a fishing expedition to find artists who will sell millions of records. File sharing is reducing the probability that any act is able to sell millions of records, and if the success of the mega-star artists is what drives the investment in new acts, it might reduce the incentive to invest in new talent. This is, at its heart, an empirical question which is left to future work. The data follows, but first a little explanation. The 1% line refers to the sales of the least popular albums; the 99% line is the sales of the most popular. The third column is the calculated sales if file-sharing were reduced by 30%. As you can see from the below, that would help the sales in the top 25% of popularity, and hurt those below. Which is another way of saying that file-trading seems to help those in the bottom three-quarters of popularity, probably for the reasons stated above. The Long Tail implications of this are pretty clear. For the majority of artists further down the tail, free distribution is good marketing, with a net positive effect on sales. Which is yet another reminder that the rules are all too often made to protect the minority of artists at the top of the curve, not most artists overall. August 31, 2005 Although it's tempting to assume that the evil record labels are once again trying to gouge us, there's some sense in their latest efforts to get Apple to abandon it's one-size-fits-all pricing model. A New York Times article over the weekend reported on the ongoing struggle between the labels and Apple over its fixed $0.99 price point. The labels would like to sell most new music for more--$1.49/track?-- while older or more obscure tracks could go for less. There's plenty to like about variable pricing. For starters, it's almost always the most efficient way to maximize markets of disparate goods and customers. As Barry Ritholtz puts it: It's a basic rule of economics: goods that have elastic demand (i..e, non essential) are highly price sensitive. Further, any item easily available for free (albeit illegally) will have an even bigger response to price increases. Apple has argued that single-price simplicity was necessary in the early days of the service, when people were just getting used to paying to download music. But now, after 500m tracks have been sold, we're clearly past the early adopter phase. So what's the right pricing model going forward? Most accounts of the dispute between Apple and the labels have focused on the industry's efforts to raise prices, which are undeniably a big part of their plan. No surprise there. The research we've been doing for the book shows that within the bulk of the online music business--the top 100,000 downloads--only 3.5 tracks on the average CD sell. So the record labels are getting less than $3 in revenue (wholesale) from albums when the music is sold by the track. That's less than half the wholesale price of a CD (although with none of the physical costs of making and distributing a CD). The shift from an album model to a track model is
[ 310, 673, 281, 8600, 28867, 23014, 2378, 969, 313, 8732, 818, 27, 1348, 481, 733, 310, 417, 673, 281, 320, 7175, 2179, 275, 253, 22654, 273, 253, 31433, 273, 247, 2288, 6134, 6617, 28, 352, 310, 247, 673, 323, 8426, 15, 187, 187, 4553, 12930, 253, 2143, 9602, 13, 2604, 3800, 28070, 1529, 1650, 273, 689, 14, 85, 27730, 283, 66, 346, 3456, 12844, 3, 665, 12470, 4130, 281, 1007, 387, 247, 5406, 273, 32905, 3044, 31516, 798, 285, 23697, 779, 313, 1787, 14, 1839, 481, 3032, 10110, 7369, 275, 253, 8923, 273, 21748, 313, 783, 1180, 273, 3038, 275, 247, 2129, 10, 7108, 15, 3044, 31516, 798, 2506, 626, 878, 619, 34555, 15, 1284, 2604, 3800, 4159, 27, 346, 1394, 285, 309, 452, 642, 987, 13, 7231, 314, 390, 37620, 13, 281, 23697, 32905, 3044, 31516, 798, 390, 6277, 2639, 570, 267, 28, 760, 1110, 597, 256, 13172, 1411, 452, 326, 987, 15, 187, 187, 688, 247, 3862, 3282, 13, 3044, 31516, 798, 285, 2639, 570, 267, 452, 256, 13172, 1411, 441, 512, 283, 338, 359, 956, 2516, 5037, 570, 434, 346, 2302, 637, 310, 271, 8930, 3, 11727, 15, 2732, 512, 13, 3044, 31516, 798, 6034, 281, 5159, 3780, 665, 369, 275, 326, 3652, 13, 285, 309, 717, 346, 1279, 531, 449, 346, 31568, 3, 1537, 452, 644, 619, 3392, 390, 3101, 13, 7586, 390, 4929, 13, 3347, 390, 6122, 15, 496, 326, 3282, 309, 1379, 352, 11697, 285, 717, 417, 3782, 275, 247, 7175, 2179, 12315, 15, 187, 187, 1989, 2604, 3800, 310, 987, 326, 253, 8993, 5870, 403, 253, 4394, 665, 403, 954, 3587, 3206, 13, 285, 253, 1390, 2181, 597, 3164, 878, 281, 923, 275, 253, 22654, 273, 616, 20993, 310, 690, 689, 14, 85, 15740, 386, 513, 14, 12311, 254, 9159, 34555, 1223, 597, 403, 1335, 294, 8855, 432, 253, 22820, 15, 187, 187, 11778, 7108, 2489, 594, 11479, 1417, 326, 359, 816, 2550, 1462, 281, 1056, 1014, 25481, 28461, 323, 616, 5231, 32, 544, 1093, 6, 11184, 49065, 685, 2620, 1107, 3622, 1329, 253, 2471, 12339, 10943, 1680, 346, 1542, 72, 6460, 3, 776, 1039, 273, 18882, 3184, 598, 28637, 3394, 594, 326, 359, 476, 1691, 731, 562, 273, 776, 13846, 285, 755, 327, 281, 776, 1735, 3128, 32, 1680, 352, 27915, 1255, 326, 49887, 441, 281, 7740, 10349, 32, 187, 187, 6140, 3800, 434, 7313, 1056, 247, 1270, 2968, 273, 3282, 27, 187, 187, 1898, 309, 717, 622, 18859, 285, 27185, 407, 436, 1928, 14, 12311, 12791, 273, 12077, 34555, 15, 187, 187, 1552, 12791, 16424, 253, 717, 7909, 10732, 326, 642, 2647, 849, 1199, 368, 8513, 2571, 13, 9790, 273, 634, 7715, 14, 10179, 22100, 588, 23697, 368, 15, 187, 187, 2042, 359, 403, 8356, 46804, 642, 2647, 752, 359, 513, 13, 2139, 39531, 313, 1839, 6177, 187, 187, 6140, 3800, 310, 9556, 13, 533, 344, 3133, 281, 7081, 247, 1805, 35380, 273, 253, 1457, 26529, 685, 1142, 594, 14, 8890, 346, 13238, 2458, 3, 452, 15, 187, 187, 510, 378, 4914, 323, 1198, 72, 6460, 187, 187, 3, 9586, 407, 2656, 937, 2604, 3800, 12013, 13, 346, 1542, 72, 6460, 310, 32391, 2220, 253, 256, 5338, 39531, 272, 15, 964, 17212, 313, 1839, 481, 2091, 4377, 5119, 13, 323, 1650, 13, 256, 13172, 13, 352, 4269, 779, 1270, 44089, 285, 20993, 283, 12157, 344, 574, 417, 1234, 8006, 273, 352, 15, 10363, 27507, 8319, 2722, 253, 44089, 273, 2564, 344, 37093, 1223, 9070, 5968, 1230, 432, 2656, 15, 10348, 2656, 23697, 779, 32, 6279, 13, 33181, 344, 1234, 8006, 285, 35907, 521, 6868, 15, 187, 187, 13238, 2458, 403, 2183, 281, 513, 253, 3242, 1072, 2181, 762, 253, 747, 33043, 15, 14698, 369, 2183, 281, 39531, 273, 253, 1869, 273, 521, 2798, 313, 6014, 84, 854, 27, 1423, 582, 285, 275, 337, 2516, 253, 30828, 282, 25264, 441, 512, 27, 346, 2042, 359, 25172, 776, 27932, 13, 754, 310, 21738, 285, 816, 281, 23697, 441, 776, 27932, 13, 285, 281, 4076, 339, 441, 432, 512, 440, 918, 22953, 1255, 3, 313, 18, 2516, 337, 27, 26, 481, 187, 187, 47565, 6460, 310, 417, 8356, 2959, 432, 2656, 15, 1707, 1364, 320, 13241, 39531, 593, 13, 417, 7960, 253, 8327, 281, 8773, 253, 9099, 273, 581, 434, 5231, 15, 2656, 858, 417, 1581, 1014, 5119, 434, 33842, 39531, 593, 281, 1978, 779, 432, 1146, 29163, 15, 754, 9606, 10260, 323, 521, 4327, 281, 6868, 313, 19, 20628, 2145, 14, 938, 481, 187, 187, 22427, 476, 359, 23697, 581, 1529, 1293, 1941, 273, 26034, 285, 247, 1818, 273, 3879, 15, 496, 253, 23356, 7670, 908, 273, 247, 4929, 6868, 920, 1411, 247, 4929, 5093, 2069, 275, 581, 1388, 13, 344, 369, 281, 320, 46804, 33181, 344, 753, 13, 346, 42, 39531, 3, 313, 42270, 1722, 27, 20, 14, 21, 28, 495, 27, 24, 14, 26, 481, 187, 187, 35, 9352, 17953, 434, 444, 3800, 1255, 187, 187, 4257, 1033, 6653, 43556, 2263, 7195, 4159, 271, 3929, 670, 19669, 17953, 13, 534, 5420, 275, 253, 399, 26947, 18700, 14, 1779, 1406, 2024, 327, 3919, 2145, 394, 15, 7195, 9513, 27, 187, 187, 12018, 13852, 382, 19669, 17953, 2183, 346, 14569, 10684, 3, 20985, 1390, 2129, 326, 344, 7175, 1644, 3918, 9662, 984, 346, 42, 871, 253, 6005, 7443, 273, 1966, 3753, 15, 964, 964, 964, 754, 556, 824, 247, 19999, 13216, 326, 309, 1158, 253, 16901, 816, 564, 4956, 689, 779, 3, 313, 740, 34, 481, 187, 187, 24080, 310, 1077, 591, 31898, 275, 7004, 13, 346, 2598, 752, 4555, 310, 17953, 7175, 2179, 253, 3918, 865, 313, 740, 34, 481, 380, 3918, 556, 5868, 512, 11307, 273, 667, 45452, 15, 1310, 344, 310, 15377, 13, 344, 1057, 417, 878, 34555, 28, 604, 344, 310, 8106, 13, 344, 651, 417, 760, 320, 8106, 273, 5615, 21600, 13, 533, 273, 10776, 670, 352, 281, 253, 2448, 952, 13, 1580, 344, 5868, 352, 7013, 5372, 816, 247, 1643, 1897, 3622, 15, 4268, 3390, 432, 17953, 434, 7579, 670, 1966, 6005, 7443, 13, 344, 1364, 1158, 253, 3918, 310, 8106, 15, 187, 187, 1989, 2139, 840, 310, 17953, 275, 824, 247, 24284, 281, 23697, 779, 313, 338, 521, 13260, 403, 987, 6177, 2091, 23662, 25394, 5119, 13, 253, 6963, 858, 417, 1333, 13, 346, 42, 1620, 574, 247, 5615, 2954, 342, 326, 3416, 13, 6827, 15, 45855, 1240, 449, 2615, 3780, 8564, 2656, 1234, 2943, 949, 23662, 13, 346, 42, 9446, 326, 368, 403, 247, 6005, 300, 1966, 1146, 13, 5119, 13, 285, 309, 452, 1691, 1977, 634, 6868, 313, 9154, 2167, 368, 13292, 1907, 7730, 352, 6844, 32, 187, 187, 2512, 310, 247, 1273, 1895, 342, 17953, 434, 24741, 281, 23697, 28, 344, 2686, 14993, 281, 16267, 253, 3918, 313, 1212, 18286, 7384, 344, 310, 8106, 10, 407, 18047, 272, 779, 347, 247, 6005, 300, 1966, 1146, 342, 247, 7870, 13216, 326, 2255, 2550, 1361, 15950, 3746, 387, 15, 4952, 604, 824, 271, 4743, 273, 253, 3918, 434, 22611, 497, 2032, 313, 395, 1142, 2255, 13292, 326, 352, 310, 594, 582, 849, 26453, 25675, 310, 352, 281, 16267, 3095, 323, 6868, 32, 187, 187, 34571, 7670, 4543, 253, 10956, 48504, 4268, 284, 8, 3879, 347, 247, 2647, 273, 1966, 6005, 7443, 27, 346, 37666, 4268, 284, 27, 344, 816, 476, 626, 1614, 1066, 2583, 449, 5171, 858, 417, 3630, 273, 253, 637, 3811, 342, 521, 3392, 434, 4475, 275, 41118, 27, 346, 1328, 310, 824, 247, 7870, 13216, 326, 1014, 7028, 2255, 564, 4956, 689, 779, 28, 344, 434, 816, 247, 6005, 300, 1966, 1146, 28, 23697, 779, 449, 5171, 858, 1642, 731, 281, 23697, 779, 33181, 344, 1234, 8006, 285, 15856, 15299, 275, 253, 6868, 313, 19, 3094, 15, 374, 27, 23, 14, 883, 481, 187, 187, 4218, 7195, 12013, 253, 5083, 672, 344, 2296, 27, 346, 2374, 247, 40723, 1268, 13, 13353, 17953, 6057, 326, 760, 2656, 476, 23697, 27932, 285, 326, 34555, 1057, 417, 8436, 70, 48371, 273, 45452, 285, 39531, 593, 3, 313, 740, 34, 481, 1359, 34019, 323, 247, 11547, 43556, 281, 452, 281, 9798, 253, 1533, 434, 4283, 28813, 382, 313, 1615, 253, 1533, 434, 7465, 13, 417, 2656, 434, 10, 752, 253, 13534, 22332, 2, 187, 187, 27035, 8, 1198, 72, 6460, 327, 253, 10547, 187, 187, 34, 1180, 273, 20378, 980, 812, 320, 6730, 281, 1329, 7195, 8, 8310, 15, 7670, 753, 13, 346, 33086, 368, 39531, 13, 368, 3091, 512, 21223, 591, 763, 3, 313, 42270, 2145, 27, 20, 481, 6049, 32, 2656, 1057, 417, 23697, 5734, 952, 403, 7378, 281, 14409, 326, 616, 3879, 310, 6868, 1020, 285, 1918, 598, 253, 6868, 15, 1284, 1048, 347, 247, 1436, 390, 247, 5674, 42575, 275, 253, 6868, 13, 2656, 588, 417, 23697, 15, 12238, 359, 1620, 6311, 253, 16507, 273, 3032, 6941, 3032, 1211, 952, 281, 320, 2668, 715, 3403, 2351, 32, 9876, 2656, 434, 25473, 253, 440, 30023, 314, 952, 273, 32794, 434, 1388, 342, 247, 10802, 1891, 281, 18578, 441, 326, 352, 310, 3430, 281, 1158, 326, 2656, 588, 23697, 441, 642, 2647, 752, 32, 187, 187, 10195, 1646, 281, 452, 14454, 313, 263, 4931, 1620, 3260, 10, 326, 2656, 310, 18465, 313, 18, 7993, 337, 27, 1010, 14, 1036, 10, 285, 326, 6868, 36158, 28473, 432, 15101, 313, 48728, 13560, 8978, 27, 18, 14, 19, 481, 1916, 4076, 339, 441, 273, 776, 27932, 627, 403, 767, 5667, 12696, 27, 337, 10, 253, 2471, 273, 7670, 327, 253, 2831, 323, 776, 27932, 13, 285, 374, 10, 776, 39531, 593, 273, 6868, 534, 49887, 441, 281, 320, 14205, 342, 2828, 275, 29767, 1204, 281, 2525, 3032, 2614, 285, 452, 776, 27932, 11974, 1977, 313, 30998, 15, 721, 27, 20, 14, 22, 481, 187, 187, 7161, 1057, 253, 13534, 9798, 326, 2656, 7175, 1644, 275, 253, 5928, 273, 39531, 593, 32, 24955, 1537, 3662, 13, 346, 42270, 3495, 27, 1706, 937, 534, 5861, 7670, 8, 806, 5511, 432, 253, 2831, 27, 346, 30646, 13, 23697, 731, 13, 323, 597, 513, 417, 871, 752, 597, 513, 449, 1723, 13, 627, 403, 1264, 2792, 670, 436, 12678, 534, 1364, 417, 320, 28849, 15, 187, 187, 510, 806, 310, 326, 13, 1580, 7670, 369, 253, 2596, 8452, 574, 644, 3430, 264, 13, 754, 812, 10972, 7325, 1642, 34555, 323, 3032, 29325, 13783, 15, 831, 4112, 19986, 10260, 432, 253, 34555, 5907, 281, 253, 37658, 273, 253, 1029, 2143, 6838, 15, 329, 7529, 281, 326, 651, 452, 644, 323, 253, 30828, 868, 281, 452, 11463, 264, 598, 247, 29751, 327, 253, 16511, 13, 3981, 13, 346, 1231, 23697, 368, 13, 4268, 284, 3, 390, 346, 1231, 23697, 368, 13, 330, 2284, 522, 7110, 449, 7670, 310, 253, 760, 2596, 665, 812, 987, 2920, 23697, 13, 1580, 253, 6617, 369, 1411, 15101, 15, 187, 187, 510, 1273, 1127, 310, 281, 320, 1160, 275, 253, 830, 273, 247, 1953, 27, 346, 3152, 297, 369, 7670, 7175, 2179, 865, 12349, 754, 7175, 2179, 253, 9647, 665, 497, 1563, 7367, 32, 12349, 754, 7175, 2179, 1110, 665, 574, 644, 24708, 264, 715, 34553, 13, 346, 36, 579, 68, 1419, 15101, 13, 12053, 68, 1419, 15101, 16296, 2207, 369, 754, 7175, 2179, 253, 9556, 7038, 665, 313, 21848, 281, 616, 12680, 24307, 10, 574, 7799, 281, 5159, 15101, 327, 247, 1180, 273, 15530, 32, 187, 187, 25110, 13, 369, 436, 34555, 12077, 32, 2207, 858, 597, 806, 878, 281, 39531, 32, 380, 30408, 574, 2183, 21263, 366, 13, 346, 8389, 2614, 320, 2220, 441, 285, 776, 2151, 3, 313, 29823, 15, 3435, 27, 1099, 481, 13314, 757, 10092, 316, 8631, 849, 253, 30396, 17914, 253, 2614, 273, 253, 11563, 1335, 5780, 275, 17913, 15, 25998, 13, 492, 356, 1037, 13, 597, 2959, 752, 597, 2546, 323, 15, 187, 187, 2374, 253, 643, 1133, 13, 627, 497, 1142, 11563, 665, 20090, 264, 253, 30860, 327, 253, 1388, 273, 19464, 886, 493, 28, 597, 497, 46804, 273, 616, 27932, 672, 597, 497, 29767, 1025, 313, 6014, 84, 374, 27, 1839, 14, 3156, 481, 3808, 574, 35219, 2149, 323, 7670, 8, 2471, 313, 6014, 84, 374, 27, 3495, 13, 1812, 481, 187, 187, 22674, 2614, 369, 417, 17914, 275, 253, 10198, 273, 17913, 275, 329, 15, 37, 15, 5571, 984, 597, 574, 18436, 253, 2846, 15, 380, 3064, 875, 1110, 665, 1234, 8006, 285, 1110, 665, 858, 417, 369, 253, 3064, 875, 1110, 3692, 2614, 369, 17914, 285 ]
is time to render righteous judgments once again (John 7:24). It is not time to be forgiving in the midst of the aftermath of a senseless crime; it is a time for justice. After describing the school shooting, Prager cites another example of over-tolerance--a "preacher" who invited everyone to look at a picture of Timothy McVeigh and forgive him (37-38). His bomb resulted in the deaths of 168 (the number of hours in a week) Americans. McVeigh doesn't need my forgiveness. As Prager wrote: "You and I have no right, religiously or morally, to forgive Timothy McVeigh or Michael Carneal; only those they sinned against have that right. In a broad sense, McVeigh and Carneal have sinned against us all--if we follow John Donne's "No man is an island" philosophy. After all, McVeigh intended to kill anyone who was in that building, and I am "anyone." "Anyone" might have been my father or mother, sister or brother, son or daughter. In that sense I take it personally and am not particularly in a forgiving mood. But Prager is right that the immediate families are the ones who are most directly involved, and the last thing they probably need to see in the midst of their grief is some over-tolerant do-gooder offering forgiveness while they are still reeling from the tragedy. Have Americans become so gutless that we just cannot stand to make even criminals accountable for their actions? [18% fewer Texans than five years ago support the death penalty.] Is "forgiveness" our way of tidying up unpleasant events so that we can put them out of our minds and get on to our next party? Is it selfishness that prompts us to forget victims? Prager's observations make a great deal of sense: And I am appalled and frightened by this feel-good doctrine of automatic forgiveness. This doctrine advances the amoral notion that no matter how much you hurt others, millions of your fellow-citizens will forgive you. If we are automatically forgiven no matter what we do, why repent (38)? Prager is Jewish, but he seems to possess a better comprehension of the New Testament than many so-called "Christians" have. The Basis for Forgiveness "Even by God," Prager writes, "forgiveness is contingent upon the sinner repenting. . ." (38). When King David, for example, sinned, it caused him great anguish and grief--because he had not repented of it. Psalm 51 shows the anguish of mind he endured while separated spiritually from God. Did God forgive him? Yes, WHEN he repented and confessed his sin. Christians are told to do the exact same thing under the new covenant. Simon was told to repent of the thought of his heart (Acts 8:22), and in 1 John the apostle reminds us all: "If we confess our sins, He is faithful and just to forgive us our sins, and to cleanse us from all unrighteousness" (1 John 1:9). Forgiveness is not automatically received from God. There must be genuine repentance, not merely the desire to escape the consequences of one's actions. God did not allow even David's sincere repentance to keep him from being punished. He suffered greatly for his choice to sin (2 Samuel 13-20). Nor can we forgive one another without evidence of sorrow and a change of behavior. In the illustration Jesus used of a brother sinning against a brother seven times in one day, he was to be forgiven WHEN he said, "I repent" (Luke 17:3-4; 3:7-9). Billy Graham's Eagerness Newspaper columnist Cal Thomas wrote an article about Billy Graham, which appeared in the Denton Record-Chronicle on March 13th. Thomas begins: Evangelist Billy Graham told "Today Show" viewers last week that he forgives President Clinton because "I know the frailty of human nature. . . . He has such a tremendous personality that I think the ladies just go wild over him" (10A). Thomas is very perceptive in asking, "So what exactly is Graham forgiving the President?" (10A). The President has denied all allegations of any wrongdoing. If he is innocent, he does not need forgiveness; if he is guilty, he would not only be guilty of sexual misconduct, but of lying about it to the American people, since he denied it emphatically just a few days ago. Judging from Graham's remark about human frailty, he must think the President is guilty. But why then is Graham in such a hurry to forgive him (if his assumptions are right)? When Nathan confronted David, the king did not say, "I never had a sexual relationship with that woman, Mrs. Uriah." Can anyone imagine God replying through Nathan, "I recognize that you are a frail human being, David, and I have put away your sin (even though you deny having committed it)"? There is a second problem with Graham's willingness to forgive; he actually seeks to excuse the President (apparently assuming he is guilty) by portraying him as a frail human being with a dynamic personality that women cannot help throwing themselves at. Even if such an opinion of the President's charm were true (and many women deny that it is so), how Biblical is it to excuse someone for sin? Neither Jesus nor the Father excused Judas' behavior as a matter of human frailty: "Poor Judas: he just can't turn down money." Paul did not write of the man living with his father's wife in Corinth: "He is such a dynamic personality that even married women go wild over him; he's just a frail human being; forgive him." Paul did ask them to forgive him WHEN he repented and quit participating in the sin (2 Cor. 2:6-11). Cal Thomas writes the truth when he says: "On a theological level, surely Graham knows that only God can forgive sins and that forgiveness does not precede acknowledgment of wrongdoing and repentance" (10A). How embarrassing for a newspaper columnist to have to teach the world's leading evangelist (by the world's standards, not God's) what the Bible teaches! Jesus' Forgiveness on the Cross A number of Scriptures could be examined to support Thomas' observation. Jesus said, "Except you repent, you shall all likewise perish" (Luke 13:3). Why? God does not forgive unless people are willing to acknowledge that their behavior is sinful and give up the sin. As long as a person or a nation persists in the sin, God will not forgive. Have we never learned the lesson of His allowing His own people to be taken into captivity? Does God's destroying the ungodly people of Noah's day with a flood fail to convince us that it is wrong to think that God will forgive us no matter what? Many seem to have forgotten (or perhaps never knew) that God is holy (1 Peter 1:15-16) and that sin separates mankind from Him (Isaiah 59:1-2). To cleanse us of our sins there are two essential ingredients: 1) the death of Jesus on the cross for our sins, and 2) our repentance of sin which prompts us to be buried with Christ in baptism to meet His blood and have our sins washed away (Rom. 6:3-5). Where does the Bible teach that God forgives in the absence of repentance? Someone might answer, "Luke 23:34," which records Jesus' first communication from the cross: "Father, forgive them, for they do not know what they do." However, there are three points about this plea which must not be overlooked. The first is that, since Jesus was the One Who had been wronged, He could legitimately ask forgiveness for His crucifiers. This situation differs greatly from the forgiveness offered to the murderer of the high school girls. A parallel to that would have been for the apostles to have tacked up a banner on the temple, saying, "We forgive you, Judas" or "We forgive you, Caiaphas." Jesus is the only One who could rightfully forgive, since the crime was against Him. The second point is to be made in the form of a question: "Whom was Jesus forgiving?" Was He forgiving the soldiers who were following orders? Was He forgiving those who had been duped into yelling, "Crucify Him, Crucify Him"? Or was He forgiving the Jewish leaders who (due to their intense hatred) had sought to kill Him on a number of occasions? Third, was this forgiveness automatic? Or did they first need to repent? The multitude had told Pilate, "His blood be upon us and our children" (Matt. 27:25). Historian Josephus describes how the Romans shed the blood of the Jews still remaining in Jerusalem. Apparently, tragically, they received what they asked for. On the other hand, there were many Jews who obeyed the gospel on the day of Pentecost; they were forgiven of their sins when they were baptized (Acts 2:38-41). Some had clamored for Jesus' death (Acts 2: 23,36). Their blood was not shed in the streets of Jerusalem in A.D. 70 because they had fled the city. The difference between those who repented and those who did not was the difference between those whose blood was shed and
[ 346, 1394, 2564, 604, 309, 32366, 562, 387, 634, 1684, 434, 1659, 323, 247, 1643, 1897, 865, 346, 17833, 449, 346, 8061, 449, 7998, 10560, 10690, 25419, 8951, 8100, 2637, 6844, 346, 3848, 56, 770, 4850, 562, 10873, 13, 8652, 449, 346, 42, 369, 4680, 5046, 309, 943, 2312, 281, 779, 449, 7998, 51, 2637, 2637, 6844, 346, 5622, 3903, 472, 13, 388, 4986, 504, 449, 346, 26123, 449, 7998, 51, 5529, 5993, 2637, 6844, 346, 6402, 2293, 10449, 5136, 346, 3074, 987, 13, 952, 13, 1339, 434, 755, 896, 281, 789, 1060, 449, 346, 6506, 13, 352, 434, 271, 27108, 449, 346, 42, 3735, 352, 449, 346, 7745, 13, 309, 1904, 626, 871, 368, 497, 247, 3817, 254, 449, 346, 37, 15242, 434, 3735, 273, 368, 285, 344, 31533, 368, 3297, 323, 8955, 449, 346, 42, 2183, 779, 359, 1313, 387, 326, 1445, 10738, 387, 20923, 12447, 434, 7225, 26729, 449, 346, 2598, 13, 604, 368, 452, 281, 8670, 11648, 323, 619, 355, 29294, 13, 320, 16105, 449, 346, 7817, 7519, 58, 5136, 346, 7883, 434, 436, 865, 346, 24774, 936, 449, 346, 510, 2929, 310, 253, 418, 15, 34, 15, 7717, 323, 4223, 337, 13, 33554, 449, 346, 24774, 936, 369, 9745, 275, 253, 2929, 672, 32398, 1119, 562, 344, 1160, 521, 806, 3041, 449, 346, 1328, 3078, 281, 10804, 4427, 253, 2774, 13, 594, 344, 5103, 779, 449, 346, 4943, 359, 564, 449, 346, 29859, 13, 10956, 13, 436, 310, 619, 3331, 13, 378, 12202, 449, 346, 35, 12202, 13, 436, 310, 619, 3101, 13, 9752, 8440, 8842, 23487, 418, 968, 22869, 449, 346, 7817, 7519, 58, 5136, 346, 29235, 281, 2525, 368, 449, 346, 46, 24259, 1843, 7570, 5136, 346, 3220, 3392, 13, 29544, 3592, 418, 968, 22869, 449, 346, 7817, 7519, 58, 5136, 346, 49, 282, 5849, 281, 2525, 368, 13, 8674, 449, 346, 1898, 619, 7586, 13, 26642, 3044, 1773, 6169, 418, 968, 22869, 449, 346, 7817, 7519, 58, 5136, 346, 12764, 449, 346, 52, 1403, 368, 3819, 353, 23863, 36126, 449, 346, 7536, 264, 253, 19110, 745, 779, 449, 346, 8195, 19669, 27301, 368, 1537, 452, 644, 449, 346, 7817, 7519, 58, 5136, 346, 8061, 449, 346, 5804, 309, 755, 368, 1633, 865, 346, 17833, 449, 346, 42, 1833, 755, 352, 13, 32398, 449, 346, 9281, 13, 31556, 449, 346, 46, 23863, 3534, 247, 1175, 921, 449, 346, 25713, 4592, 281, 779, 865, 346, 41, 2771, 249, 46539, 449, 346, 25643, 3076, 449, 346, 1328, 439, 3163, 521, 2021, 449, 346, 1898, 8288, 273, 5870, 937, 346, 38251, 8440, 13, 26642, 449, 346, 2773, 434, 776, 1682, 30484, 23642, 292, 13, 298, 1911, 466, 449, 346, 41793, 44431, 2296, 5322, 1841, 670, 368, 449, 346, 37, 15242, 13, 476, 359, 6008, 865, 346, 35, 12202, 285, 309, 971, 281, 5834, 247, 898, 27, 1229, 921, 449, 346, 4527, 2282, 13, 31556, 449, 346, 19224, 275, 13, 9931, 449, 346, 39430, 90, 19021, 35328, 49618, 952, 449, 346, 18853, 1137, 33698, 35328, 25273, 684, 449, 346, 42, 971, 281, 3812, 2305, 15, 35526, 30373, 85, 13, 32398, 449, 346, 1394, 1472, 275, 323, 247, 17877, 1113, 280, 39643, 13, 378, 12202, 449, 346, 46, 15242, 434, 619, 3965, 581, 13, 533, 26642, 434, 619, 18065, 21242, 449, 346, 1276, 2238, 273, 247, 1416, 310, 35526, 30373, 85, 865, 346, 45854, 865, 346, 22353, 449, 346, 34, 1270, 952, 13, 253, 20003, 449, 346, 32914, 2146, 369, 247, 2372, 13622, 449, 346, 1989, 1616, 619, 3000, 326, 36900, 359, 1833, 14938, 417, 14167, 5621, 342, 779, 281, 3819, 253, 48660, 449, 346, 1394, 871, 13, 309, 5339, 247, 2257, 273, 634, 2586, 3767, 1309, 253, 2137, 449, 346, 7710, 15, 35526, 30373, 85, 13, 452, 368, 1313, 11960, 936, 275, 253, 29329, 865, 346, 4374, 449, 346, 17534, 15958, 449, 346, 3172, 28723, 53, 5136, 346, 1145, 1711, 3331, 30040, 779, 449, 346, 1231, 497, 275, 253, 45690, 30068, 2366, 449, 346, 35848, 466, 308, 786, 257, 449, 346, 1328, 3078, 281, 789, 275, 253, 22336, 398, 449, 346, 3039, 858, 368, 2118, 1060, 865, 346, 39134, 449, 346, 41, 41265, 369, 247, 12120, 48554, 533, 253, 11561, 22336, 398, 497, 1766, 19275, 449, 346, 35848, 466, 1694, 789, 347, 247, 15632, 637, 13, 479, 3652, 9910, 449, 346, 35848, 466, 5611, 479, 281, 23302, 322, 2477, 3592, 449, 346, 42, 6518, 779, 1973, 326, 8039, 2199, 344, 369, 8133, 598, 21281, 326, 7122, 14, 1403, 1020, 861, 449, 346, 41, 41265, 1373, 449, 346, 42, 908, 281, 2389, 253, 10030, 10228, 611, 2695, 449, 346, 5072, 13, 1512, 449, 346, 20598, 23302, 3260, 849, 281, 29684, 247, 14838, 6079, 449, 346, 1328, 574, 42359, 46826, 272, 347, 5188, 43770, 285, 12008, 26620, 449, 346, 35848, 466, 285, 309, 908, 281, 4446, 731, 689, 281, 14759, 1373, 846, 1249, 3038, 327, 247, 11561, 22336, 254, 449, 346, 5872, 1691, 275, 1529, 2800, 3038, 407, 30162, 3243, 449, 346, 1328, 1014, 3534, 441, 6440, 20079, 247, 4564, 273, 2069, 449, 346, 3172, 28723, 53, 5136, 346, 29859, 449, 346, 6723, 368, 5471, 973, 865, 346, 17304, 368, 751, 281, 8162, 281, 253, 7827, 865, 346, 8917, 368, 871, 13, 2305, 15, 35526, 30373, 85, 13, 326, 9752, 8440, 38715, 310, 4907, 846, 479, 865, 346, 42, 1904, 626, 449, 346, 3039, 29544, 3592, 7028, 479, 13, 323, 619, 3392, 434, 2583, 937, 346, 248, 12316, 619, 2021, 326, 344, 651, 897, 521, 4833, 342, 253, 3228, 1503, 12777, 5986, 281, 452, 247, 6406, 4907, 846, 479, 449, 346, 1989, 512, 344, 812, 8722, 369, 247, 3846, 14, 423, 2972, 275, 247, 2502, 14, 3243, 3286, 3, 346, 249, 15915, 34841, 449, 346, 6723, 368, 7615, 342, 253, 9168, 13, 2305, 15, 35526, 30373, 85, 865, 346, 42, 8899, 598, 627, 449, 346, 4374, 13, 973, 13, 840, 368, 1833, 871, 326, 16234, 354, 44884, 3, 346, 911, 3014, 3746, 275, 8323, 449, 346, 42, 4089, 1142, 273, 731, 871, 2305, 15, 418, 968, 22869, 407, 1416, 449, 346, 2773, 434, 2217, 1476, 346, 42, 588, 1625, 323, 619, 33637, 672, 18308, 10427, 1406, 3249, 281, 8955, 13, 533, 417, 323, 23089, 44431, 434, 5086, 665, 373, 449, 346, 1328, 434, 247, 1846, 40677, 449, 346, 3220, 2656, 13, 29544, 3592, 1476, 346, 2347, 1652, 368, 1158, 273, 479, 449, 7998, 3886, 7273, 37, 2637, 6844, 346, 42, 1353, 7016, 449, 346, 42, 1353, 1663, 594, 7016, 449, 346, 7710, 15, 35526, 30373, 85, 449, 7998, 37, 11840, 378, 18004, 2637, 6844, 346, 7817, 7519, 58, 5136, 346, 1394, 4934, 634, 1416, 562, 273, 253, 9380, 449, 346, 24753, 253, 12142, 449, 346, 7093, 3101, 651, 2389, 326, 449, 346, 2993, 434, 247, 3802, 706, 449, 346, 510, 2238, 665, 3936, 28123, 253, 7345, 4245, 617, 594, 703, 2506, 626, 452, 281, 11476, 281, 1146, 247, 5184, 2522, 449, 346, 4045, 368, 971, 281, 871, 247, 4279, 865, 346, 17833, 449, 346, 37, 15242, 8686, 46301, 42859, 285, 1711, 6440, 5239, 432, 23302, 322, 2477, 3592, 285, 4270, 9910, 562, 273, 731, 449, 346, 2773, 434, 849, 344, 1663, 1160, 521, 2583, 449, 346, 1328, 434, 1694, 3289, 7604, 793, 512, 689, 418, 15, 34, 449, 346, 8389, 1175, 3331, 9309, 466, 13, 278, 1468, 264, 275, 247, 1113, 13035, 13, 1223, 3515, 32398, 690, 1486, 2287, 449, 346, 1898, 1024, 344, 12326, 779, 34890, 793, 13, 8909, 7375, 13, 43981, 32398, 434, 19272, 3607, 449, 346, 1394, 1053, 626, 452, 281, 2028, 479, 436, 449, 346, 42, 751, 368, 13, 378, 12202, 449, 346, 42, 1904, 626, 2028, 368, 512, 670, 33686, 449, 346, 1394, 1904, 626, 865, 346, 5498, 626, 320, 10279, 387, 479, 449, 346, 8693, 5768, 13, 309, 3735, 670, 247, 3226, 665, 3261, 751, 479, 449, 346, 42, 1694, 14338, 449, 346, 42, 1669, 7211, 387, 247, 4564, 273, 5053, 937, 4890, 7093, 1007, 14, 267, 2804, 5605, 281, 2525, 368, 937, 1841, 751, 326, 449, 346, 42, 1669, 619, 1180, 449, 346, 2993, 1925, 449, 346, 2773, 434, 849, 309, 1313, 617, 387, 3905, 10754, 570, 434, 342, 418, 46932, 449, 346, 1898, 326, 434, 512, 273, 352, 865, 346, 4374, 449, 346, 17570, 479, 1633, 449, 346, 4967, 1871, 368, 971, 281, 2525, 33686, 14196, 8791, 865, 346, 42, 1849, 4307, 1892, 281, 320, 13155, 3, 346, 2858, 253, 1039, 952, 2529, 33686, 352, 369, 751, 703, 369, 247, 3626, 449, 4890, 5498, 626, 2940, 562, 327, 479, 13, 7727, 449, 4890, 27128, 368, 1557, 449, 346, 27128, 326, 368, 3255, 3, 346, 15157, 15, 1163, 3, 346, 14866, 14196, 449, 346, 2512, 310, 247, 19309, 846, 346, 6672, 43196, 346, 6723, 368, 7615, 342, 253, 4383, 3448, 865, 346, 42, 1611, 281, 320, 449, 346, 9281, 449, 346, 1466, 434, 1611, 352, 969, 449, 346, 1898, 4456, 13, 564, 896, 281, 253, 5068, 13, 368, 1472, 38141, 779, 449, 346, 35, 909, 3390, 449, 346, 1328, 434, 7824, 562, 327, 368, 449, 346, 1394, 1472, 38141, 779, 449, 346, 2598, 13, 1705, 327, 13, 1339, 434, 513, 352, 449, 346, 1231, 1472, 3515, 562, 273, 3085, 1060, 449, 346, 1466, 434, 564, 449, 346, 23833, 13, 1053, 626, 2940, 562, 327, 479, 449, 346, 7845, 1333, 326, 368, 1557, 449, 346, 27128, 326, 368, 1158, 326, 309, 1353, 5389, 13, 285, 326, 368, 2389, 479, 449, 346, 14866, 14196, 13, 368, 871, 13, 436, 310, 247, 1077, 8872, 6200, 449, 346, 4045, 368, 1158, 368, 1472, 7032, 273, 4882, 31917, 865, 346, 17833, 449, 346, 42, 476, 513, 326, 449, 7998, 28893, 7519, 52, 26999, 8100, 2637, 6844, 7998, 37, 11840, 378, 18004, 2637, 6844, 346, 14866, 1476, 346, 15157, 5136, 346, 3633, 634, 3564, 745, 617, 1476, 346, 42, 1353, 271, 802, 1377, 532, 456, 5884, 285, 604, 368, 5181, 479, 1293, 247, 1111, 1406, 1246, 309, 1833, 25457, 368, 1476, 346, 15157, 5136, 346, 30359, 617, 3815, 449, 346, 2302, 1476, 346, 42, 1353, 247, 40677, 449, 346, 49, 3422, 11155, 449, 346, 1394, 285, 33686, 1160, 253, 20278, 16334, 2366, 13, 987, 865, 346, 8917, 368, 2455, 755, 667, 6440, 789, 865, 346, 2302, 449, 346, 4497, 13, 840, 13, 752, 670, 253, 3085, 476, 865, 346, 1147, 434, 247, 6440, 449, 346, 1276, 2238, 273, 6440, 865, 346, 19234, 8599, 479, 352, 434, 417, 5119, 473, 15, 16120, 91, 23237, 449, 346, 4125, 13, 368, 452, 281, 2028, 441, 253, 2644, 2181, 13, 49541, 13, 594, 1158, 352, 949, 449, 346, 42, 369, 18072, 3390, 387, 247, 2534, 275, 18733, 66, 449, 346, 1552, 637, 3053, 5015, 281, 479, 449, 346, 42, 1869, 309, 369, 12821, 285, 309, 369, 18439, 26395, 3076, 323, 2583, 449, 346, 1328, 753, 344, 1871, 1918, 479, 370, 1518, 281, 769, 275, 247, 34408, 466, 3085, 449, 346, 1328, 753, 344, 3058, 1529, 3226, 13, 594, 309, 1925, 33686, 449, 346, 1231, 1160, 3255, 346, 8398, 368, 449, 26133, 783, 6440, 387, 436, 1943, 2419, 247, 4564, 273, 3038, 3345, 3874, 449, 346, 5872, 344, 12668, 441, 896, 281, 418, 15, 34, 449, 346, 7161, 369, 436, 2419, 13, 4555, 865, 346, 42, 369, 3965, 562, 273, 352, 13, 604, 368, 871, 752, 309, 1599, 449, 7998, 46, 3016, 1864, 45516, 2637, 6844, 346, 1276, 513, 368, 1158, 13, 3734, 865, 346, 1552, 1694, 2712, 281, 513, 342, 253, 3226, 434, 7701, 865, 346, 12486, 5103, 13, 9060, 449, 346, 1276, 434, 326, 670, 13, 24173, 865, 346, 7093, 5006, 476, 626, 2186, 521, 1824, 865, 346, 42, 1694, 368, 411, 3298, 1103, 449, 346, 1394, 1472, 619, 1821, 285, 368, 1160, 479, 1007, 751, 247, 11213, 275, 2914, 273, 253, 954, 6422, 637, 275, 253, 7811, 449, 346, 1898, 368, 3255, 346, 6506, 13, 368, 449, 346, 7745, 387, 479, 449, 346, 5622, 3903, 472, 865, 346, 7745, 387, 479, 1476, 346, 2042, 368, 10345, 626, 2305, 15, 8726, 13, 368, 651, 320, 14116, 432, 7143, 2168, 449, 346, 1394, 1472, 247, 18750, 14, 5267, 3938, 13, 11974, 14, 484, 22161, 3255, 346, 28412, 562, 273, 436, 13, 35526, 30373, 85, 1476, 346, 1394, 1472, 896, 327, 411, 3298, 1103, 347, 273, 10873, 449, 346, 42, 971, 368, 281, 1304, 281, 479, 387, 470, 10695, 342, 247, 4857, 273, 32135, 323, 9060, 6115, 449, 346, 1394, 403, 247 ]
"You mind if I bunk out at your pop's place for a few days?" "Sure." "Thanks." "(TYPEWRITER CLACKING)" "DeWitt gets out tomorrow, Lee." "I was thinking maybe I should talk to him." "(RINGING)" "Blanchard, Homicide." "Lee." "(RUMBLING)" "MILLARD:" "All right, people, let's get back to work here." "Yeah, it's an earthquake." "I heard it." "Look, I didn't know you were a boxer." "Daddy's heard of you and he insists you stay for dinner." "I told him we met at that art exhibit at Stanley Rose's Book Shop." "So, if you have to pump everybody for my alibi, be subtle." "BUCKY:" "Who's this?" "Balto." "The paper is the L.A. Times for August 1, 1926." "Balto was bringing in the paper when Daddy found out he made his first million." "He wanted to consecrate the moment, so he shot him." "Here we go." "Mother, Father, this is my friend, Bucky." "Bucky, this is my mother, Ramona Cathcart Linscott." "BUCKY:" "Nice to meet you." "MADELEINE:" "My father, Emmett Linscott." "BUCKY:" "Pleasure to meet you, sir." "And my sister, Martha McConville Linscott." "BUCKY:" "Hi." "Saw you fight Mondo Sanchez." "Boxed the pants off him." "Another Billy Conn you might have been." "BUCKY:" "Thanks." "Can I get you something?" "Sure." "I'll get it, Daddy." "Okay, darling." "Mondo gave a good show." "Whatever happened to him?" "Heroin overdose." "Too bad." "He shamed his family." "And speaking of families," "Ramona, Martha." "That's our best Glenlivet, laddie." "Madeleine says nice things about you." "Daddy, can we eat?" "Bucky and I want to catch a 9:30 show." "Of course, darling." "Dig in, lad." "Hearty fare breeds hearty people." "Haute cuisine breeds degenerates." "I want to draw Mr. Bleichert, Daddy." "You're in for a cruel caricaturing, Bucky." "Maddy's my pretty one, but Martha's my certified genius." "What kind of a name is Bleichert?" "Dutch?" "German." "A great people, the Germans." "Hitler was a bit excessive." "But mark my words that someday we'll regret not joining forces with him to fight the Reds." "You know, I killed a lot of your countrymen during the war." "Mr. Bleichert, have you met Balto in the hallway?" "Yes." "Very realistic." "EMMETT:" "An old friend stuffed him." "We were in the Scots Regiment together." "Georgie Tilden." "He wanted to work in the flickers." "When did you move here?" "1920." "Hollywood was a cow pasture but the silent flickers were booming." "Georgie got work as a lighting man, me building houses." "Georgie introduced me to Mack Sennett." "I helped him build that housing project he was putting up underneath that god-awful sign." "Hollywoodland." "I used to love the Keystone Kops." "Me, too." "Old Mack knew how to squeeze a dollar dry." "He had extras moonlighting as laborers and vice versa." "Georgie and I used to drive them over to Hollywoodland after 12 hours on a silent flicker." "Then put in another six hours by torchlight." "He even gave us movie credits a couple of times." "EMMETT:" "Mother." "Are you feeling well?" "Would you like to contribute to the conversation?" "Did you know, Mr. Bleichert, that Ramona Boulevard is named after me?" "I didn't." "When Emmett married me, for my father's money," "he promised my family that he would use his influence with the City Zoning Board to have a street named after me." "But all he could manage was a dead-end block in a red-light district" "in Lincoln Heights." "Are you familiar with the neighborhood, Mr. Bleichert?" "I grew up there." "Yes, well, then you'll know that Mexican prostitutes" "expose themselves in windows." "I hear many of them know Mr. Linscott by name." "That's enough!" "I will sing for my supper when Mayor Bowron comes to dinner, but not for Madeleine's male whores." "He's a common policeman." "My God, Emmett!" "How little you think of me." "(THUDDING)" "I'm sorry." "I'm really so sorry." "Mr. Bleichert." "(DOG BARKING)" "BUCKY:" "You kept your name out of the papers." "Until the wedding." "Your mother would love that." "She's a snob." "The kind who takes pills the doctor gives her so she doesn't have to admit to being a hophead." "Do you want to know a secret?" "Sure." "Daddy bought rotten lumber and old movie sets from Mack Sennett and built houses out of them." "That's how he really made his money." "He's got firetraps all over L.A." "His good friend Georgie, maimed in a car crash, while running Daddy some errands." "And now he throws him scraps, odd jobs, tending Daddy's rental properties." "You don't have to tell me this." "I like you, Bucky." "I didn't tell you all about Betty." "You didn't?" "Don't be mad at me." "Last summer, I heard about a girl who looked like me." "I got curious." "I left notes at a couple of places," ""Your look-alike wants to meet you," things like that." "I left my number." "She called." "That's how I met her at LaVerne's with Lorna." "And that's all of it?" "Yes." "Tell me something." "Why'd you want to meet Betty Short anyway?" "I've worked hard to be loose" "but the way people described Betty it was like she was a natural." ""Don't walk out on me, Richard." ""Say you care." "Say that you..."" "MAN. :" "Miss Short." "There is a pause after "care"." "Are you familiar with the English language?" "I try to be." "Okay." "Let's try it again." "And remember, go back to the beginning, you're begging him." "Begging." "He's walking out on you." "You're begging him." "So, come on, let's do it." "We're running out of film here." "Let's go." "Richard, don't walk out on me." "Please say that you care." "Say that you think that I'm beautiful, and that you love me." "Miss Short, you know, this is a very sad scene." "Do you think you're capable of playing sadness?" "Sure." "I can do that." "(DUCKS QUACKING)" "(DOG BARKING)" "Miss!" "MAN:" "Get your hands off her!" "I'm an emancipated minor and if you touch me without a matron present I'll sue you!" "MAN:" "Leave her alone." "No!" "I'm a policeman." "Policeman." "You and Betty made the casting rounds together, right?" "Did you ever get any movie work?" "No." "Well, then, what about the film can?" "It's a movie." "What kind of movie?" "Something tells me it's not David O. Selznick." "Now, you have to tell us the whole thing, sweetheart, so think it through." "I was cadging at a bar in Gardena." "This man started talking to me." "I thought I was pregnant and I was desperate wicked bad for money." "He said he'd give me $200 to act in a nudie film." "He said he needed another girl, so I called Betty." "We made..." "Thank you." "...the movie at this big house a couple of hours outside town." "Then he drove us back to L.A." "Where was this house, exactly?" "I was pretty out of it, if you know what I mean." "(MUSIC PLAYING)" "What do you think, Russ?" "This got anything to do with the girl's murder?" "Long shot, Chief." "What's that about, gentlemen?" "Your boy can't hold his water?" "I got you Warrants." "You're my men and you made me look like a fool in front of the most powerful man in the department." "And you..." "Yeah, you." "Look at me." "Blanchard?" "Look at me!" "If you weren't Mr. Fire, you would be suspended from duty already." "You're a punch-drunk, washed-up fighter..." "Stay out of this, Bleichert!" "You're back on Warrants as of tomorrow." "I want you to report to me at 0800 with a letter of apology for Chief Green." "You are a
[ 16730, 387, 495, 268, 15, 78, 15, 7948, 13, 4416, 15, 721, 275, 38308, 19121, 2596, 273, 253, 9069, 1940, 2208, 4055, 15, 1707, 588, 320, 247, 4864, 16112, 1563, 253, 16730, 15, 1876, 403, 12470, 281, 8041, 390, 3698, 253, 10675, 327, 253, 9069, 1940, 4422, 15, 187, 187, 39265, 531, 13, 247, 418, 770, 10747, 14544, 13, 369, 11162, 281, 8171, 5037, 11957, 1321, 347, 28845, 323, 4412, 495, 846, 344, 25036, 4321, 436, 1770, 15, 1500, 588, 5752, 1919, 253, 4596, 6132, 15, 187, 187, 3039, 247, 3874, 342, 247, 1824, 8891, 16382, 24846, 13, 28969, 1204, 13, 48356, 285, 10459, 19412, 266, 5585, 13, 352, 7637, 598, 342, 952, 4704, 281, 36733, 984, 597, 1053, 457, 85, 452, 2217, 2583, 281, 759, 70, 15, 187, 2374, 3344, 15, 655, 13, 380, 12683, 489, 19670, 2434, 15, 5485, 773, 29796, 7795, 628, 27, 380, 4878, 474, 1806, 247, 2206, 45756, 17325, 326, 3637, 15520, 7795, 628, 13, 247, 3874, 326, 556, 46084, 264, 253, 897, 273, 3055, 18016, 1641, 275, 271, 3177, 281, 14368, 1824, 8353, 15, 380, 7815, 273, 15520, 7795, 628, 1364, 897, 247, 1345, 2075, 14, 468, 14, 2327, 985, 9633, 407, 530, 7920, 7088, 6487, 15, 187, 187, 510, 655, 14, 2913, 14, 744, 10145, 273, 15632, 8370, 36555, 326, 3053, 253, 3729, 14307, 16611, 8726, 23383, 8106, 3344, 15, 1668, 281, 581, 966, 14, 23, 17974, 1385, 273, 14954, 18557, 390, 9791, 26286, 13, 2556, 281, 253, 19759, 3928, 4412, 10158, 457, 84, 7454, 15, 187, 187, 30769, 1284, 7232, 273, 1716, 9393, 369, 6636, 275, 3563, 4162, 342, 767, 966, 14, 21, 11664, 19844, 273, 1273, 14, 14577, 549, 1665, 275, 4602, 342, 15632, 44161, 1223, 19759, 3928, 369, 275, 247, 3924, 14, 19, 3289, 8913, 15, 14214, 1712, 84, 18, 94, 187, 7770, 187, 187, 11, 998, 257, 302, 3838, 31911, 33673, 43639, 11, 310, 247, 22197, 14, 12373, 3791, 2531, 20192, 275, 32943, 390, 25047, 1363, 1008, 2041, 15, 520, 2904, 24264, 14, 22708, 1342, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 19968, 3136, 18, 1570, 1723, 13, 253, 2554, 273, 436, 3791, 2531, 20192, 347, 271, 15377, 407, 1676, 254, 390, 47113, 5570, 2223, 4558, 12744, 1008, 2041, 15, 520, 2904, 24264, 14, 40, 1730, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 40016, 4066, 74, 18, 62, 285, 1652, 310, 1929, 670, 697, 31402, 2616, 1008, 2041, 15, 520, 2904, 24264, 14, 615, 48, 22621, 8432, 40, 20966, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 1470, 489, 1817, 80, 18, 1570, 187, 187, 23270, 46758, 13, 46796, 587, 18872, 10741, 7888, 30259, 42545, 10179, 27638, 281, 23945, 7006, 285, 25306, 5747, 12321, 3167, 25774, 13, 403, 9592, 7478, 347, 247, 15979, 2803, 281, 2728, 19556, 275, 253, 11900, 10649, 6578, 2330, 342, 6722, 10741, 10332, 1008, 2041, 15, 520, 2904, 24264, 14, 35, 75, 1596, 1200, 7391, 18, 1570, 475, 52, 15, 33673, 43639, 11, 14470, 403, 1929, 281, 452, 253, 3745, 281, 830, 9015, 46758, 327, 1097, 490, 12381, 9421, 1008, 2041, 15, 520, 2904, 24264, 14, 12558, 27157, 580, 290, 5650, 18, 7254, 2041, 15, 520, 2904, 24264, 14, 49, 23242, 33364, 18, 1092, 285, 352, 310, 271, 15276, 3064, 275, 33112, 4702, 2190, 3382, 14470, 273, 475, 52, 15, 33673, 43639, 4556, 187, 187, 510, 5787, 6297, 6944, 33112, 4702, 275, 475, 52, 15, 33673, 43639, 11, 452, 417, 644, 18171, 5421, 15, 17746, 13, 15396, 323, 475, 1109, 77, 34, 11, 3320, 285, 475, 83, 18569, 39, 11, 3320, 403, 2361, 281, 6379, 33112, 4702, 1008, 2041, 15, 520, 2904, 24264, 14, 39, 276, 1994, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 28777, 606, 18, 1570, 3840, 13, 253, 475, 1033, 72, 46, 11, 3320, 13, 9706, 247, 25171, 47855, 9548, 342, 1097, 5124, 462, 7675, 681, 307, 511, 313, 11070, 46, 10, 285, 5124, 297, 1136, 297, 307, 511, 4712, 13, 812, 320, 3206, 275, 33112, 14, 14692, 3745, 984, 273, 253, 23117, 342, 253, 475, 13256, 36, 11, 3320, 326, 310, 5506, 323, 253, 3275, 273, 247, 367, 14633, 2330, 342, 18945, 285, 20320, 4024, 26132, 275, 475, 49, 15, 38143, 11, 1008, 2041, 15, 520, 2904, 24264, 14, 11773, 46845, 18, 1570, 187, 187, 6436, 13, 352, 310, 1335, 12744, 326, 534, 3320, 10577, 1543, 275, 253, 1818, 273, 33112, 4702, 2190, 253, 1264, 3608, 13, 285, 534, 2234, 8898, 3527, 10577, 14802, 253, 1159, 2544, 273, 253, 2601, 15, 187, 187, 688, 436, 1263, 13, 359, 6730, 247, 873, 273, 2164, 3382, 14470, 273, 475, 52, 15, 33673, 43639, 11, 323, 33112, 4702, 13795, 275, 1340, 281, 1089, 1534, 3910, 13, 285, 6760, 253, 2954, 875, 33112, 3275, 285, 253, 5481, 273, 475, 1109, 77, 34, 2992, 475, 1033, 72, 46, 2992, 285, 475, 83, 18569, 39, 11, 3608, 15, 187, 187, 22025, 285, 13277, 1712, 84, 19, 94, 187, 18613, 187, 187, 39671, 21978, 1712, 84, 19, 66, 94, 187, 573, 187, 187, 1552, 1263, 7241, 369, 7012, 407, 253, 21482, 7039, 273, 380, 3973, 9767, 31689, 8896, 273, 37830, 40305, 8710, 2499, 15, 1876, 5705, 6704, 3542, 8191, 7578, 2720, 281, 253, 1263, 15, 23410, 1491, 369, 26314, 1025, 285, 372, 14, 24491, 2720, 281, 1783, 15, 187, 187, 35, 24097, 14470, 285, 3116, 2515, 1712, 84, 19, 67, 94, 187, 36960, 187, 187, 22641, 13, 5345, 475, 52, 15, 33673, 43639, 11, 14470, 285, 475, 52, 15, 33673, 43639, 11, 48745, 15220, 1787, 497, 6949, 15, 1876, 253, 8709, 5728, 432, 253, 653, 20938, 273, 1363, 16362, 253, 37830, 40305, 32097, 273, 11900, 6578, 432, 4267, 281, 4332, 15, 9658, 253, 5345, 14470, 13, 577, 22453, 8709, 7011, 432, 253, 1072, 3110, 689, 247, 2180, 273, 374, 1107, 285, 495, 22453, 8709, 7011, 432, 1529, 3110, 689, 247, 2180, 273, 337, 807, 497, 6949, 15, 380, 14470, 497, 3636, 347, 475, 52, 15, 33673, 43639, 11, 407, 19183, 5216, 970, 11595, 313, 11252, 1384, 14, 6603, 4155, 28, 16181, 46, 32278, 2310, 13, 2398, 951, 14, 45, 4479, 38, 936, 587, 13, 6181, 10, 390, 16644, 313, 55, 614, 76, 28, 16181, 46, 32278, 2310, 10, 2718, 13, 840, 7141, 387, 4150, 1438, 3272, 36, 1919, 897, 672, 597, 497, 8228, 387, 5345, 3272, 36, 275, 26596, 14, 41, 8185, 21703, 313, 46, 10114, 28, 10559, 1238, 10, 10855, 15, 187, 187, 7475, 1999, 2905, 1255, 407, 22919, 7538, 285, 7368, 1783, 1712, 84, 19, 68, 94, 187, 6154, 187, 187, 49, 7228, 264, 14, 3423, 9480, 27273, 313, 14981, 7538, 10, 1783, 273, 475, 57, 5830, 11, 42, 14, 11174, 7250, 14421, 3882, 369, 2684, 281, 3653, 253, 6380, 2905, 1255, 273, 475, 52, 15, 33673, 43639, 11, 14470, 970, 247, 44104, 39, 14, 37479, 1594, 34, 4155, 313, 23270, 14, 13021, 31497, 13, 48816, 13, 6582, 13, 5106, 10, 347, 2529, 407, 1023, 338, 797, 1008, 2041, 15, 520, 2904, 24264, 14, 3251, 338, 797, 18, 1570, 380, 29375, 6866, 497, 2529, 407, 13728, 1189, 1008, 2041, 15, 520, 2904, 24264, 14, 27788, 1189, 18, 62, 16248, 530, 11070, 3788, 313, 328, 24676, 4667, 1387, 1332, 342, 20258, 280, 31218, 10, 1332, 13, 1680, 311, 684, 497, 7922, 253, 1072, 4734, 1178, 1692, 604, 253, 1318, 273, 399, 547, 10235, 273, 14259, 369, 8994, 1438, 6, 1008, 2041, 15, 520, 2904, 24264, 14, 2809, 74, 18, 1570, 187, 187, 23270, 18405, 4702, 6981, 1712, 84, 19, 69, 94, 187, 25916, 187, 187, 5279, 6170, 11048, 275, 308, 15803, 497, 15045, 342, 5352, 308, 15803, 281, 271, 26514, 28321, 273, 337, 15, 361, 313, 47771, 281, 670, 337, 6027, 740, 63, 26, 63, 46828, 16, 1686, 481, 5761, 14, 39179, 48661, 262, 398, 273, 337, 45152, 2313, 21042, 19081, 15508, 497, 7644, 8821, 281, 1016, 973, 273, 247, 25850, 6507, 10492, 3488, 25871, 9457, 4408, 4466, 9161, 14, 4714, 84, 2494, 85, 2562, 285, 10729, 387, 5345, 3272, 36, 323, 2164, 288, 15, 16181, 18405, 23742, 369, 840, 4080, 407, 9266, 43597, 6981, 15, 25487, 13, 33112, 3530, 497, 4229, 323, 337, 288, 387, 3925, 3272, 36, 13, 13968, 323, 608, 1054, 387, 9233, 342, 1052, 42213, 388, 18141, 14, 25016, 9266, 43597, 13, 840, 41502, 275, 6306, 1824, 285, 4136, 281, 6079, 15, 16181, 18405, 3530, 497, 13968, 342, 10257, 42213, 273, 5922, 6, 1289, 19601, 44963, 3527, 323, 1458, 1054, 13, 285, 253, 5748, 4038, 387, 45223, 9153, 313, 3519, 33964, 10, 369, 1239, 15, 24258, 247, 1698, 2624, 14, 2727, 313, 3519, 68, 10, 6607, 407, 495, 6027, 3871, 1840, 253, 1599, 26514, 273, 1453, 21443, 13, 8709, 497, 10509, 715, 253, 1563, 9050, 27, 642, 33112, 14281, 313, 3519, 24832, 3519, 68, 582, 5075, 33112, 14281, 313, 3519, 68, 4713, 3519, 24832, 19, 6027, 3519, 68, 582, 10290, 33112, 14281, 313, 19, 6027, 3519, 68, 4713, 3519, 24832, 21, 6027, 3519, 68, 582, 285, 2266, 33112, 14281, 313, 21, 6027, 3519, 68, 4713, 3519, 10, 1008, 2041, 15, 520, 2904, 24264, 14, 6812, 4029, 39594, 18, 1570, 187, 187, 510, 33112, 2494, 18317, 369, 5189, 407, 18555, 285, 8951, 6955, 15, 18555, 6260, 497, 4824, 562, 342, 475, 52, 15, 33673, 43639, 11, 7372, 322, 805, 746, 285, 48745, 15220, 1787, 13, 4236, 984, 322, 805, 746, 369, 253, 4585, 14281, 273, 1499, 553, 2190, 2164, 8709, 2783, 15, 16181, 46758, 497, 4136, 281, 1756, 327, 3835, 15813, 13, 285, 4229, 342, 374, 15, 22, 6, 13627, 274, 38869, 323, 387, 1878, 3387, 1054, 15, 2732, 1146, 11974, 342, 13626, 13, 253, 3530, 497, 840, 44317, 456, 275, 247, 2962, 273, 17515, 16075, 5482, 313, 1235, 281, 2233, 10970, 380, 13751, 497, 10877, 327, 17454, 19542, 84, 342, 19604, 6315, 19165, 13, 4136, 281, 6079, 323, 495, 288, 13, 285, 840, 19185, 342, 1458, 14, 10602, 18940, 3085, 342, 271, 21703, 12077, 653, 12216, 820, 727, 15, 2732, 5162, 13, 3530, 497, 2540, 342, 247, 26999, 5656, 34, 1052, 13733, 6488, 17199, 275, 253, 1029, 14, 28902, 8343, 4438, 387, 1458, 465, 55, 15, 187, 187, 3207, 6955, 369, 2684, 347, 591, 3391, 1304, 1008, 2041, 15, 520, 2904, 24264, 14, 49, 23242, 33364, 19, 1570, 25487, 13, 16181, 18405, 3530, 497, 4229, 275, 374, 15, 22, 6, 13627, 274, 38869, 13, 285, 13968, 342, 16674, 36, 313, 8501, 2324, 43959, 310, 837, 74, 49581, 481, 8951, 6955, 1783, 369, 2684, 342, 271, 418, 6955, 33930, 33819, 34, 8166, 13733, 17199, 7660, 281, 271, 329, 2981, 37200, 3719, 17199, 15, 380, 16820, 25738, 497, 42700, 905, 11141, 251, 8166, 5290, 285, 43732, 9153, 905, 1328, 14, 6560, 8166, 5290, 285, 8295, 25738, 497, 29364, 9153, 323, 16674, 36, 13, 2975, 15, 3315, 394, 6341, 497, 2668, 387, 3963, 11508, 2439, 253, 4871, 273, 253, 2813, 15, 1916, 3653, 253, 2605, 273, 253, 9015, 46758, 13, 247, 2962, 273, 11593, 313, 89, 14, 90, 10, 5748, 7118, 497, 2668, 4768, 253, 2120, 2978, 273, 253, 33112, 15, 11204, 3100, 3888, 273, 4759, 313, 39, 43414, 10, 11348, 497, 20913, 970, 247, 3540, 4438, 15, 187, 187, 9343, 14, 3169, 41234, 323, 475, 1109, 77, 34, 2992, 475, 1033, 72, 46, 2992, 285, 475, 83, 18569, 39, 11, 1712, 84, 19, 70, 94, 187, 47584, 187, 187, 35, 24097, 3882, 369, 10375, 285, 15134, 13, 840, 20068, 285, 27130, 327, 374, 6, 39086, 9480, 15, 8477, 17678, 497, 2975, 608, 6097, 330, 6435, 7246, 7258, 2696, 34, 1934, 1194, 10206, 495, 6097, 285, 608, 6097, 15679, 2446, 39017, 6435, 4490, 53, 4280, 1194, 4280, 39017, 495, 6097, 313, 805, 1423, 20633, 10, 323, 475, 1109, 77, 34, 2992, 608, 6097, 4915, 15804, 6435, 44512, 7258, 31275, 38231, 495, 6097, 285, 608, 6097, 29782, 1647, 7258, 1194, 9334, 6435, 1194, 46871, 9334, 495, 6097, 313, 1630, 1235, 20633, 10, 323, 475, 1033, 72, 46, 11, 285, 13, 4720, 13, 608, 6097, 48187, 38231, 49553, 1934, 2696, 6435, 40, 15804, 495, 6097, 285, 608, 6097, 443, 7258, 2696, 7283, 1194, 7258, 31275, 6435, 495, 6097, 313, 883, 1449, 20633, 10, 323, 475, 83, 18569, 39, 4556, 1876, 8477, 84, 3580, 497, 27867, 285, 45523, 275, 16315, 8417, 1703, 15, 5488, 13, 253, 1264, 3320, 2048, 369, 2684, 342, 38898, 7045, 511, 8477, 2556, 281, 591, 3391, 1304, 1008, 2041, 15, 520, 2904, 24264, 14, 49, 23242, 33364 ]
ceremony at 3 p.m. Tuesday, Feb. 6 in Hearing Room One of the Jeffco government center. There will be a brief reception following the ceremony. All are invited to attend or watch the broadcast on the Jeffco website. Francone, a Littleton resident, was appointed to replace Don Rosier as commissioner for District 3 after he resigned earlier this month. She will serve until the November election. When a town with a water crisis meets capitalism, populism, bureaucracy and corporate mismanagement, it ends up with people ready to revolt because they don’t have enough money to pee. On Jan. 19, The Venue Theatre Co. opened “Urinetown: The Musical,” a satirical comedy that follows Urinetown, a town that has outlawed the use of private toilets in an attempt to regulate water consumption. The citizens of Urinetown must use a public pay-per-use system owned by Urine Good Company. The 19-year-old accused of lighting Roman candles that started the North Turkey Creek Fire pleaded guilty Jan. 16 to one class-6 felony count of firing woods or prairies, according to the Jefferson County District Attorney’s Office. Andrew Askins of Conifer was charged in late April with two class-4 felonies of second-degree arson in connection with lighting fireworks while Jefferson County was in a stage-2 fire ban.Introduction {#s1} ============ *Stenotrophomonas maltophilia* is a Gram-negative opportunistic pathogen in hospitalized or compromised patients [@pone.0108409-Crossman1], [@pone.0108409-Brooke1]. However, the role of this opportunistic pathogen as an innocent bystander or causative agent often remains unclear [@pone.0108409-Goss1], [@pone.0108409-Karpati1] and little is known about its virulence factors [@pone.0108409-deOliveiraGarcia1], [@pone.0108409-Figueirdo1]. Biofilms, sessile structured bacterial communities exhibiting recalcitrance to antimicrobial compounds and persistence despite sustained host defenses, are increasingly recognized as a contributing factor to disease pathogenesis in the respiratory tract diseases associated with chronic bacterial infections [@pone.0108409-Bjarnsholt1]. *S. maltophilia* isolates are known to have the ability to form biofilms on both abiotic surfaces [@pone.0108409-DiBonaventura1]--[@pone.0108409-Pompilio1], and it is an intrinsic difference in biofilm formation among clinical isolates of *S. maltophilia*. The molecular mechanisms underlying biofilm formation in *S. maltophilia* have not been extensively studied. Recently, mutants for *rmlA* gene and *rpfF* gene are reported to decrease biofilm formation [@pone.0108409-Fouhy1], [@pone.0108409-Huang1]. Further, the *spgM* gene, encoding a bifunctional enzyme with both phosphoglucomutase (PGM) and phosphomannomutase activities, could be involved in biofilm-forming ability because of the homology with the *algC* gene that is responsible for the production of a PGM associated with LPS and alginate biosynthesis in *P. aeruginosa* [@pone.0108409-McKay1]. However, it is still unclear that which gene mutation results in the change of biofilm formation among the three genes, and which key amino acid mutation determines the function changes of the protein. In this study, we examined a set of 24 clinical isolates of *S. maltophilia* for biofilm formation traits in order to find significant differences, and evaluated the relationship between biofilm production and the detection of *rmlA*, *spgM*, and *rpfF* genes. Materials and Methods {#s2} ===================== Ethics Statement {#s2a} ---------------- This study protocol was approved by the Ethics Committee of The First Affiliated Hospital of Guangzhou Medical University. All subjects signed written informed consent prior to the study. Patient information was anonymized and de-identified prior to analysis. Bacterial isolates and growth conditions {#s2b} ---------------------------------------- Overall, 37 *S. maltophilia* isolates and *S. maltophilia* ATCC13637 were investigated. All the strains collected from the sputa of patients attending the Guangzhou institute of respiratory diseases from 2010 to 2011. Among the 37 isolates, 4 sequential strains isolated from the same patient over a period of 2 years and 3 sequential strains isolated from another patient over a period of 1 year were investigated. The isolates were identified as *S. maltophilia* by biochemical tests using manual (API 20-NE System; BioMérieux, Marcy-L\'Etoile, France) or automated (Vitek; BioMérieux) systems, then stored at −80°C until use when they were grown at 37°C in Mueller-Hinton agar (MHA; Oxoid) plates. Genetic relatedness by PFGE and cluster analysis {#s2c} ------------------------------------------------ Pulsed-field gel electrophoresis (PFGE) analysis of *Xba*I-digested genomic DNA was performed to determine the genetic relatedness of *S. maltophilia* isolates using a CHEF-Mapper XA System (Bio-Rad Laboratories, Hercules, CA, USA) as described by Seifert [@pone.0108409-Seifert1]. The interpreting criteria were described by Tenover [@pone.0108409-Tenover1] combining UPGMA (unweighted pair group method with hierarchic averages) method, Isolates were assigned the same pulsetype if the value of Dice coefficient of similarity was \>80% [@pone.0108409-Shi1]. Biofilm formation assay {#s2d} ----------------------- Overnight cultures in TSB were corrected with fresh TSB to an OD550 of 1.00 (corresponding to about 1×10^9^ CFU/ml). Two-hundred microliters of 1∶100 diluted inoculum were dispensed to each well of a sterile flatbottom polystyrene tissue culture 96-wells microtiter and incubated at 37°C for 24 h. Biofilm biomass was then measured by crystal violet assay. Briefly, biofilm samples were fixed for 1 h at 60°C, stained for 5 min at RT with 200 µl Hucker-modified crystal violet, then rinsed in standing water and allowed to dry. Biofilm samples were stained with 250 µl of 33% glacial acetic acid for 15 min, and the optical density at 492 nm (OD492) was read. Considering a low cut-off (ODc) represented by 3×SD above the mean OD of control wells, strains were classified into the following categories: no biofilm producer (OD≤ODc), weak biofilm producer (ODc\<OD≤2×ODc), moderate biofilm producer (2×ODc\<OD≤4×ODc), and strong biofilm producer (4×ODc\<OD) [@pone.0108409-Stepanovi1]. The biofilm microstructure was detected by SEM and CLSM. SEM analyses were carried out with *S. maltophilia* strain S1219 and ATCC13637, selected because S1219 was the highest producer of slime among 24 strains considered. Biofilms were allowed to grow on cover slip, and fixed with 2.5% glutaraldehyde for at least 40 min. After being washed with PBS, the samples were then dehydrated in a series of aqueous ethanol solutions (50 to 100%). The specimens were mounted on aluminum stubs with conductive carbon cement, allowed to dry for 3 h, and then coated with 15-nm Au film with an agar automatic sputter coater. After processing, samples were observed with a QUANTA 200 scanning electron microscope in the high-vacuum mode at 15 kV. CLSM was performed as pervious report [@pone.0108409-Pompilio2]. Briefly, Biofilm samples were fixed in 2.5% glutaraldehyde, and stained with FITC (fluorescein isothiocyanate). CLSM analysis was performed with an LSM 510 META laser scanning microscope attached to an Axioplan II microscope. The excitation wavelengths were 458 \[Argon laser\], and 543 nm \[He-Ne laser\], and emission wavelengths were 488 nm for FITC, respectively. Depth measurements were taken at regular intervals across the width of the device. To determine the structure of the biofilms, a series of horizontal (x-y) optical sections were taken throughout the full length of the biofilm. Confocal images of green (FITC) fluorescence were conceived using a track mode. PCR-based genotyping for *rmlA*, *spgM*, and *rpfF* {#s2e} --------------------------------------------------- Bacterial DNA was extracted and purified, then amplified and visualized on 2% agarose gel. PCR primers were respectively 5′ CGGAAAAGCAGAACATCG 3′ and 5′ GCAACTTGGTTTCAATCACTT 3′ (1222 bp) for *rmlA*, 5′ ATACCGGGGTGCGTTGAC 3′ and 5′ CATCTGCATGTGGATCTCGT 3′ (2750 bp) for *spgM* and, finally, 5′ CACGACAGTACAGGGGACC 3′ and 5′ GGCAGGAATGCGTTGG 3′ (1140 bp) for *rpfF*. All PCRs products were sequenced and BLAST in PUBMED. Furthermore, the three gene expression was performed with Reverse transcriptase PCR according to pervious report [@pone.0108409-Pompilio
[ 1010, 1084, 7693, 1678, 25140, 14, 2383, 14, 22140, 910, 709, 14, 881, 568, 709, 986, 285, 253, 1986, 11491, 6061, 3250, 783, 3250, 27077, 1114, 2047, 323, 10465, 4988, 34731, 25153, 247, 7887, 273, 495, 281, 608, 14986, 347, 253, 8723, 4719, 323, 8332, 273, 28728, 571, 4681, 1036, 1084, 7693, 1678, 25140, 14, 2383, 14, 29407, 910, 709, 14, 881, 568, 709, 986, 3856, 13, 436, 7887, 369, 6777, 347, 247, 1127, 273, 5301, 323, 253, 12938, 3607, 273, 253, 747, 15895, 15, 187, 187, 47789, 15128, 6973, 2908, 253, 2170, 762, 253, 6532, 4719, 283, 2606, 6970, 432, 5058, 281, 721, 3038, 313, 42080, 95, 17, 283, 23, 13611, 285, 5058, 281, 1249, 3038, 313, 42080, 95, 17, 283, 805, 28004, 30728, 432, 673, 5058, 281, 253, 1390, 673, 387, 534, 10465, 4988, 34731, 6376, 21759, 313, 42080, 95, 17, 283, 85, 28004, 285, 30728, 432, 673, 5058, 26480, 35631, 281, 23579, 313, 42080, 95, 17, 283, 2050, 28004, 4869, 6532, 4719, 313, 36, 95, 4090, 28004, 20408, 2281, 313, 44, 95, 293, 28004, 673, 281, 330, 95, 4090, 95, 313, 53, 95, 4090, 28004, 285, 2716, 3250, 8206, 273, 20408, 313, 85, 95, 18, 16, 19, 48307, 187, 187, 4118, 18731, 1712, 7693, 1678, 25140, 14, 1704, 14, 42834, 94, 187, 187, 52, 33816, 285, 8150, 1430, 273, 253, 1263, 9694, 497, 7515, 407, 9610, 273, 1971, 3250, 37114, 290, 10021, 3394, 313, 5428, 12648, 84, 10, 285, 4092, 10021, 3394, 313, 4576, 15168, 10, 432, 253, 1265, 273, 253, 806, 1971, 1919, 1501, 21272, 1388, 1638, 15, 6943, 18334, 9965, 5175, 13, 1690, 6728, 1159, 5175, 13, 369, 2684, 387, 9273, 285, 327, 1897, 495, 13, 721, 13, 898, 13, 285, 1638, 28, 253, 6803, 327, 1388, 495, 5866, 1501, 19572, 15, 388, 14359, 1497, 5175, 369, 2684, 387, 9273, 285, 327, 1388, 1638, 13, 285, 2936, 989, 1493, 285, 2177, 27044, 5175, 497, 2684, 387, 9273, 760, 15, 187, 187, 21214, 13277, 1712, 7693, 1678, 25140, 14, 1704, 14, 44135, 94, 187, 23796, 187, 187, 53, 95, 36, 21511, 21, 21516, 16, 8316, 95, 369, 5867, 1327, 3575, 11656, 1037, 970, 253, 48824, 6704, 5958, 1071, 1754, 327, 253, 8876, 273, 3910, 875, 9694, 2439, 5705, 285, 247, 8453, 1268, 273, 608, 6, 2796, 49, 11, 426, 964, 1762, 481, 15128, 6973, 30728, 95, 17, 283, 805, 9854, 30728, 95, 17, 283, 85, 9854, 285, 30728, 95, 17, 283, 2050, 95, 497, 2412, 3250, 45088, 313, 19293, 2412, 10, 285, 5867, 1754, 327, 247, 4872, 6804, 1566, 970, 24603, 45126, 273, 33918, 313, 52, 1719, 2715, 898, 15, 19, 28, 33918, 6516, 13, 50227, 13, 3729, 9756, 481, 17012, 285, 2180, 497, 2908, 275, 253, 1566, 347, 4229, 2538, 13, 342, 5705, 2908, 347, 247, 3632, 1055, 15, 380, 12541, 11041, 432, 253, 1566, 369, 908, 281, 3989, 5091, 6, 7162, 11508, 313, 36, 2513, 10, 323, 1878, 3250, 23600, 4420, 313, 7858, 10, 1599, 3910, 875, 9694, 15, 2053, 3910, 497, 840, 896, 3250, 45088, 281, 4044, 1127, 8197, 313, 9296, 3783, 10, 273, 17856, 2097, 285, 3969, 5091, 6, 36, 2513, 15, 1876, 15128, 6973, 497, 17903, 407, 27389, 9990, 15, 187, 187, 9340, 1712, 7693, 1678, 25140, 14, 1704, 14, 49455, 94, 187, 6877, 187, 187, 24053, 37235, 1712, 7693, 1678, 25140, 14, 1704, 14, 28949, 94, 187, 10521, 187, 187, 4527, 7652, 5705, 22546, 13, 1638, 497, 14871, 28, 512, 1638, 6312, 253, 1263, 285, 497, 2908, 275, 253, 15128, 285, 5252, 6260, 313, 2841, 544, 18, 1084, 7693, 1678, 25140, 14, 926, 14, 5831, 910, 709, 14, 881, 568, 926, 2536, 380, 5020, 273, 5014, 313, 3677, 2673, 497, 5343, 13, 2716, 497, 3168, 13, 285, 597, 17751, 275, 2363, 432, 655, 281, 7127, 1107, 313, 3235, 544, 18, 1084, 7693, 1678, 25140, 14, 12749, 14, 5831, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 5146, 2490, 187, 13641, 5576, 38626, 273, 253, 12602, 30657, 535, 50276, 13641, 24959, 50255, 36888, 313, 47, 426, 1638, 10, 187, 50276, 33250, 28527, 187, 50276, 51, 584, 13, 295, 11767, 50254, 187, 50276, 17185, 50254, 50272, 24, 313, 1235, 15, 17, 10, 187, 50276, 15383, 16, 42817, 2448, 50265, 20, 313, 1797, 15, 21, 10, 187, 50276, 47548, 50254, 50272, 18, 313, 24, 15, 18, 10, 187, 50276, 21408, 43326, 16, 34114, 8451, 254, 50275, 18, 313, 24, 15, 18, 10, 187, 50276, 29454, 50254, 50275, 19, 313, 1047, 15, 20, 10, 187, 50276, 30386, 13, 295, 11767, 50254, 2490, 50276, 33090, 50254, 50274, 884, 313, 3677, 15, 21, 10, 187, 50276, 27346, 50254, 50272, 577, 313, 1619, 15, 23, 10, 187, 50276, 19711, 13, 1599, 313, 6324, 582, 1107, 50267, 1717, 15, 24, 313, 746, 283, 2031, 10, 187, 50276, 25935, 13, 1599, 313, 6324, 582, 15841, 50267, 2526, 15, 26, 313, 1235, 15, 21, 283, 2759, 15, 26, 10, 187, 50276, 13881, 13, 1599, 313, 6324, 582, 7892, 50267, 18146, 15, 23, 313, 18795, 15, 17, 283, 19105, 15, 17, 10, 187, 50276, 31685, 13, 1599, 313, 6324, 582, 15841, 16, 78, 63, 19, 63, 50269, 1508, 15, 24, 313, 938, 15, 17, 283, 1630, 15, 19, 10, 187, 187, 31685, 13, 2133, 2280, 3605, 15, 187, 187, 8732, 31037, 708, 28431, 13, 12098, 15, 187, 187, 2641, 42244, 47673, 1712, 7693, 1678, 25140, 14, 1704, 14, 520, 740, 94, 187, 573, 187, 187, 12515, 6532, 10465, 4988, 34731, 4719, 689, 673, 310, 2011, 323, 1016, 1971, 275, 5317, 544, 19, 1084, 7693, 1678, 25140, 14, 926, 14, 12603, 910, 709, 14, 881, 568, 926, 7129, 19757, 3250, 19572, 5307, 3250, 7913, 12938, 10465, 4988, 34731, 2692, 247, 3102, 273, 6537, 3727, 2429, 342, 253, 374, 12768, 273, 9812, 10465, 4988, 34731, 9098, 5770, 1677, 721, 3038, 7419, 15, 329, 2074, 3727, 3102, 369, 2540, 323, 253, 2014, 27091, 3250, 7913, 6178, 273, 12938, 10465, 4988, 34731, 13, 533, 387, 247, 2406, 4719, 685, 342, 253, 2014, 5307, 3250, 7913, 6178, 15, 187, 187, 3138, 12515, 6532, 10465, 4988, 34731, 4719, 689, 673, 407, 1971, 15, 9812, 13, 8993, 3727, 28, 12938, 13, 12321, 3727, 5774, 5305, 11927, 14, 24, 14, 2222, 14, 72, 4699, 4253, 7693, 1678, 25140, 14, 926, 14, 12603, 94, 187, 187, 4769, 387, 390, 1840, 577, 14986, 16, 8316, 6532, 10465, 4988, 34731, 4719, 432, 337, 6178, 273, 5307, 3250, 7913, 12938, 10465, 4988, 34731, 369, 2074, 281, 326, 432, 374, 12768, 273, 9812, 10465, 4988, 34731, 15, 35780, 308, 95, 36, 21511, 21, 21516, 16, 8316, 95, 323, 253, 5307, 3250, 7913, 12938, 10465, 4988, 34731, 15895, 369, 884, 15, 22, 3038, 2429, 342, 898, 15, 25, 3038, 323, 374, 12640, 12768, 273, 9812, 10465, 4988, 34731, 9098, 5770, 13, 285, 627, 497, 642, 1534, 3910, 875, 253, 374, 26850, 2796, 49, 11, 426, 964, 24, 18895, 28, 5270, 575, 60, 19, 1084, 7693, 1678, 25140, 14, 12749, 14, 12603, 910, 709, 14, 881, 568, 2420, 2536, 496, 4499, 13, 253, 8876, 308, 95, 36, 21511, 21, 21516, 16, 8316, 95, 323, 27091, 3250, 7913, 12938, 10465, 4988, 34731, 273, 854, 15, 18, 3038, 369, 3012, 12217, 685, 253, 8876, 308, 95, 36, 21511, 21, 21516, 16, 8316, 95, 273, 898, 15, 25, 3038, 323, 253, 374, 12640, 12768, 273, 9812, 10465, 4988, 34731, 9098, 5770, 2796, 49, 11, 426, 964, 45341, 28, 5270, 544, 19, 1084, 7693, 1678, 25140, 14, 12749, 14, 12603, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 5146, 2490, 187, 4769, 387, 390, 32761, 577, 14986, 16, 8316, 313, 53, 95, 36, 21511, 21, 21516, 16, 8316, 13611, 32904, 5192, 292, 4988, 34731, 1716, 36551, 4325, 19757, 399, 4863, 273, 5307, 3250, 285, 27091, 3250, 7913, 12938, 285, 374, 12768, 273, 9098, 3250, 7913, 9812, 5192, 292, 4988, 34731, 535, 50276, 7689, 11149, 50254, 50254, 50254, 50254, 50254, 50263, 50275, 5307, 3250, 7913, 12938, 5192, 292, 4988, 34731, 374, 6806, 9098, 5770, 50275, 33856, 3250, 7913, 12938, 5192, 292, 4988, 34731, 374, 6806, 25782, 5770, 50275, 3027, 5192, 292, 4988, 34731, 374, 6806, 313, 19, 6806, 6783, 5770, 10, 187, 50276, 7078, 22928, 9625, 4485, 9625, 7040, 9625, 1532, 187, 50276, 53, 95, 36, 21511, 21, 21516, 16, 8316, 9854, 8876, 313, 22724, 10, 50254, 50254, 50254, 50254, 50254, 50263, 884, 15, 1235, 50254, 50270, 50276, 25, 15, 805, 50254, 50270, 898, 15, 1976, 187, 50276, 40189, 5301, 12938, 4632, 9812, 13, 8876, 273, 3910, 60, 66, 1084, 7693, 1678, 25140, 14, 12749, 19, 14, 9939, 14, 5831, 910, 709, 14, 881, 568, 4174, 986, 2796, 49, 5627, 60, 67, 1084, 7693, 1678, 25140, 14, 12749, 19, 14, 9939, 14, 12603, 910, 709, 14, 881, 568, 4174, 986, 50263, 2106, 17, 15, 1012, 25323, 24, 18895, 10, 50254, 50276, 2106, 18, 15, 1235, 25323, 45341, 10, 50254, 50274, 8915, 187, 187, 3027, 13, 8993, 3727, 28, 12938, 13, 12321, 3727, 15, 187, 187, 10818, 757, 273, 3910, 6125, 253, 8876, 273, 2060, 3910, 875, 253, 374, 9694, 2439, 512, 5705, 13, 285, 417, 253, 3064, 875, 253, 1129, 2458, 273, 374, 9694, 15, 187, 187, 40235, 1430, 2330, 342, 48824, 6704, 5958, 1071, 15, 187, 187, 8732, 31037, 708, 28431, 13, 12098, 15, 187, 187, 510, 6070, 273, 10465, 4988, 34731, 11058, 432, 253, 5307, 3250, 7913, 12938, 15895, 369, 2074, 281, 326, 273, 374, 12640, 12768, 273, 253, 9098, 3250, 7913, 9812, 15895, 15, 380, 5091, 6, 36, 2513, 323, 253, 11878, 273, 17856, 2097, 497, 1561, 9015, 2655, 44132, 7787, 313, 17, 15, 1438, 283, 18, 15, 1099, 6904, 1166, 1084, 7693, 1678, 25140, 14, 2383, 14, 31202, 910, 709, 14, 881, 568, 709, 4982, 544, 1093, 1084, 7693, 1678, 25140, 14, 2383, 14, 31272, 910, 709, 14, 881, 568, 709, 986, 342, 2743, 281, 30728, 95, 17, 283, 805, 95, 313, 29603, 13, 470, 15, 1525, 28, 5091, 6, 7142, 13, 470, 15, 3953, 283, 18, 15, 2125, 582, 30728, 95, 17, 283, 85, 95, 313, 29603, 13, 470, 15, 4185, 28, 5091, 6, 7142, 13, 470, 15, 4590, 283, 18, 15, 2640, 582, 285, 30728, 95, 17, 283, 2050, 95, 313, 29603, 13, 470, 15, 4185, 28, 5091, 6, 7142, 13, 470, 15, 3953, 283, 18, 15, 2941, 558, 923, 5270, 544, 20, 1084, 7693, 1678, 25140, 14, 12749, 14, 14602, 910, 709, 14, 881, 568, 2420, 7129, 380, 6070, 273, 10465, 4988, 34731, 11058, 432, 27091, 3250, 7913, 12938, 369, 3012, 4577, 685, 326, 273, 374, 12640, 9098, 3250, 7913, 12768, 273, 253, 9812, 15895, 15, 380, 4313, 273, 25169, 2097, 273, 841, 374, 3580, 323, 30728, 95, 17, 283, 805, 9854, 30728, 95, 17, 283, 85, 9854, 285, 30728, 95, 17, 283, 2050, 95, 369, 2708, 5096, 6, 26786, 17, 15, 25, 582, 285, 253, 5091, 6, 36, 2513, 497, 3345, 253, 470, 15, 1438, 283, 18, 15, 1099, 9015, 2655, 44132, 7726, 313, 3235, 544, 20, 1084, 7693, 1678, 25140, 14, 12749, 14, 14602, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 5146, 2490, 187, 7992, 290, 273, 5192, 292, 4988, 34731, 16508, 19215, 4325, 19757, 399, 4863, 273, 5307, 3250, 285, 27091, 3250, 7913, 12938, 5192, 292, 4988, 34731, 285, 374, 399, 4863, 273, 9098, 3250, 7913, 9812, 5192, 292, 4988, 34731, 535, 50254, 25169, 9601, 50274, 44700, 273, 25169, 46062, 60, 66, 1084, 7693, 1678, 25140, 14, 12749, 20, 14, 9939, 14, 5831, 910, 709, 14, 881, 568, 4174, 986, 313, 2270, 6, 7142, 60, 67, 1084, 7693, 1678, 25140, 14, 12749, 20, 14, 9939, 14, 12603, 910, 709, 14, 881, 568, 4174, 7547, 50254, 50254, 50254, 2490, 50276, 23130, 16810, 12383, 44136, 14022, 14927, 10521, 14927, 10521, 187, 50276, 42080, 95, 17, 283, 23, 9854, 14986, 6256, 73, 16, 8316, 50273, 3832, 15, 20, 50254, 50254, 50266, 2504, 15, 21, 50254, 50254, 50270, 1857, 15, 20, 50273, 18, 15, 1812, 313, 18, 15, 1630, 283, 18, 15, 1857, 6904, 68, 1084, 7693, 1678, 25140, 14, 12749, 20, 14, 9939, 14, 14602, 910, 709, 14, 881, 568, 4174, 986, 50276, 18, 15, 1762, 313, 17, 15, 4185, 283, 18, 15, 805, 10, 187, 50276, 42080, 95, 17, 283, 805, 9854, 14986, 6256, 73, 16, 8316, 50274, 1525, 15, 21, 50254, 50254, 50266, 3121, 15, 17, 50254, 50254, 50270, 2313, 15, 21, 50254, 470, 15, 1525, 313, 17, 15, 3953, 283, 18, 15, 2125, 10, 50254, 17 ]
