corpus_content
stringlengths 491
736k
|
|---|
Vitamin A directs immune cells to intestines
A key set of immune cells that protect the body from infection would be lost without directions provided by vitamin A, according to a recent study. A team of researchers found retinoic acid is necessary for two of the three types of innate immune cells that reside in the intestine to find their proper place.
This is Chang Kim.
Credit: Purdue University photo/Andrew Hancock
A key set of immune cells that protect the body from infection would be lost without directions provided by vitamin A, according to a recent study.
A team of researchers from Purdue University found retinoic acid, a metabolite that comes from digested vitamin A, is necessary for two of the three types of innate immune cells that reside in the intestine to find their proper place.
"It is known that vitamin A deficiencies lead to increased susceptibility to disease and low concentrations of immune cells in the mucosal barrier that lines the intestines," said Chang Kim, the professor and section head of microbiology and immunology in Purdue's College of Veterinary Medicine who led the research. "We wanted to find the specific role the vitamin plays in the immune system and how it influences the cells and biological processes. The more we understand the details of how the immune system works, the better we will be able to design treatments for infection, and autoimmune and inflammatory diseases."
Within the immune system there are two categories of cells that work together to rid the body of infection: innate immune cells, the innate lymphoid cells and leukocytes that are fast acting and immediately present to eliminate infection; and adaptive immune cells, the T-cells and B-cells that arrive later, but are specific to the pathogen and more effective at killing or neutralizing it.
All innate immune cells are produced in the bone marrow, but eventually populate other areas of the body. Innate lymphoid cells, which include the group studied by Kim, are present in barrier tissues. While it is known that innate lymphoid cells are concentrated in the intestines, it has been unknown how these cells find their way there, Kim said.
Innate lymphoid cells first gather in the lymph nodes before traveling to their final destination, and this is where retinoic acid acts upon two of the three subsets destined for the intestines. Kim and his team found that retinoic acid activates specific receptors in the cells that act as homing devices for the intestines. As the innate immune cells then travel through the circulatory system, the receptors grab onto and bind to molecules in the intestines and keep the cells in place, he said.
"It is important that these cells be concentrated in mucosal barrier tissues, as opposed to scattered throughout the body, because these tissues are the point of entry for many infections from bacteria, viruses and parasites," Kim said. "Now that we have established the system of migration for these cells, we can play with it a little and see what changes the behavior and function of the cells."
A paper detailing the results of the study, which was performed using both cell cultures and mice, will be published in the July 21 issue of the journal Immunity and is currently available online.
In addition to Kim, co-authors of the paper include Myung H. Kim, a graduate student in the Department of Comparative Pathobiology, and Elizabeth J. Taparowsky, a professor of biological sciences.
In a healthy system, these innate immune cells reside under the epithelial cell barrier that lines the intestine. When a pathogen arrives and penetrates the epithelial barrier, innate immune cells are already there, lying in wait. Innate immune cells sound the alarm for the broader immune response and attack the pathogen to keep it from penetrating farther into the tissue or reaching the bloodstream, Kim said.
In earlier work Kim found that vitamin A also regulates the migration of T-cells.
"It is interesting that both innate and adaptive immune cells share a vitamin A-regulated pathway for migration," he said. "However, there are distinct differences and programs that regulate the migration of the different types of cells and even subsets within them."
This is not the only vitamin known to regulate the migration of immune cells. Vitamin D has been shown to work in a similar way to guide immune cells to the skin, Kim said.
"We all know that what we eat significantly affects our overall health and immunity," he said. "While there are other important regulators of immune system function, the role vitamins play is significant. How this works on a molecular level is a growing field of study."
Foods rich in vitamin A include sweet potatoes, carrots, pumpkin, spinach, mango, cantaloupe and apricots, according to the U.S. Department of Health and Human Services.
Kim next plans to study in greater detail the molecular pathways involved in the migration of innate lymphoid cells to the intestine and other organs.
Materials provided by Purdue University. Original written by Elizabeth K. Gardner. Note: Content may be edited for style and length.
Myung H. Kim, Elizabeth J. Taparowsky, Chang H. Kim. Retinoic Acid Differentially Regulates the Migration of Innate Lymphoid Cell Subsets to the Gut. Immunity, 2015; DOI: 10.1016/j.immuni.2015.06.009
Purdue University. "Vitamin A directs immune cells to intestines." ScienceDaily. ScienceDaily, 9 July 2015. <www.sciencedaily.com/releases/2015/07/150709132634.htm>.
Purdue University. (2015, July 9). Vitamin A directs immune cells to intestines. ScienceDaily. Retrieved May 8, 2017 from www.sciencedaily.com/releases/2015/07/150709132634.htm
Purdue University. "Vitamin A directs immune cells to intestines." ScienceDaily. www.sciencedaily.com/releases/2015/07/150709132634.htm (accessed May 8, 2017).
Natural killer cell
Rapid-Response Immune Cells Are Fully Prepared Before Invasion Strikes
May 5, 2016 Through the use of powerful genomic techniques, researchers have found that the development of immune cells, called innate lymphoid cells (ILCs), gradually prepares these cells for rapid response to ... read more Getting Antibodies Into Shape to Fight Cancer
Dec. 11, 2014 The precise shape of an antibody makes a big difference to how it can stimulate the body's immune system to fight cancer, paving the way for much more effective treatments, researchers have found. ... read more Immune System Precursor Cells That Fight Infection Discovered
May 26, 2014 The innate immune system recognizes infectious agents such as viruses and bacteria. A group of lymphocytes known as "innate lymphoid cells" or ILCs plays a central role in the defense of the human ... read more Gene Discovery Reveals Importance of Eating Your Greens
Mar. 4, 2013 Eating your greens may be even more important that previously thought, with the discovery that an immune cell population essential for intestinal health could be controlled by leafy greens in your ... read more Strange & Offbeat |
Indicators of Occupational Health and Safety: Mortality from or with pneumoconiosis - MN Dept. of Health
Occupational Health and Safety Home
Occupational Health and Safety Surveillance Program
Occupational Health Indicators
WSWS Curriculum
Mortality From or With Pneumoconiosis
There are two Occupational Health Indicators for pneumoconiosis: hospitalizations for pneumoconiosis and deaths for which pneumoconiosis is the primary or contributing cause. Here we present deaths in which pneumoconiosis is a primary or contributing cause. These data are based on Minnesota death certificates. Pneumoconiosis refers to a group of interstitial lung diseases that result from inhalation of dusts, particularly mineral or metal dusts. The distinction between each type of pneumoconiosis is dependent upon the type of dust the individual was exposed to. While there are many types of dusts and corresponding lung diseases, the primary pneumoconioses are asbestosis, silicosis, and coal workers’ pneumoconiosis, caused respectively by asbestos fibers, silica, and coal dust. The dust exposure may lead to inflammation and irreversible damage of the lung tissue, eventually decreasing lung function and frequently leading to disability and possibly death. While the overwhelming majority of pneumoconiosis cases are due to occupational exposures, rare cases have been attributed to environmental exposures such as through contaminated work clothes brought into the home. Pneumoconioses put people at increased risk of other lung diseases, such chronic bronchitis, emphysema, lung cancer, pleuritis, and tuberculosis. Many occupations and industries have been associated with an increased risk of death from pneumoconiosis. Some common industries include mining (coal, metal, mineral), ship building and repair, iron and steel foundries, and construction. Some common occupations include laborers, insulation workers, boiler makers, locomotive workers, mining occupations, plumbers, pipefitters, electricians, carpenters, and millwrights.
Pneumoconioses tend to occur many years -- often many decades -- after the onset of exposure, typically well after the individual has changed jobs or has retired. As with other occupational illnesses that have long latency periods, only a small portion of pneumoconioses are identified and reported by employer-based reporting systems or workers’ compensation claims. Consequently, hospitalization data and death certificate data are frequently used data sources for monitoring rates and trends of these diseases. The use of death certificate date to identify cases of pneumoconiosis can lead to a possible undercount if the cause of death is inappropriately identified or miscoded. As the indicator makes use of both the primary and contributing cause of death, the likelihood of missing a case is reduced. Even with the possible undercount in the number of cases, the indicator provides a useful measure of the rates and trends of pneumoconiosis-related deaths in Minnesota.
Data from the NIOSH National Occupational Respiratory Mortality System indicates that 33,973 individuals had pneumoconiosis listed as either a primary or contributing cause of death in the United States between 2000 and 2014. During that same time period, a total of 419 pneumoconiosis deaths occurred in Minnesota. In both Minnesota and the U.S., 96.5% of the deaths were among males. The tables and figures below show the annual numbers and rates of death in Minnesota and in the US in which pneumoconiosis was the underlying or contributing cause of death. Rates are also shown separately for asbestosis and silicosis deaths. All rates are annual age-adjusted rates per million persons age 15 years and above.
Numbers and Age-Adjusted Rates of Total Pneumoconiosis Deaths in Minnesota, 2000-2014
Rate* per Million Residents
*the age-adjusted rate is calculated with eight, ten-year age categories.
Numbers and Age-Adjusted Rates of Total Pneumoconiosis Deaths in the U.S., 2000-2014
Rate per Million Residents
-- Numbers of All Pneumoconiosis Deaths in Minnesota, 2000-2014
Age-Adjusted Pneumoconiosis Death Rates in Minnesota, 2000-2014 Numbers and Age-Adjusted Rates of Asbestosis Deaths in Minnesota, 2000-2014
*The age adjusted rate is calculated using eight ten-year age categories.
Numbers and Age-Adjusted Rates of Asbestosis Deaths in the U.S.*
*Source: http://webappa.cdc.gov/ords/norms.html
Number of Asbestosis Deaths in Minnesota, 2000-2014
Age-Adjusted Asbestosis Death Rates in Minnesota, 2000-2014
Numbers and Age-Adjusted Rates of Silicosis Deaths in Minnesota, 2000-2014 Year
*The age-adjusted rate per million residents is also shown and is calculated using eight ten-year age categories. Some precaution must be made when interpreting rates from small numbers, as some years had fewer than 5 deaths attributed to silicosis these rates may not be reliable.
Numbers and Age-Adjusted Rates of Silicosis Deaths in the U.S., 2000-2014
*The age-adjusted rate per million residents using eight ten-year age categories.
Number of Silicosis Deaths in Minnesota, 2000-2014
Age-Adjusted Silicosis Death Rates* in Minnesota, 2000-2014
*The rate is calculated using eight, ten year categories. Some precaution must be made when interpreting rates from small numbers, as some years had fewer than 5 deaths attributed to silicosis these rates may not be stable.
A trend analysis suggested that total deaths attributed to any form of pneumoconiosis and to silicosis had a non-significant increase from 2000 to 2014 in Minnesota. The number of deaths attributed to asbestosis was found to have a statistically non-significant increase between 2000 and 2014 in Minnesota. The short time period used in this analysis and the small numbers of cases (particularly for silicosis) limit the conclusions that can be drawn about whether pneumoconioses deaths are increasing or decreasing. Longer-term data for the U.S. from the NIOSH Work-Related Lung Disease Surveillance System provide a more complete picture of trends. These data showed declining mortality rates for coal workers’ pneumoconiosis since 1982, declining silicosis mortality since 1968, but increasing asbestosis mortality from 1968 until around 2000, before starting to decline. The long latency of the pneumoconioses means that the deaths occurring in a particular year are due to exposures that occurred decades earlier. Continued surveillance is necessary to monitor the effectiveness of regulatory standards and whether workers remain at risk. Return to Indicators of Occupational Health and Safety
See also > Health Promotion and Chronic Disease See also > Chronic Disease and Environmental Epidemiology Home
For questions about this page, please contact the Center for Occupational Health and Safety
Information on this website is available in alternative formats upon request. Updated Monday, July 10, 2017 at 10:13AM |
Mesotherapy is a medical specialty that involves injecting microscopic quantities of natural extracts, homeopathic agents, pharmaceuticals and vitamins into the skin. It can be used to eliminate cellulite, promote weight loss, treat aging skin and redundant (sagging) skin, and rejuvenate the hands and neck.
Although Mesotherapy is used to treat a broad spectrum of injuries, illnesses and medical conditions, it is also employed to treat cosmetic conditions, including acne, cellulite, stretch marks, scars and wrinkles. It can also be used to reduce and contour fat.
Mesotherapy introduces microscopic quantities of homeopathic medications, traditional pharmaceuticals, vitamins, mineral and amino acids into the skin to treat a variety of conditions. All medications are selected for the specific condition being treated. The needles used in Mesotherapy are very short and thin. For fair skin, a 4 mm needle is recommended, and for darker skin, a 6 mm needle is used so the doctor can deliver the medications to the right depth. By definition any medication injected into the skin, fat or tissues of Mesoderm (middle layer of skin) is considered Mesotherapy.
Results vary depending on your body type and the condition being treated. On average, patients notice visible improvement in two to three sessions. For certain conditions, patients see results after the first session. The results do last, especially when combined with exercise and proper nutrition. However, we cannot stop the natural aging that affects your appearance. For this reason, we recommend regular maintenance visits.
You may feel a slight pinching or burning sensation when the injections are administered. However, we can provide a topical anesthetic that makes treatment virtually painless. A common side effect of Mesotherapy is bruising, which generally resolves over one week. To speed up the healing process, we recommend that the homeopathic supplement arnica be taken either orally or applied topically on a daily basis. Patients may experience temporary soreness. This will subside within 24-48 hours. |
The Neuroimmunology of Anhedonia
Gabbay, Vilma Icahn School of Medicine at Mount Sinai, New York, NY, United States
See 31 grants from Vilma Gabbay
See 5619 grants from Icahn School of Medicine at Mount Sinai
Adolescent major depressive disorder (MDD) is a major public health concern associated with significant morbidity and mortality. The identification of neurobiological correlates of adolescent MDD has been hampered by the disorder's heterogeneity. To address this challenge, the proposed project adapts a dimensional investigative approach focusing on anhedonia - the loss of pleasure - a core symptom of MDD. Anhedonia can be easily quantified and is tied to specific neural reward circuitry. Among adolescents with MDD, anhedonia is highly variable, with its full range of severity manifesting in this group. These characteristics make anhedonia an ideal candidate for such an approach. Converging data from our laboratory and others'suggest that peripheral activation of the immune system/inflammation and associated CNS alterations mediate anhedonia. We have studied the kynurenine pathway (KP), a central neuroimmunological pathway, which is activated by cytokines and degrades tryptophan into several neurotoxins ("kynurenines"). We reported increased peripheral activation of the KP and neurotoxic load in highly anhedonic MDD adolescents compared to non-anhedonic and healthy control (HC) adolescents. Further, to assess KP-associated CNS alterations, we used proton MR spectroscopy (1H MRS), a non-invasive imaging technique that measures brain metabolites reflecting different aspects of neural function. We documented associations between blood KP neurotoxins and striatal choline (membrane turnover marker) levels along with decreased anterior cingulate cortex (ACC) 3- aminobutyric acid (GABA) levels in anhedonic MDD adolescents, which were correlated with anhedonia scores in the whole MDD group. Based on these preliminary data, we propose to test the overall hypothesis that peripheral activation of the immune system and accompanying neurometabolic alterations are specifically linked to anhedonia severity. To test our hypothesis, 60 depressed adolescents (psychotropic-free) and 40 HC, ages 12-18, Tanner e 4, will be studied. Anhedonia will be measured quantitatively. Blood samples for cytokines, KP metabolites (including quinolinic acid and 3-hydroxykynurenine), kynurenine 3-monooxygenase enzyme activity (initiates the KP neurotoxic branch), and saliva samples for cortisol measures will be collected at AM after an overnight fast. Within an hour, concentrations of neurometabolites reflecting neuronal viability, GABA, and membrane turnover will be measured in the ACC and striatum, regions within the neural reward circuitry, via 1H MRS. Public Health Relevance
The current project proposes an integrated investigative strategy utilizing immunological and neurochemical imaging approaches to examine the neurobiology of anhedonia - the loss of pleasure - in depressed youth. Our focus on anhedonia as a continuous and quantitative symptom addresses the challenges of the current categorical classification schema of depression, which is based exclusively on a cluster of symptoms that often overlap with other disorders and represent distinct etiologies. This interdisciplinary approach is expected to provide novel insights into putative pathways associated with depression and anhedonia in adolescents and may provide novel targets for treatment strategies and prevention measures.
TypeResearch Project (R01) Project #1R01MH095807-01 Application #8219395
Study SectionBiobehavioral Mechanisms of Emotion, Stress and Health Study Section (MESH) Program OfficerGarvey, Marjorie A Project Start2012-09-01
NameIcahn School of Medicine at Mount Sinai DepartmentPsychiatry
The Neuroimmunology of AnhedoniaGabbay, Vilma / Icahn School of Medicine at Mount Sinai
Lapidus, Kyle A B; Gabbay, Vilma; Mao, Xiangling et al. (2014) In vivo (1)H MRS study of potential associations between glutathione, oxidative stress and anhedonia in major depressive disorder. Neurosci Lett 569:74-9
Henderson, Sarah E; Vallejo, Ana I; Ely, Benjamin A et al. (2014) The neural correlates of emotional face-processing in adolescent depression: a dimensional approach focusing on anhedonia and illness severity. Psychiatry Res 224:234-41
Shemesh, Eyal; Gabbay, Vilma (2014) Inflammatory depressive bowel diseases: the new era. J Am Acad Child Adolesc Psychiatry 53:720-2
Gabbay, Vilma; Ely, Benjamin A; Li, Qingyang et al. (2013) Striatum-based circuitry of adolescent depression and anhedonia. J Am Acad Child Adolesc Psychiatry 52:628-41.e13
Be the first to comment on Vilma Gabbay's grant |
Retired Supreme Court Justice John Paul Stevens makes a case for change: Book review
President Obama presents the Presidential Medal of Freedom to retired Supreme Court Justice John Paul Stevens, author of "Six Amendments: How and Why We Should Change the Constitution."
(Getty Images file photo)
Star-Ledger Guest Columnist
Six Amendments: How and Why We Should Change the Constitution
Little Brown, 172 pp., $23
Reviewed by Stewart Pollock
Justice John Paul Stevens retired from the United States Supreme Court in 2010 after 35 years of distinguished service, but his reverence for the Constitution remains unabated.
In “Six Amendments,”; he identifies Supreme Court decisions that, over the past 40 years, have so adversely affected basic law as to require six specific constitutional amendments.
Regarded as an original thinker, Stevens cut his own path on the court, and his book invites the reader to join him on his journey. Along the way, you will question decisions of the current Supreme Court majority and wonder about the meaning of the Constitution.
This is a book for thinkers. It also is a handbook for constitutional change.
The lightning rod among the proposed amendments is a change to the Second Amendment, which in its present form provides: “A well-regulated Militia, being necessary to the security of a free State, the right of the people to keep and bear Arms shall not be infringed.”
Until recently, Stevens explains, federal courts understood the amendment was subject to two limitations: “It applied only to keeping and bearing arms for military purposes,” and it limited the power of the federal government, but not state or local government, “to regulate the ownership or use of firearms.”
Since 2008, however, the Supreme Court has profoundly expanded the Second Amendment. In a 2008 opinion, the court ruled “that the Second Amendment protects a civilian’s right to keep a handgun in his home for purposes of self-defense.” In 2010, the court held “that the Due Process Clause of the Fourteenth Amendment limits the power of the city of Chicago to outlaw possession of handguns by private citizens.”
Those two opinions, Stevens writes, “curtail the government’s power to regulate the use of handguns that contribute to the roughly eighty-eight firearm-related deaths that occur every day.”
To support his argument for gun control, he points to the massacre of 20 first-graders and six adults at the Sandy Hook Elementary School in Newtown, Conn., on Dec. 14, 2012, and the tragic mass killings in recent years in Virginia, Colorado and Arizona.
Stevens dissented from both opinions, which have “given federal judges the ultimate power to determine the validity of state regulations of both civilian and militia-related uses of arms.”
A dissent, however, is often an appeal to a future generation. So is a book that echoes the dissent. Notwithstanding foreseeable opposition from gun owners and the National Rifle Association, Stevens recommends adding five words to the Second Amendment: A well-regulated Militia, being necessary to the security of a free State, the right of the people to keep and bear Arms when serving in the Militia shall not be infringed.
Other proposed amendments include amending the supremacy clause in Article Six to permit Congress to require state officials, in addition to state judges, to enforce federal law. Stevens believes such a requirement will enhance “the federal response to national catastrophes or acts of terrorism,” as well as ordinary federal programs.
“The simple interest of justice” justifies another amendment that would abolish sovereign immunity for states, state agencies or state officials from liability for violating federal legislation or the U.S. Constitution. Yet another amendment would change the Eighth Amendment by declaring the death penalty unconstitutional as a form of cruel and unusual punishment. As a practical matter, that proposal would not affect New Jersey, because the Legislature repealed the death penalty in 2007.
New Jersey, however, moves front and center in Stevens’ proposal “for an amendment to the constitution that merely requires federal judges to apply the same rule in cases challenging political gerrymanders that they have applied to racial gerrymanders.” He contends that congressional and legislative districts should honor natural or historic boundary lines, something that New Jersey failed to do in drawing the boundaries of the 1983 congressional map. The court, in a 5-4 opinion, rejected the 1983 map as not having been drawn in good faith. The map, which Stevens describes as “bizarre,” “grotesque” and “uncouth,” is included as a full-page exhibit. His proposed amendment would require congressional and legislative districts to be “compact and composed of contiguous territory.” Stevens also proposes a constitutional amendment that would permit state and federal legislation prohibiting corporations from making unlimited contributions in political election campaigns, and authorize Congress and the states to place “reasonable limitations” on such contributions.
In one sense, Stevens’ proposed amendments are quixotic. In a larger sense they are inspiring, and may lead to action by a future generation.
Stewart Pollock, a retired justice of the Supreme Court of New Jersey, is of counsel to the law firm of Riker Danzig Scherer Hyland & Perretti. FOLLOW STAR-LEDGER OPINION: TWITTER • FACEBOOK
Inside Opinion
NJ.com opinion departments
More Contributors |
PerkinElmer Launches Automated Quantitative Pathology Imaging System
New Platform Helps Research Immuno-oncologists and Pathologists Accelerate the Study of Cancer
By PerkinElmer | January 31, 2017
PerkinElmer, Inc., a global leader committed to innovating for a healthier world, today announced the launch of its Vectra® Polaris™ Automated Quantitative Pathology Imaging System. This new multi-modal tissue imaging system enables researchers to gain a deeper level of understanding of disease mechanisms related to new cancer immunotherapy approaches.
The Vectra Polaris system integrates high throughput, seven-color multispectral imaging with whole-slide scanning in a simplified digital pathology workflow to support the quantification and analysis of tissue sections that are stained with multiple immunohistochemical stains. This helps scientists assess biomarkers that probe deeper into the biology occurring in the immune system and cancer by detecting multiple cell types and their functional states, while also allowing researchers to determine their spatial distributions.
“From basic research to clinical research studies, scientists continue to seek advanced imaging technologies to better analyze and understand disease mechanisms,” said Jim Corbett, Executive Vice President and President, Discovery & Analytical Solutions, PerkinElmer. “The Vectra Polaris system is an innovative solution that helps further the exploration of new cancer immunotherapy approaches to help unlock the promise of precision medicine.”
The Vectra Polaris system is part of PerkinElmer's Phenoptics™ workflow solution for quantitative pathology research, which enables exploration of the interaction between tumors and immune cells to obtain a deeper understanding of disease mechanisms.
“PerkinElmer's multiplex IHC platform has addressed a critical need in immuno-oncology research to reveal the cell-level biology occurring in the tumor and its microenvironment that drives disease progression and response to immunotherapy,” said Dr. Bernard A. Fox, PhD, Chief, Laboratory of Molecular and Tumor Immunology, Robert W. Franz Cancer Research Center in the Earle A. Chiles Research Institute at Providence Cancer Center (Oregon). “The development of the Vectra Polaris system has come at the right time, to support the transition from an exploratory research tool to a high throughput rugged high speed slide analysis research system that overlays PerkinElmer's unique multispectral technology on to a digital pathology workflow. I believe the Vectra technology will become the standard for tissue biomarker studies in immuno-oncology research and form the basis for tailoring cancer therapies of the future. '
For more information on the Vectra Polaris system, please visit www.perkinelmer.com/vectrapolaris
For more information on PerkinElmer’s Phenoptics solutions, please visit www.perkinelmer.com/cancer-immunology |
Gram stains: a resource for retrospective analysis of bacterial pathogens in clinical studies.
Usha Srinivasan, Sreelatha Ponnaluri, Lisa Villareal, Brenda Gillespie, Ai Wen, Arianna Miles, Brigette Bucholz, Carl F Marrs, Ram K Iyer, Dawn Misra, Betsy Foxman.
We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 10(8) cfu/ml of Escherichia coli and 10(5) cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces.
Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres
Authors: Tim J. Dumonceaux, Jennifer R. Town, Janet E. Hill, Bonnie L. Chaban, Sean M. Hemmingsen.
Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.
One-day Workflow Scheme for Bacterial Pathogen Detection and Antimicrobial Resistance Testing from Blood Cultures
Authors: Wendy L.J. Hansen, Judith Beuving, Annelies Verbon, Petra. F.G. Wolffs.
Institutions: Maastricht University Medical Center, Erasmus Medical Center.
Bloodstream infections are associated with high mortality rates because of the probable manifestation of sepsis, severe sepsis and septic shock1. Therefore, rapid administration of adequate antibiotic therapy is of foremost importance in the treatment of bloodstream infections. The critical element in this process is timing, heavily dependent on the results of bacterial identification and antibiotic susceptibility testing. Both of these parameters are routinely obtained by culture-based testing, which is time-consuming and takes on average 24-48 hours2, 4. The aim of the study was to develop DNA-based assays for rapid identification of bloodstream infections, as well as rapid antimicrobial susceptibility testing. The first assay is a eubacterial 16S rDNA-based real-time PCR assay complemented with species- or genus-specific probes5. Using these probes, Gram-negative bacteria including Pseudomonas spp., Pseudomonas aeruginosa and Escherichia coli as well as Gram-positive bacteria including Staphylococcus spp., Staphylococcus aureus, Enterococcus spp., Streptococcus spp., and Streptococcus pneumoniae could be distinguished. Using this multiprobe assay, a first identification of the causative micro-organism was given after 2 h. Secondly, we developed a semi-molecular assay for antibiotic susceptibility testing of S. aureus, Enterococcus spp. and (facultative) aerobe Gram-negative rods6. This assay was based on a study in which PCR was used to measure the growth of bacteria7. Bacteria harvested directly from blood cultures are incubated for 6 h with a selection of antibiotics, and following a Sybr Green-based real-time PCR assay determines inhibition of growth. The combination of these two methods could direct the choice of a suitable antibiotic therapy on the same day (Figure 1). In conclusion, molecular analysis of both identification and antibiotic susceptibility offers a faster alternative for pathogen detection and could improve the diagnosis of bloodstream infections.
Immunology, Issue 65, Infection, Medicine, Microbiology, Bacteria, real-time PCR, probes, pathogen detection, blood culture, 16S rDNA gene, antibiotic resistance, antibiotic susceptibility testing
Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR
Authors: Baoguang Li, Zonglin Hu, Christopher A. Elkins.
Institutions: Food and Drug Administration.
A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.
Microbiology, Issue 84, Propidium monoazide (PMA), real-time PCR, E. coli O157:H7, pathogen, selective detection, live cells
Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton
Authors: Steven Robbins, Jisha Jacob, Xinxin Lu, Mary Ann Moran, Xiaozhen Mou.
Institutions: Kent State University, University of Georgia (UGA).
Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.
Molecular Biology, Issue 55, BrdU incorporation, fluorescence-activated cell sorting, FACS, flow cytometry, microbial community, culture-independent, bacterioplankton
Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq
Authors: Phanidhar Kukutla, Matthew Steritz, Jiannong Xu.
Institutions: New Mexico State University.
The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity and functionality of the gut community will provide insight into the effects of gut microbiota on mosquito life traits. Metagenomic RNA-Seq has become an important tool to analyze transcriptomes from various microbes present in a microbial community. Messenger RNA usually comprises only 1-3% of total RNA, while rRNA constitutes approximately 90%. It is challenging to enrich messenger RNA from a metagenomic microbial RNA sample because most prokaryotic mRNA species lack stable poly(A) tails. This prevents oligo d(T) mediated mRNA isolation. Here, we describe a protocol that employs sample derived rRNA capture probes to remove rRNA from a metagenomic total RNA sample. To begin, both mosquito and microbial small and large subunit rRNA fragments are amplified from a metagenomic community DNA sample. Then, the community specific biotinylated antisense ribosomal RNA probes are synthesized in vitro using T7 RNA polymerase. The biotinylated rRNA probes are hybridized to the total RNA. The hybrids are captured by streptavidin-coated beads and removed from the total RNA. This subtraction-based protocol efficiently removes both mosquito and microbial rRNA from the total RNA sample. The mRNA enriched sample is further processed for RNA amplification and RNA-Seq.
Genetics, Issue 74, Infection, Infectious Diseases, Molecular Biology, Cellular Biology, Microbiology, Genomics, biology (general), genetics (animal and plant), life sciences, Eukaryota, Bacteria, metagenomics, metatranscriptome, RNA-seq, rRNA depletion, mRNA enrichment, mosquito gut microbiome, RNA, DNA, sequencing
Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients
Authors: Esther Merlini, Giusi M. Bellistri, Camilla Tincati, Antonella d'Arminio Monforte, Giulia Marchetti.
Institutions: San Paolo Hospital University of Milan, Italy.
The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development of the humoral and cellular mucosal immune system1,2. Microbiota is shielded from the immune system via a strong mucosal barrier. Infections and antibiotics are known to alter both the normal gastrointestinal tract barrier and the composition of resident bacteria, which may result in possible immune abnormalities3. HIV causes a breach in the gastrointestinal barrier with progressive failure of mucosal immunity and leakage into the systemic circulation of bacterial bioproducts, such as lipopolysaccharide and bacterial DNA fragments, which contribute to systemic immune activation4-7. Microbial translocation is implicated in HIV/AIDS immunopathogenesis and response to therapy 4,8. We aimed to characterise the composition of bacteria translocating in peripheral blood of HIV-infected patients. To pursue our aim we set up a PCR reaction for the panbacteric 16S ribosomial gene followed by a sequencing analysis. Briefly, whole blood from both HIV-infected and healthy subjects is used. Given that healthy individuals present normal intestinal homeostasis no translocation of microflora is expected in these patients. Following whole blood collection by venipuncture and plasma separation, DNA is extracted from plasma and used to perform a broad range PCR reaction for the panbacteric 16S ribosomial gene9. Following PCR product purification, cloning and sequencing analyses are performed.
Medicine, Issue 52, Plasma DNA extraction, 16S rRNA gene PCR, sequencing analysis, HIV
Preparation of a Blood Culture Pellet for Rapid Bacterial Identification and Antibiotic Susceptibility Testing
Authors: Antony Croxatto, Guy Prod'hom, Christian Durussel, Gilbert Greub.
Institutions: University Hospital Center and University of Lausanne.
Bloodstream infections and sepsis are a major cause of morbidity and mortality. The successful outcome of patients suffering from bacteremia depends on a rapid identification of the infectious agent to guide optimal antibiotic treatment. The analysis of Gram stains from positive blood culture can be rapidly conducted and already significantly impact the antibiotic regimen. However, the accurate identification of the infectious agent is still required to establish the optimal targeted treatment. We present here a simple and fast bacterial pellet preparation from a positive blood culture that can be used as a sample for several essential downstream applications such as identification by MALDI-TOF MS, antibiotic susceptibility testing (AST) by disc diffusion assay or automated AST systems and by automated PCR-based diagnostic testing. The performance of these different identification and AST systems applied directly on the blood culture bacterial pellets is very similar to the performance normally obtained from isolated colonies grown on agar plates. Compared to conventional approaches, the rapid acquisition of a bacterial pellet significantly reduces the time to report both identification and AST. Thus, following blood culture positivity, identification by MALDI-TOF can be reported within less than 1 hr whereas results of AST by automated AST systems or disc diffusion assays within 8 to 18 hr, respectively. Similarly, the results of a rapid PCR-based assay can be communicated to the clinicians less than 2 hr following the report of a bacteremia. Together, these results demonstrate that the rapid preparation of a blood culture bacterial pellet has a significant impact on the identification and AST turnaround time and thus on the successful outcome of patients suffering from bloodstream infections.
Immunology, Issue 92, blood culture, bacteriology, identification, antibiotic susceptibility testing, MALDI-TOF MS.
In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration
Authors: Mark E. Kusek, Michael A. Pazos, Waheed Pirzai, Bryan P. Hurley.
Institutions: Harvard Medical School, MGH for Children, Massachusetts General Hospital.
Mucosal surfaces serve as protective barriers against pathogenic organisms. Innate immune responses are activated upon sensing pathogen leading to the infiltration of tissues with migrating inflammatory cells, primarily neutrophils. This process has the potential to be destructive to tissues if excessive or held in an unresolved state. Cocultured in vitro models can be utilized to study the unique molecular mechanisms involved in pathogen induced neutrophil trans-epithelial migration. This type of model provides versatility in experimental design with opportunity for controlled manipulation of the pathogen, epithelial barrier, or neutrophil. Pathogenic infection of the apical surface of polarized epithelial monolayers grown on permeable transwell filters instigates physiologically relevant basolateral to apical trans-epithelial migration of neutrophils applied to the basolateral surface. The in vitro model described herein demonstrates the multiple steps necessary for demonstrating neutrophil migration across a polarized lung epithelial monolayer that has been infected with pathogenic P. aeruginosa (PAO1). Seeding and culturing of permeable transwells with human derived lung epithelial cells is described, along with isolation of neutrophils from whole human blood and culturing of PAO1 and nonpathogenic K12 E. coli (MC1000). The emigrational process and quantitative analysis of successfully migrated neutrophils that have been mobilized in response to pathogenic infection is shown with representative data, including positive and negative controls. This in vitro model system can be manipulated and applied to other mucosal surfaces. Inflammatory responses that involve excessive neutrophil infiltration can be destructive to host tissues and can occur in the absence of pathogenic infections. A better understanding of the molecular mechanisms that promote neutrophil trans-epithelial migration through experimental manipulation of the in vitro coculture assay system described herein has significant potential to identify novel therapeutic targets for a range of mucosal infectious as well as inflammatory diseases.
Infection, Issue 83, Cellular Biology, Epithelium, Neutrophils, Pseudomonas aeruginosa, Respiratory Tract Diseases, Neutrophils, epithelial barriers, pathogens, transmigration
A Mouse Model for Pathogen-induced Chronic Inflammation at Local and Systemic Sites
Authors: George Papadopoulos, Carolyn D. Kramer, Connie S. Slocum, Ellen O. Weinberg, Ning Hua, Cynthia V. Gudino, James A. Hamilton, Caroline A. Genco.
Institutions: Boston University School of Medicine, Boston University School of Medicine.
Chronic inflammation is a major driver of pathological tissue damage and a unifying characteristic of many chronic diseases in humans including neoplastic, autoimmune, and chronic inflammatory diseases. Emerging evidence implicates pathogen-induced chronic inflammation in the development and progression of chronic diseases with a wide variety of clinical manifestations. Due to the complex and multifactorial etiology of chronic disease, designing experiments for proof of causality and the establishment of mechanistic links is nearly impossible in humans. An advantage of using animal models is that both genetic and environmental factors that may influence the course of a particular disease can be controlled. Thus, designing relevant animal models of infection represents a key step in identifying host and pathogen specific mechanisms that contribute to chronic inflammation. Here we describe a mouse model of pathogen-induced chronic inflammation at local and systemic sites following infection with the oral pathogen Porphyromonas gingivalis, a bacterium closely associated with human periodontal disease. Oral infection of specific-pathogen free mice induces a local inflammatory response resulting in destruction of tooth supporting alveolar bone, a hallmark of periodontal disease. In an established mouse model of atherosclerosis, infection with P. gingivalis accelerates inflammatory plaque deposition within the aortic sinus and innominate artery, accompanied by activation of the vascular endothelium, an increased immune cell infiltrate, and elevated expression of inflammatory mediators within lesions. We detail methodologies for the assessment of inflammation at local and systemic sites. The use of transgenic mice and defined bacterial mutants makes this model particularly suitable for identifying both host and microbial factors involved in the initiation, progression, and outcome of disease. Additionally, the model can be used to screen for novel therapeutic strategies, including vaccination and pharmacological intervention.
Immunology, Issue 90, Pathogen-Induced Chronic Inflammation; Porphyromonas gingivalis; Oral Bone Loss; Periodontal Disease; Atherosclerosis; Chronic Inflammation; Host-Pathogen Interaction; microCT; MRI
VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance
Authors: Muthappa Senthil-Kumar, Hee-Kyung Lee, Kirankumar S. Mysore.
Institutions: The Samuel Roberts Noble Foundation.
Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important for developing durable disease-resistant plants against wide range of pathogens. Virus-induced gene silencing (VIGS)-based forward genetics screening is a useful approach for identification of plant defense genes imparting nonhost resistance. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector to date and has been efficiently used to silence endogenous target genes in Nicotiana benthamiana. In this manuscript, we demonstrate a forward genetics screening approach for silencing of individual clones from a cDNA library in N. benthamiana and assessing the response of gene silenced plants for compromised nonhost resistance against nonhost pathogens, Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea, and X. campestris pv. vesicatoria. These bacterial pathogens are engineered to express GFPuv protein and their green fluorescing colonies can be seen by naked eye under UV light in the nonhost pathogen inoculated plants if the silenced target gene is involved in imparting nonhost resistance. This facilitates reliable and faster identification of gene silenced plants susceptible to nonhost pathogens. Further, promising candidate gene information can be known by sequencing the plant gene insert in TRV vector. Here we demonstrate the high throughput capability of VIGS-mediated forward genetics to identify genes involved in nonhost resistance. Approximately, 100 cDNAs can be individually silenced in about two to three weeks and their relevance in nonhost resistance against several nonhost bacterial pathogens can be studied in a week thereafter. In this manuscript, we enumerate the detailed steps involved in this screening. VIGS-mediated forward genetics screening approach can be extended not only to identifying genes involved in nonhost resistance but also to studying genes imparting several biotic and abiotic stress tolerances in various plant species.
Virology, Issue 78, Plant Biology, Infection, Genetics, Molecular Biology, Cellular Biology, Physiology, Genomics, Pathology, plants, Nonhost Resistance, Virus-induced gene silencing, VIGS, disease resistance, gene silencing, Pseudomonas, GFPuv, sequencing, virus, Nicotiana benthamiana, plant model
Purification and Visualization of Lipopolysaccharide from Gram-negative Bacteria by Hot Aqueous-phenol Extraction
Authors: Michael R. Davis, Jr., Joanna B. Goldberg.
Institutions: University of Virginia Health System.
Lipopolysaccharide (LPS) is a major component of Gram-negative bacterial outer membranes. It is a tripartite molecule consisting of lipid A, which is embedded in the outer membrane, a core oligosaccharide and repeating O-antigen units that extend outward from the surface of the cell1, 2. LPS is an immunodominant molecule that is important for the virulence and pathogenesis of many bacterial species, including Pseudomonas aeruginosa, Salmonella species, and Escherichia coli3-5, and differences in LPS O-antigen composition form the basis for serotyping of strains. LPS is involved in attachment to host cells at the initiation of infection and provides protection from complement-mediated killing; strains that lack LPS can be attenuated for virulence6-8. For these reasons, it is important to visualize LPS, particularly from clinical isolates. Visualizing LPS banding patterns and recognition by specific antibodies can be useful tools to identify strain lineages and to characterize various mutants. In this report, we describe a hot aqueous-phenol method for the isolation and purification of LPS from Gram-negative bacterial cells. This protocol allows for the extraction of LPS away from nucleic acids and proteins that can interfere with visualization of LPS that occurs with shorter, less intensive extraction methods9. LPS prepared this way can be separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and directly stained using carbohydrate/glycoprotein stains or standard silver staining methods. Many anti-sera to LPS contain antibodies that cross-react with outer membrane proteins or other antigenic targets that can hinder reactivity observed following Western immunoblot of SDS-PAGE-separated crude cell lysates. Protease treatment of crude cell lysates alone is not always an effective way of removing this background using this or other visualization methods. Further, extensive protease treatment in an attempt to remove this background can lead to poor quality LPS that is not well resolved by any of the aforementioned methods. For these reasons, we believe that the following protocol, adapted from Westpahl and Jann10, is ideal for LPS extraction.
Immunology, Issue 63, Microbiology, Gram-negative, LPS, extraction, polysaccharide staining, Western immunoblot
RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract
Authors: Eduardo Lopez-Medina, Megan M. Neubauer, Gerald B. Pier, Andrew Y. Koh.
Institutions: University of Texas Southwestern Medical Center , Harvard Medical School, University of Texas Southwestern Medical Center .
Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host’s immune status. As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.
Immunology, Issue 55, Pseudomonas, RNA, murine, cecum, transcriptome, qPCR, RT-PCR, PCR
Isolation and Chemical Characterization of Lipid A from Gram-negative Bacteria
Authors: Jeremy C. Henderson, John P. O'Brien, Jennifer S. Brodbelt, M. Stephen Trent.
Institutions: The University of Texas at Austin, The University of Texas at Austin, The University of Texas at Austin.
Lipopolysaccharide (LPS) is the major cell surface molecule of gram-negative bacteria, deposited on the outer leaflet of the outer membrane bilayer. LPS can be subdivided into three domains: the distal O-polysaccharide, a core oligosaccharide, and the lipid A domain consisting of a lipid A molecular species and 3-deoxy-D-manno-oct-2-ulosonic acid residues (Kdo). The lipid A domain is the only component essential for bacterial cell survival. Following its synthesis, lipid A is chemically modified in response to environmental stresses such as pH or temperature, to promote resistance to antibiotic compounds, and to evade recognition by mediators of the host innate immune response. The following protocol details the small- and large-scale isolation of lipid A from gram-negative bacteria. Isolated material is then chemically characterized by thin layer chromatography (TLC) or mass-spectrometry (MS). In addition to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS, we also describe tandem MS protocols for analyzing lipid A molecular species using electrospray ionization (ESI) coupled to collision induced dissociation (CID) and newly employed ultraviolet photodissociation (UVPD) methods. Our MS protocols allow for unequivocal determination of chemical structure, paramount to characterization of lipid A molecules that contain unique or novel chemical modifications. We also describe the radioisotopic labeling, and subsequent isolation, of lipid A from bacterial cells for analysis by TLC. Relative to MS-based protocols, TLC provides a more economical and rapid characterization method, but cannot be used to unambiguously assign lipid A chemical structures without the use of standards of known chemical structure. Over the last two decades isolation and characterization of lipid A has led to numerous exciting discoveries that have improved our understanding of the physiology of gram-negative bacteria, mechanisms of antibiotic resistance, the human innate immune response, and have provided many new targets in the development of antibacterial compounds.
Chemistry, Issue 79, Membrane Lipids, Toll-Like Receptors, Endotoxins, Glycolipids, Lipopolysaccharides, Lipid A, Microbiology, Lipids, lipid A, Bligh-Dyer, thin layer chromatography (TLC), lipopolysaccharide, mass spectrometry, Collision Induced Dissociation (CID), Photodissociation (PD)
Fluorescence Microscopy Methods for Determining the Viability of Bacteria in Association with Mammalian Cells
Authors: M. Brittany Johnson, Alison K. Criss.
Institutions: University of Virginia Health Sciences Center.
Central to the field of bacterial pathogenesis is the ability to define if and how microbes survive after exposure to eukaryotic cells. Current protocols to address these questions include colony count assays, gentamicin protection assays, and electron microscopy. Colony count and gentamicin protection assays only assess the viability of the entire bacterial population and are unable to determine individual bacterial viability. Electron microscopy can be used to determine the viability of individual bacteria and provide information regarding their localization in host cells. However, bacteria often display a range of electron densities, making assessment of viability difficult. This article outlines protocols for the use of fluorescent dyes that reveal the viability of individual bacteria inside and associated with host cells. These assays were developed originally to assess survival of Neisseria gonorrhoeae in primary human neutrophils, but should be applicable to any bacterium-host cell interaction. These protocols combine membrane-permeable fluorescent dyes (SYTO9 and 4',6-diamidino-2-phenylindole [DAPI]), which stain all bacteria, with membrane-impermeable fluorescent dyes (propidium iodide and SYTOX Green), which are only accessible to nonviable bacteria. Prior to eukaryotic cell permeabilization, an antibody or fluorescent reagent is added to identify extracellular bacteria. Thus these assays discriminate the viability of bacteria adherent to and inside eukaryotic cells. A protocol is also provided for using the viability dyes in combination with fluorescent antibodies to eukaryotic cell markers, in order to determine the subcellular localization of individual bacteria. The bacterial viability dyes discussed in this article are a sensitive complement and/or alternative to traditional microbiology techniques to evaluate the viability of individual bacteria and provide information regarding where bacteria survive in host cells.
Microbiology, Issue 79, Immunology, Infection, Cancer Biology, Genetics, Cellular Biology, Molecular Biology, Medicine, Biomedical Engineering, Microscopy, Confocal, Microscopy, Fluorescence, Bacteria, Bacterial Infections and Mycoses, bacteria, infection, viability, fluorescence microscopy, cell, imaging
Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays
Authors: Alla Gagarinova, Mohan Babu, Jack Greenblatt, Andrew Emili.
Institutions: University of Toronto, University of Toronto, University of Regina.
Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10. Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.
Genetics, Issue 69, Molecular Biology, Medicine, Biochemistry, Microbiology, Aggravating, alleviating, conjugation, double mutant, Escherichia coli, genetic interaction, Gram-negative bacteria, homologous recombination, network, synthetic lethality or sickness, suppression
Unraveling the Unseen Players in the Ocean - A Field Guide to Water Chemistry and Marine Microbiology
Authors: Andreas Florian Haas, Ben Knowles, Yan Wei Lim, Tracey McDole Somera, Linda Wegley Kelly, Mark Hatay, Forest Rohwer.
Institutions: San Diego State University, University of California San Diego.
Here we introduce a series of thoroughly tested and well standardized research protocols adapted for use in remote marine environments. The sampling protocols include the assessment of resources available to the microbial community (dissolved organic carbon, particulate organic matter, inorganic nutrients), and a comprehensive description of the viral and bacterial communities (via direct viral and microbial counts, enumeration of autofluorescent microbes, and construction of viral and microbial metagenomes). We use a combination of methods, which represent a dispersed field of scientific disciplines comprising already established protocols and some of the most recent techniques developed. Especially metagenomic sequencing techniques used for viral and bacterial community characterization, have been established only in recent years, and are thus still subjected to constant improvement. This has led to a variety of sampling and sample processing procedures currently in use. The set of methods presented here provides an up to date approach to collect and process environmental samples. Parameters addressed with these protocols yield the minimum on information essential to characterize and understand the underlying mechanisms of viral and microbial community dynamics. It gives easy to follow guidelines to conduct comprehensive surveys and discusses critical steps and potential caveats pertinent to each technique.
Environmental Sciences, Issue 93, dissolved organic carbon, particulate organic matter, nutrients, DAPI, SYBR, microbial metagenomics, viral metagenomics, marine environment
Electroporation of Mycobacteria
Authors: Renan Goude, Tanya Parish.
Institutions: Barts and the London School of Medicine and Dentistry, Barts and the London School of Medicine and Dentistry.
High efficiency transformation is a major limitation in the study of mycobacteria. The genus Mycobacterium can be difficult to transform; this is mainly caused by the thick and waxy cell wall, but is compounded by the fact that most molecular techniques have been developed for distantly-related species such as Escherichia coli and Bacillus subtilis. In spite of these obstacles, mycobacterial plasmids have been identified and DNA transformation of many mycobacterial species have now been described. The most successful method for introducing DNA into mycobacteria is electroporation. Many parameters contribute to successful transformation; these include the species/strain, the nature of the transforming DNA, the selectable marker used, the growth medium, and the conditions for the electroporation pulse. Optimized methods for the transformation of both slow- and fast-grower are detailed here. Transformation efficiencies for different mycobacterial species and with various selectable markers are reported.
Microbiology, Issue 15, Springer Protocols, Mycobacteria, Electroporation, Bacterial Transformation, Transformation Efficiency, Bacteria, Tuberculosis, M. Smegmatis, Springer Protocols
Purifying Plasmid DNA from Bacterial Colonies Using the Qiagen Miniprep Kit
Authors: Shenyuan Zhang, Michael D. Cahalan.
Institutions: University of California, Irvine (UCI).
Plasmid DNA purification from E. coli is a core technique for molecular cloning. Small scale purification (miniprep) from less than 5 ml of bacterial culture is a quick way for clone verification or DNA isolation, followed by further enzymatic reactions (polymerase chain reaction and restriction enzyme digestion). Here, we video-recorded the general procedures of miniprep through the QIAGEN's QIAprep 8 Miniprep Kit, aiming to introducing this highly efficient technique to the general beginners for molecular biology techniques. The whole procedure is based on alkaline lysis of E. coli cells followed by adsorption of DNA onto silica in the presence of high salt. It consists of three steps: 1) preparation and clearing of a bacterial lysate, 2) adsorption of DNA onto the QIAprep membrane, 3) washing and elution of plasmid DNA. All steps are performed without the use of phenol, chloroform, CsCl, ethidium bromide, and without alcohol precipitation. It usually takes less than 2 hours to finish the entire procedure.
Issue 6, Basic Protocols, plasmid, DNA, purification, Qiagen |
Ecologists gain insight into the likely consequences of global warming
A new insight into the impact that warmer temperatures could have across the world has been uncovered by scientists.
A new insight into the impact that warmer temperatures could have across the world has been uncovered by scientists at Queen Mary, University of London.
The research, published in the journal Global Change Biology on January 20, found that the impact of global warming could be similar across ecosystems, regardless of local environmental conditions and species.
The team, based at Queen Mary's School of Biological and Chemical Sciences, went to Iceland to study a set of geothermally-heated streams.
The streams provided scientists with a unique environment to conduct their research; they were able to isolate the effects of temperature from other confounding variables found in nature.
Lead author, Queen Mary's Dr Daniel Perkins, explains: "The streams in Iceland are all very similar, in terms of their physical and chemical environment, but maintain very different temperatures to each other all year round.
"This enabled us to explore how temperature, both past and present, affects the rate at which respiration responds to temperature in ecosystems."
Dr Perkins said that when the team exposed the organisms found in streams to a range of temperatures "the rate at which carbon was respired increased with temperature as expected, but surprisingly, rate of increase was consistent across streams which differed in average temperature by as much as 20°C."
Co-author Dr Gabriel Yvon-Durocher, also from Queen Mary, said: "Our findings demonstrate that the intrinsic temperature sensitivity of respiration is the same across a diverse range of organisms, adapted to markedly different temperatures. This result is important because it will help us build more accurate models to predict how rates of carbon dioxide emission from ecosystem will respond to the temperature increases forecast in the coming decades."
Dr Yvon-Durocher concludes: "Our results shed light on the temperature sensitivity of respiration over time scales of days to weeks, real differences between ecosystems may be apparent over longer time scales (e.g. years to decades), and progress in understanding these long-term responses will be key to predicting the future feedbacks between ecosystems and the climate."
Daniel M. Perkins, Gabriel Yvon-Durocher, Benoît O.L. Demars, Julia Reiss, Doris E. Pichler, Nikolai Friberg, Mark Trimmer, Guy Woodward. Consistent temperature dependence of respiration across ecosystems contrasting in thermal history. Global Change Biology, 2012; DOI: 10.1111/j.1365-2486.2011.02597.x
Wiley-Blackwell. "Ecologists gain insight into the likely consequences of global warming." ScienceDaily. ScienceDaily, 20 January 2012. <www.sciencedaily.com/releases/2012/01/120120183034.htm>.
Wiley-Blackwell. (2012, January 20). Ecologists gain insight into the likely consequences of global warming. ScienceDaily. Retrieved October 8, 2015 from www.sciencedaily.com/releases/2012/01/120120183034.htm
Wiley-Blackwell. "Ecologists gain insight into the likely consequences of global warming." ScienceDaily. www.sciencedaily.com/releases/2012/01/120120183034.htm (accessed October 8, 2015).
Winter storm
Temperature record of the past 1000 years
Chicxulub Crater
Earth & Climate News
Oct. 8, 2015 Fish caught near waste water plants display a higher rate of endocrine disruptors, researchers have found. Deformities, feminization and fall in ... read more Fracking Industry Wells Associated With Premature Birth
Oct. 8, 2015 Expectant mothers who live near active natural gas wells operated by the fracking industry in Pennsylvania are at an increased risk of giving birth prematurely and for having high-risk pregnancies, ... read more Possible Fungal Control for Leaf-Cutter Ants
Oct. 7, 2015 Biologists have found new types of specialized fungal parasites that attack the nests of leaf-cutter ants and their relatives. The discovery could provide clues for ... read more Distinguishing Coincidence from Causality: Connections in the Climate System
Oct. 7, 2015 A new fracturing fluid has been created that may increase the ability to develop geothermal energy, scientists report. This advance of tapping the natural heat of Earth may ... read more High-Arctic Butterflies Shrink With Rising Temperatures
Oct. 7, 2015 New research shows that butterflies in Greenland have become smaller in response to increasing temperatures due to ... read more Knee-Deep in Spider Leg Evolution
Oct. 6, 2015 Biologists have identified the driving force behind the evolution of a leg novelty first found in ... read more Ancient Rocks Record First Evidence for Photosynthesis That Made Oxygen
Oct. 6, 2015 A new study shows that iron-bearing rocks that formed at the ocean floor 3.2 billion years ago carry unmistakable evidence of oxygen. The only logical source for that oxygen ... read more Global Climate Agreements Could Be Counterproductive
Oct. 5, 2015 International climate agreements like the Kyoto Protocol may discourage much-needed investment in renewable energy sources, and hence be counterprodutive, according to new ... read more Tiny Ancient Fossil from Spain Shows Birds Flew Over the Heads of Dinosaurs
Oct. 6, 2015 A new discovery documents the intricate arrangement of the muscles and ligaments that controlled the main feathers of the wing of an ancient bird, supporting the notion that ... read more Fish Problems Near Waste Water Treatment Plants
Climate System: Coincidence Versus Causality
High-Arctic Butterflies Shrink With Rising Temps
Knee-Deep in Spider Leg Evolution
Are Global Climate Agreements Counterproductive?
Global Warming Skeptics Unmoved by Extreme Weather
Nov. 24, 2014 What will it take to convince skeptics of global warming that the phenomenon is real? Surely, many scientists believe, enough droughts, floods and heat waves will begin to change minds. But a new ... read more Study Suggests Non-Uniform Climate Warming Globally
Mar. 5, 2014 A recent study of five decades of satellite data, model simulations and in situ observations suggests the impact of seasonal diurnal or daily warming varies between global regions affecting many ... read more Herbivore Populations Will Go Down as Temperatures Go Up
Oct. 4, 2011 As climate change causes temperatures to rise, the number of herbivores will decrease, affecting the human food supply, according to new ... read more How Global Warming Could Cause Animals to Shrink
Sep. 27, 2011 The way in which global warming causes many of the world's organisms to shrink has been revealed by new ... read more Strange & Offbeat |
The Seductiveness of the Interval
Hamza Walker, 2010
In 2006, Romanian President Traian Basescu organized the Commission for the Study of the Communist Dictatorship in Romania. Conducted 17 years after the fall of Nicolei Ceausescu’s regime, the commission’s goal remains unclear. Was it prompted by the pursuit of justice? Was it simply a matter of historical record? Or was it to acknowledge a painful chapter in the nation’s history, which in turn would serve as the basis for healing à la South Africa’s Truth and Reconciliation Commission? In any case, the report calls into question the perspective and time frame needed to construct a national narrative in the wake of revolutionary change as Romania transitioned from a communist dictatorship to a democracy. Making up for all that was left unknown and unexpressed is a task for the last generation of artists and intellectuals bearing an imprint, however faint, of life under Ceausescu’s regime. Such is the case with the artists Stefan Constantinescu (b. 1968), Adrea Faciu (b. 1977), and Ciprian Muresan (b. 1977) participating in Seductiveness of the Interval.
Curated by Alina Serban, and initially shown in the Romanian pavilion of the 2009 Venice Biennale, Seductiveness is a group exhibition conceived in terms of theater, where the works are installed in an architectural structure amounting to a stage set. Designed by studioBASAR (Alex Axinte and Cristi Borcan), this structure will be reconstructed in its entirety in The Society’s gallery. Seductiveness is less directly concerned with Romania’s communist past than it is with how that past inflects considerations of current sociopolitical affairs. Whether it is a story of exile and displacement as in Constantinescu’s video Passenger, a first person account of a small group of Chilean political refugees who, after fleeing one dictator (Pinochet), are given asylum by another (Ceausescu); or Muresan’s video, Dog Luv, whose screenplay, by Saviana Stanescu, is a cross between George Orwell’s Animal Farm and reports of torture at Abu Ghraib; or Faciu’s EXUBERENTIA suspended, which uses a garden as metaphor for the fleetingness and frailty of life, these works are reflections on moral progress from the perspective of a generation of artists with vivid memories of life under a highly repressive political regime.
Over and above the works’ shared sociopolitical backdrop, studioBASAR’s elegant structure literally and poetically unifies them, eliciting an existential resonance between the works. The rooms housing the works are separated by open areas, or intervals, interspersed throughout the structure. Set within an overarching structure, the experience is one in which the viewer becomes an actor aware of themself in the role as viewer. In this theater of self-reflexivity, the works become parts of a much grander narrative that for want of a better term goes by the name “the human condition.” However relative the terms are from one country to the next, hope and despair nonetheless remain universal. In the era of globalization, grave acts of inhumanity and courageous acts of humanity know no national borders. Our perception of the rate at which the human condition could be said to improve not only depends on the headline events but on whether or not there are indeed roses to stop and smell.
May 2–Jun 27, 2010 |
General LGBT Health
Promoting LGBT health and wellbeing through inclusive policy development
In this paper we argue the importance of including gender and sexually diverse populations in policy development towards a more inclusive form of health promotion. We emphasize the need to address the broad health and wellbeing issues and needs of LGBT people, rather than exclusively using an illness-based focus such as HIV/AIDS. We critically examine the limitations of population health, the social determinants of health (SDOH), and public health goals, in light of the lack of recognition of gender and sexually diverse individuals and communities. By first acknowledging the unique health and social care needs of LGBT people, then employing anti-oppressive, critical and intersectional analyses we offer recommendations for how to make population health perspectives, public health goals, and the design of public health promotion policy more inclusive of gender and sexual diversity. In health promotion research and practice, representation matters. It matters which populations are being targeted for health promotion interventions and for what purposes, and it matters which populations are being overlooked. In Canada, current health promotion policy is informed by population health and social determinants of health (SDOH) perspectives, as demonstrated by Public Health Goals for Canada. With Canada's multicultural makeup comes the challenge of ensuring that diverse populations are equitably and effectively recognized in public health and health promotion policy.
Whose public health? An intersectional approach to sexual orientation, gender identity, and the development of public health goals for Canada
In this discussion paper, we review Canada’s contributions to the field of public health, with a particular emphasis on the failure of interventions aimed at individual behaviours or risk variables to adequately address key determinants of health for lesbian, gay, bisexual, transgender, transsexual, Two-Spirit, intersex, and queer (LGBTTTIQ)1 people. The ongoing process of defining new public health goals for Canada is used to illustrate how an intersectional approach to public health could more effectively address the social determinants of health for LGBTTTIQ people.
Addressing the Needs of Lesbian, Gay, Bisexual, Transgendered, Queer, and Questioning Clients within University Psychiatric Services: Reflections and Recommendations
Concerns still exist among lesbian-, gay-, bisexual-, transgendered-, and queer-identified individuals (LGBTQ individuals) about their reception and treatment by psychiatric service providers. The Psychiatric Service at the University of Toronto and the Office of LGBTQ Resources and Programs convened a committee to address expanding the capacities of the Service related to the needs of LGBTQ and questioning students. In this paper, we describe the committee's role, initiatives, and successes and discuss challenges encountered in the process. The model of community development drawn from in this work can be adapted for use in other community health settings.
Can Talking About Oppression Reduce Depression? – Modified CBT Group Treatment for LGBT People with Depression
Research has demonstrated that rates of depression are elevated among lesbian, gay, bisexual and transsexual (LGBT) people as a result of social stigmatization. However, few studies have investigated interventions which address the proposed causes of depression for LGBT people (i.e., internalized and external oppression). This study tested a cognitive behavioural therapy-based group intervention for LGBT people living with depression, which was delivered based on anti-oppression principles and included sessions on coming out and internalized homophobia. Participants demonstrated statistically significant reductions in symptoms of depression, and statistically significant increases in self-esteem, following the intervention. Implications for service delivery to LGBT people are discussed.
Breaking the Silence: Sexual Orientation in Social Work Field Education
The purpose of this study was to explore field instructors' experiences and insights in working with lesbian and gay MSW students. In-depth 1-to 1.5-hour interviews were conducted with 8 field instructors selected using purposive sampling. Data were analyzed using narrative thematic analysis and a constant comparative method. One set of themes emerged across all informants; a second set emerged exclusively from lesbian-and gay-identified informants. Dynamic interactions among the student, the field instructor–student relationship, and the agency context suggest the importance of moving beyond individual-level conceptualizations to address sexual orientation-related barriers and opportunities in field education.
Being Recognized, Accepted, and Affirmed: Self-Disclosure of Lesbian/Queer Sexuality Within Psychiatric and Mental Health Service Settings
This article explores the relationship between self-disclosure of lesbian/queer (LQ) sexuality and well-being and recovery as described by women who either identify as consumer/survivors of psychiatric and mental health services and/or who work as mental health service providers within hospital- and community-based psychiatric and mental health service settings. I explore the relationship between self-disclosure and well-being and recovery by examining three points that frame women's ideas and experiences of self-disclosure including: (a) The negation and dismissal of lesbian/queer sexuality as an identity, (b) the closing off or compartmentalizing of concerns by lesbian/queer women, and (c) sexuality as a potential source of stress and/or support for lesbian/queer women.
LGBT Mental Health Fact Sheet
LGBT Sexual Health Fact Sheet
Resources for Researchers and Service Providers
Creating Together: Developing a Mental Health and Addictions Research Agenda for Ontario - LGBT Consultation
Asking the Right Questions 2: Talking with clients about sexual orientation and gender identity in mental health, counseling and addiction settings
Rainbow Health Ontario Resource Database
Rainbow Health Network
Gay and Lesbian Medical Association |
California Requirements for a Gluten Free Commercial Kitchen
By Leanne Clute
Leanne Clute
Female chef cooking in a restaurant kitchen (Image: Dick Luria/Photodisc/Getty Images)
For decades doctors believed that a gluten-free diet was only designed for those with celiac disease. There has recently been a growing trend in the medical community of announcing conditions that can be treated using a gluten-free diet; autism, dermatitis herpetiformis and gastroesophegeal reflux disease (GERD) are a few of these medical conditions. The result of these discoveries has lead to more and more companies, restaurants and bakeries manufacturing gluten-free products. In order to be deemed a gluten-free commercial kitchen in California, a company needs to be certified by the Gluten Intolerant Group or other nonprofit organization. The regulations are the same nationwide; there are no specific requirements for California versus other states.
Prep Area
The preparation area of a gluten-free commercial kitchen is the most scrutinized part of earning a certificate. If the facility manufactures products that both contain gluten and those that do not, there is a high risk of cross contamination if the proper precautions are not taken. Kitchens should have two completely separate prep areas, one for gluten-free and one for regular products. Each kitchen area should have its own equipment for any piece that cannot be fully washed or is prone to absorb residue from items cut, cooked or baked in it. This includes commercial mixers, toasters, plastic cutting boards, stoneware and wooden spoons. Wheat flour can float in the air for up to seven days and amounts as small as 20 parts per million (ppm) of gluten can affect a sensitive person adversely.
Restaurants that choose to offer gluten-free meals need to take special precautions, especially during rush hours. Freshly-cleaned pots, pans and utensils should always be on hand for gluten-free orders. Gloves should be changed before beginning to prepare a gluten-free meal. The Gluten Intolerance Group is the primary source for obtaining a gluten free certificate for any commercial kitchen. The group works hand in hand with companies to teach them how to prepare and store food as well as how to keep their kitchens safe for gluten-free diners.
Dual-purpose kitchens need to have separate storage areas for gluten-free and regular flours to avoid cross-contamination through the air. Gluten-free flours are unbleached and organic, which makes them susceptible to expire quickly. Excess flour that is not in use or will not be used within 14 days should be kept in a freezer. The Gluten Intolerant Group will check ingredients and products regularly to ensure the parts per million of gluten is within the acceptable range (5 to 10 ppm).
Food Service Warehouse: Tips for Baking in Rented Commercial Kitchen Space
Commercial Kitchen Requirements
Commercial kitchens must follow state and federal guidelines regarding equipment specifications, public safety and taxation.
How to Obtain Certification for a Commercial Kitchen
How to Rent a Commercial Kitchen for Baking
Gluten-Free Sources of Fiber
You may worry that you're not getting enough fiber in your gluten-free diet. After all, the grains that contain the gluten protein...
California Requirements for a Commercial Kitchen
Requirements for a Commercial Kitchen in Illinois
Gluten is a protein that is found in wheat, wheat-related spices and foods processed in wheat or wheat flour. If you have...
How to Lose Weight With Gluten-Free Foods
9 Gluten-Free Baking Tips
Best Diet to Control GERD
How to Identify Symptoms of Celiac Disease
Will a Liquid Diet Help GERD?
Can Acid Reflux Cause Heart Palpitations? |
Harvard Women's Health Watch
In Brief: Cognitive behavioral therapy helps ease tinnitus discomforts
Cognitive behavioral therapy helps ease tinnitus discomforts
Published: April, 2007
Most of us have experienced ringing in the ears, often after
exposure to loud noise. Although it's a bother, it usually goes
away. But not for the 50 million Americans — roughly one in three
people ages 55 and over — who suffer from tinnitus. For them, the
ringing (or sometimes buzzing, hissing, humming, or cricket-like
chirping) is more or less continuous. These sounds have no
external source, and with rare exceptions, no one else can hear
them. For about 1% of tinnitus sufferers, the symptoms can
interfere with day-to-day functioning and even lead to
Tinnitus has many causes, and no single treatment will work for
everyone. But a review by the Cochrane Collaboration (an
international group that reviews and analyzes medical research)
suggests that cognitive behavioral therapy (CBT) can help improve
quality of life for many who have the condition. CBT is a form of
psychotherapy that focuses on making changes in patterns of
thinking in order to alter responses to troubling thoughts,
feelings, or behavior. The Cochrane review, published in January
2007, analyzed six small but well-designed randomized controlled
trials that tested the value of CBT as a treatment for tinnitus
in 285 participants.
Create a meditation spot
Meditation relieves anxiety, pain, and depression by reducing the amount of the stress hormone cortisol in your bloodstream. Add meditation into your day by setting aside a time and place devoted to deep breathing and focus. Meditating a few minutes a day for a week or two can improve mood and stress levels. |
The Appliance Of Compliance
BY Louise T. Dunne
Sector-specific, geographic and legal obligations are creating a multi-layered millstone of compliance around the neck of industry. Businesses striving to achieve regulatory compliance often end up with management systems for each certification, resulting in multiple data silos.
Consequently, many organisations are carrying deadweight in the form of duplicated data or are applying inconsistent practices, policies and procedures to satisfy the requirements of each standard.
Today’s compliance landscape presents a complex maze of ever-shifting requirements with compliance standards routinely revised and updated. New iterations of standards such as PCI DSS 3.0 and ISO27001:2013, PAS 99 etc will add further complexity.
In particular, ISO27001:2005 (soon to be ISO27001:2013) is becoming a critical compliance element for those organisations wishing to demonstrate appropriate data in the light of new cyber threat and internet borne attacks. But achieving compliance will often be an arduous undertaking requiring the transition of data from one compliance standard to the next.
However, shifting compliance requirements need not be a daunting prospect. Through the use of strategic management it is possible to rationalise, simplify and reduce the cost of compliance. By bringing together multiple standards, governance frameworks and associated management systems under a Compliance Management strategy, it becomes possible to generate cost savings, improve efficiency and create data transparency.
Compliance Management is an emerging discipline that allows various standards to be supported at the same time, without duplication, enabling the organisation to accommodate change cost effectively and efficiently.
It involves the combined management of compliance standards by centralising standards and using commonalities to derive a common framework, whilst modelling the business processes to ensure success with implementation. Compliance standards and systems often have shared requirements and by identifying these it is possible to create efficiencies, reduce costs and the diminish the drain on resources.
Compliance standards often have many aspects in common despite focusing on very different areas; be it information security, quality, or environmental health, for example. Management systems also have commonalities that lend themselves to being managed in an integrated way. For example, there will often be areas of overlap between compliance requirements such as:
Policy and Procedural Authoring
Risk Management and Methodology
Formal management system implementation
Certification matrices
Auditing practices.
By determining and using these repeat processes to create a single point from which to manage related and disparate standards, it becomes possible to reduce resource requirements, reuse common documentation requirements, eliminate duplicated documents and governance, and increase visibility and governance at Board level.
Yet the appliance of Compliance Management should not be relegated to box-ticking and deduplication. It provides a real opportunity to get to grips with the business and gain insight into how the organisation functions as a whole. By looking at the business in its entirety, a solution can be designed that will rationalise processes and maximise management buy-in.
This starts at the grass roots, with simple considerations such as how roles and responsibilities are assigned. For example, if implemented correctly, role-based access can not only ensure accountability but also promote communication across the enterprise and create better visibility of the way the business functions all the way up to board-level.
When initiated with a business process modelling strategy in this way, the benefits of Compliance Management can be even broader, helping to lower system maintenance costs, reduce training and support, improve consistency and structure, and create a transparent enterprise where management are able to make better, informed decisions.
Louise T. Dunne Louise T Dunne is MD of Auriga, a data, ICT and security consultancy that blends security with business process to provide business insight. She has extensive governance, risk and compliance knowledge having worked in information security for over a decade. A CESG Marketing Management Forum Member, IISP member with ITPC status, BSI BS 25999 Business Continuity Practitioner, CESG CLAS consultant, BSI Qualified ISO27001 Lead Auditor, and a Professional Member of the BCS and a BCS Qualified Business Process Modeller, she has also sat on the Management Committee for the Tiger Penetration Testing Scheme and was a Founder Member of the CREST Scheme. Louise is actively engaged in public and private sector security projects and regularly publishes articles and speaks about security. Website Email |
Light-driven 'Molecular Brakes' Provide Stopping Power For Nanomachines
Researchers in Taiwan report development of a new type of "molecular brake" that could provide on-demand stopping power for futuristic nanomachines. The brake, thousands of times smaller than the width of a human hair, is powered by light and is the first capable of working at room temperature, the researchers say.
Their study is scheduled for the June 5 issue of ACS' Organic Letters, a bi-weekly journal.
In the new study, Jye-Shane Yang and colleagues point out that the ability to control specific motions of small molecules or larger molecular structures is essential for the development of nanomachines. Some of these machines may find use in delivering drugs or performing surgery deep inside the human body.
Although scientists have already built molecular motors, wheels, and gears for powering nanomachines, the development of a practical braking system remains a challenge, the researchers say.
Yang’s group assembled a prototype molecular brake that resembles a tiny four-bladed wheel and contains light-sensitive molecules. The paddle-like structure spins freely when a nanomachine is in motion. In laboratory studies, the scientists showed that exposing the structure to light changes its shape so that "blades" stop spinning, putting on the brakes. The braking power can be turned off by altering the wavelength of light exposure, they add.
Yang, Jye-Shane, Huang, Yao-Ting, Ho, Jinn-Hsuan, Sun, Wei-Ting, Huang, Hsin-Hau, Lin, Ying-Chih, Huang, Shing-Jong, Huang, Shou-Ling, Lu, Hsiu-Feng, and Chao, Ito. A Pentiptycene-Derived Light-Driven Molecular Brake. Org. Lett., 2008 doi: 10.1021/ol800689a
American Chemical Society. "Light-driven 'Molecular Brakes' Provide Stopping Power For Nanomachines." ScienceDaily. ScienceDaily, 27 May 2008. <www.sciencedaily.com/releases/2008/05/080526153228.htm>.
American Chemical Society. (2008, May 27). Light-driven 'Molecular Brakes' Provide Stopping Power For Nanomachines. ScienceDaily. Retrieved August 29, 2016 from www.sciencedaily.com/releases/2008/05/080526153228.htm
American Chemical Society. "Light-driven 'Molecular Brakes' Provide Stopping Power For Nanomachines." ScienceDaily. www.sciencedaily.com/releases/2008/05/080526153228.htm (accessed August 29, 2016).
Carbon nanotube
Fullerene
Electricity generation
Synthetic Biology: Engineering a Chemical Switch Into a Light-Driven Proton Pump
Aug. 9, 2016 Synthetic biology is an emerging and rapidly evolving engineering discipline. Now scientists have engineered a chemically switchable version of the light-driven proton pump proteorhodopsin -- an ... read more Nanomachines: Pirouetting in the Spotlight
Sep. 29, 2015 Scientists have developed a new class of molecular motors that rotate unidirectionally at speeds of up to 1 kHz when exposed to sunlight at room temperature. This unique combination of features opens ... read more Nanoshuttle Wear and Tear: It’s the Mileage, Not the Age
Jan. 26, 2015 As nanomachine design advances, researchers are moving from wondering if the nanomachine works to how long it will work -- an important question as there are so many potential applications, e.g., for ... read more Molecular Motors: Power Much Less Than Expected?
Aug. 28, 2013 An innovative measurement method has been used for estimating power generated by motors of single molecule in size, comprising a few dozens atoms only. The findings of the study are of crucial ... read more Strange & Offbeat |
New mouse model reveals a mystery of Duchenne muscular dystrophy
Stanford University Medical Center
Children with Duchenne muscular dystrophy often die as young adults from heart and breathing complications. Now, researchers have developed a mouse model that accurately mimics the course of the disease in humans.
Children with Duchenne muscular dystrophy often die as young adults from heart and breathing complications. However, scientists have been puzzled for decades by the fact that laboratory mice bearing the same genetic mutation responsible for the disease in humans display only mild symptoms and no cardiac involvement.
Now, researchers at the Stanford University School of Medicine have developed a mouse model that accurately mimics the course of the disease in humans. The study is the first to demonstrate a molecular basis for the cardiac defect that is the primary killer of people with Duchenne muscular dystrophy. Furthermore, the study provides evidence for a potential treatment to help prolong heart function. The mouse model also will allow researchers and clinicians to test a variety of therapies for the inherited condition.
"Until now, scientists had no animal model of Duchenne muscular dystrophy that manifests the symptoms of the cardiac disease that kills children and young adults with the condition," said Helen Blau, PhD, the Donald E. and Delia B. Baxter Professor at Stanford and director of the Baxter Laboratory for Stem Cell Biology. "This has been a conundrum for three decades. We found that mice with moderately shortened telomeres and the Duchenne mutation exhibit profound cardiac defects and die at a young age, just like human patients."
Blau, who is also a member of the Stanford University Institute for Stem Cell Biology and Regenerative Medicine and a professor of microbiology and immunology, is the senior author of the study, which will be published July 7 in Nature Cell Biology. Foteini Mourkioti, PhD, an instructor at the Baxter Laboratory, is the lead author of the study.
The investigators found that the reason humans suffer more serious symptoms than mice has to do with the length of the protective caps, called telomeres, on the ends of chromosomes: Mice have telomeres about 40 kilobases in length, while human telomeres range from around 5 to 15 kilobases (a kilobase is 1,000 nucleotides). When the investigators introduced a second mutation in the animals that reduced telomere length to more closely match that of humans, the animals began to display the typical symptoms of the disease, including progressive muscle weakness, enlarged hearts and significantly shortened life spans.
Duchenne muscular dystrophy is the most prevalent form of the heritable muscular dystrophies. It is caused by mutations in the dystrophin gene that inhibit the production of the dystrophin protein, which connects the inside of the muscle cell to the outside matrix. The new mouse model showed that, in the absence of the dystrophin protein, the animals' heart muscle cells accumulate stress and damage due to repetitive contraction. Early treatment of a small group of animals with antioxidants protected their heart function and prolonged their lives.
Interestingly, cells in the animals from tissues that normally express dystrophin had telomeres much shorter than those in other tissues in the body that don't rely on the protein. This discovery indicates that the lack of the protein further exacerbates telomere shrinking -- a fact borne out when the researchers compared affected mice and humans.
"Telomeres in heart muscle cells from four young men who had died of Duchenne muscular dystrophy were about half the length of control samples," Mourkioti said. "They are greatly shortened."
In the context of shortened telomeres, the dystrophin mutation in the mice leads to significant impairment of cardiac function. "Essentially, the heart cannot contract well," said Mourkioti, who performed a variety of functional and imaging tests, including electrocardiograms, echocardiography and MRIs, on mice in the study. When she looked at the heart muscle cells, or cardiomyocytes, of animals with the two mutations, she found damage to the cells' energy generators, or mitochondria, along with several signs of oxidative stress. (Oxidative stress is caused by byproducts of mitochondrial metabolism known as reactive oxygen species, which damage DNA.)
To test their theory, Blau and Mourkioti treated affected animals with two different antioxidants to neutralize the reactive oxygen species -- one provided in the animals' diet and another injected into the abdomen. In each of the two groups, the 10 treated animals exhibited improvements in heart function and life span when compared to 10 control animals.
"We began the treatment when the animals were 8 weeks old, before they had begun to develop cardiac symptoms of the disorder," Blau said. "But it may be that treatment even earlier would have an even more marked effect."
Although very encouraging, researchers caution that further studies are required to determine the effect of early antioxidant treatment on patients with Duchenne muscular dystrophy.
"The important thing is that we finally have a mouse model with which we can begin testing a number of potential therapies," Blau said. "Until now, no one really understood the cardiac basis of the disease, and clinicians have been prescribing nonspecific treatments. Now we can develop more specific drugs for patients that target the cause of their cardiac dysfunction."
The new mouse model may also be applicable to the study of other inherited conditions.
"Seeing this in the heart gave us new insight," said Blau. "It's possible that the effect of shortened telomeres may be relevant to diseases other than that caused by Duchenne muscular dystrophy. Many mouse models that now fail to recapitulate human diseases may be improved by similar shortening of telomeres."
Materials provided by Stanford University Medical Center. Original written by Krista Conger. Note: Content may be edited for style and length.
Stanford University Medical Center. "New mouse model reveals a mystery of Duchenne muscular dystrophy." ScienceDaily. ScienceDaily, 7 July 2013. <www.sciencedaily.com/releases/2013/07/130707162954.htm>.
Stanford University Medical Center. (2013, July 7). New mouse model reveals a mystery of Duchenne muscular dystrophy. ScienceDaily. Retrieved May 26, 2017 from www.sciencedaily.com/releases/2013/07/130707162954.htm
Stanford University Medical Center. "New mouse model reveals a mystery of Duchenne muscular dystrophy." ScienceDaily. www.sciencedaily.com/releases/2013/07/130707162954.htm (accessed May 26, 2017).
DNA Damage Response Links Short Telomeres, Heart Disorder in Duchenne Muscular Dystrophy
Nov. 1, 2016 Telomeres shorten without cell division in a mouse model of Duchenne muscular dystrophy, new research shows. Subsequent DNA damage responses and mitochondrial dysfunction are likely cause of heart ... read more Robotic Arm Developed for Duchenne Patients
Jan. 22, 2016 Researchers have developed the A-Gear: a robotic arm that can support the daily activities of people suffering the muscular disease Duchenne Muscular Dystrophy. They recently put the final touches to ... read more New Hope in Fight Against Muscular Dystrophy
Aug. 21, 2014 Hope for those who suffer from Duchenne muscular dystrophy, an incurable, debilitating disease that cuts young lives short, can be gained by new research. Duchenne muscular dystrophy results from a ... read more Gene Therapy Protects Mice from Lethal Heart Condition, Researchers Find
Aug. 20, 2014 A new gene therapy has been shown to protect mice from a life-threatening heart condition caused by muscular dystrophy. About one in 3,500 children, mostly boys, are born with Duchenne muscular ... read more RELATED TERMS
Adult attention-deficit disorder |
Plant Parasite 'Wiretaps' Host
Dodder vines on a tomato plant. The white flowers are dodder. New research shows that chemical signals from the host, called RNA, plant pass deep into the parasite. (Neelima Sinha/UC Davis photo)
A parasitic plant that sucks water and nutrients from its plant host also taps into its communications traffic, a new report finds. The research could lead to new ways to combat parasites that attack crop plants.