15](#cpdd367-bib-0015){ref-type="ref"} and the United Kingdom Over‐the‐Counter monograph for acetaminophen recognizes a threshold of 3 to 5 μg as the minimal concentration for provision of analgesia.[16](#cpdd367-bib-0016){ref-type="ref"} Here, this threshold was chosen as a point of comparison for the SR properties of the new formulation. Secondary PK outcomes included the area under the plasma concentration--time curve from zero to 6 hours (AUC~0--6~) and zero to 12 hours (AUC~0--12~), AUC from time zero to the last time at which acetaminophen remained detectable (AUC~0--t~), and AUC from time zero extrapolated to infinity (AUC~0--inf~), maximum plasma concentration (C~max~), elimination rate (K~el~), time to C~max~ (T~max~), and half‐life of elimination (t~1/2~). ### Safety {#cpdd367-sec-0070} Safety and tolerability of the study treatments were assessed by reporting of treatment‐emergent adverse events (TEAEs) and serious adverse events (SAEs) from the start of the first treatment until posttreatment day 14. Biochemistry laboratory testing, including liver function testing, was performed at screening and on days 3, 6, 9, and 14; the assessment on day 3 occurred postdose. Hematology testing was performed at screening and on day 14, and urinalysis and virology testing were performed at screening only. Statistical Methods {#cpdd367-sec-0080} ------------------- T~C≥4μg/mL~ was analyzed nonparametrically using the Wilcoxon signed rank test based on the median of differences between treatments across subjects and a significance level of 5% (*P* = .05). PK outcomes AUC~0--12~, AUC~0--t~, and AUC~0--inf~ were log‐transformed (natural log) and analyzed based on a linear mixed model using Proc Mixed of SAS (SAS version 9.2; SAS Institute, Cary, North Carolina). Treatment and period were included in the model as fixed effects, with subjects included as a random effect. The residual variance from the model was used to construct 90% confidence intervals (CIs) for least‐squares (LS) mean differences between treatments. These differences were then back‐transformed to obtain point estimates (ratios) of geometric means and corresponding 90%CIs. All PK outcomes were summarized by descriptive statistics. Results {#cpdd367-sec-0090} ======= Study Subjects {#cpdd367-sec-0100} -------------- Of 43 subjects screened, 14 were randomized; all 14 completed the study and were included in the PK and safety analyses (Figure [1](#cpdd367-fig-0001){ref-type="fig"}). The majority of participants (71%) were female, half were white, and they ranged in age from 19 to 44 years (Table [1](#cpdd367-tbl-0001){ref-type="table"}). ###### Demographic Characteristics of the Study Population Demographics Participants (N = 14) ---------------------------------- ----------------------- Race, n (%) White 7 (50.0) Black/African American 3 (21.4) Asian 1 (7.1) Native Hawaiian/Pacific Islander 1 (7.1) Multiple 2 (14.3) Sex, n (%) Female 10 (71.4) Male 4 (28.6) Age, mean (range), years 29.7 (19--44) Weight, mean (range), kg 66.9 (50.4--84.9) Height, mean (range), cm 167.6 (151.0--184.0) BMI, mean (range), kg/m^2^ 23.7 (20.0--27.2) BMI, body mass index. John Wiley & Sons, Ltd. Pharmacokinetics {#cpdd367-sec-0110} ---------------- Mean plasma acetaminophen concentration over time is shown for each treatment in Figure [2](#cpdd367-fig-0002){ref-type="fig"}. Single‐dose 2000‐mg SR acetaminophen showed a pattern of controlled release compared with the 2 doses of IR acetaminophen 1000 mg given 6 hours apart. A similar release pattern was observed for the single 1500‐mg dose of SR acetaminophen, but at a lower concentration than with the single 2000‐mg dose. ![Mean plasma acetaminophen concentration over time by treatment. IR, immediate release; SR, sustained release.](CPDD-7-95-g002){#cpdd367-fig-0002} Time at or above 4 μg/mL plasma acetaminophen concentration from 1 dose of 2000‐mg SR acetaminophen was similar to that from 2 doses of IR acetaminophen. Median T~C≥4μg/mL~ for the 2000‐mg SR acetaminophen formulation was 10.5 hours compared with 9.8 hours for 2 consecutive doses of IR acetaminophen 1000 mg, and there were no significant differences between the 2 formulations (*P* = .7222; Table [2](#cpdd367-tbl-0002){ref-type="table"}). In contrast, the median T~C≥4μg/mL~ for 1500‐mg SR acetaminophen of 8.1 hours was significantly shorter than the median T~C≥4μg/mL~ of 9.8 hours for the 2 consecutive doses of IR acetaminophen 1000 mg (*P* = .0044; Table [2](#cpdd367-tbl-0002){ref-type="table"}). ###### Time at or Above 4 μg/mL (T~C≥4μg/mL~) Plasma Acetaminophen Concentration From Single Doses of 2000‐ and 1500‐mg SR and 2 doses of 1000‐mg IR Acetaminophen End Point 2000‐mg SR Acetaminophen 2 × 1000 mg 1500‐mg SR Acetaminophen 2 × 750 mg IR Acetaminophen 2 × (2 × 500 mg) -------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------- ------------------------------------- ----------------------------------- T~C≥4μg/mL~, median (hours) 10.50 8.12 9.75 Treatment comparison SR vs IR, median of differences[a](#cpdd367-tbl2-note-0001){ref-type="fn"} (*P*)[b](#cpdd367-tbl2-note-0002){ref-type="fn"} −0.13 (.7222) −1.50 (.0044) --- IR, immediate release; SR, sustained release. Median of differences represents the median of individual differences between the 2 treatments across all subjects, and not the difference between the medians of 2 treatments. Probability associated with Wilcoxon signed rank test. John Wiley & Sons, Ltd. The extent of acetaminophen absorption from the 2000‐mg SR formulation was similar to that of 2 consecutive doses of the 1000‐mg IR formulation. The 90%CIs for the ratios of geometric means were within bioequivalence limits (0.80--1.25)[17](#cpdd367-bib-0017){ref-type="ref"}, [18](#cpdd367-bib-0018){ref-type="ref"} with regard to AUC~0--12~ (ratio, 0.99; 90%CI, 0.94--1.04), AUC~0--t~ (ratio, 0.98; 90%CI, 0.93--1.02), and AUC~0--inf~ (ratio, 0.98; 90%CI, 0.94--1.03); see Table [3](#cpdd367-tbl-0003){ref-type="table"}. The extent of acetaminophen absorption from 1500‐mg SR was significantly smaller than that of 2 consecutive 1000‐mg doses of the IR formulation. The ratio of LS means of these 2 products for AUC~0--12~, AUC~0--t~, and AUC~0--inf~ was below 80% (\<0.8), and the 90%CIs were outside the 0.80--1.25 bioequivalence interval (Table [3](#cpdd367-tbl-0003){ref-type="table"}). ###### Extent of Acetaminophen Absorption From Single Doses of 2000‐ and 1500‐mg SR Acetaminophen and 2 Doses of 1000‐mg IR Acetaminophen LS Mean Ratio of LS Means[a](#cpdd367-tbl3-note-0001){ref-type="fn"} (90%CI[b](#cpdd367-tbl3-note-0002){ref-type="fn"}) ---------------------- --------- ----------------------------------------------------------------------------------------------------------------- ------- -------------------------------------------------------------- -------------------------------------------------------------- AUC~0--6~, μg·h/mL 61.3 47.4 45.3 1.36 (1.27--1.45)[c](#cpdd367-tbl3-note-0003){ref-type="fn"} 1.05 (0.98--1.12) AUC~0--12~, μg·h/mL 99.4 76.0 100.4 0.99 (0.94--1.04) 0
[ 1137, 14, 14573, 29425, 390, 18066, 422, 41044, 15, 733, 310, 2969, 1728, 14, 12710, 2739, 15, 187, 187, 510, 4736, 273, 436, 1263, 310, 281, 9186, 253, 9493, 285, 13399, 897, 273, 475, 83, 5507, 296, 321, 269, 1886, 321, 2992, 1690, 697, 3275, 13, 9008, 285, 1659, 275, 253, 1980, 285, 3872, 4466, 273, 253, 10351, 13347, 15, 4129, 627, 403, 2067, 2175, 327, 10351, 80, 3248, 2739, 16964, 285, 2544, 689, 673, 13, 253, 6349, 273, 8388, 16390, 6773, 310, 762, 33174, 1254, 1311, 19, 1092, 1008, 1311, 22, 1092, 1008, 1311, 883, 7254, 1311, 1012, 1656, 5488, 13, 253, 5675, 41023, 6239, 327, 8388, 16390, 6773, 2190, 8790, 11347, 14, 3169, 22132, 35136, 253, 3361, 273, 8388, 16390, 6773, 275, 253, 10351, 13347, 13, 3738, 643, 23060, 280, 4343, 452, 644, 5421, 3786, 1254, 1311, 1047, 1092, 1008, 1311, 1010, 1656, 5128, 323, 253, 1246, 1263, 310, 1754, 327, 1673, 7211, 5728, 949, 12888, 285, 7313, 327, 253, 10351, 3703, 18708, 1580, 4260, 14, 13435, 84, 15, 187, 187, 48563, 16390, 6773, 275, 40261, 25183, 1712, 4538, 19, 94, 187, 29648, 187, 187, 1909, 247, 4122, 591, 763, 494, 13, 2601, 32691, 2739, 13, 6773, 1364, 320, 5480, 6283, 323, 5718, 281, 5416, 352, 588, 1390, 323, 1996, 8353, 15, 399, 11729, 13, 30734, 13, 3779, 1076, 285, 10470, 403, 673, 14, 25224, 9698, 13, 36930, 3082, 273, 7576, 3647, 436, 285, 7624, 17749, 253, 5825, 902, 422, 3198, 273, 2021, 18294, 403, 6283, 1313, 15, 9658, 841, 13, 24396, 285, 30734, 403, 253, 17172, 3082, 273, 6773, 23029, 1254, 1311, 1036, 1092, 1008, 1311, 1166, 1656, 187, 187, 688, 11442, 3060, 13, 627, 403, 1048, 21188, 273, 42990, 272, 5893, 3580, 323, 1966, 2739, 15, 3900, 16184, 80, 14, 1592, 16390, 21436, 3580, 452, 417, 4546, 667, 1534, 9503, 275, 1980, 2739, 4466, 275, 253, 23060, 280, 4343, 313, 249, 4499, 281, 8170, 14, 38, 8963, 3060, 13, 923, 1254, 1311, 1093, 1092, 1008, 1311, 746, 1184, 582, 8388, 16390, 6773, 313, 284, 973, 347, 8388, 16390, 8463, 285, 9132, 3580, 10, 403, 24842, 14414, 2190, 253, 638, 14, 49338, 41207, 610, 15, 831, 310, 3340, 253, 1083, 275, 253, 11186, 629, 273, 253, 40261, 35026, 33489, 13, 275, 253, 10351, 13347, 285, 275, 28651, 15, 20496, 16390, 5893, 3580, 497, 7744, 14109, 13, 342, 14414, 27491, 9288, 2393, 275, 11948, 1254, 1311, 26, 1092, 1008, 1311, 1036, 1656, 187, 187, 14569, 8388, 16390, 6773, 310, 11766, 22186, 275, 40261, 25183, 285, 310, 8127, 3710, 281, 247, 18066, 422, 2739, 22186, 327, 2714, 15530, 15, 20599, 273, 824, 8388, 16390, 6773, 17114, 403, 475, 9960, 1344, 2381, 2188, 272, 11, 313, 12710, 432, 48477, 617, 804, 10, 275, 16842, 285, 475, 47081, 71, 1886, 11, 313, 12710, 432, 40732, 13, 1018, 390, 3168, 12306, 10, 275, 20341, 1254, 1311, 26, 1092, 1008, 1311, 938, 1656, 28651, 280, 8388, 16390, 6115, 1373, 35409, 13, 475, 76, 5507, 296, 321, 37472, 76, 7694, 2992, 556, 2489, 247, 2581, 11855, 33503, 10827, 323, 8353, 1309, 18066, 422, 3394, 3340, 15, 475, 48062, 77, 991, 11, 12196, 783, 14205, 24791, 11470, 247, 9305, 24791, 11609, 29025, 275, 7043, 13, 8618, 285, 43235, 342, 277, 408, 13, 310, 14109, 512, 689, 40261, 25183, 3063, 15, 1723, 13, 13399, 475, 12158, 77, 991, 11, 310, 247, 4980, 1327, 14, 1592, 16390, 1885, 13, 285, 556, 642, 36199, 342, 253, 1711, 47485, 5899, 8388, 16390, 24791, 13, 3168, 12306, 13, 2645, 1087, 249, 2352, 285, 643, 49720, 534, 369, 8927, 14205, 275, 253, 6149, 13, 7613, 253, 5788, 1416, 686, 13156, 728, 24791, 8, 1254, 1311, 938, 7254, 1311, 1423, 1656, 187, 187, 19799, 253, 23060, 280, 4343, 13, 253, 10351, 3703, 18708, 403, 253, 760, 4328, 835, 8388, 16390, 6773, 7788, 281, 320, 908, 347, 271, 15363, 2739, 15, 1707, 13, 352, 310, 1335, 8558, 4197, 275, 253, 1728, 13, 285, 3798, 347, 247, 5678, 3434, 273, 253, 5938, 285, 4475, 15, 380, 2862, 9008, 1232, 310, 3139, 21184, 13, 7668, 23862, 13, 12478, 13, 24396, 13, 285, 42990, 272, 253, 6773, 15, 4563, 23892, 6634, 1561, 253, 11692, 15, 1723, 13, 352, 310, 31735, 1896, 281, 4489, 475, 83, 5507, 296, 321, 269, 1886, 321, 11, 275, 25633, 10111, 327, 253, 10351, 3703, 18708, 15, 733, 476, 671, 320, 8686, 3909, 285, 8549, 281, 952, 434, 2914, 3369, 15, 187, 187, 15568, 1712, 4538, 20, 94, 187, 6877, 187, 187, 1552, 1263, 310, 1754, 327, 619, 1673, 7211, 5728, 949, 12888, 285, 7313, 1580, 253, 4260, 14, 13435, 84, 15, 733, 310, 629, 273, 247, 4067, 22603, 706, 8673, 2561, 13521, 13, 7106, 327, 253, 2425, 3634, 875, 7497, 285, 643, 5893, 3417, 432, 253, 10351, 13347, 15, 309, 4510, 13, 275, 8956, 342, 11960, 7678, 1254, 1311, 1508, 5413, 253, 2048, 475, 12135, 3634, 11, 432, 253, 581, 14, 21773, 8668, 10466, 407, 253, 2426, 4444, 285, 5893, 4648, 1254, 1311, 1348, 7254, 1311, 1630, 1656, 13303, 5893, 29821, 275, 253, 1980, 33698, 452, 644, 5469, 28, 3738, 619, 2561, 556, 1399, 433, 5742, 327, 5105, 2369, 8636, 1975, 3374, 13, 4444, 3640, 941, 452, 671, 644, 5728, 1254, 1311, 1619, 1092, 1008, 1311, 1717, 1656, 3619, 917, 4956, 6244, 13, 2299, 13, 4546, 247, 5884, 2554, 275, 253, 5899, 6196, 313, 395, 1014, 1679, 31735, 10, 273, 253, 8930, 398, 1254, 1311, 1229, 1656, 187, 187, 42, 5196, 440, 34218, 12888, 342, 18294, 275, 657, 383, 8420, 66, 13, 443, 75, 33320, 87, 285, 308, 1954, 83, 1200, 580, 79, 313, 783, 5347, 273, 253, 17546, 582, 285, 671, 2335, 629, 275, 2710, 4712, 347, 271, 1759, 386, 2611, 1080, 1254, 1311, 2405, 1656, 401, 3647, 285, 253, 8353, 273, 6773, 403, 629, 273, 5312, 1495, 327, 253, 10351, 3703, 18708, 15, 309, 452, 3103, 574, 1142, 9091, 281, 10018, 285, 10078, 275, 253, 9008, 273, 285, 8353, 273, 10020, 14, 49461, 8388, 16390, 6773, 15, 2752, 1673, 7211, 432, 841, 7313, 403, 619, 2022, 4973, 15, 41749, 1491, 327, 253, 6349, 273, 6773, 347, 2739, 369, 13037, 432, 22603, 5576, 5012, 13, 4288, 462, 955, 285, 1980, 14464, 8553, 1254, 1311, 19, 1092, 1008, 1311, 22, 1656, 2596, 1774, 4809, 310, 417, 5469, 275, 436, 3634, 2167, 13, 326, 310, 253, 298, 9994, 3527, 9574, 285, 12807, 3206, 275, 253, 30734, 1232, 15, 1707, 310, 273, 2282, 271, 4722, 19037, 273, 1966, 14, 12306, 14, 18227, 1257, 3939, 1060, 13, 533, 309, 452, 417, 1119, 667, 4623, 2561, 327, 253, 2494, 1258, 6464, 273, 253, 10351, 80, 3248, 475, 376, 383, 321, 269, 1886, 321, 11, 594, 2080, 15, 733, 310, 247, 9400, 323, 2852, 2561, 15, 187, 187, 22183, 79, 5576, 4758, 1712, 4538, 21, 94, 187, 15879, 187, 187, 36, 503, 8572, 13, 253, 10351, 3703, 18708, 19142, 247, 1355, 285, 4942, 2860, 11426, 5948, 1254, 1311, 1237, 1656, 4129, 3332, 39327, 1941, 5053, 1966, 32591, 273, 253, 10351, 3703, 18708, 875, 5446, 9166, 283, 10487, 13, 253, 1655, 21251, 403, 32148, 273, 44567, 7087, 339, 3767, 326, 7244, 275, 253, 28023, 5331, 1254, 1311, 1610, 1092, 1008, 1311, 1706, 1656, 16688, 629, 273, 22783, 432, 1458, 1508, 13, 253, 3072, 310, 6571, 24496, 266, 13, 15823, 281, 253, 10351, 80, 3248, 24496, 266, 6412, 313, 1438, 575, 10970, 380, 6414, 14125, 281, 253, 7489, 48022, 7528, 40857, 313, 1010, 575, 2673, 285, 2710, 1018, 43307, 11438, 15, 733, 310, 247, 2581, 11518, 6416, 5674, 2429, 281, 643, 23060, 280, 4343, 15, 380, 8930, 398, 452, 616, 1211, 7925, 3448, 273, 7087, 339, 11998, 13, 533, 954, 952, 403, 407, 15504, 270, 39661, 275, 1097, 616, 3101, 14018, 10351, 80, 3248, 285, 275, 26304, 13, 253, 3448, 273, 253, 21441, 1612, 1254, 1311, 1237, 1656, 187, 187, 2993, 20640, 5361, 13, 16121, 323, 396, 357, 14950, 1969, 285, 13949, 11572, 43928, 285, 35164, 1969, 285, 690, 39913, 30621, 497, 253, 2022, 2613, 273, 253, 6982, 1580, 1966, 10858, 1919, 2393, 28385, 5331, 1254, 1311, 1671, 1092, 1008, 1311, 1812, 1656, 844, 871, 432, 1142, 22603, 5576, 2175, 326, 7625, 342, 5899, 5243, 383, 9250, 452, 7000, 3640, 273, 2710, 3417, 275, 616, 27762, 1254, 1311, 1787, 1656, 831, 310, 671, 2032, 323, 253, 10351, 3703, 8930, 398, 15, 401, 3647, 432, 2659, 369, 8558, 281, 6186, 2739, 323, 2060, 18294, 15, 7214, 2659, 628, 272, 14768, 574, 581, 390, 625, 19750, 15, 401, 3647, 369, 247, 3309, 13503, 281, 643, 5054, 4712, 15, 45363, 43928, 2796, 9030, 706, 547, 545, 7080, 6673, 284, 11, 313, 14463, 408, 9679, 14370, 14393, 2796, 34238, 469, 80, 254, 316, 305, 610, 81, 316, 11, 313, 36010, 695, 3750, 9679, 285, 6150, 14, 40382, 497, 671, 1774, 4973, 273, 12461, 1254, 1311, 22, 1092, 1008, 1311, 1012, 1656, 380, 25108, 7478, 1077, 1643, 6773, 3417, 275, 253, 19365, 2891, 13646, 15, 9658, 841, 13, 1014, 11184, 497, 7478, 347, 2739, 13, 1690, 253, 2710, 12738, 3417, 313, 40, 324, 15203, 582, 7905, 487, 307, 13, 475, 41, 5265, 11816, 1730, 316, 15241, 11816, 1730, 316, 11, 313, 45, 11507, 285, 253, 1024, 2761, 14454, 289, 1575, 2135, 21868, 13, 475, 51, 22779, 502, 580, 682, 11, 418, 15, 1254, 1311, 1839, 7254, 1311, 1449, 1656, 380, 618, 37018, 2796, 49, 2555, 607, 3750, 2177, 25083, 11, 313, 45, 2698, 582, 534, 4536, 5420, 275, 1781, 6738, 932, 275, 21658, 13, 369, 273, 2714, 6349, 13, 1580, 1142, 952, 812, 12308, 731, 275, 1270, 3904, 432, 253, 16838, 1254, 1311, 3156, 1092, 1008, 1311, 2945, 1656, 187, 187, 10457, 253, 28385, 5331, 253, 6982, 273, 253, 10351, 13347, 13657, 432, 1355, 14, 7527, 22431, 27633, 90, 281, 3676, 14, 15681, 27633, 90, 275, 253, 3729, 14847, 15, 11056, 13, 15133, 310, 253, 3625, 5054, 2425, 1254, 1311, 1012, 1092, 1008, 1311, 3079, 1656, 380, 10351, 3703, 18708, 556, 247, 1781, 18500, 273, 1140, 88, 10787, 285, 4577, 1386, 15133, 19750, 13, 6773, 29492, 285, 671, 16540, 24791, 2796, 15426, 6972, 3779, 274, 11, 418, 2698, 285, 6150, 40732, 2796, 15426, 6972, 492, 29662, 492, 29662, 11, 418, 2698, 275, 6773, 14, 14103, 983, 15, 4129, 954, 6773, 403, 21792, 407, 841, 4067, 15133, 12671, 13, 690, 5662, 1821, 4035, 281, 6773, 323, 11284, 285, 323, 616, 1211, 8353, 275, 12171, 8818, 19750, 13, 973, 12956, 281, 253, 8704, 6150, 313, 1470, 15, 575, 60, 20, 1084, 1470, 20, 910, 709, 14, 881, 568, 926, 2536, 12571, 281, 5233, 4980, 1320, 13, 271, 3629, 1180, 273, 952, 403, 1024, 1119, 1561, 253, 3168, 14, 2052, 9388, 8776, 13, 390, 403, 9583, 275, 2579, 285, 643, 4712, 1561, 253, 31000, 5054, 8776, 15, 1470, 15, 495, 2290, 22675, 10351, 80, 3248, 19750, 7470, 323, 253, 10351, 80, 3248, 12685, 13, 443, 75, 33320, 87, 13, 3978, 6157, 15, 2053, 1980, 4194, 272, 19750, 13, 534, 497, 3786, 908, 275, 1142, 10351, 80, 3248, 18430, 13, 452, 616, 6510, 275, 253, 4577, 19750, 273, 253, 40269, 15, 15023, 1527, 424, 14, 424, 45686, 403, 1024, 6571, 908, 323, 275, 21658, 15133, 347, 247, 34057, 313, 16227, 37095, 2044, 322, 6148, 4978, 10, 187, 187, 32473, 23029, 327, 253, 10351, 3703, 18708, 1712, 4538, 22, 94, 187, 35349, 187, 187, 510, 8930, 7888, 497, 598, 281, 253, 2393, 28385, 5331, 7943, 407, 247, 5718, 6982, 1254, 1311, 19, 1092, 1008, 1311, 22, 1656, 11431, 11659, 369, 22952, 342, 9894, 273, 12687, 1523, 5352, 12134, 13, 28035, 342, 9894, 273, 6571, 14245, 285, 8388, 16390, 2739, 15, 5863, 1919, 253, 3563, 11994, 84, 285, 2393, 10333, 84, 13, 672, 1728, 1959, 91, 398, 3395, 1846, 13, 7312, 1846, 1039, 281, 14003, 5893, 3580, 327, 253, 10351, 3703, 18708, 369, 407, 24396, 285, 42990, 272, 15, 353, 3681, 932, 13, 11260, 285, 6773, 497, 5448, 14, 49461, 28, 642, 7043, 369, 908, 275, 253, 1232, 1254, 1311, 19, 1092, 1008, 1311, 883, 1656, 496, 1283, 2950, 13, 7993, 45681, 9251, 360, 13, 247, 5974, 275, 9921, 285, 5869, 13, 2540, 253, 2739, 16964, 273, 253, 10351, 3703, 8930, 398, 15, 496, 1635, 281, 247, 2238, 273, 346, 30107, 293, 3, 313, 35264, 247, 18377, 10, 1160, 273, 4688, 13, 1355, 7437, 273, 8388, 16390, 14245, 9132, 285, 39913, 13723, 13, 9251, 360, 5012, 326, 597, 18739, 5136, 1051, 475, 83, 5507, 296, 2992, 326, 310 ]
ute-cuisine or festive celebrations. It is simple home-made food. The goal of this study is to examine the historical and contemporary use of *ræstur fiskur*, including its production, preparation and place in the local and national culture of the Faroes. Although there are several studies on Faroese food habits and changes over time, the importance of fermented fish is underrepresented \[[@CR2], [@CR5], [@CR11]--[@CR13]\]. Furthermore, the growing scholarly literature on fermented fish among subsistence-based peoples ignores the presence of fermented fish in the Faroes, although other Nordic countries have been studied previously \[[@CR14], [@CR15]\]. Data for the present study is based on field notes collected through interviews and observations on the Faroe Islands since mid-1990s. Fermented fish in Scandinavia {#Sec2} ----------------------------- As a highly perishable, proteinaceous food, fish must be prepared properly for storage to ensure it will last for later consumption. Drying, fermentation, salting and smoking are time-honoured, intricate methods of accomplishing this and thereby ensuring the nutritive needs of family households are properly met. Among these, drying and fermentation are the oldest methods of fish preservation \[[@CR16], [@CR17]\]. In Northern Europe, there are long traditions of fermenting animal products for human food. While lacto-fermented vegetable products have not played any significant roles in local food culture in the Nordic countries (in contrast to Central-Eastern Europe, see \[[@CR18], [@CR19]\]), fermented fish (as well as fermented milk and meat products) are historically widespread among the pre-industrial peasantry. This is especially the case in the northern part of the Scandinavian Peninsula, in the Faroes and in Iceland. Fermented animal products were commonly appreciated, with widespread tastes acquired early in childhood \[[@CR9], [@CR16]\]. Today fermented fish is rarely eaten in Scandinavia and is largely limited to a festive food eaten on special occasions. Examples of such fermented fish dishes are *surströmming* (made from Baltic herring) in Sweden and *rakefisk* (made from trout, char or whitefish) in Norway \[[@CR9], [@CR20]\]. Icelandic fermented Greenland shark, *kæstur hákarl*, has become a rather exclusive snack reserved for consumption during festive events especially. *Gravlax* ('the buried salmon'), a raw salmon dish cured in salt, sugar and seasoned with dill, is appreciated all over Scandinavia today. However, contemporary *gravlax* is a modern non-fermented product, and has no resemblance with the old fashioned traditional fermented salmon, whitefish, cyprinids and other fishes which was originally buried in the earth, hence the survival name 'buried salmon' \[[@CR20]--[@CR22]\]. Among the Nordic countries, the Faroe Islands are the only location where fermented fish continues to be used as an everyday food. There, it is still primarily produced in the home, and usually as a combined effort of the husband and wife. The entire preparation process is itself elaborate, involving catching, cleaning, drying, and fermenting the fish. Consumption occurs within the household. However, it is nowadays possible to buy *ræstur fiskur* in grocery stores on the Faroe Islands. It can also be bought online and delivered to people's front door. Methods {#Sec3} ======= This study is based on my field notes collected through interviews and observations since the mid-1990s. It is part of a larger ethnobiological research programme, focused on the activity context between humans and other animal species from the Faroes. I prefer, in accordance with Balée \[[@CR23]\], the expression *activity context* from the one-sided perspective implied by the terms plant and animal uses \[[@CR24]--[@CR27]\]. Wild animal taxa in the local cuisine have been discussed; although my research has centred specifically on ethnozoological issues, plant knowledge data have also been collected \[[@CR28], [@CR29]\]. Edible wild plants, however, played a minor role in the traditional diet (and even less nowadays) of the islanders \[[@CR30]\]. I conducted unstructured interviews with households in Vestmanna, Gjógv and Tórshavn (the capital of the islands), and also took part in various activities as an observant participator \[[@CR31]\]. Fishing and the consumption of fish are part of daily life on the Faroe Islands. I have therefore had many opportunities to observe and participate in the preparation of and consumption of semi-dried fermented fish. My field notes from these observations are my main sources. Supplemental information on the importance of fish as food was gathered from ethnographic reports, travelogues and local historic accounts \[[@CR2], [@CR5]\]. One important aspect is not discussed in this context though, that is the lactic acid bacteria and enzymes involved in the fermentation process. There is of course an interesting triangle of human-fish-microbe active here, but I have not found any relevant research on the microflora of the Faroese *raestur fiskur* so far. It is a topic for future research. Ethnographic setting {#Sec4} -------------------- Culturally, the Faroe Islands comprise a small and relatively homogenous society \[[@CR32]\]. Although recent archaeological evidence places human colonization of the Faroe Islands between AD 400--600, the current inhabitants are descendants of Viking Norsemen that arrived in the ninth century \[[@CR33], [@CR34]\]. Being part of Denmark from 1523, the population is mostly Lutheran, belonging to the Faroese Lutheran Church (80 %). The remainder belongs to the Open Plymouth Brethren (15 %) and various charismatic movements. It is a rather conservative Christian nation compared to other Nordic countries. The islanders have their own native language of Norse extraction, but most people are by necessity bilingual in both their mother tongue Faroese and in Danish, the language of the colonial power \[[@CR32]\]. Shepherding, hunting for seabirds -- and occasionally pilot whales and seals -- and some barley cultivation were the main base of the economy since human settlement until early twentieth century \[[@CR35], [@CR36]\]. We know from many ethnographic studies that populations with traditional lifestyles have detailed knowledge of various species in their surroundings \[[@CR37]\]. This is also true for the Faroe islanders. Fishing from land was primarily to supply food for individual households. Only landowning farmers had one or more boats. Fishing was a necessary complement to other economic activities. Pilot whales (*Globicephala melas* (Traill)), grey seal (*Halichoerus grypus* (Fabricius)), and sea-birds were also important sources of nutrition \[[@CR5], [@CR13]\]. The locals recognized very few fish species in the folk taxonomy. Among these, even fewer were recognized as food, including the various cod species (Gadidae), halibut, *Hippoglossus hippoglossus* (L.), and the now almost forgotten thornback ray, *Raja clavata* L. \[[@CR38]--[@CR40]\]. The saithe (*Pollachius virens* (L.)), which sometimes appeared in large shoals inshore, was of special importance, since many people could harvest them in great numbers from the shore \[[@CR41], [@CR42]\]. During the twentieth century the economy of the Faroes transformed from small-scale coastal fishery to deep-sea fishery in the North Atlantic. Today, fishing is the primary economic activity \[[@CR13], [@CR43]\]. The Faroe Islands has a large fleet of trawlers and smaller line fishing boats, fish factories and also raises salmon (*Salmo salar* L.) and sea trout (*Salmo trutta trutta* L.) in fish-farms. Although most fish are harvested by these larger fishing vessels, some older men continue to fish for pleasure and for their own consumption in locally constructed boats, well adapted to the surrounding sea (Fig. [3](#Fig3){ref-type="fig"}). Due to rapid modernization, an increasing number of people are now found within the white-collar sector, or are engaged in service and other activities within the tertiary economic sector.Fig. 3Traditional Faroese boats suitable for the Faroese waters, Gjógv, June 2004. These local rowing boats, which were previously used in many Faroese villages, have their origin in the smaller boats of the Vikings. Small open**-**boats are now mostly used for inshore fishing as a hobby (Photo Ingvar Svanberg) Food preservation on the Faroe Islands {#Sec5} -------------------------------------- The island communities were up to the early twentieth century characterized by a storage economy \[[@CR2], [@CR5]\]. Food availability was seasonal with periods of predominately fresh foods, alternating with periods of mostly dried and fermented food. Up until the late 1960s and early 1970s, when home freezers became common, usual common way to preserve animal products on the Faroe Islands was by drying and fermenting. Mammals, birds and fish were wind-dried; no salt was used in the process \[[@CR2], [@CR11]\]. In 1846, Peter Ludwig Panum, a student in medicine and surgery, observed the food habits of the Faroe islanders. In addition to a kind of "gruel" (actually a soup) made of fat, small pieces of fermented dried meat and barley grain, Panum reports that they ate:"... *ræst*, that is
[ 521, 7408, 281, 4135, 436, 1770, 2427, 816, 1270, 15, 754, 7244, 896, 275, 253, 1986, 2077, 846, 247, 2525, 14, 395, 14, 72, 3160, 342, 17868, 1165, 763, 266, 13, 4135, 434, 9841, 11162, 530, 15, 52, 15, 45460, 6854, 15, 380, 27876, 13, 3690, 15, 11731, 11392, 7599, 4261, 314, 327, 17868, 434, 3640, 273, 4466, 285, 11727, 13, 285, 344, 7558, 346, 783, 1533, 556, 1620, 2326, 1966, 2341, 708, 13271, 263, 387, 824, 4311, 3, 347, 275, 4135, 15, 187, 187, 13788, 76, 434, 23027, 6125, 247, 1846, 4884, 432, 11731, 84, 13, 432, 8217, 434, 8969, 11980, 281, 6745, 434, 4744, 1503, 18141, 4978, 13, 846, 48287, 31528, 12188, 342, 1755, 14, 5251, 5628, 7038, 15, 11198, 14807, 2244, 2761, 1900, 2940, 1977, 432, 921, 90, 13, 892, 9476, 12225, 13762, 326, 253, 5628, 1930, 310, 24152, 281, 616, 3198, 285, 326, 597, 476, 1132, 247, 30847, 2554, 275, 253, 2570, 2493, 875, 5041, 285, 18496, 15, 187, 187, 1989, 597, 1472, 16426, 20854, 13, 285, 253, 6662, 932, 273, 5639, 9341, 275, 4135, 403, 762, 4092, 3569, 4322, 432, 247, 2208, 35524, 342, 697, 1211, 5697, 273, 3872, 3988, 15, 187, 187, 4339, 17174, 403, 1677, 281, 10805, 323, 841, 9257, 7303, 12225, 13, 275, 629, 432, 23057, 285, 275, 629, 984, 273, 616, 15663, 9927, 326, 841, 2136, 7688, 1128, 460, 87, 20961, 6289, 281, 407, 253, 5628, 3159, 1149, 266, 2981, 1128, 5092, 1527, 512, 253, 11008, 597, 878, 275, 4135, 15, 1292, 1223, 1149, 266, 2981, 476, 42341, 253, 17727, 273, 2970, 12225, 390, 2970, 4116, 281, 13330, 13, 352, 476, 626, 19086, 4135, 434, 5675, 4996, 16723, 13, 762, 253, 1149, 885, 273, 3988, 13, 715, 253, 6186, 13178, 326, 452, 644, 824, 247, 9560, 629, 273, 253, 530, 15, 52, 8634, 22800, 5454, 2954, 15, 187, 187, 11001, 1515, 932, 8, 1388, 14, 936, 14, 1201, 5871, 275, 4135, 2454, 26442, 22087, 15, 496, 378, 404, 708, 6487, 434, 4765, 4135, 10518, 28678, 17136, 13, 5196, 342, 253, 2448, 23119, 273, 20249, 275, 4135, 13, 6879, 2558, 273, 15102, 3543, 326, 5639, 4413, 403, 9592, 10357, 13509, 627, 13, 342, 7248, 5780, 247, 2201, 4468, 15, 473, 735, 429, 689, 5639, 32447, 310, 11543, 281, 1708, 257, 347, 4135, 8796, 955, 346, 527, 17431, 15832, 3, 275, 253, 42733, 19465, 3636, 275, 697, 23089, 275, 4135, 1384, 1099, 5827, 15, 1198, 758, 4302, 21916, 390, 440, 49628, 941, 19610, 407, 2060, 4750, 2758, 2963, 2729, 407, 5628, 16255, 16753, 1524, 10502, 281, 37197, 1050, 9341, 13, 347, 1057, 253, 5675, 3361, 273, 253, 5628, 3988, 1375, 15, 187, 187, 510, 22014, 273, 1554, 1515, 932, 310, 4983, 281, 921, 15, 346, 1276, 310, 634, 4112, 275, 4135, 1024, 865, 611, 4595, 4235, 6850, 273, 4568, 853, 2546, 4744, 1503, 18141, 4978, 436, 1770, 15, 346, 42, 1599, 13, 359, 1472, 13230, 937, 344, 10017, 29156, 314, 15, 1723, 13, 1503, 18141, 4978, 434, 4135, 37321, 6468, 626, 644, 4751, 17889, 13, 347, 344, 2879, 13, 346, 1147, 434, 1892, 281, 452, 247, 7517, 273, 14707, 281, 3324, 253, 2644, 1533, 8003, 2366, 285, 3553, 562, 253, 5962, 2586, 449, 187, 187, 25116, 11731, 4744, 1503, 18141, 4978, 285, 253, 21344, 15572, 273, 253, 4135, 9753, 24703, 37977, 347, 5628, 19425, 8182, 611, 2574, 22589, 23981, 323, 247, 4804, 387, 253, 6495, 6696, 273, 253, 6491, 275, 18496, 327, 3919, 3127, 13, 4022, 15, 44, 12586, 357, 1822, 34990, 6968, 4595, 428, 32879, 16, 24051, 13478, 187, 187, 1552, 346, 2230, 3, 310, 6867, 273, 247, 18109, 8113, 326, 2448, 16255, 452, 9444, 264, 1580, 655, 394, 14, 9888, 30380, 285, 46895, 7156, 85, 273, 5909, 253, 5628, 2791, 15, 9110, 2600, 13498, 824, 347, 6745, 3464, 23339, 2149, 3212, 247, 43505, 326, 310, 46994, 1046, 1770, 13, 285, 2583, 268, 2108, 715, 7189, 2392, 281, 8171, 10296, 15, 187, 187, 1672, 9020, 24238, 403, 1146, 8838, 13, 533, 747, 4394, 403, 671, 1146, 1691, 275, 1659, 15, 9044, 556, 2489, 253, 2629, 22861, 323, 253, 3781, 273, 747, 5323, 285, 7248, 7767, 942, 12262, 37197, 1050, 16255, 15, 6676, 273, 253, 3055, 14, 37802, 4712, 1146, 6537, 1053, 626, 2965, 762, 5899, 12342, 273, 3872, 3988, 13, 533, 323, 21790, 13, 346, 13980, 7350, 3, 476, 6266, 3237, 12319, 432, 849, 247, 4422, 966, 7790, 17975, 281, 253, 4248, 273, 2791, 2289, 247, 4302, 5882, 25099, 15, 15839, 9341, 403, 9592, 387, 2495, 432, 3569, 3394, 285, 15620, 3988, 16936, 15, 187, 187, 12864, 253, 3684, 13247, 14, 25559, 25633, 345, 50108, 5034, 23519, 442, 13, 534, 6497, 5487, 281, 247, 5628, 48254, 342, 36546, 689, 253, 19007, 273, 247, 530, 15, 52, 15, 22822, 985, 15, 30549, 42760, 84, 14659, 407, 6281, 1408, 407, 1375, 3420, 824, 347, 45838, 38349, 7369, 275, 4092, 6224, 15323, 326, 3977, 281, 23519, 442, 434, 18185, 432, 253, 5628, 2791, 1390, 807, 15, 187, 187, 6175, 530, 15, 52, 15, 28265, 3464, 247, 2234, 629, 273, 5628, 2136, 323, 1024, 13, 3918, 36852, 32260, 14650, 556, 2168, 2011, 247, 3367, 24741, 281, 3473, 23289, 281, 26276, 521, 5454, 21546, 281, 5041, 15, 187, 187, 22800, 434, 3918, 36852, 32260, 14650, 16030, 84, 247, 7496, 273, 19248, 347, 344, 23981, 323, 247, 4804, 342, 3684, 8118, 3918, 330, 6147, 300, 9752, 9761, 6859, 387, 253, 6398, 11103, 723, 275, 24907, 20130, 13, 3684, 7531, 13, 4163, 2164, 13, 4765, 15, 24197, 187, 187, 15745, 21546, 1691, 36852, 434, 3569, 8113, 387, 253, 2798, 273, 2136, 3646, 15, 1284, 47422, 10118, 22780, 23519, 316, 416, 9041, 8219, 13, 14149, 5628, 3646, 3448, 4665, 84, 253, 2934, 273, 3988, 21450, 285, 3797, 5231, 2905, 281, 346, 783, 1453, 285, 23339, 4263, 273, 1345, 8881, 275, 4088, 326, 778, 2818, 253, 1612, 390, 6306, 273, 253, 10362, 5628, 22356, 7021, 449, 36852, 434, 2208, 285, 11570, 40206, 2066, 868, 403, 271, 1774, 15301, 273, 816, 849, 8244, 344, 5605, 253, 9787, 8776, 281, 11472, 521, 3367, 8113, 15, 187, 187, 12486, 2606, 36852, 14211, 382, 24472, 754, 369, 4102, 15127, 281, 12008, 24654, 28, 24472, 1024, 5644, 5454, 16685, 342, 253, 1986, 2077, 13, 285, 344, 671, 6518, 19186, 19837, 346, 21416, 32260, 14650, 1869, 3, 715, 4135, 434, 5054, 5827, 15, 1284, 36852, 434, 34889, 273, 1612, 7788, 13, 4135, 434, 9836, 3646, 1533, 310, 7601, 326, 23089, 275, 4135, 1384, 1099, 310, 670, 752, 36852, 5605, 13, 342, 1652, 1488, 304, 10582, 2316, 323, 667, 11254, 15, 187, 187, 11389, 1066, 253, 3569, 2739, 5931, 13, 1158, 11100, 285, 3055, 14, 37802, 45460, 21176, 1315, 461, 4427, 5639, 12981, 407, 21455, 281, 1474, 4513, 432, 687, 442, 3128, 14, 1282, 6128, 326, 1581, 642, 2316, 323, 253, 6284, 273, 5639, 16255, 15, 187, 187, 688, 5768, 4022, 13, 7493, 16598, 13, 253, 19041, 6423, 273, 253, 5197, 323, 40456, 5625, 11709, 8, 4135, 2086, 13, 11612, 271, 15832, 17414, 27312, 342, 253, 840, 14, 13382, 14622, 530, 15, 52, 8634, 22800, 40456, 708, 19190, 36623, 489, 15, 187, 187, 4553, 247, 29341, 6431, 13, 16598, 7943, 521, 5628, 17414, 21421, 347, 346, 328, 522, 862, 17859, 3, 9159, 25774, 273, 2791, 29110, 323, 5637, 4958, 19978, 13, 247, 4619, 9787, 8776, 323, 4135, 15, 1583, 16701, 326, 604, 5639, 16255, 3078, 275, 13, 253, 2105, 369, 23415, 275, 4135, 342, 9836, 6036, 18875, 10471, 15, 1707, 556, 644, 642, 14011, 326, 4135, 310, 7378, 281, 4917, 327, 5909, 10169, 281, 19465, 352, 372, 3030, 3483, 1037, 1774, 390, 326, 352, 11532, 812, 320, 247, 2442, 3988, 2495, 15, 187, 187, 33818, 33258, 5639, 18674, 943, 1007, 281, 253, 8450, 273, 5628, 16255, 13, 534, 769, 347, 476, 3927, 275, 253, 10089, 7477, 15, 380, 1986, 15808, 7733, 4487, 13, 247, 2234, 3128, 2133, 6571, 1929, 323, 697, 789, 8362, 4833, 5871, 3345, 273, 4135, 13, 671, 2987, 41574, 1037, 281, 8722, 3055, 14, 37802, 3879, 15, 380, 1986, 15808, 434, 6264, 29002, 556, 21533, 2530, 26911, 13, 7681, 1329, 13, 285, 23245, 9091, 323, 5628, 30440, 15, 2053, 33265, 8889, 452, 644, 2234, 281, 849, 5628, 17057, 2990, 13, 4763, 5300, 13, 285, 3885, 949, 10545, 4870, 15, 443, 18639, 247, 6186, 5931, 390, 4067, 13739, 1293, 10291, 281, 1986, 15808, 8889, 310, 7479, 15, 187, 187, 2598, 2080, 13, 4135, 434, 47215, 14, 395, 14, 19982, 9787, 4446, 310, 22915, 253, 2208, 1534, 4489, 14, 249, 432, 253, 3055, 8776, 13, 973, 4457, 2969, 10276, 342, 697, 44448, 3988, 1569, 15, 416, 9041, 803, 953, 326, 346, 20415, 273, 544, 22800, 434, 3055, 8776, 4413, 62, 1128, 10387, 253, 4491, 7038, 1128, 609, 3652, 616, 2136, 1566, 18705, 1475, 253, 3198, 273, 253, 1375, 449, 496, 1614, 13, 352, 310, 2779, 326, 4135, 434, 5454, 285, 9787, 7823, 13, 432, 941, 4803, 281, 4302, 21916, 13, 588, 320, 4270, 281, 5649, 253, 9836, 16255, 326, 352, 31901, 281, 9510, 15, 187, 187, 510, 3935, 2197, 281, 9836, 16255, 556, 644, 2590, 27, 15859, 366, 13, 285, 634, 6003, 476, 20464, 15, 9704, 366, 3345, 273, 253, 2208, 434, 7465, 13, 285, 368, 1833, 1089, 5871, 625, 2834, 1128, 284, 17868, 40326, 3770, 9041, 13, 253, 11731, 273, 322, 462, 276, 13, 247, 5628, 3186, 3948, 13, 556, 2529, 15, 1707, 434, 642, 34528, 253, 747, 3569, 15990, 275, 253, 5628, 2791, 15, 187, 187, 3039, 4135, 11403, 2136, 347, 8672, 13, 2136, 7038, 878, 281, 1265, 17682, 616, 12225, 342, 253, 1072, 36231, 285, 342, 247, 15958, 4685, 273, 752, 434, 1896, 15, 733, 434, 1620, 5745, 11170, 281, 320, 30446, 281, 634, 14516, 13, 533, 3098, 15240, 5701, 273, 253, 2238, 5907, 407, 42497, 588, 320, 1239, 407, 4135, 434, 9550, 347, 247, 861, 326, 597, 476, 769, 347, 597, 751, 2584, 37197, 1050, 16255, 15, 187, 187, 33748, 39933, 1411, 2442, 2544, 275, 253, 1971, 273, 5639, 16255, 310, 271, 5667, 15942, 6612, 323, 23289, 15, 380, 5628, 2208, 778, 2624, 253, 28865, 327, 247, 27876, 13250, 581, 1388, 285, 5007, 275, 16030, 641, 323, 7654, 9370, 3487, 84, 253, 1735, 15, 1608, 5521, 458, 13539, 285, 1679, 458, 999, 333, 323, 5639, 16255, 403, 327, 253, 15990, 13, 285, 3968, 434, 10459, 2602, 1612, 275, 4135, 310, 873, 281, 1705, 598, 1411, 5827, 285, 10003, 3413, 281, 2827, 853, 352, 15, 28549, 13, 2552, 4562, 13, 4050, 187, 187, 46, 24726, 298, 5348, 403, 30601, 272, 1722, 1897, 4321, 685, 597, 858, 275, 816, 253, 10333, 84, 15, 2064, 3249, 562, 281, 320, 247, 1818, 273, 670, 577, 1897, 591, 9976, 15, 6102, 247, 14138, 1818, 556, 281, 452, 2538, 327, 643, 3417, 13, 285, 352, 1057, 15, 496, 436, 1798, 1083, 13, 253, 3417, 5876, 310, 253, 3862, 14, 29551, 1547, 3987, 23182, 15, 2053, 1547, 3987, 40382, 12666, 275, 253, 14700, 273, 253, 10439, 3729, 3968, 281, 21876, 1046, 7203, 285, 3469, 327, 253, 425, 291, 274, 432, 253, 11129, 298, 1031, 281, 10265, 731, 15, 380, 298, 5348, 403, 1024, 30601, 272, 407, 253, 673, 253, 1547, 3987, 40382, 12666, 15, 15092, 247, 1643, 8007, 253, 11260, 588, 320, 20948, 846, 253, 31767, 3056, 452, 2168, 259, 2878, 264, 15, 187, 187, 2214, 1107, 253, 4154, 556, 644, 627, 369, 642, 824, 2181, 347, 4156, 18384, 15, 380, 7952, 1818, 1850, 4670, 2427, 281, 1270, 16095, 281, 7450, 436, 1127, 15, 1292, 13, 625, 285, 625, 941, 751, 436, 1304, 327, 253, 11129, 298, 5348, 2722, 253, 8859, 310, 6296, 2970, 34562, 15, 380, 1850, 4670, 452, 1024, 14728, 616, 7125, 326, 436, 18384, 310, 417, 1955, 281, 637, 12710, 14839, 15, 7820, 13, 597, 1750, 13, 436, 310, 816, 247, 2622, 18384, 5880, 15, 187, 187, 1989, 13, 604, 627, 310, 642, 18384, 840, 849, 476, 627, 320, 247, 3626, 18384, 5880, 32, 187, 187, 4497, 13, 253, 1850, 4670, 1024, 11476, 627, 310, 18384, 15, 187, 187, 1989, 13, 604, 597, 497, 594, 3430, 327, 253, 958, 326, 253, 8859, 310, 18384, 13, 752, 2789, 3780, 1158, 597, 403, 987, 670, 352, 1146, 247, 3626, 18384, 5880, 32, 187, 187, 510, 7952, 1818, 1850, 4670, 9059, 368, 476, 626, 4517, 253, 7952, 10950, 984, 359, 686, 9903, 626, 871, 3253, 2464, 733, 310, 2032, 359, 1053, 626, 871, 3253, 13, 533, 359, 871, 436 ]
his trip to China this month went just great. He arrived back in the United States after a meet-and-greet with Wang Qishan, China's newly appointed U.S. interlocutor. The Tesla, Inc. CEO reflected admiringly on Wang's knowledge of culture and philosophy, and he claimed "the world has never seen human energy & vigor at such scale" as in China. Musk's enthusiasm represents a common reaction from CEOs, from Apple's Tim Cook to Facebook's Mark Zuckerberg, after hobnobbing with top-level Chinese leaders. Entrepreneurs almost always walk away from showy, flattering meetings convinced that the Chinese side is sympathetic to their needs and that they can play a pivotal role in the complex relations between Washington and Beijing. But they're badly mistaken, and the fundamentals of foreign businesses in China are under serious political threat from a government obsessed with its own ideas of national security. CEOs are given to falling for these carefully managed meetings, in part from ego and in part because of their persistent belief that these business relationships—inevitably referred to by the Chinese word guanxi—can open all the doors they need in China. But while guanxi can grease the wheels of getting meetings or getting attention to deals, it can't halt China's growing intrusions, under the guise of security, into the supply chains that have been such a crucial part of the U.S.-China trade relationship. Multinationals' day-to-day operations in China face unhappy prospects. In Bain & Company's 2018 China Business Climate Survey, conducted with the American Chamber of Commerce in China, 75 percent of respondents felt that foreign companies are increasingly unwelcome there, with regulation remaining a major concern. Oversight over foreign enterprises is unlikely to lighten as China pursues "indigenous innovation" in the lucrative sectors identified in its Made in China 2025 plans. Forced technology transfers or unethical data theft by individual staff members poached by Chinese firms pose real risks to multinational businesses, as does the growing presence of the Chinese security state. The frustration of multinationals is starting to show. "What is your situation in China now?" Kara Swisher of Recode asked Mark Zuckerberg this month. "I mean, we're blocked," he replied bluntly. However, Zuckerberg's China ambitions haven't been fully dashed, as he added, "It's hard to have a mission of wanting to bring the whole world closer together and leave out the biggest country." Facebook CEO Mark Zuckerberg and the overseas representatives of the China Development Forum applaud as Chinese Premier Li Keqiang arrives for a meeting at the Great Hall of the People in Beijing on March 21, 2016.Kenzaburo Fukuhara - Pool/Getty Images This "mission" is typical of a romantic vision that American firms have nursed since 19th-century merchants and missionaries dreamt of opening the Chinese market. Yet content platforms such as Facebook remain censored behind a firewall that is thickening every month, and money pours into incubators to replace technologies. Existing obstacles are being maintained, but new ones are also being put in place. Security has become the standard justification for the array of new laws and regulation enforcements targeting multinational firms. Many of the private-sector activities being controlled don't fall under traditional concepts of national security, but for regulators, "security concerns" can describe problems ranging from how a website classifies Taiwan to the degree of market access a technology firm possesses. Foreign businesses are increasingly at risk from political events and controversial security developments. Take the South Korean-Japanese grocery conglomerate Lotte, which fell victim to a Chinese quarrel with Seoul over the deployment of a U.S. missile system. Consumer boycotts encouraged by stories run by state media such as Xinhua resulted in serious sales drops that led to Lotte's withdrawal from the Chinese market last year. While U.S. suppliers remain a key part of Chinese business for now, President Xi Jinping has already shown a personal willingness to pressure executives to relay his trade intentions to Washington. China's President Xi Jinping inspects a guard of honour as he arrives for a meeting with South African President Cyril Ramaphosa at the Union Buildings in Pretoria, South Africa, July 24, 2018. Reuters Those intentions put Xi's political vision at the heart of business policy. As Citizen Lab researcher Lotus Ruan argues, emerging Chinese policy language interprets the idea of security broadly and includes actions related to "the control and censoring of public debate in ways that may affect the power or standing of the ruling Chinese Communist Party." Xi's government and personnel reshuffles are an important indicator of just how closely he wants the industrial sector to mirror his personal vision. Longtime Xi loyalist Liu He was recently promoted to vice premier; Liu now leads trade negotiations with the United States, and he also helped formally integrate "Xi Jinping thought" into China's economic plans. As Xi's consolidation of power continues, China's domestic policy world is signaling that Made in China 2025 is about what Xi wants, with little wriggle room for any deviation. Further down the political food chain, think tank and private-sector interlocutors frustrate foreign scholars by refusing to deviate from rote party-line responses that allow no room for the interests of foreign firms. In summer 2016, Scott Kennedy, the deputy director of the Center for Strategic International Studies' China program, attended an innovation dialogue affiliated with the then-prominent U.S.-China Strategic & Economic Dialogue. After a tense exchange, Kennedy characterized his Chinese dialogue counterparts as "unapologetically" offering defenses of market protections for electric vehicle batteries, a critical industrial sector for China. They insisted that if foreign firms wanted in, the cost was investing in China with domestic joint venture partners. There has been no indication that China is willing to yield on opening markets to sectors it deems strategically important or that it believes could be a potential security risk. Ambitious foreign corporations should look to the experiences of Chinese firms, which act as canaries in the coal mine. The United Front Work Department, a key party body mostly known for its work funding influence operations outside of China, also works domestically to manage private-sector behavior. The United Front's commercial oversight has traditionally provided incentives, technical support, and networking opportunities for Chinese entrepreneurs. These umbrella organizations have been key to how Chinese industries network, receive resources, and speed through regulatory processes. Growing a supply chain or larger corporation without connections to United Front organizations is impossible. So far, China's carrot-and-stick industrial drive is earning the government significant buy-in from the private sector, well beyond simple compliance with its broadening security law. Ruan posits that "many of [China's private sector companies]—including the industry leaders—are building their business model predominantly around the needs of the state." In turn, it is likely that China's trade and industrial policies, from data rules to technology transfers, will be built to benefit the domestic firms that it intends to boost. The message sent to domestic firms has been clear: Cooperate, and your organization can prosper. Operate outside of the government's standards, and you'll find operations more difficult—as Wang Xiaochuan, the CEO of Sogou, a Chinese search engine, has described. There's no escaping the new political agenda in the Chinese market. When China sees business as politics, business leaders need to start approaching their meetings with the same mindset and with a realistic understanding of what's possible. It's never savvy to be rude to your hosts, but effusive comments of the kind offered by Musk will be read by China's leadership as a sign that they can act as they like toward multinational firms. Taking precautions against potential changes in the treatment of foreign firms is an essential operational reality for executives. The Chinese government may cut the ribbon on a Tesla factory one day and send in inspectors for strict crackdowns the next. Shorter leashes and less leeway for foreign firms are on the agenda, and America's corporate soft power in China is set to come up against plans and institutions determined to erode it.Thursday, May 31, 2012 Mountain lilies are blooming 17 days earlier than they did in just the 1970s. That comes out to be a change of about 4 days per decade. Such a dramatic change has to have effects on other species, and it does. In this particular case, the species affected is the broad-tailed hummingbird. These hummingbirds arrive in the mountains of the western North America to breed every spring and depend on the nectar from the mountain lily to sustain them. The lilies are now blooming by the time the hummingbirds arrive. Within a few decades the birds will be arriving after the blooms have already wilted. For years the argument has been there was no such thing as global warming. The climate change deniers went to great lengths to push this point. But, more and more data like this report on the mountain lilies shows the planet is indeed getting warmer. The deniers have now shifted their arguments that this warming is not due to manmade emissions. Instead, they claim, this is just a normal warming cycle. But, if there is no warming then how can there be a natural warming cycle? Well, the deniers now admit there is warming. But, if they were so wrong on the fact that the planet is warming, what makes anyone think they are right about it being a natural warming cycle? The climate change deniers argue you can't trust the climate scientists because we 'don't know everything.' It is true we don't know everything, but we know this
[ 1717, 94, 187, 6154, 9794, 187, 187, 39418, 326, 370, 89, 578, 71, 724, 310, 247, 40249, 3410, 13, 285, 253, 475, 83, 11, 394, 4778, 1474, 28032, 432, 253, 2622, 6498, 2491, 15, 370, 89, 578, 71, 724, 476, 320, 7154, 1066, 715, 253, 1563, 4948, 1764, 2043, 92, 3728, 1217, 83, 94, 187, 92, 89, 578, 71, 94, 426, 1269, 17840, 94, 559, 393, 4519, 578, 83, 94, 71, 578, 83, 2023, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 89, 17840, 724, 310, 253, 2622, 4445, 273, 370, 89, 578, 71, 3303, 285, 669, 4519, 578, 83, 94, 71, 578, 83, 724, 310, 253, 40249, 4445, 15, 669, 4519, 578, 83, 724, 310, 253, 3884, 273, 253, 9331, 13, 285, 370, 71, 578, 83, 724, 310, 253, 10896, 273, 253, 9331, 275, 253, 3969, 3884, 15, 4794, 281, 40242, 313, 21, 10, 285, 313, 23, 582, 253, 7680, 1318, 273, 1016, 4778, 476, 320, 2797, 407, 20860, 2470, 24, 1084, 10914, 24, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 1269, 578, 71, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 551, 89, 17840, 94, 559, 393, 4519, 578, 83, 94, 71, 578, 83, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 1572, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 2023, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 47, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 1009, 310, 253, 475, 75, 11, 394, 5275, 6346, 273, 370, 89, 578, 71, 724, 275, 253, 3733, 941, 873, 13, 285, 370, 89, 17840, 724, 310, 253, 2622, 4445, 273, 370, 89, 578, 71, 3303, 594, 253, 1563, 2493, 2226, 27, 370, 89, 17840, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 9887, 470, 1352, 380, 7680, 1318, 273, 1016, 4778, 476, 320, 13657, 715, 20860, 2470, 25, 1084, 10914, 25, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 393, 9887, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 393, 4519, 578, 83, 94, 71, 578, 83, 94, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 465, 61, 1274, 9, 393, 4519, 578, 83, 94, 71, 578, 83, 889, 4519, 578, 77, 1990, 53, 94, 393, 918, 7415, 19, 2023, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 36, 578, 1258, 724, 310, 253, 7680, 1318, 273, 253, 475, 77, 11, 394, 4778, 273, 3410, 370, 89, 578, 71, 724, 281, 253, 4181, 7605, 3605, 13, 285, 669, 4519, 578, 83, 724, 285, 669, 4519, 578, 77, 724, 943, 10517, 20860, 2470, 26, 1084, 10914, 26, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 464, 4519, 578, 83, 889, 4519, 578, 77, 1990, 53, 94, 426, 393, 1274, 6921, 393, 2043, 92, 3728, 1217, 77, 94, 187, 92, 17, 13, 83, 393, 9540, 298, 46609, 3202, 187, 92, 18, 13, 83, 426, 298, 35918, 3202, 187, 61, 423, 92, 3728, 94, 393, 918, 35918, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 4509, 253, 1840, 13, 672, 475, 83, 11, 310, 417, 4503, 281, 475, 77, 2992, 370, 83, 393, 9540, 298, 1366, 253, 6459, 7680, 273, 10969, 4903, 310, 370, 36, 578, 925, 724, 1764, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 925, 94, 426, 465, 71, 578, 83, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 35918, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 510, 1563, 6452, 476, 320, 8392, 2556, 281, 253, 1840, 1783, 27, 380, 465, 14, 8504, 4181, 7680, 1783, 1332, 476, 5416, 326, 271, 10969, 4778, 556, 253, 6459, 7680, 1318, 672, 760, 247, 2014, 4778, 310, 10969, 15, 187, 187, 20, 15, 19, 15, 380, 5721, 284, 2322, 10330, 273, 20815, 3506, 6320, 40949, 1712, 1704, 20, 5256, 19, 14, 8751, 14, 746, 14, 8972, 1717, 94, 187, 6154, 2912, 187, 187, 39418, 326, 370, 89, 578, 71, 724, 310, 247, 40249, 3410, 285, 326, 2067, 4903, 1474, 4513, 432, 253, 2622, 6498, 2491, 27, 4778, 475, 66, 2992, 4778, 475, 67, 2992, 285, 4778, 475, 68, 4556, 370, 89, 578, 71, 724, 476, 320, 7154, 1066, 715, 253, 1563, 4948, 47279, 2043, 92, 3728, 1217, 83, 94, 187, 92, 89, 578, 71, 94, 426, 1269, 17840, 94, 559, 393, 4519, 578, 66, 94, 71, 578, 66, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 2023, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 89, 17840, 724, 310, 253, 2622, 4445, 273, 370, 89, 578, 71, 3303, 669, 4519, 578, 66, 94, 71, 578, 66, 3303, 669, 4519, 578, 67, 94, 71, 578, 67, 3303, 285, 669, 4519, 578, 68, 94, 71, 578, 68, 724, 403, 253, 40249, 4295, 15, 669, 4519, 5, 285, 475, 71, 11, 403, 253, 10746, 285, 22652, 273, 253, 9331, 15, 4794, 281, 40242, 313, 21, 10, 285, 313, 883, 582, 253, 7680, 1318, 273, 1016, 4778, 476, 320, 2797, 347, 20860, 2470, 805, 1084, 10914, 805, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 1269, 578, 71, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 551, 89, 17840, 94, 559, 393, 4519, 578, 66, 94, 71, 578, 66, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 1572, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 7165, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 510, 1563, 2493, 2226, 27, 370, 89, 17840, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 9887, 470, 1352, 380, 7680, 1318, 273, 1016, 4778, 476, 320, 13657, 715, 20860, 2470, 1012, 1084, 10914, 1012, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 393, 9887, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 393, 4519, 578, 66, 94, 71, 578, 66, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 94, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 465, 61, 1274, 9, 393, 4519, 578, 66, 94, 71, 578, 66, 889, 4519, 578, 77, 1990, 53, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 889, 4519, 578, 77, 1990, 53, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 889, 4519, 578, 77, 1990, 53, 94, 393, 918, 7415, 19, 7165, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 33397, 281, 247, 2014, 10969, 4778, 13, 672, 370, 66, 13, 67, 13, 68, 393, 9540, 298, 1366, 370, 36, 578, 6855, 3303, 370, 36, 578, 15662, 724, 285, 370, 36, 578, 12964, 724, 476, 320, 6607, 347, 20860, 2470, 1047, 1084, 10914, 1047, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 1274, 6921, 393, 2043, 92, 3728, 1217, 77, 94, 187, 92, 36, 578, 6855, 94, 426, 465, 71, 578, 66, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 46609, 3202, 187, 92, 36, 578, 15662, 94, 426, 465, 71, 578, 67, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 46609, 3202, 187, 92, 36, 578, 12964, 94, 426, 465, 71, 578, 68, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 35918, 3202, 187, 61, 423, 92, 3728, 94, 393, 918, 15, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 510, 1563, 6452, 476, 320, 8392, 2556, 281, 253, 1840, 1783, 27, 380, 465, 14, 8504, 4181, 7680, 1783, 1332, 476, 5416, 10969, 4903, 452, 253, 3687, 7680, 1318, 672, 627, 403, 2067, 10969, 4903, 15, 187, 187, 21, 15, 5128, 1720, 11682, 285, 401, 1923, 90, 34725, 35859, 32988, 1712, 1704, 21, 14, 8751, 14, 746, 14, 8972, 1717, 94, 187, 15256, 381, 187, 187, 688, 1340, 281, 8415, 253, 4471, 14, 46103, 9331, 1895, 13, 253, 465, 14, 8504, 285, 4081, 16098, 941, 14433, 5700, 403, 2529, 275, 2508, 2708, 13, 285, 253, 5301, 285, 1783, 273, 767, 3082, 403, 1677, 275, 544, 12612, 577, 15, 20, 1084, 1704, 21, 5256, 20, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 1704, 7129, 187, 187, 21, 15, 18, 15, 380, 465, 14, 8504, 5128, 1720, 11682, 8378, 1712, 1704, 21, 5256, 18, 14, 8751, 14, 746, 14, 8972, 1717, 94, 187, 36960, 187, 187, 688, 436, 19087, 13, 253, 941, 14433, 1332, 1754, 327, 465, 14, 8504, 310, 1677, 1254, 35, 1671, 14, 8751, 14, 746, 14, 8972, 1717, 1656, 2091, 627, 310, 247, 9331, 275, 247, 747, 3410, 13, 359, 476, 897, 253, 941, 14433, 1332, 347, 3637, 15, 187, 187, 13996, 337, 27, 12144, 907, 253, 747, 3410, 970, 253, 1599, 285, 11041, 273, 253, 3733, 941, 15, 380, 906, 310, 370, 89, 578, 1826, 3303, 285, 370, 89, 578, 1826, 94, 426, 393, 1274, 61, 26874, 362, 578, 18, 2023, 87, 578, 19, 5548, 5589, 13, 87, 578, 78, 94, 393, 918, 61, 29179, 1366, 370, 87, 578, 74, 724, 310, 253, 5203, 273, 253, 4778, 15, 187, 187, 13996, 374, 27, 1720, 17439, 1016, 4778, 370, 87, 578, 18, 2023, 87, 578, 19, 5548, 5589, 13, 87, 578, 78, 724, 2556, 281, 20860, 2470, 1010, 1084, 10914, 1010, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 7547, 285, 544, 2841, 374, 1084, 8751, 14, 746, 14, 8972, 1717, 14, 71, 4699, 910, 709, 14, 881, 568, 926, 4982, 835, 370, 79, 578, 74, 889, 1274, 9, 1269, 578, 1826, 1990, 92, 4799, 5994, 599, 393, 918, 1009, 310, 253, 475, 74, 11, 394, 5275, 6346, 273, 370, 89, 578, 1826, 1990, 92, 4799, 5994, 4018, 275, 3733, 3410, 370, 89, 578, 79, 393, 3181, 313, 78, 428, 337, 46538, 92, 4799, 5994, 12460, 285, 669, 1274, 61, 26874, 1269, 578, 79, 578, 74, 18424, 89, 578, 1826, 1990, 92, 4799, 5994, 12104, 599, 393, 918, 61, 29179, 578, 85, 724, 310, 253, 475, 85, 11, 394, 4778, 273, 370, 89, 578, 1826, 1990, 92, 4799, 5994, 11971, 380, 4764, 475, 76, 11, 310, 247, 3638, 1318, 273, 2793, 15, 3318, 87 ]
29} --------------------------------------------------------- Assume that $x_{f}$ is a faulty sample, and the *r*th variable deviates from the normal operating range. $x_{f}$ can be broken down into the following forms $$\begin{array}{r} {x_{f} = x^{*} + \varepsilon_{r}f_{r},} \\ \end{array}$$ where $x^{*}$ is the normal component of $x_{f}$, and $\varepsilon_{r}f_{r}$ is the faulty component. $\varepsilon_{r}$ is the direction of the fault, and $f_{r}$ is the amplitude of the fault in the corresponding direction. According to Equations (4) and (6), the contribution value of each variable can be obtained by Equation ([7](#FD7-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} = \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack x_{f} - N_{j}\left( x_{f} \right) \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = \sum\limits_{j = 1}^{k}\left\{ {x^{*} + \varepsilon_{r}f_{r} - N_{j}\left( x_{f} \right)\rbrack\varepsilon_{l}^{T}} \right\}^{2},} \\ \end{array} \\ \end{array}$$ where $N_{j}\left( x_{f} \right)$ is the *j*th nearest neighbor of $x_{f}$ in the training data set, and $x^{*}$ is the normal component of $x_{f}$, so the following relations exist: $x^{*} - N_{j}\left( x_{f} \right) \approx 0$. The contribution value of each variable can be transformed into Equation ([8](#FD8-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} \approx \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack \varepsilon_{r}f_{r} \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = k\left( \varepsilon_{r}f_{r}\varepsilon_{l}^{T} \right)^{2},} \\ \end{array} \\ \end{array}$$ where $C_{fl}$ is the contribution value of the *l*th variable of sample $x_{f}$ to the distance statistical index, and $\varepsilon_{r}$ and $\varepsilon_{l}$ should satisfy Equation ([9](#FD9-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} {\varepsilon_{r}\varepsilon_{l}^{T} = \left\{ \begin{array}{l} {0,r \neq l,} \\ {1,r = l.} \\ \end{array} \right.} \\ \end{array}$$ From the above, when *r* is not equal to *l*, $r \neq l$, the greatest contribution of abnormal variables is $C_{fr}$ $$\begin{array}{r} {C_{fr} = kf_{r}^{2} > C_{fl} \approx 0.} \\ \end{array}$$ The following conclusion can be drawn according to the above analysis: The k-NN distance contribution analysis method can ensure that an abnormal variable has the greatest contribution value when only a single variable is abnormal. 3.2. The Feasibility Analysis of Multiple Abnormal Variables {#sec3dot2-sensors-19-00929} ------------------------------------------------------------ Assume that $x_{f}$ is a faulty sample and that several variables deviate from the normal operating range: variable *a*, variable *b*, and variable *c*. $x_{f}$ can be broken down into the following forms:$$\begin{array}{r} {x_{f} = x^{*} + \varepsilon_{a}f_{a} + \varepsilon_{b}f_{b} + \varepsilon_{c}f_{c},} \\ \end{array}$$ where $x^{*}$ is the normal component of $x_{f}$, $\varepsilon_{a}f_{a}$, $\varepsilon_{b}f_{b}$, and $\varepsilon_{c}f_{c}$ are the faulty components. $\varepsilon$ and *f* are the directions and amplitudes of the fault. According to Equations (4) and (11), the contribution value of each variable can be obtained as Equation ([12](#FD12-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} = \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack x_{f} - N_{j}\left( x_{f} \right) \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = \sum\limits_{j = 1}^{k}\left\{ {x^{*} + \varepsilon_{a}f_{a} + \varepsilon_{b}f_{b} + \varepsilon_{c}f_{c} - N_{j}\left( x_{f} \right)\rbrack\varepsilon_{l}^{T}} \right\}^{2}.} \\ \end{array} \\ \end{array}$$ The following relations exist: $x^{*} - N_{j}\left( x_{f} \right) \approx 0$. The contribution value of each variable can be transformed into Equation ([13](#FD13-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} \approx \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack \varepsilon_{a}f_{a} + \varepsilon_{b}f_{b} + \varepsilon_{c}f_{c} \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = k\left( \varepsilon_{a}f_{a}\varepsilon_{l}^{T} + \varepsilon_{b}f_{b}\varepsilon_{l}^{T} + \varepsilon_{c}f_{c}\varepsilon_{l}^{T} \right)^{2}.} \\ \end{array} \\ \end{array}$$ Similar to a single abnormal variable, when $a,b,c \neq l$, $C_{fa}$, $C_{fb}$ and $C_{fc}$ can be represented as Equation ([14](#FD14-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \left\{ \begin{array}{l} {C_{fa} = kf_{a}^{2} > C_{fl} \approx 0,} \\ {C_{fb} = kf_{b}^{2} > C_{fl} \approx 0,} \\ {C_{fc} = kf_{c}^{2} > C_{fl} \approx 0.} \\ \end{array} \right. \\ \end{array}$$ The following conclusion can be drawn according to the above analysis: The k-NN distance contribution analysis method can ensure abnormal variables have the greater contribution value when there are several abnormal variables. 4. Data Reconstruction and Faulty Variable Identification Strategy {#sec4-sensors-19-00929} ================================================================== In order to solve the multi-sensor fault problem, the k-NN and proposed CNN data reconstruction strategy are described in detail below, and the comparison and analysis of two methods are given in [Section 4.3](#sec4dot3-sensors-19-00929){ref-type="sec"}. 4.1. The k-NN Data Reconstruction Method {#sec4dot1-sensors-19-00929} ---------------------------------------- In this subsection, the data reconstruction method based on k-NN is given \[[@B35-sensors-19-00929]\]. When there is a fault in a new sample, we can use the data reconstruction method as follows. Step 1: Standardize the new sample using the mean and variance of the training data. The result is $x_{new}$, and $x_{new} = \left\lbrack v_{1},v_{2},\ldots,v_{m} \right\rbrack$, $v_{i}$ is the label of the variable. Step 2: Reconstruct each variable $v_{1},v_{2},\ldots,v_{m}$ according to Equation ([15](#FD15-sensors-19-00929){ref-type="disp-formula"}) and [Figure 2](#sensors-19-00929-f002){ref-type="fig"}, where $n_{i}\left( x_{new}^{{}^{\prime}} \right)$ is the *i*th nearest neighbor of $x_{new}^{{}^{\prime}}$ in training sample $x_{n \times (m - 1)}^{{}^{\prime}}$, and $\left\lbrack x_{n_{i}{(x_{new}^{{}^{\prime}})}} \right\rbrack_{t}$ is the *t*th variable of $x_{new}^{{}^{\prime}}$. The parameter *k* is a constant value of experience. $$v