Professor Neelima Sinha and colleagues at the UC Davis Section of Plant Biology studied dodder vines growing on tomato plants in the lab. They found that RNA molecules from the host could be found in the dodder up to a foot (30 cm) from the point where the parasite had plumbed itself into the host.
Plants often use small RNA molecules as messengers between different parts of the plant. In a paper published in Science in 2001, Sinha's group showed that RNA could travel from a graft into the rest of the plant and affect leaf shape. Plants can also use specific RNAs to fight off viruses.
Picking up these RNA messengers could help the parasite synchronize its lifecycle with that of the host plant, Sinha said.
"It might be important for the parasite to know when the host is flowering, so it can flower at the same time," before the host dies, she said.
Sinha's lab holds a grant from the Rockefeller Foundation to research plant parasites, notably Striga, which attacks maize crops in Africa. Striga cannot be imported into the U.S., so dodder serves as a model system.
Ultimately, the researchers hope to use host RNA to trigger a change in the parasite that kills it or makes it less damaging, Sinha said. Finding that host RNA molecules are transported through the parasite is a step in characterizing the system, she said.
A paper describing the work is published online by the journal New Phytology. Co-authors on the paper are UC Davis postdoctoral researcher Rakefet David-Schwartz, graduate students Steven Runo and Brad Townsley, and Jesse Machuka of Kenyatta University, Kenya.
Sinha lab Web site
Discuss this story on our blog, Egghead. Media contact(s):
Neelima Sinha, Plant Biology, (530) 754-8441, [email protected]
Andy Fell, UC Davis News Service, (530) 752-4533, [email protected] |
Functional outcomes and efficiency of rehabilitation in a national cohort of patients with guillain - barré syndrome and other inflammatory polyneuropathies.
Roxana Alexandrescu, Richard John Siegert, Lynne Turner-Stokes.
To describe functional outcomes, care needs and cost-efficiency of hospital rehabilitation for a UK cohort of inpatients with complex rehabilitation needs arising from inflammatory polyneuropathies.
Using Continuous Data Tracking Technology to Study Exercise Adherence in Pulmonary Rehabilitation
Authors: Amanda K. Rizk, Rima Wardini, Emilie Chan-Thim, Barbara Trutschnigg, Amélie Forget, Véronique Pepin.
Pulmonary rehabilitation (PR) is an important component in the management of respiratory diseases. The effectiveness of PR is dependent upon adherence to exercise training recommendations. The study of exercise adherence is thus a key step towards the optimization of PR programs. To date, mostly indirect measures, such as rates of participation, completion, and attendance, have been used to determine adherence to PR. The purpose of the present protocol is to describe how continuous data tracking technology can be used to measure adherence to a prescribed aerobic training intensity on a second-by-second basis. In our investigations, adherence has been defined as the percent time spent within a specified target heart rate range. As such, using a combination of hardware and software, heart rate is measured, tracked, and recorded during cycling second-by-second for each participant, for each exercise session. Using statistical software, the data is subsequently extracted and analyzed. The same protocol can be applied to determine adherence to other measures of exercise intensity, such as time spent at a specified wattage, level, or speed on the cycle ergometer. Furthermore, the hardware and software is also available to measure adherence to other modes of training, such as the treadmill, elliptical, stepper, and arm ergometer. The present protocol, therefore, has a vast applicability to directly measure adherence to aerobic exercise.
Implantation of the Syncardia Total Artificial Heart
Authors: Daniel G. Tang, Keyur B. Shah, Micheal L. Hess, Vigneshwar Kasirajan.
Institutions: Virginia Commonwealth University, Virginia Commonwealth University.
With advances in technology, the use of mechanical circulatory support devices for end stage heart failure has rapidly increased. The vast majority of such patients are generally well served by left ventricular assist devices (LVADs). However, a subset of patients with late stage biventricular failure or other significant anatomic lesions are not adequately treated by isolated left ventricular mechanical support. Examples of concomitant cardiac pathology that may be better treated by resection and TAH replacement includes: post infarction ventricular septal defect, aortic root aneurysm / dissection, cardiac allograft failure, massive ventricular thrombus, refractory malignant arrhythmias (independent of filling pressures), hypertrophic / restrictive cardiomyopathy, and complex congenital heart disease. Patients often present with cardiogenic shock and multi system organ dysfunction. Excision of both ventricles and orthotopic replacement with a total artificial heart (TAH) is an effective, albeit extreme, therapy for rapid restoration of blood flow and resuscitation. Perioperative management is focused on end organ resuscitation and physical rehabilitation. In addition to the usual concerns of infection, bleeding, and thromboembolism common to all mechanically supported patients, TAH patients face unique risks with regard to renal failure and anemia. Supplementation of the abrupt decrease in brain natriuretic peptide following ventriculectomy appears to have protective renal effects. Anemia following TAH implantation can be profound and persistent. Nonetheless, the anemia is generally well tolerated and transfusion are limited to avoid HLA sensitization. Until recently, TAH patients were confined as inpatients tethered to a 500 lb pneumatic console driver. Recent introduction of a backpack sized portable driver (currently under clinical trial) has enabled patients to be discharged home and even return to work. Despite the profound presentation of these sick patients, there is a 79-87% success in bridge to transplantation.
Medicine, Issue 89, mechanical circulatory support, total artificial heart, biventricular failure, operative techniques
The Multiple Sclerosis Performance Test (MSPT): An iPad-Based Disability Assessment Tool
Authors: Richard A. Rudick, Deborah Miller, Francois Bethoux, Stephen M. Rao, Jar-Chi Lee, Darlene Stough, Christine Reece, David Schindler, Bernadett Mamone, Jay Alberts.
Institutions: Cleveland Clinic Foundation, Cleveland Clinic Foundation, Cleveland Clinic Foundation, Cleveland Clinic Foundation.
Precise measurement of neurological and neuropsychological impairment and disability in multiple sclerosis is challenging. We report a new test, the Multiple Sclerosis Performance Test (MSPT), which represents a new approach to quantifying MS related disability. The MSPT takes advantage of advances in computer technology, information technology, biomechanics, and clinical measurement science. The resulting MSPT represents a computer-based platform for precise, valid measurement of MS severity. Based on, but extending the Multiple Sclerosis Functional Composite (MSFC), the MSPT provides precise, quantitative data on walking speed, balance, manual dexterity, visual function, and cognitive processing speed. The MSPT was tested by 51 MS patients and 49 healthy controls (HC). MSPT scores were highly reproducible, correlated strongly with technician-administered test scores, discriminated MS from HC and severe from mild MS, and correlated with patient reported outcomes. Measures of reliability, sensitivity, and clinical meaning for MSPT scores were favorable compared with technician-based testing. The MSPT is a potentially transformative approach for collecting MS disability outcome data for patient care and research. Because the testing is computer-based, test performance can be analyzed in traditional or novel ways and data can be directly entered into research or clinical databases. The MSPT could be widely disseminated to clinicians in practice settings who are not connected to clinical trial performance sites or who are practicing in rural settings, drastically improving access to clinical trials for clinicians and patients. The MSPT could be adapted to out of clinic settings, like the patient’s home, thereby providing more meaningful real world data. The MSPT represents a new paradigm for neuroperformance testing. This method could have the same transformative effect on clinical care and research in MS as standardized computer-adapted testing has had in the education field, with clear potential to accelerate progress in clinical care and research.
Medicine, Issue 88, Multiple Sclerosis, Multiple Sclerosis Functional Composite, computer-based testing, 25-foot walk test, 9-hole peg test, Symbol Digit Modalities Test, Low Contrast Visual Acuity, Clinical Outcome Measure
Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty
Authors: Hilary C. Rees, Voichita Ianas, Patricia McCracken, Shannon Smith, Anca Georgescu, Tirdad Zangeneh, Jane Mohler, Stephen A. Klotz.
Institutions: University of Arizona, University of Arizona.
A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age. HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal. The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.
Medicine, Issue 77, Infection, Virology, Infectious Diseases, Anatomy, Physiology, Molecular Biology, Biomedical Engineering, Retroviridae Infections, Body Weight Changes, Diagnostic Techniques and Procedures, Physical Examination, Muscle Strength, Behavior, Virus Diseases, Pathological Conditions, Signs and Symptoms, Diagnosis, Musculoskeletal and Neural Physiological Phenomena, HIV, HIV-1, AIDS, Frailty, Depression, Weight Loss, Weakness, Slowness, Exhaustion, Aging, clinical techniques
High-throughput Flow Cytometry Cell-based Assay to Detect Antibodies to N-Methyl-D-aspartate Receptor or Dopamine-2 Receptor in Human Serum
Authors: Mazen Amatoury, Vera Merheb, Jessica Langer, Xin Maggie Wang, Russell Clive Dale, Fabienne Brilot.
Institutions: The University of Sydney, Westmead Millennium Institute for Medical Research.
Over the recent years, antibodies against surface and conformational proteins involved in neurotransmission have been detected in autoimmune CNS diseases in children and adults. These antibodies have been used to guide diagnosis and treatment. Cell-based assays have improved the detection of antibodies in patient serum. They are based on the surface expression of brain antigens on eukaryotic cells, which are then incubated with diluted patient sera followed by fluorochrome-conjugated secondary antibodies. After washing, secondary antibody binding is then analyzed by flow cytometry. Our group has developed a high-throughput flow cytometry live cell-based assay to reliably detect antibodies against specific neurotransmitter receptors. This flow cytometry method is straight forward, quantitative, efficient, and the use of a high-throughput sampler system allows for large patient cohorts to be easily assayed in a short space of time. Additionally, this cell-based assay can be easily adapted to detect antibodies to many different antigenic targets, both from the central nervous system and periphery. Discovering additional novel antibody biomarkers will enable prompt and accurate diagnosis and improve treatment of immune-mediated disorders.
Medicine, Issue 81, Flow cytometry, cell-based assay, autoantibody, high-throughput sampler, autoimmune CNS disease
In Vivo Modeling of the Morbid Human Genome using Danio rerio
Authors: Adrienne R. Niederriter, Erica E. Davis, Christelle Golzio, Edwin C. Oh, I-Chun Tsai, Nicholas Katsanis.
Institutions: Duke University Medical Center, Duke University, Duke University Medical Center.
Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.
Molecular Biology, Issue 78, Genetics, Biomedical Engineering, Medicine, Developmental Biology, Biochemistry, Anatomy, Physiology, Bioengineering, Genomics, Medical, zebrafish, in vivo, morpholino, human disease modeling, transcription, PCR, mRNA, DNA, Danio rerio, animal model
Compensatory Limb Use and Behavioral Assessment of Motor Skill Learning Following Sensorimotor Cortex Injury in a Mouse Model of Ischemic Stroke
Authors: Abigail L. Kerr, Kelly A. Tennant.
Institutions: Illinois Wesleyan University, University of Victoria.
Mouse models have become increasingly popular in the field of behavioral neuroscience, and specifically in studies of experimental stroke. As models advance, it is important to develop sensitive behavioral measures specific to the mouse. The present protocol describes a skilled motor task for use in mouse models of stroke. The Pasta Matrix Reaching Task functions as a versatile and sensitive behavioral assay that permits experimenters to collect accurate outcome data and manipulate limb use to mimic human clinical phenomena including compensatory strategies (i.e., learned non-use) and focused rehabilitative training. When combined with neuroanatomical tools, this task also permits researchers to explore the mechanisms that support behavioral recovery of function (or lack thereof) following stroke. The task is both simple and affordable to set up and conduct, offering a variety of training and testing options for numerous research questions concerning functional outcome following injury. Though the task has been applied to mouse models of stroke, it may also be beneficial in studies of functional outcome in other upper extremity injury models.
Behavior, Issue 89, Upper extremity impairment, Murine model, Rehabilitation, Reaching, Non-paretic limb training, Good limb training, Less-affected limb training, Learned non-use, Pasta matrix reaching task
The Use of Magnetic Resonance Spectroscopy as a Tool for the Measurement of Bi-hemispheric Transcranial Electric Stimulation Effects on Primary Motor Cortex Metabolism
Authors: Sara Tremblay, Vincent Beaulé, Sébastien Proulx, Louis-Philippe Lafleur, Julien Doyon, Małgorzata Marjańska, Hugo Théoret.
Institutions: University of Montréal, McGill University, University of Minnesota.
Transcranial direct current stimulation (tDCS) is a neuromodulation technique that has been increasingly used over the past decade in the treatment of neurological and psychiatric disorders such as stroke and depression. Yet, the mechanisms underlying its ability to modulate brain excitability to improve clinical symptoms remains poorly understood 33. To help improve this understanding, proton magnetic resonance spectroscopy (1H-MRS) can be used as it allows the in vivo quantification of brain metabolites such as γ-aminobutyric acid (GABA) and glutamate in a region-specific manner 41. In fact, a recent study demonstrated that 1H-MRS is indeed a powerful means to better understand the effects of tDCS on neurotransmitter concentration 34. This article aims to describe the complete protocol for combining tDCS (NeuroConn MR compatible stimulator) with 1H-MRS at 3 T using a MEGA-PRESS sequence. We will describe the impact of a protocol that has shown great promise for the treatment of motor dysfunctions after stroke, which consists of bilateral stimulation of primary motor cortices 27,30,31. Methodological factors to consider and possible modifications to the protocol are also discussed.
Neuroscience, Issue 93, proton magnetic resonance spectroscopy, transcranial direct current stimulation, primary motor cortex, GABA, glutamate, stroke
A Multi-Modal Approach to Assessing Recovery in Youth Athletes Following Concussion
Authors: Nick Reed, James Murphy, Talia Dick, Katie Mah, Melissa Paniccia, Lee Verweel, Danielle Dobney, Michelle Keightley.
Institutions: Holland Bloorview Kids Rehabilitation Hospital, University of Toronto, University of Toronto.
Concussion is one of the most commonly reported injuries amongst children and youth involved in sport participation. Following a concussion, youth can experience a range of short and long term neurobehavioral symptoms (somatic, cognitive and emotional/behavioral) that can have a significant impact on one’s participation in daily activities and pursuits of interest (e.g., school, sports, work, family/social life, etc.). Despite this, there remains a paucity in clinically driven research aimed specifically at exploring concussion within the youth sport population, and more specifically, multi-modal approaches to measuring recovery. This article provides an overview of a novel and multi-modal approach to measuring recovery amongst youth athletes following concussion. The presented approach involves the use of both pre-injury/baseline testing and post-injury/follow-up testing to assess performance across a wide variety of domains (post-concussion symptoms, cognition, balance, strength, agility/motor skills and resting state heart rate variability). The goal of this research is to gain a more objective and accurate understanding of recovery following concussion in youth athletes (ages 10-18 years). Findings from this research can help to inform the development and use of improved approaches to concussion management and rehabilitation specific to the youth sport community.
Medicine, Issue 91, concussion, children, youth, athletes, assessment, management, rehabilitation
Getting to Compliance in Forced Exercise in Rodents: A Critical Standard to Evaluate Exercise Impact in Aging-related Disorders and Disease
Authors: Jennifer C. Arnold, Michael F. Salvatore.
Institutions: Louisiana State University Health Sciences Center.
There is a major increase in the awareness of the positive impact of exercise on improving several disease states with neurobiological basis; these include improving cognitive function and physical performance. As a result, there is an increase in the number of animal studies employing exercise. It is argued that one intrinsic value of forced exercise is that the investigator has control over the factors that can influence the impact of exercise on behavioral outcomes, notably exercise frequency, duration, and intensity of the exercise regimen. However, compliance in forced exercise regimens may be an issue, particularly if potential confounds of employing foot-shock are to be avoided. It is also important to consider that since most cognitive and locomotor impairments strike in the aged individual, determining impact of exercise on these impairments should consider using aged rodents with a highest possible level of compliance to ensure minimal need for test subjects. Here, the pertinent steps and considerations necessary to achieve nearly 100% compliance to treadmill exercise in an aged rodent model will be presented and discussed. Notwithstanding the particular exercise regimen being employed by the investigator, our protocol should be of use to investigators that are particularly interested in the potential impact of forced exercise on aging-related impairments, including aging-related Parkinsonism and Parkinson’s disease.
Behavior, Issue 90, Exercise, locomotor, Parkinson’s disease, aging, treadmill, bradykinesia, Parkinsonism
Haptic/Graphic Rehabilitation: Integrating a Robot into a Virtual Environment Library and Applying it to Stroke Therapy
Authors: Ian Sharp, James Patton, Molly Listenberger, Emily Case.
Institutions: University of Illinois at Chicago and Rehabilitation Institute of Chicago, Rehabilitation Institute of Chicago.
Recent research that tests interactive devices for prolonged therapy practice has revealed new prospects for robotics combined with graphical and other forms of biofeedback. Previous human-robot interactive systems have required different software commands to be implemented for each robot leading to unnecessary developmental overhead time each time a new system becomes available. For example, when a haptic/graphic virtual reality environment has been coded for one specific robot to provide haptic feedback, that specific robot would not be able to be traded for another robot without recoding the program. However, recent efforts in the open source community have proposed a wrapper class approach that can elicit nearly identical responses regardless of the robot used. The result can lead researchers across the globe to perform similar experiments using shared code. Therefore modular "switching out"of one robot for another would not affect development time. In this paper, we outline the successful creation and implementation of a wrapper class for one robot into the open-source H3DAPI, which integrates the software commands most commonly used by all robots.
Bioengineering, Issue 54, robotics, haptics, virtual reality, wrapper class, rehabilitation robotics, neural engineering, H3DAPI, C++
Movement Retraining using Real-time Feedback of Performance
Authors: Michael Anthony Hunt.
Institutions: University of British Columbia .
Any modification of movement - especially movement patterns that have been honed over a number of years - requires re-organization of the neuromuscular patterns responsible for governing the movement performance. This motor learning can be enhanced through a number of methods that are utilized in research and clinical settings alike. In general, verbal feedback of performance in real-time or knowledge of results following movement is commonly used clinically as a preliminary means of instilling motor learning. Depending on patient preference and learning style, visual feedback (e.g. through use of a mirror or different types of video) or proprioceptive guidance utilizing therapist touch, are used to supplement verbal instructions from the therapist. Indeed, a combination of these forms of feedback is commonplace in the clinical setting to facilitate motor learning and optimize outcomes. Laboratory-based, quantitative motion analysis has been a mainstay in research settings to provide accurate and objective analysis of a variety of movements in healthy and injured populations. While the actual mechanisms of capturing the movements may differ, all current motion analysis systems rely on the ability to track the movement of body segments and joints and to use established equations of motion to quantify key movement patterns. Due to limitations in acquisition and processing speed, analysis and description of the movements has traditionally occurred offline after completion of a given testing session. This paper will highlight a new supplement to standard motion analysis techniques that relies on the near instantaneous assessment and quantification of movement patterns and the display of specific movement characteristics to the patient during a movement analysis session. As a result, this novel technique can provide a new method of feedback delivery that has advantages over currently used feedback methods.
Medicine, Issue 71, Biophysics, Anatomy, Physiology, Physics, Biomedical Engineering, Behavior, Psychology, Kinesiology, Physical Therapy, Musculoskeletal System, Biofeedback, biomechanics, gait, movement, walking, rehabilitation, clinical, training
A Standardized Obstacle Course for Assessment of Visual Function in Ultra Low Vision and Artificial Vision
Authors: Amy Catherine Nau, Christine Pintar, Christopher Fisher, Jong-Hyeon Jeong, KwonHo Jeong.
We describe an indoor, portable, standardized course that can be used to evaluate obstacle avoidance in persons who have ultralow vision. Six sighted controls and 36 completely blind but otherwise healthy adult male (n=29) and female (n=13) subjects (age range 19-85 years), were enrolled in one of three studies involving testing of the BrainPort sensory substitution device. Subjects were asked to navigate the course prior to, and after, BrainPort training. They completed a total of 837 course runs in two different locations. Means and standard deviations were calculated across control types, courses, lights, and visits. We used a linear mixed effects model to compare different categories in the PPWS (percent preferred walking speed) and error percent data to show that the course iterations were properly designed. The course is relatively inexpensive, simple to administer, and has been shown to be a feasible way to test mobility function. Data analysis demonstrates that for the outcome of percent error as well as for percentage preferred walking speed, that each of the three courses is different, and that within each level, each of the three iterations are equal. This allows for randomization of the courses during administration. Abbreviations: preferred walking speed (PWS) course speed (CS) percentage preferred walking speed (PPWS)
Medicine, Issue 84, Obstacle course, navigation assessment, BrainPort, wayfinding, low vision
Electroporation of Mycobacteria
Authors: Renan Goude, Tanya Parish.
Institutions: Barts and the London School of Medicine and Dentistry, Barts and the London School of Medicine and Dentistry.
High efficiency transformation is a major limitation in the study of mycobacteria. The genus Mycobacterium can be difficult to transform; this is mainly caused by the thick and waxy cell wall, but is compounded by the fact that most molecular techniques have been developed for distantly-related species such as Escherichia coli and Bacillus subtilis. In spite of these obstacles, mycobacterial plasmids have been identified and DNA transformation of many mycobacterial species have now been described. The most successful method for introducing DNA into mycobacteria is electroporation. Many parameters contribute to successful transformation; these include the species/strain, the nature of the transforming DNA, the selectable marker used, the growth medium, and the conditions for the electroporation pulse. Optimized methods for the transformation of both slow- and fast-grower are detailed here. Transformation efficiencies for different mycobacterial species and with various selectable markers are reported.
Microbiology, Issue 15, Springer Protocols, Mycobacteria, Electroporation, Bacterial Transformation, Transformation Efficiency, Bacteria, Tuberculosis, M. Smegmatis, Springer Protocols
Using Micro-Electro-Mechanical Systems (MEMS) to Develop Diagnostic Tools
Authors: Utkan Demirci.
Institutions: Brigham and Women's Hospital.
Cellular Biology, Issue 8, microfluidics, diagnostics, capture, blood, HIV, bioengineering
Development of New Therapeutic Applications Using Microfluidics
Authors: Mehmet Toner.
Cellular Biology, Issue 8, Microfluidics, Translational Research, Diagnostics, Bioengineering
Manual Muscle Testing: A Method of Measuring Extremity Muscle Strength Applied to Critically Ill Patients
Authors: Nancy Ciesla, Victor Dinglas, Eddy Fan, Michelle Kho, Jill Kuramoto, Dale Needham.
Institutions: Johns Hopkins University, Johns Hopkins Hospital , Johns Hopkins University, University of Maryland Medical System.
Survivors of acute respiratory distress syndrome (ARDS) and other causes of critical illness often have generalized weakness, reduced exercise tolerance, and persistent nerve and muscle impairments after hospital discharge.1-6 Using an explicit protocol with a structured approach to training and quality assurance of research staff, manual muscle testing (MMT) is a highly reliable method for assessing strength, using a standardized clinical examination, for patients following ARDS, and can be completed with mechanically ventilated patients who can tolerate sitting upright in bed and are able to follow two-step commands. 7, 8 This video demonstrates a protocol for MMT, which has been taught to ≥43 research staff who have performed >800 assessments on >280 ARDS survivors. Modifications for the bedridden patient are included. Each muscle is tested with specific techniques for positioning, stabilization, resistance, and palpation for each score of the 6-point ordinal Medical Research Council scale.7,9-11 Three upper and three lower extremity muscles are graded in this protocol: shoulder abduction, elbow flexion, wrist extension, hip flexion, knee extension, and ankle dorsiflexion. These muscles were chosen based on the standard approach for evaluating patients for ICU-acquired weakness used in prior publications. 1,2.
Medicine, Issue 50, Muscle Strength, Critical illness, Intensive Care Units, Reproducibility of Results, Clinical Protocols.
Using Visual and Narrative Methods to Achieve Fair Process in Clinical Care
Authors: Laura S. Lorenz, Jon A. Chilingerian.
Institutions: Brandeis University, Brandeis University.
The Institute of Medicine has targeted patient-centeredness as an important area of quality improvement. A major dimension of patient-centeredness is respect for patient's values, preferences, and expressed needs. Yet specific approaches to gaining this understanding and translating it to quality care in the clinical setting are lacking. From a patient perspective quality is not a simple concept but is best understood in terms of five dimensions: technical outcomes; decision-making efficiency; amenities and convenience; information and emotional support; and overall patient satisfaction. Failure to consider quality from this five-pronged perspective results in a focus on medical outcomes, without considering the processes central to quality from the patient's perspective and vital to achieving good outcomes. In this paper, we argue for applying the concept of fair process in clinical settings. Fair process involves using a collaborative approach to exploring diagnostic issues and treatments with patients, explaining the rationale for decisions, setting expectations about roles and responsibilities, and implementing a core plan and ongoing evaluation. Fair process opens the door to bringing patient expertise into the clinical setting and the work of developing health care goals and strategies. This paper provides a step by step illustration of an innovative visual approach, called photovoice or photo-elicitation, to achieve fair process in clinical work with acquired brain injury survivors and others living with chronic health conditions. Applying this visual tool and methodology in the clinical setting will enhance patient-provider communication; engage patients as partners in identifying challenges, strengths, goals, and strategies; and support evaluation of progress over time. Asking patients to bring visuals of their lives into the clinical interaction can help to illuminate gaps in clinical knowledge, forge better therapeutic relationships with patients living with chronic conditions such as brain injury, and identify patient-centered goals and possibilities for healing. The process illustrated here can be used by clinicians, (primary care physicians, rehabilitation therapists, neurologists, neuropsychologists, psychologists, and others) working with people living with chronic conditions such as acquired brain injury, mental illness, physical disabilities, HIV/AIDS, substance abuse, or post-traumatic stress, and by leaders of support groups for the types of patients described above and their family members or caregivers.
Medicine, Issue 48, person-centered care, participatory visual methods, photovoice, photo-elicitation, narrative medicine, acquired brain injury, disability, rehabilitation, palliative care
The Structure of Skilled Forelimb Reaching in the Rat: A Movement Rating Scale
Authors: Ian Q Whishaw, Paul Whishaw, Bogdan Gorny.
Institutions: University of Lethbridge.
Skilled reaching for food is an evolutionary ancient act and is displayed by many animal species, including those in the sister clades of rodents and primates. The video describes a test situation that allows filming of repeated acts of reaching for food by the rat that has been mildly food deprived. A rat is trained to reach through a slot in a holding box for food pellet that it grasps and then places in its mouth for eating. Reaching is accomplished in the main by proximally driven movements of the limb but distal limb movements are used for pronating the paw, grasping the food, and releasing the food into the mouth. Each reach is divided into at least 10 movements of the forelimb and the reaching act is facilitated by postural adjustments. Each of the movements is described and examples of the movements are given from a number of viewing perspectives. By rating each movement element on a 3-point scale, the reach can be quantified. A number of studies have demonstrated that the movement elements are altered by motor system damage, including damage to the motor cortex, basal ganglia, brainstem, and spinal cord. The movements are also altered in neurological conditions that can be modeled in the rat, including Parkinson's disease and Huntington's disease. Thus, the rating scale is useful for quantifying motor impairments and the effectiveness of neural restoration and rehabilitation. Because the reaching act for the rat is very similar to that displayed by humans and nonhuman primates, the scale can be used for comparative purposes. from a number of viewing perspectives. By rating each movement element on a 3-point scale, the reach can be quantified. A number of studies have demonstrated that the movement elements are altered by motor system damage, including damage to the motor cortex, basal ganglia, brainstem, and spinal cord. The movements are also altered in neurological conditions that can be modeled in the rat, including Parkinson's disease and Huntington's disease. Thus, the rating scale is useful for quantifying motor impairments and the effectiveness of neural restoration and rehabilitation. Experiments on animals were performed in accordance with the guidelines and regulations set forth by the University of Lethbridge Animal Care Committee in accordance with the regulations of the Canadian Council on Animal Care.
Neuroscience, Issue 18, rat skilled reaching, rat reaching scale, rat, rat movement element rating scale, reaching elements |
Posted by Eric Haun September 28, 2016
European Scientists Coordinate Open Ocean Observatories
European scientists are joining forces to better understand oceanic change, by coordinating ocean data acquisition, analysis and response on scales ranging from the provincial to the global.
Marking a major milestone, the first Assembly of Members meeting of the European Multidisciplinary Seafloor and water-column Observatory (EMSO) will be held September 28-29 in Rome, Italy.
Dr. Henry Ruhl of the National Oceanography Centre (NOC), who form part of EMSO, said, “Society has an increasing need for improving the availability of high quality data to understanding climate change and geo-hazards. For example the oceans store large quantities of heat and carbon dioxide, an important greenhouse gas.”
EMSO is a distributed research infrastructure, composed of fixed-point open ocean observatory nodes, whose aim is to provide coherent long-term data sets for research and monitoring. This will not only bring together countries and disciplines, but also allow the pooling of resources and coordination to assemble harmonized data into a comprehensive a regional ocean picture. This data will be made openly available to researchers and stakeholders worldwide.
The key contribution of the United Kingdom to the EMSO effort is data from the Porcupine Abyssal Plain sustained ocean observatory, coordinated by the NOC. This site is located about 300 west of Lands End and has been the location of research on the role of biology in controlling the transfer of carbon from the atmosphere to the deep sea for two decades. Its location and long-term records make it a key asset for understanding change in the ocean.
EMSO is now beginning a new level of organization as a European Research Infrastructure Consortium (ERIC), a form of governance structure for such activities that allows for longer term strategic management of large scale efforts. The EMSO founding members, and therefore its Assembly of Members, include Italy, France, Greece, Ireland, Portugal, Romania, Spain and United Kingdom, and its coordination office is hosted in Rome.
“It’s a well-accepted concept to have stations for observing weather and seismic activity on land, but our planet is mostly ocean. However, efforts to do this kind of work offshore have really matured over the last decade.” Says Professor Paolo Favali of the Istituto Nazionale di Geofisica e Vulcanologia in Rome.
EMSO observation data is collected from the ocean’s surface, through the water column to sub-seafloor across geo-hazard, physical, biogeochemical and ecological themes, with various local emphases. EMSO planning spans from polar to sub-tropical climatic zones and from the Atlantic to the Mediterranean sea of Marmara and the Black Sea. This offers a broad spectrum of study areas across diverse environments. Critically, the systems can send data to land through seafloor telecommunication cables or satellite connections from surface buoys. Test sites are also fundamental facilities for devices being incorporated into EMSO nodes.
With observatory initiatives from Canada, USA, Japan, China, Taiwan and Australia, EMSO rides a global wave of understanding that ocean processes drive our planet. EMSO also represents a fundamental contribution to the long-term vision of the Global Ocean Observing System (GOOS) eg, through the OceanSITES component of GOOS. It will contribute direct oceanic observations for the EU Global Monitoring for Environment and Security Initiative, COPERNICUS, and is aligned with the challenges and key priorities of the EU Marine Strategy Framework Directive (MSFD). The data collected by EMSO will also support policy and legislation of organizations such as the Intergovernmental Panel on Climate Change (IPCC), the United Nations Environment Program (UNEP) and the Group on Earth Observation (GEO), just to mention a few. Importantly, EMSO also joins with other ERIC efforts such as the Integrated Carbon Observing System (ICOS)
• United States • Japan • Italy
A Tale of Two ROVs
Fugro has been providing remotely operated underwater vehicle (ROV) services for Petrobras in Brazil for more than 20 years…
SKF Launches Magnetic Bearings Tuning Service
SKF has rolled out a new service called 'certified tuning E300V2', which leverages the capabilities of the E300V2 control…
Teledyne Marine Workshop Set for San Diego
Teledyne Marine will host its second biennial Teledyne Marine Technology Workshop (TMTW) at the Catamaran Resort in San Diego…
Research Vessels: The Fleet is In
A wave of new and innovative research vessels are set to help scientists enhance their understanding of the oceans. MTR profiles…
Track Cables and Pipelines with an AUV
Autonomous underwater vehicles (AUVs) can now be prepared for cable and pipeline tracking missions using survey tool Smartrak from U.K.
Offshore Engineering Advertising
Teledyne Marine Systems
貯蔵
Maritime Propulsion |
Regulation of microRNA-155 in atherosclerotic inflammatory responses by targeting MAP3K10.
Jianhua Zhu, Ting Chen, Lin Yang, Zhoubin Li, Mei Mei Wong, Xiaoye Zheng, Xiaoping Pan, Li Zhang, Hui Yan.
Accumulating evidence suggest that numerous microRNAs (miRNAs) play important roles in cell proliferation, apoptosis, and differentiation, as well as various diseases that accompany inflammatory responses. Inflammation is known to be a major contributor to atherogenesis. Previous studies provide promising evidence in support of the role of miRNAs in cardiovascular disease. However, mechanistic data on these small molecules in atherosclerosis (AS) are still missing. The present study aims to investigate the potential role of miRNAs in AS.
A Human Ex Vivo Atherosclerotic Plaque Model to Study Lesion Biology
Authors: Christian Erbel, Deniz Okuyucu, Mohammadreza Akhavanpoor, Li Zhao, Susanne Wangler, Maani Hakimi, Andreas Doesch, Thomas J. Dengler, Hugo A. Katus, Christian A. Gleissner.
Institutions: University of Heidelberg, University of Heidelberg, SLK Hospital am Plattenwald.
Atherosclerosis is a chronic inflammatory disease of the vasculature. There are various methods to study the inflammatory compound in atherosclerotic lesions. Mouse models are an important tool to investigate inflammatory processes in atherogenesis, but these models suffer from the phenotypic and functional differences between the murine and human immune system. In vitro cell experiments are used to specifically evaluate cell type-dependent changes caused by a substance of interest, but culture-dependent variations and the inability to analyze the influence of specific molecules in the context of the inflammatory compound in atherosclerotic lesions limit the impact of the results. In addition, measuring levels of a molecule of interest in human blood helps to further investigate its clinical relevance, but this represents systemic and not local inflammation. Therefore, we here describe a plaque culture model to study human atherosclerotic lesion biology ex vivo. In short, fresh plaques are obtained from patients undergoing endarterectomy or coronary artery bypass grafting and stored in RPMI medium on ice until usage. The specimens are cut into small pieces followed by random distribution into a 48-well plate, containing RPMI medium in addition to a substance of interest such as cytokines or chemokines alone or in combination for defined periods of time. After incubation, the plaque pieces can be shock frozen for mRNA isolation, embedded in Paraffin or OCT for immunohistochemistry staining or smashed and lysed for western blotting. Furthermore, cells may be isolated from the plaque for flow cytometry analysis. In addition, supernatants can be collected for protein measurement by ELISA. In conclusion, the presented ex vivo model opens the possibility to further study inflammatory lesional biology, which may result in identification of novel disease mechanisms and therapeutic targets.
Medicine, Issue 87, ex vivo model, human, tissue culture, atherosclerosis, immune response, inflammation, chronic inflammatory disease
Identifying Targets of Human microRNAs with the LightSwitch Luciferase Assay System using 3'UTR-reporter Constructs and a microRNA Mimic in Adherent Cells
Authors: Shelley Force Aldred, Patrick Collins, Nathan Trinklein.
Institutions: SwitchGear Genomics.
MicroRNAs (miRNAs) are important regulators of gene expression and play a role in many biological processes. More than 700 human miRNAs have been identified so far with each having up to hundreds of unique target mRNAs. Computational tools, expression and proteomics assays, and chromatin-immunoprecipitation-based techniques provide important clues for identifying mRNAs that are direct targets of a particular miRNA. In addition, 3'UTR-reporter assays have become an important component of thorough miRNA target studies because they provide functional evidence for and quantitate the effects of specific miRNA-3'UTR interactions in a cell-based system. To enable more researchers to leverage 3'UTR-reporter assays and to support the scale-up of such assays to high-throughput levels, we have created a genome-wide collection of human 3'UTR luciferase reporters in the highly-optimized LightSwitch Luciferase Assay System. The system also includes synthetic miRNA target reporter constructs for use as positive controls, various endogenous 3'UTR reporter constructs, and a series of standardized experimental protocols. Here we describe a method for co-transfection of individual 3'UTR-reporter constructs along with a miRNA mimic that is efficient, reproducible, and amenable to high-throughput analysis.
Genetics, Issue 55, MicroRNA, miRNA, mimic, Clone, 3' UTR, Assay, vector, LightSwitch, luciferase, co-transfection, 3'UTR REPORTER, mirna target, microrna target, reporter, GoClone, Reporter construct
Isolation of Small Noncoding RNAs from Human Serum
Authors: Samantha Khoury, Pamela Ajuyah, Nham Tran.
Institutions: University of Technology, Sydney, University of Technology, Sydney, Royal Prince Alfred Hospital.
The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are found in mammalian cells. These small RNAs are potent gene regulators controlling vital pathways such as growth, development and death and much interest has been directed at their expression in bodily fluids. This is due to their dysregulation in human diseases such as cancer and their potential application as serum biomarkers. However, the analysis of miRNA expression in serum may be problematic. In most cases the amount of serum is limiting and serum contains low amounts of total RNA, of which small RNAs only constitute 0.4-0.5%1. Thus the isolation of sufficient amounts of quality RNA from serum is a major challenge to researchers today. In this technical paper, we demonstrate a method which uses only 400 µl of human serum to obtain sufficient RNA for either DNA arrays or qPCR analysis. The advantages of this method are its simplicity and ability to yield high quality RNA. It requires no specialized columns for purification of small RNAs and utilizes general reagents and hardware found in common laboratories. Our method utilizes a Phase Lock Gel to eliminate phenol contamination while at the same time yielding high quality RNA. We also introduce an additional step to further remove all contaminants during the isolation step. This protocol is very effective in isolating yields of total RNA of up to 100 ng/µl from serum but can also be adapted for other biological tissues.
Bioengineering, Issue 88, small noncoding RNA isolation, microRNAs, human serum, qPCR, guanidinium thiocyanate , Phase Lock Gels, arrays
Profiling of Pre-micro RNAs and microRNAs using Quantitative Real-time PCR (qPCR) Arrays
Authors: Pauline Chugh, Kristen Tamburro, Dirk P Dittmer.
Institutions: University of North Carolina at Chapel Hill.
Quantitative real-time PCR (QPCR) has emerged as an accurate and valuable tool in profiling gene expression levels. One of its many advantages is a lower detection limit compared to other methods of gene expression profiling while using smaller amounts of input for each assay. Automated qPCR setup has improved this field by allowing for greater reproducibility. Its convenient and rapid setup allows for high-throughput experiments, enabling the profiling of many different genes simultaneously in each experiment. This method along with internal plate controls also reduces experimental variables common to other techniques. We recently developed a qPCR assay for profiling of pre-microRNAs (pre-miRNAs) using a set of 186 primer pairs. MicroRNAs have emerged as a novel class of small, non-coding RNAs with the ability to regulate many mRNA targets at the post-transcriptional level. These small RNAs are first transcribed by RNA polymerase II as a primary miRNA (pri-miRNA) transcript, which is then cleaved into the precursor miRNA (pre-miRNA). Pre-miRNAs are exported to the cytoplasm where Dicer cleaves the hairpin loop to yield mature miRNAs. Increases in miRNA levels can be observed at both the precursor and mature miRNA levels and profiling of both of these forms can be useful. There are several commercially available assays for mature miRNAs; however, their high cost may deter researchers from this profiling technique. Here, we discuss a cost-effective, reliable, SYBR-based qPCR method of profiling pre-miRNAs. Changes in pre-miRNA levels often reflect mature miRNA changes and can be a useful indicator of mature miRNA expression. However, simultaneous profiling of both pre-miRNAs and mature miRNAs may be optimal as they can contribute nonredundant information and provide insight into microRNA processing. Furthermore, the technique described here can be expanded to encompass the profiling of other library sets for specific pathways or pathogens.
Biochemistry, Issue 46, pre-microRNAs, qPCR, profiling, Tecan Freedom Evo, robot
Adenoviral Transduction of Naive CD4 T Cells to Study Treg Differentiation
Authors: Sebastian C. Warth, Vigo Heissmeyer.
Institutions: Helmholtz Zentrum München.
Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 T cells in vitro with TCR- and co-stimulation in the presence of TGFβ and IL-2. This bears enormous potential for future therapies, however, the molecules and signaling pathways that control differentiation are largely unknown. Primary T cells can be manipulated through ectopic gene expression, but common methods fail to target the most important naive state of the T cell prior to primary antigen recognition. Here, we provide a protocol to express ectopic genes in naive CD4 T cells in vitro before inducing Treg differentiation. It applies transduction with the replication-deficient adenovirus and explains its generation and production. The adenovirus can take up large inserts (up to 7 kb) and can be equipped with promoters to achieve high and transient overexpression in T cells. It effectively transduces naive mouse T cells if they express a transgenic Coxsackie adenovirus receptor (CAR). Importantly, after infection the T cells remain naive (CD44low, CD62Lhigh) and resting (CD25-, CD69-) and can be activated and differentiated into Tregs similar to non-infected cells. Thus, this method enables manipulation of CD4 T cell differentiation from its very beginning. It ensures that ectopic gene expression is already in place when early signaling events of the initial TCR stimulation induces cellular changes that eventually lead into Treg differentiation.
Immunology, Issue 78, Cellular Biology, Molecular Biology, Medicine, Biomedical Engineering, Bioengineering, Infection, Genetics, Microbiology, Virology, T-Lymphocytes, Regulatory, CD4-Positive T-Lymphocytes, Regulatory, Adenoviruses, Human, MicroRNAs, Antigens, Differentiation, T-Lymphocyte, Gene Transfer Techniques, Transduction, Genetic, Transfection, Adenovirus, gene transfer, microRNA, overexpression, knock down, CD4 T cells, in vitro differentiation, regulatory T cell, virus, cell, flow cytometry
Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library
Authors: Matthew J. Coussens, Kevin Forbes, Carol Kreader, Jack Sago, Carrie Cupp, John Swarthout.
The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details). To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3΄TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).
Genetics, Issue 62, Target ID, miRNA, ncRNA, RNAi, genomics
Quantitative Analysis and Characterization of Atherosclerotic Lesions in the Murine Aortic Sinus
Authors: Daniel E. Venegas-Pino, Nicole Banko, Mohammed I. Khan, Yuanyuan Shi, Geoff H. Werstuck.
Institutions: McMaster University, McMaster University.
Atherosclerosis is a disease of the large arteries and a major underlying cause of myocardial infarction and stroke. Several different mouse models have been developed to facilitate the study of the molecular and cellular pathophysiology of this disease. In this manuscript we describe specific techniques for the quantification and characterization of atherosclerotic lesions in the murine aortic sinus and ascending aorta. The advantage of this procedure is that it provides an accurate measurement of the cross-sectional area and total volume of the lesion, which can be used to compare atherosclerotic progression across different treatment groups. This is possible through the use of the valve leaflets as an anatomical landmark, together with careful adjustment of the sectioning angle. We also describe basic staining methods that can be used to begin to characterize atherosclerotic progression. These can be further modified to investigate antigens of specific interest to the researcher. The described techniques are generally applicable to a wide variety of existing and newly created dietary and genetically-induced models of atherogenesis.
Medicine, Issue 82, atherosclerosis, atherosclerotic lesion, Mouse Model, aortic sinus, tissue preparation and sectioning, Immunohistochemistry
Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster
Authors: Pietro Laneve, Angela Giangrande.
Institutions: Institut de Génétique et de Biologie Moléculaire et Cellulaire, Istituto Italiano di Tecnologia.
The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular biology has been greatly fueled by the discovery of noncoding RNAs as major players in post-transcriptional regulation. Such a revolutionary perspective has been accompanied and triggered by the development of powerful technologies for profiling short RNAs expression, both at the high-throughput level (genome-wide identification) or as single-candidate analysis (steady state accumulation of specific species). Although several state-of-art strategies are currently available for dosing or visualizing such fleeing molecules, Northern Blot assay remains the eligible approach in molecular biology for immediate and accurate evaluation of RNA expression. It represents a first step toward the application of more sophisticated, costly technologies and, in many cases, remains a preferential method to easily gain insights into RNA biology. Here we overview an efficient protocol (Enhanced Northern Blot) for detecting weakly expressed microRNAs (or other small regulatory RNA species) from Drosophila melanogaster whole embryos, manually dissected larval/adult tissues or in vitro cultured cells. A very limited amount of RNA is required and the use of material from flow cytometry-isolated cells can be also envisaged.
Molecular Biology, Issue 90, Northern blotting, Noncoding RNAs, microRNAs, rasiRNA, Gene expression, Gcm/Glide, Drosophila melanogaster
Performing Custom MicroRNA Microarray Experiments
Authors: Xiaoxiao Zhang, Yan Zeng.
Institutions: University of Minnesota , University of Minnesota .
microRNAs (miRNAs) are a large family of ˜ 22 nucleotides (nt) long RNA molecules that are widely expressed in eukaryotes 1. Complex genomes encode at least hundreds of miRNAs, which primarily inhibit the expression of a vast number of target genes post-transcriptionally 2, 3. miRNAs control a broad range of biological processes 1. In addition, altered miRNA expression has been associated with human diseases such as cancers, and miRNAs may serve as biomarkers for diseases and prognosis 4, 5. It is important, therefore, to understand the expression and functions of miRNAs under many different conditions. Three major approaches have been employed to profile miRNA expression: real-time PCR, microarray, and deep sequencing. The technique of miRNA microarray has the advantage of being high-throughput, generally less expensive, and most of the experimental and analysis steps can be carried out in a molecular biology laboratory at most universities, medical schools and associated hospitals. Here, we describe a method for performing custom miRNA microarray experiments. A miRNA probe set will be printed on glass slides to produce miRNA microarrays. RNA is isolated using a method or reagent that preserves small RNA species, and then labeled with a fluorescence dye. As a control, reference DNA oligonucleotides corresponding to a subset of miRNAs are also labeled with a different fluorescence dye. The reference DNA will serve to demonstrate the quality of the slide and hybridization and will also be used for data normalization. The RNA and DNA are mixed and hybridized to a microarray slide containing probes for most of the miRNAs in the database. After washing, the slide is scanned to obtain images, and intensities of the individual spots quantified. These raw signals will be further processed and analyzed as the expression data of the corresponding miRNAs. Microarray slides can be stripped and regenerated to reduce the cost of microarrays and to enhance the consistency of microarray experiments. The same principles and procedures are applicable to other types of custom microarray experiments.
Molecular Biology, Issue 56, Genetics, microRNA, custom microarray, oligonucleotide probes, RNA labeling
Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale
Authors: Valentina Gandin, Kristina Sikström, Tommy Alain, Masahiro Morita, Shannon McLaughlan, Ola Larsson, Ivan Topisirovic.
Institutions: McGill University, Karolinska Institutet, McGill University.
mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed “anota” algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.
Biochemistry, Issue 87, Cells, Eukaryota, Nutritional and Metabolic Diseases, Neoplasms, Metabolic Phenomena, Cell Physiological Phenomena, mRNA translation, ribosomes, protein synthesis, genome-wide analysis, translatome, mTOR, eIF4E, 4E-BP1
Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR
Authors: Marco Pacifici, Serena Delbue, Ferdous Kadri, Francesca Peruzzi.
Institutions: LSU Health Sciences Center, University of Milan.
MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis. There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software. Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.
Medicine, Issue 83, microRNAs, biomarkers, miRNA profiling, qPCR, cerebrospinal fluid, RNA, DNA
MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium
Authors: Whitney A. Greene, Alberto. Muñiz, Mark L. Plamper, Ramesh R. Kaini, Heuy-Ching Wang.
Institutions: JBSA Fort Sam Houston.
The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.
Molecular Biology, Issue 88, microRNA, microarray, human induced-pluripotent stem cells, retinal pigmented epithelium
Purification and microRNA Profiling of Exosomes Derived from Blood and Culture Media
Authors: Marguerite K. McDonald, Kathryn E. Capasso, Seena K. Ajit.
Institutions: Drexel University College of Medicine.
Stable miRNAs are present in all body fluids and some circulating miRNAs are protected from degradation by sequestration in small vesicles called exosomes. Exosomes can fuse with the plasma membrane resulting in the transfer of RNA and proteins to the target cell. Their biological functions include immune response, antigen presentation, and intracellular communication. Delivery of miRNAs that can regulate gene expression in the recipient cells via blood has opened novel avenues for target intervention. In addition to offering a strategy for delivery of drugs or RNA therapeutic agents, exosomal contents can serve as biomarkers that can aid in diagnosis, determining treatment options and prognosis. Here we will describe the procedure for quantitatively analyzing miRNAs and messenger RNAs (mRNA) from exosomes secreted in blood and cell culture media. Purified exosomes will be characterized using western blot analysis for exosomal markers and PCR for mRNAs of interest. Transmission electron microscopy (TEM) and immunogold labeling will be used to validate exosomal morphology and integrity. Total RNA will be purified from these exosomes to ensure that we can study both mRNA and miRNA from the same sample. After validating RNA integrity by Bioanalyzer, we will perform a medium throughput quantitative real time PCR (qPCR) to identify the exosomal miRNA using Taqman Low Density Array (TLDA) cards and gene expression studies for transcripts of interest. These protocols can be used to quantify changes in exosomal miRNAs in patients, rodent models and cell culture media before and after pharmacological intervention. Exosomal contents vary due to the source of origin and the physiological conditions of cells that secrete exosomes. These variations can provide insight on how cells and systems cope with stress or physiological perturbations. Our representative data show variations in miRNAs present in exosomes purified from mouse blood, human blood and human cell culture media. Here we will describe the procedure for quantitatively analyzing miRNAs and messenger RNAs (mRNA) from exosomes secreted in blood and cell culture media. Purified exosomes will be characterized using western blot analysis for exosomal markers and PCR for mRNAs of interest. Transmission electron microscopy (TEM) and immunogold labeling will be used to validate exosomal morphology and integrity. Total RNA will be purified from these exosomes to ensure that we can study both mRNA and miRNA from the same sample. After validating RNA integrity by Bioanalyzer, we will perform a medium throughput quantitative real time PCR (qPCR) to identify the exosomal miRNA using Taqman Low Density Array (TLDA) cards and gene expression studies for transcripts of interest. These protocols can be used to quantify changes in exosomal miRNAs in patients, rodent models and cell culture media before and after pharmacological intervention. Exosomal contents vary due to the source of origin and the physiological conditions of cells that secrete exosomes. These variations can provide insight on how cells and systems cope with stress or physiological perturbations. Our representative data show variations in miRNAs present in exosomes purified from mouse blood, human blood and human cell culture media
Genetics, Issue 76, Molecular Biology, Cellular Biology, Medicine, Biochemistry, Genomics, Pharmacology, Exosomes, RNA, MicroRNAs, Biomarkers, Pharmacological, Exosomes, microRNA, qPCR, PCR, blood, biomarker, TLDA, profiling, sequencing, cell culture
Implantation of a Carotid Cuff for Triggering Shear-stress Induced Atherosclerosis in Mice
Authors: Michael T. Kuhlmann, Simon Cuhlmann, Irmgard Hoppe, Rob Krams, Paul C. Evans, Gustav J. Strijkers, Klaas Nicolay, Sven Hermann, Michael Schäfers.
Institutions: Westfälische Wilhelms-University Münster, Imperial College London , Imperial College London , Eindhoven University of Technology.
It is widely accepted that alterations in vascular shear stress trigger the expression of inflammatory genes in endothelial cells and thereby induce atherosclerosis (reviewed in 1 and 2). The role of shear stress has been extensively studied in vitro investigating the influence of flow dynamics on cultured endothelial cells 1,3,4 and in vivo in larger animals and humans 1,5,6,7,8. However, highly reproducible small animal models allowing systematic investigation of the influence of shear stress on plaque development are rare. Recently, Nam et al. 9 introduced a mouse model in which the ligation of branches of the carotid artery creates a region of low and oscillatory flow. Although this model causes endothelial dysfunction and rapid formation of atherosclerotic lesions in hyperlipidemic mice, it cannot be excluded that the observed inflammatory response is, at least in part, a consequence of endothelial and/or vessel damage due to ligation. In order to avoid such limitations, a shear stress modifying cuff has been developed based upon calculated fluid dynamics, whose cone shaped inner lumen was selected to create defined regions of low, high and oscillatory shear stress within the common carotid artery 10. By applying this model in Apolipoprotein E (ApoE) knockout mice fed a high cholesterol western type diet, vascular lesions develop upstream and downstream from the cuff. Their phenotype is correlated with the regional flow dynamics 11 as confirmed by in vivo Magnetic Resonance Imaging (MRI) 12: Low and laminar shear stress upstream of the cuff causes the formation of extensive plaques of a more vulnerable phenotype, whereas oscillatory shear stress downstream of the cuff induces stable atherosclerotic lesions 11. In those regions of high shear stress and high laminar flow within the cuff, typically no atherosclerotic plaques are observed. In conclusion, the shear stress-modifying cuff procedure is a reliable surgical approach to produce phenotypically different atherosclerotic lesions in ApoE-deficient mice.
Medicine, Issue 59, atherosclerosis, mouse, cardiovascular disease, shear stress |
Forty steps carved in granite lead down from the winding path of Newport’s Cliff Walk to the crashing waves of the Atlantic Ocean. Above, past wildflowers and thick brush is a pathway through a formal hedge that seems perfect for a child’s entrance to a secret garden. Beyond, rising high on a formal lawn is one of the towering “Gilded Age” mansions. The windows are empty now, but the whisper of festive frivolity can still be heard in the wind.
Even before the turn of the century, Newport, Rhode Island, was the summer playground for America’s aristocracy. Founded in 1639, this famous seaside city was home to many of the country’s most prominent families. Hailed as the “Queen of Resorts” during the early 1800s, Newport’s illustrious Bellevue Avenue sparkled even then with significant architecture and high-society gatherings. Today, Newport’s palatial palaces still sprawl along its cliffs offering a rare glimpse into an era of grandeur. Located a pleasant drive south of Boston, Newport seems, upon first approaching its welcome sign, like most New England seafront villages. Neat colonial farms and quaint markets line the road as it curves over a bridge spanning Narragansett Bay, connecting the mainland to the island. The vista that unfolds here, as the steeple tops of Newport appear in the distance, is indeed quaint. The rich and religious purpose of this setting begins to reveal its past through its architectural icons. The island of Rhode Island is only about 15 miles long and is known by its citizens as Adquidneck, an American Indian name meaning “Isle of Peace.” Founded on the principles of religious freedom, Newport became a haven for those seeking a right to worship in the New World. The symbols of this spirit remain throughout its community with historic churches and graveyards worthy of visits for their inspirational settings. The sandy Easton’s Beach that greets vacation-goers today is the same setting that well-heeled 19th-century visitors flocked to in escape of the city’s heat. Looming out to the west along her shores is the three-and-a-half-mile, cragged white etched edge of Newport’s famous Cliff Walk. Here, above the protected public path for lovers and strollers, lie the architectural marvels of this rare American city. Nowhere in North America can there be found such a display of European-influenced grandeur than here amidst these castles by the sea. If not for the dedication of the local preservationists over the past 100 years, Newport’s historic architecture would have seen the fate of the wrecking ball that so many other important East Coast structures have seen. Local preservationists are to credit for their steadfast devotion to protecting this historic city’s treasures. The largest number of pre-Revolutionary buildings in North America still adorns the bustling streets of downtown Newport. From its rise to a destination for the elite in the 1880s, Newport’s Bellevue Avenue and Ocean Drive are still a showcase for its glorious architecture styles of Greek, Roman, Italian, French, and English designs. Palatial mansions of the mid-19th century that can be found here are the finest collection of architectural styles to be found on this side of the Atlantic. With Newport’s “Gilded Age” came palaces of Greek Revival, French Second Empire, Gothic, Italianate, Baroque, Renaissance, and Beaux-Arts forms of construction. The list of impressive and powerful residents of Newport is long. Some of the richest families in our country such as the Vanderbilts and Astors built their summer palaces here. Important political figures such as Eisenhower and John Kennedy chose the shores of this exclusive island as the site for their summer White House. The grand homes on Bellevue Avenue are predominately museums now, as the cost of residential operations during the first part of the 20th century became too great even for the very wealthy. Much to the public’s fortune, these American castles on the cliff are available for tours throughout the year. Each mansion seems grander than the next as the opulent interiors of many rival the palaces of Versailles. The winter months are a quiet time to enjoy the beauty of the homes with a variety of special concerts and events hosted throughout this snowy season. During the summer, however, visitors can tour the gardens and walk along the cliffs, imagining the way the rich and famous used to live. There are 10 mansions available for visiting on the Preservation Society of Newport County’s official Newport mansion tours. A variety of tour packages are offered ranging from a ticket to see only one home (which could take the better part of a day if you want to linger in its regal halls) or more. Three homes are about the limit one can plan to visit in a day’s time. Visitors can tour the grounds on their own or opt for a guided tour, where fascinating historical lectures are given on the details of not only the mansions, but also the residents who once lived there. Tour prices for adults range from around $16 to $25 and for children $4 to $9. The grandest summer “cottage” of Bellevue Avenue is the Breakers (44 Ochre Point Avenue). If you have time for just one mansion, this is the one to visit. This 70-room Italian Renaissance-style palazzo was owned by the Vanderbilt family and was a symbol of their social preeminence at the turn of the century. The expansive interior is filled with furnishings and fixtures designed by Allard and Sons of Paris and relief sculptures by Austrian American sculptor Karl Bitter. Boston architect Ogden Codman decorated the vast and intricate details of the family private living quarters. The Vanderbilt’s children’s rooms are an inspiration for designers seeking grandeur for their clients. Each room is exquisitely arranged seemingly awaiting the return of the seven young Vanderbilt merrymakers. The views from the enormous open terrace overlooking the Atlantic are breathtaking. One can easily imagine the grand galas that took place here across the marble floors. The Elms (367 Bellevue Avenue) was the summer residence of Mr. and Mrs. Edward Julius Berwind of Philadelphia and New York. The house was designed in 1898 to resemble the mid-18th-century French Chateau d’Asnieres (c. 1750) outside of Paris. Elaborate classical revival gardens include terraces where marble and bronze sculptures are displayed. There are marble pavilions, fountains, and a sunken garden that can be toured here. The Elms houses an exquisite collection of 18th-century French and Venetian paintings and Renaissance ceramics. There is an unusual rooftop and behind-the-scenes tour that is offered at the Elms mansion. Guests are taken into the kitchens, wine cellar, and to the third floor staff quarters for a peek at how the other half lived during the Gilded Age. Marble House (596 Bellevue Avenue) was another summer cottage owned by the Vanderbilt family. Inspired by the Petit Trianon at Versailles, life at Marble House in the late 1800s set the pace for Newport’s escalation of construction of its grand estates and hosting of extravagant social events. Five hundred thousand cubic feet of marble embellish this estate that was designed by architect Richard Morris Hunt. The owners, Mr. Cornelius Vanderbilt and his wife Alva, divorced in 1885. After her husband’s death, Mrs. Vanderbilt moved back into the house and built a ruby red Chinese Tea House on the edge of the ocean cliffs. It was here that she hosted rallies for women’s right to vote at the turn of the century. A landmark of Gothic Revival style in American architecture can be found at Kingscote (253 Bellevue Avenue). Medieval tournament tents inspired this romantic composition of towers, windows, Gothic arches, and porch roofs. Owned by southern planter George Noble Jones, this Newport landmark was built in 1839. The construction of this home on Bellevue Avenue marked the beginning of the cottage boom that would define this area for its magnificent architecture. The home includes an early installation of opalescent glass bricks by Louis Comfort Tiffany and an exotic collection of eastern and western ornamentation. Chateau-Sur-Mer (474 Bellevue Avenue) was the grandest residence in Newport from 1852 until the construction of the Vanderbilt house in the1890s. It serves as a landmark of high Victorian architecture and furnishings. The mansion was the setting for the famed “Fete Champetre” where society gathered for elaborate picnics. Chateau-Sur-Mer’s glorious gatherings became legendary in Newport and paved the way for the Gilded Age of entertaining. Rosewood (548 Bellevue Avenue) was the setting for fairy tale dinner parties where famous entertainers performed, including magician Harry Houdini. Owned by the Nevada silver heiress Theresa Fair Oelrichs, the mansion was modeled after the Grand Trianon, a garden retreat of French kings at Versailles. Architect Stanford White began a construction renovation of the home in 1899 and did not complete the project until 1902 at the reported cost of $2.5 million. Its previous owner, historian and diplomat George Bancroft developed the ‘American Beauty’ rose in the gardens here. It was during the ownership of Mrs. Oelrichs that Rosewood became known as the setting for some of the most exclusive and decadent social events in Newport. After a day or two of exploring the historic and fascinating mansions of Bellevue Avenue, there is a vivacious city to explore. It is a maritime city where its harbor is filled with grand power and pleasure sailing craft. Known as the sailing capital of the United States, many defenses of the America’s Cup yachting prize took place here. Colorful restaurants and boutiques are abundant along its harbor walk. Also home to the International Tennis Hall of Fame, Newport is the setting for many a championship tennis tournament. The Newport Country Club hosted the first U.S. Open and the first U.S. Amateur, both held in 1895. The Newport Preservation Society offers historic walking tours of downtown, where early colonial architecture is still intact. Some of the most exclusive art and antique galleries can also be found in Newport. Of particular note is the William Vareika’s Fine Arts Gallery, which houses the largest collection of famous American artist John Lafarge’s paintings and stained glass. Mr. Vareika and his wife Allison are Newport preservationists, a warm and delightful couple to meet on a trip to Newport. Most certainly knowledgeable about Newport’s history, the Vareikas are happy to share their historical perspective on the city they love so dearly. There are many hotels and bed and breakfast options available throughout the city, however, it would be wise during the peak summer season to make reservations in advance. The Newport Hyatt Regency is located on Goat Island overlooking the downtown Newport Harbor and the stately sailboats. Guests of this resort ferry back and forth to the mainland. The Newport Marriott is directly on the harbor and does not require a ferryboat ride for transport. A slightly dated but favorite motor lodge is the Cliffs, which overlooks the public beach and has access to the rambling Cliff Walk along Bellevue Avenue’s rolling seaside lawns. To make the most of a trip to this section of the Northeast, take a flight into Boston and spend a day exploring Newbury Street and Beacon Hill. A stay at the Langley Hotel is worth the visit in itself. This five-star hotel with European service offers good prices, particularly for Boston, with every comfort and luxury possible. The hotel has a lovely indoor pool and a full service spa. On Saturdays, the Langley is famous for its Chocolate Brunch where tempting entrees and desserts dripped in chocolate are resplendent. Then rent a car and head south for a beautiful New England drive to the city by the sea. The Newport experience is a unique and one-of-a-kind destination that enlightens the imagination, leaving you with a lingering image of the glorious days of America’s 19th-century silver-spoon society.
Tags:castles Category: Travel » Additional Articles for "Travel":
Nashville on the Move: Music and its Makings
Here you can write a comment to post "America’s Castles on the Cliffs: Newport’s Gilded Glories"
Building a Better, Greener Nursery: Tips to help parents create a healthy environment for Cruising the Caribbean: afloat the dream boat
spring Gallery |
Colonisation and Land Use Change on Rathlin Island Using a Multi-Proxy and sedaDNA Approach to Lake Sediments and Soils.
School of Geography
Prof AG Brown
No more applications being accepted
How good is research at University of Southampton in Geography, Environmental Studies and Archaeology
Rathlin is a small island in the Atlantic between Northern Ireland and Scotland, and is currently being investigated as part of a research project by members of the Palaeoenvironmental Laboratory at the University of Southampton (PLUS). Most studies of islands have taken an island-biogeography approach but this project seeks to go beyond this by explicitly targeting the history of inward dispersal and ecological change in relation to the human history of the island. The island has seen huge changes in population from 1200 just two hundred and fifty years ago, to 35 today. It is believed that Rathlin was first settled in the early Holocene (Mesolithic) and was colonised around 6000 years ago by early farmers. After being deforested probably in the Bronze Age, it was the first place in the Irish Sea to be raided by Vikings in AD 795. In the 17th-18th centuries its population rocketed due to fishing, kelp (seaweed) and potatoes. A full archaeological survey of the island by the Northern Irish Environment Agency completed in 2012 provides the history of human settlement and activity and structural information on farming and land use.
Rathlin island also has several natural lakes which vary in their chemistry from calcareous to acidic, and numerous abandoned farms and field systems. This provides a unique opportunity to test out new palaeoecolocal methods, and particularly sediment DNA (sedaDNA) of determining past ecological history including the timing of species immigration from the early Holocene to the 19th century. Rathlin provides a natural gateway to the island of Ireland and so can be used to define the biogeographical border in this region. At present we know virtually nothing of its ecological history, however, the modern ecology includes many alien species associated with human habitation ranging from feral crops to Japanese knotweed. The island also has a history of kelp (seaweed) application to improve soils but this and other land use practices, such as marling, have an unknown history.
The project has already cored several lakes and these sediments are available for immediate study. However, it is envisaged that there will be additional survey work and soil sampling on the island. Traditional palaeoecological approaches are being taken, particularly plant macrofossil and pollen and fungal spore analysis but also biomarkers (particularly plant leaf waxes, sterols and PAH) and sedaDNA. The soils work will also use soil DNA to identify past areas of cultivation, a technique that has proven valuable in Scotland. The close proximity of lakes with different water chemistry (due to the juxterposition of the Antrim Basalt and underlying chalk) will also provide a critical methodological test for both biomarkers and sedaDNA. All cores will be subject to whole-core scanning XRF in order to establish the relative role of catchment inputs and within lake nutrient cycling and productivity. The work will be done in co-operation with NIEA, the regional archaeologists and also the inhabitants of Rathlin island. The project will seek to address the following questions;
1. What is the pattern of early Holocene plant and animal colonisation and what is the role of humans in this ecological history?
2. Is there a biogeographical signature of Mesolithic settlement on the island?
3. When and was the island deforested?
4. What is the balance between pastoralism and arable agriculture?
5. Can old areas of arable cultivation (including for potatoes) be identified by aDNA and molecular biomarkers?
6. Are there changes in vegetation and land use after Viking colonisation?
7. Can the dramatic changes I the last 3000 years (including the Irish potato famine) be detected in lake records?
For the latest information on postgraduate opportunities within Geography and Environment, please visit our website at http://www.southampton.ac.uk/geography/postgraduate/research_degrees/studentships.page?
This is one of a range of topics currently being advertised. Funding will go to the project(s) with the best applicant(s). The studentship is funded at RCUK level, currently £14,296 per annum, with an RTSG of £750, together with home rate tuition fees. The studentship is for three years. The studentship will fully support British and EU nationals only. International students can apply but they must be able to meet the difference between home/EU and International tuition fees themselves.
Alsos, I.G., Sjögren, P., Edwards, M., Landvik, J., Gielly, L., Forwick M., Cossack, E., Brown, A.G., Jacobsen, L. V., Føreid, M. and Pedersen, M. In Preys. Sedimentary ancient DNA from Lake Skartjørna, Svalbard: Assessing the resilience of arctic flora to Holocene climate change. The Holocene 25, 1-16.
Giguet-Covex, C. et al. 2014. Long livestock farming history and human
landscape shaping revealed by lake sediment DNA. Nature Communications 1-7DOI: 10.1038/ncomms4211
D’Anjou1, F.M, Bradley, R.S., Balascio, N.L. and Finkelstein, D.B. 2012. Climate impacts on human settlement and agricultural activities in northern Norway revealed through sediment biogeochemistry. PNAS, 1-6.
Forsythe, W. and McConkey, R. 2012. Rathlin Island: An Archaeological Survey of a Maritime Landscape. Northern Ireland Archaeological Monographs 8
Hebsgaard, M.B., Gilbert, T.P., Arneborg, L., Heyn, P. Allentoft, M.E., Bunce, M., Munch, K., Schweger, C. and Willerslev, E. 2008. The Farm Beneath the Sand’ – an archaeological case study on ancient ‘dirt’ DNA. Antiquity 430-444.
The Palaeoecology Laboratory at the University of Southampton (PLUS) is an international leader in the fields of palaeoecology, palaeolimnology, geoarchaeology Quaternary Science and forensic palynology. There are presently approximately 10 postgraduates, 3 postdoctoral Research Fellows and six full time academic staff (Prof. Tony Brown, Prof. Mary Edwards, Prof. John Dearing, Prof. Pete Langdon, Dr Paul Hughes Dr Sandra Nogué-Bosch and Prof Keith Barber (Emeritus)) and a number of Visiting Fellows (Prof. Rob Scaife, Dr Catherine Langdon, Dr Pat Wiltshire, Prof. David Hawksworth CBE and Dr Shirley Wynne), as well as a dedicated research technician. The laboratory has excellent equipment for lake and mire work including three boats, a variety of corers, two vehicles and access to advanced analytical techniques such as ESEM-EDS, non-destructive core XRF scanning (ITRAX) and ICP-MS. The laboratory is involved in a number of palaeoenvironmental projects and you will be joining a thriving group of postgraduates and postdoctoral researchers (see website http://www.geog.soton.ac.uk/research/plus/). Full training in all necessary techniques will be given. Almost all palaeoecology postgraduates submit successful theses in less than four years.
How good is research at University of Southampton in Geography, Environmental Studies and Archaeology?
FTE Category A staff submitted: 32.00
Computer modelling of greenhouse gas emissions from agriculture and land use change.
University of Sussex School of Global Studies
Field scale reconstruction of nineteenth century rural land use using first County Series OS maps and parish area books
Kingston University Faculty of Science, Engineering and Computing
Fully Funded PhD Project: Ammonia cycling and emerging particulate matter pollutants under arable land-use management: A modelling approach
Dublin Institute of Technology Graduate Research School Office
Use of polymer concrete as a lining material for small diameter tunnels installed using Microtunnelling Machines
University of Birmingham Department of Civil Engineering
Multi-sensor approach: Can Quantum Technology gravity be combined with other (non QT) geophysical instrumentation to set constraints for gravity inversion |
PloS one 2016-12-10
Long-Circulating Curcumin-Loaded Liposome Formulations with High Incorporation Efficiency, Stability and Anticancer Activity towards Pancreatic Adenocarcinoma Cell Lines In Vitro.
[Mohamed Mahmud, Adriana Piwoni, Nina Filipczak, Martyna Janicka, Jerzy Gubernator]
The incorporation of hydrophobic drugs into liposomes improve their bioavailability and leads to increased stability and anticancer activity, along with decreased drug toxicity. Curcumin (Cur) is a natural polyphenol compound with a potent anticancer activity in pancreatic adenocarcinoma (PA). In the present study, different types of Cur-loaded liposomal formulations were prepared and characterized in terms of size, shape, zeta potential, optimal drug-to-lipid ratio and stability at 4°C, 37°C; and in human plasma in vitro. The best formulation in terms of these parameters was PEGylated, cholesterol-free formulation based upon hydrogenated soya PC (HSPC:DSPE-PEG2000:Cur, termed H5), which had a 0.05/10 molar ratio of drug-to-lipid, was found to be stable and had a 96% Cur incorporation efficiency. All Cur-loaded liposomal formulations had potent anticancer activity on the PA cancer cell lines AsPC-1 and BxPC-3, and were less toxic to a normal cell line (NHDF). Furthermore, apoptosis-induction induced by Cur in PA cells was associated with morphological changes including cell shrinkage, cytoplasmic blebbing, irregularity in shape and the externalization of cell membrane phosphatidylserine, which was preceded by an increase in intracellular reactive oxygen species (ROS) generation and caspase 3/7 activation. Because the liposomal formulations tested here, especially the H5 variant which exhibited slow release of the Cur in the human plasma test, the formulation may be stable enough to facilitate the accumulation of pharmacologically active amounts of Cur in target cancer tissue by EPR. Therefore, our formulations could serve as a promising therapeutic approach for pancreatic cancer and other cancers. |
Recurrence of prostate cancer is significantly lower in men with blood group O
European Association of Urology
A man’s blood group can affect the chance of a recurrence of prostate cancer after surgery, according to new research. This is the first time that this relationship has been demonstrated. Specifically, this new study has shown that patients with blood group O had a significantly decreased risk of cancer recurrence after radical prostatectomy.
A man's blood group can affect the chance of a recurrence of prostate cancer after surgery, according to new research, which was presented at the European Association of Urology congress in Stockholm. This is the first time that this relationship has been demonstrated.
Prostate cancer is the most common cancer in men, with huge differences in incidence across Europe. For localized prostate cancer the current "gold standard" treatment is Radical Prostatectomy (RP). However despite apparently successful surgery, approximately 30% of patients experience biochemical recurrence (shown by a rising level of Prostate Specific Antigen, PSA) during long-term follow-up.
This new study, from a team led by Dr Yoshio Ohno of Tokyo Medical University, has shown that patients with blood group O had a significantly decreased risk of cancer recurrence after radical prostatectomy (RP).
The team looked at 555 patients with localized prostate cancer who underwent RP between 2004 and 2010. After following the patients for an average of 52 months, they found that patients with blood group O were 35% less likely to have a recurrence of prostate cancer than patient who had blood group A.
Dr Ohno commented: "This is the first time that anyone has shown that prostate cancer recurrence can vary with blood group. Of course we need bigger studies to confirm the effect and also to see what practical application the finding might have. For example, we know that there are wide racial and geographical variations in the distribution of the ABO blood groups, and we need to be sure that this effect is significant in other groups.
As yet, we don't know why the risks vary with blood group, but this work may guide us towards new avenues of molecular research on prostate cancer progression. We need to consider what these results means in practical, clinical terms. For example, should we be counselling people with certain blood groups that they have a greater or lesser chance of recurrence, and should these risk factors be built into decisions on treatment?"
In the past, variation in ABO blood groups have been found to be associated with different risk of developing certain cancers, such as gastric and pancreatic cancers, and recently it has also been shown that prostate cancer incidence varies with blood group2.
Commenting, EAU General Secretary, Professor Per-Anders Abrahamsson (Malmo) said: "This is an interesting first finding. There is great geographical variation the incidence of prostate cancer, so there are obviously strong genetic factors at play. Blood groups have already been shown to be associated with prostate cancer incidence, not it looks like they might be associated with treatment outcomes as well."
The above post is reprinted from materials provided by European Association of Urology. Note: Materials may be edited for content and length.
European Association of Urology. "Recurrence of prostate cancer is significantly lower in men with blood group O." ScienceDaily. ScienceDaily, 14 April 2014. <www.sciencedaily.com/releases/2014/04/140414091907.htm>.
European Association of Urology. (2014, April 14). Recurrence of prostate cancer is significantly lower in men with blood group O. ScienceDaily. Retrieved September 5, 2015 from www.sciencedaily.com/releases/2014/04/140414091907.htm
European Association of Urology. "Recurrence of prostate cancer is significantly lower in men with blood group O." ScienceDaily. www.sciencedaily.com/releases/2014/04/140414091907.htm (accessed September 5, 2015).
Smokers at Twice Risk of Prostate Cancer Recurring After Surgery
Mar. 20, 2015 Current smokers, and those who have quit smoking less than 10 years previously, have twice the risk of a recurrence of prostate cancer after surgery, according to new ... read more Elevated Cholesterol, Triglycerides May Increase Risk for Prostate Cancer Recurrence
Oct. 10, 2014 Higher levels of total cholesterol and triglycerides, two types of fat, in the blood of men who underwent surgery for prostate cancer, were associated with increased risk for disease recurrence, ... read more Prostate Cancer Clinical Stage Does Not Predict Recurrence, Study Suggests
Nov. 22, 2010 A new study challenges the current staging system that determines the extent or severity of prostate cancer that has not metastasized. The study found that there is no link between localized prostate ... read more Novel Test Following Prostate Surgery Could Detect Cancer Recurrence Earlier
Sep. 29, 2010 A new test could reliably detect early increases in prostate specific antigen levels -- a biomarker commonly used to measure the recurrence of prostate cancer -- in men who have undergone prostate ... read more Strange & Offbeat |
Chasing the golden egg: Vaccination against poultry coccidiosis
Sharman, PA
Smith, NC
Wallach, M
Katrib, M
Parasite Immunology, 2010, 32 (8), pp. 590 - 598
P>Eimeria species, of the Phylum Apicomplexa, cause the disease coccidiosis in poultry, resulting in severe economic losses every year. Transmission of the disease is via the faecal-oral route, and is facilitated by intensive rearing conditions in the poultry industry. Additionally, Eimeria has developed drug resistance against most anticoccidials used today, which, along with the public demand for chemical free meat, has lead to the requirement for an effective vaccine strategy. This review focuses on the history and current status of anticoccidial vaccines, and our work in developing the transmission-blocking vaccine, CoxAbic (R) (Netanya, Israel). The vaccine is composed of affinity-purified antigens from the wall-forming bodies of macrogametocytes of Eimeria maxima, which are proteolytically processed and cross-linked via tyrosine residues to form the environmentally resistant oocyst wall. The vaccine is delivered via maternal immunization, where vaccination of laying hens leads to protection of broiler offspring. It has been extensively tested for efficacy and safety in field trials conducted in five countries and involving over 60 million offspring chickens from immunized hens and is currently the only subunit vaccine against any protozoan parasite to reach the marketplace.
Mycology & Parasitology
dc.subject.mesh
Coccidiosis
Protozoan Vaccines
Vaccines, Subunit
Antigens, Protozoan
utslib.citation.volume
0707 Veterinary Sciences
0605 Microbiology
1108 Medical Microbiology
The Hong Kong Polytechnic University, Hong Kong
/University of Technology Sydney/Faculty of Science
/University of Technology Sydney/Faculty of Science/School of Life Sciences
pubs.issue
pubs.volume |
Home Featured stories Exercise-related Changes in Estrogen Metabolism May Lower Breast Cancer Risk
Exercise-related Changes in Estrogen Metabolism May Lower Breast Cancer Risk
Image from www.deans-sport.co.uk
PHILADELPHIA — Changes in estrogen breakdown, or metabolism, may be one of the mechanisms by which aerobic exercise lowers a woman’s breast cancer risk, according to data published in Cancer Epidemiology, Biomarkers & Prevention, a journal of the American Association for Cancer Research.
“Observational studies suggest physical activity lowers breast cancer risk, but there are no clinical studies that explain the mechanism behind this,” said Mindy S. Kurzer, Ph.D., professor in the Department of Food Science and Nutrition at the University of Minnesota in Saint Paul. “Ours is the first study to show that aerobic exercise influences the way our bodies break down estrogens to produce more of the ‘good’ metabolites that lower breast cancer risk.”
Kurzer and her colleagues conducted the Women in Steady Exercise Research (WISER) clinical trial, which involved 391 sedentary, healthy, young, premenopausal women. They randomly assigned the women to two age-matched, body mass index-matched groups: a control group of 179 women and an intervention group of 212 women.
While women in the control group continued a sedentary lifestyle for the entire study period, women in the intervention group performed 30 minutes of moderate-to-vigorous aerobic exercise five times a week for 16 weeks. Aerobic exercises included the treadmill, stair stepper or elliptical machine. The researchers adjusted the workout intensity for each individual so that the maximal heart rate was uniform among all participants.
Eighty-six percent of participants from the control group and 78 percent from the intervention group completed the study.
The researchers collected 24-hour urine samples on three consecutive days prior to study initiation and on three consecutive days at the end of the study. Using a state-of-the-art technique called liquid chromatography/tandem mass spectroscopy, they measured the amount of three parent estrogens, E1, E2 and E3, and nine of their breakdown products called metabolites, in the participants’ urine samples. According to Kurzer, estrogen metabolism favoring the production of a metabolite called 2-hydroxyestrone (2-OHE1) over one called 16alpha-hydroxyestrone (16alpha-OHE1), which results in an increase in the 2-OHE1/16alpha-OHE1 ratio, has been linked with a reduction in breast cancer risk.
She and her colleagues found that aerobic exercise led to an increase in the amount of 2-OHE1 and a decrease in the amount of 16alpha-OHE1, which led to a significant increase in the 2-OHE1/16alpha-OHE1 ratio. There were no changes in the 2-OHE1/16alpha-OHE1 ratio in the urine of control group participants.
“Exercise, known to favor fitness and improve heart health, is also likely to help prevent breast cancer by altering estrogen metabolism,” said Kurzer. “It is very important, however, to decipher the biological mechanisms behind this phenomenon.”
In collaboration with researchers at the University of Pennsylvania in Philadelphia, Kurzer is conducting similar studies in women with a high risk for breast cancer. (Jeremy Moore/American Association for Cancer Research)
New research links body clocks to osteoarthritis | World Ngayon January 13, 2014 at 9:45 am
[…] exercise, regular meals and the periodic warming and cooling of joints could be used to relieve the symptoms […]
South Asian women should no longer be considered at low risk of breast cancer | World Ngayon January 13, 2014 at 10:17 am
[…] Also read: Exercise-related Changes in Estrogen Metabolism May Lower Breast Cancer Risk […]
The Pint-Sized ‘Fuel’ Phone Charger Is As Useful As It Is...
Smart advantages of Android phone
Government agencies launch community-based approach to control dengue
Insects' gut microbes hint at biofuel breakthrough
Social bond: Infants prefer individuals who punish those not like themselves
Warning! Iranians hit in email hack attack
Install Windows XP in few simple steps
Trees Used to Create Recyclable, Efficient Solar Cell
Nutrient in red meat linked to heart disease
Study puts Huntington’s disease trials on TRACK
New Implant Holds Promise for Improved Hearing |
Research News @Vanderbilt
Math Master: Sylvia T. Bozeman, MA’70, Honored with National Medal of Science Committee Appointment
Sylvia Bozeman (KAY HINTON)
Sylvia Bozeman enrolled in Vanderbilt’s graduate program in mathematics in 1968, one year after the program was integrated, and went on to become the first African American woman to earn a master’s degree in math from the university. Today she is a professor, emerita, of Spelman College in Atlanta—a career mathematics professor, and a mentor and advocate for women of color.
In July her tireless efforts to encourage women from underrepresented groups to pursue graduate degrees in mathematics were recognized by President Obama when he appointed her to the President’s Committee on the National Medal of Science. The 12-member committee is responsible for identifying nominees for the president’s consideration in selecting recipients for the prestigious award.
“This is a great honor, and it encourages me to help develop the next generation of mathematicians,” Bozeman says.
Yet she’s quick to point out: “The committee has awarded more than 500 medals, but not very many have been awarded to women. We need more development and recognition of women in the sciences.”
Bozeman began teaching at Spelman as an instructor in 1974. After earning a doctorate in mathematics at Emory University in 1980, she was promoted to assistant professor. She rose to full professor and chaired Spelman’s math department from 1982 to 1993.
“I’ve always loved math,” Bozeman says. “But I’m equally passionate about supporting and encouraging women to get advanced degrees in math—especially women of color.”
To further that goal, Bozeman serves as a board member of the Enhancing Diversity in Graduate Education (EDGE) Foundation. EDGE is a national organization, funded primarily by the National Science Foundation, with a mission to help women pursue Ph.D. degrees in the mathematical sciences, with particular inclusion of women from underrepresented groups. Co-founded by Bozeman and Rhonda Hughes of Bryn Mawr College in 1998, the program mentors women from the time they graduate from college through their doctoral studies. EDGE leaders continue to offer support after graduate school, when mentees begin their professional careers in academics or industry.
“This is how my career and my post in the Obama administration intersect,” Bozeman explains. “I want to cultivate the next generation of female leaders and innovators in mathematics—and I want to help the breakthrough work of these women to gain recognition with honors, including the National Medal of Science.”
Bozeman also serves as a member of the National Association of Mathematicians, for which she works to create new pipelines to enable minority students to enter the field of mathematics.
“I retired from Spelman three years ago, after being on the faculty for 39 years,” she says, “but I remain connected and busy.”
—ABIGAIL MEISEL
Tags: mathematics, Sylvia Bozeman
More in Fall 2016
Recent Books, Fall 2016
Transformative Times: Editor’s Letter, Fall 2016
Well Composed: Blair Celebrates Fall with Premieres, Composers and Contemporary Opera
Tumors May Have Fueled Hatfield-McCoy Feud 18 comments
Missteps to Mayhem 17 comments
Rebirth of the Midwife 12 comments
In the Face of Destruction 9 comments
Coming to America 8 comments
Vandy in Hollywood 8 comments
Best Laid Plans 8 comments
Recycled Anesthetic Technology Saves Dollars, Environment 6 comments
Good to Be Greek 6 comments
Lord of the Pointy Ears 5 comments
Fraser, Prof C.D.: Really interesting and inspiring. Just one cavil: if 64 is l…
larry654561: As human we need to come ahead to helps the poor people and …
kiger46245: Yeah technology makes our life so more easy now. People are …
trisha2616: In the transport field we can get more helps from technology…
behn6367: Marie Casares really did a great job by giving a proper idea…
History Lessons: Editor’s Letter, Summer 2017
Follow Vanderbilt on Twitter
Tweets by @VanderbiltU
More to the Story: Former Impact chairmen add to article about 1967 Symposium
Mogul in the Making: Charles D. King’s entertainment career is turning out just the way he scripted it
Let There Be Light: Paris’ first police chief exposes the unholy work afoot in the ‘crime capital of the world’
The Writing That Binds: Two decades after a botched interview, two college friends reconnect
Artist and activist: Mel Chin named Peabody College Distinguished Alumnus
Brainiac: With her innovative ‘brain soup,’ Suzana Herculano-Houzel is changing neuroscience one species at a time
Fire on Ice: Vanderbilt photographer captures Nashville Predators’ playoff run
Schoolboy to Helldiver: A Vanderbilt student writes home about a future that would never come
Golden Reed: Berkenstock celebrates 50 years with Lyric Opera of Chicago
Vanderbilt Magazine
PMB 357737
2301 Vanderbilt Place
[email protected]
About Vanderbilt Magazine
Support Vanderbilt Magazine’s Voluntary Subscription Fund
© 2017 Vanderbilt Magazine. All Rights Reserved.
Site Development: University Web Communications. |
Sleep-deprived preschoolers eat more
Sleep-deprived preschoolers eat more, says CU Boulder study. Credit: CU Boulder
The preschoolers, all regular afternoon nappers, were deprived of roughly three hours of sleep on one day - they had no afternoon nap and were kept up for about two hours past their normal bedtime - before being awakened at their regularly scheduled times the next morning.
During the day of lost sleep, the 3- and 4-year-olds consumed about 20 percent more calories than usual, 25 percent more sugar and 26 percent more carbohydrates, said Assistant Professor Monique LeBourgeois, lead study author. The following day, the kids were allowed to sleep as much as they needed. On this "recovery day," they returned to normal baseline levels of sugar and carbohydrate consumption, but still consumed 14 percent more calories and 23 percent more fat than normal.
"With this study design, children missed a daytime nap and stayed up late, which mimics one way that children lose sleep in the real world," said LeBourgeois of the Department of Integrative Physiology. According to the National Sleep Foundation, about 30 percent of preschoolers do not get enough sleep.
"We found that sleep loss increased the dietary intake of preschoolers on both the day of and the day after restricted sleep," she said. These results may shed light on how sleep loss can increase weight gain and why a number of large studies show that preschoolers who do not get enough sleep are more likely to be obese as a child and later in life.
A paper on the study was published in the Journal of Sleep Research.
Even with extensive obesity prevention efforts in the past decade, childhood obesity remains an epidemic. In 2014, 23 percent of American children under the age of 5 years were overweight or obese, said LeBourgeois. Childhood obesity increases the risk for later life chronic illnesses like diabetes and is associated with low self-esteem and depression. Overweight youth are about four times more likely to be obese as adults.
"We think one of the beauties of this study is that parents were given no instructions regarding the kind or amount of food or beverages to provide their children," said LeBourgeois. Parents fed their children just like they would on any normal day.
The researchers also studied each child across all study conditions - meaning when their sleep was optimized, restricted and recovered - which gave them control over how kids could differ individually in their eating preferences and sleep.
The children in the study - five girls and five boys - each wore small activity sensors on their wrists to measure time in bed, sleep duration and sleep quality. Parents logged all food and beverages consumed by the preschoolers, including portion sizes, brand names and quantities, using household measures like grams, teaspoons and cups. For homemade dishes parents recorded ingredients, quantities and cooking methods.
"To our knowledge, this is the first published study to experimentally measure the effects of sleep loss on food consumption in preschool children," said Elsa Mullins, the study first author and a CU Boulder researcher who worked with LeBourgeois as an undergraduate. "Our results are consistent with those from other studies of adults and adolescents, showing increased caloric intake on days that subjects were sleep deprived," she said.
Other CU Boulder co-authors include Professor Kenneth Wright, graduate student Sherin Cherian and postdoctoral fellow Salome Kurth. University of Michigan co-authors include Dr. Julie Lumeng and Associate Professor Alison Miller.
The new study opens the door for a number of follow-up studies using larger samples, experimentally controlling dietary intake and objectively measuring energy expenditure in children. The study was funded in part by a National Institute of Mental Health grant to LeBourgeois and undergraduate research grants to Mullins from CU Boulder.
Another study involving Kurth and LeBourgeois supported by a Jacobs Foundation grant and in collaboration with Brown University was recently published in Frontiers in Human Neuroscience. Findings showed that the developing brain regions of school-age children are the hardest hit by sleep restriction.
Explore further: Developing brain regions in children hardest hit by sleep deprivation
Journal reference: Frontiers in Human Neuroscience
Provided by: University of Colorado at Boulder
Developing brain regions in children hardest hit by sleep deprivation
A team of researchers from the University of Zurich has studied the effects of acute sleep deprivation in children for the first time. They discovered that the brain in five to 12-year-olds responds differently to sleep deprivation ...
Connections in the brains of young children strengthen during sleep, study finds
While young children sleep, connections between the left and the right hemispheres of their brain strengthen, which may help brain functions mature, according to a new study by the University of Colorado Boulder.
Need kids to sleep more during the school year? Start with parents' sleep habits
Children are missing out on sleep, and to change that, parents should consider adjusting their personal schedules as well, says a Purdue University expert.
Study links late sleep timing to poorer diet quality and lower physical activity
A new study suggests that among healthy adults with a habitual sleep duration of at least 6.5 hours, late sleep timing was associated with higher fast food consumption and lower vegetable intake, particularly among men, as ...
Kids' sleep guidelines spell out shut-eye guidance by age
Parental warning: Don't lose sleep over new guidelines on how much shut-eye your kids should be getting.
Body clock may be to blame when tots fight sleep (Update)
When youngsters continually struggle to fall asleep at night, new research suggests maybe their body clock doesn't match their bedtime.
School, health and behavior suffer when children have TV, video games in bedroom
A new Iowa State University study is one of the first to demonstrate the consequences of allowing children to have a TV or video game system in their bedroom.
Are children who see movie characters use guns more likely to use them?
Children who watched a PG-rated movie clip containing guns played with a disabled real gun longer and pulled the trigger more often than children who saw the same movie not containing guns, according to the results of a randomized ...
(HealthDay)—The asthma medication Singulair (montelukast) appears linked to neuropsychiatric side effects, such as depression, aggression, nightmares and headaches, according to a new review by Dutch researchers.
Parents not confident schools can assist child with chronic disease, mental health
If your child had an asthma attack during the school day, would school personnel know how to respond?
Premature infants may get metabolic boost from mom's breast milk
The breast milk of mothers with premature babies has different amounts of microRNA than that of mothers with babies born at term, which may help premature babies catch up in growth and development, according to researchers. |
Home » Blog » Skillful Leadership is More than Competency
Skillful Leadership is More than Competency
In the Summer 2017 issue of the MIT Sloan Management Review, Eric J. McNulty argues against the perception of leaders as “sets of competencies.” He writes that any approach to leadership development that shoehorns human behavior into checkboxes can’t create lasting impact.
No argument here. So why did we publish Compass: Your Guide for Leadership Development and Coaching, a book structured on competencies?
We certainly don’t see leaders as sets of competencies. And we don’t see competencies as objects that leaders merely collect during their careers. Instead, this new book presents competencies as interrelated sets of knowledge, skills, and perspectives. Competencies can’t be separated from the circumstances in which they are practiced. Leaders can’t perform skillfully without a basic understanding of what kinds of actions are more likely than others to make a difference when situations are uncertain.
The key idea here is that a competency goes beyond an isolated behavior. Neither the Compass book, nor its online counterpart, CCL Compass, is a collectors’ guide to competencies. Rather, each is a kind of relational GPS — a tool leaders can use to plot their own position — or their team’s position — relative to the challenges and problems of a constantly shifting organizational environment.
Organizations use competency lists to benchmark, measure, and track developmental milestones among their leaders. That means organizations can identify the Compass book as one of many development tools at its disposal. The book’s competency-based structure lends itself to immediate and effective use. Understood and adopted broadly throughout the organization, competencies form the basis for a “common language” to describe, nurture, and sustain effective leadership behaviors.
Through research and practice, we have confirmed what kind of actions contribute to leadership — an inclusive process among organizational members marked by direction, alignment, and commitment. A competency serves leaders in broad areas such as strategic thinking, delegation, personal resilience, resolving conflict, leading upward, and more.
For example, think about what it takes to delegate well — the knowledge of who is capable of doing what work and who can be counted on; the skill to give clear direction to people with differing knowledge and abilities to process information; and the perspective that you don’t need to do everything yourself.
If you want your leadership to make a difference, then it’s important to know where you are, where you want to go, and have some sense of what it takes to get there. As CCL Senior Fellow David Campbell once put it, “If you don’t know where you’re going, you’ll probably end up somewhere else.”
In order to figure out where you want to go and how to get there, it’d be a good idea to have a Compass handy.
This entry was posted in Coaching & Feedback, Experience-Driven Development, Organizational Development, Talent Management & Development. Bookmark the permalink.
View and Add Comments (0)
Beyond Competencies: What About the Leader’s Mind?
Leadership Development Beyond Competencies: Moving to a Holistic Approach
4 Keys for Reaching the C-Suite
How to Be a Successful Change Leader
Compass: Your Guide for Leadership Development and Coaching
CCL Compass
Assessing Employee Engagement with E4
Pete Scisco
Manager, Publication Development
View ProfileSee Articles
New Compass Tool Helps Leaders Direct Their Development
Leadership Competencies Most Important for Leading the Function
Research Reveals the 2 Most Important Competencies for Success
What Frontline Leaders Need to SucceedFirst Time Managers, Leadership & the Future, Talent Management & Development, Teams
One Key to Resolving Tech’s ‘Gender Dilemma’Conflict & Trust, Creativity & Innovation, Culture & Diversity, Experience-Driven Development, Leadership & the Future, Mentoring, Organizational Development, Talent Management & Development |
McKenzie River Trust
The McKenzie River Trust protects and cares for special lands and the rivers that flow through them in western Oregon.
The McKenzie River Trust is a nonprofit land trust that was formed in 1989 for the protection of critical habitat and scenic lands in the McKenzie basin. We expanded our service area in 2000 to include the Siuslaw, Long Tom, Coast and Middle Forks of the Willamette, and Umpqua watersheds. Over our 21 year history, the McKenzie River Trust has worked with landowners and diverse partnerships to protect, forever, over 3,000 acres of special lands in western Oregon.
The McKenzie River Trust acquires land through donation, purchase and conservation easements to provide the greatest assurance that sensitive lands are protected in perpetuity. The Trust currently owns and protects over 1,500 acres in western Oregon. These lands are protected and managed by the Trust primarily for clean water, fish and wildlife habitat, and productive natural landscape values. The Trust also holds conservation easements on over 1,600 acres of privately owned property. Protection projects on conservation easements are tailored to each landowner’s needs, rewarding stewardship of natural resources with both protection and financial incentives.
The McKenzie River Trust prides itself on being a community-based land trust, the only one working with willing landowners at a grassroots level in Lane and Douglas counties. We develop strong partnerships with landowners, public resource agencies, watershed councils, businesses, municipalities, local utilities, and funders for the purpose of collectively working to protect, enhance, and manage special land.
Contact McKenzie River Trust
Alayna DuPont
Land Protection Manager
Email McKenzie River Trust
Benton County, Oregon
Douglas County, Oregon
Lane County, Oregon
Linn County, Oregon
Related Success Stories for McKenzie River Trust
West Eugene Wetlands Partnership
An eight-organization partnership has implemented land acquisition, habitat restoration, environmental education and recreation facilities development over a 13-year period. |
Transitioning American Veterans
By Dr. Pietro Savo We find ourselves challenged to support the strengths and needs of veterans as they transition from a military life to pursuing higher education. This challenge finds its home well within the framework of Schlossberg’s transition model, which was developed to assist with a broad range of life transitions. Many institutions of higher education have developed detailed service programs to boost veteran success in higher education. What’s missing, and perhaps a barrier for success, is that the key to these programs lies in understanding the student-veteran mindset, which is becoming critical as more student-veterans seek to use their military education benefits.
The 2011 NACADA Journal article “Applying Schlossberg’s Model to Transitioning American Veterans” reports that an increasing number of student-veterans start the higher education journey with unseen injuries such as post-traumatic stress disorder (PTSD) and other mental health issues. These unseen injuries increase the likelihood of lower retention and graduation rates. Student-veterans returning to colleges and universities typically have a higher level of education and a higher level of maturity than the traditional high school graduate because they have a more diverse experience base. This experience base can be an additional barrier that adds to the difficulty of understanding the student-veteran mindset. Dr. Schlossberg’s study identified the means to overcome such a difficulty by a process that encourages an understanding of the student-veteran’s strengths, needs and challenges as they transition from the military life to the higher education journey.
We Speak A Different Language
Student-veterans are different. We take on life’s tasks as if they represent a mission. We are regimented, task-oriented and focused on the goals. We speak a different language that is easily distinguishable from one veteran to another. We communicate with experience gained from places and events that are both amazing and impossible to describe. It’s a language that cannot be learned; it can only be earned. It defines our history and the level of trust granted.
Schlossberg’s Transition Model
Schlossberg’s transition model focuses on a series of human interactions that produce a desired result as a means to promote higher education success. Schlossberg model promote dynamic change that influences the sense of competency which becomes a clear connection between a student-veteran and an institution of higher education. A connection when applied, results in higher retention, degree completion rates and a productive, transitioning American veteran. About Dr. Nancy K. Schlossberg
Dr. Nancy K. Schlossberg established the Office of Women in Higher Education at the American Council of Education, and she has served on the faculties of Wayne State University, Howard University and Pratt University. Her published books include: Getting the Most out of College (2001); Going to Plan B: How You Can Cope, Regroup and Start Your Life on a New Path (1996); Improving Higher Education Environments for Adults (1989); Counseling Adults in Transition (1984); and Perspectives on Counseling Adults (1978). Download and read the entire article featured in Career College Central Magazine, July 2012 addition page 50
by AMERICAN WRITER Dr. Pietro Savo Tradition Books Publication © 2012
American Writer a Positive Thinking Movement by Dr. Pietro Savo
Published: PERFECTION - 10 Secrets to Successful Lean Manufacturing Implementation. United States Navy Veteran View all posts by Dr. Pietro Savo This entry was posted on Friday, November 1st, 2013 at 07:20 and tagged with American Writer a Positive Thinking Movement by Dr. Pietro Savo, and she has served on the faculties of Wayne State University, by Dr. Pietro Savo, Dr. Nancy K. Schlossberg established the Office of Women in Higher Education at the American Council of Education, Howard University and Pratt University. Her published books include: Getting the Most out of College (2001); Going to Plan B: How You Can Cope, Regroup and Start Your Life on a New Path (1996); Improving Higher Education Environments for Adults (1989); Counseling Adults in Transition (1984); and Perspectives on Counseling Adults (1978)., We find ourselves challenged to support the strengths and needs of veterans as they transition from a military life to pursuing higher education. and posted in American Dream, AMERICAN WRITER, Education is power!, Imagine The Possibilities, Light Bulb Is on!, NEW HAMPSHIRE "Live Free or Die.", SPECIAL ELECTION ADDITION. You can follow any responses to this entry through the RSS 2.0 feed. « Courageous Citizens Who Banded Together
IDENTIFYING THE SIGNS – Military Students at Risk – Preventing Soldier Suicides » |
Novel susceptibility loci identified for osteoarthritis
Five novel single nucleotide polymorphisms are significantly associated with osteoarthritis, including one near the nucleostemin-encoding gene, according to a study published online July 3 in The Lancet.
(HealthDay) -- Five novel single nucleotide polymorphisms (SNPs) are significantly associated with osteoarthritis, including one near the nucleostemin-encoding gene, according to a study published online July 3 in The Lancet.
Eleftheria Zeggini, Ph.D., from the Sanger Institute in Cambridge, U.K., and colleagues conducted a large genome-wide association study involving 7,410 unrelated patients with severe osteoarthritis in the arcOGEN study (80 percent of whom had undergone total joint replacement) and 11,009 unrelated controls. The most promising signals were replicated in an independent set of up to 7,473 cases and 42,938 controls. All patients and controls involved in the study were of European descent.
The researchers identified five loci that were significantly associated with osteoarthritis and three loci just below the threshold for significance. The strongest association was seen with rs6976 on chromosome 3 (odds ratio, 1.12), which is in perfect linkage disequilibrium with rs11177, an SNP that encodes a missense polymorphism within the nucleostemin-encoding gene GNL3. In functional studies, patients with osteoarthritis had increased levels of nucleostemin in chondrocytes. Other significant loci were identified on chromosomes 9 and 6, and two loci were identified on chromosome 12. One of the signals close to significance was within the FTO gene. All risk variants exerted small effects and were common.
"We have established novel loci represented by common SNPs that confer a slight risk for osteoarthritis and are associated with the clinically important phenotype of total joint replacement," the authors write. "These results provide a basis for functional studies to identify the underlying causative variants, biological networks, and molecular cause of osteoarthritis."
Several of the authors are employed by deCODE.
More information: Abstract
Journal reference: The Lancet
Third genetic link to osteoarthritis discovered
Researchers have today revealed a new gene associated with osteoarthritis. This is only the third gene to be identified for this painful and debilitating disease that affects more than 40 per cent of people aged more than ...
Overweight men at risk of osteoarthritis of both hip and knee
Men who are overweight or obese are much more likely need a hip replacement for osteoarthritis than men who are of normal weight, finds research published online ahead of print in Annals of Rheumatic Diseases.
Pinpointing asthma susceptibility in Japanese adults
A team of geneticists has identified five specific gene regions associated with asthma susceptibility among Japanese adults. Mayumi Tamari of the RIKEN Center for Genomic Medicine, Yokohama, led the research.
Studies confirm region of chromosome 9 linked to risk for amyotrophic lateral sclerosis
Genetic variations on chromosome 9 have been identified that might have a role in the development of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. Findings in two separate Articles published Online First ...
Genome-wide study reveals 3 new susceptibility loci for adult asthma in Japanese population
Researchers at the RIKEN Center for Genomic Medicine (CGM), together with colleagues at Kyoto University, Tsukuba University, Harvard University, and other medical institutions have identified three new loci ... |
Abstract:The US Geological Survey (USGS) is completing a national assessment of coal resources in the five top coal-producing regions in the US. Point-located data provide measurements on coal thickness and sulfur content. The sample data and their geologic interpretation represent the most regionally complete and up-to-date assessment of what is known about top-producing US coal beds. The sample data are analyzed using a combination of geologic and Geographic Information System (GIS) models to estimate tonnages and qualities of the coal beds. Traditionally, GIS practitioners use contouring to represent geographical patterns of "similar" data values. The tonnage and grade of coal resources are then assessed by using the contour lines as references for interpolation. An assessment taken to this point is only indicative of resource quantity and quality. Data users may benefit from a statistical approach that would allow them to better understand the uncertainty and limitations of the sample data. To develop a quantitative approach, geostatistics were applied to the data on coal sulfur content from samples taken in the Pittsburgh coal bed (located in the eastern US, in the southwestern part of the state of Pennsylvania, and in adjoining areas in the states of Ohio and West Virginia). Geostatistical methods that account for regional and local trends were applied to blocks 2.7 mi (4.3 km) on a side. The data and geostatistics support conclusions concerning the average sulfur content and its degree of reliability at regional- and economic-block scale over the large, contiguous part of the Pittsburgh outcrop, but not to a mine scale. To validate the method, a comparison was made with the sulfur contents in sample data taken from 53 coal mines located in the study area. The comparison showed a high degree of similarity between the sulfur content in the mine samples and the sulfur content represented by the geostatistically derived contours. Published by Elsevier Science B.V.
Citation Author: Watson, W. D.; Ruppert, L. F.; Bragg, L. J.; Tewalt, S. J.
Citation Larger Work Title: International Journal of Coal Geology
Citation Online Only Flag: Citation Phsyical Description: Citation Projection: Citation Public Comments: Citation Publisher: Citation Series: Citation Series Code: Citation Series Number: Citation Search Results Text: A geostatistical approach to predicting sulfur content in the Pittsburgh coal bed; 2001; Article; Journal; International Journal of Coal Geology; Watson, W. D.; Ruppert, L. F.; Bragg, L. J.; Tewalt, S. J.
Text: A geostatistical approach to predicting sulfur content in the Pittsburgh coal bed; 2001; Article; Journal; International Journal of Coal Geology; Watson, W. D.; Ruppert, L. F.; Bragg, L. J.; Tewalt, S. J.
URL (DIGITAL OBJECT IDENTIFIER): http://dx.doi.org/10.1016/S0166-5162(01)00035-0 |
Antarctic circumpolar current carries 20 percent more water than previous estimates
By analyzing four years of continuous measurements of the Antarctic Circumpolar Current at Drake Passage, the narrowest point in the Southern Ocean, oceanographers have concluded that the current carries 20 percent more water than previous estimates. They also found that the current remains strong all the way to the seafloor.
The Antarctic Circumpolar Current transports water around Antarctica and into the Atlantic, Pacific and Indian Oceans, transferring heat and energy around the globe. Quantifying how much water it carries is an important step in understanding climate change and validating the accuracy of climate and oceanographic models.
Antarctic krill
By analyzing four years of continuous measurements of the current at Drake Passage, the narrowest point in the Southern Ocean, three University of Rhode Island oceanographers have concluded that the current carries 20 percent more water than previous estimates. They also found that the current remains strong all the way to the seafloor.
"It's important to understand the dynamics of the current so we can understand the impacts of our changing climate," said Kathleen Donohue, associate professor at the URI Graduate School of Oceanography. "We want to know how the current will respond to changing conditions, so quantifying the transport gives important guidance to the climate models that are trying to predict the future."
Donohue, along with URI Professor Randolph Watts and Marine Research Specialist Karen Tracey, will present the results of this research this week at the biennial Ocean Sciences Meeting in Honolulu. The meeting is sponsored by the American Geophysical Union, The Oceanographic Society, and the Association for the Sciences of Limnology and Oceanography.
The Southern Ocean is warming faster than other oceans, and the easterly winds that drive the current have increased significantly in the last 30 years. How the current will respond to these changes is not fully understood. Eddies, or ocean storms, are essential for transferring momentum from the circumpolar winds that drive the current to the sea floor.
To study the dynamics of the current, Donohue, Watts and Teresa Chereskin of the Scripps Institution of Oceanography deployed 35 current and pressure recording inverted echo sounders, which measure oceanic fronts and currents, across Drake Passage in 2007. They retrieved them in 2011. Another more closely spaced array of instruments was also deployed to map circulation and eddy patterns. The instruments collected higher resolution data over a longer period of time than the only other similar study of the Antarctic Circumpolar Current, which was conducted in the 1970s.
Drake Passage is an important site for oceanographic measurements because it is one of the few places around the globe where ocean currents travel through a somewhat narrow passage. Drake Passage is 800 kilometers wide and runs from the southern tip of South America to the northernmost point of Antarctica.
"We're never going to be able to measure the whole ocean," said Watts. "So if we're going to make accurate predictions of future climate, we're going to have to accurately measure processes like water transport and heat flux at key locations like the Drake Passage to guide our understanding."
The next step for the scientists is to develop a method of monitoring the Antarctic Circumpolar Current using a smaller array of instruments so the measurements can continue well into the future. They also hope to travel to the South Pacific and South Atlantic to make additional measurements of how ocean storms transport heat toward the pole.
The above story is based on materials provided by University of Rhode Island. Note: Materials may be edited for content and length.
University of Rhode Island. "Antarctic circumpolar current carries 20 percent more water than previous estimates." ScienceDaily. ScienceDaily, 26 February 2014. <www.sciencedaily.com/releases/2014/02/140226165115.htm>.
University of Rhode Island. (2014, February 26). Antarctic circumpolar current carries 20 percent more water than previous estimates. ScienceDaily. Retrieved November 24, 2014 from www.sciencedaily.com/releases/2014/02/140226165115.htm
University of Rhode Island. "Antarctic circumpolar current carries 20 percent more water than previous estimates." ScienceDaily. www.sciencedaily.com/releases/2014/02/140226165115.htm (accessed November 24, 2014).
Mixing It Up: Study Provides New Insight Into Southern Ocean Behavior
July 20, 2014 � Turbulent mixing in the deep waters of the Southern Ocean, which has a profound effect on global ocean circulation and climate, varies with the strength of surface eddies -- the ocean equivalent of ... full story
Undersea Mountains Provide Crucial Piece in Climate Prediction Puzzle
Sep. 18, 2013 � A mystery in the ocean near Antarctica has been solved by researchers who have long puzzled over how deep and mid-depth ocean waters are mixed. They found that sea water mixes dramatically as it ... full story
Scientists Cast Doubt on Theory of What Triggered Antarctic Glaciation
July 11, 2013 � Scientists have found geologic evidence that casts doubt on one of the conventional explanations for how Antarctica's ice sheet began forming. They report finding an ancient volcanic arc in the ... full story
Mathematics and the Ocean: Movement, Mixing and Climate Modeling
Oct. 17, 2012 � Mathematicians have described mathematical ideas from dynamical systems along with numerical modeling and experimental observations to analyze mixing in the ... full story
Massive Southern Ocean Current Discovered
Apr. 27, 2010 � A deep ocean current with a volume equivalent to 40 Amazon Rivers has been discovered by Japanese and Australian scientists near the Kerguelen plateau, in the Indian Ocean sector of the Southern ... full story |
Aging Chinese Face a Bleak Picture
High Rates of Poverty, Disability and Mental Illness Haunt Elderly, Pose Growing Economic Challenge
An elderly man sits in his house in Yuangudui village, in China's Gansu province.
Tom Orlik
BiographyTom Orlik
BEIJING—China's elderly are poor, sick and depressed in alarming numbers, according to the first large-scale survey of those over 60, an immense challenge for Beijing and one of the greatest long-term vulnerabilities of the Chinese economy. The survey of living conditions for China's 185 million elderly paints a bleak picture that defies the efforts of the government to build what it calls a "harmonious society," one dedicated to human welfare rather than simply economic growth. Of the generation that built China's economic boom, 22.9%—or 42.4 million—live in poverty with consumption of less than 3,200 yuan a year ($522). The fear of being old and poor, which prompts many Chinese to stash away their earnings, also cuts against another of Beijing's priorities: to rebalance the economy toward stronger consumption. Read the Study China Health and Retirement Longitudinal Study The survey, led by Chinese and international academics, covered 17,708 individuals across 28 of China's 31 provinces and was partly funded by the Chinese government through a science foundation. While careful to credit the government with progress on expanding pension and health-care coverage, it also showed that physical disability and mental-health problems are widespread: Of those surveyed, 38.1% reported difficulty with daily activities and 40% showed high symptoms of depression. International comparisons are made difficult by definitional issues. But rates of poverty, disability and depression in China all appear relatively high. The poverty rate for Americans aged over 65 is 8.7% according to the Census Bureau. The U.S. Health and Retirement Study found that 26% to 27% of elderly Americans had a disability, and depression rates are also markedly lower than in China. ENLARGE
China Real Time China's Report on the Elderly: It's Not All Bad News John Strauss, a professor at the University of Southern California and one of the leaders of the project, pointed to China's relatively low level of development as part of the explanation for higher poverty levels there. "We need to remember that China is still a developing economy, it is not yet a high-income country," he said. An aging population means the problems are compounded. The number of old people for every hundred working-age members of the population—known as the dependency ratio—will rise from 11 in 2010 to 42 in 2050, according to projections from the United Nations. Other countries will also see a rise in the dependency ratio. But the pace of aging in China is particularly marked—a consequence of the one-child policy. The survey finds that 88.7% of the elderly who require assistance with daily activities receive it from family members. But the one-child policy and the migration of many young people to China's cities for work threaten to erode the traditional approach of children caring for elderly parents. More U.S. Defense Chief Seeks to Calm Asia Allies China is also unique in encountering a serious problem with aging while still a poor country. "Other countries are old and rich," said Albert Park, a professor at Hong Kong University of Science and Technology and another survey leader. "China will be old at a relatively early stage in its development." Yu Baihui is one of many who have fallen through the cracks. Aged 73, Ms. Yu lives with her husband in a dilapidated house in Rensha, a town of 31,000 on the edges of Chongqing in western China. Like many of China's impoverished elderly, she is a former farmer, too old to benefit from the booming economy that has swept the younger generation into China's factories, and passed over by a benefit system that is skewed in favor of urbanites. "My parents don't have any pension or other allowance," said Luo Zhengfeng—Ms. Yu's son, who works selling umbrellas and tour maps in Chongqing to support his wife, child and aging parents. China's turbulent history also appears to have had an impact on the generation that lived through it. "China's elderly experienced famine in the 1950s, and the disturbance of the Cultural Revolution," said Mr. Park. "Those early experiences leave a marked impact on physical and mental health." In theory, respect for elders is deeply ingrained in China's culture. Confucius, China's cultural lodestone who has enjoyed a revival in popularity as leaders search for new sources of legitimacy, advocated the honoring of all old people. On a visit to an old people's home in Tianjin in 2009, former President Hu Jintao echoed those sentiments and set the tone for government pronouncements on China's aged. "Respecting and caring for the elderly is not only a Chinese tradition, but also a symbol of national civilization and progress," he said. Mr. Hu advocated a more inclusive form of development, with expansion of public pension and health-care coverage. The results of the China Health and Retirement Longitudinal Study suggest those efforts haven't so far been sufficient. Widespread poverty in old age also undermines China's attempt to put the economy on an even keel, with lower saving and investment and higher consumption. Despite rapid increases in wages,—which rose 14% last year for workers in the private sector according to official data— households remain unwilling to spend. One reason: the need to guard against poverty in old age. "I hope the government is stung by conscience and puts more money into pensions," said Cecilia Wang, a 30-year-old translator at a business magazine in Beijing, "but as they don't we have to save ourselves." China has enjoyed some success in expanding the welfare system. Pension coverage for urban residents has expanded from 155 million in 2003, when Mr. Hu took over, to 304 million in 2012, according to data from the Ministry of Human Resources and Social Security. Pension coverage for rural residents has grown even more rapidly. But the benefits provided by the expanded schemes remain inadequate in many cases. The survey shows that on average, recipients of the government's basic rural pension receive just 720 yuan a year. More than 90% of the elderly population is now covered by health insurance, but out-of-pocket costs remain high. "Mom had a stroke last year, and the hospital charged 18,000 yuan, but we could claim back only 1,000 yuan from insurance," said Mr. Luo, the Chongqing umbrella seller. The 17,000 yuan in out-of-pocket costs equaled almost half of his annual income. "China's government is aware of the problem and addressing it aggressively," said Mr. Park. But there are few easy answers. With a growing number of elderly relying on a shrinking workforce, the existing system of care inside the family appears untenable. But more generous pension and health-care benefits risks putting a sharply increased strain on the public finances. —Olivia Geng contributed to this article. |
Increasing Uptake Of Carbon Dioxide By Soils Points To Promising Way To Mitigate Greenhouse Warming
American Institute Of Biological Sciences
A group of researchers led by Wilfred M. Post of the Oak Ridge National Laboratory describes in the September 2004 issue of BioScience an approach to assessing "promising" techniques for mitigating global warming caused by the greenhouse effect.
A group of researchers led by Wilfred M. Post of the Oak Ridge National Laboratory describes in the September 2004 issue of BioScience an approach to assessing "promising" techniques for mitigating global warming caused by the greenhouse effect. According to Post's team, agriculturally-based options for reducing net greenhouse gas emissions by increasing sequestration of carbon in soils "should be evaluated to see how competitive they are in comparison with a variety of other options," such as flue-gas capture to reduce emissions or remove carbon dioxide already in the atmosphere.
Post and his colleagues considered the range of possible costs and benefits that could accrue from adopting land-management practices designed to increase the uptake of carbon dioxide by soils. The increasing concentration of carbon dioxide in the earth's atmosphere contributes to ongoing global warming that is causing ecological disruption and threatens human populations. The researchers note that a variety of land-use practices have apparently favorable potential for increasing carbon dioxide uptake, including intensifying cropping, adding organic material to soil, conservation tillage, and afforestation and grassland establishment. Initial cost estimates of some of these practices appear low, but many other considerations must be weighed before the techniques are likely to come into widespread use, including the likely permanence of soil carbon sequestration by different methods. Assessment of ancillary environmental effects, such as impacts on biodiversity and emissions of other greenhouse gases, is necessary, as are sensitivity analyses to determine likely consequences over the range of applicable conditions. Comprehensive economic comparisons are also called for. Post and colleagues state that "If agricultural soil sequestration is to play a role in the endeavor to reduce greenhouse gas emissions, it is important both to determine that soil sequestration practices are competitive, low-cost means of offsetting greenhouse gas emissions and to design programs or incentives that make these practices attractive for use by land managers." ###
BioScience publishes commentary and peer-reviewed articles covering a wide range of biological fields, including ecology. The journal has been published since1964. AIBS is an umbrella organization for professional scientific societies and organizations that are involved with biology. It represents over 80 member societies and organizations with a combined membership of over 200,000.
Materials provided by American Institute Of Biological Sciences. Note: Content may be edited for style and length.
American Institute Of Biological Sciences. "Increasing Uptake Of Carbon Dioxide By Soils Points To Promising Way To Mitigate Greenhouse Warming." ScienceDaily. ScienceDaily, 4 October 2004. <www.sciencedaily.com/releases/2004/10/041001091626.htm>.
American Institute Of Biological Sciences. (2004, October 4). Increasing Uptake Of Carbon Dioxide By Soils Points To Promising Way To Mitigate Greenhouse Warming. ScienceDaily. Retrieved October 25, 2016 from www.sciencedaily.com/releases/2004/10/041001091626.htm
American Institute Of Biological Sciences. "Increasing Uptake Of Carbon Dioxide By Soils Points To Promising Way To Mitigate Greenhouse Warming." ScienceDaily. www.sciencedaily.com/releases/2004/10/041001091626.htm (accessed October 25, 2016).
Soil Types
Terrestrial Biosphere Contributing to Warming Climate
Mar. 11, 2016 Terrestrial biosphere is contributing to climate change because of human activities including agriculture, researchers report. The researchers used greenhouse gas data from 2001 to 2010 and compared ... read more Greenhouse Gas 'Bookkeeping' Turned on Its Head
Mar. 9, 2016 For the first time scientists have looked at the net balance of the three major greenhouse gases -- carbon dioxide, methane, and nitrous oxide -- for every region of Earth's landmasses. They ... read more Climate Change Likely to Increase Black Carbon Input to the Arctic Ocean
Nov. 30, 2015 The levels of black carbon in Arctic rivers has been determined by researchers who found that the input of black carbon to the Arctic Ocean is likely to increase with global ... read more Global Warming May Increase Methane Emissions from Freshwater Ecosystems
Mar. 19, 2014 Rising global temperatures will increase the quantity of the key greenhouse gas methane emitted from freshwater ecosystems to Earth's atmosphere -- which could in turn lead to further warming, ... read more Strange & Offbeat |
Green nanotech can reduce risks to poor nations
Regulating nanotech is challenging, says Rajender Varma, but green chemistry could help developing countries 'leapfrog' to cleaner, healthier products.
There have been major breakthroughs in nanomaterials for use in healthcare situations and some of these have already moved beyond the laboratory into the 'real world'. Now we need to pay serious attention to their potential risk to health and to the environment, both of which are still poorly understood. Commercial nanotechnology is expected to affect almost every industrial and manufacturing sector, including medicine and drug delivery. New nano-based products are being created and introduced at an alarmingly rapid rate. One estimate says commercial nanomaterials and nano-assisted devices will be a US$1 trillion industry by 2015. Yet producing and using nanomaterials is practically unregulated, particularly in the developing world. There is an urgent need for oversight mechanisms. The World Health Assembly (the WHO's decision-making body) identified exposure to nanomaterials as a priority for the Global Plan of Action on Workers Health (adopted in 2007). And the WHO Global Network of Collaborating Centers in Occupational Health has selected nanotechnology as one of its key focus areas.