[ 582, 346, 2877, 3, 1057, 417, 2486, 346, 84, 38120, 390, 24682, 273, 247, 6735, 326, 20944, 1078, 253, 37877, 273, 247, 1083, 964, 964, 17212, 1903, 530, 15, 52, 15, 36, 15, 3015, 45910, 9, 67, 481, 3308, 13, 275, 8925, 1880, 253, 13289, 76, 29068, 14297, 3249, 1561, 3015, 45910, 9, 67, 18619, 84, 4999, 22754, 13, 359, 16670, 253, 1318, 273, 611, 27901, 434, 7830, 273, 36055, 264, 22736, 434, 7942, 2685, 875, 253, 10636, 285, 11196, 273, 253, 10713, 7289, 285, 253, 370, 16899, 13, 933, 275, 16959, 10762, 326, 611, 27901, 8025, 15, 2594, 14272, 362, 15, 31641, 4597, 1075, 40061, 13, 3690, 15, 313, 688, 294, 8741, 266, 3136, 17826, 708, 15454, 15390, 13, 3690, 11507, 10508, 378, 15, 51, 15, 17558, 13, 22146, 313, 38850, 15, 411, 15, 37, 15, 31775, 15, 14619, 10, 313, 49844, 272, 4154, 326, 9376, 273, 3765, 2930, 37729, 5373, 253, 8304, 984, 352, 24696, 16243, 432, 2442, 3916, 323, 13770, 273, 1110, 47194, 481, 2594, 671, 330, 1730, 770, 362, 15, 3973, 2448, 2418, 6022, 313, 688, 294, 10188, 45323, 36305, 1771, 2434, 11507, 16493, 378, 15, 51, 15, 854, 2405, 13, 854, 1671, 313, 38850, 15, 47, 15, 37, 15, 46917, 7901, 10, 5550, 12612, 45910, 9, 67, 10, 310, 6034, 281, 4017, 31915, 6473, 23261, 323, 1318, 281, 9659, 4821, 4254, 273, 253, 2136, 1309, 253, 2634, 27142, 8, 2180, 15, 733, 310, 417, 6034, 281, 4017, 1501, 14, 2823, 566, 420, 7830, 273, 638, 14, 30351, 6735, 23715, 24704, 273, 4458, 8, 77, 21123, 2203, 9537, 904, 1249, 378, 15, 51, 15, 854, 2787, 13, 854, 3507, 313, 38850, 15, 37, 15, 47, 1173, 15, 18263, 10, 313, 12080, 942, 275, 13212, 273, 10800, 3765, 2930, 2136, 26131, 403, 3693, 494, 762, 3015, 45910, 9, 67, 5029, 844, 671, 16670, 253, 1318, 273, 253, 32510, 273, 36055, 264, 22736, 434, 3438, 6171, 665, 588, 320, 14667, 407, 611, 27901, 15, 2594, 9516, 362, 15, 418, 7640, 3354, 313, 688, 294, 3096, 36857, 19242, 4458, 8, 77, 13, 3690, 11507, 11456, 401, 15, 20, 69, 721, 2385, 13, 721, 3712, 313, 26, 394, 4082, 15, 12487, 10, 5550, 65, 3, 3902, 3, 762, 3015, 45910, 9, 67, 10, 4419, 4737, 273, 3238, 2684, 417, 3238, 12316, 13, 1309, 253, 35393, 8037, 2180, 18574, 544, 36214, 3236, 3291, 313, 17056, 3044, 4779, 316, 13, 19498, 13, 24770, 15354, 708, 38397, 13, 367, 15, 34, 15, 362, 15, 25958, 296, 313, 688, 294, 36126, 14, 36, 4914, 582, 8688, 378, 15, 51, 15, 11343, 13, 12387, 313, 38850, 15, 52, 15, 37, 15, 28811, 15, 11161, 5029, 187, 688, 8925, 1880, 611, 27901, 3534, 1318, 762, 253, 13289, 76, 29068, 14297, 13, 359, 1364, 475, 18467, 3653, 1880, 253, 370, 25085, 13, 933, 7942, 310, 50196, 281, 253, 1318, 273, 253, 10434, 352, 2959, 15, 2594, 496, 294, 36126, 14, 36, 4914, 13, 8688, 378, 15, 51, 15, 387, 12472, 5550, 510, 4755, 14112, 4096, 273, 3015, 45910, 9, 67, 10, 310, 281, 1918, 6152, 281, 247, 811, 453, 658, 281, 253, 6070, 326, 253, 35728, 8304, 556, 2959, 6425, 1318, 323, 253, 3700, 13, 285, 13, 3103, 13, 556, 417, 644, 33661, 23715, 16349, 29559, 13, 3690, 15, 362, 15, 2604, 438, 1624, 14, 35, 2679, 33393, 13, 3690, 904, 11513, 18972, 7584, 29160, 313, 52, 15, 37, 15, 47, 15, 58, 2698, 313, 9705, 76, 3700, 323, 4344, 6425, 1318, 369, 4209, 281, 13313, 25447, 12709, 593, 1750, 481, 496, 8524, 44721, 362, 15, 48022, 48327, 13, 3690, 15, 313, 688, 294, 24126, 1758, 4458, 8, 77, 13, 3690, 11507, 3495, 378, 15, 51, 15, 898, 2090, 13, 898, 2787, 313, 38850, 15, 52, 15, 37, 15, 47, 15, 58, 15, 17103, 582, 253, 1302, 574, 281, 3653, 1880, 247, 10713, 3700, 273, 346, 1439, 14, 15627, 14, 47120, 3, 49759, 369, 323, 12054, 6425, 1318, 323, 6378, 273, 4560, 247, 25447, 3700, 762, 3015, 45297, 285, 1457, 2816, 22736, 285, 35365, 2081, 5405, 3015, 31282, 15, 380, 1302, 1119, 253, 7289, 369, 323, 12054, 6425, 1318, 835, 16243, 574, 4211, 253, 49759, 275, 187, 66, 4951, 6174, 14, 3985, 1327, 14, 14641, 15240, 7289, 323, 8180, 3413, 407, 752, 247, 2810, 14, 483, 19616, 369, 7378, 281, 2075, 323, 253, 16243, 434, 1386, 273, 49759, 846, 28008, 6031, 407, 253, 16243, 281, 35125, 273, 253, 417, 14, 15627, 14, 47120, 49759, 407, 10156, 731, 281, 643, 2442, 4147, 39053, 273, 48903, 28499, 15, 187, 2618, 15, 387, 898, 1976, 15, 2594, 671, 28230, 362, 15, 17287, 16409, 386, 29906, 15, 313, 688, 294, 2884, 4611, 582, 20105, 401, 15, 19, 69, 721, 2082, 13, 46753, 313, 19, 69, 4082, 15, 40853, 10, 313, 13550, 778, 1908, 643, 42863, 13, 4242, 16685, 323, 253, 10434, 13, 326, 253, 10434, 497, 2834, 281, 35125, 273, 285, 5989, 273, 253, 16243, 387, 253, 673, 273, 253, 7289, 13, 275, 1635, 281, 4588, 4376, 5087, 275, 18000, 604, 4344, 8180, 556, 644, 1677, 762, 3015, 45297, 558, 9002, 362, 15, 11328, 313, 688, 294, 29797, 12244, 11263, 13, 3690, 11507, 3435, 378, 15, 51, 15, 854, 1706, 13, 854, 3079, 313, 38850, 15, 38, 15, 37, 15, 30461, 15, 11299, 10, 313, 28983, 326, 16243, 4211, 5553, 4660, 323, 12054, 6425, 1318, 835, 352, 369, 7591, 281, 1089, 247, 22894, 387, 247, 2169, 4376, 13, 2136, 369, 16528, 839, 13, 285, 627, 369, 642, 1941, 326, 253, 7289, 369, 820, 254, 758, 481, 187, 27555, 29572, 5605, 247, 8857, 818, 23052, 281, 1071, 1880, 253, 370, 25085, 13, 933, 7942, 5087, 407, 611, 27901, 281, 36055, 264, 22736, 310, 4209, 1318, 281, 3324, 253, 13289, 76, 29068, 14297, 1561, 3015, 45910, 9, 67, 18619, 84, 4999, 22754, 15, 1707, 403, 642, 10434, 323, 247, 8857, 818, 23052, 281, 25596, 643, 685, 326, 4081, 15561, 285, 359, 1089, 326, 352, 556, 42326, 15785, 13, 387, 1682, 15, 380, 30501, 1941, 2722, 326, 275, 1577, 981, 253, 10713, 7289, 13, 36055, 264, 22736, 858, 417, 11377, 275, 1881, 10620, 285, 326, 253, 7289, 310, 271, 6174, 14, 3985, 9996, 15, 7717, 29572, 946, 17815, 326, 36055, 264, 22736, 45066, 253, 36698, 323, 697, 10434, 407, 18505, 697, 3302, 4376, 387, 370, 19, 15, 22, 3041, 15, 1723, 13, 23549, 70, 434, 440, 40893, 264, 6206, 2722, 326, 36055, 264, 22736, 574, 247, 5272, 3720, 323, 2509, 594, 13, 285, 326, 36055, 264, 22736, 18171, 39809, 697, 10434, 10376, 281, 247, 9257, 18872, 2086, 326, 369, 689, 16564, 407, 3345, 5067, 285, 5118, 281, 22950, 253, 1091, 327, 36055, 264, 22736, 434, 10434, 15, 7717, 29572, 519, 23747, 642, 1941, 281, 1329, 697, 17077, 326, 253, 36055, 264, 22736, 434, 10434, 403, 4409, 625, 685, 253, 370, 23922, 13, 933, 7942, 5087, 407, 611, 27901, 285, 253, 4737, 2722, 5010, 15, 380, 7942, 7830, 310, 370, 16150, 13, 933, 625, 685, 308, 5851, 52, 434, 3959, 281, 7471, 512, 273, 36055, 264, 22736, 434, 19543, 285, 310, 370, 7749, 13, 933, 1805, 685, 308, 5851, 52, 434, 1682, 3959, 15, 733, 310, 327, 253, 1029, 1930, 273, 253, 2491, 273, 2193, 6221, 275, 253, 12000, 8292, 41013, 15, 844, 3877, 326, 1097, 253, 308, 5851, 52, 3959, 285, 253, 41013, 16670, 36055, 264, 22736, 434, 8553, 1645, 26430, 15, 12414, 519, 563, 2844, 667, 1941, 13, 7717, 29572, 12148, 326, 359, 943, 5467, 326, 597, 403, 2233, 6, 4822, 917, 15, 22736, 31647, 326, 697, 1645, 400, 2272, 943, 320, 594, 21392, 15, 844, 23071, 13630, 1645, 400, 2272, 275, 9534, 751, 436, 835, 253, 2075, 1796, 588, 24174, 697, 5871, 15, 496, 1708, 273, 253, 5989, 273, 436, 1083, 13, 359, 1089, 352, 11543, 326, 247, 23052, 812, 7568, 326, 253, 13289, 76, 29068, 14297, 11521, 3345, 3015, 45910, 9, 67, 18619, 84, 4999, 22754, 15, 380, 7289, 16947, 13, 2036, 273, 253, 14049, 1750, 13, 403, 253, 760, 8064, 2130, 281, 23514, 247, 8857, 818, 23052, 15, 3308, 13, 352, 310, 30236, 275, 253, 1682, 6284, 273, 25141, 281, 5597, 436, 1083, 15, 187, 21342, 13, 7717, 29572, 310, 417, 1293, 247, 16748, 15, 733, 476, 5691, 253, 47273, 273, 253, 10713, 7289, 275, 1375, 1302, 10376, 281, 1457, 2816, 434, 22736, 285, 35365, 2081, 5405, 15, 2594, 13, 299, 15, 72, 904, 4146, 24078, 24148, 23106, 23780, 459, 362, 15, 399, 262, 695, 12551, 982, 13, 3690, 904, 854, 3655, 401, 15, 4727, 15, 818, 2082, 13, 818, 3547, 313, 38, 15, 37, 15, 47, 15, 58, 15, 8878, 10, 313, 36595, 5575, 2847, 273, 2250, 281, 873, 9255, 10713, 7289, 762, 427, 15, 58, 15, 6202, 11584, 708, 6246, 1703, 15, 20485, 25255, 13, 32193, 13, 32193, 14, 66, 558, 418, 8045, 5590, 362, 15, 2101, 408, 1342, 13, 27812, 401, 15, 4727, 15, 25589, 13, 25597, 313, 38, 15, 37, 15, 47, 15, 58, 15, 29639, 10, 313, 16514, 326, 10713, 3700, 369, 247, 25447, 12709, 593, 762, 427, 15, 58, 15, 6202, 11584, 708, 6246, 1703, 15, 3015, 32193, 285, 1364, 320, 873, 9255, 582, 2438, 1871, 13, 33933, 401, 15, 19, 69, 27318, 313, 19, 69, 4082, 15, 28355, 481, 733, 556, 24904, 673, 281, 513, 594, 15, 2594, 427, 15, 58, 15, 54, 15, 36, 15, 36, 15, 3015, 721, 14, 10768, 313, 8766, 1137, 273, 7364, 310, 475, 15429, 2800, 2607, 846, 253, 3522, 327, 534, 253, 811, 453, 658, 2335, 10023, 273, 253, 10229, 481, 187, 1992, 26799, 13, 359, 1089, 326, 436, 1083, 943, 320, 11511, 10376, 281, 3015, 26402, 9, 66, 10, 273, 253, 23560, 6307, 984, 313, 74, 10, 352, 369, 24488, 407, 247, 1643, 42545, 10179, 4991, 25141, 13, 313, 2886, 10, 352, 310, 15279, 285, 11581, 800, 984, 253, 13289, 76, 29068, 14297, 2538, 271, 562, 273, 1302, 11461, 4795, 275, 271, 23720, 3268, 281, 25141, 13, 313, 12211, 10, 16852, 310, 275, 253, 1682, 1600, 273, 25141, 984, 253, 10713, 7289, 310, 247, 1679, 8214, 562, 14, 1171, 14, 13550, 11461, 534, 1682, 11029, 512, 6284, 275, 436, 1083, 285, 313, 400, 10, 253, 14286, 273, 247, 23052, 588, 4917, 642, 5649, 281, 25141, 15, 187, 187, 18786, 187, 1231, 4098, 36055, 264, 22736, 434, 3200, 281, 5597, 436, 35393, 1083, 15, 187, 10452, 53, 1843, 19140, 4889, 39953, 40, 10634, 15, 187, 24963, 187, 60, 18, 62, 50276, 688, 4623, 629, 13, 3015, 29980, 9, 73, 2769, 18, 10, 3054, 27, 187, 187, 2042, 544, 266, 35393, 62, 5266, 310, 417, 14793, 8830, 13083, 13, 253, 1302, 3091, 1340, 6619, 1411, 253, 16243, 275, 271, 35393, 1083, 762, 253, 8857, 762, 534, 253, 5266, 369, 4724, 15, 17501, 13, 846, 2332, 13, 253, 1302, 3091, 1340, 6619, 1411, 253, 16243, 275, 271, 35393, 1083, 762, 253, 8857, 762, 534, 253, 5266, 369, 4724, 13, 760, 604, 14716, 187, 9, 18, 10, 253, 16243, 310, 3839, 417, 10054, 824, 16243, 434, 26131, 347, 824, 26131, 2489, 1955, 5734, 824, 26131, 403, 253, 2256, 273, 247, 47243, 45732, 12027, 60, 10943, 187, 883, 530, 15, 52, 15, 36, 15, 3015, 29980, 9, 73, 2769, 18, 481, 187, 60, 19, 62, 50276, 12612, 29980, 9, 71, 10, 285, 313, 72, 10, 1375, 27, 187, 187, 9, 71, 10, 3105, 22046, 2593, 36813, 273, 436, 4060, 13, 3707, 281, 253, 6070, 326, 253, 1302, 7367, 5010, 13, 285, 1919, 271, 1340, 323, 6619, 275, 253, 1083, 13, 667, 2136, 273, 253, 16243, 778, 4035, 281, 10196, 13, 285, 253, 16243, 778, 4035, 281, 897, 13, 16270, 13, 390, 35125, 273, 2867, 347, 604, 271, 35393, 1083, 8664, 253, 16243, 574, 417, 644, 24488, 15, 187, 9, 72, 10, 2058, 667, 673, 846, 253, 37877, 273, 271, 35393, 1083, 762, 8857, 818, 273, 436, 4060, 533, 1078, 271, 1340, 323, 6619, 275, 253, 1083, 13, 253, 1302, 13, 327, 2748, 273, 247, 3128, 275, 1600, 13, 846, 4366, 281, 253, 16243, 285, 247, 4854, 13, 285, 604, 3309, 281, 14003, 253, 2867, 273, 253, 8304, 390, 281, 3657, 2957, 281, 253, 8304, 13, 778, 1340, 253, 1986, 2077, 23052, 281, 6544, 271, 26964, 23052, 762, 2593, 45333, 273, 436, 4060, 281, 1379, 10023, 273, 253, 2867, 273, 253, 8304, 285, 281, 10196, 667, 2136, 273, 253, 16243, 15, 9613, 271, 1340, 323, 6619, 13, 253, 16243, 778, 35398 ]
), "value" does not include "satisfaction or securing of a debt that arose before the commencement of a case . . ." 11 U.S.C. § 549(b). Thus, in determining whether the Bulk Sale Agreement comes within § 549(b)'s safe harbor, we exclude the value of KVL's payment of Alleged Debtor's cash flow between the execution and closing of the bulk sale and the $210,000 in lease payments that KVL assumed. See Allen v. Rib Detention Equipment, Inc. (In re Roanoke Iron & Bridge Works, Inc.), 98 B.R. 256, 260 (Bankr. W.D.Va.1988) (rejecting argument that assumption of prepetition liabilities benefits the estate because it protects debtor from potential claims for breach of those leases). See also Cossitt v. First American State Bank (In re Fort Dodge Creamery Co.), 121 B.R. 831, 835 (Bankr.N.D.Iowa 1990) ("Section 549(b) is intended to protect contemporaneous exchanges for value to permit continued operation of the business during the `gap' period. It is not intended to protect post-commencement payment of pre-petition debt."); Matter of Int'l Teldata Corp., 12 B.R. 879, 882 (Bankr.D.Nev.1981) (payments in satisfaction of ongoing prepetition business debts are avoidable under § 549(b)). We also exclude the value of the salaries of Alleged Debtor's former employees who will be retained by KVL. See Hamilton v. Lumsden (In re Geothermal Resources Int'l, Inc.), 93 F.3d 648, 651 (9th Cir.1996) ("`"Value" under § 549(b) requires proof of services performed not services promised, during the involuntary gap period.'" [Emphasis original]) (quoting McManus, Stewart, Ferraro & Schwarz, P.A. v. Bakst (In re Sanchez-Casis), 99 B.R. 115, 117 (Bankr.S.D.Fla. 1989)). In determining whether KVL gave value under the Bulk Sale Agreement, we must *164 determine whether the $388,000 cash is disproportionate to the value of the assets it received. See In re Sanchez-Casis, 99 B.R. at 116 ("The obvious legislative purpose of § 549(b) is to give credit to a transferee to the extent that the bankrupt estate has received equivalent value for the transfer, and, therefore, has not been depleted."); Modern Settings, Inc. v. Prudential-Bache Securities, Inc., 1988 WL 49056 (S.D.N.Y.) (bulk transfer for fair equivalent value was sufficient to defeat fraudulent conveyance claim). In Murdock v. Plymouth Enterprises, Inc. (In re Curtina Int'l, Inc.), 23 B.R. 969, 979 (Bankr.S.D.N.Y.1982), the court had to determine whether a bulk transfer of "not-too-fresh" wafers was for reasonably equivalent value for purposes of finding a fraudulent transfer under § 548 and New York Debtor and Creditor Law § 273. The court found the sale was for reasonably equivalent value where debtor had sold the wafers in a straight arms-length non-collusive sale for consideration determined by what a close-out specialist was willing to pay for the debtor's line of wafers after unsuccessful efforts by the debtor to dispose of the not-too-fresh wafers by selling them to other potential purchasers of distressed merchandise. Id. at 975. See also Roth v. Fabrikant Bros. (In re Flato), 175 F.2d 665, 667 (2d Cir.1949) (court may consider other bids, failed negotiations for the assets, that the assets were difficult to dispose of and circumstances of the debtor at the time of the sale, in addition to actual price paid in deciding if fair consideration has been given under § 548); Wood v. Davis (In re Southeast Community Media, Inc.), 27 B.R. 834, 843 (Bankr.E.D.Tenn. 1983) (finding that debtor sold radio station for reasonably equivalent value where it was unable to find a buyer at a higher price, business was deteriorating, and there was no evidence that the sale was coerced). Times Circle wants a chapter 7 trustee to test whether the $388,000 cash paid by KVL to Alleged Debtor is sufficient value to bring the Bulk Sale Agreement within § 549(b)'s safe harbor. There are no assets for a chapter 7 trustee to administer other than that proposed litigation and we find that it has dubious merit, at best. The undisputed evidence shows that in structuring the bulk sale, Alleged Debtor did not engage in self dealing and that the sale is an arms-length transaction. Times Circle speculates that Alleged Debtor chilled the bidding for its assets by fixing its initial price at $2.5 million. However, Dowe's unchallenged testimony shows that Alleged Debtor had a reasonable basis for doing so, and that Alleged Debtor extensively marketed its assets pursuant to a carefully structured program that was overseen by outside counsel and calculated to maximize the return on Alleged Debtor's assets. Times Circle adduced no evidence to support its assertion that the Alleged Debtor's assets are worth more than the $338,000 cash paid by KVL and the proof shows otherwise. The cash payment is $143,000 more than TAVS's offer to purchase all of Alleged Debtor's inventory and is $110,000 better than TAVS's best offer. It is on the high side of the range of values contained in the Caspert appraisal. We note that both the TAVS offer and the appraisal exclude Alleged Debtor's accounts receivable. Without adducing any evidence, Times Circle contends that we should assume that they are 100% collectible. Debtor denies that its receivables should be so valued. We sharply discount receivables in situations like this where the payee will terminate its operations. In light of the circumstances of this case, we find it unlikely that a trustee could demonstrate that the Bulk Sale Agreement falls outside § 549(b)'s safe harbor. The sale proceeds, net of the secured claim, are the only funds available to compensate a chapter 7 trustee. Thus, it is plainly in the best interests of creditors to dismiss this case. Moreover, Times Circle is not without a remedy. It can challenge the propriety of the bulk sale in state court pursuant to New York's Debtor and Creditor Law. See, e.g., Sunrise Industrial Joint Venture v. Ditric Optics, Inc., 873 F.Supp. 765, 772 (E.D.N.Y. 1995) (plaintiff alleged cause of action to set aside bulk sale under N.Y. DEBT & CRED. §§ 275, 276, 276-a); Leventhal v. Spillman, 234 F.Supp. 207, 209 (E.D.N.Y.1964) (holding that bulk transfer was a fraudulent conveyance under N.Y. DEBT & CRED. § 276 and must be set aside), aff'd, 362 F.2d 264 (2d Cir.1966). It has ample time to do so. See N.Y.U.C.C. § 6-111 (statute of limitations is *165 six months after the date on which the transferee took possession of the goods). To summarize, we find that this case should be dismissed pursuant to § 305(a) of the Bankruptcy Code because (i) it was commenced by a few recalcitrant creditors, (ii) it is unnecessary and duplicative because the Bulk Sale Agreement effects an out of court arrangement resulting in an equitable distribution to creditors, (iii) dismissal is in the best interest of creditors because the bulk sale is a less expensive out-of-court arrangement which best serves all interests in this case and (iv) the appointment of a trustee will yield no benefit to creditors. Conclusion We grant Alleged Debtor's motion to dismiss this involuntary case. SETTLE ORDER AND JUDGMENT. NOTES [1] In relevant part, § 303(h)(1) states: If [an involuntary] petition is not timely controverted, the court shall order relief against the debtor in an involuntary case under the chapter under which the petition was filed. Otherwise, after trial, the court shall order relief against the debtor in an involuntary case under the chapter under which the petition was filed, only if — (1) the debtor is generally not paying such debtor's debts as such debts become due unless such debts are the subject of a bona fide dispute[.] 11 U.S.C. § 303(h)(1). [2] Section 303(f) and (g) state: (f) Notwithstanding section 363 of this title, except to the extent that the court orders otherwise, and until an order for relief in the case, any business of the debtor may continue to operate, and the debtor may continue to use, acquire, or dispose of property as if an involuntary case concerning the debtor had not been commenced. (g) At any time after the commencement of an involuntary case under chapter 7 of this title but before an order for relief in the case, the court, on request of a party in interest, after notice to the debtor and a hearing, and if necessary to preserve the property of the estate or to prevent loss to the estate, may order the United States trustee to appoint an interim trustee under section 701 of this title to take possession of the property of the estate and to operate any business of the debtor. Before an order for relief, the debtor may regain
[ 4270, 247, 5678, 1566, 273, 512, 6849, 6096, 327, 253, 2829, 15, 380, 5014, 327, 1016, 2829, 497, 6804, 29607, 1905, 3872, 390, 7811, 47685, 497, 407, 3632, 760, 15, 187, 2214, 1016, 2829, 247, 7045, 8406, 369, 4236, 285, 1016, 1387, 2210, 2366, 342, 247, 1846, 6096, 4495, 273, 253, 1566, 4270, 15, 187, 187, 18905, 14, 484, 28674, 668, 187, 187, 1231, 4581, 253, 7153, 80, 4165, 784, 10223, 22586, 342, 253, 19316, 3636, 387, 1016, 2829, 849, 281, 5115, 253, 2136, 7342, 15, 2726, 436, 1491, 253, 5014, 285, 5170, 4323, 3053, 247, 747, 22586, 6874, 281, 4271, 5018, 3058, 323, 7092, 15, 15883, 2577, 11726, 6073, 187, 187, 15883, 2577, 11726, 6073, 310, 271, 2448, 5842, 8690, 285, 3438, 4760, 15, 754, 310, 4390, 253, 820, 14, 1545, 3134, 30468, 387, 253, 2499, 273, 14070, 3052, 379, 296, 15, 187, 187, 49579, 5249, 187, 17613, 6073, 1339, 3606, 387, 45585, 1223, 4882, 323, 253, 33572, 273, 3096, 47052, 6822, 13, 38588, 275, 5403, 15, 187, 187, 6869, 5250, 5249, 187, 187, 19159, 2434, 5250, 42258, 187, 17588, 521, 4882, 5249, 13, 11726, 6073, 7416, 253, 21855, 4750, 387, 19629, 347, 247, 16125, 13372, 323, 253, 5215, 2952, 15, 496, 4695, 285, 4748, 13, 344, 369, 247, 14397, 3290, 1453, 8690, 387, 7758, 13, 2444, 323, 14397, 30468, 16955, 24747, 15, 1583, 1912, 253, 378, 5166, 3313, 11218, 275, 4748, 15, 496, 4267, 13, 672, 24747, 369, 14565, 347, 253, 1481, 8690, 387, 39492, 13, 50276, 17613, 6073, 3560, 779, 15, 754, 4307, 347, 247, 14397, 3290, 1453, 8690, 275, 4267, 285, 4332, 13, 1078, 1146, 15127, 281, 14397, 22513, 8690, 275, 4050, 285, 4072, 15, 187, 187, 39, 5166, 26962, 187, 4509, 4059, 949, 4240, 13, 11726, 6073, 369, 247, 14397, 30468, 387, 253, 401, 5166, 1268, 15, 496, 15956, 1047, 285, 15956, 1010, 13, 344, 369, 253, 14397, 30468, 327, 15731, 6421, 367, 602, 387, 3684, 9756, 2418, 15, 3032, 25774, 1060, 17045, 275, 253, 1755, 884, 275, 253, 401, 5166, 2709, 9050, 15, 496, 4022, 13, 11726, 6073, 7416, 35463, 36661, 610, 457, 84, 4750, 387, 3044, 6560, 3248, 2418, 347, 253, 14397, 30468, 13, 1078, 10884, 281, 3684, 9756, 2418, 275, 4240, 15, 754, 969, 5608, 347, 253, 14397, 30468, 15, 187, 187, 17967, 7758, 187, 688, 4765, 13, 11726, 6073, 27135, 959, 342, 16955, 24747, 672, 344, 7416, 253, 4750, 387, 3684, 7758, 347, 253, 4389, 11292, 8690, 15, 2064, 2952, 13, 344, 6518, 8690, 247, 5684, 326, 6726, 3307, 1614, 12239, 15, 187, 187, 5529, 515, 209, 187, 2214, 253, 6247, 2952, 13, 11726, 6073, 7416, 747, 1481, 8690, 31580, 11590, 457, 84, 4750, 387, 530, 23067, 347, 253, 820, 14, 1545, 3134, 30468, 285, 38521, 398, 8690, 15, 187, 187, 27129, 1495, 187, 187, 17613, 6073, 310, 432, 23860, 29091, 13, 20492, 15, 754, 20981, 342, 247, 4248, 275, 611, 1100, 10537, 15, 187, 187, 4941, 187, 187, 1413, 27, 14316, 952, 187, 1413, 27, 7878, 5842, 38521, 398, 187, 1413, 27, 7559, 47052, 33572, 5842, 3773, 187, 1413, 27, 18085, 273, 4201, 5816, 313, 22763, 952, 10, 2214, 1110, 32139, 13, 659, 2084, 310, 271, 427, 22897, 15185, 2022, 326, 9377, 715, 253, 9728, 6200, 342, 22042, 267, 17907, 15, 4325, 627, 13, 521, 789, 369, 7478, 407, 6671, 751, 444, 2480, 285, 10589, 41640, 11417, 497, 521, 17823, 285, 2165, 3640, 369, 44351, 375, 314, 2011, 4768, 253, 3963, 2952, 285, 14892, 14811, 15, 659, 2084, 310, 671, 1929, 323, 4882, 416, 3681, 316, 1329, 275, 2165, 608, 273, 253, 427, 22897, 47329, 1411, 18189, 898, 775, 455, 9562, 835, 253, 2619, 858, 417, 19021, 594, 973, 15, 187, 187, 1231, 2206, 1066, 342, 779, 281, 2312, 670, 849, 344, 1694, 3053, 275, 6884, 273, 7153, 1727, 13, 672, 354, 1132, 2210, 715, 253, 5406, 285, 849, 344, 3531, 715, 253, 4760, 344, 310, 3063, 15, 187, 187, 2347, 858, 368, 755, 3053, 275, 6884, 273, 7153, 1727, 32, 187, 187, 998, 2084, 27, 309, 908, 281, 320, 1180, 337, 275, 512, 253, 3958, 309, 4546, 1078, 6884, 533, 597, 497, 512, 3965, 1355, 15, 1893, 309, 3078, 619, 10861, 281, 2647, 3965, 1199, 594, 891, 5055, 253, 954, 4633, 2165, 15, 2756, 187, 2598, 368, 3965, 1199, 3260, 326, 1578, 4124, 369, 247, 1943, 2181, 326, 812, 320, 3531, 715, 247, 5249, 32, 187, 187, 998, 2084, 27, 20539, 309, 9047, 18605, 374, 3645, 84, 13, 352, 369, 625, 273, 247, 34057, 15, 2756, 187, 7371, 28002, 858, 368, 897, 281, 12394, 32, 187, 187, 998, 2084, 27, 309, 3965, 1199, 4546, 2712, 285, 3253, 619, 7583, 497, 305, 12784, 5519, 37152, 4097, 10718, 714, 74, 285, 4097, 1023, 7589, 6451, 497, 619, 30740, 15, 309, 4546, 247, 2257, 273, 5446, 1219, 43418, 1755, 285, 352, 2686, 3395, 11419, 323, 247, 2372, 15, 5220, 13, 427, 1920, 40014, 1329, 2210, 432, 479, 15, 187, 187, 998, 2084, 434, 6884, 2395, 19703, 521, 954, 4546, 28002, 281, 253, 987, 15, 187, 187, 6791, 309, 1642, 2139, 368, 9703, 1329, 347, 247, 2022, 32, 187, 187, 998, 2084, 27, 309, 908, 281, 320, 247, 1663, 1029, 1045, 80, 4260, 28967, 254, 751, 5958, 8319, 18605, 495, 15, 1723, 13, 10793, 891, 1132, 1411, 5847, 309, 1900, 755, 751, 247, 256, 12729, 29180, 19094, 15, 309, 369, 1620, 1663, 326, 1175, 387, 298, 18197, 533, 309, 1900, 1912, 407, 1907, 247, 8750, 3486, 275, 2285, 71, 4380, 5747, 1146, 2406, 275, 5328, 15, 1893, 891, 15433, 13, 2139, 13414, 891, 816, 1132, 247, 1698, 40389, 2554, 285, 1335, 452, 247, 1943, 3486, 534, 310, 2139, 891, 3053, 4882, 1329, 533, 891, 1132, 352, 247, 2372, 37819, 1321, 685, 247, 2622, 1329, 651, 15, 1269, 69, 2756, 187, 998, 2084, 434, 24325, 486, 3492, 326, 35560, 427, 1920, 965, 316, 1329, 281, 2740, 715, 253, 18605, 608, 30680, 15, 187, 187, 7161, 858, 634, 354, 5249, 1265, 32, 187, 187, 998, 2084, 27, 1893, 619, 354, 5249, 2686, 574, 247, 2581, 4722, 1265, 15, 309, 12165, 323, 427, 22897, 949, 253, 1527, 4426, 5425, 342, 5769, 14630, 44907, 313, 31312, 20909, 10589, 481, 3954, 253, 5599, 3515, 253, 2285, 13, 4907, 846, 2994, 13, 369, 26702, 439, 5102, 285, 3965, 1199, 2183, 11648, 327, 253, 2285, 247, 12190, 273, 8696, 281, 755, 441, 281, 1132, 2366, 15, 24161, 12656, 13, 359, 497, 1175, 2217, 281, 3330, 5747, 26476, 9815, 18752, 562, 387, 253, 1390, 1273, 285, 1907, 281, 6520, 776, 374, 480, 1947, 10787, 281, 4260, 15, 309, 1900, 1119, 352, 4722, 326, 253, 7205, 369, 2104, 281, 2794, 247, 5547, 2285, 342, 2717, 533, 8696, 28, 5476, 326, 457, 84, 253, 27736, 6200, 323, 14076, 15, 8863, 187, 2347, 497, 368, 2104, 281, 755, 8344, 407, 444, 2480, 32, 187, 187, 998, 2084, 27, 309, 3597, 562, 323, 444, 2480, 8523, 533, 387, 253, 673, 352, 4455, 597, 497, 3965, 873, 327, 36747, 2275, 15, 44943, 309, 369, 581, 273, 253, 806, 952, 597, 651, 3057, 672, 253, 2285, 3589, 457, 85, 2444, 562, 15, 8863, 187, 1147, 3133, 347, 604, 247, 2257, 273, 253, 3089, 9562, 6671, 452, 247, 2257, 273, 3237, 342, 11319, 15, 1284, 271, 427, 22897, 4760, 13, 752, 403, 1841, 326, 368, 651, 751, 281, 923, 416, 7173, 513, 281, 1056, 253, 3089, 9562, 6200, 1805, 32, 1359, 513, 368, 1928, 416, 7173, 476, 4993, 3076, 12851, 32, 187, 187, 998, 2084, 27, 427, 22897, 987, 1024, 310, 247, 2257, 273, 789, 323, 1652, 281, 642, 10921, 15, 12932, 920, 275, 3089, 9562, 2506, 457, 85, 1599, 1199, 984, 352, 457, 84, 773, 6309, 3089, 9562, 668, 285, 10305, 476, 320, 247, 5249, 17830, 15, 309, 1158, 416, 7173, 3198, 281, 1918, 625, 5445, 281, 253, 3089, 9562, 6200, 533, 309, 1053, 457, 85, 971, 281, 564, 1512, 3676, 715, 436, 984, 309, 1158, 597, 403, 2444, 327, 352, 15, 8863, 187, 48588, 672, 952, 403, 7591, 281, 19478, 323, 253, 418, 5166, 846, 581, 807, 13, 597, 564, 896, 281, 2143, 15, 6049, 452, 368, 6777, 281, 3297, 275, 253, 12085, 6200, 846, 767, 36509, 275, 427, 22897, 32, 187, 187, 998, 2084, 27, 11505, 314, 15555, 15, 309, 1849, 5262, 247, 2257, 273, 673, 327, 436, 2165, 2168, 285, 309, 1849, 12759, 594, 2810, 281, 418, 5166, 7019, 1024, 15, 309, 871, 309, 476, 1132, 387, 271, 418, 5166, 1268, 285, 309, 1663, 971, 281, 5276, 352, 15, 285, 537, 2143, 35058, 23385, 2756, 187, 1276, 310, 1633, 326, 19986, 368, 432, 643, 8525, 275, 253, 10566, 418, 5166, 32, 8035, 1039, 273, 4680, 670, 352, 310, 13, 23198, 752, 476, 368, 513, 326, 643, 8525, 588, 1620, 320, 2104, 281, 25464, 15, 187, 187, 998, 2084, 27, 309, 1849, 278, 1243, 1046, 2554, 387, 581, 1127, 387, 247, 3089, 9562, 1268, 594, 309, 476, 2096, 253, 38656, 273, 1016, 2554, 285, 671, 2173, 16928, 6355, 15, 2756, 187, 39204, 896, 281, 253, 427, 22897, 13, 1359, 513, 368, 1928, 670, 247, 2285, 751, 18189, 898, 3089, 9562, 687, 296, 2158, 247, 2285, 273, 577, 22129, 342, 581, 29938, 32, 3166, 368, 1158, 436, 310, 12207, 390, 513, 368, 1928, 253, 3089, 9562, 6200, 943, 2701, 253, 1180, 273, 22129, 591, 2285, 281, 1633, 751, 767, 32, 187, 187, 998, 2084, 27, 496, 619, 4743, 13, 352, 7024, 327, 253, 8208, 15, 2064, 310, 2139, 352, 434, 2834, 281, 1056, 4803, 1475, 15, 1310, 352, 369, 247, 18425, 665, 1904, 626, 755, 271, 418, 5166, 3959, 285, 3078, 281, 1978, 4882, 12085, 13, 840, 309, 1158, 352, 434, 4336, 34007, 326, 344, 1132, 275, 253, 427, 22897, 15, 17501, 13, 352, 1663, 17134, 398, 253, 3116, 273, 747, 12816, 1580, 2168, 4232, 3773, 403, 3965, 1199, 40806, 731, 562, 15, 2756, 187, 4045, 368, 1158, 16122, 2057, 253, 427, 22897, 390, 418, 5166, 812, 1361, 8415, 436, 1895, 32, 187, 187, 998, 2084, 27, 309, 1158, 627, 3198, 281, 320, 625, 25275, 323, 952, 281, 1132, 16, 24889, 275, 3089, 9562, 984, 987, 1024, 352, 29708, 35058, 15, 8863, 187, 2598, 581, 273, 253, 1841, 368, 4767, 369, 253, 3089, 9562, 2962, 3198, 625, 5445, 15, 2615, 368, 1375, 767, 643, 1841, 368, 923, 275, 418, 5166, 326, 310, 417, 4829, 387, 253, 1072, 1268, 275, 253, 3089, 9562, 2962, 32, 187, 187, 998, 2084, 27, 309, 1871, 1333, 2628, 7882, 1580, 3089, 9562, 6671, 11766, 7356, 2366, 323, 625, 685, 581, 8085, 15, 2756, 187, 1394, 1024, 452, 247, 2257, 273, 673, 281, 10347, 323, 253, 4240, 10039, 43531, 15, 1737, 513, 368, 2098, 327, 11138, 253, 954, 1309, 436, 42346, 32, 187, 187, 998, 2084, 27, 6408, 253, 42346, 309, 2098, 327, 11138, 2060, 17823, 285, 5999, 1050, 11891, 949, 14088, 15154, 285, 789, 327, 2285, 1993, 407, 12868, 275, 660, 3428, 84, 672, 1896, 15, 1244, 7487, 362, 24322, 15, 8863, 187, 6693, 11557, 20823, 32, 5220, 835, 513, 368, 923, 253, 10566, 6671, 2779, 15606, 387, 20490, 32, 187, 187, 998, 2084, 27, 1608, 483, 8349, 281, 512, 273, 619, 3438, 31907, 285, 21855, 4750, 13, 665, 452, 512, 10256, 479, 1633, 4451, 285, 38089, 15, 1608, 483, 483, 281, 619, 8644, 7458, 285, 3858, 665, 4035, 281, 1329, 479, 15, 1244, 432, 752, 309, 1849, 2326, 13, 309, 1158, 10566, 6671, 476, 46643, 323, 1755, 21927, 3658, 387, 20490, 15, 187, 187, 20517, 13, 5717, 368, 659, 2084, 323, 253, 9386, 4572, 15, 733, 310, 1900, 247, 11284, 281, 3984, 281, 3773, 326, 403, 387, 253, 268, 2966, 6929, 273, 6153, 253, 11419, 323, 12085, 6884, 273, 7153, 1727, 15, 187, 187, 31068, 27, 5987, 1358, 16705, 15, 681, 16, 45, 3008, 301, 998, 2084, 187, 187, 14191, 2682, 27, 5987, 1358, 2700, 15, 7553, 2682, 15, 18698, 16, 296, 2084, 412, 13000, 28521, 273, 253, 721, 2357, 36, 22158, 53, 10577, 327, 253, 9758, 257, 292, 49434, 8724, 10631, 366, 39853, 3320, 275, 18416, 1363, 342, 11454, 9402, 12834, 15, 187, 1231, 1304, 253, 1783, 273, 253, 721, 2357, 36, 22158, 53, 10577, 327, 253, 608, 13, 884, 14, 13006, 257, 292, 49434, 8724, 10631, 366, 39853, 3320, 275, 18416, 5760, 285, 2219, 273, 11454, 9402, 12834, 15, 15601, 318, 1783, 273, 11583, 1363, 342, 11454, 9402, 12834, 13, 8187, 14431, 13, 9654, 24593, 13, 285 ]
built a combined model of all views shared on the table. The participants on each table were mixed arbitrarily — national or department overlaps were by random only. For each table a transcript writer was selected and each group came together with a common shared meaning of the model built. Follow-up Session” We closed the Lego Serious Play workshop with the potentials identified at each table how to achieve the business goals. With this information the participants and upper management started a new workshop session to identify steps needed for implementation.Tommy Restivo Tommy Restivo is an American football coach and former player. He is currently the co-defensive coordinator at the University of Massachusetts Amherst. Playing career Restivo lettered at linebacker while playing for the Tigers of Georgetown College, graduating in 2006. Coaching career Early Coaching Career Following his playing career, Restivo joined the coaching staff at Marshall as a graduate assistant for the 2007 season. In 2008 and 2009, he was a defensive quality control coach at Florida, working for defensive coordinator Charlie Strong. They won the BCS National Championship in 2009. In 2010, when Strong was hired as the head coach at Louisville, Restivo followed him. He worked as a defensive quality control coach in 2010 and 2011, before being promoted to defensive backs coach in 2012 and 2013. FCS Experience From 2014 through 2017, Restivo was a defensive coordinator at the FCS level. In ’14 and ’15, he was the defensive coordinator on Buddy Pough at South Carolina State. His defenses here ranked in the top 10 in the FCS multiple categories. In 2016, Restivo joined Lance Guidry’s staff at McNeese State as the defensive coordinator, before returning to South Carolina State in 2017. He again served as the defensive coordinator. South Florida In 2018, Restivo reunited with Charlie Strong when he joined the staff at South Florida as the safeties coach. That season, he helped coach a defense that forced 22 turnovers. UMass For the 2019 season, Restivo joined new head coach Walt Bell’s staff at UMass as the co-defensive coordinator and linebackers coach. Personal life Restivo is from Toledo, OH. He graduated with a degree in Kinesiology. References Category:Living people Category:American football linebackers Category:Georgetown Tigers football players Category:Year of birth missing (living people)For those unfamiliar, Stunt is an NACS Support main that broke into the league scene with Astral Authority. From there, his work was recognized by teams like Ember and Team Liquid Academy were his mechanics and game knowledge was continuosly shown throughout the regular season and promotion tournament. Stunt is also known for playing Rammus support in game 5 of the NACS Finals against Cloud 9 Challenger where the pick did not fare so well. We sat down with him to talk about how he got started in League of Legends, when pro play came into the picture and how he turned into the player he is today. How did you get started in League of Legends? Stunt: I used to be number 1 in all the games I played before League but they were all pretty small. So I wanted my skill to matter pretty much so i picked the most popular game. So you pretty much knew that esports was a big thing that could be turned into a career? Stunt: Until I watched Season 2 Worlds, it was more of a hobby. Which champions did you use to climb? Stunt: I pretty much played anything and everything my favorite were gimmicks tho AP Master Yi and AP Sejuani were my favorites. I played a lot of AD Alistar top and it actually became meta for a bit. Also, Nautilus support came from me. Stunt's League account displaying his most played champions to the right. May I ask why you chose support as a main? Stunt: I used to be a really high elo mid laner like rank 51 Season 3. However, whenever i play against pros I always get like a sizable cs deficit. I was never really that good at laning but I always won by having a bigger impact in teamfights despite being lower in gold. So i figured, why dont i just play a low econ role and still have a big impact which is why i started playing support but i play it a bit greedier than a normal support would. xd Stunt's montage video that sparked Nautlius support to break into the Season 5 Meta. Where did your pro career start? Stunt: So my pro career actually had a rather interesting start. I qualified for NACS through the open qualifier with Samadder Gaming (later Dream Team). Now the guy running the team, named after himself, was kinda shady and pretty much told everybody on the team a bunch of lies to get us to play together. Against expectations, we were good enough to win despite Arcsecond dropping out at the last second and having to flex our 2 junglers to mid. I always found it interesting that the manager was able to create a successful team with nothing but lies; guess that’s the amateur scene for ya. How were you able to get noticed by Ember? Stunt: I tried out for Ember initially but at the time it seemed they were pretty set on Gleeb. Naturally I was one of the first people they would contact when the team wasn’t working out. It seems as if a lot of the challenger teams have a lot of problems with infrastructure. As an NACS player, what are things that you would like to see Riot do to make the challenger scene better? How do you feel Riot can fix bad ownership? Stunt: NACS right now is a lot of work for little to no reward. Winning in challenger doesn’t mean much because it’s “just challenger” and losing can be a career killer. I think Riot needs to give more exposure to the challenger scene but I don’t want to go too deep into this because I think they are working on it. Usually when people are unable to qualify for the LCS after one year, they go back to school. Why have you chosen to stay in the competitive scene after two splits in NACS? Stunt: Mainly pride. I've spent a lot of time on this game already and I've gotten so close to LCS twice now. I know I can play at an LCS level and I really want to prove it. and.. school sucks lol What is something that differs you from other supports in the NA LCS? Another way of thinking about it is, mentally what can you do that other supports will never be able to replicate. Stunt: I've mained every role at one point at a challenger level so I can understand the mentality of each role and also specific champion interactions. Going back to the NACS, How do you feel about a team like Cloud 9 challenger rostering a team of 4 veterans with one rookie? Do you think this is acceptable or do you feel the challenger scene should limit the number of veterans per team to something like two? Stunt: In my opinion, it depends on the intention. That is why it's difficult to make rules around. If it was a veteran who didn't get an LCS offer and wanted to keep playing competitive, then I think it's completely understandable that he play in the NACS. Otherwise, it really hinders the growth of new talent since already established players are pretty much shutting them out. Do you think expanding either the NACS or LCS could help solve this problem? Stunt: I think there needs to be more incentive for people to play/invest in challenger because right now it frankly sucks. So one of the things you stated was the challenger series needs more exposure. Can you state two other things you see in LCS that is not nearly at the same level in the challenger series? Stunt: I'd say job stability since challenger teams rarely stick together for more than one split. You now have a lot of time to prepare for the 2017 Spring Split. What do you plan on improving the most during this offseason? Stunt: During the offseason I plan on improving individual mechanics and situational awareness through solo queue and work on teamplay by filling in scrims when possible. And watching vods. Any shout outs? Also where do you see the NA teams likely placing at worlds? Stunt: Shoutouts to all of my former teammates and coaching staff, who have all taught me something unique and invaluable. Shoutout to my amazing fans and friends who continue to support me. And from what I've seen, I think NA teams can vy for top placements at worlds. Again, thank you Stunt for the wonderful interview. It is always a pleasure to speak to players that are at the pinnacle of creating the meta for competitive League of Legends. Twitter: https://twitter.com/LiquidStunt Twitch: https://www.twitch.tv/stuntopolisAssociation of the 677C-->T mutation on the methylenetetrahydrofolate reductase gene in Turkish patients with neural tube defects. We report the analysis of the 677C-->T mutation on the 5, 10-methylenetetrahydrofolate reductase gene in Turkish controls and cases of neural tube defects. Mutation analysis of 91 patients with neural tube defects, 72 mothers, 63 fathers, and
[ 13, 4567, 49, 14, 22027, 17016, 310, 2223, 5611, 715, 3882, 390, 5771, 13, 970, 3882, 21028, 309, 13, 253, 611, 5025, 319, 10087, 13, 390, 5771, 21028, 15, 13951, 39237, 13130, 3882, 390, 5771, 476, 840, 320, 908, 281, 2736, 24389, 3394, 407, 26041, 11282, 3756, 390, 13, 8489, 7938, 13, 275, 247, 6264, 38968, 303, 3800, 313, 23759, 2385, 481, 13951, 4507, 3082, 403, 1335, 1146, 908, 275, 1142, 30684, 13, 275, 15866, 273, 7654, 7742, 14, 84, 33816, 10132, 285, 7324, 432, 7938, 14238, 13, 984, 597, 403, 4122, 7996, 15, 187, 187, 424, 43493, 263, 47785, 6019, 43082, 47785, 824, 347, 7966, 336, 460, 390, 13882, 351, 6771, 403, 4122, 7996, 12726, 8094, 13, 1066, 281, 253, 14402, 297, 6062, 2491, 15, 43082, 40197, 14, 22027, 8740, 403, 908, 275, 1872, 10888, 285, 4554, 10888, 14006, 15, 496, 5019, 342, 247, 894, 256, 5521, 313, 39, 22897, 426, 11348, 14, 18132, 894, 256, 5521, 582, 597, 9659, 13130, 1341, 281, 320, 9070, 432, 440, 22027, 1341, 387, 18819, 273, 337, 13, 933, 1341, 1054, 1253, 18, 390, 625, 15, 831, 5199, 310, 908, 275, 894, 16775, 13, 299, 15, 305, 904, 323, 23694, 378, 1341, 432, 308, 1341, 846, 21473, 2173, 22240, 8653, 327, 616, 2553, 13, 285, 323, 9712, 273, 6804, 11048, 273, 9574, 846, 21473, 2891, 251, 14, 6160, 6430, 273, 616, 1668, 52, 30509, 407, 24389, 313, 39, 14535, 426, 11348, 275, 14, 12198, 86, 24389, 10, 313, 23759, 3566, 481, 21106, 18394, 16817, 323, 3882, 403, 19058, 7941, 14, 18942, 285, 5105, 29455, 43903, 313, 23759, 1235, 481, 187, 187, 424, 3546, 49481, 6019, 20901, 281, 253, 12726, 8094, 5393, 594, 2080, 13, 12807, 452, 253, 5750, 273, 2007, 22474, 271, 6981, 434, 7340, 407, 2625, 17442, 15, 831, 2867, 310, 3340, 4217, 323, 11745, 16101, 29240, 15, 36727, 12807, 326, 403, 908, 2223, 403, 28790, 30577, 285, 43347, 45158, 763, 34596, 313, 23759, 9726, 481, 7160, 9969, 476, 320, 38284, 275, 15666, 32541, 13, 407, 4640, 10398, 4721, 13, 390, 2359, 2755, 16671, 313, 23759, 22029, 481, 1310, 16504, 7480, 390, 3554, 300, 6059, 7480, 9548, 6981, 14238, 403, 908, 13, 253, 7340, 778, 3986, 268, 4173, 14, 390, 1014, 863, 297, 6062, 5481, 7787, 15, 3308, 13, 247, 1077, 7996, 7241, 310, 253, 897, 273, 43347, 45158, 763, 34596, 347, 247, 12726, 9548, 275, 5019, 342, 13231, 311, 13, 247, 268, 384, 267, 280, 3527, 4309, 534, 2722, 2266, 42832, 6466, 2220, 16664, 15, 187, 187, 424, 19224, 1004, 3855, 249, 285, 1794, 26834, 14, 296, 22316, 580, 21480, 6019, 2053, 17110, 403, 2223, 908, 281, 4564, 247, 12726, 12570, 281, 253, 9303, 44014, 281, 320, 5867, 15, 11568, 1004, 3855, 249, 313, 6784, 426, 33956, 15, 3583, 10, 310, 247, 28972, 326, 476, 320, 9904, 281, 247, 18379, 3066, 697, 30824, 1387, 1293, 30809, 342, 24389, 3394, 15, 733, 22294, 342, 1029, 15430, 313, 740, 1253, 26, 353, 10, 281, 247, 2173, 8092, 326, 476, 320, 13130, 342, 2710, 12726, 8094, 15, 329, 2074, 985, 310, 1794, 26834, 14, 296, 22316, 580, 21480, 313, 47854, 884, 1253, 740, 353, 481, 187, 187, 424, 7475, 1999, 9588, 6019, 47493, 2844, 3608, 326, 2127, 323, 12726, 4324, 13276, 34591, 3394, 281, 320, 9086, 5867, 15, 346, 22036, 14, 11300, 3, 9273, 313, 23759, 3763, 582, 323, 4227, 13, 310, 1754, 327, 247, 18242, 14, 17861, 3882, 3425, 12425, 323, 247, 10087, 273, 8361, 14, 42957, 44555, 15, 1310, 5639, 3882, 310, 13400, 1561, 436, 10087, 13, 352, 476, 642, 3356, 13503, 253, 32795, 3882, 326, 11646, 323, 253, 5780, 629, 273, 436, 9548, 13, 285, 37372, 2879, 5937, 7736, 6605, 1594, 14, 9896, 313, 22, 14, 67, 409, 80, 14, 21, 14, 19700, 80, 14, 20, 14, 527, 311, 1190, 14, 5346, 14, 37, 14, 42957, 1938, 4011, 23427, 10, 476, 642, 3356, 320, 20399, 4337, 281, 247, 4797, 18722, 15, 8035, 1077, 4217, 6380, 10705, 310, 17578, 313, 11707, 16094, 2601, 582, 3692, 3320, 369, 26877, 432, 247, 39018, 12306, 15, 12414, 667, 3081, 16007, 13, 17578, 2722, 2266, 11348, 15, 380, 17578, 3320, 476, 320, 908, 347, 247, 12726, 281, 7568, 12634, 1159, 13, 3320, 2048, 13, 390, 3320, 7248, 15, 10467, 25391, 3608, 26877, 432, 3289, 31652, 390, 2359, 29951, 403, 908, 323, 253, 1072, 4096, 13, 533, 24426, 273, 253, 4469, 12726, 4324, 4419, 253, 1635, 273, 271, 9548, 6605, 313, 33986, 9393, 249, 390, 1086, 14983, 13, 2975, 481, 187, 187, 817, 27057, 1375, 30734, 313, 3528, 39, 10, 187, 187, 424, 13425, 6019, 27057, 1375, 30734, 13, 2223, 2931, 347, 346, 1592, 16977, 1293, 253, 3361, 273, 1959, 1824, 937, 310, 247, 5899, 30734, 5199, 1335, 7561, 908, 323, 253, 9008, 273, 8388, 16390, 2739, 15, 46741, 6667, 403, 253, 3275, 273, 19175, 12364, 13, 3731, 80, 390, 1565, 365, 73, 313, 23759, 13391, 481, 496, 253, 2393, 1897, 273, 1794, 24377, 13, 352, 369, 671, 7561, 908, 323, 253, 6833, 273, 25158, 3580, 824, 347, 4851, 695, 3527, 313, 23759, 16607, 10, 390, 2739, 12807, 313, 23759, 20333, 582, 533, 556, 644, 8127, 7932, 275, 4491, 3063, 407, 43923, 30734, 15, 17746, 13, 13575, 39, 556, 644, 2502, 2865, 3111, 285, 310, 1146, 14859, 323, 253, 6833, 273, 9015, 43460, 285, 2074, 7006, 275, 253, 7792, 273, 346, 4193, 410, 71, 7068, 447, 449, 313, 23759, 15148, 10, 187, 187, 424, 24436, 4753, 6019, 21910, 8288, 13, 13575, 39, 7259, 403, 6571, 908, 281, 823, 1318, 281, 8138, 4753, 824, 347, 18173, 1308, 266, 13, 19175, 390, 8574, 24732, 12359, 15, 9613, 19081, 8287, 342, 26023, 11048, 313, 23759, 13391, 10, 390, 6179, 323, 253, 3116, 273, 42864, 30250, 13, 253, 9305, 4753, 403, 4536, 49640, 275, 1340, 281, 7278, 253, 4719, 273, 19818, 917, 8618, 15, 187, 187, 424, 25810, 21072, 6019, 13575, 39, 310, 247, 5899, 5028, 323, 28056, 824, 347, 795, 1909, 43912, 21306, 64, 8709, 313, 23759, 1093, 582, 984, 1465, 13203, 3116, 13, 347, 342, 643, 28056, 13, 4483, 323, 271, 7126, 24280, 273, 16007, 285, 3021, 323, 1175, 1885, 11026, 15, 1723, 13, 9094, 9346, 313, 43460, 582, 418, 514, 706, 317, 3370, 313, 90, 462, 321, 1641, 10, 313, 23759, 13210, 10, 390, 41561, 3370, 313, 47, 44530, 10, 403, 671, 1146, 7091, 15, 187, 187, 424, 7573, 18027, 6019, 496, 253, 9008, 273, 5899, 2739, 3580, 824, 347, 13, 299, 15, 305, 904, 31837, 9314, 376, 307, 313, 23759, 13210, 582, 8582, 365, 73, 390, 41621, 13, 5899, 43021, 403, 1335, 1146, 908, 15, 1198, 9787, 10264, 273, 3580, 13, 10665, 789, 327, 11369, 285, 1232, 1453, 556, 644, 2218, 15, 1284, 253, 2234, 7364, 273, 13575, 39, 403, 2280, 3700, 313, 23759, 3953, 582, 8570, 273, 4884, 4250, 13, 16101, 5760, 285, 1232, 14053, 13, 1199, 789, 556, 644, 6828, 4404, 841, 3374, 15, 7532, 3700, 3798, 7033, 281, 6605, 2289, 285, 13, 275, 34796, 30250, 13, 281, 7768, 15, 6295, 3198, 476, 320, 10048, 407, 8133, 253, 6605, 14, 18227, 7397, 1204, 7802, 327, 15492, 47902, 47987, 456, 492, 698, 15, 6235, 19249, 273, 4884, 4250, 310, 247, 1534, 5691, 285, 556, 644, 9713, 407, 2329, 8230, 398, 13, 4812, 4250, 3700, 10855, 390, 1824, 12356, 19708, 1507, 15, 1623, 247, 4891, 6605, 13, 1824, 2425, 1364, 320, 6537, 347, 352, 310, 2223, 4619, 1097, 281, 20180, 3116, 285, 1885, 4702, 15, 6610, 13, 1232, 1783, 313, 23759, 4196, 10, 275, 247, 4891, 985, 310, 417, 15246, 13, 285, 3082, 824, 347, 2494, 1179, 263, 41696, 13, 18368, 14, 16702, 390, 2822, 20542, 1783, 313, 5518, 3027, 13, 47067, 582, 42100, 14, 6209, 272, 4095, 824, 347, 15679, 390, 15679, 14, 3338, 13, 1824, 2600, 21652, 407, 23225, 1783, 13, 390, 2460, 1783, 452, 644, 7091, 15, 6676, 273, 841, 7259, 403, 762, 1263, 13, 285, 5661, 22578, 11809, 452, 644, 8156, 13, 323, 1650, 13, 275, 247, 11593, 44432, 33947, 4232, 407, 411, 356, 2980, 257, 2499, 13, 275, 253, 1503, 1105, 302, 261, 22578, 3715, 407, 253, 4145, 1267, 2277, 5197, 273, 7812, 81, 437, 1321, 390, 407, 253, 48758, 302, 911, 1794, 410, 5906, 28136, 387, 253, 18526, 6453, 275, 443, 338, 14, 9960, 14, 58, 48359, 15, 1876, 841, 11809, 403, 271, 3177, 281, 1287, 13575, 39, 715, 247, 4122, 41374, 5199, 13, 285, 16424, 452, 644, 1160, 275, 1232, 14053, 13, 533, 13, 604, 2429, 281, 43923, 30734, 13, 1643, 4870, 452, 4925, 29791, 15, 496, 6010, 13, 13575, 39, 556, 253, 11361, 273, 1698, 14, 16736, 3420, 13, 247, 2581, 27296, 1794, 410, 5906, 313, 70, 15, 305, 904, 23361, 10, 2216, 13, 1643, 15942, 3237, 285, 2969, 15450, 5162, 313, 23759, 12347, 10, 313, 27978, 1824, 11998, 582, 533, 627, 403, 12748, 275, 4311, 14, 484, 285, 1232, 1453, 15, 13575, 39, 310, 908, 323, 253, 3275, 273, 2739, 9548, 24170, 275, 247, 20846, 8020, 1232, 313, 70, 15, 305, 904, 31001, 14, 615, 4971, 272, 12807, 13, 268, 41105, 1169, 582, 285, 323, 253, 6833, 273, 690, 1774, 5899, 2739, 36993, 824, 347, 19175, 12364, 15, 187, 187, 424, 52, 899, 12364, 6833, 313, 25559, 3740, 481, 424, 313, 23759, 13391, 10, 37629, 9305, 4753, 323, 19175, 12364, 9008, 403, 247, 3511, 14, 7779, 4908, 273, 19175, 26022, 285, 271, 4503, 2408, 273, 38240, 18173, 15, 831, 310, 6804, 342, 247, 26023, 4466, 273, 795, 1909, 43912, 21306, 390, 30608, 3348, 64, 313, 32307, 671, 795, 34, 15, 594, 75, 3348, 64, 390, 795, 34, 15, 21526, 1792, 11824, 4795, 275, 247, 346, 7381, 8020, 3, 835, 41561, 3370, 13, 15727, 285, 418, 514, 706, 317, 3370, 403, 671, 1246, 15, 7243, 247, 20180, 3114, 556, 3715, 13, 253, 20846, 8020, 310, 6804, 342, 25319, 7043, 313, 3528, 39, 10, 390, 342, 1308, 460, 313, 88, 292, 30734, 10, 285, 1517, 7184, 323, 347, 1048, 347, 2067, 2607, 275, 346, 20014, 21206, 3, 30734, 20470, 15, 6408, 2298, 21206, 40436, 13, 795, 34, 15, 390, 30608, 3348, 64, 13471, 1066, 253, 13723, 285, 19175, 4324, 715, 1959, 8898, 9532, 285, 13081, 1714, 28735, 13, 285, 253, 18173, 31001, 715, 2969, 36984, 15, 7648, 8898, 2390, 285, 8618, 355, 18054, 2390, 8008, 275, 253, 594, 14, 8890, 7057, 41936, 4884, 13, 4283, 281, 247, 3644, 14, 33167, 3295, 15, 418, 9994, 3527, 9574, 42990, 253, 36984, 715, 298, 9994, 3527, 13, 285, 795, 52, 17282, 36315, 64, 11330, 690, 16075, 13, 534, 949, 15174, 285, 6561, 30734, 10513, 7418, 13746, 7006, 6867, 273, 19175, 12364, 15, 831, 2570, 1232, 556, 644, 16575, 5867, 15, 380, 10761, 9130, 273, 253, 19817, 30250, 3206, 313, 34467, 11048, 10, 403, 973, 7192, 13, 285, 1016, 2014, 1232, 3213, 556, 644, 18325, 15, 1284, 247, 906, 13, 19175, 12364, 476, 320, 1517, 7184, 275, 247, 13575, 39, 1232, 387, 247, 38041, 2074, 281, 10562, 40436, 407, 43923, 30734, 15, 1707, 403, 1142, 19112, 273, 19175, 12364, 26791, 4768, 10497, 15, 187, 187, 817, 443, 18639, 30250, 187, 187, 424, 13425, 6019, 12761, 21072, 403, 30481, 2057, 327, 4891, 23491, 313, 26555, 30621, 10, 390, 275, 5558, 4466, 313, 2377, 34700, 30621, 481, 496, 9965, 4679, 13, 21703, 10855, 390, 17941, 892, 6579, 30950, 15, 6166, 9787, 2515, 13, 1794, 410, 46435, 403, 253, 30621, 12671, 273, 4327, 15, 380, 5889, 273, 253, 4466, 4646, 310, 273, 2234, 6349, 323, 1885, 4702, 15, 496, 954, 2219, 13, 17969, 407, 19231, 1250, 30250, 310, 10432, 407, 970, 25850, 30621, 2515, 15, 187, 187, 424, 2809, 640, 892, 6579, 6019, 380, 2629, 12671, 403, 8024, 5025, 1405, 7885, 892, 6579, 342, 38393, 868, 313, 14653, 342, 7318, 15, 2456, 1253, 5388, 14141, 5558, 582, 4508, 247, 25850, 5558, 23281, 2900, 15, 473, 38190, 22185, 310, 17839, 407, 18577, 253, 892, 6579, 327, 247, 5461, 493, 19822, 33561, 390, 305, 6147, 839, 439, 4584, 15, 2091, 39861, 9574, 403, 281, 320, 8228, 13, 7768, 310, 5176, 432, 253, 23281, 4646, 407, 25317, 285, 6797, 38046, 13, 3560, 407, 1635, 273, 32788, 15514, 2052, 366, 15, 3840, 10885, 310, 2218, 762, 271, 473, 19, 14, 4924, 25850, 21613, 15, 187, 187, 424, 16621, 410, 46435, 424, 313, 1592, 420, 398, 10, 403, 4581, 44262, 342, 247, 5350, 273, 337, 418, 281, 2239, 6783, 278, 20, 15, 496, 253, 2629, 13, 29087, 1794, 410, 5906, 13 ]
, 32P-labeled phosphate is often introduced into DNA or RNA, using DNA polymerase I, the Klenow fragment, or RNA polymerase. Radioactively labeled DNA or RNA can then be used to detect hybridization events by autoradiography or, somewhat faster, in a commercial phosphoimager (→48). Radioactive methods are still being used in many laboratories, in spite of strict radiation-safety regulations and competition from faster protocols, because they are highly sensitive. **Fluorophores.** Fluorophores such as fluoresceine or rhodamine are highly sensitive reporter molecules, down to the picomolar range. Fluorophore-labeled antibodies are used in histochemical and cytochemical investigations. In combination with a cell sorter (FACS = fluorescence-activated cell sorter), they permit labeled cells to be separated from unlabeled cells at speeds of 1,000 cells min–1 or more. This procedure is used in cell biology, e. g., for separating B cells from T cells after labeling specific antigens displayed on their surface, and for separation of mixed cultures of bacteria after labeling taxon-specific sequences of their 16S rRNA by hybridization (FISH = fluorescence in-situ hybridization) (→74). Fluorescence reporters for DNA are SYBR-Green and ethidium bromide (→50). **Enzymes.** Compared to the reporter molecules mentioned so far, enzymes have the advantage of further enhancing an assay's sensitivity by signal amplification. This property is especially useful for quantitative analytical determinations. Reporter enzymes that are used often are alkaline phosphatase and horseradish peroxidase (→256). Their reactions can be assayed in biosensors, by electrochemistry, or photometrically (→258). If fluorometric or chemiluminometric enzyme assay protocols are used, the sensitivity may reach pico- or even attomolar detection limits. Thus, a very sensitive protocol is the use of horseradish peroxidase as a reporter enzyme in combination with luminol, a phtalic acid derivative which shows strong luminescence upon oxidation. **Digoxigenin and biotin-streptavidin.** These chemicals are often used to couple a reporter molecule to the biomolecule to be analyzed. Digoxigenin (MR = 390.52) is a steroid that can be coupled to a nucleotide via its hydroxy group without interfering with hybridization events. It binds with high affinity (10–9 M) to a specific antibody that can be labeled with various reporter molecules. A similar system is biotin-streptavidin (affinity 10–10 M). **Genetic markers.** Introducing genes that code for reporter proteins enables cloning events to be rapidly analyzed. "Blue-white" screening (→62), for instance, is based on a plasmid-borne DNA sequence coding for a fragment of β-galactosidase. If foreign DNA is inserted within this fragment, it can no longer complement the chromosomal DNA that codes for the remaining part of this enzyme, and externally added chromogenic substrate X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) can no longer be hydrolyzed to a blue dye. Another very useful genetic marker is GFP (green fluorescent protein), whose gene was cloned from a jellyfish. Without any additional substrates, GFP shows strong fluorescence. The GFP gene can be used as a reporter to demonstrate promoter function, gene expression, or gene regulation. Luciferase genes cloned from fireflies or photobacteria are used for the same purpose, but visualization of the expressed reporter proteins requires the addition of an enzyme substrate (luciferin or decanal, respectively). ## Solid state fermentation (SSF) **General.** Solid state fermentation, often defined as "fermentation without the presence of free water," is a traditional fermentation procedure still widely used for the preparation of fermented food. Important examples are the production of soy sauce, miso or tempeh (→114). In the early days of biotechnology, it was also widely used for the manufacture of fungal products such as citric acid (→146) or food enzymes (→172), but has been largely replaced in industry today by submerged fermentation. Recently, SSF has been rediscovered and is being explored for the manufacture of bioethanol and similar compounds in the framework of "biorefineries." (→138) **Raw materials.** Generally speaking, SSF procedures are mostly used to add value to waste materials such as wheat bran, soy or coffee bean residues. Before inoculating with starter cultures (→114) or waiting for the growth of airborne microorganisms, the raw materials are sometimes pretreated in order to enhance the concentration of digestible sugar. **Microorganisms.** SSF is a traditional domain for fungi such as _Aspergillus_ strains (→18), because hyphal growth, as with other fungi, allows for an excellent penetration of substrates and thus for good product yields. However, yeasts (ethanol), Lactobacilli (yogurts) (→116) or Bacilli (Natto) are also being employed. **Technology.** In the preparation of traditional food products such as, e. g., Sauerkraut (→116), Tempeh or cocoa, traditional crafts are still being used. For industrial manufacturing of products, considerable work on engineering and process control has been done. As the key limitations of SSF are mass transfer (→94), removal of reaction heat, analytical controls and process modeling, much work has been directed towards these issues. Mass transfer usually relates to substrate access and, in aerobic microorganisms, to oxygen. Both needs can be satisfied by putting the substrate-microorganism mixture on gently agitated percolated trays. Removal of reaction heat is a significant challenge and has been addressed by air blowers, internal heat transfer plates or water cooling jackets. On a solid substrate, water activity must be controlled as it is often critical both to microbial growth and product formation. Finally, process analysis (→96) in a solid system is not straightforward, and methods such as microcalorimetry, Fourier-transform or near infrared analysis (FTIR, NIR), aroma-sensing devices such as GC or GC-MS, water content quantification by microwave analysis, or image analysis have been employed. Many of these procedures are under study, and experimental reactor designs have been realized, for example, in a horizontal paddle mixer established by Wageningen University, in the Zymotis reactor developed by the ORSTOM Center of Montpellier or by the Platotex bioreactor engineered at the CNRS in Gif-sur-Yvette. All these designs are an attempt to develop SSF into a highly reproducible procedure, and advances have been made in process modeling, but, if compared to submerged fermentation, few processes have reached maturity. In summary, SSF has the advantages of low-cost media, a rather inexpensive bioreactor (e. g., tray) design, few operational problems and simple downstream processing (→108) (usually water extraction), but there are difficulties in scale-up and process control. SSF is used for the production of food enzyme mixtures in a koji process (e. g., starch-degrading enzymes, pectinases), and for the manufacture of some important traditional food additives such as soy sauce. **Soy sauce manufacture (Japanese style).** (→114) Traditional raw materials for soy sauce preparation are a hot-water extract of soybeans and an equal amount of roasted wheat. This is mixed with a starter culture of _Aspergillus oryzae_ (sometimes also _A. sojae_ or _A. tamari)_ resulting in a "koji" where Bacilli, yeast and Lactobacilli are also present. Once a microbial community has developed, the koji is mixed with coarse salt (SSF) or with brine (wet fermentation) and brewed for as long as several months in "moromi" fermentation tanks. During moromi brewing, _A. oryzae_ breaks down the grain and soy proteins into free amino acids and oligopeptides, and the wheat starch into simple sugars. Free amino groups and sugar aldehyde groups interact in the so-called Maillard reaction, leading to a dark-brown color. Lactic acid bacteria ferment the sugars into lactic acid, and _Saccharomyces_ produces some ethanol, which through aging and secondary fermentation creates numerous flavor compounds typical of soy sauce. This complex process has been thoroughly analyzed. The metabolic pathways of the standardized microorganisms involved (starter cultures) are well understood, and each single process step has been optimized. As a result, soy sauce can be brewed in a SSF process at a reproducibility similar to beer brewing by submerged fermentation. There are many varieties of soy sauce flavors throughout Asia. ## Growing microorganisms **General.** Microorganisms are cultivated either on solid nutrients (surface cultivation) or in liquid culture (submerged cultivation). In laboratory experiments, agar plates or shake flasks prevail. Under industrial conditions, bioreactors are the cultivation vessels of choice. The composition of the culture medium is of key importance for product formation. In most cases, contamination by undesired microorganisms is excluded by using sterile cultivation conditions. **Shake flasks.** The standard vessels are Erlenmeyer flasks with baffles (filled with ca. 50–500 mL liquid), containing a sterile liquid nutrient solution. Oxygen saturation is assured by shaking the flasks on a thermostatted reciprocal or gyrating shaker. When anaerobic bacteria are to be grown, oxygen is removed from the nutrient medium by boiling and degassing, followed by addition of thiogycolate. Further handling is done under an O2-free sterile hood. **Bioreactors** (fermenters) are closed reactors with a capacity of 1 L to > 500 m3. In the standard, stirred bioreactor,