Not just nano
Nanomaterials are being rigorously evaluated in the United States and Europe, but implementing and enforcing such regulatory standards in developing countries has been a challenging problem for all chemical-based products, not just nano products. These countries ignore the issues at their own peril.
In India, for example, there is a long list of companies, ranging across mining and chemical industries, that have failed to address the concerns of local communities and of human rights groups. From the 1984 toxic chemical disaster in Bhopal, to a bauxite mining and aluminium refinery in the Niyamgiri Hills, Orissa, activists have been waging long-running legal battles against toxic wastes. Environmental activism has grown with environmental impact assessments being a critical component of any newer industrial activity. However, it is not only large multinational companies that are shifting environmental burdens, with possible adverse toxic effects on humans in to the developing world but also smaller companies within developing nations.
What to test and who should pay?
So who should pay for screening, safety assessments and regulation? These are big costs that would hit developing country companies hard. Most nanotechnology innovations originate from research groups in small start-up businesses. Whether these businesses survive may depend on the burden imposed from regulatory bodies. Small companies can be severely restricted by the costs associated with increased oversight. Yet many of companies are catering to the needs for cheaper raw materials and products outsourced by high-cost countries. In developing countries in particular, health and safety regulations will have to carefully deliberate who should bear the cost burden of regulatory testing. It is an important task, because the regulations will in turn play a substantial role in prioritising which risks are assessed. The regulatory burden is further compounded by an ongoing debate on the correct way to screen nanomaterials for toxicity — whether to focus mainly on effects on cells investigated in vitro, in laboratory setting, or effects on whole animals (in vivo studies), which are more challenging, and can be more expensive.
We already know that traditional toxicological assays and models can produce conflicting and often irreproducible results for nanomaterials. So there is no single accepted screening platform. Green chemistry
Another way to circumvent some of these challenges may be to focus on the emerging area of 'green chemistry' to reduce or eliminate hazardous substances in the design, manufacture, and application of chemical products which also holds promise for reducing toxic health effects of nano-based entities. The use of eco-friendly and biodegradable materials in the production of metal nanoparticles is important for pharmaceutical and biomedical applications. Generating nanoparticles often requires toxic and aggressive chemical reducing agents like sodium borohydride and hydrazine, a capping agent to stabilize the particles, and volatile organic solvents such as toluene or chloroform. Although these methods may successfully produce pure, well-defined metal nanoparticles, the material, environmental and health cost of production is high. We urgently need to develop more cost-effective and benign alternatives. Leapfrogging to greener nanotech?
My own team has already developed several benign methods which use natural renewable resources such plant extracts, biodegradable polymers, polyphenols from tea sugars and even an agricultural waste such as grape pomace. These sorts of advances could help developing nations, particularly those rich in renewable plant-derived raw materials, generate nanomaterials and nanocomposites more safely. For example, Tata Chemicals in India recently introduced a water purification technology for rural communities that uses silver nanoparticles supported on rice husk-based cellulosic material and costs only US$21 per filter. It is at an early stage of development yet is expected to be widely applied and distributed around the globe. Such simple yet innovative strategies could allow the developing world to 'leapfrog' to greener, less-toxic nanotechnology, much as cell phones have avoided the need for enormous landline infrastructure.
Applying green chemistry principles to the development of new nanomaterials and applications is all the more significant at this early stage of nanotechnology development and could lead to new global 'design rules' for high-performance nanoscale substances that are eco-friendly and benign to human health. Rajender Varma is a senior scientist at the Sustainable Technology Division, National Risk Management Research Laboratory, US Environmental Protection Agency in Cincinnati, Ohio, USA. This article is part of a spotlight on Nanotechnology for health.
This article was authored by a US government employee. The views expressed in this article are those of the author and do not necessarily reflect the views and policies of the US Environmental Protection Agency. The use of trade names does not imply endorsement by the US government.
Nanotech's impacts on Africa must be carefully considered
Nano 'tea bag' purifies water
Technique for arsenic-free water developed
Nanotech for health needs the right environment
Nanotech for clean water: New technology, new rules?
By Rajender S. Varma
More on health
Transistor that mimics neurons developed
Elephantiasis linked to volcanic soils in Uganda
Nanoparticles raise vascular risk by escaping the lungs
GM drive against malaria: Treading a fine line
Brazilian scientists break genetic code of Zika protein
Rajender S. Varma
Most popularin health
Ancient parasite remains a modern scourge
Poorer nations warned over antibiotic resistance
From our partners Nature News&Comment |
Organic Material on Mars—The Case Gets Stronger
Contamination from Earth now seems less likely at the Curiosity landing site.
The Sheepbed mudstone, an ancient habitable lake in Gale Crater on Mars. (NASA/JPL)
By Dirk Schulze-Makuch
At the recent Lunar and Planetary Science Conference in Texas, two research groups led by Caroline Freissinet and Daniel Glavin made the scientific case for Martian organic material much stronger, based on new insights from the Sample Analysis at Mars (SAM) instrument on NASA’s Curiosity rover.
Curiosity already had found chlorinated organic matter—probably chlorinated by a reaction with perchlorates—on Mars. But it wasn’t clear whether the organic compounds derived from terrestrial contamination that the SAM instrument brought with it, or from indigenous Martian material. New analysis at various sampling sites indicates that, due to the relatively high detection signal, the organic material is most likely indigenous to Mars. The distinctly larger amounts of chloromethane and dichloroethane at the Sheepbed mudstone, compared to the sandy Rocknest site, suggests a Martian source of organic carbon.
This is in line with what we observe on Earth. Organic carbon is seen much more in clay and muds than it is in sandy material. And the Sheepbed mudstone already has been identified as the remnant of an ancient habitable lake.
Significantly, the organic carbon on Mars consists of reduced organic compounds, which could readily be used as building blocks for life. After the experiments on the Viking landers in the 1970s, many scientists thought that the Martian surface is oxidized, perhaps down to a significant depth. This view is clearly incorrect, and it appears more and more that Mars, or at least certain parts of the planet, were at some point in the past quite friendly to life.
Whether the organic compounds found by Curiosity came from putative Martian microorganisms cannot be determined at this time. They could just be organic material that fell to the surface in meteorites. But what’s becoming more certain is that organic material was, and still is, available on Mars in a form that could be used by microorganisms. In other words, microorganisms could clearly have made a living in the lake that would become the Sheepbed mudstone. The question then becomes: Are they possibly still there, perhaps hidden in a mud layer or underneath an ice patch, possibly in a dormant form? That’s a great question for Curiosity, or some future Mars mission, to address.
About Dirk Schulze-Makuch
Dirk Schulze-Makuch is a Professor at the Technical University Berlin, Germany, and an Adjunct Professor at Arizona State University and Washington State University. He has published seven books and nearly 200 scientific papers related to astrobiology and planetary habitability.
Read more from this author
Astrobiology Life Beyond Earth Mars Exploration
Those Safety Instructions in Your Airplane Seat Pocket? Nobody Understands Them.
The C-5 Gets An Overhaul |
Academic journals » Health and Medicine Journals » American Journal of Health Education » Article details, "Children's Physical Fitness and Academic..." Academic journal article
American Journal of Health Education
Children's Physical Fitness and Academic Performance By Wittberg, Richard A.; Northrup, Karen L.; Cottrel, Lesley
ABSTRACT Background: Childhood obesity is a major public health threat. Increased fitness may have a positive influence on cognitive performance in both adults and children. Purpose: To examine which aspects of children's fitness assessment are associated with their performance on four different academic areas. Methods: FITNESSGRAM measures aerobic capacity, abdominal strength, upper body strength/endurance, flexibility, and trunk lift. Gender and a socio-economic status proxy were compared with mean group performance scores across four subscales: mathematics, reading/language arts, science, and social studies of a statewide standardized academic performance test on a sample of 968 5th grade students (50.7% male; mean age = 10.6 years). Results: Achievement test scores were significantly better for children who were in the Healthy Fitness Zone (HFZ) for aerobic capacity and abdominal strength tests when compared to children who were unable to achieve the healthy zone. Children in the HFZ for upper body strength performed significantly better in math. Children in the HFZ for flexibility performed significantly better in math and science. No differences were found in academic performance when children in the HFZ for trunk lift were compared to children not in the healthy zone. When all FITNESSGRAM measures were used in a full factorial ANOVA with Body Mass Index (BMI), gender and meal program (a proxy variable for socioeconomic status) as covariates, aerobic capacity was found to be the only fitness variable consistently appearing as important. It was always significant as a main effect variable while no other main effect fitness variable achieved significance for any WESTEST subject. Two-way, three-way, and four-way interactions always included aerobic fitness and no other fitness measure was universal in these interactions. Discussion: Whereas, aerobic fitness appears universally important in academic success, additional mechanisms may be at work due to the several interactions that achieved significance. The interactions may be an indication of the importance of overall fitness in addition to aerobic fitness. These findings support the development and implementation of childhood cardiovascular risk surveillance programs that not only evaluate children's overweight risks but also their fitness. Translation to Health Education Practice: Increased focus on ways to improve children's fitness levels may create the need to reevaluate current policy recommendations for children's physical education. BACKGROUND Childhood obesity is considered to be one of the major public health threats of the 21st century. (1) Since 1980, the percentage of children who are overweight has more than doubled, while rates among adolescents have more than tripled. (2) In 2004, 18.8% of 6- to 11-year-old children were overweight and 17.4% of 12- to 19-year-old adolescents were overweight. (2) Childhood overweight has been shown to significantly affect a child's physical, social, and emotional development. A variety of physical health concerns known to be correlated with children's weight include high blood pressure, high cholesterol, and type II diabetes. (3) Studies have also shown that overweight children are more likely to be socially withdrawn, depressed, and anxious when compared to children of lower weight categories. (4-7) Less studied is the relationship between childhood overweight and cognitive functioning. (8-13) Previous studies have established a relationship between childhood obesity and students' academic performance. A study by Ding, Lehrer, Rosenquist, and Audrain-McGovern revealed that obesity was associated with an average GPA that was 0.43 less than non-obese adolescents. (13) Further evidence was provided by Datar, Sturm, and Maganabossa who found significant differences in test scores by overweight status at the beginning of kindergarten and at the end of grade one. (9) These authors, however, argued that the differences in student academic performance scores could be explained by other individual characteristics such as parental education and home environment. … SUBSCRIBE TODAY!
Publication: American Journal of Health Education
Wittberg, Richard A.
Northrup, Karen L.
Cottrel, Lesley
Childhood Obesity--Control
Childhood Obesity--Educational Aspects
Academic Achievement--Health Aspects
Aerobic Exercises--Influence
Understanding Childhood Obesity
By J. Clinton Smith
University Press of Mississippi, 1999
Handbook of Eating Disorders: Physiology, Psychology, and Treatment of Obesity, Anorexia, and Bulimia
By Kelly D. Brownell; John P. Foreyt
Building Background Knowledge for Academic Achievement: Research on What Works in Schools
By Robert J. Marzano
Association for Supervision and Curriculum Development, 2004
The Role of Parents in Preventing Childhood Obesity
By Lindsay, Ana C. Sussner, Katarina M. Kim, Juhee Gortmaker, Steven
The Future of Children, Vol. 16, No. 1, Spring 2006
School Commercialism: From Democratic Ideal to Market Commodity
By Thompson, Krissy
Catholic Education, Vol. 13, No. 1, September 2009
Parental Influence, School Readiness and Early Academic Achievement of African American Boys
By Joe, Emanique M. Davis, James Earl
The Journal of Negro Education, Vol. 78, No. 3, Summer 2009
School-Based Health Programs in Catholic Schools
By Goldschmidt, Erik P. Walsh, Mary E. Kelly, Katie
Momentum, Vol. 37, No. 1, February/March 2006
The Battle against Childhood Obesity: With the Condition Identified as a Contributor to Diabetes, Diet and Exercise Are Key in the Struggle to Control Weight
By Holloway, Lynette R.
Ebony, Vol. 60, No. 5, March 2005
Childhood Obesity: Is It Abuse?
By Darwin, Abigail
Children's Voice, Vol. 17, No. 4, July/August 2008
Nutrition Is Important Factor in Education Gap?
By Kochakian, Charles
New Haven Register (New Haven, CT), March 27, 2012
Fighting an Epidemic ; Decline in Childhood Obesity Rate Is Encouraging News for Nation's Health
By The Buffalo News (Buffalo, NY), March 8, 2014
Childhood Obesity Rates Fall in 18 States; Report on Preschoolers Is Seen as First Evidence of a National Drop
By Stobbe, Mike
St Louis Post-Dispatch (MO), August 7, 2013 |
Most internet resources for idiopathic pulmonary fibrosis are inaccurate, incomplete and outdated
After evaluating content on idiopathic pulmonary fibrosis on almost 200 websites, researchers with medical backgrounds found that the information on IPF from these sites was often incomplete, inaccurate and outdated.
After evaluating content on idiopathic pulmonary fibrosis on almost 200 websites, researchers with medical backgrounds found that the information on IPF from these sites was often incomplete, inaccurate and outdated. The study, "Accuracy and Reliability of Internet Resources for Information on Idiopathic Pulmonary Fibrosis" highlights the need for the medical community to continually reassess the accuracy of online information. The research was printed online ahead of print in the American Thoracic Society's American Journal of Respiratory and Critical Care Medicine.
Characterized by a progressive decline in lung function, specifically shortness of breath, IPF is chronic and ultimately fatal. Patients who rely on the Internet for treatment recommendations may be putting themselves at considerable risk. "Nearly half of IPF-related websites suggested a role for at least one medication with no proven benefit, and more than a third of websites recommended medications that are harmful in IPF," said co-author Christopher Ryerson, MD, Assistant Professor at the Centre for Heart Lung Innovation at St. Paul's Hospital and the University of British Columbia.
Using DISCERN, a validated instrument for assessing the quality of written medical information, the researchers evaluated IPF-related content on sites that included foundation/ advocacy organizations, news/media reports, blogs, and scientific resources as well as industry/for profit companies. Each site received a score based on the quality of the content, the quality of the information regarding treatment options, the overall publication, and the reliability of the publication.
The researchers found that foundation/advocacy websites were more likely to recommend non-indicated therapies for treatment. News/media reports were less likely to provide an overview of IPF, instead focusing on a single item such as newly-approved treatment. The top two websites for both content and quality scores were Wikipedia and Medscape.
"The Internet will remain a common source of health information for patients," said Jolene Fisher, MD, Respirologist at University Health Network, University of Toronto and study co-author. "The medical community, including IPF specialists, needs to take a more active role in ensuring patients have access to accurate and up-to-date online medical information. Patients with IPF should be aware that the information they are accessing may be inaccurate and that harmful recommendations may be made, even on websites from reputable organizations."
Materials provided by American Thoracic Society. Note: Content may be edited for style and length.
American Thoracic Society. "Most internet resources for idiopathic pulmonary fibrosis are inaccurate, incomplete and outdated." ScienceDaily. ScienceDaily, 5 February 2016. <www.sciencedaily.com/releases/2016/02/160205100454.htm>.
American Thoracic Society. (2016, February 5). Most internet resources for idiopathic pulmonary fibrosis are inaccurate, incomplete and outdated. ScienceDaily. Retrieved May 23, 2017 from www.sciencedaily.com/releases/2016/02/160205100454.htm
American Thoracic Society. "Most internet resources for idiopathic pulmonary fibrosis are inaccurate, incomplete and outdated." ScienceDaily. www.sciencedaily.com/releases/2016/02/160205100454.htm (accessed May 23, 2017).
Acute Pulmonary Fibrosis May Respond to Autoimmune Disease Therapy
June 17, 2015 Patients with acute exacerbations of idiopathic pulmonary fibrosis responded well to therapies similar to those used to treat autoimmune diseases, suggesting that autoantibodies may play an important ... read more Promising New Target May Treat Pulmonary Fibrosis
Mar. 18, 2015 By uncovering the mechanism by which fibrous tissue cells in the lung multiply, researchers have identified a promising new approach for the treatment of pulmonary fibrosis. Idiopathic pulmonary ... read more Idiopathic Pulmonary Fibrosis Cases Linked With Asbestos Exposure
Sep. 9, 2014 A proportion of idiopathic pulmonary fibrosis (IPF) cases may be linked with asbestos exposure, according to the results of a new study. If confirmed, the findings would mean that current treatment ... read more Thalidomide Relieves Disabling Cough and Improves Quality of Life for People With Deadly Lung Disease: Study
Sep. 17, 2012 In the first clinical trial to demonstrate an effective treatment for constant, disabling cough among people with idiopathic pulmonary fibrosis (IPF), researchers found that taking thalidomide ... read more RELATED TERMS
Pulmonary alveolus |
Researchers map carbon footprint of UK towns and cities
Institute of Physics (IOP)
The London borough of Newham is famed for producing talents such as Idris Elba, Plan B and Mo Farrah, whilst also playing host to the Olympic Stadium and West Ham United Football Club. Now an international group of researchers have found that its residents have the smallest carbon footprint in the UK.
The London borough of Newham is famed for producing talents such as Idris Elba, Plan B and Mo Farrah, whilst also playing host to the Olympic Stadium and West Ham United Football Club.
Now an international group of researchers have found that its residents have the smallest carbon footprint in the UK.
In a study of 434 municipalities across England, Wales, Scotland and Northern Ireland, they showed that according to data taken from 2004, the lifestyle of each person in Newham caused an average of 10.21 tonnes of carbon dioxide (CO2) to be emitted into the atmosphere -- the UK average was 12.5 tonnes of CO2, according to the research.
The City of London was the municipality with the highest carbon footprint -- the lifestyle of each person caused 15.51 tonnes of CO2 to be emitted into the atmosphere.
Lead author of the study, Jan Minx, from the Potsdam Institute for Climate Impact Research, said: "The carbon footprint measures all the of CO2 emissions that are released around the world in the production of the goods and services we consume in a particular area.
"If you take the iPhone for example, its carbon footprint includes all the emissions that arise in its production around the world, including the extraction of materials used to build it, the manufacturing process itself, plus all the shipping that is required for each production stage."
The findings, which have been published today, 11 September, in IOP Publishing's journal Environmental Research Letters, highlight that the carbon footprints of municipalities in the UK are determined by socio-economic rather than geographical and infrastructural factors.
Whilst the carbon footprints were slightly lower for urban areas compared to rural areas, the researchers showed that there was no general trend, which indicated that the carbon footprint may be determined by how people live rather than where people live.
Indeed, they showed that the carbon footprint increased with an advanced education of the population, increased with the number of cars a household owns, and decreased with an increasing house size. The results also showed that an additional £600 in the average weekly income resulted in an increase of one tonne per capita of CO2 emitted into the atmosphere each year.
"This is not a story about metropolitan areas, nor a story purely about income, as has been suggested in previous studies. The carbon footprint of any local area can be high or low -- regardless of whether the place is out in the countryside or in the city center.
"As our results show, the municipalities with the highest and lowest carbon footprints in the UK are situated in the same city. The carbon footprint of local areas mainly depends on the socio-economic profile and associated lifestyles of the residents," continued Minx.
The researchers also compared the carbon footprints with the 'territorial emissions' for each municipality, which measures the amount of CO2 directly emitted by the residents of the municipalities in their everyday lives, whether this is burning fuel for cooking or driving a car.
The majority of municipalities with high territorial emissions were found in the north of England in heavily industrialised areas. For the UK as a whole, 90 per cent of municipalities had a carbon footprint that was higher than their territorial emissions, meaning they were net importers of CO2.
To estimate the carbon footprints at a regional level, the researchers used a computer model to represent the detailed trade activities between 178 economic sectors in the UK and three world regions. This allowed them to allocate CO2 emissions to the final consumption of goods and services in the UK regardless of where they were emitted in the world.
Datasets that document the distribution of lifestyle types across the UK's municipalities allowed the researchers to allocate the carbon footprint on a regional scale.
The above post is reprinted from materials provided by Institute of Physics (IOP). Note: Materials may be edited for content and length.
Jan Minx, Giovanni Baiocchi, Thomas Wiedmann, John Barrett, Felix Creutzig, Kuishuang Feng, Michael Förster, Peter-Paul Pichler, Helga Weisz, Klaus Hubacek. Carbon footprints of cities and other human settlements in the UK. Environmental Research Letters, 2013; 8 (3): 035039 DOI: 10.1088/1748-9326/8/3/035039
Institute of Physics (IOP). "Researchers map carbon footprint of UK towns and cities." ScienceDaily. ScienceDaily, 10 September 2013. <www.sciencedaily.com/releases/2013/09/130910205322.htm>.
Institute of Physics (IOP). (2013, September 10). Researchers map carbon footprint of UK towns and cities. ScienceDaily. Retrieved October 4, 2015 from www.sciencedaily.com/releases/2013/09/130910205322.htm
Institute of Physics (IOP). "Researchers map carbon footprint of UK towns and cities." ScienceDaily. www.sciencedaily.com/releases/2013/09/130910205322.htm (accessed October 4, 2015).
Disaster recovery plan
Carbon dioxide sink
Gulf Stream
Carbon cycle
Earth & Climate News
Micro Photosynthetic Power Cells May Be the Green Energy Source for the Next Generation
Oct. 2, 2015 A novel micro-technology, which captures the electrical power generated by the photosynthesis and respiration of blue-green ... read more New Biodegradable Materials Could Replace Plastic Bags
Oct. 2, 2015 As England gets set to start paying for plastic bags, researchers are making inroads into developing alternative biodegradable materials that could potentially replace fossil fuel derived ... read more Researchers in Northwestern Hawaiian Islands Finds Highest Rates of Unique Marine Species
Oct. 1, 2015 Scientists returned from a 28-day research expedition aboard NOAA Ship Hi'ialakai exploring the deep coral reefs within Papahanaumokuakea Marine ... read more A Balanced Diet Is Good for Corals Too, Study Finds
Oct. 1, 2015 A nutrient-rich, balanced diet is beneficial to corals during stressful thermal events, new research shows. The study concluded that the particular nutrient balance in ... read more New Dietary Guidelines Must Be Sustainable, Regardless of Politics
Oct. 1, 2015 The new iteration of the Dietary Guidelines for Americans must incorporate sustainability considerations -- both for the health and wellbeing of Americans and the world in which we live, urges a new ... read more Accurate Timing of Migration Prolongs Life Expectancy in Pike
Oct. 1, 2015 Animal migration is a spectacular phenomenon that has fascinated humans for long. It is widely assumed that appropriate timing of migratory events is crucial for survival, but the causes and ... read more Holodeck? Using Holography to Better Understand Clouds
Oct. 1, 2015 Researchers use a real life HOLODEC (yes, said like the Star Trek holodeck). The instrument creates a holographic model of water droplets in clouds. Check out the airborne ... read more Silicon 'Plant Stones' for Strong Rice: Fertilizing & Recycling Si in Vietnamese Fields
Oct. 1, 2015 Recent research showed that silicon (Si) is an important nutrient enhancing the endurability of rice plants, however, what ... read more Rock Samples from Western US Teach How to Hunt for Life on Mars
Oct. 1, 2015 With news coming this week that NASA has confirmed the presence of flowing saltwater on the surface of Mars, the hunt for life on the Red Planet has new momentum. Now, Eocene ... read more Asteroid Impact, Volcanism Were One-Two Punch for Dinosaurs
Oct. 1, 2015 The debate whether an asteroid impact or volcanic eruptions in India led to the mass extinction 66 million years ago is becoming increasingly irrelevant, as new dates for the ... read more Micro Photosynthetic Power Cells for the Future?
Biodegradable Materials to Replace Plastic Bags
Hawaii: Highest Rates of Unique Marine Species
Balanced Diet Is Good for Corals Too
Timing Migration Right Prolongs Life in Pike
Using Holography to Better Understand Clouds
Silicon 'Plant Stones' for Strong Rice
Rock Samples: How to Hunt for Life On Mars
A Dozen Ways to Go Green for the Holidays
Dec. 10, 2014 Sustainability experts have put together a list of 12 steps, big and small, that everyone can take to reduce holiday waste and make the season a little ... read more Suburban Sprawl Cancels Carbon Footprint Savings of Dense Urban Cores
Jan. 6, 2014 According to a new study, population-dense cities contribute less greenhouse gas emissions per person than other areas of the country, but these cities' extensive suburbs essentially wipe out ... read more Natural Gas from Shale Contributes to Global Warming, Researchers Find
Apr. 12, 2011 Natural gas extracted from shale formations has a greater greenhouse gas footprint -- in the form of methane emissions -- than conventional gas, oil and coal over a 20 year period. This calls into ... read more Large Uncertainty in Carbon Footprint Calculating
Dec. 13, 2010 The calculation of carbon footprints for products if often riddled with large uncertainties, particularly related to electronic ... read more Strange & Offbeat |
Title: Paleoecological Reconstruction of the Holocene Fire Regime at Mud Lake, Eastern Ontario, near St. Lawrence Islands National Park
Authors: Ellwood, Suzanne Margaret
Ellwood_Suzanne_M_201001_MES.pdf3.68 MBAdobe PDFView/Open
Keywords: paleoecologypaleolimnologycharcoalfire historyrestoration
Abstract: Wildfire is an ecological disturbance that plays an important role in ecosystem function and interacts with climate and vegetation, relationships that may be altered by ongoing climate change. Insights from paleoecology can provide context for environmental change, including the natural range of variability. Here, the Holocene fire history of a small watershed in eastern Ontario, Canada is reconstructed. A high-resolution macroscopic charcoal series was derived from the lacustrine sediment of Mud Lake, north of Gananoque, Ontario and within the Frontenac Arch. Analysis of the charcoal record estimates a mean fire-return-interval (FRI) of 175 yr/fire around Mud Lake during the Holocene, and similar mean FRIs during different time periods indicates that it has been a largely stationary fire regime. The analysis suggests that fire activity may have recently increased, but a lack of documentary fire records for the area leaves this uncertain. There is no indication that humans have significantly impacted the fire regime, though anthropogenic ignition could have played a role in the area’s recent fires. The fire regime around Mud Lake does not appear to have shifted in association with major changes in regional vegetation. Fire activity does correlate with some paleoclimate trends. The estimated fire frequency decreased around 7500 yr BP, when wetter summers became more common in eastern Canada, and a recent increase in fire frequency would parallel with more frequent incursions of dry and cool air masses into the region. During other parts of the record, however, the fire activity does not appear to reflect the major climate impacts. The fire history of Mud Lake is relevant to the ecological management of eastern Ontario’s St. Lawrence Islands National Park and its restoration of a rare, fire-dependent tree species, the pitch pine. Though predictions vary, this area’s climate may become more favorable to fire through an increase in temperature and a decrease in summer precipitation. By providing information about the natural variability of fire activity in eastern Ontario, this research can be applied towards setting appropriate management goals during future environmental change.
Description: Thesis (Master, Environmental Studies) -- Queen's University, 2010-02-01 00:14:00.711
Appears in Collections:Queen's Graduate Theses and DissertationsSchool of Environmental Studies Graduate Theses |
The Past isn't Past
On the State of the Liberal Arts
For teachers, one of the most enjoyable things to do is spend time being students again.
So it was that I spent the past weekend at Transylvania University’s seminar on Twenty-First Century Liberal Education, along with 18 other academics from a variety of liberal arts institutions.
We all read hundreds of pages of material in preparation. In the span of 65 hours at the seminar, we spent two hours listening to formal lectures (and another hour discussing them), 10 hours in formal discussion sessions, and countless more hours informally continuing those exchanges.
Yes, this is what teachers do in the summer for fun. And it was fun—as well as intellectually illuminating and invigorating.
It was also sobering, coming as it did at a time when higher education faces plenty of public scrutiny and criticism, and when the liberal arts and liberal arts colleges in particular face charges of irrelevance.
The value of this kind of intensive consideration of a topic is that it inevitably focuses the mind. Many of the issues we discussed have been bouncing around my brain for a while (sometimes showing up in this blog), but I’ve never considered them as intensely as I did at the seminar.
Since I’m forever preaching to my students that the best way to figure out what they think about a reading or discussion is to write about it, I’ll attempt to do that myself. (All of the pieces I quote below are from the wonderful reader that the Transylvania seminar leaders put together.)
For the historian, the easiest and most obvious conclusion to take from our readings is that there is nothing new about the liberal arts—or higher education in general—being under siege. It rather seems like a permanent state of affairs. That’s no excuse for complacency about its current challenges, to be sure, but it does help leaven one’s reaction to all of the apocalyptic warnings of the demise of liberal arts. This is not new: the liberal arts college has been through this before and survived. As Alan O. Pfnister put it in 1984, “the free-standing liberal arts college in America has been a study in persistence amid change, continuity amid adaptation.”
“Continuity and change” is the essence of history, and the story of the liberal arts has seen plenty of both. The perennial debate seems to revolve mostly around the question of value and utility: What precisely is the value of the liberal arts? How do we determine that value, how do we present that value to prospective students and their parents?
For clarity’s sake, the sides can be simplified: 1) the liberal arts have value that cannot be quantified and assessed in any meaningful way, but they prepare students to lead better, more meaningful lives; and 2) the liberal arts must demonstrate their practical value in concrete, accessible ways that give others outside the academy reason to believe they are worth the time and money expended in studying them. Since these are simplifications, few people are likely to identify with either without some kind of reservation, but I’d argue that at some point everyone concerned with the topic will end up choosing one as having primacy over the other.
I choose the first. I am not unaware of the pressures being brought to bear to make college education ever more “practical” (read “directly applicable to post-graduation employment”) to justify its high price tag. I simply believe first causes matter and that something essential is lost when we, as another participant in the seminar put it, allow external rather than internal causes to determine what and how we teach.
The second point of view, however, seems to dominate the field these days. Writing in 2007, David C. Paris, professor of government at Hamilton College (and one-time participant in the Transylvania seminar) said: “the liberal arts and the academy in general need to make peace with, or at least acknowledge, the importance of the market.” I’ll meet Paris half-way: I acknowledge that the market matters. Despite his rather disdainful portrayal of the traditional liberal arts as appearing “esoteric and apart from real concerns” or “ornamental,” and of its defenders as not concerned with the “real world,” I am not oblivious to reality.
But no, I will not “make peace” with the idea that the market should determine what and how educators in the liberal arts teach. Paris argues that “the liberal arts are threatened,” at least in part, by “too narrow a self-concept” among its practitioners. He writes that “promoting a good life recognizes that there are many ways of living such a life.” The latter is true. But it is not the liberal arts that are “too narrow.” It is the market that defines the good life in the most narrow way possible, i.e., by a single standard: the dollar sign.
Our students do not need the liberal arts to tell them that money matters. The entire culture tells them that relentlessly. They cannot escape it. It is our job as educators to open them to some of the other possible answers to that basic question: “What makes a good life?”
The liberal arts have a long history of addressing that question and advancing our understanding of the good. Liberal education has been a vehicle for addressing questions of inequality and oppression, empowering students to challenge the institutions that buttress those conditions, primarily through encouraging independent thinking. It has been a truly liberating force, and it has not achieved that by asking what the market wants from it.
What message does it send about the answer to that fundamental question of the good when the Association of American Colleges and Universities (AAC&U) resorts to focus groups of students and employers to tell educators what liberal education should be? Or when the AAC&U endorses and privileges certain educational trends as superior (“active” or “high-impact”) to others and justifies its prescriptions by noting that “employers strongly endorsed” them and that they will receive “very strong support from the employer community”?
Whether they realize it or not, they are saying in effect: Let the market decide. They are abdicating their responsibility as educators to shape curriculum. They are buying into not just the language but the values of the market: if it is demanded, it must be supplied. David L. Kirp writes in Shakespeare, Einstein, and the Bottom Line: The Marketing of Higher Education: “This is more than a matter of semantics and symbols.” When we use “business vocabulary we enforce business-like ways of thinking.” (Thanks to Transylvania’s Jeffrey B. Freyman for this quotation from his paper, “The Neoliberal Turn in Liberal Education.”)
Though the proponents of this point of view often come from the progressive side of the political spectrum, they unwittingly are endorsing a decidedly illiberal view of education. As Christopher Flannery and Rae Wineland Newstad point out in “The Classical Liberal Arts Tradition,” the phrase “liberal arts” literally means the “arts of freedom” as opposed to those practiced by slaves. “Slaves are subjected to the will of others, mere tools or instruments of alien purposes, unable to choose for themselves.” So-called “practical” training was for slaves, and the liberal arts would ruin slaves for their role in society as servants to their superiors.
Liberal education later evolved—particularly in the United States—into not just the privilege of the already free, but as a vehicle for freeing the young from servile status. As Frederick Douglass makes clear in his autobiography, the liberating quality of education was the reason American slaves were denied it: “Knowledge unfits a child to be a slave.” Liberal education equips students to take their places as equals in a free society, as makers of their own lives.
But note how the AAC&U approached its call for reform in 2008. In advocating its “Engaged Learning Reforms” (which closely mirror John Dewey’s practical learning agenda of the 1930s--it is nothing new), AAC&U president Carol Geary Schneider justified the plan primarily with a table showing the “Percentage of Employers Who Want Colleges to ‘Place More Emphasis’ on Liberal Education Outcomes.” Leading the pack was “science and technology,” with the support of 82%. Next came “teamwork skills in diverse groups,” with 76%.
The clinching argument for Schneider is this: “these goals for college learning are strongly endorsed by the constituency that today’s students particularly want to please—their future employers.”
That sentence, to my mind, lays bare the essential problem with the AAC&U approach: rather than strongly reaffirming the goal of educating students to think for themselves—the traditional goal of liberal education—the AAC&U implicitly admits that it has substituted the goal of pleasing their future employers. At the end of the day, how far is that from students being “subjected to the will of others, mere tools or instruments of alien purposes, unable to choose for themselves”? This vision of the liberal arts does not free students; it puts the liberal arts at the service of society’s economic masters. It is natural that economic fear in uncertain times leads college students to want to please future employers. That does not mean that educators should seek to assuage that fear by shirking their responsibility to provide their students with far more than that, or should bend the curriculum to meet the desires of employers.
Schneider’s statement is not an isolated case, either. AAC&U’s LEAP program (Liberal Education and America’s Promise) published a piece in 2005 titled “Liberal Education for the 21st Century: Business Expectations” by Robert T. Jones, president of Education and Workforce Policy. Jones is not shy about how he sees the role of higher education: it “must respond to these trends by keeping the curriculum aligned with the constantly changing content and application of technical specialties in the workplace.” Note, education “must” serve the needs of the workplace. That which business does and wants, higher education must do—because, at the end of the day, education serves business. Education must submit to business’ “assessment” of how well it produces the “outcomes” business wants, it must get “continual input from both employers and graduates” and change its ways accordingly.
Jones states that employers “are less concerned with transcripts than the demonstration of achievement and competency across a variety of general and specialized skills.” Knowledge, wisdom, perspective—none of these traditional liberal arts goals fit this account of what employers want. “Competency” in “general and specialized skills” is the aim. Today, “competencies” has become a common buzzword in education discussions, even opening the door for granting academic credit for work experience, and threatening to make the classroom experience virtually unnecessary.
The new liberal education, Jones says, “now enhanced with practical learning [how’s that for product branding?] is the essential foundation for success in every growing occupation.” Jones is smart enough to compliment liberal education, even as he asserts that it is, at least in its current form, wholly inadequate and must be altered to serve the workplace better. But his ultimate purpose could not be clearer: education must “make peace” with the market.
Yes, there are substantial economic pressures on students today. Do we as educators, however, serve them best by surrendering our purposes to what prospective employers tell us they want? I say no. The question we need to ask is this: are the traits that employers say they want, and the means we are urged to adopt to meet them, wholly compatible with liberal education?
Take one example: Schenider tells us that colleges should change curriculum to include more “experiential learning” such as internships and “team-based assignments”—the latter because 76% of employers want more emphasis in college on “teamwork skills.” Do employers and faculty mean the same things when they advocate “teamwork skills” as an educational goal? If employers next tell us we're not producing the correct "outcome" when we teach teamwork, will we be called upon to change practices once again? Is it not possible that when some employers say they want employees with “teamwork skills,” they mean people who will not rock the boat and bring up the less essential “ethical values” that the team might be violating? I’d suggest that the recent record of the banking and financial industries shows that we may be teaching too much teamwork and not enough ethics.
It may not be coincidental that the two lowest priorities for employers on Schneider’s survey were “ethics and values” at 56% and “cultural values/traditions” at 53%. Would those who use such survey results to justify their preferred educational reforms also accept that the curriculum should not emphasize ethics and values, because employers don’t seem to care so much about them? Shouldn’t the low priority the employers placed on ethics and values suggest to us that perhaps their goals are not the same as liberal education’s, and make us at least question whether we should give priority to their preferences?
A liberal arts education should empower students with a sense of perspective, but that is precisely what is sorely lacking in this debate. The AAC&U approach smacks of fear and desperation, but is the reality really so dire that we need to look to surveys of employers to tell us what to do? Yes, the price of higher education is high (though not as high as the sticker price suggests, since most students do not pay that price), and students and their parents have a right to expect that a high-priced college education will prepare its graduates for life—including the working life.
But today’s sense of panic comes less from those realities than from a culture that reflexively and unthinkingly ridicules the liberal arts as impractical, simply because they do not immediately and automatically funnel graduates into high-paying jobs. Seemingly everyone from Click and Clack on “Car Talk” to President Obama buys into the idea that the art history major won’t get you a good job. We laugh and nod knowingly when people joke that all that liberal arts majors really need to know is how to ask “Do you want fries with that?”
But it is simply not true, as an AAC&U report shows. It may seem true when graduation comes and that dream job (making, say, at least as much money as last year’s tuition cost) does not materialize. It certainly did for me when I was in that boat. But I see much better now than I did then. Thirty years down the road, the full value to me of my liberal arts education continues to emerge. The liberal education will not pay its dividends—either economic or otherwise—in one or two or five years. When we expect it to do so, we are unthinkingly adopting the short-run values of today’s market mentality, with its concern with the next quarter’s profit, not the long-term viability of the company (see, again, the banking and financial industries). When we then change the way we teach in deference to such illusory expectations, we begin to sacrifice what we have always done best in the service of a mirage.
It is hard for liberal arts colleges to preach patience and perspective; perhaps it has rarely been harder to do so than it is now. But it is true: a liberal arts education has long-term value, value that cannot be reduced to income earned two or four years out, as the President’s “College Scorecard” seems to be intending to do.
The fact of the matter is that ten or twenty or thirty years down the road, liberal arts majors are doing fine. True, they may not make as much as their cohorts in the STEM fields. Some may need a graduate degree to enhance further their economic well-being. But the traditional liberal arts curriculum does NOT condemn liberal arts graduates to a life of poverty, and we do not serve our students well when we buy into the lie that it does.
When we accept that false narrative as true, when we contort ourselves and embrace any curricular reform that promises to make us more “practical” and “useful,” when we adopt educational practices for their branding or marketing potential rather than their educational value, we betray our fundamental mission: the education of our students for freedom, not for servitude.
AAC&U,
Transylvania seminar
Historically Moving
After more than four years doing this blog, I'm starting a new venture. History New Network recently invited me to blog on their site, and with this post, "Historical Humility," I begin.
I'll still be posting my pieces here; probably a day after they make their debut on HNN. And I will continue to use this space for the occasional less historical and more personal piece.
I'd like to thank you readers who have been following this blog--some since it began early in 2010. In retrospect, it seems that every time I began to wonder if it was worth the time and effort, someone would, out-of-the-blue, send me a nice compliment, or ask me when the next piece was coming. So thanks to everyone who did that.
I just wish my Dad was still here to see the new blog. He was probably the biggest fan of "The Past Isn't Past." Nothing gave me more satisfaction than when he would drop a casual "I liked your blog post" into our weekly Sunday afternoon phone call. After he passed, I went on his computer to send a message to his contacts to let them know, and noticed that "The Past Isn't Past" was the first bookmark on his web browser.
So, for that Great Web Browser in the Sky--and the rest of you, too--here's the bookmark for my new web home, Mark Byrnes's Facing Backwards.