[ 2600, 15, 10338, 2119, 368, 5731, 436, 1529, 673, 387, 2378, 537, 19515, 2403, 1270, 5017, 2, 5717, 368, 2, 187, 187, 8620, 13406, 1841, 1060, 15, 3954, 309, 717, 16088, 9995, 281, 14218, 634, 1501, 15, 38658, 368, 1077, 1199, 285, 309, 717, 816, 2819, 6386, 281, 3057, 368, 15, 3166, 368, 971, 281, 4496, 5926, 479, 271, 299, 14, 5719, 32, 187, 187, 25821, 403, 4581, 15, 187, 187, 1628, 42, 457, 78, 271, 2102, 74, 35, 23173, 11602, 187, 187, 12764, 13, 309, 717, 399, 81, 657, 763, 88, 518, 21401, 247, 16132, 25694, 24773, 285, 30278, 6485, 1754, 275, 1457, 14, 13569, 5801, 13, 5427, 15, 309, 789, 342, 747, 37735, 13, 30440, 13, 31847, 13342, 13, 285, 41982, 15, 309, 717, 247, 23932, 20299, 1063, 285, 309, 3630, 13, 3984, 13, 285, 7279, 6571, 670, 1359, 281, 5311, 12192, 13, 30278, 3668, 13, 3580, 10123, 13, 496, 9458, 25694, 13, 8404, 11263, 9137, 3966, 15, 187, 187, 4045, 368, 971, 281, 11075, 271, 15650, 21001, 7116, 10518, 32, 187, 187, 8252, 22915, 432, 1388, 581, 1293, 1469, 9825, 15, 187, 187, 8398, 368, 2, 187, 187, 1394, 452, 8379, 7416, 776, 30710, 1618, 15, 187, 187, 44427, 3189, 1623, 6745, 187, 187, 3220, 5863, 4202, 7225, 1040, 3617, 462, 1981, 187, 187, 4967, 309, 28890, 16132, 25694, 32, 3052, 309, 9872, 16132, 25694, 27560, 386, 496, 19950, 13, 31870, 32, 187, 187, 4553, 17388, 13, 309, 452, 1142, 4606, 281, 5206, 16132, 25694, 347, 247, 5249, 15, 309, 2389, 281, 1056, 2561, 13, 3166, 253, 1783, 273, 253, 4422, 13, 3166, 9137, 13, 285, 789, 2556, 281, 619, 1659, 285, 619, 673, 326, 2139, 309, 5966, 715, 7336, 10721, 15, 11056, 13, 309, 717, 247, 31847, 21955, 285, 309, 476, 1908, 4266, 347, 247, 16132, 25694, 27560, 386, 285, 6485, 1754, 275, 19950, 13, 5427, 15, 187, 187, 41, 603, 271, 40900, 3105, 271, 13677, 15, 5057, 253, 9567, 16132, 25694, 2579, 323, 15023, 285, 11864, 322, 1025, 10518, 265, 275, 5427, 390, 11762, 15, 2752, 15040, 310, 253, 20162, 273, 3515, 1029, 27012, 2006, 38207, 27069, 84, 1880, 326, 310, 949, 619, 4751, 7303, 3055, 5268, 789, 13, 285, 619, 25021, 15, 3166, 368, 452, 667, 1953, 670, 1359, 281, 1265, 16132, 25694, 347, 247, 5249, 32, 309, 651, 751, 281, 1361, 368, 342, 634, 5865, 9137, 5249, 285, 309, 476, 671, 1361, 368, 342, 634, 3909, 42440, 13, 9137, 13, 14892, 285, 28064, 15, 187, 187, 1394, 476, 5206, 752, 368, 971, 281, 3037, 2, 187, 187, 4967, 30278, 310, 46741, 323, 634, 10518, 32, 187, 187, 6175, 367, 5077, 778, 4446, 625, 11784, 285, 8404, 3420, 778, 320, 1774, 323, 634, 10518, 533, 8708, 30278, 310, 253, 27882, 273, 3909, 3361, 15, 1893, 13, 3166, 368, 878, 30278, 6485, 275, 19950, 313, 31870, 10, 390, 1310, 368, 971, 281, 871, 849, 30278, 1361, 634, 2136, 285, 6635, 253, 4623, 7731, 15, 7764, 1281, 479, 871, 13, 309, 651, 320, 5211, 281, 1361, 368, 15, 22032, 441, 187, 187, 21020, 247, 12232, 2554, 275, 776, 789, 187, 187, 18281, 275, 253, 18349, 285, 9413, 625, 670, 253, 5796, 1951, 285, 616, 6281, 15, 30706, 1146, 247, 21392, 31409, 285, 1132, 247, 9560, 2554, 275, 24279, 841, 5389, 9195, 285, 616, 9410, 323, 2852, 14649, 15, 1552, 3688, 7033, 281, 35164, 285, 625, 3782, 281, 35164, 323, 4295, 273, 14230, 9851, 273, 6069, 44262, 15, 187, 688, 6069, 22578, 11809, 973, 1929, 275, 253, 1445, 13, 247, 22578, 11179, 342, 7236, 25502, 15432, 15308, 285, 1907, 271, 29450, 285, 271, 19564, 323, 17351, 273, 247, 4484, 386, 275, 4250, 3700, 2954, 342, 253, 7236, 25502, 13, 310, 18495, 407, 247, 14230, 1481, 4441, 327, 1755, 273, 253, 22578, 11179, 15, 496, 2176, 11809, 13, 253, 14230, 1481, 12093, 581, 390, 625, 4000, 17980, 49359, 15, 2053, 4000, 17980, 49359, 13, 534, 778, 320, 273, 11962, 9552, 15432, 23746, 290, 16671, 1561, 1016, 643, 13, 5752, 387, 1878, 767, 6378, 15, 2596, 4096, 310, 13, 273, 2282, 13, 281, 14393, 253, 22578, 4184, 932, 3304, 253, 22578, 11179, 15, 8035, 4096, 310, 281, 1329, 1275, 3814, 272, 10679, 15, 380, 9381, 273, 253, 4000, 17980, 49359, 6887, 253, 1275, 3814, 272, 10679, 275, 4569, 2954, 281, 253, 7236, 25502, 275, 253, 22578, 11179, 281, 12454, 253, 1275, 3814, 272, 1232, 15, 3932, 253, 4000, 17980, 49359, 1364, 320, 2104, 281, 21033, 4103, 281, 1016, 643, 13, 253, 49359, 403, 10877, 594, 347, 281, 4853, 271, 50183, 875, 731, 15, 380, 50183, 13, 1223, 6941, 253, 9381, 273, 253, 49359, 13, 671, 25097, 247, 1854, 323, 253, 3727, 273, 33419, 6353, 4441, 275, 253, 22578, 11179, 15, 10022, 13, 35164, 403, 2530, 387, 2710, 8593, 2439, 253, 50183, 281, 3657, 436, 3727, 273, 33419, 6353, 15, 380, 35164, 671, 1159, 281, 3657, 7768, 275, 253, 10825, 3345, 253, 22578, 11179, 432, 8136, 949, 253, 50183, 281, 253, 22578, 4484, 386, 534, 275, 247, 5558, 5148, 3809, 1517, 16478, 22578, 778, 320, 5558, 11914, 984, 3057, 273, 5558, 11914, 342, 7768, 778, 906, 275, 253, 4702, 273, 36286, 275, 253, 5558, 11914, 15, 1916, 2007, 3657, 7768, 23753, 715, 253, 22578, 11179, 13, 247, 3835, 3678, 310, 2530, 326, 32113, 253, 2317, 432, 253, 1755, 273, 253, 22578, 4484, 386, 6363, 281, 253, 5004, 273, 253, 14230, 1481, 285, 598, 253, 50183, 281, 253, 35164, 2439, 253, 50183, 15, 187, 688, 253, 1232, 273, 20462, 824, 5558, 5148, 3809, 1517, 16478, 44262, 13, 352, 310, 1846, 3946, 281, 12106, 253, 12510, 273, 253, 14230, 1481, 35164, 762, 9559, 2515, 326, 403, 4122, 11543, 281, 2826, 281, 7624, 21684, 253, 12510, 273, 824, 35164, 762, 2622, 2515, 15, 6408, 253, 2282, 273, 824, 2216, 253, 35164, 403, 12021, 281, 247, 18144, 1783, 534, 14802, 253, 14393, 2380, 762, 247, 27710, 5161, 43081, 7343, 313, 3717, 34, 582, 28055, 253, 9065, 1896, 7343, 15, 22460, 13, 253, 3437, 34, 310, 24045, 281, 320, 247, 1083, 275, 534, 13, 323, 5913, 1921, 13, 247, 2991, 39843, 8641, 684, 275, 253, 22578, 4484, 386, 8479, 247, 12338, 7466, 273, 253, 22578, 4484, 386, 534, 275, 1614, 5621, 253, 3835, 3678, 598, 253, 50183, 875, 253, 14230, 1481, 49359, 835, 253, 3835, 3678, 285, 5558, 11914, 403, 24045, 281, 3486, 253, 14230, 1481, 35164, 534, 403, 2439, 253, 50183, 15, 1916, 2525, 2216, 6095, 13, 253, 35164, 1364, 320, 2104, 281, 3831, 253, 3835, 3678, 285, 5558, 11914, 534, 588, 452, 33419, 6353, 15308, 275, 1340, 281, 3657, 247, 3727, 273, 33419, 6353, 281, 3345, 253, 22578, 11179, 15, 1707, 403, 2067, 9351, 273, 3576, 14230, 1481, 35164, 1929, 275, 253, 1445, 15, 187, 4041, 1511, 273, 14230, 1481, 14393, 973, 1929, 281, 1110, 18024, 275, 253, 1445, 310, 247, 5558, 12539, 14393, 15, 496, 247, 5558, 12539, 14393, 13, 253, 50183, 875, 253, 14230, 1481, 49359, 310, 523, 9698, 594, 326, 247, 39445, 310, 4447, 407, 253, 50183, 3139, 15, 329, 5558, 824, 347, 5558, 11914, 310, 4845, 275, 253, 39445, 7624, 23534, 253, 50183, 715, 767, 7118, 13, 581, 1840, 253, 5558, 285, 581, 2708, 15, 380, 3835, 3678, 13, 3304, 253, 22578, 13, 4508, 33419, 6353, 840, 8725, 432, 253, 1755, 273, 253, 22578, 4484, 386, 6363, 598, 949, 253, 50183, 281, 253, 5558, 11914, 275, 253, 12539, 14393, 15, 380, 5558, 12539, 14393, 762, 2622, 2515, 3400, 271, 3576, 14393, 1411, 3835, 3678, 10346, 562, 273, 253, 50183, 285, 1411, 7768, 10346, 715, 253, 22578, 11179, 1223, 6941, 253, 4000, 17980, 14230, 1481, 49359, 281, 21033, 4103, 281, 1016, 643, 15, 1723, 13, 762, 253, 3437, 34, 1783, 13, 253, 7466, 273, 253, 22578, 4484, 386, 812, 3490, 253, 3835, 3678, 598, 253, 50183, 275, 247, 12338, 5133, 15, 496, 253, 1232, 13, 253, 3835, 3678, 812, 866, 293, 253, 5558, 11914, 432, 253, 12539, 14393, 4830, 35164, 285, 40865, 4441, 275, 253, 50183, 1840, 253, 12539, 14393, 13, 7624, 18164, 253, 5558, 12539, 14393, 18860, 762, 824, 24045, 2515, 15, 187, 8195, 1511, 273, 14230, 1481, 14393, 973, 1929, 275, 253, 1445, 310, 253, 2157, 17980, 14393, 10646, 2014, 390, 2709, 2157, 17980, 35164, 275, 2962, 403, 4845, 2439, 253, 50183, 15, 6408, 22578, 1275, 3814, 272, 13, 253, 2157, 17980, 35164, 403, 5777, 809, 16148, 281, 1581, 1805, 9381, 273, 253, 4000, 17980, 14230, 1481, 49359, 1223, 1309, 22578, 4254, 253, 35164, 403, 41470, 281, 2572, 616, 24844, 14603, 15, 20599, 273, 841, 3510, 273, 35164, 778, 320, 1119, 275, 530, 15, 52, 15, 2790, 15, 1621, 15, 495, 13, 42389, 13, 12730, 281, 322, 15, 11414, 80, 13, 6808, 2552, 3436, 13, 10333, 285, 275, 530, 15, 52, 15, 2790, 15, 1621, 15, 495, 13, 25, 746, 13, 28757, 281, 416, 15, 9808, 371, 28957, 13, 6808, 3978, 2030, 13, 15788, 15, 187, 16812, 1529, 14393, 973, 1929, 275, 253, 1445, 285, 4158, 5742, 323, 3437, 34, 2515, 310, 247, 1511, 273, 5188, 44960, 14393, 275, 534, 247, 5313, 273, 5148, 310, 22491, 264, 281, 581, 273, 253, 14230, 1481, 49359, 594, 347, 281, 9017, 2439, 253, 50183, 875, 253, 49359, 281, 1561, 2810, 18326, 281, 253, 643, 10358, 15, 380, 4096, 273, 436, 14393, 310, 281, 8069, 2406, 253, 13584, 1854, 2170, 281, 3021, 2701, 23753, 762, 3437, 34, 15, 1723, 13, 672, 12021, 281, 1783, 13, 436, 14393, 1223, 28055, 8493, 23753, 285, 6941, 10358, 9381, 13, 1057, 417, 4336, 8415, 253, 1895, 273, 13538, 3727, 273, 33419, 6353, 762, 5460, 22578, 2515, 824, 347, 3437, 34, 15, 187, 688, 5440, 1946, 2898, 4165, 15, 1621, 15, 818, 1047, 13, 14256, 7429, 346, 13745, 5201, 3787, 422, 8874, 888, 353, 4319, 1023, 267, 3, 4724, 3747, 15, 2145, 13, 14828, 407, 500, 15, 10867, 249, 285, 500, 15, 330, 15, 378, 1241, 781, 627, 310, 2529, 6576, 323, 24844, 253, 50183, 875, 7361, 254, 25502, 326, 12093, 247, 12112, 3558, 15432, 275, 253, 50183, 285, 7660, 281, 271, 769, 18186, 5122, 15, 380, 769, 18186, 5122, 310, 7032, 273, 14252, 253, 12112, 3558, 715, 3057, 342, 253, 4295, 273, 253, 7361, 254, 25502, 7624, 24844, 253, 50183, 15, 187, 8195, 24844, 5122, 310, 2529, 275, 5440, 1946, 2898, 4165, 15, 1621, 15, 818, 1047, 13, 20735, 7429, 346, 13745, 5201, 3787, 422, 8874, 888, 353, 4319, 1023, 267, 3, 4724, 3747, 15, 2145, 13, 14828, 407, 500, 15, 10867, 249, 13, 1024, 530, 15, 52, 15, 2790, 15, 1621, 15, 577, 13, 36709, 13, 47763, 15, 380, 14393, 2529, 15308, 12093, 247, 12112, 3558, 7660, 281, 581, 273, 253, 7361, 254, 4295, 285, 13633, 2439, 253, 50183, 281, 2822, 253, 643, 7361, 254, 4445, 15, 2091, 6799, 271, 769, 18186, 5122, 5997, 253, 12112, 3558, 281, 3057, 253, 643, 7361, 254, 4445, 7624, 24844, 253, 50183, 875, 253, 4295, 15, 187, 688, 1635, 13, 253, 643, 7744, 1929, 3510, 273, 35164, 824, 347, 473, 14, 32226, 13, 44462, 84, 13, 3966, 904, 1223, 6830, 3576, 762, 3437, 34, 2515, 13, 513, 417, 1581, 323, 3576, 9381, 273, 253, 14230, 1481, 49359, 15, 41, 37672, 428, 6053, 72, 7417, 32676, 39967, 1608, 8635, 84, 187, 187, 5, 23, 15, 1235, 187, 187, 48100, 479, 672, 436, 1885, 4916, 2130, 27, 187, 187, 5496, 27, 187, 187, 17624, 313, 1671, 2188, 10, 187, 187, 6504, 8613, 313, 1449, 2188, 10, 187, 187, 46374, 313, 1857, 2188, 10, 187, 187, 2973, 454, 27, 187, 187, 34, 46385, 187, 187, 22526, 187, 187, 18942, 187, 187, 10252, 187, 187, 40796, 187, 187, 50, 555, 27, 187, 187, 11185, 27, 187, 187, 41, 37672, 6053, 72, 7417, 32676, 310, 253, 6323, 1635, 281, 253, 2455, 4633, 6053, 72, 7417, 39967, 1608, 8635, 2491, 15, 380, 1608, 8635, 84, 452, 644, 18461, 970, 247, 4451, 6315, 8212, 16, 3118, 517, 13, 4795, 275, 253, 954, 28831, 6053, 72, 7417, 1608, 8635, 326, 388, 37672, 452, 2455, 3562, 15, 1552, 310, 247, 330, 3424, 14784, 6335, 13, 908, 323, 16634, 16, 336, 2184, 285, 3164, 187, 977, 4893, 187, 187, 10195, 625, 4278, 403, 2130, 387, 27, 187, 187, 26562, 56, 27, 3944, 1358, 2700, 15, 5616, 413, 14, 262, 15, 681, 16, 187, 51, 547, 399, 30704, 14313, 27015, 25173, 44278, 23773, 3196, 750, 556, 247, 17319, 314, 1708, 285, 31255, 13746, 342, 247, 12662, 273, 43486, 432 ]
content. Make sure you update this another time at once..Keep making great stuff! thank you! Good remarkable things here. Now I am incredibly glad to peer your post. Bless you very much and I am just looking ahead to contact you. Do you want to please drop me an e-mail? Comments are closed. “I’m an IndiBlogger!” Hi, I am Dp Vishwakarma a Digital Marketing consultant and SEO expert based in New-Delhi, India. I work with new startups, entrepreneurs, freelancers, and bloggers. I am a Professional Blogger and I write, speak, and consult mostly about How to blog tips, SEO news, products reviews, Inbound Marketing, Social Media marketing etc. Do you want to Start an Online Profitable Business? Start earning from day one without going anywhere. Thank you! You have successfully joined our subscriber list. Friend Me On Facebook My Upcoming Book | Googling Why I Choose Digital Marketing? Am I Top Digital Marketing Consultant In Delhi,India? After Engineering, I have many reasons to choose Digital Marketing as a career. I love to make research, Do the analysis of the website, Do marketing, and work according to my place and my time that why I entered into Internet magic. Today, I am a freelancer and I can consider myself as a Digital Marketing Consultant and expert based in Delhi, India. Hire an Expert Not an Agency. Get the Best Digital Marketing service for Small and Mid Sized Businesses in India or worldwide. My expertise is the psychology of running high yielding Advertising Campaigns whether that is through my fully managed private client work, and my consulting. Do you have any question about How to start Digital Marketing as a career? I would like to help you with your digital marketing career and I can also help you with your online branding, marketing, promotion and advertisement. You can choose what you want to learn! Why SEO is Important for your Business? While PPC may drive more revenue and Social media may be important for your Business but organic SEO is the backbone of online presence. So, Do you need SEO expert in Delhi (India) or If you want to know how SEO help your business and generate the relevant customer. Please Let me know, I would be happy to help you.Support us Play a vital role in our work Share in the excitement and discover more about the palaces and their stories. Enjoy being a valued supporter and play a crucial role in preserving these beautiful buildings and their contents for future generations.This invention relates to seals and more particularly to seals for components of closure heads of nuclear reactors. In nuclear reactor designs well known in the art, a reactor vessel with fuel assemblies disposed therein and having an inlet and an outlet for circulation of a coolant in heat transfer relationship with the fuel assemblies, is sealed by a closure head located on top of the reactor vessel. In certain designs, the closure head comprises one or more rotatable plugs. These rotatable plugs, which may be of varying sizes disposed eccentrically within each other, serve at least two purposes. One purpose is, of course, to seal the reactor internals inside the reactor vessel. Another purpose is to support refueling machines. The rotation of the rotatable plugs positions the refueling machines in appropriate relationship to the fuel assemblies in the reactor vessel to facilitate the refueling process. Since the rotatable plugs must be able to rotate relative to each other, the plugs are mounted so as to define an annulus between them. The annulus, while allowing the rotation of the plugs, also establishes a path for the release of radioactive particles located in the reactor vessel. Accordingly, seals are provided at various locations across the annulus to prevent this release of radioactive particles. The seals also function to prevent oxygen in the atmosphere outside the reactor vessel from passing through the annulus to the reactor coolant which in a liquid metal fast breeder reactor may be liquid sodium because contact of liquid sodium with oxygen may result in the formation of impurities in the liquid sodium. To further prevent oxygen leakage into the reactor vessel, a cover gas is provided that fills the space from the top of the reactor coolant pool to the bottom of the closure head and up the annulus to the seals across the annulus. In the process of designing such liquid metal fast breeder reactors, it is common practice to analyze the effectiveness of the closure head seals under extreme conditions that are highly unlikely to occur to thereby assure the effectiveness of such seals under normal conditions. During the course of such design the seals are subjected to a sophisticated analysis which determines the seal response under a hypothetical core disruptive accident (CDA), theoretically the worst possible accident. Typically, the CDA is hypothesized to be a case in which, for whatever reason, a void violently propagates in the reactor coolant causing a violent expansion of the reactor coolant which in turn forces the cover gas up the annulus between the closure head plugs where the cover gas and liquid sodium are hypothesized to impact the closure head seals which are across the annulus. To meet design requirements, the seals must be able to contain the cover gas and liquid sodium which will have radioactive particles therein in order to prevent a release of radioactive particles to outside the reactor vessel. There are several kinds of effective closure head seals known in the art. One type of closure head seal well known to those skilled in the art is a liquid dip seal. In a liquid dip seal, the annulus between the closure head plugs is contoured so that a trough is formed by the annulus itself. A liquid such as liquid sodium is placed in the trough thereby dividing the annulus into two sections, one above the liquid and one below. The cover gas, inside the reactor, containing radioactive particles then extends from the top of the reactor coolant pool up through the annulus to the liquid sodium in the dip seal. The liquid dip seal under normal conditions provides an effective seal against cover gas migration out of the annulus and against oxygen migration into the reactor vessel while allowing the rotatable closure head plugs to rotate relative to each other. However, under the CDA analysis, the expansion of the reactor coolant could force the cover gas up the annulus in a violent manner. In the process, the cover gas could expel the liquid sodium from the dip seal onto seals and bearings located in the annulus above the dip seal, thereby rendering the liquid dip seal ineffective under such hypothesized conditions. Another type of closure head seal well known in the art is the inflatable seal wherein single or multiple inflatable seals in series are placed across the annulus. During reactor refueling, the inflatable seals are slightly deflated to allow better rotation of the rotatable closure head plugs while during reactor operation the seals are inflated to increase their sealing capability. Examples of these types of seals may be found in U.S. Pat. No. 3,514,115 to S. Gallo, issued May 26, 1970 and in U.S. Pat. No. 3,819,479 to R. Jacquelin, issued June 25, 1974. Still another seal well known in the art and designed specifically for CDA conditions is a type of labyrinth seal in which a piece of metal is bolted to one of the closure head plugs so as to extend across the annulus between the plugs to within close proximity to the other plug. The purpose of this seal is to effectively lower the leak path area to thus limit leakage under CDA. However, when subjected to analysis, this seal while theoretically reducing leakage and allowing plug rotation, does not completely solve the problem of preventing release of radioactive particles under severe reactor conditions such as CDA. In copending application Ser. No. 714,220 entitled "Core Disruptive Accident Margin Seal" filed Aug. 13, 1976 by J. Garin and J. C. Belsick there is described apparatus for sealing the annulus between riser assemblies that comprises a flexible member disposed in the annulus and attached to an actuating mechanism. The actuating mechanism is capable of pulling the flexible member into contact with the components of the riser assemblies thereby sealing the annulus. Another sealing mechanism is described in copending application Ser. No. 714,221 entitled "Core Disruptive Accident Margin Seal" filed Aug. 13, 1976 by J. Garin, now U.S. Pat. No. 4,078,969. The seal described therein comprises a flexible member attached to one of the riser components and extending across the annulus to near the other riser component. When desired an actuating mechanism causes the flexible member to contact the other riser component thereby sealing the annulus between the components. In addition, the other commonly known types of seals such as O-rings, bellows, etc., while possibly effective under CDA conditions, do not allow for effective rotation of the closure head plugs.Harrows - Supergrip Carbon Dart Shafts $6.50 Notify me when this product becomes available: Size: Short (35mm) Intermediate (40mm) Medium (45mm) Colour: Aqua Gold Green Red Silver Qty: Description: Harrows Supergrip Carbon is the latest addition to the ever popular Supergrip Dart Shaft range. The Shafts have been manufactured using a unique carbon composite/compound, resulting in the most durable Supergrip Shaft that Harrows have ever created.This is a C++ XML library, used for databases/cego and probably other applications Many more details are available at: WWW: http://www.lemke-it.com/ Rice DREAM™ Classic Original Organic Rice Drink has a deliciously light and refreshing flavor with a hint of sweetness from
[ 121, 163, 119, 212, 5444, 13484, 30004, 6088, 1357, 124, 35643, 6957, 10716, 240, 163, 105, 212, 15244, 31895, 25276, 13973, 4340, 24412, 16385, 241, 15899, 234, 26795, 5444, 29734, 13610, 15244, 46291, 108, 17321, 234, 35300, 20557, 215, 31362, 27661, 244, 3917, 1357, 124, 35643, 6957, 20025, 43136, 41102, 6957, 4746, 15936, 10446, 6418, 4746, 13484, 30004, 3917, 7111, 226, 17955, 216, 6088, 164, 223, 116, 23956, 228, 6957, 42165, 13609, 41102, 31895, 25276, 45776, 27098, 4340, 14236, 39573, 45466, 44330, 22010, 18140, 209, 13748, 2155, 227, 33532, 42930, 2155, 228, 5494, 232, 8650, 118, 5444, 164, 227, 123, 23826, 6218, 1769, 229, 1769, 102, 35643, 6449, 12676, 228, 13484, 38675, 226, 18678, 6344, 10962, 228, 18678, 13752, 209, 14106, 187, 187, 35241, 1769, 237, 49030, 18140, 23371, 1357, 124, 35643, 6418, 20603, 9935, 6686, 18514, 26443, 50, 27, 187, 187, 5804, 417, 1089, 49535, 375, 187, 187, 42, 452, 8038, 253, 43439, 8904, 374, 15, 23, 12144, 285, 971, 281, 1611, 281, 9978, 247, 439, 472, 7368, 15, 187, 1989, 309, 476, 626, 1089, 253, 49535, 375, 275, 253, 10269, 14, 26758, 15, 187, 187, 6693, 13991, 3736, 187, 36, 22728, 13, 23085, 187, 187, 34, 27, 187, 187, 1394, 954, 2779, 8038, 432, 253, 964, 983, 74, 970, 253, 40445, 9978, 15, 1422, 878, 281, 2057, 3334, 253, 25426, 9978, 390, 564, 949, 12047, 285, 3609, 253, 416, 11872, 4735, 15, 535, 46, 8623, 14013, 846, 10919, 18061, 275, 17975, 27, 247, 23931, 3072, 14, 3169, 1263, 15, 187, 29099, 267, 18061, 556, 644, 12258, 347, 253, 1971, 273, 4327, 323, 990, 14, 13311, 10919, 2728, 15, 12751, 267, 18061, 5459, 253, 2495, 273, 15110, 1955, 281, 1048, 14, 3945, 28999, 1256, 15, 380, 3510, 273, 1501, 14, 3675, 38484, 36929, 778, 6889, 2190, 1027, 23365, 4811, 285, 16175, 7625, 15, 1916, 3522, 13, 1781, 3072, 14, 3169, 2175, 273, 1501, 14, 3675, 38484, 36929, 275, 11650, 10919, 11286, 20841, 313, 51, 3125, 84, 10, 452, 11766, 644, 2361, 15, 1916, 7409, 253, 6127, 273, 1501, 14, 3675, 38484, 36929, 275, 5628, 416, 3125, 84, 13, 359, 2684, 247, 23931, 3072, 14, 3169, 11077, 1263, 875, 8210, 285, 4695, 1754, 327, 941, 432, 253, 3313, 4775, 16541, 20421, 275, 17975, 15, 29484, 84, 273, 2923, 9364, 275, 416, 3125, 84, 497, 2429, 342, 1110, 273, 253, 2087, 3072, 970, 19817, 9364, 11878, 313, 52, 3027, 84, 481, 9658, 253, 7543, 1036, 416, 3125, 84, 313, 1348, 1976, 10798, 285, 22856, 18, 10753, 28, 1599, 2363, 7127, 15, 18, 3279, 1249, 15, 21, 1107, 10, 285, 3307, 44443, 1436, 14, 10526, 273, 8310, 13, 23349, 1501, 14, 3675, 8186, 15110, 497, 11245, 15, 380, 322, 3027, 273, 512, 15110, 369, 495, 15, 1976, 313, 2222, 6, 7162, 7726, 495, 15, 1812, 14, 21, 15, 1093, 481, 10168, 574, 247, 2169, 2495, 685, 1821, 323, 253, 2440, 273, 36929, 313, 52, 3027, 608, 15, 2125, 323, 2255, 285, 322, 3027, 374, 15, 2055, 323, 1821, 481, 12751, 267, 13, 18676, 285, 6728, 15110, 497, 253, 954, 1846, 15110, 13, 342, 322, 3027, 84, 273, 7127, 15, 1717, 13, 5976, 15, 2511, 285, 608, 15, 2922, 13, 2975, 15, 2091, 31539, 407, 2363, 13, 416, 3125, 84, 273, 2872, 2363, 387, 11286, 16616, 938, 1107, 10, 574, 253, 4585, 2495, 273, 1501, 14, 3675, 38484, 36929, 15, 831, 1263, 14371, 1027, 6127, 273, 36929, 846, 10919, 18061, 275, 5628, 416, 3125, 84, 13, 342, 2169, 1485, 39725, 273, 12333, 285, 18676, 15110, 15, 4111, 6433, 943, 320, 625, 28027, 386, 275, 17565, 416, 3125, 84, 323, 1501, 14, 3675, 38484, 36929, 3340, 275, 9243, 1363, 15, 50, 27, 187, 187, 2347, 281, 14003, 5806, 5438, 846, 5321, 275, 42125, 37727, 187, 187, 6407, 13, 309, 858, 1007, 387, 436, 1953, 13, 533, 697, 689, 247, 807, 1711, 15, 50276, 17833, 314, 1024, 627, 310, 247, 1175, 1039, 275, 42125, 337, 15, 18, 15, 18, 281, 4459, 5806, 5438, 3579, 846, 247, 2608, 31317, 253, 5321, 6409, 275, 253, 37727, 15, 187, 688, 247, 2829, 342, 6763, 273, 5861, 13, 19690, 310, 5667, 15, 50276, 1898, 604, 247, 2608, 2789, 2067, 5806, 10165, 326, 3434, 10095, 626, 452, 281, 320, 6015, 15, 187, 187, 34, 27, 187, 187, 510, 3662, 310, 1335, 253, 1072, 27, 562, 273, 253, 3817, 13, 42125, 2506, 626, 1329, 436, 3879, 15, 1707, 403, 247, 4564, 273, 14997, 275, 253, 2523, 40143, 342, 20412, 27, 1852, 1787, 2357, 13, 1852, 2090, 2941, 15, 380, 4766, 1935, 966, 275, 436, 4385, 2987, 1293, 26264, 42125, 2127, 15, 187, 187, 34, 27, 187, 187, 1552, 4735, 556, 644, 2879, 281, 42125, 347, 629, 273, 253, 337, 15, 23, 3727, 285, 310, 11410, 1024, 407, 4284, 15, 733, 310, 2529, 275, 253, 3727, 7211, 27, 187, 187, 7104, 30000, 1024, 31221, 15116, 327, 253, 1618, 1859, 846, 6153, 13, 187, 50276, 264, 2996, 390, 37193, 271, 1789, 15, 733, 457, 84, 1896, 281, 15042, 253, 2045, 187, 50276, 38631, 273, 22980, 15116, 407, 4758, 253, 14003, 64, 41282, 11104, 187, 50276, 936, 16708, 15, 535, 34, 15828, 6415, 15165, 387, 271, 13952, 275, 41460, 556, 1629, 2016, 264, 745, 253, 39486, 285, 7154, 715, 1264, 4243, 13, 9811, 581, 1436, 285, 2450, 981, 625, 685, 7783, 13, 6338, 1333, 15, 187, 187, 16227, 27, 27816, 1227, 41460, 9044, 9966, 366, 1227, 10535, 483, 187, 187, 510, 30623, 47069, 29218, 11720, 369, 8785, 24549, 16479, 285, 2800, 10402, 2758, 432, 37418, 17001, 14254, 275, 253, 8935, 672, 352, 25753, 387, 16336, 74, 3227, 443, 536, 33967, 13952, 15, 187, 187, 510, 35251, 46198, 369, 2820, 281, 2659, 275, 5536, 8105, 16668, 84, 285, 9313, 15, 187, 187, 510, 13952, 369, 4581, 285, 20818, 1073, 13083, 846, 253, 7343, 15, 187, 187, 16227, 27, 27816, 1227, 4165, 700, 330, 356, 34797, 1227, 743, 324, 50025, 13677, 187, 187, 3493, 1351, 1629, 2352, 745, 39486, 285, 13471, 715, 1264, 7437, 387, 41460, 434, 16336, 74, 3227, 443, 536, 33967, 13952, 1905, 642, 2361, 15444, 1005, 5987, 1358, 85, 15, 1940, 16, 14633, 56, 25, 71, 14633, 58, 68, 44, 14402, 15, 16705, 15, 681, 16, 48, 82, 25, 84, 45335, 43, 72, 49511, 1905, 15501, 6317, 313, 14947, 10, 12626, 47235, 14947, 10, 5080, 608, 13, 9169, 187, 187, 44354, 763, 3420, 753, 253, 5020, 273, 952, 327, 4450, 497, 18416, 533, 627, 497, 671, 670, 1384, 5639, 47912, 15, 187, 187, 42, 36563, 15636, 14355, 714, 254, 965, 4629, 66, 753, 27, 346, 20810, 13, 253, 30623, 47069, 29218, 6415, 4571, 626, 2186, 327, 253, 39486, 1955, 281, 4105, 8588, 2515, 285, 1629, 2016, 264, 323, 1475, 2456, 14, 1549, 78, 544, 18467, 14, 19196, 649, 47744, 187, 187, 1328, 753, 253, 6415, 840, 6497, 875, 1884, 285, 3387, 26156, 745, 253, 990, 273, 253, 39486, 15, 187, 187, 19895, 8308, 401, 1240, 12436, 249, 611, 14799, 5783, 247, 18416, 15245, 574, 4962, 285, 21043, 643, 952, 574, 644, 11062, 15, 754, 753, 5293, 273, 253, 16545, 952, 497, 275, 247, 4619, 1617, 15, 187, 187, 49, 909, 47069, 753, 275, 247, 3908, 326, 253, 6415, 574, 4783, 745, 253, 39486, 285, 326, 16479, 497, 1146, 44543, 15, 329, 28179, 323, 253, 2567, 858, 417, 2085, 2007, 4278, 15, 187, 187, 6369, 55, 2361, 326, 253, 6415, 574, 9919, 281, 2659, 275, 5536, 8105, 14, 16668, 84, 5747, 253, 2045, 767, 20818, 5877, 745, 1955, 281, 253, 5448, 15, 187, 187, 2512, 452, 644, 642, 15444, 1005, 13, 285, 776, 11062, 16479, 452, 644, 2668, 281, 4675, 15, 187, 187, 1231, 588, 4035, 281, 2085, 2007, 1491, 342, 17730, 281, 253, 7119, 15, 2756, 187, 49, 909, 47069, 29218, 1905, 30623, 47069, 29218, 12626, 16247, 1405, 21949, 47069, 10, 5080, 608, 13, 9169, 187, 187, 17213, 20541, 2692, 16479, 21266, 949, 581, 273, 253, 1781, 30611, 281, 8773, 3066, 581, 273, 253, 15926, 13, 285, 18660, 273, 9708, 86, 398, 2444, 1475, 253, 11720, 15, 187, 187, 8665, 20541, 327, 2675, 3420, 2692, 247, 787, 8879, 3304, 253, 9954, 13, 534, 369, 1996, 1691, 562, 407, 45399, 15, 187, 187, 33495, 8308, 48005, 3899, 330, 1240, 262, 7055, 5582, 753, 9061, 574, 417, 2568, 644, 2104, 281, 3984, 281, 253, 25244, 13, 247, 18416, 3872, 285, 247, 3684, 13247, 13, 665, 497, 6566, 281, 452, 644, 11062, 275, 253, 7343, 15, 187, 187, 42, 36563, 434, 1345, 15303, 556, 10098, 271, 14392, 15, 187, 187, 16227, 27, 27816, 1227, 14554, 3964, 1314, 3035, 265, 714, 786, 343, 303, 1227, 743, 324, 50025, 13677, 187, 187, 510, 1698, 14, 16736, 30623, 47069, 29218, 556, 247, 18500, 273, 11439, 9954, 428, 7543, 3452, 70, 723, 285, 5540, 6037, 13097, 16340, 428, 285, 556, 644, 12060, 323, 1384, 1107, 15, 187, 187, 34, 30623, 47069, 35251, 46198, 3551, 275, 432, 25454, 22577, 275, 253, 1986, 8365, 47229, 1629, 2016, 264, 745, 253, 39486, 387, 253, 1072, 13952, 327, 818, 4247, 15, 1707, 497, 642, 32853, 533, 253, 13952, 574, 281, 320, 20220, 4581, 15, 187, 187, 1898, 247, 30623, 47069, 35251, 46198, 671, 1629, 2016, 264, 745, 253, 39486, 387, 1535, 357, 5894, 13952, 275, 4247, 4765, 13, 31314, 272, 1066, 253, 1930, 273, 247, 28900, 37159, 253, 6150, 15, 1707, 497, 642, 32853, 15, 187, 187, 44354, 763, 29218, 753, 352, 26224, 512, 697, 8630, 275, 285, 562, 273, 16336, 74, 3227, 443, 536, 33967, 327, 8330, 313, 6790, 673, 481, 187, 187, 14, 24197, 1227, 15501, 34330, 280, 7021, 9752, 793, 5863, 2802, 39419, 416, 6356, 9045, 457, 27069, 496, 23799, 187, 187, 34330, 280, 7038, 275, 23799, 403, 17178, 6386, 342, 5841, 281, 8913, 416, 6356, 9045, 432, 9591, 275, 253, 2586, 1108, 816, 3618, 846, 703, 12316, 281, 10541, 1066, 617, 31196, 3153, 12699, 15, 187, 187, 510, 16305, 689, 416, 6356, 9045, 457, 84, 32219, 951, 3924, 769, 556, 294, 14, 37114, 264, 846, 247, 747, 1304, 432, 253, 9251, 14, 17557, 698, 757, 13281, 3128, 313, 49, 1719, 10, 3916, 617, 3045, 13, 9355, 323, 611, 780, 66, 418, 1765, 321, 327, 2145, 5080, 313, 2693, 582, 651, 320, 271, 20423, 281, 11650, 2193, 15, 187, 510, 48191, 2208, 556, 7654, 4803, 672, 352, 3249, 281, 5343, 34983, 13, 285, 10846, 403, 2424, 281, 3835, 598, 432, 616, 13574, 281, 616, 15746, 15, 187, 510, 42300, 556, 18343, 9061, 665, 2523, 12699, 16000, 275, 253, 8558, 8797, 2586, 281, 12009, 253, 1963, 9141, 457, 84, 2898, 15, 187, 510, 19156, 13, 534, 556, 10098, 18162, 1411, 253, 530, 15, 52, 15, 689, 697, 1329, 273, 5143, 275, 253, 10800, 11182, 275, 253, 10515, 5791, 13, 556, 671, 14315, 326, 13571, 22251, 403, 15979, 281, 253, 1986, 2077, 457, 6982, 15, 187, 49, 1719, 8920, 12916, 6657, 21174, 274, 7958, 14990, 15493, 312, 324, 8599, 48191, 11547, 253, 8141, 13, 773, 22191, 416, 6356, 9045, 1524, 3013, 352, 390, 417, 13, 359, 871, 326, 253, 10474, 703, 556, 5087, 671, 9945, 281, 253, 2137, 275, 24076, 1425, 187, 48598, 312, 324, 3916, 253, 2362, 651, 320, 773, 28709, 281, 50124, 11867, 4466, 13, 1112, 770, 1981, 1980, 9558, 265, 13, 29549, 8479, 11655, 281, 253, 2586, 457, 84, 6982, 285, 8109, 5143, 457, 84, 2137, 3646, 13, 534, 310, 4516, 407, 3968, 6598, 187, 54, 1814, 36972, 4352, 22277, 416, 6356, 9045, 13, 665, 310, 1929, 323, 1053, 920, 15447, 14, 67, 1875, 367, 12548, 260, 641, 1507, 285, 12267, 14, 8656, 19269, 323, 617, 14349, 84, 13, 5821, 281, 41761, 407, 48191, 5323, 4321, 436, 1770, 313, 14060, 2693, 481, 187, 49, 460, 19934, 42134, 84, 13, 253, 28960, 3212, 253, 921, 13, 8838, 416, 6356, 9045, 457, 84, 4323, 310, 773, 13823, 273, 253, 2586, 457, 84, 10132, 285, 253, 12748, 273, 2509, 247, 921, 6598, 187, 11796, 1346, 1690, 8784, 21704, 31274, 40214, 285, 443, 15082, 2951, 71, 6451, 452, 3786, 11372, 18162, 275, 253, 2586, 323, 616, 4327, 273, 10015, 13, 285, 253, 3438, 1621, 399, 17290, 16057, 4358, 742, 562, 387, 253, 2208, 407, 15081, 703, 1160, 773, 66, 2201, 17789, 668, 672, 703, 3534, 275, 281, 253, 7619, 4803, 323, 617, 921, 275, 253, 2586, 1390, 807, 313, 2904, 481, 187, 187, 18551, 1644, 187, 187, 7475, 250, 187, 187, 29849, 187, 187, 22986, 1838, 13, 2159, 323, 13951, 38544, 5417, 13 ]
�繁に人間とゾウが衝突する場所だ。同州北部に点在する森林には約488頭のゾウが生息しているが、そこは、人間の住居と茶畑が集中している場所でもある。(参考記事: 「【動画】井戸に落ちたヒョウを村人総出で救出」 ) 次ページ:子ゾウはどうなった?Q: Can not find mongos I have installed the MongoDB 2.6 Standard and want to try to setup a shard cluster. But I can't find the mongos in the bin-directory. Any suggestions ? Ciao, Andre A: You most likely installed from the .msi using the Typical setup. You need to either install the Complete setup or go through Custom and select the Router feature. Malignancies after renal transplantation in Taiwan: a nationwide population-based study. Renal transplantation has been regarded as the treatment of choice for end-stage renal disease. Renal transplantation increases the risk of cancers due to long-term immunosuppression. The types of post-transplantation malignancies may vary among different geographic regions and ethnic populations. To date, large population-based studies of post-transplantation malignancies in Asian renal transplant recipients (RTRs) have rarely been reported. To investigate the patterns of post-transplantation malignancies in Chinese RTRs, we performed a nationwide population-based cohort study between 1997 and 2008 based on data from the National Health Insurance Database in Taiwan. Patterns of cancer incidence in RTRs were compared with those of the general population using standardized incidence ratios (SIRs). Among the 4716 RTRs (2475 males and 2241 females; mean age 44.1 ± 12.4 years) and 22 556 person-years of observation, 320 post-transplant cancers were diagnosed. The SIR of all cancers was 3.75 (95% confidence interval 3.36-4.18). Women had a higher risk than men for the development of malignancies (SIR 5.04 for women and SIR 2.88 for men). Renal, bladder and liver cancers were the most common cancers, with SIRs of 44.29, 42.89 and 5.07, respectively. When stratified by age, RTRs of young age at transplant (<20 years) had the highest risk of post-transplantation malignancies. This study demonstrates different patterns of malignancies after renal transplantation in Chinese RTRs, with higher incidences of kidney and bladder cancers. Physicians should be more vigilant in examining RTRs for post-transplantation malignancies especially in younger patients.Q: How to preserve filter selection after save in Django Admin First, I did look at this question, but its over a year old. Surely now there is a good way in Django 1.1.1 to carry filter selection forward after a user clicks the save button in the Admin. In a table with thousands of records, filtering is essential. And if a user makes several filter choices that effort shouldn't have to be repeated. A: The answer is still the same: out of the box, Django doesn't support this behavior. There are a couple of tickets in the issue tracker with patches: #3777, #6903. The middleware class in this comment works without modifying Django code. A: This feature has been added to Django as part of the 1.6 release and is enabled now by default. It is described in the release notes: ModelAdmin now preserves filters on the list view after creating, editing or deleting an object. It’s possible to restore the previous behavior of clearing filters by setting the preserve_filters attribute to False. A passenger plane landing at an airport in Istanbul has skidded off the runway and broken into three parts, killing one person and injuring more than 150, officials say. Photo: AFP / Istanbul Security Directorate / Handout The Pegasus Airlines jet was carrying 171 passengers and six crew members from Izmir province in the west when it crashed at Sabiha Gokcen airport. The Boeing 737 was trying to land in heavy tailwinds and rain. The airport was closed and flights diverted after the accident. Photo: AFP / Serhat Cagdas / Anadolu Agency Plane skids off runway and breaks into three pieces at Istanbul's Sabiha Gokcen airport — no reported fatalities https://t.co/GMW8fGMYcK pic.twitter.com/Oq8sTUJgUi — BBC News (World) (@BBCWorld) February 5, 2020 Turkish media said the majority of people on board were Turkish but there were also about 20 foreign nationals. Istanbul Governor Ali Yerlikaya said: "Unfortunately, the Pegasus Airlines plane couldn't hold on the runway due to poor weather conditions and skidded for around 50-60m [164-196ft]." He said the plane then fell between 30 and 40 metres off the end of the runway. Health Minister Fahrettin Koca confirmed a Turkish citizen had died and 157 other people had been injured. He said none of the wounded people were in a critical condition. Pegasus said in a statement that the plane had gone off the runway and that passengers were being evacuated. A spokesperson for the company did not provide further details. NTV reported that the plane had attempted to land in heavy tail-winds despite the previous two flights holding off due to the wind. There have been no fatalities, and our injured passengers have been taken to hospital. We will continue to provide further information with regards to the incident. Pegasus Airlines — Pegasus Airlines (@flymepegasus) February 5, 2020 Video footage showed passengers climbing through one of the large cracks to escape via one of the wings, and dozens of rescuers working around the jet. Other footage on social media showed a blaze inside the aircraft, which was later put out by firefighters. Transport Minister Mehmet Cahit Turhan said authorities had not yet been able to speak to the pilots, a Turkish national and a South Korean, who were believed to have been injured in the accident. Istanbul's public prosecutor has launched an inquiry. Photo: AFP / Muhammed Enes Yildirim / Anadolu Agency The low-cost Pegasus Airlines has a fleet of 83 aircraft - 47 Boeings and 36 Airbus planes - and has been flying for 20 years. A Pegasus Boeing 737 coming in from Sharjah in the United Arab Emirates skidded off the runway at the same airport on 7 January. There were no casualties but the airport had to be temporarily closed. And a Pegasus Boeing 737 also skidded off the runway at Trabzon airport in January 2018, plunging down the side of a cliff overlooking the sea. There were no casualties. Turkish Airlines said it cancelled all its flight in and out of Sabiha Gokcen on Wednesday (local time). - Reuters / BBCIslamic Party Ramps Up ‘Ban Rihanna’ Campaign In Malaysia Islamic leaders in Malaysia are pressing ahead with calls to ban Rihanna from performing in the country – just weeks after she promised to tone down her forthcoming live concert. The controversy over Rihanna’s saucy stage act has re-emerged after a new report from the Pan-Malaysian Islamic party (PAS) claims her performance, planned for Kuala Lumpur on 13 February (09), would be an insult to Asian values. The Malaysian government has strict rules when it comes to female performers, and artists are required to cover up from their shoulders to their knees. The PAS has urged authorities who issue concert permits in the primarily Muslim country to reject the organiser’s application. The organisation, which has launched protests against the U.S. over its support of Israel in the ongoing struggle in the Middle East, has also warned that ticket buyers are contributing to the United States’ economy. PAS youth wing leader Kamaruzaman Mohamad tells Malaysian newspaper the Star, “Whether Rihanna realises it or not, we know that the taxes she has paid also contributed to the war in Gaza.” Mohamad claims the event would be “akin to insulting Eastern culture, belittling local artistes, internationally causing losses to the country’s economy and supporting Israel’s war policy, which is supported by America”. Umbrella hitmaker Rihanna, who is known for donning flesh-baring PVC corsets and knee-high boots for her gigs, agreed to abide by Malaysian laws earlier this month (Jan09). Pineapple Concerts, the promoters behind the show, maintained Rihanna’s management is “aware of the country’s regulations and the difficulties of doing a show”. Artists including Avril Lavigne and Gwen Stefani have previously faced protests in the country for their choice of clothes, and the former No Doubt singer lashed out at the government by claiming she made “a major sacrifice” when she gave in to the dress rules for her show in the country last year (08). Archives Genre Stats RFID, short for Radio Frequency ID,
[ 3181, 470, 5, 275, 669, 4153, 393, 3181, 1926, 1991, 92, 36, 599, 3503, 1352, 3813, 13, 359, 778, 5645, 275, 247, 41886, 47456, 1612, 2962, 15, 187, 187, 6407, 13, 14657, 370, 86, 5, 347, 247, 4764, 13, 359, 5645, 275, 47456, 2962, 275, 253, 4903, 370, 91, 64, 18, 13, 393, 5589, 13, 1182, 64, 79, 5, 275, 253, 1563, 5133, 15, 1198, 667, 1127, 3019, 91, 64, 19, 1337, 6768, 13, 91, 64, 79, 1009, 275, 253, 5028, 1764, 4153, 8, 2029, 1274, 6921, 9, 91, 64, 19, 1337, 6768, 13, 91, 64, 79, 1572, 1274, 93, 187, 93, 91, 64, 76, 93, 2239, 393, 2204, 578, 74, 30, 19, 1990, 76, 14, 18, 94, 1040, 91, 64, 74, 93, 14101, 76, 30, 19, 1337, 6768, 13, 79, 393, 918, 15, 393, 918, 61, 8633, 11227, 253, 1159, 310, 20059, 285, 2014, 14, 24995, 323, 370, 91, 64, 18, 5, 275, 247, 10481, 1355, 17256, 1520, 9168, 273, 253, 6510, 15, 7757, 13, 253, 1159, 476, 320, 11848, 627, 275, 247, 41886, 47456, 2962, 15, 6000, 10235, 273, 326, 47456, 7466, 310, 271, 20059, 1159, 327, 253, 5028, 669, 4153, 9805, 285, 13, 407, 10040, 839, 253, 1072, 5199, 13, 476, 320, 11848, 4336, 715, 247, 47456, 1612, 2962, 15, 380, 10303, 273, 253, 47456, 7466, 275, 253, 4903, 370, 91, 64, 18, 13, 393, 5589, 13, 1182, 64, 79, 5, 778, 320, 11848, 347, 47456, 2962, 275, 370, 86, 1352, 187, 187, 42297, 13, 359, 778, 5645, 253, 1159, 275, 253, 4778, 370, 86, 5, 806, 15, 2635, 13, 253, 10303, 273, 253, 7466, 403, 20059, 3470, 327, 253, 5028, 669, 4153, 1352, 187, 187, 24801, 13, 359, 588, 4271, 253, 47456, 2962, 7466, 273, 342, 253, 2962, 370, 86, 63, 79, 4615, 1926, 9501, 92, 41, 4935, 91, 64, 18, 1337, 5589, 13, 91, 64, 79, 13, 86, 3822, 187, 187, 4118, 50276, 92, 4, 4674, 14, 2031, 94, 187, 187, 2214, 667, 5818, 370, 51, 1366, 4853, 253, 5818, 370, 51, 4464, 91, 18103, 407, 3318, 51, 4464, 91, 1228, 426, 393, 1274, 6921, 187, 61, 1274, 4880, 2204, 578, 74, 61, 249, 1926, 1991, 92, 59, 6092, 391, 64, 74, 1182, 63, 74, 61, 918, 93, 391, 64, 74, 61, 249, 416, 13, 5095, 391, 64, 79, 30, 17, 14101, 295, 61, 620, 470, 61, 918, 12499, 5095, 4700, 496, 643, 3000, 13, 370, 51, 4464, 91, 18103, 8414, 273, 7473, 47456, 2962, 275, 370, 91, 5, 342, 10303, 275, 370, 51, 5, 285, 41025, 11542, 432, 2708, 15, 187, 187, 1447, 49, 3671, 696, 844, 452, 16207, 1274, 61, 4841, 2704, 1588, 92, 34, 4935, 91, 64, 18, 13, 7958, 64, 18, 10, 393, 7718, 1926, 1588, 92, 34, 4935, 91, 64, 79, 13, 86, 1182, 64, 79, 10, 187, 464, 918, 61, 3799, 889, 249, 1926, 1991, 92, 50, 31379, 86, 1743, 2617, 337, 12084, 6048, 91, 64, 79, 1228, 393, 6768, 6048, 91, 64, 18, 1228, 4615, 4700, 187, 187, 510, 906, 3637, 407, 9953, 327, 370, 79, 5, 432, 253, 1563, 2867, 273, 253, 9158, 2367, 1588, 92, 34, 4018, 27, 1764, 1274, 5716, 1588, 92, 34, 4935, 91, 13, 7958, 17990, 1124, 18, 92, 7958, 889, 918, 10, 3503, 5095, 362, 2253, 1906, 426, 473, 61, 1274, 9, 91, 2497, 3577, 1906, 47715, 918, 10, 5095, 4700, 8079, 13, 342, 253, 6517, 273, 253, 1307, 3019, 7958, 14607, 18, 724, 534, 4620, 275, 253, 3638, 1307, 273, 5572, 669, 1588, 92, 38, 2000, 17, 9, 7958, 4244, 2426, 15979, 281, 253, 10235, 1764, 1274, 60, 91, 2497, 76, 889, 918, 62, 4615, 187, 61, 1274, 5716, 1588, 92, 34, 4935, 91, 13, 7958, 17990, 1124, 18, 92, 7958, 889, 918, 10, 3503, 1890, 2406, 253, 2341, 407, 387, 1878, 370, 76, 5, 285, 13, 1580, 627, 403, 642, 11390, 273, 4016, 2341, 13, 26262, 47602, 370, 87, 2253, 1906, 5, 604, 370, 76, 31, 3577, 1906, 47044, 187, 187, 4118, 50276, 92, 4, 4674, 14, 1857, 94, 187, 187, 1466, 2367, 1588, 92, 34, 5000, 76, 5, 320, 253, 10303, 273, 253, 7466, 273, 253, 5572, 2367, 1588, 92, 34, 4935, 91, 13, 7958, 1009, 275, 9136, 273, 370, 91, 18965, 1764, 1968, 92, 1545, 35832, 94, 187, 50276, 464, 1588, 92, 34, 4935, 91, 13, 7958, 4010, 393, 2204, 578, 76, 61, 249, 1926, 1991, 92, 59, 6092, 1926, 1588, 92, 34, 5000, 76, 4615, 1182, 63, 76, 5095, 4700, 1284, 2540, 275, 253, 4737, 273, 11506, 905, 49, 3671, 5290, 253, 5572, 2367, 1588, 92, 34, 5000, 76, 5, 323, 370, 76, 61, 570, 428, 18, 5, 8687, 760, 2426, 273, 2341, 669, 463, 428, 465, 1352, 380, 1072, 310, 2032, 323, 2367, 1588, 92, 34, 6922, 14, 18, 724, 342, 253, 6517, 273, 253, 3638, 1307, 9929, 86, 2497, 18, 3363, 187, 187, 688, 2426, 273, 253, 9158, 2367, 1588, 92, 34, 5000, 76, 1366, 253, 47456, 2962, 7466, 273, 476, 320, 3542, 347, 27, 1764, 1968, 92, 34, 983, 94, 187, 1926, 1274, 61, 4841, 2704, 1588, 92, 34, 4935, 91, 64, 18, 13, 7958, 64, 18, 10, 393, 7718, 1926, 1588, 92, 34, 4935, 91, 64, 79, 13, 86, 1182, 64, 79, 10, 187, 464, 918, 61, 3799, 4203, 187, 61, 2204, 578, 76, 64, 18, 1337, 6768, 13, 76, 64, 79, 94, 50276, 464, 1274, 61, 4841, 2704, 1588, 92, 34, 6922, 76, 64, 18, 94, 393, 7718, 1926, 1588, 92, 34, 6922, 76, 64, 79, 94, 187, 464, 918, 61, 3799, 8633, 50276, 91, 64, 18, 768, 76, 64, 18, 889, 5589, 1182, 64, 79, 768, 76, 64, 79, 94, 50276, 4615, 4700, 1310, 370, 76, 64, 75, 654, 10042, 2204, 578, 74, 29, 75, 94, 313, 76, 64, 74, 12, 18, 1009, 323, 690, 370, 75, 1366, 840, 253, 3969, 1307, 27309, 407, 2341, 15711, 15, 187, 187, 2115, 10082, 318, 2493, 285, 8870, 414, 187, 35000, 187, 187, 4118, 50276, 92, 4, 4674, 14, 2950, 94, 187, 187, 16628, 253, 44881, 11968, 2962, 27, 16207, 3005, 1603, 91, 6567, 88, 10, 426, 393, 1124, 18, 88, 393, 2204, 578, 79, 61, 249, 464, 1991, 92, 59, 6092, 393, 1274, 19724, 1124, 39231, 61, 918, 4800, 79, 50276, 61, 393, 249, 1926, 1991, 92, 50, 599, 4464, 91, 13, 88, 5029, 1890, 380, 1840, 2962, 310, 253, 3064, 875, 253, 1563, 767, 40955, 27, 1764, 2043, 92, 2132, 94, 187, 61, 1968, 92, 40965, 18, 94, 187, 50276, 61, 1124, 18, 92, 91, 12, 88, 94, 7196, 393, 1124, 18, 88, 428, 393, 1124, 92, 91, 1217, 88, 63, 19, 94, 559, 393, 1124, 92, 91, 63, 19, 1217, 88, 63, 20, 94, 428, 187, 50276, 61, 6768, 5095, 13, 393, 3362, 1040, 91, 41533, 93, 88, 93, 5095, 13, 3202, 393, 1968, 92, 40965, 19, 94, 187, 61, 1124, 18, 92, 91, 12, 88, 94, 7196, 393, 1124, 18, 91, 428, 393, 1124, 92, 88, 1217, 91, 63, 19, 94, 559, 393, 1124, 92, 88, 63, 19, 1217, 91, 63, 20, 94, 428, 187, 50276, 61, 6768, 5095, 13, 393, 3362, 1040, 91, 49651, 93, 88, 93, 5095, 4880, 423, 92, 2132, 2138, 380, 2962, 2367, 3005, 1603, 91, 6567, 88, 1009, 310, 247, 7473, 669, 3005, 2911, 3701, 387, 370, 91, 12, 88, 30, 17, 1366, 275, 253, 3282, 326, 34027, 91, 12, 88, 10, 5095, 1926, 3005, 1603, 91, 6567, 88, 10, 426, 470, 5095, 4700, 187, 187, 4118, 50276, 92, 4, 4674, 14, 2504, 94, 187, 187, 510, 1563, 1774, 906, 588, 320, 4232, 275, 5238, 905, 8832, 4207, 187, 187, 1447, 1044, 34, 696, 844, 452, 1764, 1968, 92, 42485, 18, 94, 187, 50275, 34758, 1588, 92, 34, 4935, 91, 13, 7958, 582, 464, 1588, 92, 34, 4935, 88, 13, 41440, 9102, 50276, 30, 39231, 4615, 1926, 3005, 1603, 91, 6567, 88, 10, 5095, 11227, 390, 39406, 13, 1764, 1968, 92, 42485, 19, 94, 187, 50276, 61, 1274, 34758, 1588, 92, 34, 5000, 76, 13, 1926, 1588, 92, 34, 5000, 77, 61, 918, 62, 426, 3383, 18, 4800, 77, 393, 3005, 578, 76, 12, 77, 14, 18, 94, 5095, 4700, 187, 187, 1447, 68, 1044, 34, 696, 380, 2962, 1764, 11510, 578, 74, 29, 75, 94, 313, 91, 64, 74, 12, 91, 64, 75, 10, 5095, 1926, 1274, 61, 4841, 2704, 1588, 92, 34, 4935, 91, 64, 18, 13, 7958, 64, 18, 10, 393, 7718, 1926, 1588, 92, 34, 4935, 91, 64, 79, 13, 86, 1182, 64, 79, 10, 187, 464, 918, 61, 3799, 889, 249, 50276, 464, 1991, 92, 50, 31379, 86, 1743, 2617, 18, 12084, 6048, 91, 64, 79, 17968, 6768, 6048, 91, 64, 18, 1228, 187, 61, 1968, 92, 2148, 2138, 310, 13123, 275, 370, 91, 64, 18, 1337, 6768, 13, 91, 64, 79, 5, 285, 13, 7613, 13, 310, 271, 3284, 273, 1764, 11510, 1182, 64, 74, 2497, 18, 94, 5095, 1926, 1991, 92, 50, 31379, 86, 1743, 2617, 18, 12084, 5095, 8605, 91, 64, 18, 1337, 6768, 13, 91, 64, 79, 9502, 5095, 4700, 187, 187, 24804, 13, 253, 41025, 273, 370, 91, 64, 18, 5, 275, 403, 11542, 2708, 407, 9929, 18, 1352, 187, 187, 4118, 50276, 92, 4, 4674, 14, 2385, 94, 187, 187, 1231, 1024, 27566, 253, 1563, 906, 432, 6899, 905, 1044, 34, 696, 27, 187, 187, 1447, 85, 2700, 696, 380, 10303, 13, 1764, 1968, 92, 34, 1906, 94, 187, 61, 1274, 60, 86, 63, 78, 61, 918, 62, 4615, 187, 61, 4841, 1926, 1588, 92, 34, 4935, 91, 64, 18, 13, 7958, 64, 18, 10, 393, 6768, 1926, 1588, 92, 34, 4935, 91, 64, 79, 13, 86, 1182, 64, 79, 1572, 3799, 5095, 13, 393, 3362, 278, 61, 249, 1926, 1991, 92, 59, 28503, 11227, 273, 9136, 273, 370, 86, 5, 275, 253, 7466, 403, 13123, 8870, 3470, 275, 370, 91, 64, 18, 1337, 6768, 13, 91, 64, 79, 1366, 342, 387, 954, 2969, 25284, 327, 253, 35076, 641, 370, 91, 64, 74, 12, 91, 64, 75, 30, 17, 5, 285, 370, 91, 64, 74, 30, 17, 1352, 187, 187, 3463, 24297, 905, 68, 1044, 34, 5290, 352, 31088, 281, 5276, 253, 41025, 273, 370, 91, 64, 79, 5, 275, 253, 7466, 273, 403, 11542, 432, 1840, 15, 187, 187, 510, 5150, 13, 1764, 1968, 92, 250, 18, 94, 187, 50276, 464, 1274, 61, 4841, 2704, 1588, 92, 38, 6922, 76, 64, 18, 1603, 7958, 64, 18, 1572, 5589, 1926, 1588, 92, 38, 6922, 76, 64, 79, 1603, 7958, 64, 79, 10, 187, 464, 918, 61, 3799, 4203, 1926, 1274, 61, 4841, 889, 1124, 2386, 1588, 92, 38, 6922, 76, 64, 18, 1603, 7958, 64, 18, 9783, 86, 768, 76, 64, 18, 3080, 5589, 393, 1124, 2386, 1588, 92, 38, 6922, 76, 64, 79, 1603, 7958, 64, 79, 9783, 86, 768, 76, 64, 79, 599, 187, 464, 918, 61, 3799, 14640, 6556, 1580, 253, 12124, 15355, 27309, 5734, 669, 2204, 465, 64, 74, 426, 470, 1352, 380, 9261, 2367, 1588, 92, 38, 5000, 76, 393, 936, 1484, 2497, 76, 94, 1926, 1588, 92, 38, 5000, 76, 5, 3732, 281, 253, 5572, 2367, 1588, 92, 34, 4935, 91, 13, 7958, 1009, 6993, 347, 253, 19137, 3318, 2386, 25802, 2005, 4935, 7958, 4800, 76, 393, 15869, 393, 1124, 18955, 25802, 2005, 4935, 7958, 4800, 76, 1217, 86, 63, 76, 94, 5095, 11227, 534, 2789, 512, 2426, 3963, 285, 1327, 6148, 3647, 387, 370, 86, 30, 17, 1366, 3707, 323, 253, 2969, 15903, 275, 253, 3638, 1307, 7201, 25802, 2005, 4935, 7958, 14607, 18, 3363, 187, 187, 7542, 27309, 604, 370, 76, 64, 79, 2239, 17, 1366, 253, 12124, 15355, 1764, 4841, 1926, 1588, 92, 34, 4935, 91, 64, 18, 13, 7958, 64, 18, 10, 393, 6768, 1926, 1588, 92, 34, 4935, 91, 64, 79, 13, 86, 1182, 64, 79, 1572, 3799, 1890, 7024, 327, 370, 91, 64, 79, 5, 760, 949, 2426, 273, 253, 830, 16207, 1588, 92, 52, 4935, 7958, 64, 79, 7415, 91, 64, 79, 94, 50276, 4615, 13, 393, 3362, 187, 70, 768, 1952, 91, 64, 79, 94, 5095, 13, 393, 3362, 247, 61, 249, 393, 21103, 805, 464, 1991, 92, 59, 28503, 11227, 347, 973, 347, 1764, 2043, 92, 14856, 94, 187, 50276, 91, 64, 79, 9, 91, 64, 79, 14, 18, 1572, 6768, 9, 91, 64, 79, 14, 76, 12 ]
times 0$ in $\Omega \times {\mathbb{C}}^*$. Therefore, we may expand in a convergent Laurent power series. First, viewing $u$ as a parameter, we expand in Laurent series in the variables $z_1, \ldots, z_n$ in the following manner. For any point $(z_2,\dots,z_n)$ in the domain $$\Omega'=\left\{(z_2,\dots,z_n)\left| |z_k| > \sum_{i=2}^{k-1} |z_i|,\,k=2,\dots,n \right. \right\}\,,$$ the function is analytic and single-valued for $z_1$ in a sufficiently small punctured neighborhood of the origin. Hence, the function can be expanded there in a convergent Laurent series. Every coefficient of that Laurent expansion is an analytic function on the domain $\Omega'$ and, by iterating the same procedure, can be expanded completely into a Laurent power series. The coefficients of the Laurent expansion in the variables $z_1, \ldots, z_n$ may be expanded as Laurent series in $u$. Alternatively, we may expand the function in the variable $u$ first. Then, the coefficients of the expansion are analytic functions on the domain $\Omega$. Later, we will identify the Laurent series expansion of with the series $u^n\, {\mathsf{H}}(z_1,\ldots,z_n,u)$. ### {#section-44} For any ring $R$, define the ring $R((z))$ by $$R((z)) = \left\{ \left.\sum_{i\in {\mathbb{Z}}} r_i z^i\right| r_i\in R, \, r_n=0,\, n\ll 0\right\} \,.$$ In other words, $R((z))$ consists of formal Laurent series in $z$ with coefficients in $R$ and exponents bounded from below. \[Pfs\] We have $${\left\langle}{\mathcal{A}}(z_1,uz_1) \cdots {\mathcal{A}}(z_n,u z_n) {\right\rangle}\in {\mathbb{Q}}[u^{\pm 1}] ((z_n)) \dots ((z_1))\,.$$ The result follows by induction on $n$ from the following property of the operators ${\mathcal{A}}$: $$\left({\mathcal{A}}(z,uz)-\frac1{uz}\right)^* \, v_\mu = O\left(z^{-|\mu|}\right) \,.$$ Indeed, with the exception of the term $(uz)^{-1}$ which appears in the constant term of operator $\mathcal{E}_0(uz)$, terms contributing to the coefficient $$\left[z^{-k}\right]\, \left({\mathcal{A}}(z,uz)-\frac1{uz}\right)^*$$ lower the energy by at least $k$ and, since there are no vectors of negative energy, annihilate $v_\mu$ if $k>|\mu|$. ### {#section-45} Let ${\mathcal{A}}_k$ be the coefficients of the expansion of the operator ${\mathcal{A}}(z,uz)$ in powers of $z$: $$\label{defAk} {\mathcal{A}}(z,uz)= \sum_{k\in {\mathbb{Z}}} {\mathcal{A}}_k\, z^k \,.$$ As observed in the proof of Proposition \[Pfs\], the operator ${\mathcal{A}}_k$ for $k\ne -1$ involves only terms of energy $\ge - k$. The same is true for ${\mathcal{A}}_{-1}$ with the exception of the constant term $-u^{-1}$. In terms of the operators ${\mathcal{A}}_k$, the Laurent series expansion of can be written as: $$\label{Ams} {\left\langle}{\mathcal{A}}(z_1,uz_1) \cdots {\mathcal{A}}(z_n,u z_n) {\right\rangle}= \sum_{k_1,\dots,k_n} {\left\langle}{\mathcal{A}}_{k_1} \cdots {\mathcal{A}}_{k_n} {\right\rangle}\, z_1^{k_1}\ldots z_n^{k_n} \,.$$ If $k_j < -\sum_{i<j} (k_i+1)$ for some $j$, then the corresponding term vanishes by energy considerations. Commutation relations and rationality ------------------------------------- ### {#section-46} Consider the doubly infinite series: $${\delta}(z,-w) = \frac1w \sum_{n\in{\mathbb{Z}}} \left(-\frac zw\right)^n \ \in {\mathbb{Q}}((z,w)).$$ The above series is the difference between the following two expansions: $$\begin{aligned} \label{zw1} \frac1{z+w} &= \frac1w - \frac{z}{w^2} + \frac{z^2}{w^3} - \dots \,, \quad |z|<|w| \,, \\ \label{zw2} \frac1{z+w} &= \frac1z - \frac{w}{z^2} + \frac{w^2}{z^3} - \dots \,, \quad |z|>|w| \,.\end{aligned}$$ The series ${\delta}(z,-w)$ is a formal $\delta$-function at $z+w=0$, in the sense that $$(z+w) \, {\delta}(z,-w) = 0 \,.$$ ### {#section-47} The following important result will be established in Section \[ffff\]. \[ThA\] We have $$\label{cA1} [{\mathcal{A}}(z,uz),{\mathcal{A}}(w,uw)] = zw\, {\delta}(z,-w) \,,$$ or equivalently, $$\label{cA2} \left[{\mathcal{A}}_k, {\mathcal{A}}_l\right] = (-1)^l \delta_{k+l-1} \,.$$ \[cThA\] The series $$\prod_{i<j} (z_i+z_j) \, {\left\langle}{\mathcal{A}}(z_1,uz_1) \cdots {\mathcal{A}}(z_n,u z_n) {\right\rangle}\in {\mathbb{Q}}[u^{\pm1}] ((z_n))\dots ((z_1)) \label{cle}$$ is symmetric in $z_1,\dots,z_n$ and, hence, is an element of $$\prod z_i^{-1} \, {\mathbb{Q}}[u^{\pm1}] \, [[z_1,\dots,z_n]] \,.$$ Indeed, the exponents of $z_1$ in are bounded below by $-1$. ### {#section-48} We now deduce the following result from Theorem \[ThA\]: \[twww\] The coefficients, $$\label{Amu} \left[u^m\right]\, \langle {\mathcal{A}}(z_1,uz_1) \dots {\mathcal{A}}(z_n,u z_n)\rangle \,, \quad m\in {\mathbb{Z}}\,,$$ of powers of $u$ in the expansion are symmetric rational functions in $z_1,\dots,z_n$, with at most simple poles on the divisors $z_i+z_j=0$ and $z_i=0$. By Corollary \[cThA\], it suffices to prove the exponents of $z_n$ in the expansion of are bounded from above. The equation, $$\label{re1} {\left\langle}{\mathcal{E}}_{k_1}(uz_1)\ldots {\mathcal{E}}_{k_n}(uz_n) {\right\rangle}= {\left\langle}\frac{{\mathcal{E}}_{k_1}(uz_1)}{u^{k_1}}\ldots \frac{{\mathcal{E}}_{k_n}(uz_n)}{u^{k_n}} {\right\rangle},$$ holds since the vacuum expectation vanishes unless $\sum k_i = 0$. The transformation ${\mathcal{E}}_k \to u^{-k} {\mathcal{E}}_k$ applied to the operator ${\mathcal{A}}(z,uz)$ acts as the substitution $${{\varsigma}}(uz)^k \mapsto \frac{{{\varsigma}}(uz)^k}{u^k} \,,$$ which makes all terms regular and nonvanishing at $u=0$, except for the simple pole in the constant term ${{\varsigma}}(uz)^{-1}$. Since vanishes if $k_n >0$, the vacuum expectation $$\langle {\mathcal{A}}(z_1,uz_1) \dots {\mathcal{A}}(z_n,u z_n)\rangle$$ depends on $z_n$ only through terms of the form $${\mathcal{S}}(uz_n)^{z_n} \,, \quad e^{auz_n} \,, \quad a\in \tfrac12{\mathbb{Z}}\,,$$ as well as $$\begin{gathered} z_n(z_n-1)\dots(z_n-k+
[ 10, 551, 988, 186, 2044, 258, 25603, 426, 436, 3333, 17440, 28, 11866, 186, 14626, 551, 2657, 186, 64, 2043, 25580, 9, 80, 25603, 558, 2657, 186, 80, 25603, 15, 1178, 5475, 9, 84, 4814, 13, 258, 3902, 558, 2657, 186, 64, 25756, 25580, 9, 80, 25603, 558, 2657, 186, 2520, 15, 3985, 426, 258, 25603, 15, 3985, 28, 2657, 186, 2309, 2032, 28, 988, 186, 94, 988, 186, 28293, 313, 70, 10, 551, 2657, 186, 2309, 3221, 28, 988, 186, 94, 996, 186, 94, 187, 186, 2023, 2032, 558, 535, 186, 20900, 19217, 15597, 22, 15, 40861, 7570, 64, 9536, 426, 686, 2974, 22, 5618, 187, 50274, 187, 186, 20900, 19217, 15597, 22, 15, 261, 31130, 426, 1159, 1082, 551, 187, 50270, 14626, 551, 187, 50266, 2309, 12196, 6790, 20900, 8, 275, 3497, 10, 3857, 3497, 5013, 6790, 20900, 6038, 20767, 3635, 3857, 187, 50258, 2073, 12426, 20900, 8, 275, 3497, 10, 3857, 3497, 5013, 12426, 20900, 6038, 20767, 3635, 28, 187, 50270, 94, 187, 50270, 28293, 313, 70, 10, 551, 187, 50266, 3122, 187, 50262, 688, 8726, 29969, 285, 5046, 643, 27030, 13, 368, 476, 19495, 5718, 275, 253, 6661, 7533, 13, 534, 187, 50262, 9846, 2847, 271, 2228, 281, 320, 13044, 3185, 273, 16344, 253, 2969, 604, 16, 7271, 3908, 15, 187, 50265, 8480, 187, 50266, 2309, 3221, 28, 187, 50270, 94, 187, 50274, 4718, 535, 50274, 12804, 15, 20900, 8224, 15, 15905, 9, 20900, 19217, 15597, 22, 558, 187, 186, 12804, 15, 20900, 19217, 15597, 22, 426, 29019, 19217, 15597, 22, 28, 187, 94, 6020, 187, 3122, 187, 475, 443, 6364, 12291, 27, 187, 475, 50276, 14, 11700, 614, 7364, 428, 3944, 1358, 2700, 15, 11296, 614, 15, 2061, 16, 10423, 15, 2974, 187, 475, 50276, 14, 16025, 9567, 32923, 1271, 428, 3944, 1358, 3211, 15, 9906, 15, 681, 16, 30053, 16, 463, 1032, 16, 463, 1032, 64, 6855, 82, 15, 2974, 4, 14461, 49, 15503, 8904, 187, 475, 209, 186, 14, 253, 2608, 1364, 23255, 1078, 40204, 476, 320, 908, 187, 475, 50276, 14, 1016, 11700, 7316, 556, 247, 3710, 1180, 273, 5810, 313, 1525, 2385, 11061, 582, 941, 588, 878, 281, 320, 5195, 2439, 10175, 187, 475, 50276, 14, 642, 7316, 943, 5669, 390, 5731, 625, 685, 8688, 2385, 11061, 273, 941, 275, 247, 2014, 3908, 390, 21430, 1277, 84, 588, 4710, 27, 187, 475, 50276, 186, 60, 5330, 1051, 17169, 4756, 27, 11700, 3908, 310, 1512, 1048, 2464, 672, 6789, 1332, 27, 544, 2224, 1838, 2277, 33329, 1450, 13393, 5949, 9336, 19769, 6870, 27, 346, 17, 89, 1438, 3011, 2874, 68, 313, 4883, 64, 12641, 64, 57, 5077, 64, 15253, 64, 3886, 1848, 56, 64, 15253, 64, 35581, 6844, 4328, 27, 16375, 29469, 21760, 941, 27, 642, 62, 187, 475, 187, 475, 29084, 84, 27, 187, 475, 50276, 14, 359, 778, 971, 281, 3359, 3081, 3470, 323, 253, 40204, 760, 7092, 187, 475, 50276, 14, 849, 476, 359, 417, 897, 14268, 281, 6016, 6874, 4328, 187, 1738, 187, 9, 3701, 1082, 551, 187, 186, 605, 4812, 46719, 395, 187, 2044, 28218, 426, 714, 17162, 4985, 15, 8906, 13, 187, 186, 32512, 426, 714, 17162, 4985, 15, 8700, 13, 187, 186, 12070, 64, 1267, 6229, 64, 37009, 1433, 426, 8688, 2385, 13, 187, 186, 24608, 64, 9536, 426, 686, 58, 9571, 20900, 19217, 1383, 535, 186, 605, 1980, 4903, 187, 186, 64, 17440, 426, 3635, 13, 535, 186, 70, 20201, 426, 22573, 3322, 1864, 23242, 5318, 13, 187, 186, 69, 20201, 426, 30358, 3322, 1864, 23242, 5318, 13, 535, 186, 6930, 996, 475, 380, 29019, 19217, 40, 6364, 966, 17930, 253, 5559, 443, 6364, 5718, 3948, 15, 996, 475, 1214, 12361, 714, 17162, 4985, 15, 8906, 996, 475, 1214, 2437, 29019, 19217, 40, 6364, 996, 475, 1214, 36073, 996, 475, 1214, 31930, 714, 17162, 4985, 15, 8906, 15, 20900, 996, 475, 1214, 3575, 256, 11930, 551, 2776, 94, 41622, 15, 380, 5718, 4328, 15, 996, 475, 1214, 3575, 258, 14044, 551, 4241, 94, 41622, 15, 329, 6661, 1789, 15, 996, 1738, 187, 186, 20900, 19217, 40, 6364, 426, 1159, 9, 84, 11930, 13, 258, 14044, 10, 551, 996, 186, 2044, 326, 426, 436, 13, 187, 50266, 2364, 6648, 426, 30744, 187, 50266, 261, 16282, 20900, 13, 6874, 4814, 13, 14208, 28, 187, 50270, 996, 186, 20900, 19217, 40, 6364, 15, 12185, 2437, 15, 36073, 15, 4065, 9, 3529, 13, 256, 11930, 13, 29019, 19217, 40, 6364, 15, 40861, 7570, 64, 9536, 13, 258, 14044, 558, 6886, 186, 338, 6522, 795, 17440, 10, 551, 988, 186, 605, 2794, 253, 5447, 988, 186, 64, 17440, 426, 17899, 15, 463, 1032, 15, 20907, 15, 6953, 9, 20900, 19217, 40, 6364, 15, 7538, 15286, 558, 187, 50272, 605, 253, 8171, 21165, 26019, 3944, 1358, 30838, 300, 4068, 15, 681, 16, 31224, 16, 90, 4113, 19, 16, 42186, 16, 1099, 22858, 883, 13, 512, 9407, 2886, 5810, 403, 4136, 70, 3707, 1227, 1163, 475, 3736, 346, 654, 2239, 1040, 3706, 1157, 988, 186, 64, 17440, 15, 5758, 9, 13686, 15, 12428, 15, 5465, 15, 13481, 33692, 5709, 6602, 27, 3458, 61, 865, 4713, 11899, 6087, 36739, 32666, 72, 13, 45381, 559, 30225, 8, 559, 29019, 19217, 40, 6364, 15, 36602, 2925, 9434, 558, 988, 186, 64, 17440, 15, 21599, 2073, 25875, 22454, 8681, 5803, 8021, 44237, 686, 559, 22454, 64, 9536, 559, 686, 313, 2364, 46434, 13, 4328, 46434, 13, 1318, 46434, 10, 5137, 996, 186, 94, 6886, 186, 261, 16282, 20900, 426, 28218, 15, 20900, 8224, 15, 21766, 6570, 64, 44405, 11013, 326, 3333, 12428, 28, 996, 186, 12426, 4814, 426, 28218, 15, 40461, 15, 788, 2073, 12426, 4814, 8, 559, 29019, 19217, 40, 6364, 15, 40861, 7570, 64, 9536, 558, 6886, 186, 338, 6522, 6874, 4814, 10, 551, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 4328, 34468, 559, 299, 20201, 9, 12804, 15, 20900, 8224, 15, 21766, 6570, 64, 44405, 10, 559, 32589, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137, 996, 186, 94, 6886, 186, 2967, 426, 795, 17440, 15, 21599, 2073, 12995, 2234, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 4328, 34468, 559, 299, 20201, 9, 3529, 3333, 12428, 10, 559, 32589, 5137, 996, 186, 2364, 6648, 426, 25425, 996, 996, 186, 14626, 551, 988, 186, 605, 35388, 327, 253, 10175, 285, 3711, 253, 10149, 988, 186, 6050, 313, 2967, 15, 261, 13159, 10990, 6649, 551, 2657, 186, 2044, 269, 392, 426, 277, 20201, 9, 2967, 15, 3423, 9, 17, 4027, 28122, 186, 338, 6522, 2234, 6648, 60, 71, 392, 3291, 551, 2664, 186, 2364, 6648, 60, 71, 392, 62, 426, 2032, 28, 2664, 186, 3529, 3333, 1911, 4814, 9, 71, 392, 558, 2657, 186, 94, 28122, 186, 2967, 15, 8384, 1874, 988, 186, 94, 996, 186, 94, 4720, 551, 988, 186, 2967, 15, 10483, 1874, 996, 186, 94, 6886, 186, 605, 436, 310, 6874, 5718, 13, 5416, 326, 253, 6874, 2234, 310, 873, 996, 186, 338, 313, 261, 16282, 20900, 10, 551, 988, 186, 12804, 15, 40461, 15, 1178, 2073, 12426, 4814, 8, 559, 29019, 19217, 40, 6364, 15, 40861, 7570, 64, 9536, 13, 2032, 558, 996, 186, 94, 535, 50270, 3529, 15, 11342, 5949, 9, 12804, 15, 20900, 15, 4339, 64, 13587, 58, 558, 187, 186, 4718, 535, 186, 32512, 15, 31930, 9, 20900, 19217, 40, 6364, 13, 28218, 15, 20900, 19217, 4814, 264, 13, 551, 6886, 186, 3122, 988, 475, 45211, 281, 2590, 253, 2193, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 8250, 988, 1738, 996, 186, 64, 8250, 27, 1159, 1082, 551, 988, 186, 20900, 19217, 40, 6364, 15, 12185, 2437, 3333, 8250, 15, 4065, 9, 2520, 558, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 4328, 34468, 559, 299, 20201, 9, 2520, 3333, 12428, 10, 559, 32589, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137, 996, 186, 2023, 6886, 186, 3122, 988, 475, 45211, 281, 20279, 271, 5382, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 788, 5475, 988, 1738, 996, 186, 64, 788, 5475, 27, 1159, 9, 84, 4814, 10, 551, 988, 186, 2044, 14208, 426, 795, 17440, 15, 21599, 2073, 12995, 1318, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 2234, 34468, 559, 299, 20201, 9, 84, 4814, 10, 559, 32589, 4889, 4328, 34468, 559, 299, 20201, 9, 2520, 3333, 12428, 10, 559, 32589, 11470, 2657, 186, 2877, 426, 34973, 11866, 186, 14626, 551, 2657, 186, 6050, 313, 2967, 15, 261, 13159, 10990, 6649, 551, 2664, 186, 2877, 7079, 14208, 15, 3423, 9, 17, 558, 2664, 186, 2967, 15, 8384, 1874, 2657, 186, 94, 988, 186, 94, 4720, 551, 2657, 186, 2967, 15, 10483, 1874, 988, 186, 94, 11866, 186, 2309, 1318, 3736, 277, 20201, 9, 2877, 10, 1163, 3635, 28, 996, 186, 2023, 6886, 186, 3122, 988, 475, 45211, 281, 5386, 271, 5382, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 12163, 5475, 988, 1738, 996, 186, 64, 12163, 5475, 27, 1159, 9, 84, 4814, 10, 551, 988, 186, 58, 17162, 4985, 15, 2808, 1587, 2013, 11305, 40204, 2234, 27, 346, 559, 256, 4814, 558, 988, 186, 20900, 19217, 40, 6364, 15, 12185, 2437, 3333, 12163, 5475, 15, 4065, 9, 2520, 13, 256, 4814, 558, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 2234, 34468, 559, 299, 20201, 9, 84, 4814, 10, 559, 32589, 4889, 4328, 34468, 559, 299, 20201, 9, 2520, 3333, 12428, 10, 559, 32589, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137, 996, 186, 2023, 6886, 186, 3122, 988, 475, 45211, 281, 5386, 271, 5382, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 1178, 5475, 988, 1738, 996, 186, 64, 1178, 5475, 27, 1159, 9, 84, 4814, 13, 258, 3233, 10, 551, 988, 186, 58, 17162, 4985, 15, 2808, 1587, 10452, 40932, 346, 559, 258, 3233, 559, 346, 281, 346, 559, 256, 4814, 558, 11866, 186, 2520, 3333, 1911, 4814, 9, 84, 4814, 558, 11866, 186, 2044, 256, 32629, 7760, 4814, 426, 299, 20201, 9, 84, 4814, 582, 2657, 186, 84, 32629, 7760, 11930, 426, 299, 20201, 9, 2520, 3333, 12428, 582, 2657, 186, 84, 32629, 7760, 3902, 426, 299, 20201, 9, 80, 3233, 582, 1380, 18993, 7019, 13, 5046, 417, 3309, 2657, 186, 66, 15888, 426, 24345, 2657, 186, 79, 18378, 426, 11700, 64, 1267, 6229, 64, 37009, 1433, 428, 313, 84, 32629, 7760, 4814, 559, 256, 32629, 7760, 11930, 481, 3985, 13, 187, 50262, 74, 30, 17, 13, 480, 28, 11866, 186, 605, 253, 2978, 273, 253, 1318, 23141, 253, 2130, 2317, 988, 186, 338, 313, 79, 18378, 654, 256, 32629, 7760, 3902, 15, 3985, 10, 551, 2657, 186, 1542, 313, 75, 426, 256, 32629, 7760, 3902, 15, 3985, 28, 891, 654, 480, 28, 891, 7079, 295, 18378, 10, 551, 2664, 186, 66, 15888, 15, 11340, 9, 84, 32629, 7760, 3902, 15, 39765, 9, 74, 13, 295, 18378, 4027, 2657, 186, 94, 988, 186, 94, 2010, 551, 2657, 186, 66, 15888, 15, 11340, 9, 84, 32629, 7760, 3902, 558, 988, 186, 94, 11866, 186, 605, 5559, 32636, 970, 49784, 3185, 273, 5731, 13, 984, 352, 310, 7938, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 2234, 34468, 559, 256, 32629, 7760, 4814, 559, 32589, 4889, 4328, 34468, 559, 256, 32629, 7760, 11930, 559, 32589, 5137, 988, 186, 1542, 313, 74, 426, 470, 13, 480, 426, 247, 15888, 15, 3985, 28, 891, 654, 480, 28, 891, 7079, 337, 10, 551, 2657, 186, 64, 17440, 15, 21599, 2073, 19240, 17116, 686, 559, 22454, 64, 9536, 559, 686, 20436, 5550, 8, 559, 256, 32629, 7760, 4814, 559, 686, 995, 17169, 559, 256, 32629, 7760, 11930, 559, 686, 995, 17169, 559, 247, 15888, 60, 74, 62, 559, 686, 2807, 5137, 988, 186, 94, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137 ]
) { var oDriver = this._driver; try { _beginTransaction(oDriver); oDriver.setItem(sKey, oValue); _commitTransaction(oDriver); this.length = oDriver.length; return true; } catch (e) { return false; } } }, true); StorageEngineHTML5.ENGINE_NAME = 'html5'; StorageEngineHTML5.isAvailable = function() { try { return ('localStorage' in window) && window['localStorage'] !== null && ('sessionStorage' in window) && window['sessionStorage'] !== null; } catch (e) { /* In FireFox and maybe other browsers, you can disable storage in the configuration settings, which will cause an error to be thrown instead of evaluating the simple if/else statement. */ return false; } }; Util.StorageManager.register(StorageEngineHTML5); Util.StorageEngineHTML5 = StorageEngineHTML5; }()); /* * Gears limitation: * - SQLite limitations - http://www.sqlite.org/limits.html * - DB Best Practices - http://code.google.com/apis/gears/gears_faq.html#bestPracticeDB * - the user must approve before gears can be used * - each SQL query has a limited number of characters (9948 bytes), data will need to be spread across rows * - no query should insert or update more than 9948 bytes of data in a single statement or GEARs will throw: * [Exception... "'Error: SQL statement is too long.' when calling method: [nsIDOMEventListener::handleEvent]" nsresult: "0x8057001c (NS_ERROR_XPC_JS_THREW_JS_OBJECT)" location: "<unknown>" data: no] * * Thoughts: * - we may want to implement additional functions for the gears only implementation * - how can we not use cookies to handle session location */ (function() { // internal shorthand var Util = YAHOO.util, Lang = YAHOO.lang, SQL_STMT_LIMIT = 9948, TABLE_NAME = 'YUIStorageEngine', // local variables _driver = null, eURI = encodeURIComponent, dURI = decodeURIComponent, /** * The StorageEngineGears class implements the Google Gears storage engine. * @namespace YAHOO.util * @class StorageEngineGears * @constructor * @extend YAHOO.util.Storage * @param sLocation {String} Required. The storage location. * @param oConf {Object} Required. A configuration object. */ StorageEngineGears = function(sLocation, oConf) { var that = this, keyMap = {}, isSessionStorage, sessionKey, rs; StorageEngineGears.superclass.constructor.call(that, sLocation, StorageEngineGears.ENGINE_NAME, oConf); if (! _driver) { // create the database _driver = google.gears.factory.create(StorageEngineGears.GEARS); // the replace regex fixes http://yuilibrary.com/projects/yui2/ticket/2529411, all ascii characters are allowede except / : * ? " < > | ; , _driver.open(window.location.host.replace(/[\/\:\*\?"\<\>\|;,]/g, '') + '-' + StorageEngineGears.DATABASE); _driver.execute('CREATE TABLE IF NOT EXISTS ' + TABLE_NAME + ' (key TEXT, location TEXT, value TEXT)'); } isSessionStorage = Util.StorageManager.LOCATION_SESSION === that._location; sessionKey = Util.Cookie.get('sessionKey' + StorageEngineGears.ENGINE_NAME); if (! sessionKey) { _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE location="' + eURI(Util.StorageManager.LOCATION_SESSION) + '"'); _driver.execute('COMMIT'); } rs = _driver.execute('SELECT key FROM ' + TABLE_NAME + ' WHERE location="' + eURI(that._location) + '"'); keyMap = {}; try { // iterate on the rows and map the keys while (rs.isValidRow()) { var fld = dURI(rs.field(0)); if (! keyMap[fld]) { keyMap[fld] = true; that._addKey(fld); } rs.next(); } } finally { rs.close(); } // this is session storage, ensure that the session key is set if (isSessionStorage) { Util.Cookie.set('sessionKey' + StorageEngineGears.ENGINE_NAME, true); } that.fireEvent(Util.Storage.CE_READY); }; Lang.extend(StorageEngineGears, Util.StorageEngineKeyed, { /* * Implementation to clear the values from the storage engine. * @see YAHOO.util.Storage._clear */ _clear: function() { StorageEngineGears.superclass._clear.call(this); _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE location="' + eURI(this._location) + '"'); _driver.execute('COMMIT'); }, /* * Implementation to fetch an item from the storage engine. * @see YAHOO.util.Storage._getItem */ _getItem: function(sKey) { var rs = _driver.execute('SELECT value FROM ' + TABLE_NAME + ' WHERE key="' + eURI(sKey) + '" AND location="' + eURI(this._location) + '"'), value = ''; try { while (rs.isValidRow()) { value += rs.field(0); rs.next(); } } finally { rs.close(); } return value ? dURI(value) : null; }, /* * Implementation to remove an item from the storage engine. * @see YAHOO.util.Storage._removeItem */ _removeItem: function(sKey) { YAHOO.log("removing gears key: " + sKey); StorageEngineGears.superclass._removeItem.call(this, sKey); _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE key="' + eURI(sKey) + '" AND location="' + eURI(this._location) + '"'); _driver.execute('COMMIT'); }, /* * Implementation to remove an item from the storage engine. * @see YAHOO.util.Storage._setItem */ _setItem: function(sKey, oData) { YAHOO.log("SETTING " + oData + " to " + sKey); this._addKey(sKey); var sEscapedKey = eURI(sKey), sEscapedLocation = eURI(this._location), sEscapedValue = eURI(oData), // escaped twice, maybe not necessary aValues = [], nLen = SQL_STMT_LIMIT - (sEscapedKey + sEscapedLocation).length, i=0, j; // the length of the value exceeds the available space if (nLen < sEscapedValue.length) { for (j = sEscapedValue.length; i < j; i += nLen) { aValues.push(sEscapedValue.substr(i, nLen)); } } else { aValues.push(sEscapedValue); } // Google recommends using INSERT instead of update, because it is faster _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE key="' + sEscapedKey + '" AND location="' + sEscapedLocation + '"'); for (i = 0, j = aValues.length; i < j; i += 1) { _driver.execute('INSERT INTO ' + TABLE_NAME + ' VALUES ("' + sEscapedKey + '", "' + sEscapedLocation + '", "' + aValues[i] + '")'); } _driver.execute('COMMIT');