I love the Fourth of July
(Re-posted from July 1, 2010)
I love the Fourth of July.
Not just because of fireworks (though who doesn't love a good fireworks display?). And not just because of cookouts (and, since you can throw a veggie burger on the grill too, who doesn't love a good cookout?). And not just because it gives me a reason to play two of my favorite songs, Bruce Springsteen's "Fourth of July, Asbury Park (Sandy)" and Dave Alvin's "Fourth of July" (though, seriously, this would be reason enough).
I love the Fourth because of the Declaration of Independence.
It began sometime in my childhood. At some point, on some vacation, at some historical site, my parents bought me a facsimile of the Declaration. It probably tells you all you need to know about me that I thought this was a great souvenir. It was hard, brittle, yellowed paper that crackled when you handled it. For some time I thought all official documents were thus. So when, in the fifth grade, my classmates called upon me to write a peace treaty ending the Great Spitball War between Group 2 and Group 3 (a foreshadowing that I would one day study diplomatic history?), I insisted on taking the piece of paper, coloring it with a yellow crayon, and then crumpling it up in a ball and flattening it out so that, at least to my eye, it looked like my copy of the Declaration. Then it was official.
Later, I eventually stopped wondering why there were so many "f"s where there should clearly be "s"s, and thought more about its content. Just about every American is familiar with the most famous passage about the self-evident truths. But there is a lot more to the Declaration. Much of it, the bulk of it really, is essentially an indictment of George III justifying the break. Reading it with an historian’s rather than
a patriot’s eye, many of the points don’t really hold up. But my favorite part of the Declaration isn’t one of the well-known lines, or something obscure from the list of charges. It comes at the end, just a simple, short phrase, and it encapsulates for me what is best about the Fourth of July.
When you think about it, July 4 isn’t really the most natural date for the nation’s birth. There are other turning points we could have chosen, for example, the outbreak of hostilities. Using that criterion, April 19, 1775, the date of the battles of Lexington and Concord, would be a better choice. Perhaps February 6, 1778, the date a great power, France, recognized American independence and entered an alliance with the U.S. that would help win the war, would be fitting. Legally one could argue that April 9, 1784, the date Britain recognized independence with its acceptance of the Treaty of Paris, was the true independence day.
But we didn’t chose the date of a battle, or the recognition of a great power, or the acceptance of the mother country. We chose the date of a declaration. What does July 4, 1776 mark, after all? A decision. An intention. Not a change in fact, but a change of mind. Looked at coldly, purely as a matter of fact, the Declaration is an absurdity. The colonies declared that they were independent, but they clearly were not. The colonies were still ruled by royal governors appointed by the King, and were occupied by tens of thousands of British soldiers. But the declaration nonetheless boldly states, in the words of a resolution first proposed by Richard Henry Lee nearly a month earlier, that “these united Colonies are, and of Right ought to be Free and Independent States.”
And it’s that phrase that I love: “and of Right ought to be.” The Declaration is not one of fact. It is one of what “of Right ought to be.” This country was founded with its eyes on the Right. Those men who signed the declaration were not always right. About some things, many of them, in many ways, were tragically wrong. But they knew the importance of what ought to be. And they knew that the most important date was not the one when men took up arms, but when they decided to do what was right. When it has been at its worst, this country has settled passively for what is, or what cynics said has always been and thus must always be. When it has been at its best, it has remembered to keep its eyes on what "of Right ought to be."
Have a wonderful Fourth of July, and sometime between the cookout and the fireworks, think a little about what of Right ought to be. And then work to make it a reality. That’s what the Fourth, and being an American, means to me.
Maliki is the New Diem
Some people are talking coup d'etat in Iraq.
David Ignatius writes that "President Obama sensibly appears to be leaning toward an alternative policy that would replace Maliki with a less sectarian and polarizing prime minister."
The impulse to replace Maliki is understandable. Most observers of Iraq argue that he has played a large role in the growing sectarian divide between the majority Shi'ites and the minority Sunnis, and thus bears responsibility for the growth of ISIS in the north.
The unstated assumption, of course, is that another popularly elected, plausible leader could have governed differently and guided Iraq into a functioning democracy, and that now, the fact that elections produced Maliki should not stop the United States from maneuvering behind the scenes to get a more able (read "pliable") leader in his place. Then the United States can go about fixing Iraq.
President George W. Bush shakes hands with Iraqi PrimeMinister Nuri al-Maliki, July 25, 2006. Photo by Kimberlee Hewitt, public domain via Wikimedia Commons
Perhaps. More likely is that the internal conditions in Iraq produced the kind of leader Maliki became. If that's the case, then a coup to oust Maliki will do no good at all. Instead, it is likely to make things worse.
There is certainly precedent for that. In the mid-1950s in South Vietnam, the Eisenhower administration sought a non-communist popular leader who would not be tarnished by associations with the departing French colonizers. It settled on Ngo Dinh Diem.
For about six years, Diem seemed the answer to American prayers. He created a separate South Vietnamese government as a counter to Ho Chi Minh's communist North. He led a fairly stable regime that served American interests in the region.
President Dwight D. Eisenhower shakes hands with SouthVietnamese President Ngo Dinh Diem, May 8 , 1957U.S. National Archives and Records Administation
But then in 1960, the National Liberation Front began its offensive against Diem's government. As pressure grew, Diem grew more oppressive, in particularly cracking down on the majority Buddhists. By the fall of 1963, the American embassy and elements of the Kennedy administration decided that Diem was the problem and needed to go. American officials sent signals to South Vietnamese generals who then ousted and murdered Diem and his brother.
Ignatius effectively proposes that the United States do the same thing in Iraq today:
The people who will pull the plug on Maliki are Kurdish leader Massoud Barzani and other Iraqi kingmakers. The United States should push them to signal unmistakably that Maliki is finished…. Saudi Arabia wants Obama to announce that he opposes Maliki. It would be better just to move him out, rather than hold a news conference.
One can only hope that Obama resists such pressure. Things with Diem didn't work out well.
In a February 1, 1966 conversation with Sen. Eugene McCarthy, LBJ put it bluntly. Kennedy was told, he said, that Diem
was corrupt and he ought to be killed. So we killed him. We all got together and got a goddamn bunch of thugs and we went in and assassinated him. Now, we've really had no political stability since then.
The political instability that followed the Diem coup was a major contributing factor in LBJ's disastrous decision to Americanize the war in Vietnam.
The desire to replace Maliki is another example of the imperial attitude toward Iraq: America gets to decide when it is time for the leader to go. I have little doubt that if the United States determined to do so, it could mount a coup against Maliki. But as always, the question is: what then?
As with the initial invasion, it is relatively easy to destroy. It is much harder to build. The United States can probably destroy Maliki if it so chooses. But can it build anything to replace him?
David Ignatius,
Dwight Eisenhower,
John F. Kennedy,
Lyndon Johnson,
Ngo Dinh Diem,
David Brooks and Pottery Barn Imperialism
One of the reasons I continue to read David Brooks is that he is often unintentionally revealing. Since he is, I think, quite sincere, he does not indulge in clever subterfuge in making his arguments. Thus he sometimes lays bare what otherwise remains hidden behind what Andrew Sullivan last week (ironically) called "noble lies."
In his June 13 column, Brooks tries to lay the blame for Iraq's current travails at the foot of Barack Obama. Before American troops left in 2011, he writes:
American diplomats rode herd on Prime Minister Nuri Kamal al-Maliki to restrain his sectarian impulses. American generals would threaten to physically block Iraq troop movements if Maliki ordered any action that seemed likely to polarize the nation.
After U.S. troops left, he writes:
Almost immediately things began to deteriorate. There were no advisers left to restrain Maliki’s sectarian tendencies. The American efforts to professionalize the Iraqi Army came undone.
Brooks never acknowledges the obvious (though unstated) assumption behind all of this: that Iraq could not be expected to function without the United States. It seems that Nuri al-Maliki (hand-picked by George W. Bush in 2007, by the way) bears no responsibility for indulging his "sectarian impulses" (and note that Maliki is ruled by "impulse," not thought or calculation), and the Iraqi army bears no responsibility for not being professional. It is all due to the absence of Americans, who of course, know best.
Brooks says, quite without irony, that "Iraq is in danger of becoming a non-nation." It never occurs to him that a state that--according to him--cannot function without American diplomats riding herd and American generals threatening its leader might already be a "non-nation."
Without knowing it, Brooks embraces an imperial role for the United States. It was America's job to control the Iraqi government, make it do the right thing. The United States should have stayed in Iraq for as long as it took. Leaving Iraq was "American underreach."
Brooks also embraces the reflexive American-centric mindset far too common on both the left and the right in the United States: the idea that whatever happens abroad happens because of something the United States either did or did not do. An incorrect American policy of withdrawal led to this state of affairs. It necessarily follows that whatever is going on in Iraq now can be fixed by the correct American policy.
Neither of those things is true. It is an illusion that Americans cherish because they think it gives them control over a chaotic world.
The American invasion of Iraq in 2003 broke Iraq. Iraqis thus far have not been able to put it back together. Maybe they never will. The lesson to be learned from that, however, is not what Brooks would have us believe: "The dangers of American underreach have been lavishly and horrifically displayed."
In the lead up to the Iraq War in 2003, Colin Powell allegedly talked about the so-called "Pottery Barn rule: You break it, you own it." The true lesson of Iraq is this: that American military intervention can easily break a country. It does not follow that American military intervention can just as easily make a country. Having disastrously bungled in breaking Iraq, Brooks would now have the United States once again bungle in trying to make it.
What the United States must "own" is not the state of Iraq, but the responsibility for breaking that state. Those are not the same thing. Responsibility begins with not making the situation worse by repeating the original mistake.
David Brooks, it seems, never learned that lesson. One hopes Barack Obama has.
Colin Powell,
David Brooks,
Nuri al-Maliki,
Somebody Told Us There'd Be Days Like These
With chaos returning to Iraq due to the growing power of ISIS (Islamic State of Iraq and Syria) in the north, the partisan divide over the American war there has resurfaced as well. Supporters of the war charge President Obama with losing Iraq because he withdrew American forces, while critics of the war fume at the gall of the architects of that disastrous war now posing as experts on the region.
Because the debate has been largely partisan, with Republicans and Democrats lining up rather predictably, there is a sense that this is merely a partisan dispute. It is not. Unfortunately, the partisan nature of the current debate makes it seem so.
Rather than go back to the 2003 debate, I decided to look back a little further--to the first war with Iraq in 1991, and the criticism of the George H. W. Bush administration for its refusal to go "on to Baghdad." Those Republican foreign policy leaders defended their decision by predicting undesirable outcomes--ones which we are now seeing come to fruition.
Re-reading the memoirs of Colin Powell (then Chair of the Joint Chiefs) and James Baker (then Secretary of State), it becomes immediately apparent that they foresaw today's events as the nearly inevitable outcome of a U.S. invasion to topple Saddam.
President George H. W. Bush, Secretary of State James Baker, National
Security Advisor Brent Scowcroft, Gen. Colin Powell, Jan. 15, 1991
Writing in 1995, Gen. Powell quoted U.S. ambassador to Saudi Arabia, Charles Freeman, who wrote in a 1991 cable: "For a range of reasons, we cannot pursue Iraq's unconditional surrender and occupation by us. It is not in our interest to destroy Iraq or weaken it to the point that Iran and/or Syria are not constrained by it." Baker also observed in 1995 that "as much as Saddam's neighbors wanted to see him gone, they feared that Iraq might fragment in unpredictable ways that would play into the hands of the mullahs in Iran, who could export their brands of Islamic fundamentalism with the help of Iraq's Shi'ites and quickly transform themselves into the dominant regional power."
Supporters of the war who now bemoan the growth of Iran's influence in Iraq have no one but themselves to blame. We were told it would be like this.
The current situation--a stable Kurdistan, ISIS in control of much of the Sunni-dominated areas, Shi'ites rallying to the defense of their holy sites--portends the possible partition of Iraq, either formally or de facto. That, too, was foreseen in 1991.
Powell: "It would not contribute to the stability we want in the Middle East to have Iraq fragmented into separate Sunni, Shia, and Kurd political entities. The only way to have avoided this outcome was to have undertaken a largely U.S. conquest and occupation of a remote nation of twenty million people."
The United States spent eight long years doing just that, occupying Iraq to keep it together. But that was never a sustainable long-term prospect. It went on too long as it was. Nevertheless, there are some neocons today suggesting that the United States never should have left Iraq.
Baker, who was known for his domestic political skills before he went to the State Department, knew that scenario was untenable: "Even if Saddam were captured and his regime toppled, American forces would still be confronted with the specter of a military occupation of indefinite duration to pacify the country and sustain a new government in power. The ensuing urban warfare would surely result in more casualties to American GIs than the war itself, thus creating a political firestorm at home."
Twenty years ago, these Republican statesmen predicted the situation we now see in Iraq. They warned anyone who would listen that an American intervention to overthrow Saddam Hussein would have undesirable consequences contrary to American interests, regardless of any specific actions the United States did or did not take in pursuit of that larger goal.
Keep in mind that they said these things would happen with their president in charge, with themselves making policy. They understood that there are forces that such an act would set loose which the United States could not control, no matter who was in office. They said all this long before anyone had ever even heard of Barack Obama. The idea that any specific act by the president is primarily responsible for the current state of affairs in Iraq is absurd on the face of it.
That won't stop people from saying so. But it should keep the rest of us from believing it.
Brent Scowcroft,
George H. W. Bush,
James Baker,
Leadership and Interventionism Are Not the Same Thing
Robert Kagan has written a piece in the New Republic entitled "Superpowers Don't Get to Retire." In it, he bemoans what he perceives as America's retreat from its responsibility to preserve a liberal world order. Kagan argues: "Many Americans and their political leaders in both parties, including President Obama, have either forgotten or rejected the assumptions that undergirded American foreign policy for the past seven decades."
Kagan is correct that public attitudes towards America's role in the world have shifted recently, but he dramatically overstates the case when he posits a break with a 70-year tradition. He seems to equate "leadership" with military interventionism. Americans have rejected the latter, not the former.
What Kagan does not recognize is that the public's current aversion to military interventionism abroad is not only consistent with America's pre-World War II foreign policy, but with the golden age of leadership he praises.
Kagan's fundamental mistake is to think that the American people embraced military interventionism during and after World War II. They did not.
Americans have always been averse to military actions leading to large numbers of American casualties and extended occupations of hostile territory. In the two years before Pearl Harbor, Americans (even the so-called "interventionists") desperately clung to the idea that they could protect American interests merely by supplying the British (and later the Soviets) with the weapons to do the fighting.
While conventional wisdom suggests that Pearl Harbor changed all that, the reality is different. Even after the United States entered the war, it was reluctant to launch military operations that posed the threat of huge casualties. As David M. Kennedy has stated, this American predilection to avoid combat with Germany's forces in France led Stalin to conclude: "it looks like the Americans have decided to fight this war with American money and American machines and Russian men."
Even the major architect of the postwar order, Franklin Roosevelt, did not envision an America that would permanently station large numbers of U.S. soldiers abroad, much less deploy them on a regular basis. Yes, he did see the United States as the leading power in the new United Nations. But the point of having the so-called "Four Policemen" was to insure that the other three would be the ones to send soldiers to keep order in their respective spheres of interest. He imagined that the American role would be primarily in the form of naval and air power. "The United States will have to lead," FDR said of the UN, but its role would be to use "its good offices always to conciliate to help solve the differences which will arise between the others." FDR, Churchill, and Stalin at TeheranBy Horton (Capt), War Office official photographer [Public domain], via Wikimedia Commons
As the historian Warren Kimball has written, at the 1943 Teheran conference, when Stalin pressed him on how the United States would comport itself as one of the policemen, "FDR resorted to his prewar notion of sending only planes and ships from the United States to keep the peace in Europe." In FDR's mind, the United States would be primarily responsible for order in the western hemisphere, a role it had played for decades.
Even the so-called American declaration of cold war, the Truman Doctrine speech of March 1947, avoided the implication that American military forces would be deployed to uphold the doctrine. The speech simultaneously signaled to the world that the United States was both assuming some of Britain's responsibilities and had given up on the idea of cooperation with the Soviet Union. Nonetheless, Truman explicitly stated that the aid he was requesting would not be military: "I believe that our help should be primarily through economic and financial aid which is essential to economic stability and orderly political processes." Truman presented aid to Greece and Turkey as mere money to make good on the far larger investment of lives and treasure during World War II: "The assistance that I am recommending for Greece and Turkey amounts to little more than 1 tenth of 1 per cent of this investment. It is only common sense that we should safeguard this investment and make sure that it was not in vain."
The Korean War changed that by requiring quick American military intervention to prevent the collapse of South Korea in the summer of 1950, but when it bogged down into a stalemate after the Chinese intervention in November, the public quickly soured on the war. In January 1951, "49% thought the decision was a mistake, while 38% said it was not, and 13% had no opinion," according to Gallup. While those numbers fluctuated over the next two years, and more Americans thought the war was not a mistake whenever an end to the war was in sight, the American public in general did not support military actions that led to substantial American casualties and prolonged combat. The public's disillusionment with the war was one of the reasons that an increasingly unpopular President Truman decided not to run for reelection in 1952.
The next president, Dwight Eisenhower, moved quickly to end that war, and, more importantly, instituted a foreign policy that had at its core the principle of avoidance of any Korea-style wars in the future. Rather than engage in limited wars in every world hot spot, Eisenhower determined that such a course would bankrupt the country. He preferred "massive retaliation": the idea that a threat to essential American interests would be met with a nuclear threat, not a conventional response in kind. Even when the French faced defeat in Vietnam, Eisenhower refused to intervene, and never seriously considered deploying American troops to Vietnam.
While John Kennedy came into office criticizing that approach, pledging to "pay any price, bear any burden," the sobering experience of the Cuban missile crisis made him rethink that mindset. The cold war, he said in June 1963, imposed "burdens and dangers to so many countries," and specifically noted that the US and Soviet Union "bear the heaviest burdens." He spoke of the American aversion to war: "The United States, as the world knows, will never start a war. We do not want a war. We do not now expect a war. This generation of Americans has already had enough -- more than enough -- of war and hate and oppression."
While one may argue that Kennedy's policies led to the next American war in Vietnam under his successor Lyndon Johnson, it is also the case that Johnson sought to avoid a land war. Significantly, he looked first to use air power. Operation Rolling Thunder, the American air campaign against North Vietnam, was meant to forestall the need for American ground troops in large numbers. It was only after the clear failure of bombing to achieve American aims that Johnson escalated the war with more ground troops.
When that effort too proved futile, Richard Nixon again returned to air power as America's main instrument to maintain order abroad. His Vietnamizaion policy tried to balance the withdrawal of American troops with the deployment of increased air power. The "Nixon Doctrine," announced that henceforth "we shall furnish military and economic assistance when requested in accordance with our treaty commitments. But we shall look to the nation directly threatened to assume the primary responsibility of providing the manpower for its defense." In other words, America's friends should not expect American troops to do their fighting for them.
I'd argue that from Nixon up until George W. Bush's invasion of Iraq, that was American policy. Ronald Reagan, George H. W. Bush, and Bill Clinton all avoided open-ended military commitments of American troops (Clinton's air-only campaign against Serbia in 1999 is the best example).
Only the first war against Iraq in 1991 challenged that trend, and even that war involved a longer preliminary air campaign than a ground one: five weeks of bombing preceded the ground campaign, which lasted only 100 hours. According to Colin Powell, Bush had the Vietnam War in mind when he resisted the calls of "on to Baghdad." Bush "had promised the American people that Desert Storm would not become a Persian Gulf Vietnam," Powell writes in his memoir, "and he kept his promise." Within two weeks of the ceasefire, the 540,000 U.S. troops began their withdrawal from the Persian Gulf.
Even the American war in Afghanistan in 2001 was planned to keep the American "footprint" light, relying on American air power and the Afghan Northern Alliance to do much of the fighting. It was the invasion and prolonged occupation of Iraq beginning in 2003 that predictably soured Americans once again on the prospect of extended military engagements.
In sum, what Americans are experiencing now is not exceptional, but rather normal. In the aftermath of extended, costly military interventions leading to the loss of American lives, the American people revert to their historical aversion to solving problems by fighting in and occupying foreign states. That does not mean the United States ceases to be relevant, or ceases to lead. It simply means that Americans have been reminded once again that not every problem can be solved by an invasion, and that leadership is more than a reflexive application of American military might.
"Superpowers Don't Get to Retire",
FDR,
Four Policemen,
Harry Truman,
Richard Nixon,
Robert Kagan,
The New Republic,
Truman Doctrine
I am an associate professor of history at Wofford College in Spartanburg, SC. My obsessive interest in politics goes back to watching the Watergate hearings as a child (seriously).
You can follow me on Twitter: @byrnesms
Andrew Sullivan: The Dish
William A. Carleton
Michele Bachmann and the Frozen Founders
Santorum's Education: "What a Snob!"
Acting President
MOOCs and Books
"And the War Came"
Arab 1848
Daniel Walker Howe
George Kennan
Islamic center
John B. Judis
Ponnuru
Secession gala
South Carolina Secession
Texas School board |
17 Scalds burns in children under 3 years: an analysis of neiss narratives to inform a scald burn prevention program
Wendy Shields,
Eileen McDonald,
Andrea Gielen,
Kaitlin Pfisterer
Johns Hopkins Center for Injury Research and Policy, USA
Background objectives To determine the incidence of paediatric scald burns for children younger than 3 years treated in U.S. hospital emergency departments. To quantify injury patterns associated with scald burns to inform prevention recommendation messaging.
Methods The NEISS coding manual was reviewed for cause of injury and its database was queried to identify cases among patients up to age 3 years old with a diagnosis of scald burns between 1/01/2009 and 12/31/2012. The resulting data set was downloaded and case narratives were reviewed to identify injury patterns associated with scald burns.
Results The NEISS query identified 2,104 scald burn cases in children younger than 3 years old between 2009–2012. The NEISS query estimated 11,028 scald burns nationally. The analysis of the case narratives resulted in the identification of six precipitating and/or contributing factors including: bathing/tap water, cooking/heating, parent/patient consuming beverage or food, appliance, grabbed/pulled/kicked/dropped/fell off table/counter/dresser, and other/not specified.
Conclusions NEISS is a valuable tool to identify scald burn risks. The NEISS data system provided an opportunity to identify scald burns in children under 3 years of age. An examination of the precipitating and contributing factors associated with scald burns provided information that can be utilised to inform prevention interventions for caretakers of young children. Interpretation of NEISS results is limited due to the lack of consistency and detail in narratives about the injury event.
http://dx.doi.org/10.1136/injuryprev-2015-041654.17 |
TBI and dementia: Link or no link?
Published Friday 14 July 2017 Published Fri 14 Jul 2017
By Yella Hewings-Martin PhD
Researchers are using population studies and animal models to investigate how TBIs might lead to progressive neurodegeneration in some patients.
Whether or not traumatic brain injury predisposes individuals to dementia has long been under investigation, and the results of different studies are often conflicting. But evidence is mounting that traumatic brain injury can cause long-term damage to the brain.
Traumatic brain injuries (TBIs) disrupt the normal function of the brain. They occur as a result of a blow or jolt to the head, or an injury that penetrates it, according to the Centers for Disease Control and Prevention (CDC).
In 2013, 2.8 million people in the U.S. sustained TBI, of which approximately 56,000 resulted in death. The age groups most affected by TBI were small children up to the age of 4, teenagers and young adults between 14 and 25 years, and those over 75 years of age. The most common causes of TBI were falls, being struck by an object, and car accidents.
The immediate symptoms can range from headaches and blurry vision to slurred speech and short-term memory problems. TBIs can also have long-term effects on health, with an increased risk of seizures and infections sometimes following.
Research has suggested a link between TBI and several forms of progressive neurodegeneration - such as dementia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), and Parkinson's disease - but there is conflicting evidence.
Why is it so difficult to find conclusive evidence? And what are the long-term predictions for TBI patients?
The latest findings
Last week, Medical News Today reported on a study by Finnish researchers, which was published in the journal PLOS Medicine. Using the Finnish Care Register for Health Care, the team compared the medical notes of working-age individuals under the age of 65 with mild or moderate to severe TBI, all of whom had subsequently developed dementia, Parkinson's disease, or ALS.
They found a link between moderate to severe TBI and dementia, but no links with Parkinson's disease or ALS were discovered.
Importantly, they found that the incidence rate of dementia in moderate to severe TBI patients was similar to that found in the general population. But dementia occurs mostly in the elderly, highlighting that TBI shifts the risk from old age to working age.
The dataset used in this study was comprehensive; Finland has a tax-funded healthcare system. According to the authors, all acute TBI cases are treated at public hospitals and would therefore have been included in the study.
Yet data were only available for TBI patients who had subsequently been admitted to the hospital with neurodegenerative symptoms. The authors explain that it is possible that other patients with a diagnosis of neurodegeneration may have been missed if they had not been hospitalized at the time.
The results of the Finnish study concurred with data published last year in the Asian Pacific Journal of Public Health. Here, rates of dementia were higher among Taiwanese TBI patients than among those who had not sustained TBI.
Another study, published recently in the Journal of Alzheimer's Disease, failed to establish a link between TBI and Alzheimer's disease.
The authors compared 706 U.S. seniors with and without TBI and found that cognitive decline in participants was not affected by having experienced TBI. But in this study, TBI was self-reported by the study participants rather than assessed in their medical notes, meaning that data may not have been accurate.
A systematic review published earlier this year in Annals of Physical & Rehabilitation Medicine struggled to find a meaningful connection between TBI and Alzheimer's disease.
The review included 18 studies, but the authors were unable to classify TBI by severity. By grouping mild and moderate to severe TBI into the same category, it may not have been possible to establish a connection between TBI and Alzheimer's disease.
Other studies, however, have found clear links between TBI and Alzheimer's disease and Parkinson's disease.
TBI, neurodegeneration link supported
In an Alzheimer's disease patient cohort, those with histories of moderate to severe TBI began to experience symptoms and received their diagnosis by an average of 2.5 years earlier than non-TBI patients, according to a recent study published in the journal The Clinical Neuropsychologist. But again, TBI was self-reported in this study.
A paper published last year in JAMA Neurology found that while there was no link between TBI and dementia or Alzheimer's disease, there was a connection with Parkinson's disease.
Some of the study participants had consented to brain autopsies after their death. Both mild and moderate to severe TBI patients showed signs of Lewy bodies, a hallmark of Parkinson's disease, in their brains, while moderate to severe TBI patients also had signs of cerebral microinfarcts.
Importantly, while study participants were aged 65 and over, a third of mild and nearly half of moderate to severe TBI patients were age 25 years or younger when they sustained their TBI. This demonstrates that TBI could have long-term neurodegenerative effects.
The problem with this type of study is that they mostly rely on measures of association. This means that researchers establish whether or not there is a link between TBI and neurodegeneration in a particular study population based on the data they are using.
However, it is not possible to establish cause and effect in these studies, meaning that there could be other biological mechanisms involved in causing neurodegeneration in these patients.
To study what happens in the brain after TBI, researchers turn to animals. Here, the events following TBI are beginning to be unraveled.
How can TBI cause neurodegeneration?
A recent article in Reviews in the Neurosciences summarized what is known, to date, about the neurological damage following TBI.
The initial injury damages blood vessels, neurons, and other cell types. As a secondary effect, neurons become overstimulated, resulting in oxidative stress and cell death. Water metabolism is also affected, causing swelling in the brain.
The blood-brain barrier, which is normally impenetrable to most substances, becomes disrupted, allowing immune cells to infiltrate the damaged brain.
The combination of oxidative damage, neuroinflammation, edema, and damaged blood flow can cause significant and long-term damage to the brain.
Using a mouse model of brain injury, a recent study published in The Journal of Neuroscience set out to investigate the long-term effects of TBI in more detail.
Damage to the regions surrounding the injury site was immediate. Crucially, long-term damage was observed in distant regions in the brain and was attributed to chronic neuroinflammation.
In a mouse model of Alzheimer's disease, long-term effects were also observed after TBI in a study reported in Neuroscience Letters. Interestingly, there were no immediate differences in the brains of aged mice that had experienced TBI and those that had not.
Both injured and uninjured mice developed senile plaques, a hallmark of Alzheimer's disease, at the same rate for the first week of the study. However, at 28 days after the TBI, significantly more plaques were present in the mice. This was accompanied by impaired spatial learning.
The researchers interpreted this to mean that TBI accelerates Alzheimer's disease symptoms.
For patients who have experienced TBI, what do these data mean?
The need for long-term monitoring
While it is possible to study the cellular events that follow TBI in model systems, it is more difficult to confidently apply these results to human patients.
Many studies point to long-term effects of TBI on the brains of animals and humans, but the extent of the damage and the precise implications remain unclear.
Regardless of their results, what most studies agree on is the need for long-term monitoring for TBI patients, especially those who have experienced moderate to severe TBI. There is also a call for more accurate diagnostic criteria that would allow physicians to spot the onset of TBI-associated neurodegeneration earlier.
This would enable physicians to closely monitor patients and start treatments or interventions early on, with the aim of slowing the progression of cognitive decline.
It is clear that more studies are needed, specifically those that investigate cause and effect and that can link the results to large-scale, accurate population data.
It is also important to remember that not all of those who have sustained TBI will definitely go on to develop progressive neurodegeneration.
In the Finnish study, 1.6 percent of those with a history of mild TBI went on to develop dementia. Even though those with moderate to severe TBI were 90 percent more likely to receive a dementia diagnosis, this still only equates to a rate of 3.5 percent.
While there is strong evidence to suggest a risk of long-term damage to the brain after sustaining TBI, questions remain on why some patients go on to develop progressive neurodegeneration and how many are likely to be affected.
Alzheimer's / Dementia
Neurology / Neuroscience Parkinson's Disease Seniors / Aging
Vets' Brain Injuries Linked To Long Term Health Problems A report by a non-profit US medical organization suggests that military personnel who suffer severe or moderate traumatic brain injury (TBI) are at greater risk of long term health problems... Read now
Single Brain Trauma May Direct Lead To Alzheimer's Disease Over Time Over 1.7 million Americans suffer a traumatic brain injury each year, and beyond the immediate effects, growing evidence demonstrates that a single traumatic brain injury, or TBI, may initiate... Read now
How Does Radiation Affect Pediatric Cancer Patients Long-Term? A recent study published in the journal Pediatric Blood & Cancer has outlined the late effects radiation may have on pediatric cancer patients. Read now
Innovative 'brain prosthesis' could help with memory loss The symptoms of dementia, including memory loss, are incurable. But a new brain prosthesis implanted in the hippocampus is showing promise as a potential cure for memory loss. Read now
Traumatic brain injury in older adults linked to increased dementia risk Researchers suggest that moderate to severe traumatic brain injury (TBI) sustained at age 55 or over may increase dementia risk, as could mild TBI at age 65 or over. Read now
Tony July 14, 2017 6:36 am
....I am living with Younger Onset Dementia, T B I caused, most likely Alzheimers.....diagnosed 2007.....so at least in my case alone, there is a link.....severe car accident injuries to my head, sustained in 1990 being the most likely cause...
Spotlight on: Alzheimer's / Dementia
Alzheimer's disease: are we close to finding a cure?
There seems to be more focus than ever on Alzheimer's research. But how close are scientists to developing effective prevention and treatment strategies for the disease?
What Is Alzheimer's Disease?
Discussing Alzheimer's disease, a progressive neurologic disease of the brain. We take a look at the causes, symptoms, prevention and the latest research on treatments.
Taking a close look at dementia, a broad term for a progressive deterioration in cognitive function. We discuss the possible causes, symptoms and treatment options.
Hyposmia: Causes, treatment, and related conditions
Hyposmia is a term describing partial or complete loss of the sense of smell. Learn about the causes, how it is treated, and related conditions.
Ceylon cinnamon: Health benefits, uses, and more
Cinnamon is a widely-used spice in cooking, but Ceylon cinnamon may also help protect against diabetes, Alzheimer's disease, and other conditions.
Popular in: Alzheimer's / Dementia
What happens to the brain as we age?
How to keep your brain healthy as you age
Alzheimer's disease: Scientists close in on how it starts and how to stop it
How an eye test could detect Alzheimer's
Algorithm could predict Alzheimer's risk years before symptoms occur |
At MIT, Holdren Issues Call for Action on Climate Disruption
James F. Smith
John P. Holdren, President Obama's chief science and technology advisor, draws a grim picture of our world at the end of this century if we fail to start slashing greenhouse gas emissions that are ravaging the global climate: Summers will be dangerously hotter, slashing wheat crop yields in India by more than 60 percent and African corn crops by over 40 percent. And sea levels could rise as much as six feet by 2100, gobbling up chunks of coastal land.It's not just a worry for the distant future, Holdren said in a speech at MIT on October 25. The impact of climate disruption is already serious, causing floods, wildfires, and drought. The hottest 15 years on record have all occurred since 1990, with 2005 the warmest and 2009 second.Holdren is on leave from Harvard University, where he was director of the Science, Technology, and Public Policy program at Harvard Kennedy School's Belfer Center for Science and International Affairs. He is currently serving as assistant to the president for science and technology and director of the president's Office of Science and Technology Policy.In the 2010 David J. Rose Lecture at MIT's Wong Auditorium, Holdren issued a call to action, arguing for an integrated package of initiatives to protect the environment and achieve energy security. But he acknowledged that political obstacles are blocking agreement in Washington on how to move forward.Here are links to Holdren's detailed slide presentation, to see an excellent MIT news article, and to watch the video of Holdren's lecture.Holdren identified two central challenges: —Reducing dependence on oil for transportation, since more than three-fourths of carbon emissions come from burning fossil fuels, and vehicles produce about 40 percent of that carbon dioxide, (roughly equal to the emissions from coal-burning power plants). —Generating enough new sources of affordable clean energy to allow people around the world to achieve prosperity without worsening global warming by overdependence on fossil fuels.He offered sober statistics on current trends: For one, global oil consumption is forecast to surge from 82 million barrels per day in 2008 to 120 million barrels per day by 2030. At current rates of growth, total energy consumption will rise 60 percent and electricity use by 75 percent as soon as 2030.But he warned that mitigating climate change will need drastic changes — and that none alone will be sufficient. Rather, a coordinated set of measures will be needed to cut energy use in buildings, make cars more efficient, capture and store carbon from power plants, and build more nuclear power plants, wind turbines, and other alternatives to coal-fired plants.Holdren sketched an array of steps the Obama Administration is taking to push forward on these fronts, including major investments in research and development and $80 billion worth of clean-energy projects in the "stimulus" program.On nuclear power, he sketched the potential for a sharply increased role for nuclear plants but also assessed the risks in disposing of or storing spent fuel and protecting against proliferation.
Smith, James F.. “At MIT, Holdren Issues Call for Action on Climate Disruption.” News, Belfer Center for Science and International Affairs, Harvard Kennedy School, October 29, 2010. Share
The Author James F. Smith
Former Communications Director, Belfer Center for Science and International Affairs
Climate change policy
Climate agreements
Coal, Carbon Capture, & Storage
Energy Innovation policy
U.S. energy policy
Sustainability science
U.S. domestic politics |
Tag: Convocation
Author Andrew Solomon explores differences that unite us in convocation
Award-winning author, lecturer and activist Andrew Solomon presents “Far from the Tree: How Difference Unites Us” Thursday, Feb. 2 at 11:10 a.m. in the Lawrence Memorial Chapel as part of Lawrence University’s 2016-17 convocation series.
Solomon will conduct a question-and-answer session immediately following his address. The event, free and open to the public, also will be available via a live webcast.
The presentation is based on Solomon’s best-selling book “Far from the Tree: Parents, Children, and the Search for Identity,” which won the 2012 National Book Critics Circle Award for Nonfiction and the 2013 Anisfield-Wolf Prize for Nonfiction.
Based on interviews with more than 300 families and a decade of research, Solomon argues that individual human differences within families is a universal experience. He chronicles parents coping with children with a variety of challenges, from deafness, dwarfism and Down’s syndrome to schizophrenia, severe disabilities and autism, as well as children who are prodigies or transgender and the profound meaning they find in doing so.
His previous book, The Noonday Demon: An Atlas of Depression, won the 2001 National Book Award for Nonfiction and was a finalist for the 2002 Pulitzer Prize.
Splitting time between New York City and London, Solomon writes about politics, culture and psychology, covering topics as diverse as Libyan politics and deaf culture. He contributes to numerous publications, including Travel and Leisure, the New York Times and The New Yorker.
In addition to his writing, he holds appointments as professor of clinical psychology at Columbia University Medical Center and lecturer in psychiatry at Weill-Cornell Medical College in New York. In 2008, he was recognized with the Humanitarian Award of the Society of Biological Psychiatry for his contributions to the field of mental health.
Solomon earned a bachelor’s degree in English from Yale University, a master’s degree in English from Jesus College, Cambridge and a Ph.D. in psychology from Jesus College.
Founded in 1847, Lawrence University uniquely integrates a college of liberal arts and sciences with a nationally recognized conservatory of music, both devoted exclusively to undergraduate education. It was selected for inclusion in the book “Colleges That Change Lives: 40 Schools That Will Change the Way You Think About College.” Engaged learning, the development of multiple interests and community outreach are central to the Lawrence experience. Lawrence draws its 1,500 students from nearly every state and more than 50 countries.
Posted on January 30, 2017 April 11, 2017 Author Rick PetersonCategories Press ReleasesTags Andrew Solomon, Convocation, National Book Award, National Book Critics Circle Award, Pulitzer Prize
Lawrence University Convocation Features Cartoonist, Author Alison Bechdel
Award-winning cartoonist and author Alison Bechdel discusses her life and career in the Lawrence University convocation “Drawing Lessons: The Comics of Everyday Life” Tuesday, Oct. 15 at 11:10 a.m. in the Lawrence Memorial Chapel. She also will conduct a question-and-answer session at 2:30 p.m. in the Warch Campus Center cinema. Both events are free and open to the public.
Bechdel’s work includes the groundbreaking comic “Dykes to Watch Out For” and the graphic novel memoirs “Fun Home: A Family Tragicomic“(2006) and “Are You My Mother: A Comic Drama” (2012).
Featuring a cast of quirky fictional characters navigating life’s daily struggles, “Dykes to Watch Out For,” is drawn from Bechdel’s own experiences as a politically active lesbian. It has enjoyed nearly three decades of syndication in more than 50 alternative newspapers and magazines. Ms. Magazine deemed it “one of the preeminent oeuvres in the comics genre, period.”
Bechdel’s national profile rose with the release of “Fun Home,” a book-length autobiographical work in which she explores her relationship with her closeted, bisexual father and his apparent suicide. It became the first graphic novel named Time magazine’s Best Book of the Year. It also was a finalist for the National Book Critics Circle Award, won the 2007 Eisner Award for Best Reality-Based Work and has been a required text for students in Lawrence’s Freshman Studies course since 2011.
Her most recent work, “Are You My Mother,” complements “Fun Home,” with reflections on her fraught, complex relationship with her mother.
Beyond her self-syndicated comics and memoirs, Bechdel has drawn for Slate, McSweeney’s, The New York Times Book Review and U.K. literary magazine Granta. She was awarded a 2012-13 Guggenheim Fellowship for Creative Arts and edited “Best American Comics 2011.” Other honors include a seat on the Usage Panel of the American Heritage Dictionary in 2006, a fellowship at the University of Chicago and the Bill Whitehead Award for Lifetime Achievement, which honors LGBT writers.
Posted on October 11, 2013 Author Rick PetersonCategories Press ReleasesTags Alison Bechdel, Convocation, Lawrence University
Entrepreneur Larry Robertson Discusses Importance of “Thought to Action” in Lawrence Convocation
Award-winning author and recognized expert in entrepreneurship and creative thought Larry Robertson approaches Lawrence University’s 2012-13 convocation series theme “From Thought to Action” from an intriguing and unusual vantage point with his presentation “Butch, Sundance and Australia: Making the Leap From Thought to Action.”
The address, Thursday, Oct. 11 at 11:10 a.m. in the Lawrence Memorial Chapel, is free and open to the public.
Larry Robertson, founder and president, Lighthouse Consulting
For more than two decades, Robertson has resided in the world of entrepreneurs, serving as advisor, investor and roles in between. Drawing upon a background that includes positions with J.P. Morgan, the venture firm and investment bank Robertson, Stephens & Company and the Walt Disney Company, Robertson has establishing himself as a leading authority on entrepreneurship in public, private and academic forums.