[ 15, 7820, 13, 253, 6415, 43816, 1314, 816, 2590, 273, 253, 8930, 1078, 7281, 18432, 8855, 715, 253, 6150, 15, 187, 187, 18765, 6747, 2983, 574, 17288, 13, 616, 23658, 8388, 23716, 4455, 281, 1056, 598, 21987, 360, 80, 434, 2564, 15, 14566, 3735, 432, 6270, 251, 12727, 13, 840, 1907, 521, 4702, 41007, 80, 264, 13, 3405, 22210, 285, 521, 39230, 4829, 44550, 407, 9954, 432, 11864, 1106, 13, 21987, 360, 80, 8505, 4425, 2217, 369, 2217, 15, 47747, 521, 15917, 9954, 896, 2495, 264, 31160, 2716, 273, 521, 9974, 14603, 15, 754, 369, 13, 846, 512, 13, 275, 3923, 387, 253, 2914, 1128, 783, 1682, 1899, 281, 1056, 247, 31532, 3061, 15, 187, 187, 3404, 818, 27, 1010, 247, 15, 78, 904, 3159, 2210, 432, 253, 3923, 9729, 27, 346, 3493, 6597, 275, 1273, 2983, 5149, 1462, 407, 281, 4459, 562, 2983, 3063, 15, 1720, 2655, 532, 36544, 342, 24401, 449, 187, 187, 49340, 444, 1596, 383, 369, 3413, 281, 16338, 247, 6692, 6215, 1078, 344, 25753, 15, 1720, 5250, 253, 10289, 344, 1871, 644, 26400, 323, 369, 1024, 562, 273, 253, 1953, 13, 533, 281, 521, 1669, 444, 1596, 383, 3047, 247, 50148, 14954, 387, 779, 15, 754, 1335, 574, 30514, 491, 13, 594, 344, 19301, 253, 36653, 1892, 285, 253, 14792, 39, 1629, 2016, 264, 4404, 253, 50148, 13, 2167, 512, 253, 1223, 10305, 625, 28036, 15, 2732, 27535, 598, 327, 253, 747, 2303, 13, 444, 1596, 383, 4352, 253, 20994, 281, 8027, 521, 41007, 80, 15, 754, 3264, 253, 6415, 13, 1708, 2348, 407, 247, 7020, 13, 281, 2619, 598, 3885, 15, 2091, 352, 1904, 626, 13, 444, 1596, 383, 340, 43730, 253, 8945, 3727, 19732, 816, 281, 320, 2119, 15, 187, 187, 3463, 840, 253, 14792, 39, 369, 5434, 4087, 1698, 13, 5046, 6818, 14, 12071, 4669, 1840, 253, 5149, 27164, 15, 2726, 43721, 9506, 281, 10347, 13, 444, 1596, 383, 41912, 521, 9215, 26880, 285, 13, 2761, 1293, 4680, 13, 4925, 1066, 342, 521, 1669, 1133, 281, 4575, 253, 13970, 10334, 9530, 1735, 281, 521, 7319, 15, 733, 369, 1633, 344, 1900, 858, 281, 4828, 514, 253, 14792, 39, 434, 11480, 14, 37893, 14955, 1309, 2659, 723, 15, 187, 187, 1552, 673, 13, 2167, 13, 253, 6415, 434, 11480, 34408, 2400, 19123, 285, 342, 625, 7819, 352, 1014, 21863, 15, 3900, 253, 26225, 1453, 24686, 497, 43805, 13, 253, 13970, 10334, 24686, 8505, 10345, 626, 15, 367, 26080, 347, 2455, 13, 444, 1596, 383, 15433, 344, 1537, 320, 2104, 281, 8778, 521, 6415, 604, 344, 812, 10380, 17941, 745, 253, 6692, 20998, 2820, 594, 1892, 281, 8416, 779, 745, 15, 187, 187, 1909, 36989, 14, 25, 434, 10852, 353, 6364, 574, 3264, 13, 344, 5082, 626, 320, 1469, 327, 436, 9974, 390, 253, 1273, 15, 8948, 417, 1014, 253, 2626, 15, 7820, 13, 353, 6364, 651, 320, 247, 407, 1676, 254, 13, 521, 2793, 3710, 281, 752, 253, 4704, 2316, 4014, 881, 313, 11095, 253, 512, 14, 43442, 298, 13360, 365, 4584, 43400, 10, 2183, 779, 390, 752, 344, 812, 923, 323, 2994, 27164, 504, 15, 2064, 4131, 253, 21114, 3803, 574, 2183, 521, 25244, 326, 13, 604, 878, 320, 13, 344, 1871, 1408, 253, 40294, 6079, 273, 3678, 2820, 281, 1089, 253, 6692, 15, 346, 688, 326, 1083, 937, 48690, 1406, 753, 13, 346, 664, 1833, 512, 1790, 1066, 275, 253, 1824, 2366, 285, 452, 247, 5322, 1652, 38769, 449, 187, 187, 688, 253, 21114, 3803, 434, 2336, 79, 18888, 247, 41007, 80, 369, 1620, 247, 41007, 80, 1128, 262, 369, 2057, 247, 2619, 282, 13, 247, 259, 1914, 466, 13, 247, 6773, 390, 247, 7263, 365, 13692, 15, 346, 2042, 627, 310, 760, 581, 637, 1669, 937, 48690, 1406, 574, 21947, 15, 346, 42, 971, 326, 637, 281, 1379, 521, 2619, 282, 275, 285, 755, 247, 4352, 449, 187, 187, 6175, 6692, 10289, 12595, 43442, 285, 549, 3062, 2967, 3058, 1652, 673, 281, 4704, 253, 347, 14, 28948, 14, 328, 21201, 25760, 14, 67, 297, 1653, 13, 294, 28456, 253, 41007, 80, 42504, 313, 20415, 273, 534, 1024, 4824, 41007, 13347, 10, 369, 625, 9542, 15, 733, 5486, 1097, 11922, 253, 41007, 80, 285, 6890, 253, 17808, 10309, 15, 187, 187, 688, 253, 1531, 17263, 10913, 1032, 13, 342, 253, 4036, 79, 593, 6478, 2392, 2509, 4021, 7143, 313, 6458, 1076, 24401, 285, 23345, 41007, 13347, 10, 285, 342, 247, 28938, 273, 4036, 79, 593, 50276, 48590, 7281, 84, 13, 294, 28456, 1016, 6415, 812, 4354, 1379, 247, 2716, 4964, 15, 6707, 3184, 247, 5678, 285, 4751, 25899, 1273, 9974, 313, 30063, 12595, 16665, 432, 512, 1740, 15495, 13496, 342, 271, 3270, 14, 1200, 8201, 5878, 273, 24401, 285, 41007, 13347, 10, 812, 973, 1379, 767, 390, 625, 3038, 15, 16257, 13, 273, 2282, 13, 12595, 32173, 651, 671, 452, 281, 21244, 342, 27930, 285, 331, 23581, 253, 806, 5149, 434, 9954, 15, 187, 187, 5872, 13, 387, 818, 27, 1857, 247, 15, 78, 904, 247, 22491, 432, 253, 4797, 13, 247, 1304, 432, 50148, 795, 53, 531, 64, 686, 84, 42513, 6415, 27, 346, 27788, 11811, 13, 8505, 9054, 13, 8184, 264, 15, 378, 10745, 3578, 7759, 13, 4181, 16918, 6574, 432, 11864, 1106, 449, 733, 369, 417, 1199, 281, 564, 327, 15, 329, 3158, 7484, 2692, 253, 2448, 11811, 281, 320, 767, 4289, 6574, 432, 35289, 4351, 10627, 13, 533, 752, 2238, 497, 597, 32, 380, 3361, 273, 15495, 651, 1056, 512, 253, 3064, 13, 273, 2282, 15, 187, 187, 33451, 387, 2378, 13, 21987, 360, 80, 6960, 247, 10299, 2380, 5550, 48819, 1695, 6215, 3510, 285, 6558, 3057, 1476, 481, 1707, 369, 840, 253, 3343, 323, 625, 3668, 13, 4619, 3668, 1128, 66, 2180, 273, 5167, 1215, 7049, 264, 745, 275, 2909, 533, 7407, 347, 16649, 1005, 15, 187, 187, 3404, 818, 27, 3680, 247, 15, 78, 15, 2210, 247, 956, 14, 251, 3935, 27, 253, 9054, 11811, 574, 12059, 2282, 281, 32571, 7759, 1128, 3529, 760, 23573, 285, 546, 34785, 342, 697, 479, 3800, 1255, 15, 187, 187, 35, 3428, 3987, 1024, 342, 440, 17932, 2531, 13, 12345, 6221, 27875, 1482, 13, 285, 21987, 360, 80, 14116, 253, 5234, 432, 41007, 13347, 281, 24401, 15, 187, 187, 31840, 326, 4131, 327, 10289, 795, 15886, 10344, 64, 1157, 657, 39, 14, 23, 434, 747, 6392, 22389, 5490, 322, 15, 18707, 10512, 15, 574, 13452, 342, 36989, 14, 23, 434, 6392, 22389, 24609, 36362, 444, 15, 50178, 670, 253, 22161, 3835, 18707, 434, 13303, 38718, 812, 2085, 50178, 434, 308, 8561, 84, 15, 50178, 13, 18707, 812, 923, 13, 369, 1335, 9958, 253, 2538, 273, 247, 2552, 3349, 15165, 7343, 326, 2197, 521, 308, 8561, 34869, 4830, 253, 12595, 285, 840, 3034, 8036, 689, 4697, 15, 6724, 35571, 407, 6909, 254, 795, 9304, 356, 5582, 64, 313, 11927, 14, 25039, 582, 50178, 434, 47710, 1321, 285, 8188, 4998, 497, 642, 625, 685, 277, 34455, 285, 36712, 13, 533, 50178, 434, 2454, 285, 46532, 497, 46727, 2624, 285, 19933, 1701, 15, 23264, 1996, 13, 342, 521, 9412, 22133, 1335, 246, 7760, 13, 344, 4395, 13827, 314, 13, 344, 1871, 4518, 3663, 690, 2801, 285, 521, 2454, 369, 4366, 1598, 14530, 285, 4797, 14, 11958, 15, 11706, 13, 50178, 574, 16701, 327, 4283, 521, 40294, 3063, 15, 187, 187, 64, 15886, 10344, 64, 47609, 31678, 33508, 316, 4742, 313, 49645, 14, 23, 434, 2045, 6392, 10, 574, 7169, 18707, 313, 8701, 3438, 8630, 5908, 10, 4618, 31243, 28, 18707, 574, 3965, 1199, 4425, 752, 344, 9355, 281, 513, 342, 253, 7031, 15, 4325, 5015, 342, 247, 3094, 267, 11936, 18425, 665, 574, 816, 7416, 253, 40294, 13, 18707, 6311, 273, 253, 39883, 2668, 407, 253, 322, 8561, 84, 285, 253, 2323, 273, 253, 308, 8561, 84, 275, 970, 9005, 3835, 50276, 936, 8989, 616, 2746, 15, 18707, 671, 2210, 1977, 432, 326, 5955, 625, 13762, 685, 2455, 273, 253, 26329, 434, 10665, 34385, 689, 253, 1655, 17177, 273, 13303, 38718, 15, 187, 187, 1147, 369, 1633, 18707, 574, 4230, 9357, 327, 2455, 1580, 8119, 272, 253, 40294, 434, 401, 21, 39, 14, 21, 19543, 896, 275, 2393, 4162, 15, 3900, 841, 13303, 38718, 8, 23205, 32081, 14, 56, 723, 1160, 352, 1896, 323, 795, 15886, 10344, 64, 281, 4459, 625, 22161, 9954, 13, 616, 2879, 2801, 8513, 253, 9954, 84, 8, 12394, 2281, 285, 32183, 1430, 15, 1583, 497, 3365, 1512, 5536, 323, 616, 1698, 8815, 9177, 285, 3710, 7236, 5350, 28, 597, 574, 253, 1928, 313, 248, 1871, 14315, 388, 2018, 90, 275, 253, 1897, 1078, 253, 17413, 25682, 10, 273, 4751, 10607, 308, 8561, 84, 15, 187, 187, 40, 2321, 272, 752, 344, 1871, 6311, 670, 253, 3094, 267, 11936, 18200, 5043, 521, 806, 4608, 3640, 273, 253, 401, 21, 39, 14, 21, 434, 3045, 2159, 27366, 13, 18707, 4425, 281, 1978, 521, 3578, 13303, 8076, 6262, 8707, 512, 2366, 13, 12060, 387, 1029, 28036, 275, 2567, 342, 253, 322, 8561, 84, 15, 1723, 13, 943, 50178, 434, 25963, 308, 8561, 84, 1408, 715, 667, 7596, 13, 512, 344, 574, 281, 513, 369, 5553, 346, 8380, 327, 1066, 13, 8438, 3, 285, 1361, 313, 10328, 347, 352, 369, 10, 651, 320, 327, 253, 1039, 15, 187, 187, 20810, 13, 18707, 434, 2098, 281, 13920, 253, 322, 8561, 84, 42030, 264, 1309, 8027, 15, 1876, 253, 322, 8561, 84, 2335, 745, 327, 10130, 342, 795, 15886, 10344, 64, 686, 84, 806, 12595, 3301, 13, 533, 6308, 1076, 253, 1273, 3301, 13, 534, 2908, 18707, 434, 13303, 38718, 285, 50178, 434, 8397, 505, 2392, 13, 4455, 281, 1379, 11654, 15, 2896, 253, 673, 18707, 434, 401, 21, 13139, 497, 4720, 42864, 285, 4447, 598, 13, 271, 34456, 2101, 579, 593, 574, 6960, 33508, 316, 4742, 434, 322, 8561, 84, 281, 1481, 4745, 323, 253, 6692, 15, 187, 187, 8457, 344, 369, 7293, 327, 33508, 316, 4742, 434, 25760, 14, 67, 297, 1653, 323, 15034, 13, 436, 1691, 18707, 275, 247, 4993, 15, 1916, 521, 1270, 6619, 13, 18707, 4592, 281, 6308, 247, 41007, 80, 40294, 2708, 779, 4447, 598, 285, 13590, 562, 1293, 22161, 33352, 15, 7659, 2821, 597, 1364, 320, 50178, 434, 308, 8561, 84, 313, 9328, 497, 417, 582, 18707, 574, 521, 16340, 956, 15, 18707, 15433, 344, 812, 1335, 5834, 598, 342, 253, 322, 8561, 84, 689, 253, 2303, 13, 533, 597, 497, 2119, 745, 281, 247, 3563, 1265, 15, 733, 369, 2168, 17682, 854, 247, 15, 78, 15, 187, 187, 6300, 1078, 854, 247, 15, 78, 904, 347, 35289, 4351, 10627, 434, 21987, 360, 80, 16515, 8140, 48717, 37699, 327, 253, 5889, 273, 253, 2448, 6215, 4702, 281, 253, 6146, 13, 271, 795, 35832, 28720, 64, 1007, 483, 2361, 247, 747, 8630, 273, 9054, 42504, 20362, 795, 41, 11028, 86, 64, 1157, 436, 673, 432, 1029, 1268, 15, 380, 1821, 327, 795, 35832, 28720, 64, 686, 84, 8630, 5147, 9047, 36792, 1242, 347, 3034, 8036, 24401, 5439, 5699, 3471, 656, 398, 273, 1824, 326, 2349, 343, 31836, 806, 795, 41, 11028, 86, 64, 285, 840, 795, 52, 590, 86, 64, 1905, 7461, 39085, 247, 12786, 25790, 273, 6619, 672, 253, 32125, 4720, 8790, 1356, 285, 1097, 11811, 13082, 13, 8505, 440, 1026, 41746, 15, 187, 187, 48144, 272, 253, 1943, 42504, 13, 353, 953, 26826, 401, 976, 4355, 16470, 271, 9954, 8981, 8326, 15, 1583, 497, 378, 14, 1166, 84, 13, 253, 530, 15, 52, 15, 8663, 434, 26101, 42786, 1566, 15, 2058, 806, 13, 347, 253, 9954, 1128, 12496, 6933, 275, 512, 1128, 5267, 2094, 264, 396, 445, 600, 1977, 13, 401, 976, 4355, 13876, 2139, 253, 21141, 16340, 10345, 626, 23453, 731, 15, 2635, 344, 12659, 752, 10458, 18062, 253, 11306, 12360, 346, 4371, 84, 3, 497, 294, 19280, 281, 320, 15, 1583, 812, 760, 452, 35653, 432, 11864, 1106, 1128, 6309, 581, 625, 2372, 273, 1941, 19673, 21987, 360, 80, 434, 3236, 3061, 281, 294, 1513, 35289, 4351, 10627, 434, 41007, 80, 9954, 342, 24401, 15, 187, 187, 6300, 840, 1007, 8349, 20673, 2568, 1529, 8630, 273, 9954, 275, 9458, 432, 11864, 1106, 15, 401, 976, 4355, 16042, 25279, 9054, 16340, 275, 436, 6323, 1387, 15, 1583, 497, 25760, 14, 67, 297, 1653, 1014, 2167, 597, 497, 17682, 751, 642, 25760, 14, 67, 297, 589, 943, 27, 973, 2708, 253, 9005, 3835, 275, 20126, 1289, 1487, 795, 3333, 24059, 387, 2378, 1503, 18503 ]
. Instead, the plane skimmed just clear of the island before cartwheeling into the sea. Though neither attack had succeeded, their sheer ferocity seemed to make up Nagumo's mind. Having heard from Tomonaga, then having his formation torpedoed, strafed and his flagship nearly demolished by aircraft from Midway, Nagumo apparently decided enough was enough. Holding his reserve aircraft back risked wasting half of his strike capability. He was, after all, in command at the front—the best position to make a tactical decision. At 7:15 a.m., word came from the command bridge: "Planes in second attack wave stand by to carry out attack today. Reequip yourselves with bombs." Bert Earnest was determined to sink a Japanese ship before he crashed. Reaching the carrier he'd been aiming for was now out of the question, but to his left Earnest saw a cruiser firing at him. He still had rudder, so he kicked the pedal hard and the TBF skidded towards the cruiser, though all the while losing more altitude. After lining up on the new target, Earnest hit the switches to launch his torpedo. He expected the plane, lightened by a ton, to pick up speed. When it didn't, Earnest yanked the emergency release lever just to be sure. By then the TBF was dangerously low, maybe twenty-five feet above the wave tops. With scant moments to prepare, Earnest tightened his shoulder harness and, almost without thinking, reached down with his left hand to adjust the trim tab wheel next to his seat. It was something he always did to counteract the TBF's nose-heavy tendency during landings. This time, though, the plane's nose nudged upward and with more turns it even climbed. While the elevator control cables were severed, the trim tab cables apparently weren't. Practical as ever, Earnest figured he might be able to fly his plane if he could somehow shake off the Japanese fighters trying so hard to finish him off. As VT-8's Fred Mears had expected, he wouldn't be going on this strike or the second. Maybe not even the third. Instead, Mears would be a bystander, his experience limited to what the ready room teletype (plus the all-hands loudspeaker announcements) told him or what he could see for himself topside. That morning the skipper had told his pilots that, if need be, he'd run the squadron dry of gas trying to find the Japanese. "In that case," Waldron said, "we'll all sit down in the water together and have a nice little picnic." In the skipper's vernacular a torpedo was never a torpedo—it was either a pickle, a wienie, a fish or a torpecker. "If there is only one man left," Waldron had emphasized. "I want that man to take his pickle in and get a hit." While Japanese carrier deckhands and armorers needed little time to ready the as-yet-unarmed dive-bombers, rearming the torpedo bombers (many of which now carried torpedoes) was more complicated. It meant both removing the torpedo and changing the mounting hardware. In the cramped hangars, with the ordnance elevators doing double duty (lifting bombs and lowering torpedoes) and with a shortage of ordnance handling carts, rearming each plane could easily take a half hour. Readying a combined and fully coordinated second strike (balanced deck loads from all four carriers equipped with an anti-shipping mix of bombs and torpedoes) could well take two or more hours. Meanwhile, of course, deck crews would also have to contend with recovering and stowing the first wave's aircraft. Then, at 7:45 a.m., a bolt from the blue, a report from cruiser _Tone_ 's scout plane: "Ten ships, apparently enemy, sighted. Bearing ten degrees, distance 240 miles from Midway." It was not much to go on. A quick plot showed the American ships to be two hundred miles from Striking Force, but what kind were they? The presence of carriers would make all the difference, of course. Almost at once, Nagumo ordered a flash response ("Ascertain ship types and maintain contact!"). There was then the wait for more news, critical news—a period of suspense ticked off in minutes but experienced as eternities. At 7:58 a.m. came a follow-on message: the enemy ships had altered course to eighty degrees—that only frustrated and enraged with its meagerness. Brimming now with uncharacteristic, barely contained impatience, and Nagumo suspended the switch from torpedoes to bombs. Earlier that morning on carrier _Enterprise_ , VF-6's new CO Lieutenant James S. Gray Jr. had spoken with VT-6's CO Lieutenant Commander Eugene E. Lindsey about the fighter cover Gray's Wildcats could provide Lindsey's TBDs. Lindsey, Gray could see, was still suffering the effects of a May 28 landing accident that sent his TBD crashing onto the deck and then tumbling overboard. Retrieved by destroyer _Monaghan_ (DD-354), Lindsey's bombardier and radioman were no more than drenched and shaken, but Lindsey's face and torso were painfully cut and bruised. Days later, with his rib cage still taped, he moved stiffly, he'd clearly lost some weight and his face was noticeably pale and blue-black. Still, Lindsey had insisted on leading his squadron today. _Enterprise_ CAG Wade McClusky (VF-6's previous CO) had granted Gray (his former flight officer) wide latitude; Gray had pretty much decided what he planned to do with the coverage. From talking with a Coral Sea veteran who had just joined the squadron, Gray learned of the pounding taken by the SBDs and the success of the TBDs in using cloud cover to mask their approach. Gray also came away from that discussion more convinced than ever of the Zero's considerable superiority over the current crop of Wildcats. It was something Gray had harped on ever since commissioning the squadron's F4F-4 inventory back in early April. While these Wildcats' folding Sto-Wings made it possible for _Enterprise_ to carry more fighter aircraft, their added weight hurt the aircrafts' climb rate and maneuverability. They were simply too heavy for their low horsepower and limited fuel capacity; they had the feel (he'd warned Halsey in the days before the Tokyo raid) of fully loaded TBDs. Gauging what he'd learned about the Coral Sea strikes plus his firsthand knowledge of the F4F-4's performance shortfalls, Gray decided to keep his ten Wildcat escorts all together, flying at high altitude in company with the SBDs. However, should Lindsey's fourteen TBDs run into any trouble, all he had to do was radio "Come on down, Jim" and help (such as it was) would be on the way. Unfortunately, Gray's plan to accompany the SBDs unraveled during launch. All the SBDs took off on schedule with _Enterprise_ 's first deck load, but spotting the second load, which included Gray's Wildcats and Lindsey's Devastators, seemed to take forever. By the time Gray's F4Fs were finally airborne and formed up, an impatient Spruance had ordered McClusky's SBDs to head immediately for the Japanese. Because he was depending on McClusky's dive-bombers for navigation, this put Gray in a fix. To his great relief, Gray happened to spot a torpedo squadron below him formed up and heading out without fighter escort. Deciding they must be Lindsey's TBDs (they were not), Gray had his planes follow. Gray figured he could still catch up with the SBDs over the target, but they were sure off to a late start. It was already approaching 8 a.m. Just before 8 a.m., as Striking Force's Nagumo anxiously awaited clarification on the composition of the American ship formation to the north, an _Akagi_ lookout reported a new flight of enemy bombers attacking _Hiryu_ , this time from high level. The men on _Akagi_ 's flight platform watched apprehensively as tumbling bombs raised huge geysers of water that encircled first _Hiryu_ and then _Soryu_ —then breathed a collective sigh of relief when the turbulence finally subsided and both ships emerged, apparently unscathed. Eyeing the big bombers, Mitsuo Fuchida grabbed an aircraft recognition chart. They were B-17s, the U.S. Army's newest bomber model. At first, as the aircraft—fourteen in all—drifted serenely away, Fuchida wondered why the CAP planes weren't pursuing them. Then he remembered what tough opponents the heavily armed "forts" were reputed to be. They could only have flown from Midway—just one more bit of evidence backing Nagumo's original decision to rearm Striking Force's torpedo aircraft with bombs. Just then lookouts spotted yet another flight of aircraft inbound from Midway. Fuchida counted sixteen enemy planes in this latest group. They were dive-bombers even though they were approaching like no dive-bomber should: well below the cloud cover in shallow glides _._ Almost at once Zeros
[ 6742, 4086, 8525, 697, 5140, 13, 359, 3877, 326, 11019, 10656, 11990, 2550, 15249, 247, 7248, 534, 310, 16706, 342, 253, 3448, 285, 4096, 273, 253, 6645, 15, 5076, 13, 1580, 13, 347, 253, 14383, 78, 454, 3719, 1302, 6283, 4879, 13, 253, 7977, 11521, 327, 253, 22094, 281, 5276, 271, 2228, 275, 253, 16342, 434, 10858, 273, 253, 330, 13652, 2891, 13, 627, 310, 642, 39284, 10656, 7977, 14475, 432, 247, 1463, 13, 8342, 3448, 7914, 273, 253, 6645, 15, 187, 10971, 13, 359, 3877, 326, 530, 37, 1433, 4899, 3797, 247, 346, 22408, 2135, 3, 8332, 13, 534, 3054, 326, 6224, 273, 33631, 2867, 403, 14320, 281, 320, 1561, 247, 1375, 604, 346, 783, 2867, 310, 24610, 432, 271, 3906, 13, 4657, 13, 27134, 13, 13250, 390, 643, 1659, 273, 5718, 275, 436, 1375, 285, 3346, 313, 19, 10, 253, 22094, 310, 417, 39195, 275, 253, 1375, 273, 253, 37896, 449, 530, 15, 45, 15, 34, 15, 6852, 15, 3690, 15, 13662, 3015, 1668, 9, 67, 481, 380, 4710, 2135, 8332, 3021, 25153, 253, 1612, 273, 247, 1728, 1375, 281, 2891, 247, 7289, 273, 10229, 33781, 323, 271, 562, 14, 1171, 14, 3409, 37896, 604, 253, 1728, 1375, 22094, 310, 417, 48715, 275, 4602, 342, 253, 7289, 275, 253, 12095, 1375, 15, 380, 4710, 2135, 8332, 3400, 2891, 17382, 275, 326, 352, 651, 5416, 326, 4413, 2509, 2136, 12718, 275, 11637, 651, 27723, 46123, 8800, 253, 1072, 2891, 7977, 347, 4471, 14, 3409, 9341, 6498, 275, 776, 1375, 15, 3824, 4214, 14184, 556, 6747, 8671, 436, 8332, 4543, 23552, 271, 19890, 4710, 2135, 8332, 15, 1916, 253, 10214, 13, 5238, 24877, 9, 20, 10, 19, 9, 66, 2769, 20, 10, 273, 253, 6307, 3400, 27, 187, 9, 20, 10, 1198, 6378, 273, 17621, 285, 622, 9564, 420, 273, 6021, 762, 436, 5426, 13, 247, 22094, 310, 39195, 275, 1529, 1375, 604, 275, 326, 1375, 253, 22094, 310, 2256, 281, 247, 2036, 6021, 2891, 13, 247, 17117, 2891, 4080, 407, 2036, 6021, 13, 247, 17117, 2891, 323, 253, 15863, 273, 2509, 2136, 13, 390, 247, 10459, 5739, 2891, 390, 604, 326, 1375, 556, 7571, 281, 2256, 253, 22094, 281, 247, 2036, 6021, 2891, 13, 10159, 273, 1880, 13, 275, 958, 13, 253, 1375, 1057, 390, 1057, 417, 15, 475, 28883, 8187, 367, 15, 52, 15, 3015, 10677, 520, 9, 20, 10, 19, 9, 66, 2769, 20, 10, 313, 18532, 2879, 481, 733, 310, 13, 273, 2282, 13, 323, 253, 4214, 14184, 281, 3653, 1880, 247, 4710, 2135, 8332, 651, 1805, 1055, 6340, 253, 6034, 11315, 6974, 15, 10244, 13, 604, 253, 4214, 14184, 16995, 281, 5283, 271, 7914, 273, 253, 2891, 6645, 281, 2953, 253, 10656, 7350, 273, 253, 4487, 285, 281, 1056, 2590, 326, 17463, 6224, 403, 5118, 347, 275, 14, 3409, 24528, 323, 34871, 6378, 13, 352, 812, 4354, 513, 594, 347, 18627, 1840, 15, 187, 2214, 253, 20128, 4606, 13, 359, 5194, 342, 253, 14383, 78, 454, 3719, 1302, 326, 253, 4487, 273, 27464, 434, 7248, 310, 10214, 281, 253, 2590, 41066, 273, 5238, 24877, 9, 20, 10, 19, 9, 66, 2769, 1036, 10, 273, 253, 13662, 27828, 6307, 15, 10022, 13, 359, 10418, 253, 1340, 2708, 11734, 3883, 275, 3718, 273, 14383, 78, 454, 15, 187, 28292, 9060, 8293, 401, 5696, 41, 42410, 285, 3438, 9060, 8293, 1503, 18137, 1556, 34, 858, 417, 10078, 275, 253, 3061, 273, 436, 1083, 15, 187, 24963, 187, 60, 18, 62, 50276, 510, 4487, 434, 7248, 3054, 13, 347, 253, 346, 16691, 4086, 937, 326, 27, 346, 43819, 273, 33631, 3367, 2867, 403, 275, 253, 1375, 275, 534, 6742, 281, 247, 37896, 6634, 449, 9901, 3643, 15, 6124, 3015, 21579, 15, 1731, 9, 67, 2769, 19, 481, 3932, 253, 562, 14, 1171, 14, 3409, 37896, 3936, 6742, 275, 11637, 672, 247, 346, 44721, 7289, 3, 310, 3651, 78, 456, 13, 253, 4487, 26574, 1110, 6224, 347, 11637, 6224, 15, 187, 60, 19, 62, 50276, 39, 15, 48, 15, 35, 15, 310, 271, 31931, 2492, 323, 346, 4924, 327, 4450, 449, 380, 8453, 273, 253, 25344, 310, 326, 352, 5239, 253, 1127, 387, 534, 4060, 323, 10229, 11999, 281, 253, 37896, 15, 346, 510, 2087, 13, 4320, 4086, 310, 13, 326, 2220, 7289, 269, 15, 80, 15, 67, 15, 387, 1127, 273, 38388, 13, 4060, 11999, 432, 253, 24451, 253, 2774, 627, 310, 247, 6742, 281, 253, 10289, 3346, 544, 42, 62, 71, 253, 7289, 310, 1160, 269, 15, 80, 15, 67, 15, 387, 1127, 273, 12095, 13, 253, 4060, 1057, 417, 1509, 1919, 326, 1127, 310, 4925, 449, 1500, 21239, 1282, 362, 15, 330, 15, 708, 353, 15, 31186, 336, 2434, 904, 8437, 3643, 15, 15705, 15, 37296, 13, 31039, 18972, 4791, 1731, 313, 746, 2405, 481, 187, 60, 20, 62, 50276, 5035, 3044, 36647, 17885, 9537, 15, 362, 15, 1879, 3903, 885, 13662, 40518, 904, 3436, 2263, 15, 2946, 15, 21, 394, 1722, 2511, 13, 5922, 2263, 15, 35386, 15, 19, 69, 17181, 313, 13034, 558, 5255, 15861, 13, 3690, 15, 362, 15, 14038, 31244, 13, 23917, 27301, 15, 13900, 13, 48354, 329, 15, 19, 69, 1249, 4590, 313, 13435, 558, 7758, 33646, 15, 273, 27464, 362, 15, 19838, 16456, 3230, 2434, 904, 38794, 1893, 15, 19, 69, 818, 3763, 313, 28811, 15, 5229, 15, 2946, 15, 19, 69, 3656, 15, 16134, 558, 27464, 32098, 362, 15, 32524, 78, 708, 10664, 284, 13, 898, 1717, 322, 15, 56, 15, 19, 69, 818, 3156, 313, 41062, 15, 5229, 15, 2946, 15, 8441, 558, 10406, 571, 47922, 2434, 15, 362, 15, 15605, 273, 27464, 13, 34897, 427, 15, 56, 15, 19, 69, 721, 2945, 313, 39235, 15, 17103, 558, 367, 357, 296, 47922, 2434, 15, 362, 15, 15558, 33646, 15, 273, 27464, 13, 11084, 12051, 15, 19, 69, 34958, 13, 37516, 427, 15, 56, 15, 19, 69, 16493, 313, 48115, 15, 2051, 15, 14880, 582, 2278, 5868, 13, 11084, 12051, 15, 19, 69, 41156, 13, 38794, 427, 15, 56, 15, 19, 69, 25597, 313, 14880, 481, 187, 60, 21, 62, 50276, 1909, 4879, 1840, 13, 253, 11637, 8332, 9563, 347, 3637, 27, 187, 187, 43819, 273, 33631, 3367, 2867, 403, 275, 436, 2418, 604, 253, 2867, 310, 8549, 390, 24610, 281, 247, 37896, 13, 1561, 436, 2418, 10159, 273, 253, 269, 15, 80, 15, 67, 15, 1127, 390, 643, 2515, 273, 253, 7289, 15, 187, 3547, 367, 15, 52, 15, 3015, 10677, 520, 9, 20, 10, 19, 9, 66, 2769, 1036, 481, 5238, 1668, 9, 66, 10, 273, 530, 37, 1433, 4899, 3400, 326, 27, 187, 43819, 273, 3367, 2867, 403, 275, 436, 1375, 604, 27, 187, 9, 66, 10, 253, 2867, 310, 8549, 390, 24610, 281, 247, 37896, 13, 643, 685, 253, 1986, 2077, 2208, 13, 1561, 436, 1375, 10159, 273, 253, 269, 15, 80, 15, 67, 15, 1127, 390, 643, 2515, 273, 253, 7289, 15, 187, 2447, 338, 15, 9333, 273, 33224, 323, 13662, 14929, 6013, 13, 530, 15, 45, 15, 34, 15, 6852, 15, 3690, 15, 13662, 3015, 1668, 15, 187, 42665, 78, 454, 25153, 326, 253, 11637, 4214, 14184, 556, 417, 8671, 530, 37, 1433, 4899, 275, 697, 25983, 13, 533, 7211, 13, 347, 253, 16342, 2111, 858, 13, 923, 25782, 329, 15, 19, 69, 387, 898, 3583, 295, 15, 608, 25782, 329, 15, 19, 69, 898, 2385, 13, 326, 3448, 432, 253, 37749, 3162, 556, 644, 8671, 275, 11637, 15, 496, 436, 4227, 13, 352, 310, 5165, 326, 253, 10359, 273, 253, 11637, 8332, 369, 2668, 2336, 37438, 432, 530, 37, 1433, 4899, 13, 3707, 253, 4214, 14184, 16737, 253, 13604, 346, 977, 685, 253, 1986, 2077, 2208, 449, 1723, 13, 275, 271, 5165, 47412, 474, 29002, 13, 253, 4214, 14184, 16737, 760, 581, 273, 253, 767, 764, 284, 908, 281, 873, 745, 326, 13604, 13, 7624, 4933, 6054, 281, 253, 26704, 27838, 273, 253, 8332, 407, 253, 4676, 15, 187, 60, 22, 62, 50276, 510, 16342, 434, 16402, 13812, 875, 6224, 281, 562, 14, 1171, 14, 3409, 4147, 39053, 5398, 1701, 2220, 1880, 253, 10229, 403, 22111, 407, 253, 37896, 390, 407, 247, 1846, 10289, 310, 671, 20276, 984, 1048, 6924, 1083, 1569, 5936, 326, 6742, 281, 247, 1846, 10289, 310, 22602, 19581, 281, 6742, 281, 253, 37896, 15, 2594, 16342, 362, 15, 5874, 25746, 9537, 904, 33152, 3643, 15, 5922, 13, 24687, 329, 15, 21566, 313, 42362, 558, 1457, 2816, 285, 11637, 2434, 15, 362, 15, 330, 328, 472, 23194, 2434, 904, 32526, 3643, 15, 8187, 13, 13718, 329, 15, 854, 1619, 313, 746, 1731, 558, 24611, 27849, 589, 13, 3690, 15, 362, 15, 611, 1952, 567, 1342, 13, 26240, 3643, 15, 15705, 15, 33790, 13, 17294, 329, 15, 19, 69, 721, 1525, 13, 18450, 313, 38249, 10, 5550, 510, 2087, 4086, 310, 326, 247, 6742, 273, 10229, 281, 247, 10289, 10376, 281, 247, 3310, 273, 7289, 310, 247, 6742, 281, 253, 22894, 4209, 281, 1509, 4060, 281, 253, 10229, 285, 253, 10289, 387, 2378, 4916, 253, 5570, 273, 253, 22894, 449, 582, 19936, 8081, 3803, 362, 15, 23840, 13, 35786, 3643, 15, 17115, 13, 11858, 329, 15, 818, 3566, 313, 746, 1619, 558, 22119, 1294, 4694, 285, 367, 10892, 2434, 15, 362, 15, 330, 438, 1240, 90, 367, 10892, 2434, 904, 22146, 3643, 15, 13620, 13, 13062, 329, 15, 45297, 313, 45995, 481, 733, 651, 3176, 326, 13, 762, 11637, 1569, 13, 642, 3588, 13812, 4961, 875, 17463, 6224, 281, 562, 14, 1171, 14, 3409, 4147, 39053, 285, 6224, 281, 562, 14, 1171, 14, 3409, 4147, 39053, 24610, 407, 1846, 10289, 15, 187, 25438, 1682, 19101, 432, 1457, 20159, 29122, 29938, 1054, 280, 1301, 187, 187, 49, 12427, 562, 690, 273, 253, 1682, 5701, 432, 436, 2469, 8849, 187, 187, 18, 15, 346, 1231, 457, 250, 15428, 40316, 16156, 281, 247, 3310, 3063, 342, 253, 1457, 20159, 29122, 15, 754, 369, 247, 2285, 13595, 323, 253, 6115, 32329, 275, 4050, 15, 754, 2210, 275, 347, 247, 2940, 14, 251, 275, 4748, 13, 12431, 247, 26104, 285, 3395, 247, 4983, 5252, 13, 9090, 344, 457, 84, 644, 271, 17006, 281, 776, 2919, 285, 3114, 13, 253, 34075, 1351, 2021, 285, 352, 457, 84, 4824, 689, 281, 441, 387, 253, 29122, 15, 733, 457, 84, 247, 3965, 1175, 1388, 323, 779, 275, 253, 4131, 2970, 6704, 13, 38588, 275, 253, 9055, 13, 594, 344, 457, 84, 15335, 313, 66, 11877, 481, 309, 1053, 457, 85, 871, 672, 44065, 313, 45, 6188, 261, 10, 310, 1907, 779, 861, 253, 3310, 15, 309, 457, 69, 1056, 2119, 281, 1007, 352, 689, 2167, 313, 36425, 582, 1056, 2119, 368, 452, 253, 3451, 17301, 275, 627, 15, 1292, 359, 457, 250, 1469, 861, 779, 3063, 281, 247, 3310, 15, 309, 457, 78, 9979, 281, 320, 598, 627, 342, 779, 15, 309, 457, 78, 2221, 14, 1087, 2995, 273, 521, 7355, 285, 253, 1039, 344, 457, 84, 15726, 285, 13781, 436, 15, 309, 871, 344, 285, 521, 2021, 403, 31115, 323, 253, 1329, 273, 594, 1142, 326, 452, 6518, 779, 949, 436, 1232, 1425, 187, 187, 14, 29122, 28466, 22723, 12286, 1299, 327, 15428, 40316, 16156, 187, 187, 19, 15, 346, 1147, 457, 84, 2761, 751, 581, 273, 619, 13702, 1705, 2032, 15, 309, 457, 306, 644, 247, 29122, 7989, 2761, 1580, 309, 369, 7824, 313, 284, 247, 5772, 481, 3771, 281, 320, 247, 629, 273, 253, 2285, 285, 320, 1475, 253, 3773, 310, 625, 685, 309, 812, 3524, 323, 1425, 187, 187, 14, 16156, 187, 187, 20, 15, 346, 6693, 673, 247, 4760, 310, 1133, 81, 14050, 407, 22723, 12286, 1299, 281, 1132, 8399, 285, 310, 247, 11452, 13, 368, 1805, 2868, 344, 457, 84, 1469, 281, 320, 1633, 13, 594, 309, 457, 78, 20138, 281, 923, 779, 15, 831, 5599, 13279, 634, 2927, 15, 1422, 476, 1928, 521, 3885, 13, 594, 352, 457, 84, 1633, 326, 1219, 11328, 908, 281, 1333, 2802, 5804, 368, 1928, 521, 3885, 29200, 1422, 476, 1928, 521, 3885, 285, 309, 457, 78, 2819, 3579, 281, 6523, 779, 15, 309, 871, 22723, 285, 344, 457, 620, 2794, 9503, 281, 755, 436, 5599, 3206, 285, 352, 588, 320, 13103, 1425, 14, 29122, 14397, 30468, 6625, 13114, 327, 806, 14, 4650, 2619, 21444, 249, 11980, 84, 187, 187, 21, 15, 346, 42, 457, 78, 816, 17682, 352, 849, 4130, 2010, 651, 15, 309, 457, 78, 3551, 275, 1060, 2120, 14, 2184, 15, 309, 457 ]
delivery rule supports its construction, we note that mere administrative ease cannot justify a regulation which is inconsistent with the language and purpose of the statute. Moreover, since, as the Gilmour II court properly noted, the burden falls on the taxpayer to prove an error in the Commonwealth's settlement of the CNI tax, there is no undue administrative burden arising from a proper, plain language interpretation of the statute. Finally, we note that UDITPA includes a "throwback" provision, which states that sales of tangible property are deemed to be within a state if "the property is shipped from an office, store, warehouse, factory or other place of storage in this state and ... (2) the taxpayer is not taxable in the state of the purchaser." U.L.A. Div. Inc. Tax § 16(b). The throwback provision thus recognizes the power of a home state to tax a sale of goods destined for an out-of-state purchaser if the home state taxpayer is not taxed in connection with the sale in the destination state. The throwback provision provides tax equity in that it would ensure that companies doing business solely in Pennsylvania would ostensibly bear the same tax burden as multi-state businesses operating in our state. Our General Assembly has neither adopted this provision nor enacted an analogous throwback provision. To the contrary, Section 401(3)2(a)(3) of the Code provides: (3) For purposes of allocation and apportionment of income under this definition, a taxpayer is taxable in another state if in that state the taxpayer is subject to a net income tax, a franchise tax measured by net income, a franchise tax for the privilege of doing business, or a corporate stock tax or if that state has jurisdiction to subject the taxpayer to a net income tax, regardless of whether, in fact, the state does or does not. *684 72 P.S. § 7401(3)2(a)(3) (emphasis added). It is, of course, for the General Assembly to determine whether a throwback provision would better effectuate the intended statutory scheme. Similarly, if the General Assembly wishes to adopt an interpretation of the tax statute to address the administrative concerns of the Department and to make clear that dock sales are calculated as in-state revenues for taxation purposes, it could easily do so as outlined above. For the foregoing reasons, we agree with the Gilmour II court that the Department of Revenue's regulation is contrary to the clear wording of Section 401(3)2(a)(16) of the Tax Reform Code. Accordingly, we affirm the order below entering judgment in favor of Gilmour. Former Chief Justice FLAHERTY and former Chief Justice ZAPPALA did not participate in the decision of this case. NOTES [1] The Department's regulation states, as the "general rule," that: "Sales of tangible personal property are in the state in which delivery to a purchaser occurs." 61 Pa.Code § 153.26(b)(2). Since the out-of-state purchaser takes delivery in Pennsylvania when a "dock sale" is consummated, the Department treats those sales as Pennsylvania sales. [2] F.O.B. is an abbreviation for "free on board." The significance of the designation is that it sets the point at which title for goods passes to the purchaser. "The general, legal rule is, that upon sale f.o.b. at point of shipment, title passes from the seller the moment there is a delivery to the carrier ... [I]f the sale is made f.o.b. at point of destination, the title does not pass until that point is reached." Shetzline v. C. & M. Produce Co., 101 Pa.Super. 432, 1931 WL 3526 (1931). [3] See McDonnell Douglas Corp. v. Franchise Tax Bd., 26 Cal.App.4th 1789, 33 Cal.Rptr.2d 129 (1994); Texaco, Inc. v. Groppo, 215 Conn. 134, 574 A.2d 1293 (1990); Florida Dept. of Revenue v. Parker Banana Co., 391 So.2d 762 (Fla.Ct.App.2d Dist.1980); Revenue Cabinet v. Rohm & Haas, 929 S.W.2d 741 (Ky.Ct.App. 1996); Olympia Brewing Co. v. Commissioner of Revenue, 326 N.W.2d 642 (Minn.1982); Pabst Brewing Co. v. Wisconsin Dept. of Revenue, 130 Wis.2d 291, 387 N.W.2d 121 (Wis. App.1986), review denied, 130 Wis.2d 544, 391 N.W.2d 209 (1986). [4] As noted above, the Pennsylvania provision reads as follows: Sales of tangible personal property are in this State if the property is delivered or shipped to a purchaser, within this State regardless of the f.o.b. point or other conditions of the sale. 72 P.S. § 7401(3)2(a)(16). Section 16(a) of UDITPA provides that: Sales of personal property are in this state if: (a) the property is delivered or shipped to a purchaser, other than the United States government, within this state regardless of the f.o.b. point or other conditions of the sale. Unif. Division of Income for Tax Purposes, U.L.A. Div. Inc. Tax § 16. Gilmour recognizes that the Pennsylvania General Assembly has not adopted UDITPA in its entirety, but notes, as the Commonwealth Court did, see 750 A.2d at 952 n. 5 750 A.2d 948, that language from the Uniform Act has been adopted in Pennsylvania. In this instance, it is apparent that the substance of the Pennsylvania provision was taken verbatim from UDITPA, except the General Assembly deleted the clause "other than the United States government." However, in an apparent grammatical oversight, the General Assembly deleted only one of the two commas used to set off that clause, thereby giving rise to the differing interpretations of the provision by the parties. [5] The Commonwealth's asserted distinction between sales to out-of-state purchasers premised upon whether the goods are retrieved by the purchaser or by a common carrier is also problematic because longstanding case law suggests that delivery to a common carrier is tantamount to delivery to the purchaser. See Commonwealth v. Wiloil Corp., 316 Pa. 33, 173 A. 404 (1934); New York and Pennsylvania Co. v. Cunard Coal Co., 286 Pa. 72, 132 A. 828 (1926); Harvey Probber, Inc. v. Kauffman, 181 Pa.Super. 281, 124 A.2d 699, 700 (1956) ("The general rule is that a delivery of goods to a carrier pursuant to a contract of sale is a delivery to the buyer sufficient to pass title to the goods and the carrier at once becomes the agent of the buyer."), citing Popper v. Rosen, 292 Pa. 122, 140 A. 774 (1928); Pittsburgh Provision and Packing Co. v. Cudahy Packing Co., 260 Pa. 135, 103 A. 548 (1918). It would appear that, under Pennsylvania law, no valid distinction exists between dock sales to out-of-state purchasers and sales to out-of-state purchasers shipped by common carrier. Five best quotes from New Orleans Saints rookie minicamp Picking out some of the best comments from this past weekend 1. "We’re signing Devon Walker to a contract today with the New Orleans Saints. He was a team captain for the Green Wave in 2012. He came in as a walk-on in 2009, earned a scholarship and became a starting safety, obviously he’s been an inspiration to our region and community, the Tulane family and it’s carried over to us at the Saints. It’s a pretty good day for him in the morning getting signed, graduating in the afternoon, so he’s officially (a Saint). I don’t know when Mickey (Loomis) is having him sign the contract. I’d make sure to look it over though (laughter), make sure you have the correct bonus in there. But we’re going sign him today to a contract. I’m proud to be up there with him. I’m super-proud of his recovery and the way he’s handled and approached this. I know he and his family are thankful for the support of so many that have helped him through this process.” - Saints Coach Sean Payton on signing Devon Walker 2. "It’s almost like one of my dreams come true. I’ve been a Saints fan almost since I was walking (as a kid). Just to be a part of the team and be around the players is more than I could hope for.” - Walker 3. "Any time a player is handpicked by Sean Payton to play offense and is a receiver, you better believe he’s going to be something, so I’m anxious to see him. This guy opens your eyes. You can feel his speed, so it’s something that Al Davis used to say ‘Can you feel his speed?’ You can feel his speed and I’m looking forward to seeing him. I know Sean and he’ll create roles to get this guy involved and it will be awesome.”- Saints defensive coordinator Rob Ryan on first-round pick Brandin Cooks 4. "I’m just approaching it how everyone else would. I’m coming in here full-go. I’
[ 5749, 71, 62, 409, 4247, 337, 13, 6752, 13, 4135, 3534, 598, 13474, 5286, 273, 964, 964, 964, 14590, 330, 6788, 2053, 411, 7058, 7177, 497, 417, 1078, 6798, 1535, 3800, 387, 253, 3200, 281, 5597, 3924, 15, 187, 187, 57, 8296, 15, 380, 13421, 434, 6515, 3658, 275, 253, 41337, 26775, 5538, 1716, 29340, 346, 23315, 14, 21831, 47890, 3, 187, 688, 271, 3081, 3908, 9262, 327, 6010, 3883, 313, 783, 346, 7857, 21978, 8375, 253, 13421, 8631, 253, 5628, 346, 10394, 273, 1881, 14, 12722, 47890, 449, 4794, 281, 253, 4748, 21978, 27, 187, 187, 11, 45153, 544, 510, 985, 273, 2634, 1286, 14, 12722, 47890, 6038, 556, 247, 1048, 2892, 275, 4135, 285, 556, 644, 973, 1929, 281, 13, 285, 35037, 342, 407, 13, 5628, 4413, 15, 16531, 14, 12722, 47890, 1057, 417, 1599, 3426, 12228, 274, 1632, 390, 1881, 14, 11018, 15, 496, 1055, 13, 1881, 14, 12722, 47890, 10770, 281, 247, 985, 273, 7248, 762, 253, 20446, 273, 247, 13205, 6757, 8534, 327, 11136, 273, 253, 5628, 2208, 15, 6166, 436, 10545, 985, 13, 253, 4676, 3206, 7279, 342, 1016, 643, 281, 3986, 13969, 327, 25899, 4712, 323, 253, 4096, 273, 10922, 253, 16566, 285, 9417, 253, 1600, 347, 873, 6593, 762, 5628, 5323, 285, 7823, 15, 10400, 790, 9583, 275, 824, 2424, 1881, 14, 12722, 47890, 403, 973, 6600, 326, 597, 403, 2256, 281, 22414, 323, 4433, 281, 10078, 275, 824, 19915, 13, 390, 323, 1327, 14, 46451, 342, 1881, 14, 12722, 47890, 13, 1690, 24184, 2996, 616, 13474, 987, 15, 187, 7130, 281, 253, 13421, 13, 14590, 330, 866, 8949, 497, 17886, 407, 1881, 14, 12722, 47890, 7248, 13, 253, 16566, 273, 534, 497, 346, 936, 6558, 42062, 13474, 13, 46126, 253, 6284, 273, 253, 2586, 347, 247, 2644, 285, 3693, 1881, 14, 43739, 422, 7324, 449, 380, 4748, 21978, 671, 25339, 253, 13421, 434, 31896, 273, 6265, 281, 253, 23119, 5001, 1881, 14, 12722, 47890, 15, 187, 187, 57, 3252, 15, 8065, 473, 9852, 621, 187, 688, 16585, 253, 10732, 273, 346, 1286, 14, 12722, 47890, 7911, 995, 12734, 30972, 285, 247, 1180, 273, 42608, 26542, 281, 271, 4223, 8065, 26777, 6808, 407, 253, 2418, 19190, 285, 17061, 5399, 5550, 10452, 36, 2807, 7429, 346, 48, 9852, 621, 1623, 16531, 14, 21831, 47890, 367, 695, 272, 1198, 35110, 24148, 23910, 3, 5550, 11496, 473, 9852, 621, 6788, 17868, 40326, 899, 70, 13, 380, 49540, 273, 18567, 14, 9304, 24261, 7153, 261, 4004, 275, 4135, 13, 6752, 28553, 15, 530, 15, 4051, 706, 15, 4472, 15, 418, 15, 7498, 15, 848, 13, 24519, 14, 2693, 28, 30972, 10840, 11367, 5571, 15, 380, 8065, 473, 9852, 621, 13, 534, 760, 3206, 9836, 7911, 13, 346, 9468, 12086, 326, 253, 18014, 273, 2176, 9787, 3580, 10018, 253, 5927, 4376, 7787, 873, 407, 616, 9056, 5454, 12485, 449, 17868, 40326, 899, 70, 13, 6752, 28553, 15, 530, 15, 4051, 706, 15, 4472, 15, 418, 15, 7498, 15, 387, 24519, 28, 923, 671, 7493, 16598, 13, 380, 16040, 273, 38692, 27, 367, 695, 272, 47670, 447, 285, 253, 48730, 27920, 281, 25388, 4135, 434, 19190, 4155, 13, 380, 4135, 9109, 1621, 15, 7584, 13, 655, 313, 14060, 15, 6469, 481, 380, 5927, 7911, 497, 1754, 327, 247, 1885, 434, 3388, 4815, 275, 253, 4491, 15, 16598, 13, 380, 4135, 9109, 1621, 15, 7584, 13, 655, 28, 923, 671, 17868, 40326, 899, 70, 13, 6752, 28553, 15, 530, 15, 4051, 706, 15, 4472, 15, 418, 15, 3555, 15, 387, 25597, 15, 187, 187, 9, 20, 10, 187, 187, 38546, 52, 3481, 5642, 1042, 37453, 45375, 2025, 19904, 3123, 5656, 52, 187, 187, 42, 15, 380, 8210, 3667, 553, 187, 28343, 253, 38548, 72, 318, 273, 253, 8210, 3667, 553, 285, 4162, 6585, 13, 253, 4974, 43206, 2918, 247, 1180, 273, 12225, 835, 7159, 4925, 15486, 327, 4376, 285, 13474, 12686, 284, 15, 2053, 12225, 497, 11612, 407, 6338, 432, 1097, 253, 23119, 285, 253, 13421, 15, 187, 688, 8210, 13, 253, 4376, 273, 14590, 330, 369, 370, 21, 15, 21, 16, 5840, 15, 2058, 690, 1127, 13, 7159, 873, 253, 5927, 4376, 387, 370, 22, 15, 20, 16, 5840, 285, 253, 4376, 9461, 281, 387, 1878, 370, 22, 16, 5840, 15, 1723, 13, 875, 2552, 5307, 285, 4565, 6585, 13, 627, 369, 247, 346, 19209, 2137, 937, 534, 7369, 275, 13474, 7911, 18752, 281, 1679, 685, 370, 19, 15, 25, 16, 5840, 15, 831, 4620, 281, 452, 644, 4269, 407, 271, 7466, 275, 4135, 434, 3275, 5350, 326, 8424, 1314, 432, 271, 5165, 346, 24418, 4524, 6924, 3, 387, 247, 7544, 4974, 43206, 4804, 15, 187, 688, 4565, 5307, 13, 253, 5927, 13474, 4376, 369, 370, 22, 15, 18, 16, 5840, 15, 1723, 13, 347, 352, 4620, 326, 5293, 273, 253, 7159, 497, 1563, 326, 4376, 13, 7159, 5821, 281, 346, 8629, 1419, 3, 326, 4376, 285, 9262, 436, 4345, 281, 253, 13421, 346, 1542, 9612, 31830, 883, 62, 187, 11, 45225, 2058, 247, 4974, 43206, 4804, 275, 4162, 6585, 13, 253, 36994, 5469, 247, 5926, 275, 253, 4376, 285, 253, 3332, 7466, 275, 4135, 434, 3275, 5350, 15, 2058, 581, 1127, 1309, 253, 4804, 13, 253, 8612, 432, 253, 13421, 8191, 253, 2758, 326, 27, 187, 9586, 2167, 29640, 310, 417, 247, 7741, 1885, 13, 352, 556, 644, 13714, 13527, 1580, 8210, 15, 30696, 253, 2538, 273, 1655, 10132, 13, 3839, 8288, 13, 253, 7248, 556, 417, 644, 1077, 5547, 15, 544, 510, 13421, 62, 863, 3844, 6349, 281, 253, 13701, 285, 2440, 273, 253, 23119, 13, 285, 4419, 749, 14, 25756, 22425, 281, 769, 354, 39237, 15, 48327, 878, 281, 20090, 253, 4491, 15486, 285, 4491, 4803, 15, 2091, 32447, 403, 46875, 616, 16256, 13, 597, 671, 878, 281, 1908, 253, 1600, 273, 253, 1375, 347, 247, 2644, 15, 187, 3404, 253, 4804, 13, 253, 16596, 5821, 281, 4796, 253, 5927, 13474, 4376, 432, 370, 22, 15, 740, 16, 5840, 281, 370, 20, 15, 938, 16, 5840, 13, 18289, 275, 8956, 342, 253, 4345, 387, 253, 4565, 5307, 4804, 15, 380, 2909, 564, 327, 281, 1375, 326, 27, 346, 6436, 13, 984, 253, 16596, 452, 417, 5821, 327, 253, 10473, 6297, 273, 253, 21999, 285, 38419, 985, 13, 352, 4558, 247, 2201, 1953, 1880, 436, 4376, 2701, 476, 320, 27810, 8069, 449, 187, 187, 2267, 15, 48332, 281, 253, 6752, 3667, 553, 187, 688, 4397, 285, 4596, 6585, 13, 253, 13421, 6311, 326, 253, 5284, 6398, 369, 7296, 9745, 271, 3270, 14, 23593, 272, 4176, 1411, 253, 5628, 14590, 330, 16596, 15, 831, 1491, 369, 39010, 281, 253, 23119, 15, 1623, 581, 3389, 13, 1133, 15720, 7211, 13, 8505, 432, 13421, 6338, 13, 1375, 27, 313, 18, 10, 5749, 81, 62, 3621, 2278, 285, 755, 5480, 3664, 313, 19, 10, 346, 32897, 2278, 285, 2953, 352, 3664, 285, 313, 20, 10, 5749, 81, 62, 3621, 7409, 436, 2647, 31830, 805, 62, 187, 2374, 4596, 1668, 13, 6585, 13, 253, 23119, 2918, 247, 4804, 342, 7159, 4681, 1012, 62, 2058, 253, 4804, 13, 7159, 13, 346, 1615, 1039, 273, 1133, 13423, 937, 5821, 281, 7164, 253, 346, 29309, 3901, 13474, 4376, 3, 281, 370, 20, 16, 5840, 4983, 327, 4247, 337, 13, 6752, 15, 12254, 671, 5821, 281, 2701, 253, 2264, 13474, 4644, 323, 6752, 281, 4791, 13, 5388, 16298, 313, 3113, 1016, 2567, 6883, 2060, 13474, 4644, 9771, 569, 10, 285, 281, 417, 5645, 616, 3275, 5350, 15, 12254, 8, 4345, 369, 346, 1468, 264, 387, 22474, 253, 1881, 14, 12722, 47890, 273, 253, 4491, 449, 496, 4565, 6585, 13, 253, 23119, 7581, 264, 1529, 4804, 15995, 7159, 281, 2319, 16994, 436, 4345, 15, 187, 3650, 760, 310, 627, 642, 25712, 1941, 273, 509, 15305, 275, 253, 7177, 16585, 436, 4345, 13, 533, 841, 7177, 671, 1804, 13, 327, 616, 2454, 13, 326, 436, 4345, 369, 17610, 4681, 1047, 62, 2596, 3054, 13, 323, 1650, 13, 475, 42980, 326, 253, 5014, 346, 585, 4686, 326, 5628, 39944, 330, 16596, 403, 8839, 7032, 273, 27017, 253, 1881, 14, 12722, 47890, 273, 253, 4491, 3, 984, 313, 18, 10, 4135, 556, 2406, 13711, 4815, 28, 313, 19, 10, 346, 25307, 273, 39944, 330, 275, 4135, 310, 4122, 36409, 275, 1740, 16596, 285, 3021, 13, 352, 310, 4942, 3477, 281, 3986, 440, 1988, 1561, 253, 4491, 3664, 313, 20, 10, 6186, 310, 275, 6654, 342, 4831, 285, 4376, 34044, 403, 12264, 28, 285, 313, 21, 10, 627, 310, 2266, 3116, 275, 4831, 323, 39944, 330, 347, 271, 346, 343, 13481, 494, 1885, 449, 8035, 3054, 27, 187, 60, 66, 62, 2110, 1493, 432, 7732, 1561, 253, 4491, 369, 326, 253, 32447, 497, 2104, 281, 1790, 1066, 2366, 387, 436, 1798, 673, 984, 29640, 7911, 574, 4925, 5561, 5004, 13, 285, 642, 581, 812, 10265, 247, 2007, 14518, 28, 253, 1735, 1921, 369, 13, 984, 253, 2586, 574, 5485, 598, 253, 6264, 3580, 2136, 432, 247, 1959, 7324, 4809, 253, 32447, 497, 1607, 5911, 285, 574, 642, 4327, 533, 281, 7703, 4491, 1881, 14, 11973, 15, 187, 29129, 13, 247, 6010, 273, 253, 4565, 6585, 4804, 432, 23119, 434, 4422, 7211, 326, 27, 187, 10489, 6031, 407, 253, 39944, 330, 4974, 14, 2115, 6614, 273, 544, 783, 23119, 62, 964, 964, 964, 9836, 16596, 497, 2104, 281, 3986, 247, 1881, 14, 10088, 4345, 8379, 13, 17580, 597, 651, 25706, 1453, 253, 10671, 285, 13870, 273, 24217, 281, 5115, 253, 4736, 273, 28366, 1223, 12976, 13474, 7911, 15, 6102, 1881, 14, 1120, 5335, 5593, 13, 7194, 1754, 327, 2634, 1120, 27106, 10671, 281, 46126, 7911, 13, 13474, 275, 247, 16645, 285, 42062, 5133, 285, 4575, 23043, 8, 452, 644, 4336, 9009, 407, 1016, 32447, 8, 1211, 7089, 285, 1881, 14, 1120, 5335, 13, 1293, 667, 2208, 7268, 15, 43312, 327, 2552, 337, 13, 6752, 13, 14590, 330, 369, 7117, 347, 247, 1885, 10568, 4376, 10123, 407, 4135, 434, 36262, 285, 247, 14393, 273, 638, 14, 6772, 1208, 407, 253, 544, 1779, 7272, 1092, 534, 556, 2530, 6422, 29002, 285, 4999, 36259, 323, 253, 7092, 273, 1881, 14, 1120, 5335, 15486, 2190, 9836, 16596, 15, 187, 9, 36214, 2879, 36033, 1010, 62, 187, 6080, 7177, 16585, 253, 4596, 285, 4565, 6585, 12225, 16084, 326, 21999, 285, 38419, 369, 908, 281, 7767, 253, 4676, 8, 4345, 15, 1723, 13, 5293, 273, 841, 7177, 4518, 1375, 326, 7159, 8, 15486, 34617, 3453, 497, 27810, 949, 21999, 285, 38419, 15, 496, 958, 13, 253, 3389, 15212, 1840, 11120, 10770, 281, 346, 19209, 10123, 449, 187, 187, 8296, 15, 380, 6752, 3667, 553, 187, 187, 34, 15, 575, 46785, 723, 285, 3419, 36559, 187, 187, 28343, 253, 5068, 273, 6752, 285, 253, 12108, 273, 253, 3302, 5833, 327, 4247, 3436, 13, 5826, 13, 253, 4974, 43206, 2918, 7418, 346, 29309, 1515, 3, 12225, 835, 7159, 4925, 15486, 5001, 4376, 285, 3453, 15, 1707, 497, 671, 247, 1180, 273, 4974, 43206, 12225, 835, 642, 15486, 497, 4925, 4681, 1036, 62, 535, 187, 11, 42082, 378, 15, 575, 49153, 273, 6845, 2084, 274, 1632, 187, 187, 33397, 281, 253, 1924, 5001, 253, 4596, 6585, 4345, 13, 253, 4623, 7177, 3831, 642, 25712, 1941, 273, 509, 15305, 285, 13, 247, 1180, 273, 841, 7177, 13, 327, 616, 2454, 13, 1804, 12228, 274, 1632, 4681, 1166, 62, 1198, 1650, 13, 581, 7177, 7211, 27, 187, 688, 6469, 13, 352, 310, 3264, 326, 253, 13474, 45544, 4323, 985, 588, 320, 4934, 285, 4035, 281, 1132, 247, 2762, 2554, 15, 1292, 13, 984, 253, 5213, 2791, 556, 3531, 323, 253, 1805, 15455, 672, 2429, 342, 253, 4112, 275, 2393, 6752, 13, 253, 24741, 285, 4588, 12510, 273, 2710, 16596, 281, 29406, 588, 320, 2406, 685, 253, 1897, 672, 253, 2791, 574, 247, 2834, 673, 15, 187, 187, 9, 36214, 2879, 481, 10244, 13, 247, 6519, 1160, 767, 1897, 846, 253, 8164, 4176, 369, 4724, 3054, 27, 187, 6872, 29640, 32447, 13, 14946, 407, 253, 544, 1779, 7272, 1092, 2335, 5593, 544, 249, 6157, 62, 281, 2701, 3275, 281, 4017, 4376, 285, 281, 5416, 247, 2634, 5530, 14, 1373, 272, 8, 273, 253, 4376, 46894, 13, 533, 275, 253, 1048, 1408, 13, 824, 44436, 310, 14043, 285, 588, 4354, 18382, 3561, 281, 253, 37960, 273, 11528, 285, 1078, 253, 1071, 273, 673, 15, 187, 187, 36, 15, 575, 44831, 16040, 187, 187, 7130, 281, 7159, 8, 16608, 2473, 9172, 285, 253, 12503 ]
"[f]rom January 1, 2002, China gave up export administration of . . . vitamin C"). These WTO documents were not before Judge Trager at the motion to dismiss stage. XIII. The Ministry's Statements in the Instant Litigation Concerning "Self-Discipline" In an additional statement submitted on summary judgment (the "2009 Statement"), the Ministry describes the Chinese "system of self-discipline." According to the 2009 Statement: *533 [The system of `self-discipline'] has a long history in China and has been well known to, and complied with by, Chinese companies. Self-discipline does not mean complete voluntariness or self-conduct. In effect, self-discipline refers to a system of regulation under the supervision of a designated agency acting on behalf of the Chinese government. Under this regulatory system, the parties involved consult with each other to reach consensus on coordinated activities for the purpose of reaching the objectives and serving the interest as set forth under Chinese laws and policies. Persons engaged in such required self-discipline are well aware that they are subject to penalties for failure to participate in such coordination, or for non-compliance with self-discipline, including forfeiting their export right. According to the Ministry, vitamin C exporters were governed by self-discipline regulation, the objectives of which were "to maintain orderly export, safeguard the interests of the country as a whole and avoid self-destructive competition." The 2009 Statement also discusses the Ministry's delegation of authority to the Chamber regarding self-discipline. XIV. 1998 Opinions In discussing the notion of "self-discipline prices", Professor Shen and a number of commentators cite to an August 1998 directive issued by the State Economic and Trade Commission ("SETC") entitled "Opinions On Self-Discipline Pricing For Certain Industrial Products" ("1998 Opinions"). Wang Xiaoye, The Prospect of Anti-Monopoly Legislation in China, 2002 Wash. U. Glob. Stud. L.Rev. 201, 208-09; Shen Report ¶ 70. The 1998 Opinions, which only involved domestic prices, "demanded that the producers of certain industrial products observe the minimum price limits set by their respective trade associations." Wang Xiaoye, 2002 Wash. U. Glob. Stud. L.Rev. at 208; see also Scott Kennedy, The Price of Competition: Pricing Policies and the Struggle to Define China's Economic System, The China Journal No. 49, 19 (Jan. 2003). The minimum prices were based on a product's average costs in the industry. Kennedy, The China Journal No. 49, 19; see also Wang Xiaoye, 2002 Wash. U. Glob. Stud. L. Rev. at 209. (3) ACTIONS OF CHINESE MARKET PARTICIPANTS I. The 1997 Regime Between the promulgation of the 1997 Regime and April 2001, the Subcommittee held a number of meetings where defendants reached agreements on price and export quotas. These meetings were attended by officials from both the Chamber and the Ministry. In 1997, the price of vitamin C was $4.4/kg. At some point, defendants set the minimum price at $5.3/kg and the price rose to at least $5/kg. However, between May 2000 and December 2001, there was a "price war," which resulted in export prices dropping to less than $2.8/kg. This appears to have been caused by an expansion in China's production capacity that stemmed from an apparent "misunderstanding" at a 1999 Subcommittee meeting. In December 2000, the minimum export price was $5.1/kg. However, as it appears that none of the defendants were following that price, defendants agreed to "nullify" that price and submitted this agreement to the Ministry "for approval."[11] *534 At a Subcommittee meeting in April 2001, the attendees discussed a drop in the price and the recent expansion in China's production capacity. At one point during the meeting, the representative from the Ministry informed the members that: Even though VC is not a resource product, it has been strictly regulated since 1997. Regarding the effects of current regulations, generally speaking, the regulation has not been very successful. [The Ministry] attaches importance to the establishment and development of the Chamber, and requires sub-committees to act proactively. Enterprises need to obey the industry agreements and industry rules. When enterprises are maximizing their profits, they also need to consider the interest of the state as a whole. At the meeting, the manufacturers agreed to reduce the minimum export price from $5.10/kg to $3.20/kg, presumably in accordance with the agreement at the December 2000 meeting. The minutes go on to state that: "However, because the manufacturers have not agreed on the enforcement mechanisms of the verification and chop system, it remains a major question whether this price limit can be enforced effectively." II. Transition to the 2002 Regime In September and November 2001, the Ministry learned that the European Union was considering bringing an anti-dumping suit against the Chinese vitamin C manufacturers. This information was forwarded to the Chamber. On one document, handwritten notes, apparently from Ministry officials, state: (1) "[p]lease review and get prepared"; (2) "please review and address it"; and (3) "[p]lease investigate this matter."[12] On November 16, 2001, the Chamber held a meeting with defendants.[13] At the meeting, defendants, "by way of hand voting," agreed to raise the "coordinated export price" to $3/kg starting on January 1, 2002. Defendants also agreed to limit the total export volume for 2002 to 35,500 tons (with each company receiving individual export volume allocations) and to not expand their production capacity. Defendants' agreement was "aimed at enhancing the self-discipline of the industry." In December 2001, the Chamber convened another meeting amongst defendants to discuss implementing this agreement. Not only is there no affirmative evidence of compulsion in the documents discussing this agreement, but these documents also suggest, on their face, that this agreement was voluntary.[14] One states, for example, *535 that the participants "concluded that Chinese Vitamin C manufacturers are absolutely capable of realizing the self-discipline of the industry" because (1) China has lower gross costs; (2) "production of Vitamin C in China is highly centralized in four manufacturers and thus, it is relatively easy to reach unison within the industry"; (3) supply is in balance with demand and price declines are psychological; and (4) there is strong growth in demand for Vitamin C as an "irreplaceable product." Another states: [a]nalysis from persons within the industry was that the enterprises were able to sit down together at this particular time because VC prices had reached rock bottom, and no one could sustain a further slide; the next reason was, because the country had opened up the commercial products business from a free competition aspect the enterprises were impelled and had no choice but to seek industry self-regulation. Similarly, a summary of the December 2001 meeting from Chamber's website notes that: through efforts by the Vitamin C Sub-Committee of [the Chamber] . . . domestic manufacturers were able to reach a self-regulated agreement successfully, whereby they would voluntarily control the quantity and pace of exports to achieve the goal of stabilization while raising export prices. Such self-restraint measures, mainly based on `restricting quantity to safeguard prices, export in a balanced and orderly manner and adjust dynamically' have been completely implemented by each enterprises' own decisions and self-restraint, without any government intervention. Beginning on May 1, 2002, vitamin C was listed as a product requiring price reviews by China's Customs and a seal of pre-approval by the [Chamber], which has provided powerful oversight and safeguards for the implementation of self-restraint agreements among domestic manufacturers. (Emphasis added).[15] Some documents discussing the November and December 2001 meetings imply that verification and chop was used to enforce the parties' agreement. However, none of these documents clearly state that defendants' agreements restricting output were enforced through verification and chop. In fact, the document quoted above explicitly refers to "price reviews." III. The 2002 Regime A. Meetings and Agreements Between the beginning of 2002 and the filing of the initial complaint on January 26, 2005, the Subcommittee held numerous "coordination" meetings where defendants reached agreements regarding price and output. There were also a number of Subcommittee meetings where no agreements were reached.[16] *536 B. Evidence of Voluntariness Similar to the record regarding the November 2001 agreement, the relevant documents contain no affirmative evidence of compulsion and, a number of these documents, on their face, suggest voluntariness.[17] For example, one documents notes: In 2003, it is expected that the export quota management system will be kept and continue to play a positive role. But, because the international market has turned for the better considerably when compared with the situation in early 2002, the willingness and actual effectiveness of various manufacturers to cooperate will be lower than the days when the market had a difficult time. (Emphasis added). Similarly, a speech made two days after the instant suit was filed states: These VC enterprises, mediated by the [Chamber], took measures [in 2004] to limit production to protect price and to ensure a `soft-landing' of the price plunge, but in the long run, such allegiance is vulnerable and will easily succumb to the temptation of profit and before the test of time. C. Minimum Price According to defendants' interrogatory answers and the deposition
[ 281, 452, 1534, 42752, 15, 3824, 3410, 2722, 247, 2074, 9058, 13, 533, 359, 760, 452, 2800, 11123, 342, 370, 46, 578, 33029, 2239, 884, 768, 740, 15, 22, 94, 353, 1126, 16351, 724, 273, 534, 581, 310, 271, 44613, 13, 285, 597, 403, 5195, 2439, 659, 1131, 495, 285, 577, 15, 187, 187, 1231, 671, 6730, 253, 4177, 4702, 6733, 13, 534, 359, 4853, 347, 253, 4313, 273, 45147, 281, 5890, 313, 1229, 21370, 1549, 611, 10, 4201, 9005, 8660, 2280, 13, 247, 17335, 323, 5787, 3678, 2280, 15, 3900, 253, 4313, 273, 8660, 2280, 281, 3678, 2280, 310, 417, 7933, 253, 1072, 875, 11123, 13, 436, 4313, 3400, 247, 2097, 273, 26230, 253, 4177, 4702, 6733, 762, 253, 9376, 273, 3638, 3678, 14, 936, 14, 49476, 4313, 15, 831, 4177, 4702, 6733, 4483, 441, 281, 7277, 253, 45147, 3192, 715, 2395, 253, 4778, 3678, 45009, 15, 844, 1089, 326, 10159, 273, 3924, 13, 253, 4177, 4702, 6733, 13794, 689, 625, 685, 1264, 7367, 273, 9777, 285, 253, 18849, 10670, 921, 642, 1941, 273, 29660, 432, 1027, 7625, 15, 831, 906, 18726, 342, 253, 4342, 273, 12000, 284, 6836, 1162, 355, 15, 313, 9430, 10, 665, 1119, 2074, 4177, 4702, 37469, 13, 2931, 347, 253, 4313, 273, 48288, 20545, 313, 66, 17335, 323, 45147, 10, 285, 5787, 9946, 2280, 13, 323, 18745, 285, 1327, 14, 47787, 11123, 15, 187, 187, 3138, 3027, 1934, 3295, 14, 4897, 7484, 273, 253, 32530, 52, 11123, 313, 15044, 10, 342, 776, 3410, 11123, 313, 41369, 84, 10, 689, 14, 446, 7655, 13, 4645, 326, 5293, 2965, 275, 253, 33906, 3636, 407, 35677, 1162, 355, 15, 313, 9204, 10, 347, 11123, 19355, 32507, 15, 3824, 3410, 11123, 3636, 37006, 347, 49015, 44399, 84, 390, 38268, 947, 84, 275, 6018, 293, 1162, 355, 15, 313, 15117, 10, 390, 11826, 1162, 355, 15, 313, 12430, 13, 5307, 10, 285, 403, 7101, 342, 2502, 285, 4797, 6114, 13, 2975, 16079, 2203, 14, 1968, 568, 296, 1808, 10148, 71, 1093, 15, 9275, 910, 3429, 26303, 25067, 986, 187, 187, 60, 77, 19533, 19533, 1181, 35540, 418, 6059, 11108, 708, 470, 15, 21378, 708, 470, 15, 17537, 708, 1401, 17, 15, 11027, 424, 708, 470, 15, 50246, 708, 1401, 17, 15, 8897, 424, 708, 470, 15, 13482, 61, 187, 12481, 35540, 7532, 708, 470, 15, 37684, 708, 470, 15, 42515, 708, 470, 15, 34333, 708, 470, 15, 26, 1540, 708, 1401, 17, 15, 12582, 424, 708, 470, 15, 38043, 61, 187, 998, 8739, 7532, 708, 470, 15, 25772, 708, 470, 15, 25320, 708, 470, 15, 22, 2090, 708, 470, 15, 26, 1540, 708, 470, 15, 28209, 708, 470, 15, 13482, 61, 187, 52, 6764, 708, 470, 15, 35366, 708, 470, 15, 26, 3245, 708, 1401, 17, 15, 11027, 424, 708, 470, 15, 26, 1540, 708, 1401, 17, 15, 12582, 424, 708, 1401, 17, 15, 17758, 44175, 187, 84, 52, 6764, 708, 470, 15, 22, 2090, 708, 470, 15, 41892, 708, 470, 15, 25358, 708, 470, 15, 26, 1540, 708, 470, 15, 41356, 708, 470, 15, 39273, 61, 187, 50184, 35540, 43669, 708, 470, 15, 23829, 708, 470, 15, 39069, 708, 1401, 17, 15, 7174, 424, 708, 470, 15, 50246, 708, 1401, 17, 15, 8897, 424, 708, 470, 15, 38043, 61, 187, 56, 1513, 35540, 43669, 708, 470, 15, 22, 2090, 708, 470, 15, 20991, 708, 470, 15, 12971, 708, 470, 15, 28209, 708, 470, 15, 28209, 708, 470, 15, 13482, 61, 187, 50184, 35540, 7532, 708, 470, 15, 37684, 708, 470, 15, 42515, 708, 470, 15, 34333, 708, 470, 15, 26, 1540, 708, 1401, 17, 15, 12582, 424, 708, 470, 15, 38043, 61, 187, 12481, 47127, 35540, 7532, 708, 470, 15, 35488, 708, 470, 15, 25025, 708, 1401, 17, 15, 11325, 424, 708, 470, 15, 50246, 708, 1401, 17, 15, 12582, 424, 708, 470, 15, 13482, 61, 187, 35, 12769, 18189, 47127, 35540, 7532, 708, 470, 15, 49416, 708, 470, 15, 25025, 708, 1401, 17, 15, 11325, 424, 708, 470, 15, 33964, 708, 1401, 17, 15, 12582, 424, 708, 470, 15, 13482, 61, 187, 52, 6764, 16, 37, 461, 418, 6059, 11108, 708, 470, 15, 21378, 708, 470, 15, 17537, 708, 470, 15, 16742, 708, 470, 15, 33964, 708, 470, 15, 28209, 708, 470, 15, 39273, 61, 187, 52, 6764, 16, 35, 12769, 18189, 47127, 35540, 7532, 708, 470, 15, 12115, 708, 470, 15, 31819, 708, 470, 15, 34333, 708, 470, 15, 33964, 708, 470, 15, 33964, 708, 470, 15, 39273, 61, 187, 37, 461, 7532, 16, 998, 8739, 7532, 708, 470, 15, 25959, 708, 470, 15, 26, 1036, 708, 470, 15, 31416, 708, 470, 15, 50246, 708, 470, 15, 28209, 708, 470, 15, 38043, 61, 187, 35, 12769, 18189, 1227, 50184, 4110, 46, 35540, 7532, 708, 470, 15, 24, 746, 708, 470, 15, 17537, 708, 470, 15, 20826, 708, 470, 15, 50246, 708, 470, 15, 28209, 708, 470, 15, 13482, 61, 187, 187, 3138, 5695, 880, 71, 746, 15, 9275, 910, 3429, 568, 17, 15, 1976, 61, 25067, 986, 187, 187, 3138, 5695, 880, 71, 938, 15, 9275, 910, 3429, 568, 17, 15, 1976, 61, 25067, 986, 187, 187, 3074, 253, 5165, 10575, 342, 5016, 3924, 1705, 342, 247, 1643, 15985, 1832, 15, 3973, 13, 342, 760, 10488, 14, 531, 11123, 13, 776, 3410, 556, 3710, 7605, 1612, 281, 4271, 1534, 10575, 13, 3340, 342, 2716, 253, 11123, 275, 23266, 495, 15, 10330, 273, 13554, 275, 45147, 285, 256, 52, 6764, 342, 253, 2120, 32530, 52, 3410, 313, 8478, 515, 16240, 44965, 292, 355, 13663, 1181, 575, 6622, 13, 275, 9008, 582, 534, 10949, 253, 8661, 1199, 625, 17568, 13, 588, 452, 3687, 7605, 1612, 313, 267, 15932, 841, 14023, 3480, 253, 475, 41, 398, 29311, 11, 37590, 1848, 941, 285, 41343, 1783, 326, 3400, 625, 7899, 45147, 6341, 481, 6347, 13, 776, 9162, 6974, 16000, 441, 281, 9186, 4764, 10575, 342, 1675, 281, 253, 4757, 273, 253, 5016, 15, 3900, 436, 3425, 1531, 438, 600, 43341, 271, 5016, 13, 253, 8062, 273, 767, 3007, 2821, 11123, 2223, 3797, 2709, 25767, 2720, 281, 2457, 40405, 6466, 13, 26264, 253, 1268, 273, 4177, 4702, 387, 10444, 8661, 544, 70, 15, 72, 904, 1214, 13473, 805, 1092, 347, 973, 347, 253, 7133, 273, 253, 2457, 12948, 313, 70, 15, 72, 904, 27353, 44965, 292, 355, 13663, 1181, 575, 8012, 13, 4748, 481, 1284, 247, 906, 13, 18745, 2718, 2223, 513, 417, 4780, 23352, 949, 253, 5016, 8661, 2931, 407, 776, 9162, 985, 15, 187, 187, 3138, 5695, 880, 71, 1797, 15, 9275, 910, 3429, 26303, 25067, 986, 187, 187, 29030, 16912, 593, 273, 26602, 5128, 34730, 275, 1716, 10981, 1699, 20970, 32032, 187, 2518, 9998, 187, 187, 2214, 1016, 13649, 13, 359, 6337, 2800, 40070, 6663, 6328, 13840, 281, 2557, 253, 4103, 6349, 273, 12160, 13, 37590, 1848, 13, 285, 353, 3027, 14, 39, 3027, 941, 275, 1030, 26208, 253, 1318, 273, 253, 6012, 45147, 28, 13671, 2280, 28, 256, 52, 6764, 28, 285, 8660, 9208, 13, 20545, 13, 285, 11843, 15, 844, 858, 436, 407, 10941, 13840, 342, 512, 2130, 941, 342, 13840, 970, 247, 8578, 273, 253, 3426, 10895, 275, 1340, 281, 3653, 604, 285, 849, 253, 5928, 273, 247, 1798, 10895, 1543, 275, 247, 12082, 689, 14, 390, 762, 14, 383, 14508, 273, 841, 3602, 15, 5317, 905, 983, 264, 696, 2722, 247, 8612, 1650, 27, 253, 1682, 14, 8491, 41343, 84, 323, 512, 2800, 13840, 323, 353, 6903, 347, 973, 347, 253, 17909, 6442, 13139, 323, 253, 3602, 273, 1600, 15, 187, 187, 3138, 15402, 7162, 11508, 2572, 342, 253, 33860, 273, 941, 15, 31411, 5224, 253, 8876, 1979, 273, 253, 9934, 6, 7162, 7726, 275, 253, 5912, 3268, 1159, 313, 26423, 10, 323, 1016, 4764, 323, 253, 2644, 873, 273, 11123, 4103, 281, 253, 2491, 672, 512, 273, 253, 941, 403, 908, 275, 253, 4944, 15, 6915, 512, 2130, 941, 13, 253, 8876, 9934, 6, 13794, 403, 27, 721, 15, 20, 1202, 3181, 740, 768, 25, 724, 575, 45, 30148, 16351, 724, 313, 49476, 20545, 582, 337, 15, 25, 1202, 3181, 740, 768, 23, 724, 575, 46, 30148, 16351, 724, 313, 49476, 2280, 582, 470, 15, 1438, 575, 44, 313, 32538, 8660, 3276, 582, 577, 15, 21, 575, 44, 313, 44041, 8660, 3276, 582, 374, 15, 18, 1202, 3181, 740, 768, 26, 724, 575, 46, 30148, 16351, 724, 313, 31885, 2280, 582, 470, 15, 27706, 575, 46, 30148, 16351, 724, 575, 6147, 13668, 18, 724, 313, 52, 6764, 582, 285, 337, 15, 20, 1202, 3181, 740, 2497, 883, 724, 575, 6147, 13668, 18, 724, 313, 84, 52, 6764, 481, 12160, 941, 403, 9560, 323, 253, 7441, 273, 256, 52, 6764, 13, 5727, 8660, 20545, 13, 2280, 13, 285, 1458, 14, 1099, 611, 3276, 403, 1682, 20793, 407, 37590, 1848, 941, 342, 2007, 10806, 3732, 407, 41708, 432, 1884, 14, 1518, 60, 575, 1202, 1906, 5, 78, 1181, 16079, 2203, 14, 1968, 568, 1087, 912, 10148, 71, 1423, 15, 9275, 910, 3429, 26303, 25067, 986, 187, 187, 1909, 3264, 13, 253, 45147, 310, 3012, 20793, 407, 12160, 941, 15, 831, 310, 5183, 275, 5317, 905, 1087, 912, 5290, 835, 253, 8876, 9934, 6, 7162, 7726, 1979, 310, 247, 2803, 273, 669, 3549, 5, 21, 4067, 275, 253, 5928, 273, 12160, 41708, 15, 3900, 13671, 2280, 310, 9648, 973, 20793, 407, 253, 530, 13152, 14, 3027, 1934, 941, 3815, 13, 253, 5928, 273, 12160, 941, 14280, 281, 906, 275, 9243, 13671, 3072, 20665, 1146, 4236, 407, 40070, 6663, 6328, 15, 831, 1055, 476, 320, 2326, 275, 253, 3910, 275, 253, 12160, 14679, 285, 253, 4757, 273, 253, 418, 22493, 285, 11960, 961, 13471, 275, 253, 2710, 12471, 273, 5317, 905, 983, 264, 4207, 2091, 247, 9243, 13671, 3072, 7646, 310, 4236, 13, 247, 4577, 6919, 273, 253, 13671, 8295, 310, 8025, 281, 35282, 432, 3563, 14, 881, 6114, 13, 4795, 275, 247, 14955, 281, 6642, 253, 13671, 2280, 669, 3549, 740, 14, 938, 5, 6, 2406, 685, 672, 512, 253, 941, 403, 908, 15, 831, 476, 320, 2326, 275, 5317, 905, 81, 13437, 696, 835, 359, 7484, 253, 8876, 24622, 3064, 275, 253, 1318, 273, 253, 13649, 3607, 323, 13840, 342, 18464, 941, 5239, 15, 12160, 41708, 1030, 44196, 1097, 253, 45147, 285, 13671, 2280, 13, 285, 352, 310, 671, 253, 954, 1774, 11225, 9459, 281, 37709, 253, 256, 52, 6764, 15, 380, 5928, 273, 12160, 941, 671, 14280, 281, 906, 275, 271, 689, 14, 383, 14508, 273, 253, 45147, 4795, 275, 271, 6642, 273, 253, 256, 52, 6764, 669, 3549, 5, 1449, 6, 2169, 685, 275, 13840, 970, 512, 2130, 941, 15, 187, 187, 41, 398, 29311, 941, 403, 3782, 9560, 275, 1030, 26208, 253, 5412, 8660, 3276, 15, 367, 22897, 941, 5431, 19270, 253, 5241, 273, 253, 9812, 8295, 13, 533, 275, 2219, 273, 253, 5412, 383, 8660, 9208, 13, 367, 22897, 18672, 60, 575, 1202, 1906, 5, 78, 1181, 575, 261, 5431, 1512, 44785, 4024, 285, 352, 310, 760, 275, 17385, 342, 253, 37590, 1848, 10257, 60, 575, 1202, 1906, 5, 78, 1181, 575, 2203, 326, 253, 5412, 8660, 3276, 310, 12054, 20793, 15, 496, 4499, 13, 347, 3264, 13, 5890, 8660, 3276, 310, 417, 973, 20793, 407, 253, 37590, 1848, 941, 15, 35540, 20545, 310, 5431, 973, 14, 383, 18280, 342, 247, 5019, 273, 9812, 1719, 285, 367, 22897, 941, 13, 760, 7552, 670, 247, 2803, 273, 669, 3549, 5, 19, 625, 8767, 275, 5928, 273, 37590, 1848, 941, 15, 187, 187, 4350, 29349, 7313, 403, 9560, 323, 1030, 26208, 253, 8660, 2280, 13, 3692, 9934, 6, 7162, 7726, 651, 320, 387, 1878, 247, 2803, 273, 495, 4067, 1293, 37590, 1848, 941, 15, 2091, 353, 3027, 941, 387, 25738, 669, 2260, 393, 463, 5, 1884, 60, 575, 1202, 1906, 5, 78, 1181, 575, 609, 21223, 12125, 13, 253, 8660, 2280, 4916, 2761, 4336, 440, 48454, 347, 253, 41343, 4428, 1652, 1491, 670, 253, 8660, 8295, 15, 380, 8660, 2280, 6642, 310, 253, 954, 7996, 281, 253, 5928, 273, 2173, 15302, 15, 14522, 13, 253, 8660, 2280, 5998, 407, 40070, 6663, 6328, 310, 669, 3549, 5, 1549, 6, 2169, 672, 37590, 1848, 941, 403, 10432, 347, 2429, 342, 672, 512, 941, 403, 908, 28, 2299, 13, 672, 41708, 387, 25738, 669, 2260, 187, 61, 463, 1884, 5, 60, 575, 1202, 1906, 5, 78, 1181, 575, 261, 10432, 13, 253, 8660, 2280, 310, 5998 ]
to have significant enhancements. Our sample shows a similar trend, but we only have six galaxies with $M_{*} > 10^{10.5} M_{\odot}$ of which one is an elliptical, and they are spread across Stages 3 and 4. We also examined the star formation efficiency, which we define as the ratio of SFR to warm (30$-$60 K) birth cloud dust mass, a proxy for molecular gas mass. While the ratio of dust mass to gas mass is not necessarily the same between galaxies, this ratio provides a means of estimating the star formation efficiency under the assumption of constant gas-to-dust ratio. This star formation efficiency allows us to compare the SFR taking into account the variable gas reservoirs. We find that regardless of stage, the star formation efficiency ranges over more than three orders of magnitude and the cumulative distributions show no evidence of originating from different populations. This result agrees with the findings of Casasola et al. (2004) who found similar star formation efficiencies, defined as the ratio of FIR luminosity (a proxy for SFR) and molecular hydrogen mass, for interacting and non-interacting galaxies. ![IRAC color-color plot of the SIGS galaxies (square) with our sample galaxies (diamonds) over-plotted, showing that none fall in the wedge identified by Stern et al. (2005) as galaxies hosting AGN. Our sample galaxies identified optically as Seyferts or LINERs in Keel et al. (1985) or Ho et al. (1997, 2000) and are marked with red and blue stars, respectively.[]{data-label="stern"}](f18.pdf){width="\linewidth"} [lcccccccc]{} Dust Luminosity & 0.238 & 0.224 & **0.017** & 0.767 & **0.008** & 0.129\ Total Dust Mass & 0.095 & 0.072 & 0.462 & 0.964 & **0.022** & 0.423\ Stellar Mass & 0.366 & 0.655 & 0.569 & 0.964 & 0.271 & 0.129\ SFR & 0.980 & 0.983 & **0.017** & 0.964 & **0.022** & **0.028**\ sSFR & 0.569 & 0.953 & 0.606 & 0.964 & 0.768 & 0.883\ Cold Dust Temperature & 0.337 & 0.417 & **0.006** & 0.767 & **0.008** & 0.423\ Warm Dust Temperature & 0.569 & 0.237 & 0.106 & 0.271 & 0.271 & 0.129\ Cold Dust Mass & 0.095 & 0.072 & 0.462 & 0.964 & **0.022** & 0.423\ Total Warm Dust Mass & 0.682 & 0.678 & **0.019** & 0.767 & **0.022** & 0.129\ Birth Cloud Warm Dust Mass & 0.912 & 0.678 & **0.019** & 0.492 & **0.022** & 0.129\ SFR/Dust Luminosity & 0.238 & 0.224 & 0.999 & 0.492 & 0.271 & 0.883\ SFR/Birth Cloud Warm Dust Mass & 0.119 & 0.478 & 0.462 & 0.492 & 0.492 & 0.883\ Dust Mass/Stellar Mass & 0.644 & 0.916 & 0.857 & 0.767 & 0.271 & 0.423\ Birth Cloud /Cold ISM Dust Mass & 0.719 & 0.224 & 0.037 & 0.767 & 0.271 & 0.129\ ![image](f19.pdf){width="0.75\linewidth"} ![image](f20.pdf){width="0.75\linewidth"} All the apparent variations with interaction stage come with a few caveats. First, with only thirty-one galaxies, our sample has limited statistical power to identify significant variations, especially with half the galaxies in Stage 3. Analysis of trends in SFR and sSFR with the full SIGS sample (Brassington [[*et al.*]{}]{} 2013, in preparation), which covers the stages much more uniformly, will have greater statistical power (albeit these comparisons lack the *Herschel* SPIRE data and SED analysis that provides more accurate SFR measurements). Second, our classification scheme permits us to examine parameter variations with respect to the strength of the interaction. While this sequence crudely mimics an interaction, the dynamics of two colliding galaxies often includes multiple encounters prior to final coalescence, modifying the level of star formation at intermediate stages [e.g., @tor12], as well as the intensity of the final burst (e.g., Hopkins [[*et al.*]{}]{} 2008, 2009). As a result, interacting systems often do not progress linearly through the interaction stages defined by our classification system. ![image](f21.pdf){width="\linewidth"} Relative Importance of Specific Data Sets in Constraining Galaxy Parameters --------------------------------------------------------------------------- For each galaxy, we ran six MAGPHYS fits to measure the relative importance of UV, SPIRE, and MIR-FIR data in constraining the value of the derived SFR; stellar mass; sSFR; and dust temperatures, luminosity, and masses. We did this by comparing fits with all available data with fits using a subset of the complete dataset in order to determine if and how the absence of a particular dataset results in a systematic over- or under-estimation of these parameters. Figure \[msed\] shows a representative example: the best-fit SEDs for all six fits for M101 as well as the accompanying PDFs for the parameters of interest. ![Parameter confidence intervals increase with the omission of data. Points indicate the median size of the 68% confidence interval in the probability distribution function (PDF) for each parameter for the whole set of galaxies relative to the range when all of the data are used in the fit. Using all available data, the median 68% ranges are: 6.3$\times10^{8}$ L$_{\odot}$ (dust luminosity), 1.8$\times10^{6}$ M$_{\odot}$ (dust mass), 0.80 K (cold dust temperature), 4.4 K (warm dust temperature), 2.1$\times10^{9}$ M$_{\odot}$ (stellar mass), 0.047 M$_{\odot}$ yr$^{-1}$ (SFR), and 1.3$\times10^{-11}$ yr$^{-1}$ (sSFR). UV data are crucial for the determination of sSFR, whereas dust luminosity, mass, and 15-25 K temperature are best constrained by SPIRE data with further constraints applied by photometry from 30-200[ $\mu$m]{}.[]{data-label="prange"}](f22.pdf){width="\linewidth"} As expected, the SFR is significantly constrained by UV data. This is demonstrated in Figure \[prange\], where the median 68% confidence interval size is a factor of $\sim$4 larger in the absence of UV photometry. While stellar mass is fairly well constrained by the UBV-IRAC data alone, the absence of UV data tends to result in younger stellar population templates being selected by MAGPHYS. This effect can be seen in the differences in the UV slope and the strength of the Lyman and Balmer breaks in the various panels of Figure \[msed\]. When a younger stellar population template is selected, a smaller fraction of the stellar emission is assumed to originate from late-type stars, resulting in a tendency to estimate the stellar mass $\sim10-20$% lower than when all the data are used. This can be seen in Figure \[pdiff\] where we plot the median fractional difference in the value of the galaxy properties for fits with incomplete data sets. UV photometry constrains both the SFR and stellar mass, and it is also the most important wavelength regime to constrain the sSFR. The absence of UV data also tends to result in an over-estimation of the SFR resulting in an estimate of the sSFR $\sim$40% higher than in fits using all available data. Herschel data are particularly crucial in constraining the cold dust temperature. PACS data typically outline the peak of the IR emission, but in cases of the coldest dust temperatures, PACS 170[ $\mu$m]{} is typically too indeterminate and it is only in conjunction with the SPIRE 250[ $\mu$m]{} data that the cold dust temperature is reasonably constrained. In contrast, as expected, warm dust temperature is not well constrained by the SPIRE data. Dust luminosity is typically well-estimated with a combination of IRAS and PACS data, only becoming about a factor of $\sim$2 more uncertain in absence of SPIRE data. SPIRE observations are crucial for constraining the dust mass, whose 68% confidence interval would be at least a factor of 3 larger without SPIRE data. When MIR data at wavelengths $\lambda \ge$ 30[ $\mu$m]{} are likewise absent, the dust mass becomes almost completely unconstrained as the SED contains little information about the dust emission. The dust mass estimate is the most sensitive to the absence of specific datasets. Interestingly, the dust mass estimated by MAGPHYS is $\sim$60% higher when SPIRE data are excluded as compared with when all data are used; however, when photometry at wavelengths $\lambda \ge 30$[ $\mu$m]{} is excluded, the dust mass is estimated
[ 321, 587, 209, 187, 615, 1557, 716, 513, 609, 13090, 13450, 15, 187, 34, 2443, 66, 27, 17849, 716, 513, 274, 4265, 13090, 13450, 187, 615, 29188, 282, 18205, 83, 11317, 15, 187, 9, 51, 6457, 1178, 70, 10, 187, 4749, 446, 86, 13, 8794, 32, 187, 28895, 209, 16163, 6811, 86, 2636, 305, 32294, 615, 16163, 6811, 27, 187, 24968, 5101, 4265, 7318, 258, 294, 15478, 292, 4265, 187, 21601, 579, 247, 372, 1261, 74, 295, 265, 303, 15478, 262, 15, 187, 9, 51, 6457, 1178, 70, 10, 187, 38, 3241, 13090, 5433, 4265, 13, 3820, 372, 22871, 442, 47692, 7846, 66, 15, 187, 28895, 913, 13013, 1049, 609, 629, 14576, 16724, 79, 554, 4265, 250, 363, 74, 372, 391, 4265, 86, 6598, 187, 12442, 17457, 479, 66, 838, 484, 2517, 17849, 716, 513, 274, 4265, 13090, 13450, 187, 14573, 6868, 1209, 17255, 27487, 30405, 15478, 70, 15, 187, 13026, 79, 2457, 13, 8794, 2578, 9111, 466, 17849, 716, 948, 38851, 35803, 729, 255, 15, 187, 1672, 13374, 74, 17155, 24843, 34258, 48414, 2247, 355, 246, 4265, 86, 187, 24427, 8794, 23105, 372, 2636, 17849, 10044, 38851, 15733, 74, 660, 86, 2721, 15, 187, 187, 33824, 11308, 313, 1047, 3357, 14, 2262, 209, 187, 138, 228, 30935, 7136, 37134, 17686, 8095, 3147, 3393, 5117, 17757, 22206, 7136, 1454, 124, 3393, 48614, 10977, 8348, 21394, 3868, 17757, 13, 209, 187, 5676, 10298, 37134, 4654, 2141, 7072, 12388, 7136, 15, 187, 138, 99, 2863, 24292, 48614, 19927, 18383, 33627, 23871, 8348, 10977, 2863, 4733, 24036, 14439, 3147, 35691, 3952, 10298, 43242, 49626, 48614, 13, 209, 187, 2141, 29704, 8348, 1454, 108, 14439, 3147, 5613, 7136, 3868, 2863, 18383, 14439, 4134, 38929, 5676, 22206, 7136, 187, 4134, 8520, 36684, 9203, 4134, 2599, 5117, 20933, 2141, 24292, 19927, 3147, 5613, 28832, 16287, 30175, 9737, 3868, 8348, 4733, 209, 187, 19927, 17686, 9028, 42313, 3393, 16411, 29495, 6450, 17648, 10227, 28434, 15, 187, 138, 99, 28649, 16962, 21027, 3955, 8348, 25651, 7490, 7539, 4992, 48911, 10977, 2863, 10227, 2863, 4733, 209, 187, 2599, 8520, 19073, 4654, 4992, 3147, 23871, 5117, 4134, 8348, 3868, 16411, 25235, 187, 138, 219, 9650, 11910, 11112, 11630, 2863, 8361, 10139, 17757, 14439, 15, 187, 138, 229, 10139, 17757, 8095, 49100, 16003, 27, 48185, 16287, 12116, 40051, 6450, 3868, 16411, 187, 7072, 14858, 5613, 2989, 49456, 9529, 39242, 18383, 6450, 7072, 3393, 30656, 18383, 3952, 12116, 6450, 15, 187, 138, 229, 10139, 17757, 11112, 3393, 11630, 16411, 14733, 27, 209, 187, 138, 239, 4992, 3147, 9529, 39242, 18383, 6450, 7072, 3393, 30656, 18383, 3952, 12116, 6450, 30175, 37677, 8348, 15, 187, 9, 138, 230, 9203, 5776, 14858, 10, 187, 138, 228, 4134, 5776, 7136, 13, 9529, 7490, 3868, 33627, 28, 187, 138, 228, 29704, 8348, 1454, 124, 9203, 38093, 5613, 2989, 9529, 5676, 9203, 12116, 16411, 3868, 16411, 27, 187, 138, 228, 30935, 7136, 5898, 5676, 27435, 7072, 3393, 30656, 9529, 27580, 47909, 14439, 7072, 10139, 209, 187, 7072, 14858, 19073, 13850, 26097, 11910, 4733, 4654, 2141, 5776, 8348, 5676, 39242, 15, 187, 9, 138, 230, 9203, 5776, 14858, 10, 187, 12507, 30681, 8095, 11910, 29354, 25651, 11910, 13, 4654, 8520, 26855, 3955, 5346, 2141, 26097, 11910, 26855, 9650, 3147, 8348, 15, 187, 138, 228, 29704, 8348, 9737, 5676, 24745, 4654, 42044, 26097, 11910, 17686, 9028, 2863, 3955, 3955, 8348, 21227, 209, 187, 2599, 8520, 7539, 19927, 4654, 4992, 23871, 5117, 4134, 8348, 3868, 16411, 25235, 187, 138, 234, 48911, 10977, 2863, 10227, 7136, 4733, 4654, 8520, 5898, 47946, 29354, 17686, 19073, 4654, 4992, 9529, 39242, 18383, 6450, 7072, 3393, 30656, 187, 48614, 3952, 12116, 6450, 23766, 9737, 2989, 5776, 12388, 3952, 26097, 11910, 2141, 18806, 9737, 5117, 7072, 9203, 3147, 11910, 2141, 15, 187, 138, 219, 2599, 44586, 42191, 5613, 9203, 25326, 4733, 13, 49456, 23977, 3952, 11910, 8348, 25651, 3393, 30656, 209, 187, 19927, 15902, 30793, 13913, 38377, 16411, 9737, 21027, 9650, 34500, 15, 187, 138, 219, 9650, 3393, 16411, 25628, 18383, 5776, 11630, 16411, 3952, 10139, 9529, 39242, 26855, 3955, 44687, 21394, 47946, 29354, 209, 187, 5676, 10298, 49456, 24292, 9650, 3393, 16411, 19073, 46440, 25326, 7072, 4992, 10977, 24745, 16411, 30175, 5613, 6450, 16287, 14439, 15, 187, 187, 29520, 27, 209, 187, 15168, 826, 294, 7397, 44841, 6255, 340, 1578, 278, 31076, 3737, 15, 187, 15288, 288, 907, 6868, 17113, 274, 27868, 372, 75, 860, 3641, 19146, 23246, 15, 187, 39, 489, 23136, 1141, 917, 1753, 50158, 860, 5940, 21682, 187, 18920, 1753, 530, 1397, 15, 2343, 288, 12043, 49307, 36071, 15, 187, 15288, 42078, 80, 27, 346, 46, 11524, 19095, 5586, 642, 13679, 12083, 3446, 187, 33972, 9500, 7222, 375, 247, 32644, 343, 15, 187, 18204, 254, 7222, 80, 27, 7659, 31945, 187, 371, 860, 3293, 1395, 66, 440, 1113, 23246, 15, 187, 23083, 16538, 7222, 80, 27, 18150, 257, 1578, 284, 7349, 284, 355, 1113, 23246, 15, 187, 9, 51, 261, 284, 10, 187, 52, 2083, 16078, 13, 25769, 332, 45328, 32, 187, 49, 2771, 22572, 2343, 1753, 46154, 17113, 6575, 27, 187, 38, 11769, 13022, 49267, 826, 761, 1464, 187, 615, 26566, 6972, 1936, 3025, 440, 1144, 6187, 4239, 80, 15, 187, 9, 51, 261, 284, 10, 187, 2302, 7222, 66, 35927, 13, 479, 2343, 37266, 257, 44379, 15, 187, 58, 21799, 1950, 1578, 27868, 441, 13167, 187, 293, 346, 78, 11524, 19095, 5586, 642, 13679, 12083, 3446, 187, 17483, 3241, 12910, 383, 376, 2343, 1753, 13647, 1395, 66, 440, 1113, 23246, 187, 316, 6575, 28870, 376, 8274, 10045, 340, 3336, 7860, 15, 187, 2422, 2457, 13, 642, 246, 40594, 187, 1452, 2197, 343, 339, 28824, 2272, 15, 187, 3251, 46154, 48414, 6575, 372, 826, 43587, 637, 3525, 187, 90, 642, 246, 40594, 1753, 1262, 335, 12083, 372, 35927, 15, 187, 187, 27684, 27, 209, 187, 147, 233, 18007, 10626, 6810, 96, 13963, 230, 12859, 103, 14, 27339, 20770, 147, 229, 147, 242, 33389, 29052, 147, 235, 20770, 10740, 13, 187, 12859, 233, 18007, 6810, 102, 49657, 42252, 15, 187, 31468, 26344, 24990, 10740, 29598, 24990, 6810, 233, 18007, 37167, 25398, 41855, 21062, 18007, 13, 6810, 238, 26344, 18007, 24990, 43845, 147, 235, 21062, 24990, 10740, 13, 187, 21677, 27339, 20770, 6810, 233, 18007, 25269, 13963, 231, 6810, 238, 18007, 33389, 35790, 18007, 33992, 187, 26344, 43845, 13963, 105, 36403, 24990, 10740, 32017, 25398, 31468, 29052, 35154, 42252, 33839, 13963, 235, 18007, 187, 35154, 35790, 10740, 32017, 31468, 26344, 36894, 29598, 24990, 6810, 233, 18007, 37167, 25398, 35154, 10626, 12859, 242, 15, 187, 21677, 29052, 10740, 6810, 102, 12859, 103, 21677, 24990, 32017, 18007, 27, 187, 26344, 13963, 235, 24990, 346, 20770, 21677, 33389, 147, 101, 147, 235, 31468, 21062, 24990, 449, 187, 13963, 104, 32017, 18007, 33839, 29052, 10740, 33839, 20770, 27339, 33992, 15, 187, 26344, 20770, 27339, 337, 27, 32017, 18007, 36403, 20770, 13963, 235, 6810, 97, 20770, 33389, 18007, 187, 20770, 21677, 33839, 25398, 33992, 6810, 233, 13963, 242, 15, 187, 26344, 20770, 27339, 374, 27, 32017, 21677, 32017, 26344, 33992, 6810, 233, 13963, 242, 187, 31468, 20770, 25269, 35790, 27339, 21062, 33992, 25269, 21677, 20770, 18007, 15, 187, 9, 147, 101, 36403, 12859, 102, 10, 187, 43845, 26344, 12859, 235, 13, 6810, 243, 35154, 12859, 242, 32, 187, 21677, 27339, 20770, 29598, 29052, 10740, 6810, 236, 12859, 230, 31468, 24990, 187, 25398, 18007, 29598, 24990, 42252, 6810, 234, 12859, 104, 27339, 33992, 27, 187, 147, 233, 18007, 6810, 243, 26344, 25398, 31468, 6810, 238, 25398, 10626, 33389, 24990, 35154, 12859, 242, 187, 20770, 18007, 43845, 12859, 237, 32017, 26344, 25398, 12859, 102, 33992, 15, 187, 9, 147, 101, 36403, 12859, 102, 10, 187, 21677, 13963, 242, 37167, 31468, 13963, 231, 15, 187, 21677, 12859, 241, 21062, 33992, 32017, 10740, 29598, 24990, 6810, 233, 18007, 25269, 21062, 27339, 18007, 15, 187, 21677, 27339, 20770, 6810, 238, 21677, 147, 242, 6810, 243, 35154, 29052, 49657, 25269, 36403, 20770, 41855, 33839, 20770, 187, 18007, 3, 20770, 21677, 33389, 147, 101, 147, 235, 31468, 21062, 24990, 3446, 187, 35154, 10740, 25269, 26344, 13963, 235, 18007, 33839, 20770, 10740, 25269, 13963, 227, 187, 20770, 21677, 32017, 26344, 33992, 6810, 233, 13963, 242, 37167, 31468, 147, 233, 21062, 24990, 6810, 238, 29052, 36894, 46977, 29052, 13963, 241, 12859, 96, 15, 187, 12859, 227, 147, 233, 32017, 21677, 33389, 21062, 147, 229, 13963, 104, 33992, 29598, 26344, 25398, 18007, 15, 187, 21677, 24990, 42252, 33389, 24990, 29052, 18007, 147, 229, 33992, 6810, 236, 43845, 18007, 187, 12859, 227, 13963, 242, 32017, 35154, 42252, 6810, 97, 20770, 33389, 18007, 32017, 18007, 24990, 29052, 147, 101, 20770, 15, 187, 187, 48236, 27, 209, 187, 17483, 11856, 294, 7397, 48873, 6255, 13, 187, 9307, 820, 8901, 278, 31076, 3737, 15, 187, 39, 478, 31812, 4474, 913, 284, 80, 187, 371, 6575, 7950, 489, 74, 48743, 41534, 1747, 80, 13, 187, 6681, 27052, 246, 3685, 1485, 83, 36789, 1753, 711, 257, 8625, 6584, 187, 9307, 21682, 372, 39416, 31812, 12228, 1792, 9392, 13, 187, 1452, 448, 13431, 372, 346, 78, 11524, 19095, 187, 8, 79, 3685, 3578, 1689, 1753, 479, 711, 1291, 1148, 8, 3446, 187, 30377, 1565, 3443, 284, 1162, 522, 284, 15, 187, 24858, 24470, 5111, 27, 1086, 4355, 5586, 258, 1753, 36156, 187, 72, 493, 8125, 372, 8405, 274, 258, 269, 17457, 14, 339, 15, 187, 24858, 24470, 513, 261, 27, 8405, 489, 258, 269, 17457, 14, 339, 187, 81, 376, 3265, 284, 820, 261, 284, 15, 187, 9, 51, 261, 375, 10, 187, 4749, 1868, 13, 31627, 32, 187, 35147, 42185, 258, 1753, 36156, 18219, 17113, 6575, 27, 187, 3, 49, 609, 336, 11856, 1645, 5741, 187, 615, 8733, 396, 15070, 274, 5111, 2654, 21620, 3446, 187, 9, 51, 261, 375, 10, 187, 53, 16469, 36664, 13, 10959, 31277, 36146, 31812, 15, 187, 35147, 3974, 247, 1950, 1753, 994, 376, 247, 17532, 187, 3, 79, 3685, 3578, 1689, 1753, 479, 711, 1291, 1148, 3446, 187, 5072, 86, 44189, 19095, 396, 21058, 247, 8405, 274, 258, 269, 17457, 14, 339, 187, 681, 42839, 1452, 4019, 299, 3336, 14291, 15, 187, 6717, 303, 13, 642, 269, 303, 9527, 523, 284, 13, 187, 87, 406, 5437, 12065, 3509, 8901, 396, 2197, 343, 28824, 3377, 15, 187, 47, 3685, 39434, 1757, 42361, 10081, 35927, 1486, 3377, 187, 70, 12065, 4109, 1757, 35927, 513, 1753, 396, 711, 1291, 1148, 15, 187, 187, 14376, 27, 209, 187, 1552, 310, 6255, 372, 14, 498, 33066, 13, 187, 395, 352, 310, 21653, 15, 187, 42, 858, 352, 407, 7343, 672, 309, 15856, 619, 2628, 13, 187, 2858, 352, 369, 594, 8644, 187, 3529, 309, 3715, 247, 1039, 323, 368, 187, 936, 513, 352, 327, 4096, 15, 187, 42, 1067, 352, 346, 783, 417, 7016, 1332, 449, 187, 1147, 556, 767, 5018, 15, 187, 13996, 581, 27, 7659, 504, 752, 187, 5658, 1053, 626, 1918, 247, 7435, 670, 15, 187, 13996, 767, 27, 5037, 626, 1918, 247, 7435, 187, 10383, 1110, 1841, 15, 187, 9, 45, 5244, 10, 187, 21595, 13, 987, 32, 187, 1989, 309, 871, 752, 368, 1472, 4680, 27, 187, 1552, 7835, 751, 247, 13612, 187, 1542, 8577, 715, 271, 40889, 15, 187, 9, 45, 5244, 10, 187, 1147, 434, 8261, 13, 309, 755, 326, 247, 2257, 15, 187, 1989, 326, 434, 835, 187, 783, 346, 1439, 7016, 3, 629, 3249, 275, 15, 187, 3220, 1332, 310, 512, 670, 417, 4933, 247, 7435, 187, 5302, 33773, 285, 2314, 8098, 15, 187, 2598, 275, 253, 990, 13, 187, 5658, 1053, 626, 452, 281, 1928, 8106, 15, 187, 1394, 403, 327, 634, 1682, 3879, 13, 209, 187, 395, 368, 452, 2717, 281, 26012, 323, 15, 187, 187, 33741, 27, 209, 187, 52, 2880, 70, 4857, 267, 12704, 1327, 557, 2059, 26293, 32616, 15, 187, 11592, 256, 2880, 70, 20641, 3767, 80, 39884, 1213, 251, 9877, 15, 187, 3864, 40620, 13, 1705, 8429, 17090, 794, 91, 279, 609, 591, 3273, 74, 187, 300, 6365, 19095, 3105, 15953, 32, 187, 4678, 73, 13, 1313, 6811, 13431, 1161, 2177, 12580, 3649, 571, 187, 8924, 18656, 308, 1406, 80, 1073, 2101, 796, 8, 187, 70, 256, 2880, 70, 1098, 74, 828, 262, 8657, 187, 66, 5940, 260, 6736, 2328, 257, 3737, 24932, 13, 187, 4123, 572, 1079, 16165, 261, 336, 345, 4164, 7496, 609, 187, 300, 362, 493, 287, 2086, 785, 4510, 7067, 15, 187, 37956, 557, 2059, 584, 14173, 74, 307, 609, 298, 457, 7821, 7067, 13, 187, 785, 2177, 12580, 584, 34843, 332, 80, 30670 ]
urile de care te doare în cot. A doua: să te doară în cot de acele lucruri. (Râsete) Simplu, nu? Dar știu ce gândești: asta sună ca o rețetă pentru a deveni nesimțit. (Râsete) Este în regulă, aud de multe ori asta. Dar acolo apare partea „nepărerii de rău”. Metoda mea presupune să te doară în cot cu sinceritate și politețe. În final, nu trebuie să te simți vinovat. Exprimi cel mai bun comportament al tău și nu ai de ce să îți ceri scuze. Modern Greek (1453-): Αυτό είναι το πνευματικό ξεκαθάρισμα, και είναι μαγικό. Το έκανα κατά λάθος όταν παραιτήθηκα, αλλά ήταν τόσο καταπληκτικό που ανέπτυξα έναν τρόπο για εσάς να το κάνετε επίτηδες. Τον ονομάζω «η μέθοδος του να μην λυπάστε». Έχει δύο βήματα. Βήμα πρώτο: Αποφασίστε για τι δεν σας καίγεται καρφί. Βήμα δεύτερο: Μην σας καίγεται καρφί για αυτά. (Γέλια) Απλό, σωστά; Αλλά ξέρω τι σκέφτεστε: Αυτό ακούγεται σαν συνταγή για να γίνεις μαλάκας. (Γέλια) Δεν πειράζει, μου συμβαίνει συχνά. Αλλά εκεί μπαίνει το κομμάτι του «να μη λυπάστε». Η μέθοδός μου αφορά το να μη σας καίγεται καρφί με ειλικρίνεια και ευγένεια. Έτσι στο τέλος, δεν χρειάζεται να νοιώθετε ενοχές. Έχετε την καλύτερή σας συμπεριφορά και δεν έχετε να απολογηθείτε για τίποτα. Spanish: Es la reorganización mental y es mágica. Lo hize sin pensar cuando dejé mi trabajo. Fue tan increible que desarrollé una forma para que Uds. lo hagan conscientemente. Lo llamo: "Método para no culparse". Hay dos pasos a seguir. Primer paso: Decidan qué les importa un carajo. Segundo paso: Manden esas cosas al carajo. (Risas) Sencillo, ¿verdad? Pero sé lo que están pensando: Esto más parece la receta de cómo volverse un estúpido. (Risas) No pasa nada, me lo dicen mucho. Y ahí es cuando usamos el "método para no culparse". Éste muestra lo que nos importa un carajo usando nuestra honestidad y educación. Al final, no tienen que sentirse culpables. Se están comportando de la mejor manera y no tienen que disculparse de nada. iw: זהו סידור-בלגן מנטלי, וזה קסם. עשתי את זה במקרה, כשהתפטרתי, אבל זה היה כה מדהים שפיתחתי למענכם שיטה כדי לעשות את זה במכוון. אני קוראת לה: שיטת "לא מצטערת." יש לה שני שלבים. שלב 1: להחליט על מה לא שמים זין. שלב 2: לא לשים זין על הדברים האלה. (צחוק) פשוט, נכון? אבל אני יודעת מה אתם חושבים: זה נשמע כמו מתכון להפוך לשמוקים. (צחוק) אין בעיה. אומרים לי את זה הרבה. אבל כאן נכנס החלק של ה"לא מצטערת". כי השיטה שלי היא לא לשים זין בעזרת כנות ונימוס. ואז לא מרגישים אשמה. אתם מתנהגים יפה ואין לכם על מה להתנצל. Portuguese: É uma reorganização mental, uma coisa mágica. Fiz isso por acaso quando larguei meu emprego, mas foi tão incrível que desenvolvi uma forma de fazer isso voluntariamente, que chamo de "método 'não tenho que me desculpar'". Ele tem duas etapas. Etapa um: decida para o que você gostaria de ligar o foda-se. Etapa dois: ligue o foda-se pra essas coisas. (Risos) Simples, né? Mas sei o que você está pensando: "Parece uma receita de como se tornar um idiota". (Risos) Tudo bem, ouço muito isso. Mas é aí que entra a parte "não tenho que me desculpar". Meu método se resume a ligar o foda-se com franqueza e educação. Assim, no fim das contas, você não precisa se sentir culpado. Não estará fazendo nada errado e não terá nada do que se desculpar. English: This is mental de-cluttering, and it is magical. I did it by accident when I quit my job, but it was so amazing that I developed a way for you to do it on purpose. I call it "the not sorry method." It has two steps. Step one: Decide what you don't give a fuck about. Step two: Don't give a fuck about those things. (Laughter) Simple, right? But I know what you're thinking: This sounds like a recipe for turning into an asshole. (Laughter) It's okay, I get that a lot. But that's where the "not sorry" part comes in. My method is all about not giving a fuck using honesty and politeness. So in the end, you don't have to feel guilty. You are on your best behavior, and you have nothing to apologize for. Italian: Siete letteralmente non dispiaciuti. Non siete nemmeno degli stronzi. Quindi, come può funzionare per voi il Metodo NotSorry? Beh, mettiamo che vi piaccia ‘Il Trono di Spade' e siete stati invitati a una cena domenica sera, la quale interferisce con il guardare il vostro programma preferito. Vi dispiace rifiutare l’invito, ma vi piace davvero tanto
[ 285, 2620, 2571, 497, 48867, 3206, 275, 253, 2440, 273, 253, 24642, 285, 497, 3021, 10432, 432, 253, 6630, 15, 13036, 281, 253, 1265, 273, 253, 6752, 11073, 807, 13, 352, 369, 4425, 281, 6630, 7971, 2392, 342, 26704, 2308, 273, 46837, 3535, 2793, 1309, 6585, 15, 9901, 6, 273, 7971, 2392, 4895, 616, 28687, 15, 16035, 6133, 2392, 812, 436, 320, 10509, 715, 1110, 665, 574, 187, 187, 18, 15461, 16035, 6133, 456, 625, 685, 337, 10014, 2796, 79, 13912, 1722, 10, 187, 187, 19, 15461, 16035, 6133, 456, 337, 10014, 760, 2796, 79, 13912, 854, 10, 187, 187, 20, 15461, 2325, 257, 10166, 285, 497, 670, 281, 12454, 323, 253, 806, 673, 275, 4247, 6752, 2796, 79, 13912, 854, 10, 187, 187, 688, 253, 6630, 13, 34989, 497, 1160, 5001, 16038, 281, 12454, 13, 253, 2554, 273, 3733, 275, 616, 4685, 273, 367, 5993, 13, 616, 8450, 273, 46837, 3535, 313, 70, 15, 72, 15, 12748, 285, 849, 597, 5440, 264, 10, 285, 616, 12351, 9503, 347, 247, 7971, 1080, 275, 5974, 4715, 15, 16035, 6133, 2392, 574, 281, 2281, 247, 3908, 327, 247, 608, 14, 3659, 34461, 797, 4311, 285, 497, 3839, 1677, 271, 5107, 281, 5513, 616, 9172, 15, 1198, 1110, 665, 497, 1335, 281, 12454, 13, 7234, 497, 3159, 264, 824, 326, 616, 24789, 273, 752, 597, 943, 390, 651, 513, 497, 39039, 15, 187, 187, 21214, 6260, 187, 15879, 187, 187, 1992, 2451, 323, 1534, 3910, 1561, 285, 875, 253, 1264, 2390, 13, 581, 14, 1106, 1783, 273, 11041, 285, 247, 475, 5996, 26901, 5355, 45, 3871, 10, 1071, 497, 20023, 15, 7900, 760, 767, 2390, 313, 28402, 6133, 456, 2378, 285, 30199, 625, 685, 2378, 10, 497, 2429, 13, 247, 767, 14, 29551, 5974, 4479, 84, 475, 85, 4842, 2566, 369, 3732, 2378, 253, 2193, 574, 644, 15045, 323, 13919, 273, 11041, 970, 13202, 1751, 4479, 84, 1071, 15, 496, 1097, 10872, 13, 247, 475, 49, 11, 2877, 4398, 470, 15, 1762, 369, 2783, 1534, 15, 187, 187, 36303, 5701, 187, 573, 187, 187, 8430, 1016, 7971, 1080, 369, 6760, 407, 521, 16, 379, 1387, 1563, 247, 721, 14, 11151, 10014, 13, 253, 11088, 941, 403, 4390, 417, 2130, 15, 16185, 5701, 2361, 497, 5728, 432, 247, 2087, 7103, 273, 247, 1180, 273, 1027, 7794, 273, 253, 747, 13521, 387, 253, 990, 273, 6585, 15, 21696, 497, 2546, 281, 4385, 327, 253, 2762, 285, 4016, 7794, 273, 253, 7971, 1080, 347, 247, 5048, 273, 5511, 875, 24642, 1963, 34768, 285, 3484, 15, 380, 5701, 2959, 497, 13, 2299, 13, 273, 247, 625, 2087, 3753, 285, 2530, 12288, 715, 7971, 2392, 4479, 15277, 432, 253, 5974, 8668, 15, 187, 187, 9340, 187, 6877, 187, 187, 38306, 7639, 281, 12454, 187, 26043, 187, 187, 1147, 651, 3176, 326, 46837, 3535, 369, 3839, 1146, 20023, 323, 253, 3451, 4606, 313, 3235, 544, 19, 1084, 53, 19, 910, 709, 14, 881, 568, 2420, 2536, 16035, 6133, 2392, 3543, 326, 352, 369, 616, 8294, 313, 2597, 15, 26, 2673, 285, 597, 6566, 275, 253, 367, 5993, 11727, 313, 2526, 15, 24, 10970, 1707, 497, 13, 2299, 13, 1679, 15276, 15265, 839, 2616, 15, 733, 369, 417, 10084, 281, 1089, 326, 2761, 9901, 6, 273, 7971, 2392, 313, 3235, 544, 19, 1084, 53, 19, 910, 709, 14, 881, 568, 2420, 7547, 497, 2509, 594, 323, 32223, 6378, 13, 7296, 326, 14892, 1024, 4419, 247, 9551, 20820, 15, 24059, 2716, 4860, 326, 7830, 369, 247, 8180, 15, 496, 436, 2743, 13, 32016, 574, 4425, 326, 1223, 253, 5899, 13521, 369, 1146, 815, 833, 562, 13, 7971, 2392, 285, 3382, 6936, 17846, 641, 651, 320, 867, 328, 12072, 15, 187, 187, 5146, 2490, 187, 1785, 3743, 4236, 407, 7971, 2392, 323, 15299, 275, 253, 747, 367, 5993, 13521, 15, 16035, 6133, 2392, 812, 3609, 625, 685, 581, 4500, 15, 535, 50276, 424, 1785, 3743, 323, 30753, 424, 50254, 50254, 50254, 50274, 1401, 6, 7971, 2392, 2796, 79, 13912, 5922, 4846, 187, 50276, 28505, 397, 43090, 187, 50276, 42, 2868, 352, 310, 619, 8294, 281, 8162, 281, 253, 747, 31454, 13521, 50255, 424, 2597, 15, 26, 424, 187, 50276, 42, 2868, 275, 253, 11727, 273, 1895, 14, 3169, 4715, 50254, 50254, 50274, 424, 2526, 15, 24, 424, 187, 50276, 1147, 651, 8162, 4404, 619, 9551, 20820, 672, 9433, 323, 14892, 50254, 50274, 424, 1549, 15, 23, 424, 187, 50276, 41349, 4606, 50254, 50254, 50254, 50266, 50274, 424, 2385, 15, 22, 424, 187, 50276, 3220, 12318, 273, 4487, 16, 28014, 2546, 479, 281, 12454, 50254, 50254, 50272, 424, 1610, 15, 20, 424, 187, 50276, 39965, 300, 3535, 310, 271, 5107, 281, 6233, 330, 5414, 2792, 50254, 50254, 50270, 424, 805, 15, 18, 424, 187, 50276, 8665, 313, 70, 15, 72, 15, 4264, 31454, 9551, 28, 6110, 275, 9551, 285, 4715, 28, 281, 3037, 342, 3484, 10, 50275, 424, 1797, 15, 19, 424, 187, 187, 47416, 187, 397, 187, 187, 39965, 6133, 1080, 3733, 574, 4518, 644, 5547, 13, 342, 512, 1264, 2390, 7809, 326, 616, 4685, 273, 367, 5993, 574, 2559, 347, 247, 906, 13, 285, 326, 253, 3733, 574, 2530, 731, 342, 12288, 715, 253, 4323, 273, 247, 1355, 1387, 313, 3235, 544, 20, 1084, 53, 20, 910, 709, 14, 881, 568, 2420, 2536, 831, 369, 5783, 846, 597, 574, 30199, 327, 387, 1878, 581, 10014, 313, 3235, 544, 21, 1084, 53, 21, 910, 709, 14, 881, 568, 2420, 2536, 7243, 597, 574, 30199, 13, 253, 3733, 1160, 625, 3282, 13, 3782, 323, 1110, 665, 574, 30199, 625, 685, 2378, 313, 3235, 544, 21, 1084, 53, 21, 910, 709, 14, 881, 568, 2420, 7547, 313, 3953, 15, 18, 6, 273, 1110, 665, 574, 30199, 625, 685, 2378, 4632, 15, 9743, 15, 22, 6, 273, 1110, 665, 574, 30199, 2378, 481, 187, 187, 5146, 2490, 187, 39965, 6133, 2392, 4479, 24789, 273, 253, 3486, 273, 3733, 327, 616, 3640, 273, 367, 5993, 285, 616, 39236, 5001, 46837, 3535, 285, 616, 806, 1355, 1387, 8450, 15, 535, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50266, 50276, 424, 13019, 273, 2793, 424, 50254, 252, 50264, 50276, 187, 50276, 7078, 2518, 9998, 32703, 22712, 23784, 36056, 187, 50276, 424, 39965, 6133, 1080, 3733, 424, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50272, 2490, 50276, 424, 3175, 34354, 5935, 28981, 1042, 2637, 8200, 849, 651, 2281, 634, 3640, 16, 4524, 6924, 273, 253, 367, 5993, 11727, 32, 1401, 18, 426, 5293, 374, 426, 43721, 495, 426, 5272, 16, 25629, 577, 426, 1175, 608, 426, 7126, 424, 50254, 979, 50263, 1401, 19, 15, 22, 3279, 470, 15, 1839, 424, 50266, 424, 19, 15, 21, 3279, 470, 15, 1812, 424, 50272, 424, 20, 15, 17, 3279, 470, 15, 1348, 424, 50271, 424, 19, 15, 24, 3279, 470, 15, 1093, 424, 187, 50276, 424, 9006, 4827, 28981, 1042, 2637, 8200, 849, 651, 368, 2281, 634, 3640, 16, 4524, 6924, 273, 253, 367, 5993, 11727, 32, 1401, 18, 426, 5293, 374, 426, 43721, 495, 426, 5272, 16, 25629, 577, 426, 1175, 608, 426, 7126, 424, 50254, 979, 50263, 424, 20, 15, 25, 3279, 470, 15, 1099, 424, 50266, 424, 20, 15, 26, 3279, 470, 15, 1229, 424, 50272, 424, 21, 15, 17, 3279, 470, 15, 746, 424, 50271, 424, 20, 15, 26, 3279, 470, 15, 1012, 424, 187, 50276, 8917, 253, 7971, 1080, 3733, 2085, 368, 342, 4209, 12288, 715, 849, 247, 7971, 1080, 943, 8722, 247, 1355, 367, 5993, 1387, 32, 1401, 18, 426, 7052, 14936, 374, 426, 14936, 495, 426, 417, 2119, 577, 426, 5194, 608, 426, 7052, 5194, 424, 50275, 424, 20, 15, 26, 3279, 470, 15, 1229, 424, 50266, 424, 20, 15, 23, 3279, 470, 15, 2945, 424, 50272, 424, 20, 15, 25, 3279, 470, 15, 1348, 424, 50271, 424, 20, 15, 25, 3279, 470, 15, 1166, 424, 187, 50276, 424, 4678, 4202, 7407, 342, 46837, 3535, 424, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50266, 2490, 50276, 2347, 858, 16, 3088, 368, 1928, 1078, 30753, 634, 806, 6874, 32, 1401, 18, 426, 34639, 374, 426, 20138, 495, 426, 858, 417, 1158, 670, 352, 577, 426, 13224, 608, 426, 9049, 424, 50254, 50254, 50262, 424, 20, 15, 18, 3279, 470, 15, 2417, 424, 50266, 424, 19, 15, 26, 3279, 470, 15, 1449, 424, 50272, 424, 20, 15, 18, 3279, 470, 15, 1610, 424, 50271, 424, 20, 15, 17, 3279, 470, 15, 2405, 424, 187, 50276, 4045, 368, 2868, 326, 275, 1340, 281, 2489, 625, 9848, 16, 2655, 6390, 281, 12454, 13, 581, 1364, 12454, 625, 685, 337, 10014, 32, 1401, 18, 426, 7052, 14936, 374, 426, 14936, 495, 426, 417, 2119, 577, 426, 5194, 608, 426, 7052, 5194, 424, 50273, 424, 21, 15, 23, 3279, 470, 15, 1093, 47546, 66, 63, 50269, 424, 20, 15, 21, 3279, 470, 15, 2950, 47546, 67, 63, 50275, 424, 21, 15, 21, 3279, 470, 15, 1348, 47546, 317, 63, 50275, 424, 21, 15, 19, 3279, 470, 15, 746, 424, 187, 50276, 39965, 300, 3535, 390, 9551, 275, 253, 5899, 13521, 32, 1401, 18, 426, 7052, 14936, 374, 426, 14936, 495, 426, 417, 2119, 577, 426, 5194, 608, 426, 7052, 5194, 424, 50254, 50254, 50254, 50254, 50254, 50263, 2490, 50276, 688, 2426, 273, 31454, 4715, 13, 651, 368, 4510, 281, 12454, 313, 1826, 24642, 10, 313, 30786, 685, 4035, 281, 9798, 3484, 858, 514, 1037, 313, 74, 15, 70, 15, 29608, 10, 347, 310, 20023, 275, 253, 5899, 24642, 6177, 50275, 424, 20, 15, 26, 3279, 470, 15, 1229, 424, 50266, 424, 20, 15, 25, 3279, 470, 15, 2537, 424, 50272, 424, 20, 15, 20, 3279, 470, 15, 1706, 424, 50271, 424, 20, 15, 23, 3279, 470, 15, 1423, 424, 187, 50276, 11778, 368, 2455, 33444, 3095, 313, 19047, 1173, 390, 643, 10, 342, 2743, 281, 3237, 326, 368, 778, 452, 7407, 275, 634, 1355, 1387, 12154, 15, 50254, 50254, 50254, 424, 47, 16, 34, 424, 50259, 424, 20, 15, 20, 3279, 470, 15, 2537, 424, 50272, 424, 19, 15, 21, 3279, 470, 15, 1731, 424, 50271, 424, 19, 15, 23, 3279, 470, 15, 1348, 2796, 79, 13912, 2030, 4846, 187, 187, 63, 66, 13, 67, 13, 317, 3503, 49, 16160, 470, 15, 1762, 187, 187, 5146, 2490, 187, 39965, 6133, 1080, 8450, 273, 616, 1355, 2390, 40727, 27, 30753, 323, 253, 806, 673, 285, 10620, 342, 5974, 3237, 15, 535, 50276, 16525, 6154, 10521, 187, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50272, 1401, 13019, 273, 2793, 424, 50254, 50270, 50276, 187, 50276, 7078, 39423, 315, 32703, 4372, 15369, 4372, 187, 50276, 424, 39965, 6133, 839, 253, 806, 10014, 424, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50254, 50272, 535, 50276, 2347, 651, 368, 2281, 634, 806, 23647, 16, 28402, 300, 3535, 6874, 313, 74, 15, 70, 15, 10498, 337, 6177, 1401, 18, 426, 38074, 374, 426, 20297, 495, 426, 417, 2119, 577, 426, 1175, 608, 426, 7126, 424, 50254, 50254, 50254, 50254, 50274, 1401, 20, 15, 25, 3279, 470, 15, 1787, 424, 50266, 424, 20, 15, 21, 3279, 470, 15, 1731, 424, 50275, 424, 17, 15, 25745, 424, 50273, 424, 20, 15, 22, 3279, 470, 15, 1797, 424, 535, 50276, 4553, 30753, 634, 806, 721, 2129, 10014, 13, 849, 513, 368, 1928, 3839, 670, 46837, 3535, 32, 1401, 18, 426, 9239, 352, 374, 426, 2509, 352, 984, 309, 452, 281, 495, 426, 6861, 22809, 577, 426, 30963, 608, 426, 31905, 424, 50254, 50254, 50262, 50276, 424, 21, 15, 22, 3279, 470, 15, 1630, 424, 50266, 424, 21, 15, 23, 3279, 470, 15, 746, 424, 50275, 424, 17, 15, 24, 2222, 424, 50273, 424, 21, 15, 23, 3279, 470, 15, 1010, 424, 535, 50276, 4553, 30753, 323, 581, 10014, 273, 721, 3618, 13, 849, 858, 368, 1928, 670, 253, 367, 5993, 1232, 275, 2426, 273, 14312, 4715, 275, 13715, 32, 1401, 18, 426, 18860, 374, 426, 12345, 3576, 495, 426, 6861, 22809, 577, 426, 1175, 608, 426, 7126, 424, 50254, 245, 50265, 424, 21, 15, 20, 3279, 470, 15, 2405, 424, 50266, 424, 20, 15, 25, 3279, 470, 15, 938, 424, 50275, 424, 17, 15, 17726, 424, 50273, 424, 20, 15, 26, 3279, 470, 15, 1166, 424, 535, 50276, 10758, 368, 574, 30199, 337, 10014, 13, 858, 253, 7971, 1080, 3733, 1056, 625, 3282, 275, 2426, 273, 4685, 253, 2554, 273, 253, 7971, 1080, 275, 1355, 1387, 367 ]
and five others were intimately involved in the development of the curriculum and were thus excluded from the survey. Prior to the start of the 2002 academic year, it was decided to survey facilitators with differing levels of facilitation experience during 2001. 61% of facilitators returned their questionnaires. Facilitators could this be classified into those who had 1\. Facilitated more than 1 theme (*n*= 17) 2\. Facilitated 1 theme only (*n*= 8) 3\. Been trained and were about to facilitate for the first time in January 2002 (*n*= 8) In the survey, inquiries were made regarding motivation to facilitate, the role of training in their understanding of PBL, their experiences of facilitation (e.g. difficulties and how they coped) and their perceived roles as a facilitator in student learning. Facilitators had to rate a statement on a 5-point Likert scale and were generally given an opportunity to explain their answers. For those who were still to facilitate, statements were worded such that their perceptions of what they should or would do were probed. Statistical analyses -------------------- To check for significant differences within and between the three groups, one-way analysis of variance and a *post hoc*(LSD) test were undertaken. Where only two groups (facilitated once and facilitated more than once) were compared, a two-tailed student\'s *t*-test was applied once the values had been corrected for equality of variance using Levene\'s test. In both instances, a *P*value \< 0.05 was considered significant. Student comments ---------------- Although each facilitator was evaluated by his/her group following a 6-week theme, the comprehensive data are currently not available. Student comments reported were collected from a general evaluation of a number of different aspects of the new programme at the end of 2001. Students were asked to comment on the positive and negative aspects of the facilitator as a channel of communication between curriculum organisers and students. The comments received were, however, of a more general nature and provided insight into facilitators\' abilities from the student perspective. Results ======= Motivation to facilitate ------------------------ It would appear that facilitation was generally being undertaken for the correct reasons (Table [2](#T2){ref-type="table"}). Facilitators felt that it was their responsibility (87.9%) and they believed in the PBL philosophy (66.7%). There were, however, less intrinsic motivating factors. It was not surprising to find that almost 61% of facilitators (Table [2](#T2){ref-type="table"}) were doing so for promotional purposes, considering that promotion now requires a teaching portfolio. Almost half indicated that payment was a consideration. In this regard, Faculty had decided that while the traditional programme was being phased out, facilitators and clinical skills tutors would be remunerated. ###### Reasons selected by facilitators for participating in the new PBL programme. Facilitators could select more than one option. **Reasons for facilitating** **% facilitators (*n*= 33)** -------------------------------------------------------------------------------------------------------- ------------------------------ I believe it is my responsibility to contribute to the new undergraduate programme **87.9** I believe in the philosophy of problem-based learning **66.7** It would contribute towards my teaching portfolio when applying for promotion **60.6** Financial reasons **48.5** My Head of Department/School asked me to facilitate **33.3** Facilitation is an opportunity to earn CPD points **12.1** Other (e.g. enjoy undergraduate teaching; interested in teaching and learning; to learn with students) **21.2** Training -------- Facilitator training had clearly been successful, with all three groups indicating that their understanding of PBL had increased as a result, and that the training had provided them with insight into the management of a small group (Table [3](#T3){ref-type="table"}). This was confirmed after they had facilitated on at least one theme (Table [4](#T4){ref-type="table"}). Once they had facilitated, the training made more sense, particularly for those who had facilitated more than once (Table [4](#T4){ref-type="table"}) (94.1% of those who had facilitated more than once vs. 62.5% of those who had facilitated once). ###### Facilitators\' perceptions of the impact of training on their knowledge of PBL and their sentiments regarding facilitation and their first small group experiences. **Level of experience** ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------- ------------------- -------------------- -------------------------- **Facilitator training** **PRIOR TO TRAINING**, how would rate your knowledge/understanding of the PBL philosophy? **1 = none 2 = scant 3 = reasonable/average 4 = good 5 = excellent** **2.5 ± 0.38** **2.4 ± 0.36** **3.0 ± 0.24** **2.7 ± 0.18** **AFTER TRAINING**, how would you rate your knowledge/understanding of the PBL philosophy? **1 = none 2 = scant 3 = reasonable/average 4 = good 5 = excellent** **3.8 ± 0.25** **3.9 ± 0.30** **4.0 ± 0.19** **3.9 ± 0.13** Did the facilitator training provide you with sufficient insight into how a facilitator should manage a small PBL group? **1 = strongly disagree 2 = disagree 3 = not sure 4 = agree 5 = strongly agree** **3.9 ± 0.30** **3.6 ± 0.42** **3.8 ± 0.24** **3.8 ± 0.17** **Becoming experienced with facilitation** How did/do you feel before facilitating your first session? **1 = annoyed 2 = anxious 3 = did not think about it 4 = confident 5 = excited** **3.1 ± 0.55** **2.9 ± 0.40** **3.1 ± 0.33** **3.0 ± 0.31** Do you believe that in order to become more comfortable/equipped to facilitate, one must facilitate more than 1 theme? **1 = strongly disagree 2 = disagree 3 = not sure 4 = agree 5 = strongly agree** **4.6 ± 0.18**^a^ **3.4 ± 0.46**^b^ **4.4 ± 0.24**^ac^ **4.2 ± 0.19** Facilitation or teaching in the traditional programme? **1 = strongly disagree 2 = disagree 3 = not sure 4 = agree 5 = strongly agree** In terms of undergraduate learning, would you prefer to facilitate (new curriculum) (rather than continue to teach students didactically (i.e. lectures) as is undertaken in the traditional curriculum)? **3.9 ± 0.30** **3.8 ± 0.49** **3.3 ± 0.34** **3.6 ± 0.22** Have you ever consulted someone (MEDev or other) with regard to problems that you may have experienced in your small group sessions. **N/A** **3.3 ± 0.49** **2.4 ± 0.26** **2.6 ± 0.24 (*n*= 25)** ^a,b,ac^*P*\< 0.05 ###### Facilitator experiences of their small groups tutorials: facilitating for the first time and dealing with student problems. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ **Level of experience** ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------- ---------------- ------------- ---------------- **Facilitating the first theme** How would you rate your first tutorial/facilitation session (i.e. Case 1)? **1 = dreadful 2 = satisfactory 3 = not sure 4 = good 5 = excellent** **3.8 ± 0.37** **3.4 ± 0.26** **0.387** **3.5 ± 0.21** After facilitating your first 6 week theme, how do you feel generally about facilitation? **1 = hate it 2 = doing it because I have to 3 = ambivalent 4 = coping 5 = enthusiastic** **4.5 ± 0.27** **4.6 ± 0.19** **0.795** **4.6 ± 0.15** After facilitating for one theme of 6 weeks, how did you feel about the PBL process in terms of promoting learning in Medicine? **1 = ineffective 2 = barely effective 3 = ambivalent 4 = good 5 = excellent** **4.3 ± 0.31** **3.8 ± 0.20** **0.195** **3.9 ± 0.17** Once you had facilitated 1 theme, did the facilitator training make more sense in terms of understanding the role of the facilitator in small group P
[ 44390, 12841, 617, 13, 703, 20311, 281, 3324, 617, 11626, 562, 715, 253, 1527, 13, 3981, 326, 795, 379, 64, 637, 313, 395, 309, 15433, 387, 326, 673, 326, 703, 5486, 346, 379, 637, 3, 275, 625, 685, 581, 3282, 5627, 369, 253, 760, 3578, 263, 44392, 41461, 275, 253, 1533, 13, 253, 581, 285, 760, 3327, 13, 418, 9358, 10231, 13, 285, 352, 1663, 3589, 626, 667, 897, 323, 667, 11870, 1711, 637, 281, 1611, 285, 8230, 1411, 617, 3918, 15, 187, 187, 41, 28989, 2335, 12688, 6258, 434, 7318, 461, 280, 16157, 347, 247, 1943, 16391, 13, 533, 8505, 344, 1871, 3786, 4425, 326, 436, 369, 253, 2360, 281, 1056, 521, 2118, 15, 5863, 281, 253, 1390, 7017, 13, 253, 1711, 30013, 4546, 352, 4484, 13, 6179, 1919, 7641, 466, 434, 14709, 2183, 617, 352, 369, 673, 323, 617, 281, 1625, 690, 32428, 15, 2635, 13, 344, 19347, 562, 13, 10884, 342, 521, 44392, 41461, 13, 285, 3053, 281, 13920, 7641, 466, 434, 32428, 13, 23727, 15, 7641, 466, 13, 4854, 521, 3590, 13, 3261, 598, 13, 35954, 13, 285, 840, 3200, 264, 281, 3327, 347, 604, 281, 1333, 13, 346, 12864, 4179, 449, 187, 187, 2598, 418, 9358, 3407, 24935, 253, 32428, 13, 285, 281, 1918, 6152, 835, 6152, 310, 1955, 13, 344, 1663, 795, 35293, 64, 253, 32428, 326, 2360, 13, 35397, 846, 35397, 13, 1919, 4720, 44390, 12948, 275, 327, 253, 990, 273, 581, 273, 521, 30811, 5123, 13, 18779, 6748, 247, 23007, 38205, 13, 417, 12401, 8352, 46602, 8962, 3750, 30900, 272, 13, 14257, 689, 9177, 272, 418, 9358, 434, 625, 419, 17852, 2746, 15, 2091, 44390, 6699, 745, 253, 32428, 13, 594, 1875, 13, 396, 1875, 13, 285, 20284, 253, 2862, 2419, 342, 521, 11479, 85, 1546, 13, 2762, 3347, 24649, 13, 1046, 6985, 3407, 45927, 13, 342, 253, 6517, 273, 12688, 6258, 13, 418, 9358, 13, 285, 617, 7590, 3817, 254, 13, 353, 2131, 15, 1583, 13, 751, 253, 39004, 13, 20618, 616, 40667, 285, 26044, 1977, 15, 187, 187, 11, 7130, 281, 2067, 26624, 13, 285, 418, 9358, 10231, 2994, 13, 36533, 1128, 395, 2571, 665, 15433, 253, 1072, 1128, 926, 1520, 3430, 15, 187, 187, 4, 4392, 2277, 1719, 346, 39, 43718, 3, 411, 5626, 947, 187, 187, 4, 187, 187, 4, 48488, 322, 15, 411, 3077, 8301, 187, 187, 64, 9917, 432, 44934, 285, 388, 290, 2727, 434, 380, 33216, 353, 7380, 13, 436, 24540, 13, 407, 253, 7291, 285, 3862, 33293, 2516, 10520, 13, 273, 253, 21426, 25375, 1227, 35951, 382, 3692, 5211, 3440, 285, 5211, 3753, 4035, 281, 22611, 625, 685, 13719, 1107, 846, 521, 2393, 2471, 13, 275, 23430, 4414, 187, 187, 14358, 401, 1832, 8799, 254, 285, 521, 8624, 16304, 13, 5490, 367, 15, 7902, 13, 6940, 4852, 273, 247, 7695, 22014, 15, 7902, 913, 742, 22134, 984, 344, 812, 1089, 642, 8446, 323, 521, 4092, 16672, 13, 533, 8799, 254, 434, 8327, 281, 1089, 14924, 347, 247, 4092, 26650, 369, 14205, 762, 247, 5536, 14037, 273, 42551, 730, 451, 414, 15, 1244, 1223, 7902, 499, 351, 4861, 25060, 49136, 275, 39340, 25813, 13, 8799, 254, 434, 787, 37018, 314, 6871, 474, 12046, 4824, 779, 598, 285, 598, 285, 598, 275, 253, 2144, 1533, 1128, 8045, 1230, 281, 247, 1268, 326, 1014, 521, 14779, 2341, 812, 417, 23808, 342, 15, 187, 187, 1328, 369, 581, 273, 253, 954, 48994, 21220, 1821, 665, 556, 2455, 3531, 598, 275, 253, 1533, 273, 4633, 3440, 1128, 266, 275, 303, 7116, 9845, 254, 3692, 22611, 556, 13, 604, 2712, 13, 8228, 275, 253, 19063, 13256, 280, 9976, 285, 247, 2716, 1580, 521, 2471, 28, 253, 8406, 273, 690, 273, 253, 1270, 2455, 11707, 9575, 275, 253, 4633, 39287, 5550, 41, 531, 656, 47925, 12447, 937, 346, 34, 249, 626, 29056, 1257, 10940, 249, 8, 33051, 247, 24455, 35951, 382, 3692, 4882, 369, 247, 30951, 275, 253, 2440, 273, 326, 7935, 285, 3692, 4833, 327, 638, 14, 67, 412, 35951, 1346, 369, 49634, 760, 407, 326, 273, 22992, 388, 1100, 28, 285, 247, 2593, 637, 665, 812, 14284, 271, 2862, 3961, 347, 642, 581, 2010, 812, 15, 1876, 273, 841, 17714, 497, 521, 285, 2568, 13, 751, 253, 19455, 42493, 665, 5605, 281, 1132, 5516, 1059, 13, 344, 574, 247, 21337, 8327, 281, 3324, 281, 253, 1345, 521, 2389, 273, 8946, 3440, 285, 273, 253, 1963, 15, 3032, 878, 281, 3959, 436, 9140, 285, 452, 352, 7607, 369, 2761, 1429, 3022, 285, 13, 1429, 3022, 13, 253, 8513, 672, 352, 369, 10945, 369, 3676, 285, 1048, 15, 187, 187, 28058, 31593, 695, 13, 253, 44392, 2689, 251, 382, 285, 8254, 7795, 382, 275, 401, 1832, 434, 1652, 3961, 432, 26421, 281, 23430, 13, 31947, 2069, 672, 8799, 254, 369, 594, 2120, 273, 521, 5471, 323, 4092, 3440, 326, 344, 4571, 626, 1361, 4882, 13, 1014, 275, 247, 2360, 34583, 13, 342, 512, 253, 12256, 414, 273, 534, 344, 369, 7032, 15, 1292, 436, 3589, 626, 253, 401, 1832, 326, 253, 6383, 574, 5087, 281, 4089, 15, 187, 187, 3, 8836, 275, 253, 8446, 651, 1158, 344, 369, 10776, 1066, 937, 31593, 695, 2296, 15, 346, 3726, 1871, 42963, 13, 686, 8380, 327, 13, 401, 1832, 11388, 754, 1871, 1379, 247, 1863, 304, 273, 48347, 390, 1633, 285, 1333, 25036, 314, 13, 686, 27031, 987, 13, 1060, 352, 310, 2464, 346, 187, 187, 1898, 344, 1871, 499, 351, 715, 690, 246, 1403, 36765, 492, 31757, 432, 46487, 9251, 1219, 2205, 15, 187, 187, 24115, 254, 434, 4092, 37321, 497, 512, 994, 88, 967, 342, 521, 2389, 273, 253, 1963, 15, 380, 8068, 7291, 13, 1284, 41844, 22801, 13, 2378, 2540, 591, 916, 1242, 326, 346, 783, 1963, 310, 253, 7935, 273, 521, 2798, 13, 253, 18542, 273, 521, 12607, 449, 187, 187, 39, 1832, 574, 271, 1963, 275, 521, 10230, 275, 1457, 2816, 285, 13, 1996, 13, 275, 521, 2419, 387, 659, 15, 21975, 507, 13, 418, 15, 42, 15, 7900, 332, 344, 2427, 13, 344, 7799, 562, 9091, 281, 1132, 253, 1963, 15, 496, 7785, 13, 275, 30953, 13, 327, 271, 5010, 391, 1369, 10593, 784, 7408, 342, 4498, 16360, 26878, 8757, 13, 344, 21863, 598, 281, 253, 1963, 2343, 649, 273, 253, 33017, 273, 37702, 33003, 342, 42430, 40897, 20887, 13, 253, 36368, 434, 1963, 382, 15, 3032, 1304, 327, 752, 4592, 627, 369, 5431, 8799, 254, 757, 27, 346, 6407, 2305, 15, 40897, 20887, 4546, 253, 2656, 14, 3364, 285, 840, 309, 4546, 253, 2656, 14, 3364, 449, 187, 187, 3039, 344, 369, 2444, 275, 253, 3085, 795, 998, 526, 90, 28323, 64, 275, 23430, 13, 13515, 1078, 521, 2471, 13, 344, 1119, 271, 1963, 327, 253, 873, 15, 754, 2206, 1066, 281, 1132, 285, 323, 1264, 3038, 3275, 369, 2918, 598, 347, 253, 2862, 2567, 18029, 10032, 3086, 15, 2596, 273, 521, 1643, 9091, 281, 1132, 253, 1963, 323, 247, 4618, 8446, 13, 285, 281, 1132, 347, 344, 3078, 281, 1132, 13, 2210, 1309, 247, 807, 344, 5262, 327, 253, 4750, 273, 18972, 56, 275, 29089, 275, 253, 2393, 20960, 2890, 15, 754, 574, 271, 12546, 4087, 5547, 3563, 2360, 2086, 627, 13, 795, 39, 1832, 8799, 254, 434, 416, 14292, 9585, 64, 1157, 327, 534, 344, 21758, 285, 502, 15280, 285, 4546, 253, 6276, 31482, 18542, 326, 369, 521, 28648, 15, 1244, 840, 13, 247, 4564, 273, 3038, 1996, 13, 275, 253, 2393, 3038, 273, 253, 4131, 13, 253, 4660, 5907, 247, 2086, 273, 7107, 13, 19951, 1963, 3440, 15, 380, 1963, 382, 1620, 2959, 667, 33484, 15, 733, 369, 401, 1832, 8799, 254, 13, 4882, 342, 247, 2120, 2600, 420, 326, 11766, 2210, 281, 779, 15, 187, 187, 2512, 1364, 452, 644, 1633, 273, 253, 1072, 2600, 420, 323, 779, 327, 247, 1388, 275, 31687, 672, 344, 2206, 1066, 387, 247, 12881, 1963, 275, 9964, 434, 6039, 3354, 34713, 285, 5950, 767, 33067, 955, 407, 31540, 313, 10002, 6337, 2626, 275, 401, 1832, 434, 1984, 347, 253, 6459, 637, 275, 2892, 1128, 45, 14695, 285, 17179, 399, 15, 21519, 497, 806, 285, 1273, 582, 19548, 32786, 15767, 434, 346, 29520, 30866, 1621, 15, 337, 937, 27461, 15701, 434, 346, 28625, 14461, 376, 360, 937, 48582, 13456, 14, 44, 641, 28101, 434, 346, 39, 3243, 273, 253, 378, 19493, 31069, 3, 313, 4609, 13, 10488, 1107, 3622, 13, 574, 417, 2568, 644, 9391, 11802, 281, 2471, 407, 7158, 279, 1346, 285, 11643, 5490, 582, 285, 1879, 303, 77, 434, 346, 29520, 23264, 449, 8256, 273, 841, 19654, 556, 2455, 644, 4439, 13, 533, 253, 28718, 670, 731, 1804, 326, 8799, 254, 3543, 253, 24701, 5130, 273, 11803, 12656, 13195, 689, 521, 9215, 27, 344, 4546, 731, 949, 4951, 285, 840, 14186, 731, 598, 275, 247, 3511, 1971, 15, 187, 187, 34, 8068, 12256, 7935, 4657, 2223, 2197, 247, 45729, 1963, 313, 21013, 3825, 273, 253, 2419, 10, 281, 8799, 254, 434, 8614, 2316, 672, 344, 369, 4882, 627, 15, 496, 253, 1355, 3038, 13, 344, 651, 298, 962, 247, 2316, 1020, 273, 12958, 342, 12435, 84, 13, 31540, 13, 285, 37834, 2224, 15, 2596, 4131, 13, 846, 1264, 3038, 273, 3440, 13, 401, 1832, 2206, 896, 285, 5125, 281, 521, 12958, 13, 346, 11778, 1529, 5253, 13, 285, 309, 1833, 1132, 368, 619, 7583, 5313, 449, 3032, 3858, 22770, 742, 3746, 285, 8799, 254, 10098, 715, 521, 7583, 12012, 5039, 504, 342, 3189, 449, 187, 187, 1552, 369, 1633, 326, 2210, 562, 273, 253, 1077, 18440, 273, 7195, 17025, 8799, 254, 15, 733, 369, 629, 273, 253, 11440, 1941, 273, 253, 14779, 3282, 273, 2957, 326, 344, 3543, 672, 521, 3101, 4962, 15, 754, 574, 644, 25279, 387, 253, 673, 15, 2006, 4115, 19989, 3592, 8799, 254, 4546, 253, 18542, 285, 253, 1963, 285, 13, 273, 253, 13365, 2151, 326, 703, 17564, 13, 7195, 13, 617, 25423, 3347, 13, 369, 617, 7583, 15, 4058, 2471, 369, 247, 6966, 432, 534, 8799, 254, 1620, 1663, 12372, 15, 35775, 1078, 521, 1211, 2471, 387, 253, 30394, 358, 314, 2363, 273, 10488, 14, 27248, 13, 344, 9924, 247, 40641, 534, 346, 28235, 11898, 521, 7765, 937, 2556, 281, 521, 1390, 7205, 13, 3619, 20799, 413, 1615, 15, 754, 1925, 352, 346, 7161, 14026, 2752, 12273, 443, 531, 865, 187, 187, 3, 18431, 24591, 342, 1027, 14505, 497, 3542, 937, 20799, 413, 1615, 31562, 13, 346, 2858, 5293, 497, 7607, 407, 6270, 15, 8256, 10048, 779, 4543, 18212, 4469, 253, 44089, 273, 326, 40641, 449, 187, 187, 1552, 44089, 23321, 8799, 254, 323, 253, 2120, 6818, 14, 13524, 1107, 326, 344, 369, 4336, 247, 629, 273, 253, 1533, 273, 3440, 15, 733, 3977, 779, 13, 1892, 327, 253, 25296, 273, 521, 3101, 434, 2471, 13, 281, 271, 1607, 292, 3472, 7875, 281, 47320, 23676, 1962, 1440, 15, 733, 4541, 1119, 2122, 285, 1669, 779, 342, 271, 440, 1946, 5542, 273, 355, 5632, 19408, 534, 13, 387, 581, 1127, 13, 17735, 779, 275, 12907, 15, 1292, 352, 369, 521, 3101, 434, 2471, 13, 1512, 13, 326, 3977, 281, 521, 1524, 13032, 715, 253, 3440, 1533, 273, 3972, 5616, 15, 187, 187, 1328, 369, 5686, 2552, 3127, 13, 40253, 13, 715, 247, 11617, 7231, 2021, 15, 3032, 3392, 13, 12824, 8799, 254, 13, 9843, 273, 253, 3506, 656, 7432, 757, 30021, 6412, 13, 3261, 327, 24455, 347, 346, 30911, 432, 253, 22144, 434, 22586, 449, 1292, 2872, 6270, 3735, 7835, 3551, 562, 273, 253, 894, 1032, 273, 3972, 5616, 326, 48515, 779, 15, 329, 4864, 1611, 387, 7473, 18542, 9775, 574, 1652, 1055, 327, 779, 15, 754, 10256, 2994, 285, 4541, 12103, 247, 12681, 347, 247, 12256, 42493, 387, 367, 15, 52, 15, 11289, 15, 14772, 275, 1495, 344, 7117, 521, 288, 19074, 447, 347, 346, 30911, 13, 3440, 13, 3440, 285, 625, 3440, 449, 2896, 840, 344, 574, 671, 9288, 490, 2821, 6284, 275, 2739, 285, 26375, 13, 533, 275, 521, 2143, 1897, 436, 16485, 651, 452, 644, 12054, 7899, 15, 187, 187, 3039, 344, 369, 25963, 344, 11719, 28384, 264, 521, 1039, 715, 253, 15915, 19670, 13, 247, 6440, 2419, 13, 285, 11750, 1070, 521, 1039, 1066, 281, 247, 2914, 14, 736, 7319, 987, 275, 896, 273, 7057, 478, 466, 29655, 968, 13, 665, 4546, 18542, 323, 253, 11561, 6590, 15, 1500, 1339, 779, 14518, 762, 253, 27188, 8087, 285, 327, 281, 253, 18542, 32217, 12200, 617, 285, 13 ]
Hawk ignored her, she proceeded to bring her opinions out into the open, saying that _her_ man (and I figured at that time that she meant "her man" in more than one sense*) was the only tenor saxophone in the world, the one and only Pres, Lester Young, and it really wasn't any use for any tired old man to try and blow against her President. Hawk took Lady Day's caustic remarks as a big joke, but apparently he'd previously decided that this was the night to make his move. Up to the last minute, the old fox played it cool, waiting until Billie's juice told her it was time for her to sing some blues. Then, he slipped out, returning with his saxophone, and started to accompany Billie's blues, softly. Billie, hearing his sound, looked up, startled, and then motioned to Pres as if to say, "Take charge." So Lester began blowing the blues, and to give credit where credit is due, he really _played_ the blues that night, chorus after chorus, until finally Hawk burst in on the end of one of his choruses, cascading a harmonic interruption, not unlike Mount Vesuvius erupting, virtually overpowering Lester's more haunting approach. When Hawk finished off the blues, soaring, searing, and lifting the entire house with his guttural, positive sonority, every tub began cheering, with the exception of Lady Day, Lester, and her pet boxer, Mister. They, like the Arabs, folded their tents and stole away. *According to several associates, and Lester Young himself, Rex—and others who figured the same—figured wrong. # THOMAS "FATS" WALLER # # JOHN S. WILSON _Also from Shapiro and Hentoff's The Jazz Makers, this appreciation, by the critic and broadcaster John Wilson, of the beloved composer / pianist whose happy music and happy nature continue to charm more than fifty years after his early death, in 1943_. Both Fats Waller and his principal tutor, James P. Johnson, lived lives of aching frustration. Johnson ached openly because he could find no audience for his serious compositions, but Waller's desire to find acceptance as a serious musician was buried under a heavy coating of pervasive geniality. And while Johnson plodded steadily downhill in puzzled despair, Waller's blithely ironical attitude carried him up and up and up in the material world—eventually to a level that even his enormous energy could not cope with. He was one of the most massively talented men who has ever turned up in the world of popular music—an inimitable entertainer whose charm has, if anything, grown in the nostalgic decade and a half since his death; the writer of some of the great evergreen songs in the popular repertoire ("Honeysuckle Rose," "Ain't Misbehavin' "); a jazz pianist whose playing was a landmark in the development of that instrument and whose influence on pre-bop pianists was surpassed only by that of Earl Hines; and a section man who could swing an entire band as no one else could. All of these gifts were his and yet, like the inevitable clown who wants to play Hamlet, he had a consuming desire to bring to the public his love of classical music and of the organ. His need to offer this gift and have it accepted was almost childlike and, childlike, the hurt when it was rejected was deep and long. Gene Sedric, the saxophonist and clarinetist in Fats's little band from 1938 to 1943, remembers times when Waller was so full of his feeling for serious music that he couldn't help playing, even in a nightclub, with all the musicality of which he was capable. But this wasn't the Fats that the customers had paid to hear. "People in the audience would think he was lying down," Sedric says. "They'd yell, 'Come on, Fats!' He'd take a swig of gin or something and say resignedly, 'Aw right, here it is.' " And he'd plod into some tawdry trifle from Tin Pan Alley. Waller's serious ambitions were all entwined with his love of the organ. The Chicago critic, Ashton Stevens, once observed perceptively that "the organ is the instrument of his heart, the piano of his stomach." Fats had an organ in his apartment in New York and, later, in his house at St. Albans, L.I. Wherever he went, he sought out opportunities to play the organ. In Paris, in 1932, on an otherwise rambunctious trip with songwriter Spencer Williams, he climbed up to the organ loft of the Cathedral of Notre Dame with Marcel Dupré, the cathedral's organist. His report on what happened there was typically Wallerian: "First Mr. Dupré played the God-box and then I played the God-box." When he was working in the film _Stormy Weather_ in 1943, shortly before his death, he found an organ on the set. He sat down to play and for three hours production was held up as the entire company listened entranced. One of his few opportunities to play the organ for a wide audience, and to play as he wanted to play, came during a year he spent on the staff of WLW in Cincinnati in the early thirties. He had an enormously successful late night program there, _Fats Waller's Rhythm Club_ , on which he sang and clowned and played the driving stride piano that was his specialty. And then, a couple of hours later, in the early hours of the morning, the station offered a program of quiet, peaceful organ music. The organist never received any billing. It was Fats Waller, playing with a full contentment that rarely came to him. There must have been something of the same contentment for him on a day in 1927 when he sat down at a pipe organ in Victor's Camden studios and recorded two fugues by Bach (who ran third in Fats's book as the greatest man in history—Lincoln and Franklin D. Roosevelt were first and second), Moszkowski's "Spanish Dance No. 1," Liszt's "Liebestraum," Rimsky-Korsakov's "Flight of the Bumble Bee" (which, thirty years ago, had not yet been galloped to death by accordionists and Harry James), and Friml's "Spanish Days." None of these recordings has ever been released, but the rumors about them suggest that Waller felt the stern eye of studio expectations burning over his shoulder: he played them through straight and then dressed them up in a hot treatment. A Chicago musical instrument store often sent a Hammond organ (compliments of the house) to Waller's hotel room when he was playing there. In the small hours, he would lull a roomful of guests with spirituals, Bach, and hymns. One morning, after three hours of music, Fats sat back and suggested to his guests, "Have another glass, and I'll play you my favorite piece." His friends refreshed themselves and Waller launched into his favorite—"Abide with Me." This was something that came out of the very marrow of Thomas Wright Waller. It was part of the continuing evidence of the enormous sense of loss that he felt when his mother died. He had been sixteen at the time. Adeline Lockett Waller played the piano and the organ and, of the dozen children that she bore, Thomas, her youngest son, was her favorite. Her death was a shock from which Waller never really recovered. Shortly before his own death at the unseemly age of thirty-nine, he composed a melody which "really shook his soul," according to his last manager, Ed Kirkeby. He called it "Where Has My Mother Gone?" "Several lyrics with different titles were written," Kirkeby recalls, "but none were accepted by Tom. None satisfied him nor adequately expressed the anguish of that melody." This anguish pursued Waller for the full twenty-three years that he was completely a part of the world of music. It led him, hard on the heels of his mother's death, to an impetuous marriage to Edith Hatchett. It quickly foundered and left him with an unending stream of alimony troubles which, at one point, landed him in jail. But it was his mother's death, too, that led to his real entrance into the music world of Harlem. He was born May 21, 1904, into a deeply religious family. His father, Edward Waller, minister of the Abyssinian Baptist Church, looked on jazz as "music from the devil's workshop." But young Tom heard sounds coming out of the cellars of Harlem that intrigued him. A brief try at formal piano instruction had little effect on him. He taught himself and quickly gained a reputation as a musical clown at P.S. 89. Later in life he listed his hobbies as "music, music, music and more music." By then he had also acquired abiding interests in food and liquor, but in his school days this listing would have been reasonably accurate. When he was fourteen he regularly wormed his way into the Lincoln Theatre, a movie house, and battled his way down to a front-row seat right in back of Maizie Mullins, who played piano for the silent films. She let him slide under the brass rail and on to the piano stool beside her and,
[ 329, 15, 7544, 13, 1157, 40959, 13, 21669, 187, 187, 13, 329, 904, 544, 37, 457, 38, 3373, 1306, 3455, 329, 904, 544, 8478, 304, 864, 6811, 3455, 401, 904, 708, 544, 6116, 4635, 3455, 322, 15, 5403, 13, 1157, 818, 2597, 187, 187, 13, 353, 15, 575, 45, 15, 8065, 13, 1157, 5540, 13, 35543, 187, 187, 13, 329, 15, 575, 56, 904, 544, 2906, 45459, 3455, 427, 904, 544, 22795, 6481, 3455, 353, 904, 708, 544, 53, 311, 296, 899, 3455, 444, 15, 5403, 13, 1157, 37728, 13, 818, 1010, 187, 187, 13, 330, 15, 575, 39, 904, 708, 544, 48, 32182, 6426, 3455, 500, 15, 575, 49, 15, 14960, 13, 1157, 26578, 13, 20995, 187, 187, 13, 500, 15, 575, 39, 904, 544, 39, 445, 76, 3455, 330, 15, 575, 52, 904, 708, 544, 17185, 3455, 322, 15, 575, 37, 15, 575, 46, 15, 8210, 13, 1157, 35302, 13, 43476, 187, 187, 13, 401, 15, 575, 42, 904, 544, 6148, 1784, 27766, 71, 3455, 367, 15, 575, 49, 904, 708, 544, 42, 33144, 3455, 657, 15, 6157, 13, 1157, 38429, 13, 7288, 187, 187, 13, 330, 15, 575, 46, 904, 544, 32227, 682, 3455, 353, 904, 708, 544, 14749, 47019, 3455, 500, 15, 575, 39, 15, 8441, 13, 1157, 29117, 13, 12446, 187, 187, 13, 500, 15, 575, 42, 904, 544, 49, 834, 5282, 3455, 329, 15, 575, 49, 904, 708, 544, 55, 928, 3455, 353, 15, 5403, 13, 1157, 854, 1797, 187, 187, 13, 322, 904, 544, 9547, 442, 37873, 3455, 401, 904, 708, 544, 37, 457, 38, 3373, 1306, 3455, 329, 15, 6585, 13, 1157, 31619, 13, 14212, 187, 187, 13, 418, 904, 544, 9494, 69, 3455, 444, 15, 575, 55, 904, 544, 49340, 13890, 3455, 443, 904, 708, 544, 49320, 26534, 3455, 309, 15, 6157, 13, 6700, 23297, 14804, 33962, 1464, 22042, 11168, 3737, 9890, 66, 13, 6879, 13, 9199, 187, 187, 13, 444, 904, 544, 39, 1000, 4595, 3455, 329, 904, 708, 544, 34752, 40030, 3455, 308, 15, 5307, 13, 1157, 46443, 13, 418, 883, 187, 187, 13, 444, 904, 544, 1044, 16468, 3455, 416, 15, 575, 43, 904, 708, 544, 43254, 3455, 353, 15, 6585, 13, 1157, 47919, 13, 46436, 187, 187, 13, 444, 15, 575, 37, 15, 5826, 13, 1457, 45979, 8439, 13, 7584, 13, 42955, 187, 187, 13, 444, 15, 575, 37, 904, 544, 53, 311, 296, 899, 3455, 444, 904, 544, 48592, 3455, 329, 15, 575, 34, 904, 544, 37, 41178, 3455, 329, 15, 575, 38, 904, 544, 52, 19369, 3455, 329, 904, 544, 31266, 41710, 3455, 500, 15, 575, 52, 904, 544, 37, 1368, 78, 14, 16281, 961, 3455, 416, 15, 575, 36, 904, 708, 544, 46, 366, 80, 3455, 353, 15, 6469, 13, 1157, 608, 4196, 13, 30135, 187, 187, 13, 308, 15, 575, 34, 904, 544, 998, 1507, 251, 3455, 367, 15, 575, 35, 904, 544, 41, 405, 254, 3455, 500, 15, 575, 38, 904, 708, 544, 55, 395, 25210, 3455, 399, 15, 575, 34, 15, 8441, 13, 275, 27548, 11204, 15, 4165, 15, 10508, 27, 4325, 25196, 281, 7667, 991, 447, 27, 253, 29930, 273, 659, 8739, 17709, 327, 20970, 27452, 13, 1407, 15, 330, 15, 575, 60, 4015, 262, 1568, 83, 3455, 530, 15, 575, 60, 39, 902, 2721, 14, 29997, 14, 2422, 14941, 282, 7564, 3455, 708, 500, 15, 575, 60, 41, 976, 376, 3455, 33141, 1253, 12, 187, 187, 13, 367, 15, 575, 35, 904, 544, 41, 405, 254, 3455, 500, 15, 575, 38, 904, 708, 544, 52, 1405, 13692, 14, 41, 1351, 3455, 308, 15, 575, 34, 15, 8065, 13, 1157, 9199, 13, 44504, 187, 187, 13, 443, 904, 544, 52, 678, 3455, 329, 904, 544, 44, 16859, 3455, 427, 904, 544, 56, 6594, 2205, 3455, 500, 904, 544, 47795, 4611, 3455, 401, 904, 708, 544, 3864, 2966, 3455, 308, 15, 5403, 13, 7846, 287, 14, 545, 16, 24341, 1508, 1235, 187, 187, 13, 444, 904, 544, 31266, 41710, 3455, 500, 15, 575, 52, 904, 544, 48592, 3455, 329, 15, 575, 34, 904, 544, 24721, 25740, 3455, 500, 15, 575, 40, 904, 544, 52, 19369, 3455, 329, 904, 544, 37, 1368, 78, 14, 16281, 961, 3455, 416, 15, 575, 36, 904, 544, 15992, 408, 1342, 3455, 444, 15, 575, 37, 904, 544, 46, 366, 80, 3455, 353, 904, 708, 544, 41, 321, 2205, 14, 44, 7707, 3455, 399, 15, 8065, 13, 1157, 12472, 13, 1249, 2031, 187, 187, 13, 399, 15, 575, 34, 904, 708, 544, 48563, 1373, 3455, 443, 15, 575, 43, 15, 8441, 13, 1157, 13062, 13, 39515, 187, 187, 13, 500, 15, 575, 56, 904, 544, 998, 11391, 3455, 500, 904, 708, 544, 3864, 2966, 3455, 308, 15, 6157, 13, 1457, 45979, 13, 898, 13, 14509, 187, 187, 13, 399, 15, 575, 51, 904, 544, 15992, 408, 1342, 3455, 444, 15, 575, 37, 904, 544, 29140, 3455, 418, 15, 575, 46, 904, 708, 544, 37, 41178, 3455, 329, 15, 575, 38, 15, 5215, 13, 275, 3765, 187, 187, 13, 329, 15, 575, 34, 15, 5826, 13, 23011, 22857, 13, 2499, 273, 5041, 13, 1986, 2077, 1108, 5041, 187, 187, 13, 418, 15, 575, 46, 904, 544, 15992, 408, 1342, 3455, 444, 15, 575, 37, 904, 544, 1231, 261, 91, 3455, 399, 15, 575, 51, 904, 708, 544, 37, 41178, 3455, 329, 15, 575, 38, 15, 5215, 13, 1157, 721, 3046, 13, 36438, 187, 46, 3681, 3756, 5731, 15, 187, 510, 5728, 941, 921, 326, 253, 6867, 9856, 11783, 25895, 310, 5343, 13, 6931, 1107, 1711, 13, 4817, 253, 6647, 4708, 11783, 3756, 1174, 327, 617, 806, 3177, 13, 369, 10166, 327, 253, 2628, 13, 574, 1679, 685, 2620, 1107, 273, 2793, 275, 11783, 3756, 387, 253, 673, 703, 2335, 253, 8368, 13, 17923, 625, 685, 1384, 11783, 5576, 34666, 591, 2129, 13, 556, 13640, 275, 247, 11783, 3756, 14, 6160, 44588, 1561, 253, 2469, 807, 13, 285, 2987, 387, 271, 329, 1311, 14, 3649, 28286, 11783, 3756, 9509, 15, 831, 1491, 310, 4158, 281, 3812, 247, 5406, 273, 253, 6867, 11783, 25895, 13, 417, 281, 5100, 667, 1511, 273, 2629, 32696, 323, 11570, 665, 1347, 11783, 3756, 15, 1310, 368, 452, 2173, 3533, 670, 11783, 3756, 6167, 9231, 326, 497, 417, 9577, 407, 436, 3929, 13, 4496, 3630, 281, 253, 6647, 4708, 15, 56, 38815, 1905, 496, 253, 9693, 14, 12879, 1728, 273, 247, 20193, 4675, 9165, 581, 7814, 7237, 436, 1770, 13, 3918, 6729, 29115, 432, 521, 7312, 4544, 48733, 6519, 285, 5907, 271, 8813, 347, 281, 2139, 10823, 497, 16907, 2509, 594, 15225, 436, 6132, 2952, 15, 657, 302, 398, 13, 344, 753, 13, 816, 6403, 457, 85, 4680, 4951, 15, 187, 187, 1628, 7834, 273, 253, 1921, 326, 776, 8672, 3133, 594, 10458, 987, 1024, 13, 285, 5441, 285, 5859, 285, 4154, 1057, 417, 1646, 281, 320, 9880, 253, 1388, 512, 253, 673, 13, 310, 984, 359, 457, 250, 1892, 14, 88, 1250, 417, 281, 1900, 1158, 4518, 672, 359, 457, 250, 16060, 1806, 344, 2183, 247, 2316, 1020, 273, 11576, 665, 448, 6390, 275, 387, 1878, 370, 1010, 13, 1518, 1016, 281, 9922, 33374, 398, 15, 773, 1898, 253, 2586, 310, 16060, 13, 285, 597, 452, 1175, 1921, 281, 320, 1425, 187, 187, 510, 10732, 326, 11163, 651, 12009, 10823, 760, 984, 597, 1053, 457, 85, 2096, 253, 5441, 20588, 247, 3790, 273, 761, 3428, 7097, 1905, 773, 39302, 253, 3802, 706, 1806, 1239, 253, 30062, 327, 247, 5041, 5779, 5084, 407, 6277, 443, 3796, 13, 253, 3438, 6519, 16360, 323, 3918, 6086, 411, 15, 11301, 1905, 285, 45511, 253, 6944, 4154, 273, 253, 4544, 326, 7637, 7948, 15, 1198, 512, 253, 5955, 273, 1786, 1557, 285, 9100, 285, 7375, 13, 387, 253, 5161, 273, 253, 5674, 457, 84, 8881, 436, 2965, 556, 644, 253, 6680, 273, 1045, 31367, 15, 187, 187, 7710, 15, 6729, 457, 84, 7579, 326, 25986, 7237, 4546, 715, 247, 13071, 15127, 407, 521, 17139, 326, 344, 310, 247, 17330, 14, 45093, 3041, 10723, 1045, 262, 382, 665, 310, 2119, 326, 344, 6057, 1682, 285, 11121, 326, 1110, 665, 14936, 816, 6403, 457, 85, 275, 616, 987, 13846, 15, 9018, 2564, 326, 2305, 15, 6729, 369, 5439, 275, 1679, 385, 36545, 5989, 407, 247, 2014, 3101, 665, 344, 753, 2378, 3058, 2739, 37946, 15, 2207, 326, 3738, 344, 2427, 281, 3055, 2143, 13, 344, 2335, 1107, 281, 2075, 745, 521, 6831, 15407, 15, 18190, 670, 2305, 15, 6729, 457, 84, 16562, 7162, 556, 1160, 779, 715, 247, 9484, 273, 1633, 344, 1620, 908, 281, 320, 15, 34, 4297, 284, 18056, 284, 473, 6357, 23748, 8221, 47019, 187, 187, 34, 4297, 284, 18056, 284, 473, 6357, 23748, 8221, 47019, 313, 6448, 4162, 3495, 13, 19949, 10, 369, 253, 806, 10692, 273, 44509, 27356, 15, 42535, 284, 18056, 284, 13, 617, 4021, 1677, 1416, 13, 2097, 346, 73, 10270, 12685, 3, 275, 9883, 15, 187, 187, 9709, 5896, 285, 806, 10692, 187, 48, 6357, 23748, 8221, 47019, 369, 253, 4475, 273, 3438, 3918, 19580, 15916, 6984, 1822, 13, 45906, 779, 672, 344, 369, 2168, 3918, 275, 4437, 6752, 846, 4804, 779, 1309, 247, 374, 14, 2913, 47467, 2444, 275, 253, 9883, 34202, 275, 308, 909, 1028, 304, 267, 4904, 15, 1500, 2959, 8746, 9883, 14, 41, 857, 22017, 24588, 275, 6157, 15, 4058, 7875, 281, 6984, 1822, 7402, 275, 17038, 275, 5403, 347, 6984, 1822, 434, 1307, 275, 3906, 2210, 281, 247, 2810, 15, 187, 187, 32197, 342, 285, 16253, 273, 2151, 187, 688, 4247, 6469, 13, 42535, 284, 18056, 284, 11580, 3599, 45998, 274, 372, 15753, 23511, 444, 29506, 275, 5003, 33414, 322, 3627, 13, 2112, 342, 2067, 23289, 273, 9883, 18674, 6498, 29492, 275, 326, 2846, 15, 50276, 3726, 497, 11525, 281, 7164, 11891, 323, 253, 390, 545, 507, 5780, 275, 1142, 33260, 1131, 347, 247, 906, 273, 34473, 39003, 13, 534, 574, 43287, 44509, 27356, 275, 8065, 15, 187, 187, 2993, 17734, 8671, 767, 2151, 13, 533, 703, 1024, 556, 2145, 2151, 275, 617, 1557, 13, 512, 273, 5207, 11704, 617, 281, 12951, 274, 45877, 327, 4247, 3435, 13, 5403, 13, 253, 1388, 703, 25368, 1146, 806, 10692, 15, 1500, 4307, 627, 342, 12951, 274, 356, 9041, 2151, 275, 878, 13, 285, 6518, 253, 4475, 273, 12951, 274, 45877, 434, 840, 3918, 13, 3035, 40428, 378, 6836, 23511, 15, 380, 2620, 2151, 17734, 8671, 403, 1925, 2070, 36706, 5332, 4115, 13, 15273, 18559, 86, 860, 13, 7980, 13, 29778, 285, 37641, 15, 187, 187, 1909, 806, 10692, 273, 44509, 27356, 703, 369, 3782, 1929, 323, 617, 789, 342, 5720, 2151, 285, 13975, 12907, 13239, 15, 1500, 3562, 247, 2086, 13, 346, 36, 2771, 15753, 23511, 546, 4358, 9368, 265, 995, 534, 310, 48526, 4404, 23703, 2151, 2444, 275, 44509, 27356, 8, 10198, 15, 831, 2086, 556, 644, 18270, 23159, 407, 617, 5938, 434, 3569, 18062, 15, 473, 6357, 23748, 8221, 47019, 7788, 8615, 323, 2151, 434, 3570, 13, 407, 1850, 28590, 247, 530, 15, 52, 8634, 3169, 19156, 326, 369, 14163, 3206, 275, 253, 10156, 273, 5283, 422, 2151, 407, 970, 253, 8573, 281, 42620, 13893, 8548, 15, 187, 187, 4941, 187, 187, 7504, 4859, 187, 21166, 327, 42535, 284, 18056, 284, 473, 6357, 23748, 8221, 47019, 313, 249, 9883, 10, 187, 50023, 273, 3599, 45998, 274, 372, 15753, 23511, 372, 444, 29506, 275, 5003, 33414, 322, 3627, 187, 187, 1413, 27, 30488, 10782, 187, 1413, 27, 14316, 952, 187, 1413, 27, 8836, 432, 657, 3604, 1448, 3262, 30277, 371, 43365, 187, 1413, 27, 6407, 47721, 273, 44509, 27356, 187, 1413, 27, 29520, 2255, 275, 8672, 60, 2513, 17888, 273, 329, 15, 5006, 69, 2886, 432, 253, 8825, 273, 253, 308, 324, 20122, 1479, 46414, 1570, 187, 510, 4477, 1246, 247, 7000, 5740, 273, 247, 23551, 7372, 273, 1876, 265, 1962, 5182, 5006, 69, 2886, 1500, 274, 13, 7011, 432, 247, 8825, 3410, 2797, 432, 253, 46247, 296, 15985, 275, 253, 21520, 273, 253, 1680, 17369, 1784, 413, 15079, 14593, 13, 253, 47858, 1479, 46414, 313, 783, 15448, 273, 253, 345, 301, 451, 285, 347, 4752, 1831, 280, 8661, 273, 253, 39565, 13, 697, 13424, 285, 19183, 2425, 285, 5661, 20192, 5755, 481, 5128, 327, 253, 6242, 273, 436, 47113, 5570, 347, 247, 35223, 13354, 442, 275, 253, 8825, 273, 2710, 49900, 403, 671, 1677, 15, 329, 6452, 369, 8392, 326, 329, 15, 5006, 69, 2886, 369, 271 ]
A. 1999, , 513, 142 , A., [D’Ercole]{}, A., [Brighenti]{}, F., & [Recchi]{}, S. 2006, , 787 , M. L. 1998, , 36, 435 , A. W., [Arimoto]{}, N., [Irwin]{}, M., & [Tolstoy]{}, E. 2006, , 373, 715 , C. F., & [Ostriker]{}, J. P. 1977, , 218, 148 , J. F., [Frenk]{}, C. S., & [White]{}, S. D. M. 1997, , 490, 493 , F. I., [van der Werf]{}, P. P., & [Icke]{}, V. 2004, , 422, 55 , C. M., [Villata]{}, M., & [Navarro]{}, J. F. 1996, , 315, 105 , J. I., [Pontzen]{}, A. P., & [Viel]{}, M. 2006, , 821 , S., [Matteucci]{}, F., & [D’Ercole]{}, A. 2001, , 322, 800 , L., [Held]{}, E. V., [Bertelli]{}, G., & [Saviane]{}, I. 2004, Memorie della Societa Astronomica Italiana, 75, 110 , E., [Ferrara]{}, A., & [Broadhurst]{}, T. 2000, , 536, L11 , E., [Thacker]{}, R. J., & [Davis]{}, M. 2001, , 557, 605 , E. D. 2005, New Astronomy Review, 49, 453 , E. D., [Tolstoy]{}, E., [Cole]{}, A. A., [Dolphin]{}, A. E., [Saha]{}, A., [Gallagher]{}, J. S., [Dohm-Palmer]{}, R. C., & [Mateo]{}, M. 2003, , 596, 253 , T. A., [Stetson]{}, P. B., [Hesser]{}, J. E., & [Vandenberg]{}, D. A. 1996, in ASP Conf. Ser. 98: From Stars to Galaxies: the Impact of Stellar Physics on Galaxy Evolution, ed. C. [Leitherer]{}, U. [Fritze-von-Alvensleben]{}, & J. [Huchra]{}, 328–+ , P. B., [Hesser]{}, J. E., & [Smecker-Hane]{}, T. A. 1998, , 110, 533 , G., [Seth]{}, A., [Katz]{}, N., [Wadsley]{}, J., [Governato]{}, F., & [Quinn]{}, T. 2006, astro-ph/0602350 , E., [Gallagher]{}, J. S., [Cole]{}, A. A., [Hoessel]{}, J. G., [Saha]{}, A., [Dohm-Palmer]{}, R. C., [Skillman]{}, E. D., [Mateo]{}, M., & [Hurley-Keller]{}, D. 1998, , 116, 1244 , D. A., & [Ferland]{}, G. J. 1996, , 103, 467 , J. W., [Stadel]{}, J., & [Quinn]{}, T. 2004, New Astronomy, 9, 137 , D. R., [Skillman]{}, E. D., [Young]{}, L. M., & [Dolphin]{}, A. E. 2007, in prep , A. A. 2005, PhD thesis, University of Washington, United States – Washington , L. M., [Skillman]{}, E. D., [Weisz]{}, D. R., & [Dolphin]{}, A. E. 2007, , 659, 331 Mammography update. The collected data show that the typical registered mammographer is female, 39 years old, passed the ARRT mammography exam on her first attempt, was trained on the job, had less than five years of experience in mammography at the time she took the examination, performs more than 20 mammographic exams per week, has participated in a mammography-specific seminar within the past year, and works at an ACR-accredited mammography facility. This information is designed to draw a picture of the typical mammographer, not to establish any type of standard qualifications for personnel who perform mammography. If you have specific questions about mammography registrants that were not answered by this article, please write to the ARRT.WASHINGTON — In the Boston-area home of a wealthy hospital executive one Saturday evening this month, President Obama departed from his usual campaign stump speech and offered an explanation as to why Democrats were seemingly doing so poorly this election season. Voters, he said, just aren’t thinking straight. “Part of the reason that our politics seems so tough right now, and facts and science and argument does not seem to be winning the day all the time, is because we’re hard-wired not to always think clearly when we’re scared,” he told a roomful of doctors who chipped in at least $15,200 each to Democratic coffers. “And the country is scared, and they have good reason to be.” The notion that voters would reject Democrats only because they don’t understand the facts prompted a round of recriminations — “Obama the snob,” read the headline on a Washington Post column by Michael Gerson, the former speechwriter for President George W. Bush — and fueled the underlying argument of the campaign that ends Tuesday. For all the discussion of health care and spending and jobs, at the core of the nation’s debate this fall has been the battle of elitism. Mr. Obama’s remark that autumn evening played into a perception promoted by his critics that he is a Harvard-educated millionaire elitist who is sure that he knows best and thinks that those who disagree just aren’t in their right minds. Never mind that Mr. Obama was raised in less exalted circumstances by a single mother who he said once needed food stamps. Or that although he went to private school, he took years to pay off his college loans. Something about Mr. Obama’s cerebral confidence has made him into a symbol of something he never used to be.Aguas Santas Ocaña Navarro Aguas Santas Ocaña Navarro (born April 23, 1963) was the first lady of Honduras. Aguas Santas, her double given name, means "holy waters" in Spanish. Marriage and first lady Ocaña Navarro was the wife of former President Ricardo Maduro, marrying him when he was already President in October 2002 after meeting him during a 2-year stint working in the Spanish embassy in Tegucigalpa. She received dual Spanish-Honduran citizenship in 2004. Her marriage to Maduro ended in divorce in 2006 as Maduro's term in office came to a close. Working with and adoption of children In January 2003, Aguas Santas visited El Hogar de Niños Emanuel in San Pedro Sula, along with several executives of Spanish corporations operating factories in that city. They were hoping to raise awareness for the orphans remaining in many orphanages as a result of Hurricane Mitch, which had devastated Honduras in 1998. She legally adopted two children, but she now has 13 children in her care, all of whom accompanied her to Nicaragua on January 27, 2006, the day she ceased being first lady. She worked there with Nicaraguan children in need, and helped the wife of Nicaragua's then President, Enrique Bolaños. The five children legally adopted are called Leidy Jackeline, Kevin Josué, Francis, Joan and Jackie. As first lady of Honduras she was particularly known for her work with Street children and visiting jailmates. She created a program, "Cero Niños en las Calles", which is geared towards eliminating children working in Honduras' streets. This program has been severely criticized by her husband's political opponents. Ocaña Navarro continues fighting for children's rights, by denouncing a U.S.-based organisation that was allegedly involved in the selling of adoptive children by using the internet to lure prospective clients. References External links Information on Aguas Santas Ocaña Navarro (in Spanish) Website of El Hogar de Niños de Emanuel in San Pedro Sula Category:1963 births Category:Living people Category:People from Vega del Guadalquivir Category:First Ladies of Honduras Category:Spanish women in politics[Isolation of A. boydii from the soil of the Tadzhik SSR]. The authors present a detailed description of a pathogenic strain of Allescheria boydii Shear, isolated from a soil sample obtained from the karst cave in the vicinity of the Iskan derkerev lake, the Tajik SSR (the morphology of the conidial and ascosporic stages of the fungus, its physiological and biochemical activity and experimental pathogenicity). Data on the existence of this causative agent as a saprophyte in the soil of various continents are also given. A conclusion was drawn that A. boydii was an
[ 274, 4213, 7263, 336, 250, 512, 8, 328, 1988, 80, 345, 826, 278, 571, 32, 2101, 561, 74, 826, 298, 6977, 15, 9823, 653, 11816, 571, 74, 299, 3641, 3731, 74, 247, 1339, 936, 345, 826, 4857, 66, 1073, 418, 8807, 299, 4164, 8753, 2110, 487, 287, 247, 4396, 321, 287, 1073, 427, 2610, 13, 458, 260, 583, 27060, 638, 9877, 583, 1161, 275, 24887, 33083, 3641, 22865, 6156, 1073, 247, 3764, 15, 187, 187, 37, 267, 23476, 29037, 12580, 710, 6156, 826, 298, 6977, 270, 757, 6357, 14804, 298, 9821, 15, 378, 22622, 74, 4164, 396, 6319, 72, 2072, 6319, 4658, 287, 1705, 2454, 5711, 17846, 442, 458, 396, 250, 13, 872, 2284, 247, 4172, 1851, 463, 250, 26644, 448, 11158, 410, 4274, 1306, 826, 4857, 66, 14804, 278, 571, 717, 3737, 15, 2652, 408, 580, 4692, 458, 15482, 1306, 13, 660, 695, 6319, 4635, 311, 2623, 4164, 246, 580, 13013, 13, 27246, 2623, 13738, 306, 4164, 594, 567, 35570, 13, 5398, 19020, 23105, 4329, 74, 298, 8, 8125, 417, 14077, 66, 299, 4164, 45048, 15, 308, 1575, 2284, 247, 2197, 2683, 74, 5111, 3093, 682, 49315, 4192, 21622, 1073, 7362, 770, 5650, 1073, 418, 8807, 13, 4204, 16399, 17090, 1161, 43278, 618, 365, 6156, 12733, 609, 299, 17908, 642, 13, 3641, 4927, 622, 1136, 10510, 80, 16439, 15715, 4635, 15, 444, 287, 11664, 547, 13, 5306, 80, 13, 1161, 43278, 269, 37554, 7349, 12931, 6513, 6319, 6156, 32239, 5303, 4019, 660, 86, 6836, 13, 5303, 4019, 891, 5135, 363, 14804, 48137, 302, 30692, 13, 6429, 572, 5021, 11664, 5033, 5991, 3641, 3816, 3620, 66, 847, 365, 8625, 12704, 2192, 293, 547, 15, 187, 187, 8816, 74, 2197, 2886, 21540, 1509, 74, 15, 657, 13535, 994, 376, 250, 275, 37610, 1758, 298, 8, 4894, 376, 1073, 9997, 6319, 376, 6319, 85, 410, 13, 9171, 8636, 13, 847, 45588, 8393, 74, 2902, 787, 86, 15, 9823, 45310, 2284, 823, 375, 601, 4164, 8472, 24069, 13013, 15, 1244, 17090, 355, 7692, 7795, 936, 13, 638, 339, 440, 43022, 2942, 250, 277, 8, 317, 46385, 13, 320, 87, 6319, 306, 15, 11726, 17090, 275, 268, 728, 74, 591, 4426, 1962, 1273, 80, 34843, 11924, 355, 22874, 395, 2610, 13, 803, 17090, 4164, 43022, 2942, 250, 13, 4927, 15039, 339, 2336, 601, 4164, 278, 900, 1339, 936, 15, 9823, 4927, 756, 37873, 17090, 1073, 4329, 80, 13, 345, 891, 305, 297, 15208, 622, 19613, 5946, 74, 18253, 270, 46332, 1448, 8472, 24069, 13013, 15, 187, 187, 12391, 15288, 594, 1161, 42185, 256, 306, 3129, 571, 6234, 15062, 15, 187, 187, 12391, 52, 12931, 25235, 187, 187, 12391, 11592, 16399, 17113, 609, 21267, 246, 5738, 717, 3737, 13, 1551, 66, 25235, 187, 187, 12391, 31673, 5086, 13, 419, 17542, 2331, 80, 1073, 479, 25235, 187, 187, 12391, 52, 20283, 17908, 1161, 8511, 17542, 2331, 80, 1073, 716, 6234, 15062, 13, 299, 4927, 3861, 3248, 13, 3641, 270, 26293, 17090, 256, 26171, 270, 406, 6357, 5303, 4019, 826, 1791, 463, 14852, 4019, 1448, 3036, 28482, 13, 256, 4635, 438, 423, 21206, 458, 5188, 4946, 345, 826, 20365, 66, 15, 187, 187, 17613, 2284, 4293, 4252, 15, 187, 187, 45, 4113, 660, 493, 17090, 622, 6736, 4164, 8472, 24069, 13013, 8753, 2338, 6575, 247, 270, 26293, 1513, 74, 345, 1095, 66, 13, 345, 1509, 6035, 13, 299, 3641, 260, 2269, 17090, 4164, 7590, 936, 345, 826, 637, 80, 13, 479, 2343, 756, 609, 4396, 17090, 256, 36144, 826, 4049, 29583, 15, 8081, 74, 3641, 4358, 5297, 17090, 13, 660, 3248, 1140, 458, 278, 466, 18814, 1257, 13, 3641, 638, 3899, 442, 323, 442, 1955, 277, 5741, 34715, 376, 458, 2873, 395, 460, 15, 8758, 5408, 74, 13, 1327, 704, 5297, 295, 25341, 13, 209, 2771, 387, 350, 902, 66, 4204, 24887, 48414, 12263, 13, 277, 455, 8, 38067, 250, 1161, 3641, 2454, 6156, 13, 26932, 12580, 584, 250, 1161, 246, 13077, 25183, 872, 41231, 15, 309, 402, 10986, 38393, 74, 3641, 5419, 463, 87, 4692, 4164, 5188, 9108, 2221, 74, 410, 13, 826, 20983, 20365, 66, 8685, 8864, 87, 4355, 15, 10283, 331, 3649, 17090, 49315, 278, 571, 270, 406, 6357, 18542, 13, 512, 834, 266, 17090, 826, 637, 80, 15, 187, 187, 12391, 37, 4998, 74, 24932, 16399, 2344, 5297, 13431, 5940, 270, 5021, 7222, 339, 1266, 74, 682, 17908, 299, 716, 256, 26171, 653, 74, 13046, 571, 6234, 15062, 440, 2963, 8, 687, 1940, 13, 7539, 6811, 362, 11816, 900, 14008, 936, 270, 1751, 299, 2343, 594, 1161, 32239, 11737, 425, 24821, 10986, 22602, 739, 17622, 247, 479, 15, 1325, 219, 2336, 80, 32, 25235, 187, 187, 11592, 5408, 74, 295, 25341, 15, 418, 4113, 3641, 42644, 1528, 17090, 1073, 8794, 19975, 458, 5188, 4946, 345, 458, 5188, 6319, 6319, 4946, 13, 278, 526, 263, 17090, 1081, 251, 266, 32567, 13, 4927, 1220, 20852, 17090, 299, 441, 68, 12931, 49315, 37610, 1758, 15, 26810, 8753, 2338, 2284, 247, 1327, 12910, 1189, 7373, 13, 1327, 594, 591, 41518, 28250, 15, 1023, 4482, 1751, 260, 2269, 515, 74, 1073, 512, 834, 266, 609, 826, 2288, 16170, 14804, 20983, 20365, 66, 13, 26027, 25457, 1557, 91, 2721, 13, 14804, 268, 1256, 70, 14804, 20983, 637, 80, 13, 1327, 16399, 4172, 19387, 6073, 15, 427, 2610, 41096, 6156, 1936, 14345, 1323, 4534, 1513, 74, 13, 618, 365, 6156, 1161, 256, 609, 49472, 2323, 80, 32, 1294, 6319, 87, 2284, 440, 7687, 900, 16656, 1866, 48316, 591, 5037, 4611, 322, 3298, 42466, 299, 24808, 80, 591, 479, 13, 591, 4164, 12580, 584, 250, 1161, 3641, 8685, 22083, 505, 80, 26644, 944, 5367, 15, 3545, 41518, 258, 1266, 74, 1290, 66, 3300, 4946, 250, 275, 332, 375, 303, 587, 13, 4204, 31434, 41096, 5711, 16407, 571, 1442, 80, 247, 572, 5021, 24932, 1327, 3641, 209, 2771, 24843, 941, 12580, 584, 250, 13, 1327, 2343, 345, 375, 336, 5711, 13, 2197, 2683, 29595, 823, 375, 601, 3641, 21791, 3456, 339, 15, 11726, 2284, 39814, 331, 15959, 803, 47504, 1327, 594, 591, 2677, 70, 29900, 15, 8081, 74, 13, 7374, 4335, 18205, 74, 13, 3641, 391, 2865, 1730, 74, 13, 7393, 2052, 9245, 17846, 442, 458, 278, 466, 260, 583, 13, 557, 453, 5297, 4164, 1339, 936, 13, 7362, 739, 74, 1955, 8132, 248, 1073, 5818, 5744, 74, 12263, 591, 427, 5021, 299, 479, 425, 285, 2284, 15, 187, 187, 45, 8, 261, 6836, 8685, 15539, 5303, 4019, 402, 12355, 13, 4164, 45048, 17043, 80, 13, 14088, 16439, 7687, 8885, 2827, 4692, 12934, 739, 23611, 15, 3327, 74, 13, 820, 74, 4211, 74, 523, 8657, 1161, 3641, 41096, 6156, 4358, 5297, 4611, 278, 571, 10279, 250, 27060, 1073, 440, 278, 3248, 24041, 13, 4164, 2248, 80, 37033, 7262, 936, 275, 629, 13166, 15, 2051, 6736, 4164, 11750, 6646, 4927, 15039, 339, 299, 298, 8, 261, 6836, 13, 820, 74, 402, 10986, 3295, 74, 3578, 25933, 1073, 2248, 80, 26714, 2610, 13, 15260, 490, 24785, 29847, 298, 834, 3230, 13, 17113, 2284, 1161, 41096, 6319, 5711, 2457, 12704, 4426, 4752, 66, 4204, 7393, 1987, 609, 247, 36707, 418, 8807, 1327, 1323, 21363, 1257, 1721, 14345, 1937, 263, 250, 3635, 66, 1073, 6945, 12436, 11780, 16407, 357, 587, 15, 7057, 396, 377, 74, 749, 7067, 1161, 4164, 24808, 80, 425, 74, 11449, 74, 1073, 322, 3298, 42466, 299, 4164, 9412, 250, 35504, 1161, 17908, 331, 15959, 3641, 2454, 5711, 3641, 1323, 21363, 589, 80, 20125, 7067, 1073, 1049, 42061, 270, 406, 6357, 15, 13160, 26797, 44807, 12187, 826, 24041, 1936, 893, 1161, 15733, 1940, 458, 22640, 591, 572, 5021, 4030, 275, 1595, 37036, 14804, 278, 571, 5809, 29847, 15, 187, 187, 817, 5540, 15, 187, 187, 53, 18540, 2284, 18593, 10424, 24956, 66, 275, 5940, 5086, 36155, 7961, 13, 557, 19397, 893, 1724, 5650, 15, 353, 571, 10279, 250, 13, 5303, 4019, 1185, 5940, 1220, 66, 1061, 6836, 591, 389, 8, 2771, 2017, 290, 682, 1108, 295, 25341, 49656, 13, 295, 3525, 1073, 7934, 1108, 3641, 22083, 856, 332, 17090, 591, 32716, 209, 2771, 15070, 682, 24041, 1448, 1404, 28697, 15, 187, 187, 12391, 6892, 419, 74, 4688, 936, 6234, 15062, 13, 7539, 6811, 42185, 48414, 682, 5086, 13, 298, 8, 312, 3737, 14804, 6429, 383, 376, 246, 8, 3227, 260, 42401, 682, 32, 25235, 187, 187, 1898, 17090, 7940, 9392, 345, 278, 900, 13229, 250, 13, 1161, 704, 336, 16439, 15715, 4635, 18205, 13535, 299, 3641, 4172, 21568, 12931, 1073, 25639, 74, 1140, 891, 4426, 74, 13, 4172, 8337, 14345, 1399, 80, 1936, 442, 13, 653, 280, 68, 2623, 27, 7539, 19008, 5860, 13, 1161, 270, 5021, 3036, 19702, 1161, 8511, 25235, 3277, 11780, 23105, 278, 44710, 1315, 255, 13890, 13, 557, 2152, 80, 345, 440, 5306, 80, 557, 3456, 35504, 27, 187, 187, 12391, 52, 16697, 363, 5940, 2297, 376, 25235, 187, 187, 24711, 7496, 2284, 512, 80, 946, 41380, 299, 11886, 8, 900, 3641, 4285, 580, 304, 19702, 74, 27, 4164, 7934, 3641, 41096, 6156, 501, 66, 1073, 440, 270, 279, 3088, 29428, 13589, 13, 6429, 4164, 1649, 80, 13, 458, 1308, 3649, 571, 13, 458, 18814, 1257, 2827, 4692, 1705, 12539, 565, 74, 277, 8, 12892, 660, 1822, 15, 7198, 32716, 209, 2771, 331, 682, 516, 6319, 16451, 66, 425, 74, 3295, 74, 1073, 1680, 348, 571, 13, 42722, 1140, 2344, 336, 19933, 68, 4513, 13, 826, 278, 571, 40800, 630, 16170, 3641, 8685, 3300, 1288, 682, 519, 909, 86, 682, 512, 8, 1369, 25341, 28, 258, 376, 13, 5940, 1936, 6319, 893, 1551, 262, 2338, 66, 355, 12417, 80, 1448, 391, 6035, 13, 38688, 258, 45524, 1649, 80, 13, 258, 45524, 3066, 2827, 4692, 22083, 41376, 1073, 440, 23915, 410, 4691, 4611, 13, 3641, 1061, 306, 299, 1828, 9321, 13, 15539, 440, 8, 266, 7838, 571, 15, 3905, 41171, 13, 458, 5796, 11105, 460, 13, 2343, 1213, 324, 531, 7137, 255, 739, 17622, 299, 877, 332, 26471, 13, 3641, 4962, 2771, 298, 8, 303, 10862, 70, 1073, 5940, 269, 4881, 4691, 21463, 682, 1705, 572, 4415, 21540, 305, 1528, 2110, 74, 15, 187, 187, 2946, 6736, 268, 1584, 74, 260, 641, 74, 247, 260, 2269, 609, 418, 8807, 15, 3905, 448, 16726, 2284, 26932, 7323, 587, 13, 4927, 2438, 42401, 17090, 13, 34505, 1028, 17090, 26932, 2245, 531, 15, 9823, 490, 1288, 42401, 17090, 13, 3641, 270, 26293, 17090, 13, 3641, 4172, 21568, 12931, 1073, 25639, 74, 1705, 1327, 41096, 6156, 24843, 4688, 936, 13, 30670, 1161, 269, 4113, 1140, 8625, 893, 4204, 17846, 936, 572, 437, 8, 2843, 42136, 7349, 12931, 1578, 1860, 7067, 15, 39233, 826, 331, 15959, 299, 246, 13077, 25183, 13, 275, 42592, 27060, 1073, 440, 278, 3248, 13, 8685, 12130, 9085, 12704, 31801, 74, 682, 15, 8758, 3300, 4946, 6319, 6156, 27060, 5940, 23603, 1370, 4019, 6429, 5940, 1053, 2072, 13, 5940, 1053, 2072, 1073, 355, 6319, 1405, 6319, 2369, 37266, 7173, 936, 2459, 74, 13, 1162, 5991, 1161, 512, 6464, 3641, 3300, 67, 3385, 66, 1323, 11670, 682, 15, 309, 21004, 4635, 490, 15208, 458, 331, 580, 4692, 7323, 74, 299, 7677, 6811, 13, 1705, 396, 16399, 269, 37554, 36098, 5297, 20938, 45078, 26644, 305, 9401, 1073, 2963, 4635, 1054, 32616, 13, 299, 458, 2876, 1173, 4692, 4164, 944, 5367, 27060, 1448, 458, 68, 7067, 15, 39233, 271, 5528, 66, 27060, 355, 893, 13, 41096, 6156, 653, 4781, 277, 902, 442, 13, 8685, 6868, 86, 6859, 15, 444, 4164, 1649, 80, 23915, 301, 739, 17622, 18253, 3007, 80, 256, 1519, 587, 3641, 1061, 306, 1073, 5940, 37619, 682, 13, 16656, 3467, 1464, 1112, 33383, 4019, 15, 187, 187, 29710, 2886, 1161, 8685, 8507, 6859, 13, 275, 1213, 2960, 4927, 7496, 17090, 540, 41530, 13, 7374, 653, 4781, 13, 27060, 1936, 442, 13, 6429, 1327, 3641, 4962, 70, 653, 25362, 37303, 15, 5201, 339, 14088, 27, 7539, 55, 1914, 74, 345, 479, 6234, 299, 1936, 282, 1161, 298, 8, 317, 3118, 1530, 515, 74, 21267, 3779, 360, 5169, 1073, 2951, 71, 4692, 15, 32516, 74, 328, 339, 13, 268, 5047, 423, 21206, 256, 1519, 706, 83, 3649, 900, 27, 7539, 127, 219, 5940, 40963, 1161, 803, 601, 19021, 14088, 345, 716, 13, 1821, 80, 5086, 1161, 42185, 15070, 682, 27, 17113, 41231, 1073, 513, 332, 29781, 3592, 609, 1442, 80, 247, 3414, 358, 3381, 25235, 187, 187, 11592, 41096, 87, 13431, 24843, 4688, 936, 24887, 591, 5528, 601, 2336, 601, 891, 15891, 472, 249, 21037, 820, 6319, 84, 12931, 7677, 442, 298, 8 ]
arlo torcere all'unisono con la mia? Spensi la luce. Mi spogliai e mi misi a letto con la lettera di Lila e il segnalibro azzurro di Nino, le cose più preziose che in quel momento mi pareva di avere. Dal finestrone pioveva la luce bianca della luna. Baciai il se­gna­libro come facevo tutte le sere, provai a rileggere nel chiarore debole la lettera della mia amica. Brillavano le pentole, scric­chiolava il tavolo, pesava greve il soffitto, premeva ai lati l'aria notturna e il mare. Tornai a sentirmi umiliata dalla capacità di scrittura di Lila, da ciò che lei sapeva plasmare e io no, mi si appannarono gli occhi. Ero felice, certo, che lei fosse così bra­va anche senza scuola, senza i libri della biblioteca, ma quella felicità mi rendeva colpevolmente infelice. Poi sentii dei passi. Vidi entrare in cucina l'ombra di Sar­ra­tore, scalzo, col suo pigiama blu. Mi tirai addosso il lenzuolo. Andò al rubinetto, prese un bicchiere d'acqua, bev­ve. Restò in piedi per qualche secondo davanti al lavandino, posò il bicchiere, si mosse verso il mio letto. Mi si accucciò di lato, con i gomiti appoggiati sul bordo del lenzuolo. «Lo so che sei sveglia» disse. «Sì». «Non ci pensare alla tua amica, resta». «Sta male, ha bisogno di me». «Sono io che ho bisogno di te» disse, e si protese, mi baciò sulla bocca senza la leggerezza del figlio, schiudendomi le labbra con la lingua. Restai immobile. Lui scostò appena il lenzuolo seguitando a baciarmi con cura, con passione, e mi cercò il petto con la mano, me lo accarezzò sotto la camicia. Poi mi lasciò, scese tra le mie gambe, mi premette forte due dita sopra le mutandine. Non dissi, non feci niente, ero atterrita da quel comportamento, dall'orrore che mi faceva, dal piacere che tuttavia provavo. I suoi baffi mi pungevano il labbro superiore, la sua lingua era ruvida. Si staccò dalla mia bocca piano, allontanò la mano. «Domani sera ci facciamo una bella passeggiata io e te sulla spiaggia» disse un po' roco, «ti voglio molto bene e lo so che anche tu ne vuoi tantissimo a me. È vero?». Non dissi niente. Lui mi sfiorò di nuovo le labbra con le lab­­bra, mormorò buonanotte, si sollevò e uscì dalla cucina. Io seguitai a non muovermi, non so per quanto tempo. Sebbene cercassi di allontanare la sensazione della sua lingua, delle sue carezze, della pressione della sua mano, non ci riuscivo. Nino aveva voluto avvisarmi, sapeva che sarebbe successo? Pro­vai un odio incontenibile per Donato Sarratore e disgusto per me, per il piacere che mi era rimasto nel corpo. Per quanto oggi possa sembrare inverosimile, da quando avevo memoria fino a quella sera non mi ero mai data piacere, non lo conoscevo, sentirmelo addosso mi sorprese. Restai nella stessa posizione non so per quante ore. Poi, alle prime luci, mi riscossi, raccolsi tutte le mie cose, disfeci il letto, scrissi due righe di ringraziamento per Nella e me ne andai. L'isola era quasi senza suoni, il mare fermo, solo gli odori erano intensissimi. Presi, coi soldi contati che mi aveva lasciato mia madre più di un mese prima, il primo vaporetto in partenza. Appena il battello si mosse e l'isola, coi suoi colori teneri di primo mattino, fu abbastanza lontana, pensai che ave­vo finalmente qualcosa da raccontare a cui Lila non avrebbe potuto opporre nulla di altrettanto memorabile. Ma seppi subito che il disgusto nei confronti di Sarratore e il ribrezzo che io stessa mi facevo mi avrebbero impedito di aprir bocca. Infatti questa è la prima volta che cerco le parole per quella fine inattesa della mia vacanza. ## 36. Trovai Napoli immersa in una maleodorante, disfatta calura. Mia madre, senza dire una sola parola per com'ero diventata – niente acne, nera di sole – mi rimproverò perché ero tornata prima del previsto. «Che hai fatto» disse, «ti sei comportata male, l'amica della maestra t'ha cacciata?». Andò diversamente con mio padre, che fece gli occhi lucidi e mi riempì di complimenti tra i quali, ripetuto cento volte, spiccava: «Madonna, che bella figlia che ho». Quanto ai miei fratelli, dissero con un certo disprezzo: «Sembri una negra». Mi guardai allo specchio e anch'io mi meravigliai: il sole mi aveva resa di un biondo splendente, ma il viso, le braccia, le gambe erano come dipinti d'oro scuro. Finché ero stata im­mersa nei colori di Ischia, sempre tra facce bruciate, la mia trasformazione mi era sembrata adeguata all'ambiente; ora, una vol­ta restituita al contesto del rione, dove ogni viso, ogni via erano rimasti di un pallore malato, mi parve eccessiva, quasi un'anomalia. La gente, le palazzine, lo stradone trafficatissimo e polveroso, mi diedero l'impressione di una foto mal stampata come quelle dei giornali. Appena potei corsi a cercare Lila. La chiamai dal cortile, si affacciò, sbucò dal portone. Mi abbracciò, mi baciò, mi riempì di complimenti come non aveva mai fatto, tanto che fui travolta da tutto quell'affetto così esplicito. Era la stessa e tuttavia, in poco più di un mese, era ulteriormente cambiata. Non sembra­va più una ragazza ma una donna, una donna di al­me­no diciotto anni, età che allora mi sembrava avanzata. I vecchi abiti le stavano corti e stretti, come se ci fosse cresciuta dentro nel giro di pochi minuti, e le stringevano il corpo più del lecito. Era ancora più alta, aveva spalle dritte, era sinuosa. E il viso pallidissimo sul collo sottile mi parve di una delicata, inconsueta bellezza. Sentii che era nervosa, in strada si guardò intorno, alle spalle, più volte, ma non mi diede spiegazioni. Disse solo: «Vieni con me» e volle che l'accompagnassi alla salumeria di Stefano. Aggiunse, prendendomi sottobraccio: «È una cosa che posso fare solo con te, meno male che sei tornata: pensavo di dover aspettare fino a settembre». Non avevamo mai fatto quel percorso verso i giardinetti co­sì strette l'
[ 3874, 764, 770, 11155, 285, 1740, 30679, 1016, 281, 253, 14184, 15757, 281, 396, 23215, 11873, 12016, 3144, 281, 253, 2418, 330, 8, 251, 2254, 29983, 13, 253, 3928, 15757, 285, 253, 1284, 6017, 23215, 270, 314, 15757, 15, 380, 21250, 13, 534, 369, 253, 6253, 275, 253, 2892, 273, 2235, 23215, 278, 552, 12225, 275, 436, 1073, 255, 1467, 13, 369, 8120, 264, 632, 90, 247, 9950, 1652, 3819, 7954, 11, 3874, 4514, 442, 11155, 875, 253, 819, 1641, 14, 994, 35315, 13, 8444, 388, 15, 17410, 13, 285, 2516, 2006, 293, 273, 11590, 3062, 15, 187, 7910, 4289, 285, 14327, 14, 531, 13008, 359, 47, 3, 5248, 964, 249, 253, 1315, 333, 13, 273, 534, 2305, 15, 2006, 293, 4763, 391, 15, 1157, 13, 26218, 1157, 1227, 5817, 187, 1945, 264, 326, 247, 17409, 27109, 1514, 323, 253, 1345, 1191, 101, 15, 964, 428, 85, 48530, 77, 63, 472, 75, 17035, 16531, 285, 2021, 403, 1855, 14, 187, 19221, 806, 281, 11377, 253, 4116, 273, 5042, 21288, 63, 21288, 63, 80, 616, 747, 2419, 327, 11590, 3062, 187, 783, 329, 2310, 15434, 15, 1893, 352, 369, 8342, 1264, 309, 7539, 24, 16896, 9739, 2464, 63, 8, 500, 3, 63, 11768, 1157, 5554, 3, 6234, 4479, 40129, 11, 71, 4117, 2464, 14, 891, 44038, 16896, 5042, 6267, 6267, 187, 609, 3198, 326, 260, 9866, 26263, 2455, 87, 3416, 686, 3736, 63, 55, 9336, 3, 71, 25830, 8, 16896, 686, 63, 41, 8, 35797, 7252, 25458, 327, 187, 249, 253, 7773, 604, 703, 1663, 16995, 281, 1163, 5042, 60, 264, 4379, 39893, 323, 247, 1643, 1897, 13, 1919, 187, 21528, 598, 1633, 281, 10073, 253, 7773, 309, 75, 2653, 50105, 3253, 278, 40628, 275, 187, 19102, 398, 1293, 3405, 1699, 1046, 11083, 346, 17169, 16896, 10983, 187, 14866, 35099, 6018, 553, 273, 44261, 13, 309, 250, 9, 395, 310, 9100, 247, 1643, 3618, 8, 18125, 342, 617, 25969, 13, 964, 21707, 15, 6277, 329, 248, 1596, 15, 187, 34, 23298, 8264, 70, 1677, 407, 5767, 9545, 66, 35160, 23215, 637, 387, 253, 1728, 273, 253, 5767, 265, 388, 1595, 466, 689, 534, 253, 1270, 285, 21995, 466, 9002, 1390, 8330, 1014, 14, 588, 320, 1408, 310, 1160, 598, 480, 1251, 13, 369, 11346, 407, 512, 1246, 13, 9123, 3511, 14128, 271, 1871, 21332, 37323, 1336, 285, 21968, 15, 416, 15, 444, 15, 45280, 369, 7015, 4417, 285, 5874, 23215, 3600, 15634, 10910, 369, 1481, 46216, 15, 187, 7710, 15, 285, 6827, 15, 6539, 15, 187, 1779, 763, 311, 78, 403, 253, 549, 14, 187, 395, 253, 380, 187, 34, 1180, 273, 253, 2151, 1484, 71, 253, 39705, 538, 14, 8374, 396, 73, 1062, 11612, 253, 27288, 6836, 4344, 327, 30867, 300, 333, 15, 1583, 1160, 253, 7408, 275, 29132, 23215, 5580, 434, 8661, 15, 187, 783, 187, 936, 755, 253, 9383, 33610, 7423, 302, 15, 187, 21707, 15, 35578, 7560, 342, 5471, 273, 253, 31427, 326, 651, 320, 2218, 253, 1892, 2444, 5172, 489, 2472, 1216, 13, 604, 667, 625, 8294, 369, 13044, 2220, 617, 15, 733, 369, 247, 1077, 4722, 285, 12833, 14, 2, 187, 3258, 8446, 285, 352, 369, 1077, 8342, 281, 28, 964, 72, 16896, 5042, 63, 480, 16896, 63, 5042, 1605, 34762, 387, 253, 32354, 923, 246, 77, 6234, 255, 253, 41996, 466, 4584, 574, 253, 964, 14774, 26300, 3706, 1484, 325, 241, 19396, 7693, 273, 617, 8446, 15, 187, 19396, 3333, 19396, 19396, 1157, 1157, 1157, 1163, 844, 12423, 9995, 281, 4089, 326, 776, 3331, 187, 15, 14866, 2325, 335, 1240, 40824, 5292, 556, 4895, 480, 63, 5042, 5042, 266, 23972, 13, 310, 1199, 187, 936, 253, 10128, 43921, 266, 2499, 1163, 5042, 16896, 63, 1157, 63, 75, 63, 5042, 32264, 63, 428, 16896, 63, 5042, 16896, 63, 5042, 5042, 63, 5042, 16896, 187, 2811, 703, 556, 5262, 253, 480, 10, 505, 767, 187, 7710, 15, 10351, 251, 13, 273, 21249, 13, 187, 10526, 15, 5767, 49671, 433, 40824, 5292, 13, 247, 16125, 273, 401, 15, 388, 15, 322, 904, 31707, 15, 556, 671, 4783, 281, 43921, 266, 13, 285, 11643, 16765, 23215, 815, 5292, 556, 4895, 281, 253, 2143, 534, 344, 11612, 1390, 807, 275, 20973, 15, 187, 13243, 670, 969, 275, 247, 1643, 1897, 15, 187, 34361, 9012, 672, 368, 476, 15, 733, 891, 187, 1962, 522, 9921, 15, 34069, 2092, 310, 11727, 417, 973, 7192, 15, 733, 253, 32650, 1930, 273, 6242, 15, 187, 34, 48301, 14608, 588, 11977, 310, 247, 5042, 382, 273, 440, 13578, 891, 320, 2918, 387, 659, 2487, 2207, 21289, 360, 19670, 13, 480, 3592, 63, 75, 904, 5042, 63, 246, 63, 70, 11590, 3062, 1501, 3906, 27, 2, 323, 253, 8726, 4487, 13, 1735, 7213, 5210, 14, 27, 480, 90, 22492, 1266, 5042, 1473, 844, 3194, 13, 308, 15, 5332, 84, 13, 5767, 19926, 14, 28, 187, 12292, 264, 15, 187, 510, 2282, 3885, 1157, 1987, 383, 187, 1171, 8057, 8451, 5042, 63, 11753, 263, 891, 8, 782, 1106, 285, 253, 9701, 13939, 273, 49905, 1952, 3928, 15, 380, 2862, 5049, 310, 1249, 15, 74, 31, 21, 6574, 275, 2978, 13, 285, 352, 588, 320, 6107, 3307, 2069, 13, 47657, 23215, 6446, 247, 2264, 4181, 273, 246, 570, 5492, 4555, 187, 1630, 15, 52, 15, 2697, 6574, 15, 443, 31, 48497, 4780, 556, 644, 9979, 4651, 273, 247, 4273, 10, 90, 5006, 534, 1160, 327, 253, 5603, 1106, 13, 285, 407, 4437, 1163, 10874, 264, 8330, 9055, 15, 337, 15, 329, 15, 416, 15, 367, 13218, 85, 14340, 3054, 13, 4829, 1905, 1905, 428, 891, 28, 32, 49, 15, 187, 7553, 4108, 14, 12071, 6574, 273, 18236, 389, 14, 18, 380, 6212, 6169, 3684, 39749, 268, 24894, 3971, 588, 320, 2879, 281, 253, 6818, 8404, 9585, 588, 2186, 247, 11012, 275, 6574, 273, 5694, 1106, 534, 369, 13044, 891, 5453, 2419, 6794, 13, 4005, 15, 1884, 394, 15, 1527, 281, 253, 1733, 4263, 1345, 1390, 3978, 13, 7312, 1175, 673, 310, 12316, 281, 512, 15, 380, 806, 5492, 281, 320, 1408, 689, 253, 5603, 23215, 1039, 2282, 369, 275, 655, 54, 25, 15, 187, 510, 1388, 7054, 1265, 25369, 556, 2879, 5352, 1600, 281, 253, 1270, 502, 284, 23215, 256, 280, 13, 32721, 432, 253, 1781, 1180, 273, 1049, 75, 300, 13211, 323, 13512, 12783, 285, 12684, 782, 14, 6446, 8470, 1024, 31226, 715, 253, 3906, 273, 253, 5032, 61, 42, 17894, 330, 8777, 47747, 6487, 13, 275, 253, 8057, 329, 719, 1810, 14353, 609, 16790, 13, 21801, 15, 3105, 760, 1457, 2816, 398, 13, 533, 994, 79, 28954, 9346, 273, 643, 8238, 403, 19129, 23215, 6446, 285, 4028, 323, 13512, 15, 416, 15, 353, 15, 19760, 273, 9396, 7518, 6736, 13, 28675, 904, 556, 3053, 327, 271, 19744, 7408, 6146, 342, 247, 3128, 13, 8058, 5042, 80, 259, 1632, 253, 1270, 5492, 13, 285, 521, 2451, 323, 247, 3817, 556, 644, 2959, 15, 8068, 13, 33070, 13, 28299, 285, 9693, 546, 23215, 3021, 74, 9346, 403, 2403, 33196, 13, 1223, 253, 958, 326, 824, 247, 1781, 354, 1831, 23215, 246, 279, 273, 253, 10865, 48154, 432, 253, 2080, 4255, 556, 3977, 7418, 41498, 281, 1265, 5791, 432, 253, 11553, 8852, 8238, 281, 923, 253, 12417, 15, 187, 24080, 500, 15, 50087, 556, 6312, 1163, 9470, 16663, 281, 521, 1728, 13, 47657, 23215, 6446, 253, 3652, 7019, 697, 3438, 1979, 15, 187, 14866, 6393, 17698, 556, 4102, 1460, 23215, 40754, 10665, 36982, 486, 327, 253, 9268, 393, 1930, 273, 11573, 3532, 777, 8669, 13, 534, 556, 309, 644, 4336, 269, 5666, 275, 15, 187, 74, 367, 15, 411, 515, 1947, 588, 3464, 1060, 512, 686, 8986, 3185, 273, 10884, 281, 253, 2846, 15, 187, 28448, 13, 253, 7318, 93, 690, 667, 625, 13, 891, 187, 14721, 310, 417, 247, 2372, 33178, 14, 187, 21859, 1884, 394, 247, 11012, 588, 320, 1259, 23215, 546, 387, 253, 9585, 288, 276, 15, 339, 15, 380, 5453, 1167, 23215, 270, 398, 588, 1408, 253, 355, 8, 2464, 74, 343, 15, 21803, 259, 2711, 91, 285, 767, 2870, 30624, 13, 22906, 942, 13, 275, 823, 74, 23215, 246, 279, 281, 643, 3386, 9023, 9828, 273, 36067, 323, 1110, 16362, 15, 2006, 23215, 7517, 13, 2030, 23903, 15, 187, 1201, 7237, 15, 1707, 588, 320, 2800, 294, 1241, 13, 1690, 27438, 708, 14963, 434, 346, 20598, 10079, 30866, 449, 48702, 403, 327, 7289, 323, 436, 2362, 407, 253, 3289, 3767, 15, 187, 48188, 6956, 377, 13, 6935, 254, 2610, 416, 18050, 28954, 13, 18410, 296, 1362, 13, 25975, 8757, 13, 6827, 15, 187, 46, 15, 367, 15, 8966, 187, 32841, 29416, 187, 17239, 444, 904, 3347, 273, 2305, 15, 285, 6827, 15, 367, 15, 443, 15, 10664, 515, 13, 4962, 7216, 9055, 273, 24109, 23215, 7020, 5895, 15, 15955, 1560, 3238, 497, 2918, 187, 28781, 9055, 387, 253, 24496, 266, 393, 2218, 2717, 2010, 533, 755, 1841, 715, 247, 6412, 13, 3555, 15, 470, 15, 657, 15, 47050, 13, 30654, 13, 1191, 101, 246, 2134, 13, 2039, 15544, 28, 734, 420, 387, 6115, 3423, 187, 7710, 15, 24179, 1023, 14990, 285, 2021, 546, 14, 399, 15, 3010, 13, 3052, 1342, 70, 28178, 42466, 15, 5779, 932, 27, 11010, 264, 385, 14, 20349, 21519, 434, 6519, 353, 15, 444, 15, 1639, 14799, 13, 5767, 47320, 8757, 15, 891, 387, 7121, 2522, 4344, 1390, 8216, 15, 187, 13, 45, 15, 754, 460, 13, 367, 15, 353, 15, 2195, 428, 187, 26218, 24179, 1023, 14990, 41195, 2305, 15, 8178, 14, 6676, 1821, 403, 2820, 281, 4951, 257, 1040, 246, 398, 285, 2305, 15, 9069, 2246, 432, 1457, 2816, 253, 10325, 342, 9881, 326, 452, 13, 327, 6926, 15, 187, 510, 806, 2129, 275, 3821, 706, 263, 253, 7395, 14, 2195, 6446, 24136, 588, 1918, 271, 247, 1258, 38645, 275, 8726, 6696, 15, 3512, 8070, 84, 285, 3522, 6138, 1996, 15, 187, 5035, 4366, 275, 11590, 3062, 5084, 273, 1345, 4804, 275, 253, 3327, 49945, 6412, 1735, 2129, 15, 187, 36, 22120, 15, 187, 510, 9730, 434, 13534, 6550, 273, 253, 36380, 80, 23215, 940, 10643, 47441, 6412, 2918, 271, 12833, 23215, 7846, 280, 4804, 1390, 6926, 12611, 187, 2, 72, 5391, 2965, 285, 8986, 15, 380, 966, 16382, 387, 253, 2810, 273, 253, 4131, 2579, 323, 271, 34375, 2136, 751, 6874, 273, 14327, 14, 2620, 2909, 15, 2305, 15, 20628, 416, 15, 6212, 310, 4007, 285, 21001, 15, 14655, 418, 15, 6212, 310, 6657, 285, 9732, 15, 329, 2675, 4514, 23215, 44722, 13, 247, 15, 25011, 1456, 9353, 285, 271, 9165, 9353, 1557, 323, 253, 1459, 23215, 258, 316, 6284, 285, 4712, 273, 253, 966, 15, 9730, 665, 403, 417, 5010, 546, 23215, 305, 2961, 588, 320, 12045, 1365, 25213, 281, 512, 253, 25687, 273, 253, 6003, 15, 380, 806, 3963, 4804, 259, 3093, 320, 2918, 6926, 13, 4437, 374, 13, 253, 1388, 873, 323, 253, 28, 1081, 28, 73, 12723, 8, 4609, 3, 609, 670, 281, 187, 510, 38025, 351, 5450, 187, 510, 2626, 2129, 2805, 71, 253, 1457, 2816, 38025, 351, 5450, 3407, 327, 7216, 342, 253, 747, 16260, 921, 275, 2120, 13, 5547, 1408, 23215, 39920, 1340, 15, 346, 510, 5625, 9167, 937, 346, 510, 11960, 1059, 273, 15753, 50022, 3, 285, 346, 510, 187, 34, 1077, 3965, 12142, 369, 6076, 23215, 1308, 456, 387, 253, 13328, 251, 486, 273, 253, 3189, 14, 346, 5498, 626, 513, 326, 31270, 937, 2296, 253, 3706, 2298, 451, 6412, 672, 5767, 18827, 466, 25975, 41473, 263, 273, 253, 29737, 36822, 15, 891, 33330, 285, 6911, 27286, 273, 6212, 14, 795, 4772, 187, 3, 5498, 626, 513, 752, 13, 8674, 865, 12325, 253, 387, 14, 891, 43887, 3684, 497, 7028, 407, 253, 30654, 15, 7565, 371, 640, 3, 830, 247, 33422, 273, 11555, 5257, 386, 1157, 253, 3555, 15, 308, 15, 322, 15, 12963, 334, 8754, 614, 15, 380, 309, 10263, 1612, 1014, 323, 253, 1943, 1132, 14, 187, 14543, 73, 49, 63, 2966, 40150, 253, 391, 4029, 9388, 789, 14, 1542, 253, 891, 346, 5498, 626, 1691, 326, 17844, 275, 326, 5253, 1157, 2872, 952, 18607, 2403, 616, 1728, 2419, 13, 835, 22299, 9910, 403, 253, 5042, 13, 32, 23659, 3736, 74, 9739, 8, 3446, 77, 27, 325, 241, 2, 25137, 2375, 537, 27, 63, 537, 43, 32, 45, 15, 77, 273, 8472, 900, 3, 17016, 449, 387, 6212, 6169, 3684, 15, 4086, 15, 346, 510, 11960, 1059, 273, 15753, 50022, 3, 342, 187, 3 ]
town committeman and four delegates each to the Assembly Convention to se¬ lect delegatus to the State C'onventjon, the County Convention and the Assem¬ bly Convention. The attendance, which was the largest in the history of pri¬ mary meetings in this diatrict, was occasioned liy a gentle little fight fo* town committeeman between the prts- ent incumbent, Charles H. Russell, and John Adel of Bellmore. Two hundred and forty-one votes weN" cast .in the fray, of which Mr. Adel receive r. ,,¦ , /• asked that a gymnasium for the public ¦. . -t-'l^ardj'- Self and family are mov- school first to engage the attention of ^'"^'"^o their new house on Bellmore the Auxiliary. So it was plain three I «7^^"".'^' J"^^, ,?'"»\'.*;*f,'.'- i,''^^ ^'''' are needs that cnn occupy everv woman ' ?^V]""f "^'^^ '^H'*" William Wallace on in the village if she really wishes to : ^[edford avenue for a few days, until take up something to assist the village Ijey Ket everything m readiness in officers without straining every nerve " "'^^ • Miss Eleanor Keime of Cork, Ire(and is spending a few weeks' vacation with her aunt, .Mrs. Michael Ahearn. A lawn fete given by Miss Ella Gor¬ man at the home of the Misses Hattie over which the great and Sadie Wood last Wednesday even- will be run is made up jng, was enjoyed by all present, eating hot corn an'd frankfurters and rolls. R. E. Hilton was chief cook and Wil¬ bur Hubbell was head waiter. Mr. and Mrs. Alex. Chisholm are the ar- and the The A number of the children uf the ))ub- lic sehool attended the Mineola fair on Friilay. They made the trip in Rus¬ sell's stages. the to get the coveted hallot. Mrs. Heath spoke with feeling of the injustice that would be done the hard working waue earner, if any more responsibility was thrown upon her. It was a very interesting and enthusi-! astic audience and it was very plain to; .g^^ ^^ j^^^ ^ Deubert at the Worth see tl»at the sjieaker had the .sympathy ; u„,,cp of her audience. ,,._,,,, , , , : We arc glad to hear that our friend .Miss Beulah Humphrey has returned j^ ^ ^an Horn, is much to the Ohio Wesleyan University : ^^^^ ,^j^ ^^^^^^ -^^^ ^^^^ ^ ^^ ^^^ where she has spent the j)ast two Mr. Faron, of Brooklyn, years. Miss Mildred Humphrey, a graduate of F. H. S., 1910. has also gone to Wesleyan, and Harry Hum¬ phrey has returned to the school which he attended last year in Connecticut. him about again in a few days. Always laugh when you can. It i cheap medicine. Merriment is philosophy not well understood. It the sunny side of existence. A complimentary entertainment will Following is a ^ist of unclaimed i be held at Stones Orpheum Theatre, jett^j., ^^ t^e Bellmore post office:! for the Fire Department, next Wednes-: jyjjgg ^da Weeks, T. Jacks, Miss Mes-; timed. The course speed ,contest of Long Island ^^lotor i'arkway and the adjacent roads of Nassau County. The entire circuit is 12.i>4 miles in length, and it will be covered 22 times, mak¬ ing a total distance of tne race exactly 27.S.OS miles. G>eat progress has been proud parents of a bal)y boy which made on the parkway, and by October : rived Wednesday afternoon. 1. A. R. Pardingtcn states, nearly — — - i;?P. twenty-five miles of practically com-1 The Smithville South Athletic pleted road will be added to the twenty Social Club will hold a dance in miles of motorway which was thrown i club house Friday, Sept. 30th. open to the motoring public last June, usual good time is promised to all. The first race to be run over the park¬ way course was in 19U8. The daybreak start undoubtedly has added fresh interest to the great clas¬ sic, judging from the large number of apjilications for seats boxes and fiark- ing spaces now pouring into the office of the ]\Iotor Cups Holding Company, in the Long Acre Sciuare Building, Manhattan. Not only New Yorkers, but entnusiasts of other cities are wir¬ ing and writing for seats. R. M. Bond of Lake Helena, Fla., has started on an automobile trip north with a party, proved ^o winess the great race, and his check for a box has been received. Chicago, Indianapolis, Buffalo and Boston en¬ thusiasts are making reservations, while the fact that such a large propor¬ tion of the drivers hail from the far West has led numerous enthusiasts to start East from the Pacific coast cities to see the contest. Thomas J. Thornton has completed : extensive alterations to his home, mak¬ ing the building twice its former size. Miss Mary Wolf has recently pur¬ chased considerable acreage on the east \ side of Little Neck Road, which has I been completely fenced in. i P. Wassung will remain here all ' winter instead of returning to the city. Martin, the ca| some any more, i tain is not a bit lone- September 30th a dance will be giv¬ en at the Club hou.se. The club mem¬ bers will run the al'.'iir. Prize waltz and two ste;/, refreshments, in addi¬ tion to other features promise plenty of amusement for those attending. Ad¬ mission, 25 cents. day evening. There will be six reels, including Montgomery & Stone's "Old Town Dance." Tickets are on sale for this event by the firemen. sie Mopp, Lemerino Ruggusi, Majstyn, Emma Williams, Mrs. M. P. Henry Wantagh Paul E., son of Mr. and Mrs. P. G. Haass, died Monday afternoon of peri¬ tonitis. Funeral services were held Wednesday afternoon at the Lutheran \ done nothing else but get things into a Church, Rev. 0. V. Werner, pastor, ¦ tangle, officiating; interment at Greenfield Mr. Alfred Seaman and family en- D. More, Ammane Salvatore. Postals: joyed ex-President Roosevelt's speech M. E. Cloca, Miss Edith Williams. i at Riverhead fair last Thursday. ,L. Heine, P. M. ! - ¦ Alfred Seaman entertained Mr. Wal- Many men are trying to straighten | ters and Mr. Jeffries from New York the universe with fingers that have, on Sunday. The first week in Octobor the Will- ! ing Workers will give an aflFair in Fire Hall. Particulars and date announced later. See notice in Bellmore column of public meeting in the Presbyterian Church next week. Cemetery. The Men's Bible Class of the Metho¬ dist Episcopal Church held an enthusi¬ astic meeting last Sunday preliminary !gini fall and winter. The class meets at the close of the morning service for an earnest business like session of forty- five minutes. Mr. Samuel R. Smith is president and Prof. Roy L. Smith is leader and teacher. A social commit¬ tee, a.membership committee and an executive committee care for the vari¬ ous interests and activities of the class. Men who are not otherwise en¬ gaged will be cordially welcomed to all the privileges of the organization. The first regular meeting wili be held Sunday, October 2, the day set for the; bu;h;;'which"are about to The Hippodrome The third week qf the New York Hippodrome began on Monday with the new triple show in full, successful run¬ ning order. "The International Cup," "The Ballet of Niagara" and "The A very pretty wedding was cele¬ brated at the parsonage of the Me- "Don't do that Kenneth," says the ; morial Church when Miss Jessie Emma proprietor of the soda fountain. i Crawford and Robert Powell of Smith- _ __ "Don't do what, sir?" asks the at- i ville South were married by the pastor. Earthquake" form a trio of unusual tendant , the Rev. T. S. Braithwaite. The I drawing power even for the big play- tnhP^innintr the rpanlar work-for the i "Don't put that straw in that glass , young people intend making their home house, where crowded houses are the ^,?,. ?i""'".l:„! '%uf..:^..J?L.l of lenio" phosphate." at Smithville South. rule. "The Ballet of Niagara" with "
[ 14605, 27, 475, 5346, 11, 426, 470, 15, 1099, 13, 475, 35, 11, 426, 470, 15, 5525, 13, 285, 475, 81, 11, 426, 470, 15, 4838, 28, 8746, 14, 14605, 27, 475, 5346, 11, 426, 470, 15, 1610, 13, 475, 35, 11, 426, 470, 15, 7931, 13, 285, 475, 81, 11, 4398, 470, 15, 2874, 481, 3840, 13, 2406, 14, 2068, 2013, 414, 1159, 10571, 20184, 323, 253, 1055, 273, 31262, 1881, 14, 48995, 327, 6406, 14, 48262, 2323, 13, 534, 6786, 7605, 8453, 275, 253, 8746, 14, 14605, 1617, 760, 313, 20199, 27, 475, 5346, 11, 426, 470, 15, 2922, 13, 475, 35, 11, 426, 470, 15, 2874, 13, 285, 475, 81, 11, 426, 470, 15, 805, 28, 8746, 27, 475, 5346, 11, 426, 470, 15, 2693, 13, 475, 35, 11, 426, 470, 15, 4699, 13, 285, 475, 81, 11, 426, 470, 15, 2125, 481, 20672, 14, 2068, 2013, 414, 1159, 20184, 323, 1884, 6, 273, 253, 19817, 1055, 273, 31262, 1881, 14, 48995, 327, 2014, 14, 14605, 2323, 285, 3349, 6, 273, 253, 1055, 327, 8746, 14, 14605, 2323, 15, 844, 671, 24045, 326, 2406, 14, 2068, 2013, 414, 1159, 778, 10571, 5513, 253, 2538, 273, 6246, 39, 285, 15481, 327, 6406, 14, 48262, 2323, 15, 3900, 6246, 39, 285, 15481, 497, 20804, 281, 2014, 14, 14605, 2323, 4313, 313, 527, 4128, 2538, 475, 81, 11, 426, 470, 15, 2904, 285, 470, 15, 1093, 13, 1183, 11507, 275, 253, 8746, 14, 14605, 1617, 13, 3687, 6246, 39, 369, 2330, 342, 3687, 6406, 14, 48262, 2323, 3066, 2406, 14, 2068, 2013, 414, 1159, 2796, 5346, 11, 426, 470, 15, 883, 13, 475, 35, 11, 426, 470, 15, 5525, 13, 285, 475, 81, 11, 426, 470, 15, 2640, 481, 4129, 3910, 275, 7605, 8453, 273, 436, 1055, 497, 2540, 875, 253, 767, 2515, 13, 253, 9777, 273, 253, 2538, 369, 2074, 875, 2515, 1754, 327, 253, 14787, 273, 253, 8492, 14, 43122, 28551, 5325, 6, 330, 2513, 273, 253, 440, 15291, 1025, 2538, 875, 2014, 14, 285, 8746, 14, 14605, 2515, 2470, 3235, 495, 1084, 8476, 20, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 8457, 6246, 39, 8058, 281, 320, 247, 24888, 273, 3045, 275, 2014, 14, 313, 17, 15, 1093, 13, 475, 81, 11, 426, 470, 15, 5523, 10, 285, 8746, 14, 14605, 2515, 313, 17, 15, 805, 13, 475, 81, 11, 426, 470, 15, 2693, 582, 347, 973, 347, 273, 31262, 1881, 14, 48995, 313, 17, 15, 1797, 13, 475, 81, 11, 426, 470, 15, 2874, 582, 359, 7515, 253, 6387, 326, 352, 3815, 20184, 323, 3045, 1805, 685, 253, 24045, 2538, 15, 7088, 1255, 14, 1171, 14, 8491, 369, 10870, 875, 253, 24045, 1566, 326, 2908, 247, 5921, 875, 6246, 39, 285, 253, 6454, 5593, 313, 34, 1864, 27, 577, 31013, 15, 4185, 13, 10904, 378, 1864, 27, 577, 32168, 15, 3121, 10, 285, 271, 17958, 1566, 1690, 247, 1480, 1055, 273, 6246, 39, 313, 34, 1864, 27, 577, 38819, 15, 4148, 13, 10904, 378, 1864, 27, 577, 33120, 15, 3121, 28, 475, 9650, 8769, 19, 24123, 1093, 10, 426, 2164, 15, 3712, 13, 475, 81, 11, 426, 470, 15, 1047, 28, 25607, 46124, 426, 470, 15, 2125, 905, 2270, 6, 7309, 426, 470, 15, 361, 16, 17, 15, 2904, 28653, 12938, 6784, 426, 470, 15, 28271, 28, 330, 6766, 426, 470, 15, 1525, 481, 3308, 253, 24045, 2457, 1566, 369, 4516, 347, 247, 16571, 5740, 273, 253, 941, 15, 496, 253, 17958, 1566, 13, 6246, 39, 369, 3587, 2330, 342, 2323, 4313, 275, 2014, 14, 14605, 7587, 13, 533, 417, 275, 8746, 14, 14605, 7587, 313, 20199, 27, 475, 5346, 11, 426, 470, 15, 1099, 13, 475, 35, 11, 426, 470, 15, 8897, 13, 285, 475, 81, 11, 426, 470, 15, 2874, 28, 8746, 27, 475, 5346, 11, 426, 470, 15, 1036, 13, 475, 35, 11, 426, 470, 15, 7174, 13, 285, 475, 81, 11, 426, 470, 15, 32720, 481, 3840, 13, 253, 1480, 2538, 273, 31262, 1881, 14, 48995, 285, 2406, 14, 2068, 2013, 414, 1159, 327, 8746, 14, 14605, 2323, 4313, 2540, 275, 253, 24045, 1566, 6376, 1534, 275, 253, 17958, 1566, 15, 9157, 13, 2709, 23190, 14, 1171, 14, 8491, 14452, 497, 4942, 7197, 275, 253, 1566, 275, 534, 6246, 39, 369, 20804, 281, 2323, 4313, 2796, 9650, 8769, 19, 24123, 938, 10, 426, 5922, 15, 2945, 13, 475, 81, 11, 426, 470, 15, 2941, 28, 25607, 46124, 426, 470, 15, 3071, 905, 2270, 6, 7309, 426, 470, 15, 2640, 16, 17, 15, 2693, 28653, 12938, 6784, 426, 470, 15, 27706, 28, 330, 6766, 426, 470, 15, 35366, 28, 329, 1864, 27, 577, 31416, 15, 2055, 13, 10904, 378, 1864, 27, 577, 38978, 15, 2950, 7147, 24045, 1566, 27, 475, 9650, 8769, 19, 24123, 1093, 10, 426, 3435, 15, 3712, 13, 475, 81, 11, 426, 470, 15, 2922, 28, 25607, 46124, 426, 470, 15, 1762, 905, 2270, 6, 7309, 426, 470, 15, 361, 16, 17, 15, 2693, 28653, 12938, 6784, 426, 470, 15, 2125, 28, 330, 6766, 426, 470, 15, 26, 2691, 582, 7809, 436, 14282, 9383, 11610, 943, 320, 20184, 323, 275, 1635, 281, 31262, 1881, 14, 48995, 285, 2406, 14, 2068, 2013, 414, 1159, 15, 187, 187, 10971, 13, 1223, 2363, 369, 417, 15970, 273, 2406, 14, 2068, 2013, 414, 1159, 13, 352, 369, 2330, 342, 6406, 14, 48262, 3045, 275, 1097, 2515, 15, 3813, 13, 271, 17958, 1566, 18005, 253, 1480, 1854, 432, 2363, 281, 6406, 14, 48262, 2323, 369, 5762, 15, 7088, 1255, 14, 1171, 14, 8491, 275, 253, 17958, 1566, 1690, 2363, 313, 34, 1864, 27, 8978, 3763, 15, 2941, 13, 10904, 378, 1864, 27, 8978, 2526, 15, 3208, 28, 475, 9650, 8769, 19, 24123, 1423, 10, 426, 3435, 15, 2693, 13, 475, 81, 11, 426, 470, 15, 1797, 28, 25607, 46124, 426, 470, 15, 2941, 905, 2270, 6, 7309, 426, 470, 15, 361, 16, 17, 15, 2922, 28653, 12938, 6784, 30, 17, 15, 18832, 28, 330, 6766, 426, 470, 15, 1525, 10, 369, 7197, 672, 2429, 342, 253, 24045, 1566, 15, 11362, 369, 2330, 342, 6406, 14, 48262, 2323, 275, 1097, 2014, 14, 285, 8746, 14, 14605, 7587, 2796, 5346, 11, 426, 4150, 17, 15, 12058, 13, 475, 81, 11, 426, 470, 15, 520, 28, 475, 5346, 11, 426, 4150, 17, 15, 1093, 13, 475, 81, 11, 426, 470, 15, 520, 13, 1183, 13351, 9937, 436, 13, 512, 24045, 2538, 2361, 1840, 497, 2540, 3907, 273, 436, 1480, 1055, 273, 2363, 15, 4129, 2363, 778, 320, 247, 14282, 9383, 11610, 273, 6406, 14, 48262, 3045, 13, 697, 7680, 281, 14613, 3910, 2190, 5662, 7747, 19958, 432, 436, 6891, 2363, 2491, 369, 1355, 285, 697, 11250, 25047, 253, 13328, 5632, 273, 253, 1566, 15, 3813, 13, 253, 24045, 1566, 369, 14667, 15, 187, 187, 21, 15, 21561, 1712, 1704, 21, 94, 187, 18669, 187, 187, 1552, 1263, 310, 581, 273, 253, 806, 281, 8338, 7688, 2190, 1881, 14, 48995, 13, 3520, 1159, 13, 285, 5662, 7747, 4479, 3045, 327, 247, 1524, 14, 10186, 13, 7826, 29198, 15363, 3879, 1532, 33151, 14, 48262, 1223, 5015, 327, 247, 4481, 15, 32384, 342, 2074, 2175, 13, 14270, 2323, 369, 3012, 2406, 275, 8746, 14, 14605, 7587, 1254, 35, 1508, 1092, 1008, 35, 1348, 1656, 28319, 31262, 1881, 14, 48995, 285, 2406, 14, 2068, 2013, 414, 3520, 1159, 497, 15970, 273, 3687, 6406, 14, 48262, 2323, 13, 3782, 275, 253, 8746, 14, 14605, 1617, 15, 380, 11686, 1055, 273, 1881, 14, 48995, 327, 8746, 14, 14605, 2323, 3400, 2007, 1941, 326, 1881, 14, 48995, 310, 271, 1774, 14613, 27152, 3907, 273, 3520, 1159, 285, 14601, 15, 2053, 1543, 9017, 2045, 3210, 20057, 1881, 14, 48995, 13, 3520, 1159, 13, 285, 5164, 7364, 275, 5662, 7747, 285, 1804, 625, 2561, 275, 253, 3634, 273, 2570, 13, 1524, 14, 10186, 8892, 310, 3058, 15, 187, 187, 8430, 6406, 14, 48262, 3045, 13072, 342, 2559, 4836, 10454, 13, 2169, 2308, 273, 2406, 14, 2068, 2013, 414, 3520, 1159, 285, 1881, 14, 48995, 26513, 841, 34044, 15, 2053, 1543, 403, 5185, 342, 2045, 789, 407, 30483, 49061, 285, 11651, 1254, 35, 1797, 1184, 275, 534, 17357, 7312, 31262, 3885, 285, 854, 14, 8938, 5863, 14, 395, 14, 6826, 673, 2190, 5875, 5662, 7747, 497, 2330, 342, 3687, 8746, 14, 14605, 31262, 2864, 942, 15, 329, 1781, 2133, 273, 1941, 8525, 253, 2554, 273, 15296, 3520, 1159, 275, 37460, 12351, 5164, 7364, 285, 11850, 3290, 273, 1495, 715, 5662, 33428, 1254, 35, 22, 7254, 35, 26, 1656, 41429, 273, 253, 1246, 1263, 13, 275, 253, 3634, 273, 247, 1524, 14, 10186, 5164, 4836, 13, 823, 281, 436, 1941, 2613, 285, 7501, 625, 2175, 19693, 3626, 2531, 9938, 273, 4712, 273, 5312, 3811, 15, 380, 8996, 273, 4116, 17905, 10296, 7788, 281, 1756, 9086, 13, 285, 2045, 2561, 6492, 326, 1014, 1029, 15415, 5662, 7747, 513, 417, 23652, 907, 31262, 285, 1159, 1309, 8746, 14, 14605, 9534, 1254, 35, 1797, 1656, 1284, 824, 13, 253, 9099, 323, 5662, 7747, 4479, 5312, 15415, 13, 5252, 13, 285, 3290, 273, 1495, 778, 320, 10665, 15, 29475, 267, 285, 6938, 12214, 285, 8525, 326, 7278, 5164, 3045, 1957, 11674, 1786, 14892, 8130, 323, 5662, 7747, 9592, 11372, 342, 247, 1495, 2317, 1607, 272, 264, 407, 21481, 4116, 267, 15374, 15, 187, 187, 6067, 4342, 4103, 281, 1881, 14, 48995, 2007, 17433, 6443, 253, 878, 323, 3081, 8368, 273, 24102, 273, 5164, 15151, 275, 2570, 13, 1524, 14, 10186, 7533, 15, 15397, 281, 2045, 2175, 327, 12351, 5164, 7364, 1254, 35, 23, 1092, 1008, 35, 24, 1092, 1008, 35, 805, 1092, 1008, 35, 1010, 5413, 1881, 14, 48995, 13082, 347, 247, 23403, 273, 4836, 3045, 15, 380, 1534, 11686, 1055, 3637, 253, 2675, 9699, 7792, 534, 803, 953, 326, 4292, 342, 3687, 3367, 10307, 2905, 281, 6936, 313, 70, 15, 72, 904, 31262, 10, 403, 625, 2779, 281, 11377, 275, 4712, 326, 1287, 3947, 4601, 824, 347, 3520, 1159, 3045, 1254, 35, 1012, 1656, 4129, 359, 3264, 281, 10018, 1480, 285, 11686, 2538, 275, 1097, 2515, 13, 352, 310, 417, 10084, 253, 2538, 497, 8943, 275, 253, 8746, 14, 14605, 1617, 760, 15, 16531, 14, 48995, 3762, 6482, 4219, 697, 15970, 1612, 310, 954, 13741, 762, 625, 17905, 2515, 13, 247, 13989, 326, 556, 644, 12724, 47790, 2439, 7625, 285, 13576, 1254, 35, 1012, 1092, 1008, 35, 1812, 1656, 380, 2264, 1055, 273, 1881, 14, 48995, 275, 21565, 6406, 14, 48262, 2323, 13, 275, 1635, 281, 253, 3777, 2554, 273, 3520, 1159, 327, 253, 11686, 1055, 273, 1881, 14, 48995, 275, 8746, 14, 14605, 7587, 13, 671, 5936, 10307, 12656, 778, 1957, 247, 10046, 27152, 273, 271, 2060, 4479, 84, 3745, 281, 4459, 562, 2570, 4712, 273, 5312, 3811, 672, 2429, 342, 3520, 1159, 285, 14601, 15, 41764, 79, 276, 965, 285, 11651, 1254, 35, 1423, 1184, 1119, 326, 9965, 5593, 273, 31262, 285, 1159, 497, 417, 2266, 23477, 273, 5662, 7747, 4479, 3045, 327, 1524, 14, 10186, 16239, 8892, 285, 9125, 326, 2616, 643, 685, 3520, 5350, 313, 70, 15, 72, 904, 31937, 13, 1881, 14, 48995, 10, 1132, 1774, 9503, 275, 5662, 7747, 4479, 1524, 14, 8206, 16239, 15, 19594, 432, 253, 14613, 6239, 2007, 5936, 326, 1881, 14, 48995, 4479, 84, 2554, 275, 8925, 13576, 778, 320, 1014, 10046, 685, 326, 273, 4588, 3745, 1254, 35, 883, 1092, 1008, 35, 1012, 7254, 35, 1010, 1656, 831, 310, 1774, 13, 347, 4292, 665, 24947, 247, 4836, 347, 16400, 390, 18844, 778, 320, 1679, 2779, 281, 11377, 275, 253, 2425, 1014, 604, 2060, 5350, 1057, 417, 33459, 11497, 1254, 35, 1012, 1092, 1008, 35, 1423, 1656, 12526, 13, 841, 14613, 7089, 778, 1421, 281, 3777, 3520, 2425, 13, 15506, 16239, 13, 285, 2957, 273, 14275, 1254, 35, 20, 1092, 1008, 35, 21, 5413, 512, 2234, 2616, 281, 5547, 15174, 15, 187, 187, 1552, 556, 1774, 12739, 323, 253, 2216, 273, 14613, 285, 6938, 12214, 323, 5662, 7747, 15, 3900, 2045, 1941, 6492, 1881, 14, 48995, 285, 3520, 1159, 403, 1774, 23477, 273, 7747, 4479, 3290, 273, 1495, 4768, 253, 15174, 1232, 1254, 35, 21, 1092, 1008, 35, 23, 1092, 1008, 35, 24, 5413, 253, 1543, 273, 253, 1246, 1263, 5224, 1881, 14, 48995, 285, 3520, 1159, 403, 1029, 11674, 1786, 14892, 8130, 47323, 31414, 625, 2570, 1495, 8470, 323, 5662, 7747, 15, 22606, 2425, 12214, 452, 8379, 12845 ]
task: *β* = 0.25, *B* = 0.004, and *p* = 0.003; dual-task: *β* = 0.33, *B* = 0.007, and *p* \< 0.001). Further, lower-extremity function partially accounted for the effect of gait self-efficacy on street-crossing success, which achieved statistical significance in the dual-task condition only (single: *β* = 0.07, *B* = 0.001, and *p* = 0.12; dual: *β* = 0.09, *B* = 0.002, and *p* = 0.04). Lower-extremity function accounted for 30% of the standardized effect of gait self-efficacy on single-task success and 28% of the effect on dual-task success. We also hypothesized that lower-extremity function may partially explain the effects of CRF and BMI on street-crossing success. While CRF and BMI were unrelated to single-task success ratio (indirect effects *p* = 0.08 and 0.18, resp.), in the dual-task condition, greater CRF was associated with greater street-crossing success via lower-extremity function (*β* = 0.11, *B* = 0.004, and *p* = 0.02). Although differences in statistical significance of this effect were observed between the two conditions, the magnitude of the effects was similar between conditions based on the overlap of the bias-corrected bootstrap 95% CIs of the unstandardized effects between single- and dual-task conditions ([Table 3](#tab3){ref-type="table"}). Because CRF proved to be a correlate of performance in single- (0.18, *p* = 0.005) and dual-task conditions (0.12, *p* = 0.09), as well as of gait self-efficacy (0.21, *p* = 0.001), we assessed the possibility that it alone accounted for performance better than the hypothesized effects. Goodness-of-fit was comparable between the hypothesized model that included a correlation between CRF and the outcome measures (AIC: 4855.98, adjusted BIC: 4859.76) and an alternate model including a direct effect of CRF (AIC: 4852.97, adjusted BIC: 4856.76; *χ*^2^(18) = 24.51, *p* = 0.14; RMSEA = 0.04 \[90% CI = 0.00/0.08\]; SRMR = 0.041; CFI = 0.99). Thus the hypothesized final model was supported as a viable description of the data. In the alternate model, CRF was directly associated with success ratio in single-task trials, but not in dual-task trials (single: *β* = 0.25, *B* = 0.008, and *p* = 0.001; dual: *β* = 0.16, *B* = 0.006, and *p* = 0.051). Further, the direct effects of gait self-efficacy and lower-extremity function on dual-task success ratio observed in the hypothesized model remained significant in the alternate model. Additionally, multiple goodness-of-fit indices were relatively worse in the model in which CRF was unrelated to success ratio (*χ*^2^(20) = 33.42, *p* = 0.03; RMSEA = 0.06 \[90% CI = 0.02/0.09\]; SRMR = 0.047; CFI = 0.980; AIC: 4857.88, adjusted BIC: 4861.46 versus hypothesized model: *χ*^2^(18) = 27.51, *p* = 0.07; RMSEA = 0.05 \[90% CI = 0.00/0.09\]; SRMR = 0.04; CFI = 0.986), indicating this meaningful covariate should be accounted for in addition to gait self-efficacy and lower-extremity function. Finally, while age was not predictive of lower-extremity function, it was associated with street-crossing performance in both conditions. Therefore, an alternate model assessing the direct path from age to street-crossing success was tested. Goodness-of-fit in the alternate model including age (AIC: 5962.03, adjusted BIC: 5966.56; *χ*^2^(22) = 27.09, *p* = 0.21; RMSEA = 0.03 \[90% CI = 0.00/0.07\]; SRMR=0.039; CFI = 0.99) was worse when compared with the hypothesized model. Age was associated with street-crossing success in both single- and dual-task trials (*β* = −0.018, *p* = 0.01; *β* = −0.18, *p* = 0.01, resp.). Despite this, all hypothesized effects reported above were observed independent of this direct effect of age. Although age may be a meaningful covariate of street-crossing performance, its contribution to behavioral differences among older adults sampled from this narrow age range was small and its inclusion compromised the parsimony of the model. Therefore, the hypothesized model was retained. 4. Discussion {#sec4} ============= This study is one of the first to explore relationships among self-efficacy, physical function, and older adults\' performance on a real-world, potentially risky everyday behavior---street-crossing while talking on a phone. Consistent with similar studies, crossing success was significantly lower in dual-task trials \[[@B23], [@B24]\]. Greater gait self-efficacy and lower-extremity physical function were predictive of greater street-crossing success, particularly in the dual-task condition. The indirect effect of self-efficacy on dual-task success provides further evidence that self-efficacy is an important behavioral determinant independent of physical function and fitness. These results extend previous models linking self-efficacy, physical function, and functional limitations in older adults and suggest more research in the context of complex, real-world tasks is needed. Although street-crossing performance declined with increased task complexity, higher levels of lower-extremity physical function and self-efficacy attenuated these declines. These results are consistent with previous work by Hausdorff and colleagues \[[@B21]\] in which slower usual gait speed and 8-foot Up-and-Go time among healthy older adults were associated with greater dual-task gait decrements. A large body of evidence supports the role of preserved physical function in mitigating perceived functional limitations and maintaining quality of life into older adulthood \[[@B5]--[@B9]\]. Findings of the present study, in the context of a real-world functional task, add to this evidence base and warrant more studies employing naturalistic simulations of activities of daily living. The prevalence of attention demanding technologies continues to grow rapidly, and previous research indicates that even high functioning older adults do not prioritize gait and function during dual-task situations \[[@B21]\]. As such, the consequences for older adults\' daily functioning, safety, and quality of life may be considerable. Behavioral and environmental interventions and supports that enhance functional performance represent priority health promotion strategies for older adults increasingly faced with a life space impinged by overlapping attentional stimuli. Our findings relative to self-efficacy further underscore the need for additional examination of trajectories of functional impairment in complex, real-world settings. Similar to previous studies on perceived functional limitations \[[@B6], [@B7], [@B12], [@B15]\], self-efficacy emerged as a predictor of task performance. The significant indirect effect follows the social cognitive framework which posits that individuals with greater personal efficacy related to skills (e.g., gait) are more likely to engage in activities that develop competencies such as physical function performance \[[@B13]\]. Although we expected to observe direct and indirect effects in both conditions, it is not surprising the effects were evident in the dual-task condition only. Self-efficacy theory hypothesizes its predictive power is most potent under more demanding conditions, a proposition that has been consistently corroborated across populations and behaviors \[[@B13], [@B36]\]. The total effect of self-efficacy in predicting street-crossing success, in addition to the reduced role of physical function on the indirect effect of self-efficacy in dual-task trials, also suggests efficacy expectations may represent a stronger determinant of an individual\'s ability to carry out complex activities of daily living when compared with physical function and fitness. Giannouli and colleagues \[[@B22]\] found that laboratory measures of gait and function were not strong predictors of older adults\' performance on real-world mobility tasks and argued that factors other than physical capacity (e.g., cognition, self-efficacy) play important roles in older adults\' real-life mobility. Evidence from the behavioral literature further suggests that self-efficacy\'s role in determining behaviors may be even stronger than that of actual ability \[[@B11], [@B13]--[@B15]\]. This is important, as individuals who perceive a task as overwhelming or threatening may be less likely to engage in the activity even if individual capacity does not prohibit participation \[[@B13], [@B22]\]. Unfortunately, these behavioral decisions may lead to reduced physical activity, impaired mobility, and loss of independence \[[@B3], [@B4]\], all key factors to successful aging. This has important implications for the design of behavioral and environmental interventions for older adults. While previous evidence indicates self-efficacy and physical function are important predictors of adults\' quality of life throughout the aging process \[[@B4], [@B6], [@B7]\], the results of the present study indicate self-efficacy and physical function are high priority health promotion strategies amidst progressively more complex life spaces for older adults. Physical activity interventions have successfully utilized
[ 77, 1519, 466, 64, 3140, 2402, 568, 36047, 15, 8456, 3, 4725, 187, 187, 1394, 476, 36219, 253, 1859, 1097, 970, 14784, 390, 2086, 33866, 313, 70, 15, 72, 15, 6753, 14, 1993, 13, 10280, 14, 5560, 13, 3966, 481, 187, 187, 510, 954, 1846, 1841, 309, 1089, 4266, 14707, 281, 1818, 275, 271, 16904, 403, 253, 9830, 15, 1422, 812, 897, 253, 7126, 418, 1519, 466, 19284, 3909, 8121, 281, 16030, 253, 8090, 285, 1818, 616, 9830, 15, 187, 187, 20806, 13, 1014, 342, 253, 8121, 13, 368, 1912, 626, 320, 2104, 281, 1818, 253, 6799, 3295, 15, 496, 841, 2219, 13, 368, 651, 878, 281, 13542, 4647, 247, 5806, 327, 20243, 27, 187, 187, 1208, 5806, 426, 19743, 6573, 9824, 313, 5856, 30616, 15, 788, 6573, 9, 8882, 4672, 13, 51, 15, 4897, 15, 7265, 6573, 19258, 1228, 821, 2234, 5455, 426, 10030, 5455, 1587, 424, 2807, 821, 15259, 426, 418, 1519, 466, 3902, 18229, 29, 6573, 9824, 8743, 10978, 10, 16904, 3145, 15, 1911, 3902, 18229, 9, 2364, 5455, 13, 418, 1519, 466, 8324, 15, 38505, 64, 44624, 13, 15259, 10, 187, 187, 1394, 476, 5206, 534, 1854, 281, 4647, 253, 5806, 327, 13, 390, 368, 812, 4647, 352, 281, 512, 11865, 275, 1083, 368, 816, 971, 253, 16904, 281, 452, 247, 2014, 3295, 15, 187, 187, 24004, 2920, 13, 846, 436, 2221, 14, 32600, 13035, 2282, 13, 368, 403, 13762, 326, 6240, 247, 2159, 285, 18612, 16904, 275, 634, 10469, 622, 310, 417, 326, 1892, 9418, 510, 1294, 21639, 457, 84, 23488, 41714, 562, 253, 2170, 323, 530, 938, 28, 380, 411, 505, 265, 15, 831, 310, 271, 2170, 875, 11442, 309, 394, 300, 1914, 13, 380, 16631, 13648, 1041, 13, 49508, 263, 17869, 13, 285, 253, 7335, 356, 21706, 15, 187, 187, 4509, 47580, 327, 253, 25278, 352, 3133, 2779, 326, 359, 588, 320, 8871, 43177, 13, 8374, 28082, 13, 31022, 13, 285, 12405, 275, 49508, 263, 17869, 347, 271, 823, 327, 281, 253, 5368, 43079, 985, 15, 11243, 5328, 2472, 32226, 588, 320, 5611, 8139, 187, 187, 510, 7335, 356, 21706, 310, 835, 1780, 356, 1575, 285, 521, 8544, 1160, 247, 1462, 1411, 253, 29894, 273, 353, 636, 263, 1309, 253, 15764, 273, 4922, 16554, 1078, 13590, 2584, 253, 24819, 398, 273, 253, 2745, 678, 15, 380, 1294, 21639, 457, 84, 23488, 1057, 417, 1421, 441, 281, 2868, 326, 627, 588, 320, 271, 4227, 323, 436, 28, 4931, 352, 588, 320, 629, 273, 253, 39688, 1386, 15, 187, 187, 1231, 476, 1902, 690, 10610, 10872, 313, 47530, 5363, 10, 326, 476, 671, 320, 14088, 264, 15, 2053, 403, 1146, 46156, 347, 7741, 42034, 790, 2708, 253, 24819, 398, 273, 253, 2745, 678, 313, 10355, 581, 2708, 1016, 15469, 481, 1737, 5300, 359, 588, 320, 23420, 4558, 281, 320, 2326, 15, 30445, 436, 310, 253, 1854, 359, 588, 320, 3192, 281, 380, 5418, 20952, 15, 187, 187, 10758, 359, 3986, 253, 5418, 20952, 352, 310, 12744, 604, 359, 588, 5517, 253, 6680, 13, 320, 994, 34455, 275, 352, 13, 390, 604, 436, 588, 320, 247, 1421, 598, 281, 253, 1594, 14, 27879, 275, 776, 9008, 281, 4901, 353, 636, 263, 15, 187, 187, 1672, 18799, 2069, 6386, 2195, 4672, 187, 187, 17803, 8465, 1128, 14, 187, 187, 2042, 368, 651, 751, 281, 1329, 619, 6031, 342, 399, 11282, 457, 84, 43358, 13935, 3262, 1487, 13, 390, 5046, 816, 4489, 479, 247, 10562, 13, 5532, 253, 31656, 6409, 2708, 42908, 7673, 327, 30517, 301, 14, 746, 187, 187, 24650, 38336, 18469, 27, 380, 24891, 22954, 812, 5241, 275, 5427, 407, 253, 4766, 273, 2552, 285, 13237, 268, 1715, 562, 846, 326, 13, 247, 26278, 5763, 407, 7717, 10701, 275, 11696, 342, 4156, 25021, 5882, 37319, 400, 15208, 13, 556, 8131, 15, 510, 2802, 27555, 22481, 5427, 6282, 7054, 10840, 457, 4453, 387, 1264, 1027, 15018, 285, 5936, 326, 5427, 812, 923, 253, 1180, 273, 24891, 2219, 14270, 6879, 13, 933, 1475, 2552, 3307, 15, 510, 2285, 4270, 1264, 3210, 281, 3283, 253, 10005, 273, 253, 24891, 15, 5815, 1566, 3400, 271, 6642, 273, 849, 253, 15742, 812, 46196, 762, 1027, 2515, 285, 3400, 16039, 327, 849, 253, 2208, 285, 1786, 11319, 476, 3794, 281, 253, 8891, 15, 510, 1304, 908, 1264, 3210, 27, 253, 7155, 1566, 13, 253, 673, 2962, 1566, 285, 253, 12017, 44043, 1889, 7334, 496, 5925, 4568, 3111, 313, 2354, 3027, 10, 1566, 15, 380, 7155, 1566, 4648, 13554, 275, 253, 5195, 273, 253, 2728, 275, 9972, 285, 253, 1982, 13, 285, 10384, 731, 4830, 5427, 281, 3283, 697, 18974, 15, 510, 673, 2962, 1566, 3936, 715, 8180, 941, 2439, 673, 9894, 275, 4135, 285, 3684, 9733, 13, 285, 5223, 84, 731, 281, 5427, 457, 84, 941, 15, 380, 6725, 3027, 1566, 310, 1754, 327, 271, 13418, 273, 21068, 2281, 273, 253, 6581, 13, 534, 310, 253, 3388, 1180, 273, 952, 1016, 2762, 1436, 12741, 84, 15, 20058, 13, 253, 1264, 3210, 2530, 2800, 20553, 323, 253, 15742, 285, 1918, 271, 14011, 273, 672, 352, 1537, 320, 4999, 281, 8488, 253, 5569, 3487, 380, 1304, 671, 8131, 767, 15216, 281, 921, 672, 253, 1083, 47966, 812, 2965, 281, 5058, 15, 380, 15216, 5467, 253, 5569, 3487, 310, 6508, 4457, 2552, 495, 285, 253, 21068, 2281, 273, 253, 6581, 310, 470, 15, 25, 13, 326, 310, 13, 1016, 9813, 1436, 35818, 253, 2728, 281, 470, 15, 25, 643, 952, 15, 496, 253, 806, 10076, 13, 604, 253, 5569, 3487, 310, 6508, 281, 2552, 1458, 13, 253, 1083, 47966, 588, 2965, 281, 5058, 407, 4397, 1458, 15, 496, 253, 1273, 10076, 13, 604, 253, 5569, 3487, 310, 6508, 281, 2552, 1884, 13, 2219, 588, 5926, 281, 5058, 407, 4260, 14, 18948, 15, 50, 27, 187, 187, 2347, 281, 1089, 835, 271, 3280, 6634, 1561, 247, 1618, 275, 15548, 32, 187, 187, 42, 1353, 3652, 247, 2969, 10913, 1342, 2165, 987, 1024, 13, 285, 309, 971, 281, 320, 2104, 281, 4271, 835, 275, 247, 1618, 247, 2608, 5476, 265, 247, 2173, 4857, 15, 1198, 1650, 13, 604, 253, 3159, 1618, 369, 544, 37, 13, 51, 13, 34, 13, 40, 13, 48, 13, 47, 62, 1969, 285, 253, 2608, 5476, 265, 329, 13, 309, 971, 281, 320, 2104, 281, 755, 247, 1091, 326, 651, 1333, 577, 1051, 2520, 310, 619, 4242, 2127, 594, 2080, 187, 2948, 3632, 187, 187, 3418, 64, 3550, 426, 14412, 433, 1383, 686, 29266, 1383, 686, 11300, 1383, 686, 35270, 1383, 686, 2606, 6038, 187, 19057, 64, 3550, 426, 8168, 187, 16191, 64, 3418, 426, 3632, 15, 22122, 9, 3418, 64, 3550, 10, 187, 29076, 426, 8472, 9, 16191, 64, 3418, 10, 187, 16191, 64, 3418, 64, 3550, 426, 1618, 9, 16191, 64, 3418, 10, 187, 13197, 64, 30758, 426, 11793, 187, 187, 3845, 2073, 3220, 3159, 556, 686, 559, 1213, 9, 29076, 10, 559, 686, 4857, 9, 84, 481, 3401, 187, 187, 3845, 9, 16191, 64, 3418, 64, 3550, 10, 187, 187, 1542, 891, 275, 4236, 64, 3418, 64, 3550, 27, 187, 50274, 19057, 64, 3550, 15, 9691, 2073, 64, 3401, 187, 187, 6050, 2165, 64, 30758, 27, 187, 50274, 3845, 9, 19057, 64, 3550, 10, 187, 50274, 4297, 405, 426, 3280, 2073, 1276, 4857, 513, 368, 971, 281, 5476, 32, 3401, 187, 50274, 338, 5476, 275, 4236, 64, 3418, 64, 3550, 27, 187, 50270, 3845, 2073, 29235, 5476, 2, 3401, 187, 50274, 7271, 27, 187, 50270, 3845, 2073, 47, 1714, 2, 3401, 187, 187, 34, 27, 187, 187, 1394, 476, 897, 253, 3605, 1159, 273, 50276, 66, 1618, 187, 70, 15, 72, 15, 209, 187, 17636, 3159, 64, 3550, 15, 4663, 2073, 11300, 3401, 187, 19, 187, 187, 1989, 604, 253, 5476, 310, 417, 275, 253, 1618, 13, 368, 588, 755, 247, 11740, 4756, 15, 1422, 878, 281, 6016, 436, 6517, 15, 535, 27, 8259, 3197, 27, 5343, 2819, 323, 4076, 1708, 1407, 85, 323, 3906, 25561, 1361, 2, 187, 187, 42, 1353, 3387, 434, 73, 15, 309, 3798, 8251, 2717, 13, 513, 417, 1557, 323, 253, 13624, 273, 2854, 4657, 1407, 85, 434, 390, 2133, 8689, 698, 15, 309, 1353, 2819, 323, 1633, 1708, 285, 4076, 326, 309, 476, 8251, 1475, 247, 2257, 273, 952, 1309, 253, 1388, 15, 18190, 326, 588, 417, 38134, 1977, 432, 619, 2133, 15, 309, 1849, 644, 2819, 285, 2819, 2391, 13070, 4496, 32, 187, 187, 42, 1353, 13864, 281, 4089, 19237, 25073, 375, 15, 309, 452, 326, 2, 309, 1620, 1869, 352, 651, 320, 247, 26710, 309, 812, 8251, 281, 789, 15, 23359, 387, 352, 13, 309, 1353, 417, 2119, 2139, 309, 1869, 326, 1051, 262, 19931, 2810, 15, 733, 943, 417, 4996, 2496, 327, 2571, 13, 5734, 597, 4901, 619, 5956, 8232, 15, 309, 751, 19237, 25073, 375, 4672, 11239, 368, 323, 5909, 619, 2927, 2391, 187, 187, 45, 1377, 485, 434, 3905, 657, 466, 1144, 31596, 2391, 262, 816, 2210, 562, 1390, 807, 285, 1959, 3530, 403, 4354, 574, 387, 353, 1974, 434, 15, 2596, 273, 619, 820, 14, 26719, 31394, 352, 5312, 13, 285, 352, 19931, 2810, 281, 253, 4808, 15, 1500, 556, 1077, 2619, 90, 9075, 285, 310, 1234, 7228, 264, 407, 11216, 5920, 83, 1972, 15, 92, 187, 50276, 3, 37336, 7912, 13408, 4312, 1381, 346, 15367, 11871, 110, 22044, 5225, 3, 187, 94, 18812, 3800, 466, 273, 35284, 187, 187, 510, 5893, 18794, 4428, 17268, 347, 8485, 13, 26015, 13, 285, 27541, 347, 667, 19827, 15, 39800, 11060, 863, 328, 1003, 281, 247, 1643, 4109, 1120, 451, 25045, 4483, 2534, 67, 19222, 1563, 253, 12899, 273, 253, 39800, 358, 46191, 281, 6351, 253, 9136, 273, 690, 273, 253, 954, 17874, 13, 6422, 5074, 1929, 281, 1966, 4466, 13, 533, 253, 1533, 6131, 594, 1199, 625, 15, 831, 8499, 4428, 247, 13365, 3081, 1931, 358, 4610, 323, 841, 25427, 29353, 281, 5206, 13, 342, 17268, 273, 1270, 8928, 13, 24762, 13, 390, 24957, 6349, 15, 187, 187, 688, 2159, 13, 604, 368, 956, 253, 12899, 273, 253, 39800, 358, 46191, 432, 253, 20929, 434, 42958, 13, 368, 452, 2289, 281, 253, 4610, 3559, 1060, 15, 1198, 247, 2715, 273, 436, 2600, 342, 3386, 10932, 407, 1268, 13, 5532, 1060, 15, 187, 187, 30377, 13645, 39800, 358, 14559, 15, 3900, 368, 1472, 48825, 13, 667, 608, 14, 8938, 2317, 273, 2834, 25061, 326, 368, 4901, 2636, 1169, 281, 2489, 2834, 25061, 323, 667, 15906, 326, 11999, 949, 352, 846, 326, 1127, 15, 831, 1055, 6634, 1014, 604, 253, 2834, 25061, 310, 3562, 407, 10721, 15, 380, 5968, 273, 253, 31865, 12330, 949, 50082, 5200, 273, 28164, 285, 7692, 934, 15, 1284, 808, 273, 253, 35887, 15, 1422, 452, 11820, 641, 1215, 275, 247, 884, 14, 8938, 9941, 1475, 4834, 15, 1422, 476, 3282, 253, 2087, 4328, 273, 24511, 4723, 18445, 13, 48833, 13, 33387, 13, 285, 3600, 18639, 17268, 1561, 247, 1180, 273, 6574, 4503, 281, 634, 10350, 34301, 313, 35674, 337, 481, 39800, 11060, 5706, 328, 1003, 15, 2091, 247, 15906, 11521, 21291, 1561, 608, 4669, 273, 368, 1223, 368, 1472, 48825, 13, 368, 476, 897, 634, 4884, 281, 1056, 247, 2714, 440, 21201, 9974, 407, 11044, 14650, 327, 326, 15906, 15, 1422, 403, 1801, 17952, 275, 436, 2983, 13, 534, 13330, 4723, 4503, 281, 374, 69, 25, 559, 634, 659, 27410, 34301, 275, 787, 15414, 12777, 4723, 15, 187, 187, 29969, 39800, 358, 14559, 15, 3900, 48825, 13, 368, 476, 2118, 598, 281, 608, 4669, 275, 667, 3884, 672, 247, 15906, 38771, 368, 342, 247, 479, 14906, 2983, 15, 831, 4866, 1057, 417, 46554, 8104, 273, 5107, 15, 380, 5968, 273, 253, 30013, 2789, 368, 19779, 285, 612, 10563, 15, 1284, 808, 273, 253, 35887, 15, 1422, 452, 5750, 327, 12255, 285, 26866, 1411, 2853, 16723, 13, 285, 6351, 1801, 24485, 275, 6995, 429, 15, 380, 24866, 90, 30013, 6057, 672, 352, 310, 1146, 11213, 264, 15, 39800, 11060, 5706, 328, 1003, 15, 3900, 368, 403, 48825, 13, 672, 368, 1056, 247, 3976, 46984, 2451, 390, 13868, 4710, 13, 368, 476, 8171, 253, 1180, 368, 4533, 342, 634, 38615, 757, 1268, 15, 187, 187, 40, 263, 6077, 39800, 358, 14559, 15, 2091, 368, 1891, 271, 3745, 2451, 390, 13868, 4710, 1223, 48825, 13, 368, 476, 897, 634, 4884, 281, 6351, 247, 17301, 281, 253, 4533, 4503, 281, 253, 1180, 273, 38952, 17268, 1561, 884, 4669, 273, 368, 15, 831, 17301, 2550, 8268, 634, 10350, 34301, 313, 35674 ]
lottie_fileName="animation.json" /> You can customize the view both using XML or programmatically (e.g. auto-play, repeat-count, etc). The most common things I find myself wanting to change in an animation are the colors. You could use the excellent LottieFiles online editor to inspect the layers and change their colors. Sometimes, even with the editor, you won't be able to change the desired color. In these cases, you would need to manually apply a filter on runtime: val filter = SimpleColorFilter (ContextCompat.getColor(context!!,R.color.mainColorLight)) val keyPath = KeyPath("**") val callback = LottieValueCallback<ColorFilter>(filter) animationView.addValueCallback(keyPath, LottieProperty.COLOR_FILTER, callback) You can choose which path to apply the filter on, or you could apply it to all paths in case you just want the animation to have a single color. Hopefully, after this super-quick crash course, you are convinced that adding a short and fancy animation in your Android app is not that hard :)The Producer’s Letter lays out the area for U20; The Wastes. This is an area between Northern Ithilien, The Dead Marshes, Dagorlad, and the Slag Hills. From chatter on the forums it seems likely that we will be picking moss, lichens, mushrooms, and flowers in Dagorlad as an add on to the existing flora system. Perhaps gold earrings will be introduced … The Slag Hills is where Aragorn and his army made a stand against the armies of Mordor during the Battle of Morannon before heading toward the Towers of the Teeth. The Producer’s Letter does not lead us to believe that there will be an instance for this; perhaps it will be part of the Epic line. We can expect some classic instances (fellowship) that can also be soloed. These are being hailed as resource dungeons below the Towers of the Teeth (likely one below each tower). What resources we will be farming remains to be seen. Certainly this is the path we will be taking to The Black Gate. Once we reach the Black Gate it is unclear if we will witness the battle, be entrenched in it, or if this will be a lead up to the X-Pac in our preparation to enter Mordor. Exciting times ahead !!! ———————- If you would like to support my efforts with Dadi’s LOTRO Guides, or maybe just buy me a beer, click the donate button below 🙂More on Covid-19 NEW DELHI: The coronavirus epidemic could peak in India by the middle of May and gradually peter out after that, a modelling exercise by Times Network in partnership with global consulting firm Protiviti, has predicted.The ‘Times Fact India Outbreak Report’ looks at three different possibilities and suggests that India could see the number of coronavirus cases crossing 75,000 around May 22.The team built three models to predict the progression of the coronavirus. Each model provides an estimate of how the outbreak could unfold under different conditions and provides insights on how the government and health infrastructure can respond to the crisis.The report used three models: the percentage model, the time series model and the Susceptible Exposed Infected Recovered (SEIR) model. The percentage model uses trends in the spread of the disease in Italy and the US, and applies them onto India to predict its trajectory.The time series model takes into consideration data across time periods in China and South Korea, and adapts them to India’s data. The SEIR model is based on an estimation of reproduction rate of the virus, which is the average number of people each positive person infects. Together, the three models provided six projections for the outbreak and give an indication of when it might be safe to lift the lockdown The report also predicted two scenarios to show when the case tally could fall to zero. The scenarios assume the lockdown is extended beyond May 3 and the reproduction rate of the virus is 0.8, that is, each infected person spreads the disease to 0.8 other people. In the first scenario, if the lockdown is extended to May 15, the case tally will fall to zero by September 15. In the second scenario, if the lockdown is extended to May 30, cases will drop to zero by mid-June.Q: How to find where an input occurs within a list in python? I'm building a simple hangman game right now, and I want to be able to identify where in a list a user guesses a specific letter. For example, if the word list was [D,R,A,G,O,N] -- and the user guesses A, I want to be able to get a return that would say 4...this is my failed code so far import random word_list = ['red', 'better', 'white', 'orange', 'time'] hidden_list = [] selected_word = random.choice(word_list) letters = len(selected_word) selected_word_list = list(selected_word) game_playing = True print('My word has ' + str(letters) + ' letter(s).') print(selected_word_list) for i in selected_word_list: hidden_list.append('_') while game_playing: print(hidden_list) guess = input('What letter do you want to guess?') if guess in selected_word_list: print('Nice guess!') else: print('Nope!') A: You can use the index function of a list e.g. >>> word_list.index('white') 2 But if the guess is not in the list, you will get a ValueError. You need to handle this exception. :confused: female looking for clean light edt for office???? help! I'm 40'sh. I usually wear nothing, do not care for the smell of drug store edt's or body sprays. I'm looking for something light and clean that I can wear around a lot of people during the day. Something that will not stray away from my body. I've been looking and looking....help please? I'm pleased to hear Philosykos. I have that! I never thought it would be a scent I could wear to work. Looking at it, I'm not sure why I thought that...it stays close. It should not intrude on others, unless they enter my comfort zone. I like Philosykos!! Thank you for opening my eyes.... Lancome's La Vie est Belle....it just came out last year and free samples are easily had at Macy's. One of my co-workers wears it daily, and it stays close to the skin. She has very picky taste and is repulsed by loud fragrances.{ "navigationBarTitleText": "我买到的" }Menagerie of Might The animal kingdom contains creatures as vast, exotic, and bizarre as any monster. Totemic attunement to a few terrestial mammals allows barbarians following the Path of the Totem Warrior to gain the powers of some of the most noble, powerful animals known to human culture, but the world offers so much more. This supplement contains a dozen additional totem options for these mighty warriors to choose, with creatures of great cultural, symbolic, or ecological importance. In short, if you follow the Path of the Totem Warrior from the Player's Handbook, you have access to the options presented here. For a version of this content with features organized by level, click here. Elephant Totem Spirit. While you're raging, any 5-foot space of difficult terrain that you enter ceases to become difficult terrain for any creature that passes through it after that point. This effect occurs even if the difficult terrain is created by magic. The spirit of the elephant tears through snarls of vegetation and rubble. Aspect of the Beast. You have tremorsense in a 10-foot radius around yourself. You can sense the general location of thunder damage dealt, earthquakes, storms, and burrowing creatures within a number of miles equal to your Constitution modifier (minimum 1). Totemic Attunement. When a creature falls prone within 5 feet of you while you're raging, you can use your reaction to make a special unarmed strike by stomping on that creature. You are proficient in this attack, which deals damage equal to 2d8 + your Strength modifier in bludgeoning damage. Fox Totem Spirit. While raging, you can move up to 5 feet in any direction when a creature misses you with a melee attack. This movement does not provoke attacks of opportunity. The spirit of the fox makes you swift and evasive. Aspect of the Beast. You have advantage on checks and saves against illusions, and gain proficiency in Insight. The tricksy fox knows when it is being fooled. Totemic Attunement. While you are raging, when you make a Charisma check or saving throw, you can replace the number you roll with your barbarian level. Gorilla Totem Spirit. When you fail an ability check or saving throw while raging, you can use your reaction to gain a bonus to the roll equal to the number of allied creatures within 10 feet of you. This bonus cannot exceed your Constitution modifier (minimum
[ 84, 1337, 2059, 61, 3181, 61, 3115, 4010, 45, 64, 52, 9, 84, 1337, 2059, 1126, 3023, 889, 3181, 61, 3115, 10, 45, 63, 52, 9, 84, 1337, 2059, 61, 3181, 61, 3115, 1009, 835, 370, 45, 64, 52, 5, 12853, 253, 6486, 1885, 273, 1980, 370, 45, 2911, 41586, 689, 669, 3023, 61, 249, 322, 1366, 285, 370, 45, 63, 52, 9, 84, 1337, 2059, 61, 3181, 61, 3115, 1009, 310, 253, 7898, 370, 45, 2911, 3701, 534, 476, 320, 4441, 275, 253, 3638, 1307, 273, 247, 7470, 32133, 6339, 2962, 313, 9088, 310, 271, 15424, 1327, 14, 36020, 4764, 1060, 672, 370, 78, 61, 8275, 19, 4615, 9, 21, 4244, 923, 3015, 575, 1447, 328, 83, 418, 3470, 8001, 831, 1127, 310, 1774, 323, 253, 4685, 273, 776, 4327, 273, 10985, 323, 669, 4820, 92, 5990, 2000, 76, 1352, 496, 253, 4872, 4758, 13, 253, 18232, 6056, 1253, 2809, 1240, 13535, 1332, 476, 320, 908, 281, 1263, 436, 7898, 370, 45, 2911, 3701, 407, 5001, 370, 40, 61, 3181, 61, 4820, 92, 5990, 2000, 76, 5, 347, 247, 2629, 35925, 14632, 273, 669, 4820, 92, 6104, 2026, 19, 9, 79, 12, 76, 28185, 831, 1332, 369, 6508, 281, 253, 2087, 966, 273, 10985, 2390, 273, 15341, 77, 26630, 285, 6304, 40214, 1008, 8561, 62, 275, 247, 3332, 789, 273, 443, 8500, 1008, 40, 8500, 7798, 1092, 285, 6296, 275, 436, 1083, 253, 1263, 273, 18935, 370, 45, 2911, 20619, 323, 370, 40, 4932, 78, 10392, 1364, 6388, 253, 10985, 669, 6796, 464, 4820, 92, 5990, 5000, 76, 5, 347, 2931, 407, 12400, 15, 496, 436, 3282, 6899, 575, 1447, 33921, 27, 11984, 2101, 418, 1159, 696, 1275, 1100, 253, 1543, 581, 31326, 3066, 253, 1332, 273, 253, 3638, 1307, 13, 534, 1057, 417, 2085, 247, 4156, 5164, 5150, 313, 9154, 275, 253, 4872, 1083, 481, 187, 187, 2809, 303, 5650, 1008, 2809, 303, 5650, 22700, 62, 369, 581, 273, 253, 22223, 398, 275, 253, 1263, 273, 10985, 2390, 275, 253, 8946, 4758, 15, 754, 5421, 23178, 4948, 273, 2716, 14, 49112, 2801, 285, 369, 2104, 281, 4711, 247, 8488, 273, 23178, 4948, 273, 2801, 370, 76, 16, 19, 1366, 835, 370, 76, 61, 5090, 20, 5, 310, 271, 8909, 7007, 13, 281, 23178, 4948, 273, 2801, 370, 76, 14, 18, 1352, 3032, 906, 369, 2797, 3066, 253, 5019, 273, 271, 9909, 6779, 2087, 3006, 25299, 249, 1008, 34337, 249, 42093, 1092, 285, 253, 1716, 3025, 6899, 273, 844, 300, 1008, 1231, 300, 26369, 1570, 2596, 273, 253, 42852, 323, 253, 2440, 273, 253, 14923, 35373, 1332, 323, 4872, 2390, 1008, 34949, 44, 19, 28, 1214, 7386, 44, 62, 369, 281, 4044, 247, 27259, 451, 8488, 13, 285, 6296, 436, 369, 253, 2022, 2898, 273, 1008, 7386, 44, 1092, 247, 8488, 432, 313, 33455, 10, 8946, 2390, 281, 253, 4569, 2087, 4872, 2390, 13, 970, 253, 1716, 3025, 6899, 273, 330, 462, 69, 437, 285, 367, 5946, 1507, 5985, 14, 2809, 37557, 2479, 36, 3299, 20, 28, 1214, 36, 3299, 9595, 2498, 2091, 359, 10358, 253, 1543, 273, 436, 789, 323, 370, 40, 4932, 19, 29119, 891, 15, 70, 904, 370, 78, 30, 19, 1366, 715, 253, 7792, 273, 1008, 7386, 44, 1092, 359, 4044, 247, 2074, 8488, 15, 187, 187, 1466, 669, 2059, 5, 320, 247, 13241, 313, 343, 21456, 10, 260, 316, 4239, 267, 6779, 273, 370, 40, 4932, 19, 29591, 34, 4244, 285, 669, 10314, 5, 320, 271, 22816, 3772, 41050, 6779, 273, 669, 4820, 92, 5990, 2026, 19, 79, 3713, 34, 3822, 844, 1333, 326, 669, 10314, 5, 310, 247, 41675, 5650, 8488, 273, 669, 2059, 5, 604, 323, 2761, 512, 6486, 5053, 669, 3023, 5, 835, 669, 2059, 1126, 3023, 724, 310, 440, 3358, 1245, 13, 669, 10314, 1126, 3023, 724, 310, 253, 1980, 27259, 451, 8488, 273, 669, 2059, 1126, 3023, 724, 1677, 407, 253, 11191, 640, 20169, 2479, 20794, 640, 3571, 28, 1214, 11773, 47, 312, 4595, 3291, 342, 1675, 281, 669, 4144, 1126, 3023, 724, 285, 253, 21496, 669, 4820, 92, 6104, 2026, 19, 79, 3713, 36, 10, 11380, 4820, 92, 5990, 2026, 19, 79, 3713, 36, 1009, 313, 2887, 3015, 575, 1447, 328, 83, 418, 3470, 696, 323, 4278, 582, 285, 387, 253, 2570, 5053, 669, 10314, 1126, 3023, 724, 310, 253, 8488, 281, 669, 4820, 92, 5990, 2026, 19, 79, 3713, 36, 1009, 273, 253, 6779, 669, 3124, 1126, 4144, 1126, 3023, 12523, 2059, 1126, 3023, 6580, 7660, 281, 669, 2059, 1126, 3023, 724, 407, 253, 39116, 17668, 2479, 2347, 70, 14643, 28, 1214, 3837, 1317, 7912, 10352, 348, 12731, 2498, 831, 5426, 8725, 281, 667, 370, 78, 61, 5090, 18, 1366, 533, 323, 8909, 370, 78, 5, 253, 8488, 310, 281, 669, 4820, 92, 5990, 2026, 19, 79, 12, 18, 3713, 34, 4244, 253, 21496, 310, 273, 669, 4820, 92, 8683, 2026, 19, 79, 12, 18, 3713, 36, 1009, 275, 669, 4820, 92, 5990, 2026, 19, 79, 12, 18, 3713, 36, 4244, 285, 387, 253, 4222, 303, 13616, 266, 5053, 581, 3936, 253, 2629, 8488, 313, 2887, 13441, 187, 187, 6693, 13241, 260, 316, 4239, 267, 6779, 669, 2059, 5, 273, 370, 40, 4932, 19, 29591, 34, 1009, 556, 247, 41675, 5650, 8488, 669, 10314, 5, 281, 669, 4820, 92, 5990, 2026, 19, 79, 3713, 34, 3822, 187, 187, 6067, 4737, 4428, 247, 8037, 27, 6899, 575, 1447, 33921, 27, 46, 962, 254, 5290, 281, 320, 4581, 275, 247, 31196, 823, 423, 360, 281, 436, 789, 313, 255, 667, 2281, 253, 906, 3139, 369, 8058, 275, 1008, 40, 266, 39980, 2610, 7798, 1092, 923, 2708, 481, 1198, 253, 34002, 273, 253, 8488, 323, 21349, 12314, 14237, 923, 24297, 575, 1447, 5528, 17405, 27, 3129, 24595, 27259, 451, 8488, 4207, 2726, 841, 1543, 581, 476, 1263, 253, 1980, 18232, 6056, 19704, 980, 10939, 273, 253, 10711, 7212, 285, 697, 31341, 47091, 313, 2887, 2708, 481, 187, 187, 1909, 5393, 1840, 13, 323, 370, 78, 30, 19, 5, 390, 370, 76, 30, 18, 5, 776, 1543, 403, 49795, 15, 496, 253, 2087, 1083, 597, 3469, 327, 2067, 13260, 13, 690, 273, 534, 497, 2168, 1246, 275, 1008, 1405, 805, 62, 313, 1542, 253, 1980, 7794, 1060, 13, 10046, 13260, 403, 3058, 481, 2053, 403, 7000, 275, 3015, 575, 1447, 783, 6779, 391, 1689, 2582, 68, 9, 3115, 31148, 285, 9093, 22149, 1066, 281, 253, 6242, 273, 247, 41675, 5650, 1511, 17668, 323, 3835, 723, 273, 2087, 4872, 2390, 15, 313, 8497, 326, 1014, 253, 2605, 273, 6278, 14, 13897, 494, 14237, 273, 10985, 2390, 273, 669, 4820, 92, 5990, 2000, 76, 5, 310, 387, 1246, 7202, 2698, 3308, 253, 17697, 629, 273, 436, 789, 476, 320, 12258, 347, 247, 5141, 273, 253, 1263, 273, 1980, 2616, 432, 370, 40, 4932, 78, 10392, 281, 669, 6796, 464, 4820, 92, 5990, 5000, 77, 1352, 187, 187, 1992, 253, 1682, 273, 776, 3640, 13, 436, 310, 253, 806, 3177, 281, 1263, 1980, 2616, 689, 667, 10985, 1387, 3345, 253, 1387, 370, 40, 4932, 19, 10392, 313, 2858, 370, 40, 4932, 19, 10392, 310, 247, 2714, 1083, 13, 923, 2708, 582, 347, 973, 347, 253, 806, 5140, 273, 3426, 370, 45, 2911, 20619, 13, 1014, 342, 370, 76, 30, 18, 1352, 187, 187, 510, 9376, 669, 1906, 578, 19, 78, 889, 6040, 401, 49538, 534, 310, 10046, 685, 253, 1617, 669, 1906, 64, 78, 61, 6040, 401, 18636, 3058, 323, 253, 6242, 273, 370, 40, 4932, 78, 29119, 310, 3058, 984, 359, 897, 313, 1568, 285, 275, 1008, 1405, 805, 3291, 1543, 432, 1008, 10172, 39, 7330, 28, 1214, 11773, 47, 312, 4595, 19, 28, 1214, 40, 8500, 22, 28, 1214, 40, 8500, 21, 1092, 835, 352, 369, 8025, 15, 831, 9376, 10260, 8077, 7790, 253, 23276, 285, 11355, 253, 7977, 285, 10096, 327, 690, 7681, 4278, 15, 187, 187, 510, 1263, 273, 10985, 2390, 275, 253, 3634, 273, 3772, 41050, 4948, 285, 1980, 6779, 3762, 369, 15247, 407, 844, 300, 1008, 1231, 28, 1214, 1231, 300, 19, 1092, 665, 5421, 253, 27957, 6779, 273, 370, 40, 4932, 19, 29119, 1024, 671, 1929, 347, 253, 844, 300, 6779, 15, 831, 6779, 285, 697, 2087, 5904, 403, 2905, 281, 7418, 3237, 13, 299, 15, 72, 904, 253, 39116, 17668, 285, 253, 44806, 1253, 40, 1350, 1253, 6140, 284, 324, 24366, 2479, 56, 8950, 1033, 44250, 16134, 28, 1214, 2347, 70, 14643, 28, 1214, 56, 8950, 1033, 44250, 14643, 28, 1214, 41, 14007, 28, 1214, 49, 69, 19, 28, 1214, 44, 438, 4123, 51, 455, 261, 9204, 28, 1214, 56, 10339, 28, 1214, 40, 266, 39980, 2610, 6961, 28, 1214, 40, 266, 39980, 2610, 7798, 6660, 285, 556, 644, 23033, 275, 643, 3672, 347, 973, 313, 70, 15, 72, 904, 1008, 23083, 267, 36122, 28, 1214, 2347, 70, 16134, 2498, 187, 187, 2422, 284, 13, 275, 253, 3634, 273, 10985, 2390, 370, 40, 4932, 19, 10392, 310, 3164, 271, 6517, 15, 1284, 247, 2022, 1650, 13, 22816, 14237, 273, 436, 1387, 513, 11476, 387, 954, 581, 1536, 770, 4584, 1566, 2479, 56, 8950, 1033, 44250, 16134, 28, 1214, 16380, 43, 28, 1214, 46840, 81, 579, 348, 8602, 6660, 285, 6296, 253, 3762, 273, 1980, 10303, 369, 6508, 281, 436, 1083, 407, 28918, 81, 579, 348, 2479, 37, 6451, 28, 1214, 37, 6451, 19, 2498, 41675, 5650, 1511, 28676, 285, 1980, 2616, 323, 12314, 14237, 273, 370, 40, 4932, 19, 7398, 3181, 61, 6796, 464, 4820, 92, 5990, 5000, 76, 5, 497, 8818, 275, 1008, 6217, 52, 21, 28, 1214, 1405, 23, 1092, 285, 923, 671, 1008, 6217, 52, 18, 28, 1214, 6217, 52, 740, 28, 1214, 6217, 52, 22, 28, 1214, 6217, 52, 25, 28, 1214, 40, 43, 6453, 1570, 380, 35373, 1332, 273, 1008, 3299, 51, 62, 369, 6508, 281, 370, 40, 4932, 19, 10392, 407, 44806, 1008, 40, 266, 1092, 533, 760, 323, 253, 5958, 14595, 18, 5, 44676, 4816, 76, 30, 18, 14553, 1292, 954, 15538, 253, 6779, 11813, 273, 370, 40, 4932, 19, 10392, 285, 669, 4820, 92, 8683, 2026, 19, 79, 12, 18, 724, 403, 2905, 3066, 253, 39116, 17668, 2479, 2347, 70, 14643, 1092, 923, 671, 1008, 40, 266, 6759, 62, 285, 253, 10414, 15308, 481, 187, 187, 688, 253, 8946, 4758, 13, 1608, 565, 6451, 1008, 2809, 565, 6451, 20778, 62, 908, 39116, 2962, 281, 9093, 3989, 253, 773, 46429, 3711, 3, 273, 253, 8488, 273, 41675, 5650, 13, 285, 15753, 8754, 1008, 24534, 8754, 20778, 62, 369, 2104, 281, 1414, 9038, 253, 8488, 273, 41675, 5650, 13, 969, 970, 39116, 2962, 15, 48690, 1033, 44250, 1008, 56, 8950, 1033, 44250, 16134, 28, 1214, 56, 8950, 1033, 44250, 18263, 28, 1214, 56, 8950, 1033, 44250, 14643, 28, 1214, 56, 8950, 1033, 44250, 14209, 62, 908, 253, 39116, 17668, 281, 4044, 1980, 285, 4156, 2723, 2979, 875, 14237, 273, 669, 4820, 92, 7084, 2000, 19, 4932, 19, 10392, 285, 669, 4820, 92, 8683, 2000, 20, 1352, 187, 187, 510, 1327, 14, 1116, 303, 13616, 266, 285, 4156, 1543, 273, 48690, 1033, 44250, 497, 14923, 760, 4102, 27, 380, 1980, 1327, 14, 1116, 303, 13616, 266, 41675, 5650, 17668, 875, 370, 40, 4932, 19, 10392, 285, 669, 4820, 92, 8683, 2026, 19, 79, 12, 18, 724, 407, 44806, 285, 12933, 249, 1008, 56, 10339, 62, 285, 253, 27259, 451, 414, 1543, 407, 44806, 285, 32185, 2610, 1008, 40, 266, 39980, 2610, 7798, 62, 313, 1542, 253, 4222, 303, 13616, 266, 1083, 923, 1008, 3837, 1317, 7912, 10352, 348, 12731, 28, 1214, 3837, 1317, 7912, 10352, 348, 11496, 28, 1214, 3837, 1317, 11496, 28, 1214, 29099, 472, 9595, 2498, 496, 1008, 40, 266, 39980, 2610, 7798, 62, 253, 4477, 6508, 253, 8488, 273, 41675, 5650, 1008, 2809, 303, 5650, 22700, 62, 432, 669, 4820, 92, 7084, 2000, 19, 4932, 19, 29591, 34, 1009, 281, 370, 40, 4932, 19, 29591, 34, 4244, 285, 2529, 253, 12314, 629, 273, 253, 3772, 41050, 13358, 6637, 273, 370, 40, 4932, 19, 29591, 34, 4244, 970, 253, 39116, 8488, 273, 8182, 1008, 43, 7084, 74, 12430, 62, 281, 669, 4820, 92, 8683, 2026, 19, 77, 12, 18, 3713, 34, 1009, 323, 370, 77, 61, 1266, 295, 5, 313, 4609, 310, 1929, 281, 320, 28078, 10, 285, 253, 789, 273, 15948, 1008, 34021, 6622, 62, 327, 253, 32709, 9162, 323, 669, 4820, 92, 8683, 2026, 19, 77, 12, 18, 724, 313, 2887, 671, 1008, 46, 536, 6620 ]
s,\pi\times\tau)=L_S(s,\pi_{\nu}\times\tau)L^S(s,\pi\times\tau)$ where $L_S$ denotes the finite product of local $L$-factors over $\nu\in S$, and $L^S(s,\pi\times\tau)$ is the partial $L$-function which can be located in the constant term of a suitable Eisenstein series (there is an implicit non-canonical parameter here when $m\equiv2\,(4)$, see § \[unr L functions\]). This point is important for the understanding of our choice of covering for $\operatorname{GL}_k$. In the linear setting, the Langlands–Shahidi method can be used to study this partial $L$-function by regarding $G\times\operatorname{GL}_k$ as a standard Levi subgroup of $\operatorname{Sp}_{2(n+k)}$. This method was extended to the general class of covering groups of Brylinski and Deligne [@BD] in a recent work of Gao [@Gao2018], and indeed in this case the study of twisted $L$-functions for $G^{(m)}$ must involve the covering $\widetilde{\operatorname{GL}}_k$ as defined by restriction. In this sense Theorem \[theorem:complete Sp L function\] refines the results one obtains via the method of the constant term, which does not provide a global functional equation (even in the linear case). Shimura [@Shimura1973] was one of the pioneers in the study of covering groups in the classical setting. He studied modular forms of half-integral weight and was able to produce a lift of modular forms of weight $k/2$, where $k\geq3$ is an odd integer, to modular forms of weight $k-1$. His result was obtained via the combination of an integral representation generalizing Rankin [@Rankin1939], and the Converse Theorem of Weil [@Weil1967]. One of the motivations for the development of the generalized doubling method for linear groups [@CFGK2; @CFK] was to obtain a functorial lift, and indeed this was the main application of [@CFK], a lift from (certain) classical groups to the appropriate general linear groups, using the Converse Theorem of Cogdell and Piatetski-Shapiro ([@CPS3; @CPS1999]). When we plug the results of this work for $G^{(2)}$, i.e., $m=2$, into the framework of [@CFK], we obtain a similar lift. Let $\pi$ be a genuine (irreducible) cuspidal representation of $G^{(2)}(\A)$, and $\Pi$ be an irreducible automorphic representation of $\operatorname{GL}_{2n}(\A)$. We say that $\Pi$ is a Shimura lift of $\pi$ if for almost all finite places $\nu$ where $\pi_{\nu}$ is unramified, $\Pi_{\nu}$ is the local functorial lift of $\pi_{\nu}$ given by the Satake isomorphism ([@Satake63; @McNamara]) with respect to $\psi_{\nu}$ and the embedding $\operatorname{Sp}_{2n}(\C)<\operatorname{GL}_{2n}(\C)$ (see § \[unr L functions\] for details), and at the complex places $\Pi_{\nu}$ is the lift to $\operatorname{GL}_{2n}(\C)$ of the representation $\theta_{\psi_{\nu}}(\pi_{\nu})$ attached to $\pi_{\nu}$ by the theta correspondence ([@Howe1989; @AdamsBarbasch1995]). This definition extends to any $m\geq1$, but for odd $m$ the lift is to $\operatorname{GL}_{2n+1}(\A)$, the embedding is of $\operatorname{SO}_{2n+1}(\C)$ in $\operatorname{GL}_{2n+1}(\C)$, and at the archimedean places one takes the standard lift (see ). Any genuine cuspidal representation $\pi$ of $G^{(2)}(\A)$ has a Shimura lift $\Pi$ to $\operatorname{GL}_{2n}(\A)$. Our proof contains a gap: Theorem \[theorem:Muller\], to be closed in a forthcoming addendum to this work (at any rate the result itself was proved in [@GanIchino2018], see below). For the uniqueness of the lift for globally generic representations see Corollary \[corollary:globl functorial lift\]. With these results one can study the local Langlands conjectures independently of the trace formula and its prerequisites (see below). As mentioned above, for $m=2$ or $k=1$ our results are unconditional. In the general case they depend on several assumptions, some of which were already present in [@me12] (for the local aspects here, stronger assumptions are needed). These are detailed in § \[the representation rho\_c(tau)\] and essentially boil down to the existence of a Shimura type correspondence for coverings of general linear groups. (Note that even the structure of square-integrable representations of covering groups of $\operatorname{GL}_k$ is at present unknown.) Thus the conditional part of this work can be regarded as a reduction of the study of local factors from $G^{(m)}$ to $\widetilde{\operatorname{GL}}_l$. To the best of our knowledge, this is the first attempt to study local factors over any covering group outside the group $G^{(2)}$ (but $G^{(2)}$ is a special case, see below), as well as the first construction of complete $L$-functions, even with $k=1$. The assumption $\mu_{2m}\subset F^*$, which is stronger than the condition $\mu_m\subset F^*$ needed for the existence of $G^{(m)}$, is needed because we use (here and in [@me12]) results from [@BBF2011; @McNamara2; @Gao5; @Gao4], where it was assumed. This assumption greatly simplifies the formulas and reduces the burden and dependence on some technical details. The study of covering groups in the context of automorphic forms and local representation theory was initiated by Weil [@We; @Weil2], who studied the oscillator representation of $G^{(2)}$, now also known as the Weil representation. This representation and its generalizations are related to numerous problems, e.g., the theta correspondence and the Gan–Gross–Prasad conjecture ([@Waldspurger1980; @Howe1989; @Waldspurger1989; @HKS; @Pd2; @KudlaRallis2005; @WGS; @GanIchino2016; @GanIchino2018]), and has been instrumental in other areas as well (e.g., [@Segal1959; @Howe1980]). Alas, in the context of covering groups $G^{(2)}$ is probably an exception. As a main example, irreducible representations of this group do admit at most one Whittaker model ([@Waldspurger1980; @BFJ; @Szpruch2007]), and indeed the theory of local coefficients was extended to this case by Szpruch ([@Dani; @Dani2]). Shimura type integrals and local factors for generic representations of $G^{(2)}\times\widetilde{\operatorname{GL}}_k$ were constructed in [@GRS4; @me6], and see also [@GRS1; @GRS10; @GRS5; @GRS8; @GJRS]. The doubling method of [@PSR] was extended to $G^{(2)}$ by Gan [@Gan], but only for the rank-$1$ twists ($k=1$). But most importantly the representation theories of $G^{(2)}$ and $\operatorname{SO}_{2n+1}$ are related via the theta correspondence ([@Howe1989], see also [@Gan2014] and the references therein). In the classical setting, Shintani [@Shintani1975] used theta series to essentially construct the “inverse map" of the lift of Shimura, and Niwa [@Niwa1975] was able to explicate the lift of Shimura, again using theta series. Waldspurger [@Waldspurger1980; @Waldspurger1981; @Waldspurger1989; @Waldspurger1991] used the theta correspondence to obtain local and global correspondences between representations of $\operatorname{SL}_2^{(2)}$ and $\operatorname{SO}_3$. The non-archimedean and global results of Waldspurger were generalized only recently: The local non-archimedean Shimura correspondence between $G^{(2)}$ and $\operatorname{SO}_{2n+1}$ by Gan and Savin [@WGS] and the functoriality results by Gan and Ichino [@GanIchino2018] (for the archimedean case see [@AdamsBarbasch1995; @AdamsBarbasch1998; @Adams1998; @Renard1999]). In [@GanIchino2018] the authors extended the lift of Shimura [@Shimura1973] from $\operatorname{SL}_2^{(2)}(\A)$ to $G^{(2)}(\A)$, and described the generic part of the automorphic discrete spectrum of $G^{(2)}(\A)$, using the theta lift of Li [@JSLi1997] to $\operatorname{SO}_{2l+1}(\A)$ for $l\gg n$ (which is known to be nonzero) and the work of Arthur [@Arthur2013] on the endoscopic classification for $\operatorname{SO}_{2l+1}$ (see also [@Mok2015
[ 921, 598, 281, 789, 533, 7960, 5262, 521, 673, 4361, 11727, 1905, 7552, 271, 6485, 327, 2101, 2610, 4019, 13, 2556, 281, 2305, 26424, 1905, 534, 651, 1056, 779, 816, 1529, 1083, 273, 45957, 552, 21853, 17927, 14, 282, 23479, 15, 187, 187, 1989, 352, 369, 253, 3236, 8113, 13, 273, 247, 637, 3365, 7824, 1977, 432, 253, 1127, 23786, 273, 521, 789, 13, 326, 3534, 253, 2926, 697, 9907, 4549, 15, 733, 17256, 1520, 253, 13693, 1877, 273, 773, 1601, 1806, 326, 50205, 38562, 326, 309, 457, 306, 3597, 281, 2740, 1066, 1142, 2069, 1078, 15, 26424, 10945, 253, 773, 1601, 668, 273, 5387, 4552, 314, 4645, 598, 323, 247, 2628, 326, 574, 642, 1921, 281, 2226, 13, 275, 3718, 273, 253, 1881, 14, 1020, 26317, 773, 1601, 668, 273, 4361, 11727, 15, 1737, 1537, 359, 512, 513, 604, 359, 812, 513, 253, 1072, 32, 187, 187, 510, 773, 1601, 281, 4086, 668, 2250, 310, 247, 4633, 5299, 36633, 13, 271, 5795, 281, 1469, 327, 9974, 15, 733, 8687, 9257, 285, 12832, 1563, 1046, 4086, 275, 253, 3310, 13, 534, 275, 954, 789, 30345, 556, 253, 8542, 1055, 273, 32103, 789, 1066, 281, 247, 37431, 15, 187, 187, 1989, 4931, 359, 878, 1633, 751, 253, 7285, 27, 773, 1601, 281, 878, 1425, 1310, 4130, 342, 247, 41690, 13, 8138, 1020, 13, 390, 27009, 2628, 3365, 9284, 281, 921, 598, 281, 352, 13, 359, 651, 3037, 247, 2257, 670, 849, 1199, 273, 776, 673, 310, 2668, 598, 342, 773, 1601, 668, 326, 556, 3253, 281, 513, 342, 776, 10096, 327, 16610, 5299, 13, 285, 2717, 387, 512, 281, 513, 342, 253, 1841, 359, 878, 281, 1408, 247, 12524, 5948, 15, 10708, 1071, 187, 187, 2948, 313, 187, 186, 3, 20602, 3, 187, 186, 3, 19462, 3, 535, 186, 3, 7280, 15, 681, 16, 4174, 10408, 16, 31010, 16, 2566, 9432, 1255, 3, 187, 10, 187, 187, 4997, 6004, 30985, 19774, 2402, 9, 85, 475, 19462, 15, 53, 10, 551, 187, 186, 85, 15, 12965, 1587, 65, 4174, 2012, 1969, 1590, 65, 943, 873, 253, 1416, 275, 11632, 15, 33522, 995, 11632, 9, 85, 475, 19462, 15, 53, 10, 551, 996, 186, 85, 15, 4221, 5984, 1082, 996, 186, 73, 3843, 1071, 9432, 1255, 15, 9395, 9, 85, 10, 996, 186, 37671, 288, 15, 36272, 484, 1082, 6886, 186, 1212, 2402, 3843, 288, 15, 4257, 2946, 2402, 1082, 996, 186, 4997, 2402, 3843, 288, 15, 4257, 19774, 2402, 9, 1212, 2402, 10, 996, 186, 7341, 2402, 3843, 11632, 2402, 559, 19292, 7341, 3, 996, 186, 73, 15, 31766, 1587, 4478, 995, 49700, 21005, 995, 346, 2184, 995, 49700, 1590, 995, 11632, 2402, 13, 14035, 2402, 481, 21659, 23779, 1082, 6886, 186, 73, 15, 41094, 9, 7341, 2402, 10, 6886, 186, 33522, 4505, 3843, 288, 15, 3633, 58, 16878, 4505, 1587, 4997, 15, 33522, 2807, 996, 186, 338, 46420, 4505, 15, 2402, 3613, 11632, 2402, 551, 988, 186, 85, 15, 30597, 2103, 1587, 2402, 369, 417, 873, 281, 2462, 84, 275, 11632, 15, 33522, 995, 11632, 2402, 10, 996, 186, 94, 187, 186, 2311, 187, 94, 187, 187, 4997, 6004, 10828, 6586, 9, 85, 475, 19462, 15, 53, 10, 551, 535, 186, 605, 34521, 436, 1071, 10513, 247, 1159, 342, 2634, 30930, 2012, 1969, 21005, 65, 840, 10513, 271, 2012, 14, 5695, 432, 326, 187, 186, 605, 831, 588, 417, 320, 3309, 672, 627, 403, 2012, 14, 13485, 13644, 2130, 281, 3785, 1309, 436, 1071, 535, 186, 85, 15, 12965, 1587, 65, 4174, 2012, 1969, 4478, 14, 5695, 30, 29, 1051, 39334, 943, 4711, 247, 2444, 1159, 7646, 995, 11632, 9, 85, 475, 19462, 15, 53, 10, 551, 996, 186, 73, 3843, 1071, 9432, 1255, 15, 9395, 9, 85, 10, 996, 186, 2044, 1486, 2228, 6886, 186, 605, 13119, 253, 2012, 14, 5695, 996, 186, 1212, 2402, 3843, 288, 15, 4257, 2946, 2402, 1082, 996, 186, 73, 15, 31766, 1587, 6953, 995, 346, 1212, 995, 622, 2402, 481, 21659, 23779, 1082, 996, 186, 28474, 19774, 2402, 3843, 288, 15, 4257, 19774, 2402, 9, 1212, 2402, 10, 996, 186, 73, 15, 31766, 1587, 4478, 995, 49700, 21005, 995, 346, 2184, 995, 2062, 19774, 2402, 10, 996, 186, 73, 15, 41094, 9, 28474, 19774, 2402, 10, 6886, 186, 28474, 58, 16878, 3843, 288, 15, 3633, 58, 16878, 4505, 1587, 4997, 15, 33522, 2807, 996, 186, 28474, 58, 16878, 15, 2402, 426, 4890, 996, 186, 28474, 58, 16878, 15, 8893, 426, 4890, 996, 186, 73, 15, 10639, 58, 16878, 4505, 1587, 4997, 15, 4478, 15, 33522, 995, 2062, 58, 16878, 10, 6886, 186, 1000, 426, 288, 15, 12560, 1587, 17447, 995, 19479, 7836, 995, 346, 2184, 15, 17447, 995, 346, 4997, 15, 2184, 995, 346, 4997, 15, 4478, 15, 33522, 995, 346, 2184, 15, 2307, 2807, 996, 186, 338, 1486, 3613, 5296, 551, 988, 186, 20602, 15, 17148, 6677, 9, 1000, 10, 988, 186, 85, 15, 47837, 1587, 26383, 281, 2794, 13586, 2910, 323, 2012, 14, 5695, 2807, 996, 186, 94, 6886, 186, 3474, 2012, 37, 14119, 4505, 426, 2634, 22050, 355, 23344, 27, 35261, 187, 50254, 245, 50265, 14055, 58, 564, 15, 17447, 1227, 187, 50254, 245, 50265, 48168, 15640, 8076, 995, 13357, 2184, 15, 17447, 9686, 187, 50254, 245, 50265, 2634, 996, 186, 73, 15, 3378, 4505, 1587, 37, 14119, 3140, 995, 2012, 37, 14119, 4505, 13, 470, 10487, 10, 6886, 186, 1000, 426, 288, 15, 12560, 1587, 31510, 995, 346, 7973, 995, 19479, 85, 995, 2062, 19774, 2402, 33229, 14, 4478, 995, 346, 25107, 996, 186, 338, 1486, 3613, 5296, 551, 988, 186, 20602, 15, 17148, 6677, 9, 1000, 10, 988, 186, 85, 15, 47837, 1587, 26383, 281, 2794, 2012, 14, 5695, 2807, 996, 186, 94, 6886, 186, 605, 388, 1887, 333, 359, 452, 271, 2012, 14, 5695, 4672, 996, 186, 605, 1281, 84, 897, 352, 996, 186, 73, 15, 41094, 1587, 2807, 996, 186, 1826, 19774, 2402, 3843, 288, 15, 4257, 19774, 2402, 9, 1212, 2402, 10, 6886, 186, 73, 15, 31766, 1587, 4478, 995, 49700, 4478, 14, 5695, 995, 2062, 19774, 2402, 33229, 14, 4478, 995, 747, 19774, 2402, 10, 996, 186, 73, 15, 41094, 9, 1826, 19774, 2402, 10, 996, 186, 73, 15, 31766, 1587, 283, 31007, 995, 346, 2566, 995, 346, 45552, 995, 49700, 6790, 995, 49700, 2369, 14, 67, 1765, 995, 49700, 1212, 995, 622, 2402, 481, 21659, 23779, 1082, 996, 186, 73, 15, 31766, 1587, 24416, 995, 622, 2402, 13, 747, 19774, 2402, 481, 21659, 23779, 1082, 6886, 186, 1826, 58, 16878, 3843, 288, 15, 3633, 58, 16878, 4505, 1587, 4997, 15, 33522, 2807, 996, 186, 338, 747, 58, 16878, 15, 2402, 3613, 747, 19774, 2402, 551, 988, 186, 85, 15, 30597, 2103, 1587, 20419, 1159, 1416, 310, 2462, 84, 417, 2462, 84, 995, 747, 58, 16878, 15, 2402, 13, 747, 19774, 2402, 10, 996, 186, 94, 6886, 186, 338, 747, 58, 16878, 15, 8893, 3613, 346, 17, 15, 17, 15, 18, 3, 551, 988, 186, 85, 15, 30597, 2103, 1587, 20419, 1159, 2715, 310, 2462, 84, 417, 470, 15, 17, 15, 18, 995, 747, 58, 16878, 15, 8893, 10, 996, 186, 94, 535, 186, 2311, 187, 94, 187, 510, 10850, 308, 744, 1916, 11748, 6061, 18598, 15648, 1916, 40448, 2903, 1923, 8874, 4537, 187, 187, 510, 3416, 387, 253, 4055, 273, 247, 15091, 3982, 1411, 253, 5002, 48048, 310, 873, 281, 755, 370, 24, 3041, 15, 187, 187, 510, 10850, 556, 644, 4370, 2400, 407, 253, 47191, 2812, 254, 273, 247, 15091, 3982, 1411, 779, 407, 247, 3416, 665, 3916, 703, 369, 20512, 37576, 407, 253, 48048, 15, 380, 5002, 9558, 556, 644, 6960, 281, 1133, 689, 521, 4832, 5861, 281, 253, 3416, 13, 665, 310, 873, 281, 4763, 370, 24, 3041, 15, 187, 187, 7130, 281, 1302, 7177, 2797, 407, 380, 2071, 505, 13, 10850, 556, 1919, 253, 990, 273, 253, 1770, 281, 4711, 7177, 4645, 512, 521, 1524, 8304, 13, 8458, 13, 19750, 13, 9954, 84, 13, 3966, 15, 187, 187, 1328, 671, 556, 281, 1614, 689, 512, 1491, 327, 21518, 2987, 344, 21186, 13, 512, 6021, 344, 556, 12431, 1580, 4059, 13, 512, 12222, 344, 1160, 689, 370, 22, 13, 933, 1580, 4059, 285, 4278, 327, 667, 9341, 344, 556, 247, 13841, 275, 15, 187, 187, 1909, 380, 2071, 505, 806, 2361, 13, 2604, 2865, 6077, 21398, 2653, 1905, 665, 1912, 247, 370, 24, 3041, 3883, 1411, 10850, 846, 703, 7558, 344, 37576, 617, 327, 253, 873, 273, 247, 6612, 921, 1905, 4724, 7177, 4321, 436, 807, 37781, 779, 273, 11711, 1076, 9790, 273, 8918, 275, 6021, 281, 3693, 1907, 281, 2075, 15, 187, 187, 688, 617, 4104, 15091, 13, 21398, 2653, 7558, 326, 1309, 253, 3275, 273, 773, 2993, 21979, 10850, 1806, 253, 48048, 20512, 37576, 617, 407, 3490, 2920, 10922, 521, 1133, 3304, 617, 7619, 281, 7692, 617, 8050, 42797, 285, 11566, 4121, 15, 187, 187, 1909, 253, 19564, 11323, 13, 380, 10850, 457, 84, 4320, 1930, 4724, 247, 3200, 323, 247, 747, 2332, 281, 1333, 326, 253, 2408, 273, 253, 3883, 369, 1512, 1029, 285, 326, 1941, 369, 14999, 275, 8109, 253, 1750, 15, 1723, 13, 253, 5963, 275, 253, 2647, 13230, 253, 3200, 15, 11540, 1877, 273, 5667, 14300, 20896, 275, 1966, 16327, 407, 1327, 14, 44490, 7218, 19177, 1754, 327, 530, 21271, 14, 50, 14, 46873, 16, 3338, 15, 187, 688, 3332, 1107, 13, 970, 7218, 19177, 4302, 281, 1263, 14300, 556, 1160, 690, 4780, 15, 1723, 13, 275, 4588, 3382, 2175, 13, 627, 403, 1643, 2175, 327, 14300, 2905, 5198, 11168, 982, 342, 1966, 16327, 347, 3530, 15, 496, 436, 1263, 13, 253, 16327, 3530, 273, 1363, 342, 5667, 14300, 313, 46353, 10, 497, 5421, 407, 10941, 342, 5875, 952, 281, 8338, 253, 2544, 273, 16327, 19789, 875, 41039, 1363, 285, 5875, 952, 275, 1340, 281, 1089, 2442, 20896, 285, 10761, 9130, 15, 743, 17452, 3045, 5558, 19849, 9904, 342, 42227, 1306, 673, 14, 1171, 14, 31045, 2280, 25535, 313, 54, 21271, 14, 50, 14, 46873, 16, 3338, 10, 4302, 369, 908, 281, 12106, 253, 16327, 19789, 273, 6879, 2219, 273, 5667, 14300, 1387, 313, 46353, 10, 285, 6879, 2219, 273, 5875, 1453, 1387, 313, 10431, 481, 4794, 281, 253, 367, 7858, 14, 4877, 3102, 8981, 1783, 13, 15991, 342, 1534, 3910, 313, 49, 654, 964, 1762, 10, 875, 253, 444, 41, 1387, 285, 253, 20663, 1387, 497, 22546, 562, 13, 1690, 884, 2442, 20896, 824, 347, 418, 14, 20912, 41568, 15, 380, 10761, 9130, 3206, 497, 8898, 3527, 11082, 13, 14126, 3527, 11082, 28972, 14689, 13, 26132, 285, 14746, 4073, 15, 380, 1327, 14, 44490, 7218, 19177, 1754, 327, 530, 21271, 14, 50, 14, 46873, 16, 3338, 4302, 476, 8069, 4271, 253, 8967, 19789, 273, 2442, 20896, 275, 253, 16327, 273, 5667, 41039, 1363, 285, 2085, 247, 10527, 3720, 323, 253, 1971, 273, 3382, 14300, 15, 38571, 273, 247, 2813, 14, 4524, 14, 2566, 313, 37, 3329, 10, 310, 271, 9909, 3213, 275, 247, 10264, 1232, 273, 253, 399, 3329, 15, 380, 399, 3329, 476, 320, 5762, 970, 247, 49568, 326, 3797, 247, 11234, 273, 19832, 16, 11021, 313, 42, 16, 48, 10, 17596, 15, 20599, 273, 253, 49568, 476, 2486, 247, 1077, 1698, 2105, 49568, 313, 27901, 1647, 10, 390, 247, 1029, 14, 423, 49568, 15, 44019, 5175, 310, 581, 5853, 908, 323, 5175, 253, 399, 3329, 285, 8687, 19507, 273, 941, 407, 247, 11234, 273, 11017, 13178, 875, 247, 30572, 32232, 285, 247, 33168, 273, 253, 399, 3329, 15, 22460, 13, 253, 11017, 5175, 3797, 30572, 1256, 273, 253, 941, 13, 323, 1650, 6024, 11017, 14800, 281, 253, 399, 3329, 13, 407, 253, 30572, 32232, 715, 247, 11234, 273, 11017, 13178, 390, 14800, 285, 13800, 273, 253, 941, 13, 323, 1650, 247, 11234, 273, 11017, 18012, 13, 407, 253, 33168, 715, 247, 3710, 1180, 273, 6024, 11017, 18012, 15, 1310, 253, 399, 3329, 310, 247, 1698, 9176, 1385, 2216, 13, 253, 399, 3329, 310, 625, 21291, 281, 19541, 2355, 6332, 285, 253, 13800, 273, 253, 941, 310, 1679, 10237, 347, 1180, 273, 11017, 13178, 310, 1679, 1955, 281, 3710, 1180, 273, 6024, 11017, 14800, 285, 6024, 11017, 18012, 15, 187, 1992, 2572, 253, 1180, 273, 6024, 11017, 14800, 281, 253, 30572, 32232, 285, 281, 2572, 253, 1180, 273, 6024, 11017, 18012, 432, 253, 33168, 13, 247, 10382, 6081, 14, 3229, 30941, 6081, 313, 6075, 4476, 10, 310, 2908, 275, 253, 399, 3329 ]
show up to work but merely spent his time reading philosophy — becoming an expert on Spinoza, according to Mr Garcia — which would make him just another case of dreary workplace pseudo-leisure. But it was the original vision, of a man simply walking away from the pointlessness of his work, that gave the story its viral appeal. It punctured the mystification of “work,” that oppressive abstraction that I’ve tried to break down many times before. Garcia rejected the “work” of dutifully showing up for a job that had no reason to exist, in favor of the self-fulfilling “work” of reading philosophy. What might we all do if we could do the same? The “work to rule” action is a popular labor tactic, an alternative to going on strike. It involves carefully and literally following every rule in the contract, which in most workplaces has the practical effect of slowing work down to a crawl. But perhaps we need something like the opposite: “work to need.” If everyone with a pointless, wasteful, or destructive job simply refused to show up to it, we would learn a lot about how much of our time is taken up with “work” that has everything to do with our dependence on wage labor, and nothing at all to do with the things we need to run a decent society.package test import ( "fmt" "testing" "github.com/fnproject/cli/testharness" ) func TestSettingFuncName(t *testing.T) { t.Run("`fn init --name` should set the name in func.yaml", func(t *testing.T) { t.Parallel() h := testharness.Create(t) defer h.Cleanup() appName := h.NewAppName() funcName := h.NewFuncName(appName) dirName := funcName + "_dir" h.Fn("init", "--runtime", "go", "--name", funcName, dirName).AssertSuccess() h.Cd(dirName) yamlFile := h.GetYamlFile("func.yaml") if yamlFile.Name != funcName { t.Fatalf("Name was not set to %s in func.yaml", funcName) } }) } func TestInitImage(t *testing.T) { // NB this test creates a function with `rn init --runtime` then creates an init-image from that // This will not be necessary when there are init-images publicly available to pull during this test t.Run("`fn init --init-image=<...>` should produce a working function template", func(t *testing.T) { h := testharness.Create(t) var err error // Create the init-image appName := h.NewAppName() h.Fn("create", "app", appName).AssertSuccess() origFuncName := h.NewFuncName(appName) h.Fn("init", "--runtime", "go", origFuncName) h.Cd(origFuncName) origYaml := h.GetYamlFile("func.yaml") origYaml.Name = "" origYaml.Version = "" h.WriteYamlFile("func.init.yaml", origYaml) err = h.Exec("tar", "-cf", "go.tar", "func.go", "func.init.yaml", "go.mod") if err != nil { fmt.Println(err) t.Fatal("Failed to create tarball for init-image") } const initDockerFile = `FROM alpine:latest COPY go.tar / CMD ["cat", "/go.tar"] ` h.WithFile("Dockerfile", initDockerFile, 0600) err = h.Exec("docker", "build", "-t", origFuncName+"-init", ".") if err != nil { fmt.Println(err) t.Fatal("Failed to create init-image") } // Hooray we have an init-image!! // Lets use it h.Cd("") newFuncName := h.NewFuncName(appName) h.Fn("init", "--init-image", origFuncName+"-init", newFuncName) h.Cd(newFuncName) h.Fn("--registry", "test", "deploy", "--local", "--no-bump", "--app", appName).AssertSuccess() h.Fn("invoke", appName, newFuncName).AssertSuccess() newYaml := h.GetYamlFile("func.yaml") if newYaml.Name != newFuncName { t.Fatalf("generated function name is %s not %s", newYaml.Name, newFuncName) } if newYaml.Version != "0.0.1" { t.Fatalf("generated function version is %s not 0.0.1", newYaml.Version) } }) } The Game Told To Turn Over Financial Records To Sexual Assault Accuser The woman at the center of a lawsuit brought against the California rapper is set to get $7 million. The Game has been dogged by the looming specter of a lawsuit brought against him by a woman who claims she was sexually assaulted by the rapper. The California artist has been ordered to hand over his financial records to the woman, who is set to receive $7 million. According to court documents obtained by The Blast, Game has until the end of the month to produce documents showing all his real estate, cars, boats, aircrafts, etc. He also has to turn over all information on artistic works he owns, all income he has earned since 2014, all expenses he made over $5,000 since 2014 and details on any businesses he has a stake in. As The Blast first reported, Priscilla Rainey — who won a $7 million judgment against Game after she claimed he assaulted her on the set of a reality show — filed documents earlier this year accusing him of diverting millions of dollars in income to avoid having to pay. In her 2015 lawsuit, Rainey claimed that during the production of “She Got Game,” the rapper sexually assaulted her by forcefully reaching his hand inside her dress to rub her bare vagina and buttocks. As the outlet adds, The Game’s legal side filed a motion for a new trial to say that the amount of the judgment was too high and that evidence was lacking in supporting the claim. However, the judge in the matter blocked the motion.Identification of essential hypertension biomarkers in human urine by non-targeted metabolomics based on UPLC-Q-TOF/MS. In recent years, using metabolomics technology to study hypertension has made some progress. However, in actual clinical studies, there are few studies on hypertension related metabonomics with human urine as samples. In this study, the urine samples of patients with essential hypertension (EH) were studied by comparing with healthy people to explore the changes of urine metabolites between hypertensive patients and healthy people in order to find potential biomarkers and metabolic pathways. An ultra performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MS) technology was used to analyze the urine metabolites of 75 cases of essential hypertension group (EH) and 75 cases of healthy control group (HC). According to the PLS-DA pattern recognition analysis, substances with significant differences (P < .05) between the EH group and the HC group were screened out, including 10 potential biomarkers such as L-methionine. The metabolic pathways involved were amino acid metabolism, fatty acid metabolism steroid hormone, biosynthesis and oxidative stress. The non-targeted metabolomics based on UPLC-Q-TOF/MS technology can effectively identify the differential metabolites of potential biomarkers in the urine of essential hypertensive patients and provide a theoretical basis for the treatment of clinical hypertension.Testing of a device-under-test (DUT) is an integral step in a manufacturing process of the DUT. The DUT can be tested using a tester that includes a plurality of Input/Output (I/O) ports. Examples of the tester can include a very low cost tester (VLCT) or a high-end tester. Scan testing is one technique used for testing the DUT and involves shifting of data by a plurality of scan chains between a decompressor and a compressor of the DUT. Typically, the scan testing includes decompression of the data, for example external scan inputs to the DUT, by the decompressor into a plurality of scan chains or inputs and compression of the data, for example a plurality of scan outputs, by the compressor into a limited number of external scan outputs. If the DUT is a low pin count design, the DUT is more prone to aliasing errors and the compression of the data is less robust as number of scan chains is less due to limited number of external scan inputs and external scan outputs. To increase the number of external scan inputs to the decompressor and to increase the number of external scan outputs from the compressor, a serializer-deserializer (SerDes) is included in the DUT