In 1992, he founded Lighthouse Consulting, a firm that provides management guidance to new and innovative entrepreneurs as well as some of the best-known names in business and the nonprofit sector.
He earned multiple awards for his 2009 book “A Deliberate Pause: Entrepreneurship and its Moment in Human Progress” in which he argues the importance of being a watchful observer and attentive listener before taking action. From composer Igor Stravinsky to Nobel Peace Prize winner Muhammad Yunus, he cites numerous examples of agents of change who took time to think seriously about what they wanted to accomplish before deciding how to do so.
“We must not only change the way we do things,” writes Robertson, “we must learn how to change in better ways — to think as changemakers do, entrepreneurially, even if we let others lead.”
A resident of Arlington, Va., Robertson earned bachelor and master’s degrees at Stanford University and Northwestern University’s Kellogg School of Management, respectively. He serves as an adjunct professor of entrepreneurship at Georgetown’s McDonough School of Business.
Oklahoma State University’s School of Entrepreneurship honored Robertson with its 2011 Igniting the Flame Award, which recognizes the person who best moves the entrepreneurial community forward.
Lawrence began its own program in innovation and entrepreneurship in the fall of 2008 with the course “Pursuit of Innovation.” The program has since expanded to include other courses and course modules in economics, government, physics, studio art, the conservatory of music and theatre. The I & E program has directly benefited more than 250 students from a wide range of majors since it was launched.
Founded in 1847, Lawrence University uniquely integrates a college of liberal arts and sciences with a world-class conservatory of music, both devoted exclusively to undergraduate education. It was selected for inclusion in the Fiske Guide to Colleges 2013 and the book “Colleges That Change Lives: 40 Schools That Will Change the Way You Think About College.” Individualized learning, the development of multiple interests and community engagement are central to the Lawrence experience. Lawrence draws its 1,450 students from nearly every state and more than 50 countries. Follow Lawrence on Facebook.
Posted on October 4, 2012 October 4, 2012 Author Rick PetersonCategories Academics, Press ReleasesTags Convocation, innovation and entrepreneurship, Larry Robertson, Lawrence University
Lawrence Welcomes Author and Cultural Critic William Deresiewicz for University Convocation
Provocative essayist, cultural critic and author William Deresiewicz presents “Through the Vale of Soul-Making: The Journey of the Liberal Arts” Thursday, April 19 at 11:10 a.m. in a Lawrence University convocation. The presentation, in the Lawrence Memorial Chapel, will be followed by a question-and-answer session at 2:30 p.m. in the Warch Campus Center cinema. Both events are free and open to the public.
William Deresiewicz
Focusing on higher education, social media and other culture issues, Deresiewicz is a contributing writer for The Nation and a contributing editor for The New Republic. His weekly “All Points” blog on culture and society appears in The American Scholar.
A three-time National Magazine Award nominee (2008, ’09, ’11), his essays include “Generation Sell” (the business plan as art form of our age), “The Disadvantages of an Elite Education” (what the Ivy League won’t teach you) and “Faux Friendship” (about Facebook).
“Solitude and Leadership,” an essay that encourages the practice of introspection, concentration and nonconformity he delivered as an address to the plebe class at the U.S. Military Academy at West Point in 2009, has been used as a teaching tool across the U.S. military, the corporate world, schools of business and at the Aspen Institute.
Deresiewicz spent 10 years (1998-2008) as an English professor at Yale University before embarking on a full-time writing career. He chronicled the chronicled the transformative effect literature has had on his life in the 2011 novel “A Jane Austen Education: How Six Novels Taught Me About Love, Friendship, and the Things That Really Matter.”
Founded in 1847, Lawrence University uniquely integrates a college of liberal arts and sciences with a world-class conservatory of music, both devoted exclusively to undergraduate education. Ranked among America’s best colleges by Forbes, it was selected for inclusion in the book “Colleges That Change Lives: 40 Schools That Will Change the Way You Think About College.” Individualized learning, the development of multiple interests and community engagement are central to the Lawrence experience. Lawrence draws its 1,445 students from 44 states and 35 countries. Follow us on Facebook.
Posted on April 17, 2012 August 6, 2012 Author Rick PetersonCategories Academics, Press ReleasesTags Convocation, Lawrence University, William Dereisewicz
Noted Primatologist Frans de Waal Examines Primate-Human Connections in Lawrence University Convocation
One of the world’s pre-eminent primatologists discusses his ground-breaking discoveries on the connections between primate and human behavior, from aggression to morality and culture, in a Lawrence University convocation.
Primatologist Frans de Waal
Frans de Waal, C. H. Candler Professor in the psychology department at Emory University, presents “Morality Before Religion: Empathy, Fairness and Prosocial Primates,” Thursday, Feb. 2 at 11:10 a.m. in the Lawrence Memorial Chapel. de Waal also will conduct a question-and-answer session at 1:30 p.m. in the Warch Campus Center cinema. Both events are free and open to the public.
Born in the Netherlands, de Waal began observing primate behavior at the Arnhem Zoo while a student at the University of Utrecht. His observations of a colony of 25 chimpanzees over a six-year period provided the basis for his 2005 book “Our Inner Ape.”
de Waal, who directs the Living Links Center at the Yerkes National Primate Research Center in Atlanta, the oldest and largest primate research institute in the nation, is credited with introducing the term “Machiavellian” to the vocabulary of primatologists. In his first book, “Chimpanzee Politics,” he compared the schmoozing and scheming of chimpanzees involved in power struggles with that of human politicians. In 1994, then-Speaker of the House Newt Gingrich put “Chimpanzee Politics” on the recommended reading list for all freshmen Congressmen.
His research led to the discovery of reconciliation among primates and the founding of the field of animal conflict resolution. In 2007, Time Magazine named him one of the “100 World’s Most Influential People Today.”
de Waal came to the United States in 1981 and spent the first 10 years of his American career with the Wisconsin National Primate Research Center in Madison. He is the author of 13 books on primate behavior, among them 2009’s “The Age of Empathy: Nature’s Lessons for a Kinder Society,” “Primates and Philosophers: How Morality Evolved,” “Peacemaking Among Primates” and 1998’s “Bonobo: The Forgotten Ape,” the first book to combine and compare data from captivity and the field.
His research has earned him election to both the National Academy of Sciences and the Royal Dutch Academy of Sciences.
Posted on January 30, 2012 August 6, 2012 Author Rick PetersonCategories Academics, Press ReleasesTags " "Our Inner Ape, " Living Links Center, "Chimpanzee Politics, Appleton, Convocation, Frans de Waal, Lawrence University, primate behavior, Wisconsin
Author Alex Ross Talks Music at Lawrence University
Author and journalist Alex Ross, music critic for The New Yorker, spoke at Lawrence University Thursday, Nov. 3 about the continuities among various genres of music. He sat for a brief interview prior to his convocation.
Posted on November 3, 2011 November 3, 2011 Author Rick PetersonCategories Press ReleasesTags Alex Ross, Convocation, Lawrence University
Lawrence Welcomes Music Critic Alex Ross for University Convocation
Erudite author and music critic Alex Ross explores the historical connection shared by an evolving string of musicians — from 16th-century Spaniards to J.S. Bach to Led Zeppelin bassist John Paul Jones — in a Lawrence University convocation.
Ross presents “The Lamento Connection: Bass Lines of Music History,” Thursday, Nov. 3 at 11:10 a.m. in the Lawrence Memorial Chapel. He also will conduct a question-and-answer session from 2:30-3:30 p.m. in the Warch Campus Center cinema. Both events are free and open to the public.
A Harvard University graduate, Ross began his career in the early 1990s writing music critiques for The New York Times. Since 1996, he has covered everything from the New York Metropolitan Opera to Radiohead as music critic of The New Yorker.
His first book, 2007’s “The Rest is Noise: Listening to the Twentieth Century,” chronicled the historical, biographical and social context of music from 1900-2000. Among the observations he detailed are the porous borders shared by popular and modern classical music. “The Rest is Noise” earned a National Book Critics Circle award and was named finalist for the Pulitzer Prize.
In 2010 he released a second book, “Listen to This,” a collection of revised essays from his New Yorker magazine columns. Ross was recognized with a $500,000 MacArthur Foundation “genius” Fellowship in 2008.
Posted on November 1, 2011 Author Rick PetersonCategories Press ReleasesTags Appleton, Convocation, Lawrence University, Wisconsin
Writer Rebecca Solnit Discusses “Hope, Disaster and Utopia” in Lawrence University Convocation
In collaboration with Green Roots’ Earth Week celebration, award-winning author and cultural historian Rebecca Solnit presents “Swimming Upstream in History: Hope, Disaster, Utopia” April 20 at 11:10 a.m. as part of Lawrence University’s 2009-10 convocation series.
Solnit’s address in the Lawrence Memorial Chapel, 520 E. College Ave., will be followed by a question-and-answer session at 2 p.m. in the Warch Campus Center cinema. Both events are free and open to the public.
Rebecca Solnit
An activist for ecological and human rights issues, Solnit is the author of 12 books, among them “Hope in the Dark: Untold Histories, Wild Possibilities,” “Wanderlust: A History of Walking” and 2004’s “River of Shadows: Eadweard Muybridge and the Technological Wild West,” a historical tour de force that has been hailed as one of the best books of the past decade.
In her most recent book, 2009’s “A Paradise Built in Hell: The Extraordinary Communities that Arise in Disaster,” Solnit offers an investigation of human emotion in the face of catastrophe. She explore the common citizen responses of empathy, spontaneous altruism and mutual aid, which turn out to be more typical than the conventional perception of violence and selfishness, in the face of such disasters as the 1906 San Francisco earthquake, the 9/11 terrorist attacks and Hurricane Katrina.
A contributing editor at Orion Magazine, the San Francisco-based Solnit has been recognized with two National Book Critics Circle Awards and the Lannan Literary Award for Nonfiction. She has been awarded grants from the Guggenheim Foundation and the National Endowment for the Arts.
Solnit serves as contributing editor to Harper’s magazine and writes for the “London Review of Books” and the political website Tomdispatch.com.
Posted on April 16, 2010 August 21, 2014 Author Rick PetersonCategories Press ReleasesTags Appleton, Convocation, Earth Day, Green Roots, human rights, Lawrence University, Rebecca Solnit, Wisconsin
Abigail Disney Receiving Honorary Degree, Delivers Convocation “Peace is Loud”
Award-winning film producer, activist and humanitarian Abigail Disney will be recognized Thursday, January 28 by Lawrence University with an honorary doctor of humane letters degree.
As part of the degree-granting ceremony in the Lawrence Memorial Chapel, Disney will deliver the convocation “Peace is Loud,” an address based on her award-winning 2008 documentary “Pray the Devil Back to Hell,” which examines Liberia’s civil war.
A screening of “Pray the Devil Back to Hell” will be held in the Warch Campus Center cinema at 1 p.m., followed by a question-and-answer session with Disney at 2 p.m. All events are free and open to the public.
Disney’s film chronicles the inspirational story of the courageous women of Liberia, whose efforts played a critical role in bringing an end to a long and bloody civil war and eventually led to the 2005 election of Ellen Johnson-Sirleaf as Liberia’s president, Africa’s first democratically elected female head of state.
Disney served as the producer of “Pray the Devil Back to Hell,” which has earned critical praise and collected more than 15 awards, including the Best Documentary Award at New York City’s Tribeca Film Festival, the Cowboy Award Winner – Audience Choice Award at the Jackson Hole Film Festival, the Social Justice Award for Documentary Film at the Santa Barbara Film Festival and the Golden Butterfly Award at the Movies that Matter Festival.
She founded and serves as president of the New York City-based Daphne Foundation, which supports grassroots and emerging organizations that deal with the causes and consequences of poverty, focusing on the creation and implementation of long-term solutions to intractable social problems.
The grandniece of Walt Disney, founder of the Disney media and entertainment empire, she also has played a leadership role in a number of other social and political organizations, among them the New York Women’s Foundation, from which she recently retired as chair, the Roy Disney Family Foundation, the White House Project, the Global Fund for Women, the Fund for the City of New York and the Ms. Foundation for Women.
Disney earned a bachelor’s degree from Yale University, a master’s degree from Stanford University, and her Ph.D. from Columbia University.
Posted on January 25, 2010 June 25, 2010 Author Rick PetersonCategories Press ReleasesTags Abigail Disney, Appleton, Convocation, Honorary Degree, Lawrence University, Pray the Devil Back to Hell, Wisconsin
Lawrence University Recognizing Film Producer, Philanthropist Abigail Disney with Honorary Degree
Award-winning film producer, activist, and philanthropist Abigail Disney will be recognized Thursday, January 28, 2010 by Lawrence University with an honorary doctor of humane letters degree.
As part of the degree-granting ceremony in the Lawrence Memorial Chapel, Disney will deliver the convocation “Peace is Loud,” an address based on her award-winning 2008 documentary film “Pray the Devil Back to Hell.”
“Lawrence University is proud to be welcoming a woman of Abigail Disney’s passion, abilities and stature to campus and presenting her with an honorary degree,” said Lawrence President Jill Beck. “As we prepare our students for lives of achievement and meaningful citizenship, Ms. Disney epitomizes the ideals to which we hope they will aspire.”
In conjunction with Disney’s address, multiple showings of the documentary “Pray the Devil Back to Hell” will be held in the Warch Campus Center cinema in January: 1/7, 12 noon; 1/12, 7 p.m.; 1/20, 8 p.m., 1/28, 1 p.m. A special panel of Lawrence faculty and students will discuss issues raised in the film following the 8 p.m. screening on Jan. 20. All events are free and open to the public.
“I am so thrilled and honored to have been chosen for this honorary degree,” said Disney. “It was a bolt from the blue and a shot in the arm, to mix a couple of metaphors and I am so happy that it came from a wonderful and vibrant institution like Lawrence.”
Disney’s film chronicles the inspirational story of the courageous women of Liberia, whose efforts played a critical role in bringing an end to a long and bloody civil war and restored peace to their shattered country.
She served as the producer of “Pray the Devil Back to Hell,” which earned critical praise and collected more than 15 awards, including the Best Documentary Award at New York City’s Tribeca Film Festival, the Cowboy Award Winner – Audience Choice Award at the Jackson Hole Film Festival, the Social Justice Award for Documentary Film at the Santa Barbara Film Festival and the Golden Butterfly Award at the Movies that Matter Festival.
Disney founded and serves as president of the New York City-based Daphne Foundation, which supports grassroots and emerging organizations that deal with the causes and consequences of poverty, focusing on the creation and implementation of long-term solutions to intractable social problems.
She also has played a leadership role in a number of other social and political organizations, among them the New York Women’s Foundation, from which she recently retired as chair, the Roy Disney Family Foundation, the White House Project, the Global Fund for Women, the Fund for the City of New York and the Ms. Foundation for Women. In 1998, when the foundation’s namesake publication, Ms. Magazine, faced financial hardship, Disney joined with magazine founder Gloria Steinem and a group of other investors to form Liberty Media for Women, which secured the magazine’s future.
The grandniece of Walt Disney, founder of the Disney media and entertainment empire, she is the vice chair of the board of Shamrock Holdings Incorporated, a professional investment company that manages more than $1.5 billion in assets.
Posted on December 2, 2009 June 28, 2010 Author Rick PetersonCategories Press ReleasesTags Abigail Disney, Appleton, Convocation, Honorary Degree, Lawrence University, Wisconsin |
Vascular effects of exercise training in CKD : current evidence and pathophysiological mechanisms
Van Craenenbroeck, Amaryllis H.
van Craenenbroeck, Emeline M.
Kouidi, Evangelia
Vrints, Christiaan J.
Couttenye, Marie M.
Conraads, Viviane M.
Cardiovascular disease remains the main cause of morbidity and mortality in patients with CKD, an observation that cannot be explained by the coexistence of traditional risk factors alone. Recently, other mechanisms, such as alterations in nitric oxide bioavailability, impaired endothelial repair mechanisms, inflammation, and oxidative stress (all characteristic in CKD), have gained much attention as mediators for the increased cardiovascular risk. Regular physical training is a valuable nonpharmacological intervention for primary and secondary prevention of cardiovascular disease. Likewise, the benefits of exercise training on exercise capacity and quality of life are increasingly recognized in patients with CKD. Furthermore, exercise training could also influence potential reversible mechanisms involved in atherosclerosis and arteriosclerosis. After discussing briefly the general concepts of vascular disease in CKD, this review provides an overview of the current evidence for the effects of exercise training at both clinical and preclinical levels. It concludes with some practical considerations on exercise training in this specific patient group.
Clinical journal of the American Society of Nephrology. - Baltimore, Md
Baltimore, Md : 2014
9:7(2014), p. 1305-1318
http://dx.doi.org/doi:10.2215/CJN.13031213
Translational Pathophysiological Research (TPR)
Laboratory Experimental Medicine and Pediatrics (LEMP)
Centre for Research and Innovation in Care (CRIC)
[E?say:metaLocaldata.cgzprojectinf] |
Prostate Issues in Non-Neutered Male Dogs
by Dondi Ratliff
A veterinarian's physical examination can determine a male dog's prostate health.
Dean Golja/Digital Vision/Getty Images
The two major reasons for neutering a nonbreeding dog have been for better behavior and health. As one of the species to have a prostate, an intact male dog shows a higher risk for prostate problems the older he gets. In many cases, a dog will show signs of these problems on average by the age of 8: benign prostatic hyperplasia or BPH, bacterial prostatis, paraprostatic cysts and prostatic neoplasia -- also known as cancer.
Benign Prostatic Hyperplasia and Prostatic Cysts
BPH results from the natural aging process of a dog's working prostate. Neutered males lose most function of the prostate after surgery. If older dogs show signs of bloody urethral discharge, tenesmus, or bloody or painful ejaculate -- for breeders -- even infrequently, these could be signs of BPH. Further, because of the risk of glandular hypertrophy associated with this problem, prostatic cysts may develop. The most effective treatment is neutering the dog, although some medicinal choices do exist.
Bacterial Prostatis and Abscesses
Bacterial prostatis results from an infection of the prostate gland. Though occurring at any age, this illness is mostly seen in older dogs with BPH. It is more severe than BPH despite having similar symptoms, which also are more severe. It can cause ascending infections throughout the dog's body; therefore, fever, pelvic discomfort, and partial anorexia are additional signs. If left untreated, prostatic abscesses may develop. The abscesses can be life-threatening due to the risk of septicemia, endotoxemia and localized peritonitis. These abscesses constitute an emergency and have a high mortality rate when ignored. Neutering is the advisable solution.
Paraprostatic Cysts
These cysts, unlike those found with BPH, are not "true" prostatic cysts. They are found around or attached to the outside of the prostate gland, while BPH-related cysts are found within it. In a radiograph, paraprostatic cysts can appear as large as a second bladder in the dog. Though they typically remain benign, the cysts should be removed before they grow large enough to interfere with the urinary tract or cause infection. Once infected, these cysts most often result in prostatic abscesses.
Prostatic Neoplasia
Almost all prostate problems are heralded by the dog having trouble defecating since the prostate is so close to the rectum. Neoplasia is no exception. Prostatic disease does not mean a dog will get cancer. Only 5 to 7 percent of dogs with prostate troubles get neoplasia; however, neoplasia is the most lethal due to the diagnosis coming too late to stop metastatis. Most dogs with neoplasia will have prostatic adenocarcinoma, which infects both intact and castrated dogs. Other dogs may get transitional cell carcinoma -- which recent studies claim may be caused by neutering -- leiomyosarcoma, and hemangiosarcoma. Dogs suffering from neoplasia will show signs of other prostate diseases, but also may have abdominal or lumbar pain, rear limb weakness, weight loss and more. Adenocarcinoma often has a survival rate of one to two months post-diagnosis.
Atlantic Coast Veterinary Conference 2001: Diagnosis and Medical Management of Canine Prostatic Disease; Melissa S. Wallace, DVM, Dipl. ACVIM
Professor's House: Prostate Cancer in Dogs
National Center for Biotechnology Information: A Population Study of Neutering Status as a Risk Factor for Canine Prostate Cancer; Jeffrey N. Bryan, et al
Dondi Ratliff is a certified secondary English teacher in Texas. Her articles typically cover topics regarding animals both wild and domesticated. Ratliff holds a Bachelor of Arts in English from Tarleton State University, a Master of Arts in teaching from Texas Woman's University, and a Master of Arts in English from Tarleton State University.
Can Diapers Prevent Male Dogs From Mating?
Calicivirus In Dogs
At What Age Do You Castrate a Male Dog?
The Effects of Rat Poison on Dogs & Cats 1
The Effects of Rimadyl in Canines 2
The Effects of a Dangerously High Fever in Dogs 3
Embryonic Development in a Canine 4
Effects of Glyphosate on Dogs 5
The Effects of Juvenile Renal Dysplasia in Dogs 6
What Are the Effects After a Dog Has a Heat Stroke? 7
The Effects of Thyrosyn Medicine in Dogs 8
Effects of Moving on Dogs 9
The Effects of Dog Whistles 10
Can a Male Dog Become Aroused After He Has Been Neutered?
Canine Dog Behavior Problems
Health Problems Caused by Coprophagia in Dogs
My Dog Is Having Problems Adjusting to a New Environment
Does Having a Dog Spayed Disqualify Her in Shows?
Dog Behavioral Problems: Licking |
Hydrotropic fractionation of birch wood into cellulose and lignin: A new step towards green biorefinery
Gabov, K., Fardim, P., and da Silva Júnior, F. G. (2013). "Hydrotropic fractionation of birch wood into cellulose and lignin: A new step towards green biorefinery," BioRes. 8(3), 3518-3531.
Hydrotropic treatment is an attractive process that uses water-soluble and environmentally friendly chemicals. Currently, this method is practically unexploited on a large scale due to the long treatment times required. In this study, the hydrotropic process was modified by the addition of hydrogen peroxide, formic acid, or both. The modified treatments were more selective than the reference, and the pulps obtained using the modified treatments had lower lignin contents. After bleaching, the resultant pulps were comparable to dissolving pulps with respect to the content of hemicelluloses and viscosity. Cellulose solutions were successfully obtained in a 7% NaOH/12% urea aqueous solvent after pretreating the bleached pulp with a HCl/EtOH mixture. Hydrotropic lignin was recovered from the spent solution by precipitation in water. The lignin had very low contents of carbohydrates and sulphur. The preliminary results show that a hydrotropic process can be used for such biorefinery applications as fractionation of fibres, cellulose polymer, and lignin from birch wood. The green cellulose and lignin biopolymers can potentially be used for shaping biomaterials or production of bio-based chemicals. |
Prevnar 13(TM) is based on the scientific foundation of Prevnar(R) (Pneumococcal 7-valent Conjugate Vaccine [Diphtheria CRM197 Protein]), the standard in pneumococcal disease prevention for infants and young children. It contains the seven serotypes in Prevnar (4, 6B, 9V, 14, 18C, 19F and 23F), plus six additional serotypes (1, 3, 5, 6A, 7F and 19A) responsible for the greatest remaining burden of invasive disease. Prevnar has been available in the U.S. for more than nine years. It is currently available in 95 countries and more than 235 million doses have been distributed worldwide.
The Prevnar 13 submission is based on a clinical trial program of 13 core Phase 3 studies involving more than 7,000 infants and young children. To date, the company has submitted regulatory applications for Prevnar 13 in more than 50 countries spanning six continents, with filings in additional countries planned. In July, Prevenar 13*, as it is known outside the U.S., was approved in Chile for use in infants and young children. About Pneumococcal Disease Pneumococcal disease is complex and describes a group of illnesses all caused by the bacterium Streptococcus pneumoniae. Pneumococcal disease is the leading cause of vaccine-preventable death worldwide in children younger than 5 years of age and is estimated to cause up to one million deaths worldwide in children each year.
Pneumococcal disease affects both children and adults, and includes invasive infections such as bacteremia/sepsis and meningitis, as well as pneumonia and otitis media. Important Safety Information for Prevnar 13* In clinical studies, the most commonly reported adverse events in children were injection site reactions, fever, irritability, decreased appetite, and increased and/or decreased sleep. Risks are associated with all vaccines, including Prevnar 13. Hypersensitivity to any vaccine component, including diphtheria toxoid, is a contraindication to its use. As with any vaccine, Prevnar 13 may not provide 100% protection against vaccine serotypes or protect against nonvaccine serotypes.
Indication for Prevnar((R))
Prevnar(R) is indicated for active immunization of infants and toddlers against serious invasive disease caused by Streptococcus pneumoniae, including bacteremia (bloodstream infection) and meningitis (infection of the membranes surrounding the brain and spinal cord) caused by the seven serotypes in the vaccine. The seven serotypes (strains) of S. pneumoniae included in the vaccine (4, 6B, 9V, 14, 18C, 19F, and 23F) are the strains that most commonly cause these serious diseases in children. The routine schedule is 2, 4, 6, and 12 to 15 months of age.
Prevnar(R) is also indicated for immunization of infants and toddlers against otitis media (ear infections) caused by the seven serotypes in the vaccine. Protection against ear infections is expected to be less than that for invasive disease. As with any vaccine, Prevnar(R) may not protect all individuals receiving the vaccine from serious invasive disease caused by S. pneumoniae. This vaccine should not be used for treatment of active infection.
Important Safety Information for Prevnar((R))
Ask your child's health care provider about the risks and benefits of Prevnar(R) and if Prevnar(R) is right for your child.
In clinical studies, the most frequently reported adverse events included injection site reactions, fever (greater than or equal to 38 degrees C/100.4 degrees F), irritability, drowsiness, restless sleep, decreased appetite, vomiting, diarrhea, and rash. Risks are associated with all vaccines, including Prevnar(R). Hypersensitivity to any vaccine component, including diphtheria toxoid, is a contraindication to its use. Prevnar(R) does not protect 100% of children vaccinated. Immunization with Prevnar(R) does not substitute for routine diphtheria immunization.
About Wyeth Pharmaceuticals Wyeth Pharmaceuticals, a division of Wyeth, has leading products in the areas of women's health care, infectious disease, gastrointestinal health, central nervous system, inflammation, transplantation, hemophilia, oncology, vaccines and nutritional products.
Wyeth is one of the world's largest research-driven pharmaceutical and health care products companies. It is a leader in the discovery, development, manufacturing and marketing of pharmaceuticals, vaccines, biotechnology products, nutritionals and non-prescription medicines that improve the quality of life for people worldwide. The Company's major divisions include Wyeth Pharmaceuticals, Wyeth Consumer Healthcare and Fort Dodge Animal Health.
The statements in this press release that are not historical facts are forward-looking statements that are subject to risks and uncertainties that could cause actual results to differ materially from those expressed or implied by such statements. In particular, clinical trial data are subject to differing interpretations, and the views of regulatory agencies, medical and scientific experts and others may differ from ours. There can be no assurance that Prevnar 13 will receive regulatory approval in the United States or in other markets or will be commercially successful. Other risks and uncertainties that could cause actual results to differ materially from those expressed or implied by forward-looking statements include, among others, risks related to our proposed merger with Pfizer, including satisfaction of the conditions of the proposed merger on the proposed timeframe or at all, contractual restrictions on the conduct of our business included in the merger agreement, and the potential for loss of key personnel, disruption in key business activities or any impact on our relationships with third parties as a result of the announcement of the proposed merger; the inherent uncertainty of the timing and success of, and expense associated with, research, development, regulatory approval and commercialization of our products and pipeline products; government cost-containment initiatives; restrictions on third-party payments for our products; substantial competition in our industry, including from branded and generic products; emerging data on our products and pipeline products; the importance of strong performance from our principal products and our anticipated new product introductions; the highly regulated nature of our business; product liability, intellectual property and other litigation risks and environmental liabilities; the outcome of government investigations; uncertainty regarding our intellectual property rights and those of others; difficulties associated with, and regulatory compliance with respect to, manufacturing of our products; risks associated with our strategic relationships; global economic conditions; interest and currency exchange rate fluctuations and volatility in the credit and financial markets; changes in generally accepted accounting principles; trade buying patterns; the impact of legislation and regulatory compliance; risks and uncertainties associated with global operations and sales; and other risks and uncertainties, including those detailed from time to time in our periodic reports filed with the Securities and Exchange Commission, including our current reports on Form 8-K, quarterly reports on Form 10-Q and annual report on Form 10-K, particularly the discussion under the caption "Item 1A, Risk Factors" in our Annual Report on Form 10-K for the year ended December 31, 2008, which was filed with the Securities and Exchange Commission on February 27, 2009. The forward-looking statements in this press release are qualified by these risk factors. We assume no obligation to publicly update any forward-looking statements, whether as a result of new information, future developments or otherwise.
*Trademark
'/>"/>SOURCE Wyeth PharmaceuticalsCopyright©2009 PR Newswire.All rights reserved0GOODRelated biology technology :1. Wyeth Announces Stockholder Approval of Pfizer Merger at 2009 Annual Meeting2. Trubion Pharmaceuticals Announces Extension of Research Period Under Its Wyeth Collaboration3. Wyeth Announces Holder Right to Surrender Convertible Debentures4. Wyeth Declares Common Stock Dividend5. New Phase 3 Data Continue to Indicate that Wyeths Investigational 13-valent Vaccine Has the Potential to Broaden Coverage Against Pneumococcal Disease6. Wyeth Sets Webcast and Conference Call For 2009 Second Quarter Earnings7. Wyeth Announces Full Redemption of $2 Convertible Preferred Stock8. Wyeth Declares Common and Preferred Stock Dividends9. Wyeth Sets Webcast and Conference Call for 2009 First Quarter Earnings10. Wyeth to Present at the SG Cowen & Co. 29th Annual Healthcare Conference11. Wyeth to Present at the Goldman Sachs Healthcare CEOs Unscripted Conference
Post Your Comments: *Name:*Comment: *Email: (Date:6/27/2017)... ... June 27, 2017 , ... According ... activated carbon (PAC)-based materials do not have negative short- or long-term effects on ... contaminated with polychlorinated biphenyls (PCBs) located at the Puget Sound Naval Shipyard & ... (Date:6/26/2017)... (PRWEB) , ... June 26, 2017 , ... The ... use of health IT to create efficiencies in healthcare information exchange and a statutory ... W. Rucker, MD, head of the federal Office of the National Coordinator for Health ... (Date:6/23/2017)... WI (PRWEB) , ... June ... ... announce the launch of a redesigned, easier-to-navigate website for all six of ... boards for physicians, nurses, dentists, pharmacists, physical and occupational therapists, and biotechnicians, ... (Date:6/22/2017)... ... June 22, 2017 , ... ... specialists DST Diagnostische Systeme & Technologien GmbH, thereby expanding its product portfolio to ... from hay fever, urticaria, asthma, atopic eczema or a food allergy. Allergies are ... Breaking Biology Technology:[0] Study of In-Situ Treatment Using Powder Activated Carbon Demonstrates Minimal Short- and Long-Term Effects on Benthic Communities[0] ONC Head Donald Rucker to Headline WEDI Forum Addressing Critical Healthcare Challenges[0] The #1 Online Healthcare Job Boards Announce New Site Launch[0] AESKU.GROUP Acquires DST Diagnostische Systeme & Technologien GmbH(Date:4/5/2017)... 2017 Today HYPR Corp. , leading ... component of the HYPR platform is officially FIDO® ... security architecture that empowers biometric authentication across Fortune 500 ... secured over 15 million users across the financial services ... home product suites and physical access represent a growing ... (Date:4/4/2017)... NEW YORK , April 4, 2017 ... solutions, today announced that the United States Patent and ... The patent broadly covers the linking of an iris ... the same transaction) and represents the company,s 45 th ... our latest patent is very timely given the multi-modal ... (Date:3/30/2017)... ANGELES , March 30, 2017 On April ... Hack the Genome hackathon at Microsoft,s ... exciting two-day competition will focus on developing health and ... Hack the Genome is the ... been tremendous. The world,s largest companies in the genomics, ... Breaking Biology News(10 mins):[0] HYPR IoT Authentication Platform Achieves FIDO Alliance Certification[1] EyeLock Receives Patent for Sequentially Linking Iris Matching With Facial Imaging[4] Sequencing.com to Host the World's First Hack the Genome HackathonBiology NavigationAIDS/HIVBioinformaticsBiotechnologyBiochemistryCancerCell BiologyDevelopmental BiologyEcologyEnvironmentEvolutionFood TechnologyGeneGeneticsGenomicsHealth/MedicineImmunologyMicroarrayMicrobiologyMolecularMarine BiologyNanobiotechnologyNeurobiologyPlant SciencesStem CellSystems BiologyVirusWomen HealthMedical NavigationAbortionAchesADHDAddictionAlcoholAllergyAlternative MedicineAlzheimer's DementiaAnxiety/StressArthritisAutismBacteriaBloodBird Flu/Avian FluBonesBreast CancerCancerCardiovascularCervical CancerChikungunyaCholesterolClinical TrialsColorectal CancerConferencesCrohn'sCystic FibrosisDengueDentistryDepressionDiabetesDrugEating DisordersEducationEpilepsyErectile DysfunctionEye Health/BlindnessFertilityFlu/ColdGastroIntestinalGeneticsGoutHeadache/MigraineHearing/DeafnessHIV/AIDSHuntington's DiseaseHypertensionImmune System/VaccinesInsuranceInfectious DiseasesIrritable-Bowel SyndromeInternetLeukemiaLifestyleLiver Disease/HepatitisLung CancerLupusMad Cow DiseaseMedical DevicesMedical Students/TrainingMedicare/MedicaidMedicoMen's healthMental HealthMRI/UltrasoundMRSA/Drug ResistanceMultiple SclerosisMuscular DystrophyNeurologyNursingNutrition/DietObesity/Weight LossPain/AnestheticsParkinson's DiseasePediatrics/Children's HealthPharma/Biotech IndustryPharmacy/PharmacistsPregnancyPrematureProstatePsychology/PsychiatryRehabilitationRespiratory/AsthmaSARSSchizophreniaSeniors/AgingSexual HealthSleep/Sleep DisordersSmokingStatinsStem Cell ResearchStrokeSurgeryTransplants/Organ DonationsVirusesWater - Air QualityWomen's HealthCopyright © 2003-2012 Bio-Medicine. All rights reserved.ABOUT | CONTACT US | DISCLAIMER | PRIVACY POLICY | TERMS AND CONDITIONS |
Graham Priest
Logic: A Very Short Introduction
A Very Short Introduction
Logic is often perceived as having little to do with the rest of philosophy, and even less to do with real life. In this lively and accessible introduction, Graham Priest shows how wrong this conception is. He explores the philosophical roots of the subject, explaining how modern formal logic deals with issues ranging from the existence of God and the reality of time to paradoxes of probability and decision theory. Along the way, the basics of formal logic areexplained in simple, non-technical terms, showing that logic is a powerful and exciting part of modern philosophy.ABOUT THE SERIES: The Very Short Introductions series from Oxford University Press contains hundreds of titles in almost every subject area. These pocket-sized books are the perfect way to get ahead in a new subject quickly. Our expert authors combine facts, analysis, perspective, new ideas, and enthusiasm to make interesting and challenging topics highly readable.
Graham Priest is Professor of Philosophy at the University of Queensland. He has also held positions at the University of St Andrews and the University of Western Australia. He is the author of In Contradiction, Beyond the Limits of Thought, and over 100 articles in philosophy books and journals. He has held visiting positions in universities in Australia, the United Kingdom, the United States, Russia, and Brazil, and is a Fellow of the Australian Academy of Humanities.
"This book is terrific... It covers a lot of ground, but in a wonderfully relaxed and interesting way."-Simon Blackburn, University of Cambridge and author of Think"This text is ideal for giving students a quick introduction to formal logic or for adding pizzazz to an otherwise dry logic course."--Glenn Ross, Franklin & Marshall College
Knowledge: A Very Short Introduction
Jennifer Nagel
What Does it All Mean?
Climate: A Very Short Introduction
Mark A. Maslin |
So, friend or foe? ID management and access control
by Charles Hayhoe
Whether it's Basel II, Sarbanes-Oxley, or the FSA's updated Combined Code, many organizations are struggling to meet current compliance requirements. But it seems the burden is only set to get worse.
Implementation of the new capital rules is not due until 2007, although Basel II requires that compliant systems are in use well before then. This means companies have to act now to introduce and integrate the technology required to meet regulatory requirements.
Reducing and managing operational risk is a common theme running through the new regulations. It forms a core element of the evaluation method set out in the Basel Capital Accord for calculating minimum capital adequacy requirements. Most of the operational risks defined by the accord relate to "access to computer data by physical persons," or in other words, identity management and access control.
In the information economy, IT security is paramount, not only to protect against external threats, but also to prevent the internal misuse of systems and data. Financial services firms need to be able to provide an audit trail of who accessed what information and for what purpose, for example, which requires granular control of user access based on identity management. Poor access management can open the door to operational risk that can directly translate into major financial losses.
As well as minimizing risks, identity management and access control technology can also streamline the deployment of procedures critical in a banking environment, such as "de-provisioning" and role-based management.
Of the seven types of operational risk defined by the Basel Capital Accord, ID management and access control have a critical role in addressing three of them.
Understand the risks
Operational risks related to users are primarily linked to the reliance on passwords as the main method of access control. For example, if a resource can only be accessed by a password, the user will tend not to refer to that resource.
Another problem is that if employees are required to use and remember a large number of passwords, then they will tend to note them down on paper or in another non-secure format. This can facilitate internal fraud.
Often, teams are given a single password, potentially giving individual employees over-generous access rights and enabling them to access data not normally associated with their role. This also raises issues of non-repudiation.
Sometimes a single password is allocated for all the resources an employee can access. In this scenario, a hacker need only break the security on a single system to gain access to all other systems and data.
Another major area of operational risk is administration of access rights. Ever-changing IT environments, promotions, internal moves, staff re-assignments and employee churn make keeping a tight control on access rights a complex job. This creates the potential for operational risks. Access rights allocation is often delegated to systems engineers, who see this as a secondary task. Changes or updates are therefore often delayed or are prone to errors.
Access rights of leavers are often not comprehensively revoked – companies often fail to keep a complete inventory of authorizations granted. Leavers can often still gain access to systems even though they are no longer employed.
Passwords are often forgotten, resulting in calls to the helpdesk. The volume of password-related calls in large companies means a large number of helpdesk agents are given administrative rights to change or re-set passwords, providing a route for internal fraud.
Using a "provisioning" solution with identity management will significantly reduce the risks outlined above. Allocation (and cancellation) of access rights is easily done from a central console. This allocation of rights is done on the basis of organizational criteria, by trustworthy persons – with no technical know-how required. All these administrative operations must of course be logged so that they can be audited.
Centralized identity management and access control significantly simplifies the work of the operational risk management team and can be used to complement intrusion detection systems (IDSs), which, in isolation, provide insufficient coverage of all IT risks.
A large percentage of operational incidents involve access gained using stolen or incorrectly-used passwords and will therefore not necessarily be prevented by an IDS. An ID-management and access-control solution will enable the source of the access and the conditions in which access rights were wrongly granted to be quickly identified and remedied. Operational incidents are often directly attributable to staff and take place internally. As a result, there is no external access attempt to be blocked or denied.
An IDS will centralize alert data, but not the means of remedying these alerts. After detecting an operational incident, network appliances (such as firewalls and routers) have to be reconfigured using their own associated administration tools. An identity-management and access-control solution, on the other hand, allows the immediate correction of the source of the incident from one central console, whatever the platform (mainframe, website and so on).
ID-management and access-control solutions deliver a range of benefits. These include an immediate reduction in operational risks (and, potentially, insurance costs) with a corresponding reduction in operational incidents (and consequent financial loss and penalties).
Another benefit is auditable information on access rights and authorized or unauthorized system/data access that can be integrated with existing reporting tools to give a clearer picture of operational risk. You will also have more granular, centralized control enabling faster reaction to access risks as they are detected.
Identity-management and access- control solutions also deliver significant productivity gains. For example, users save time by only needing a single password, and no longer have to wait days for new access rights as systems administration is streamlined. Helpdesk costs are slashed. And administrators can set up new accounts or change or cancel access rights more quickly.
It is clear that identity management and a centralized approach to rights management are key to reducing operational risk.
But with the unreliability of passwords, how can a financial organization be sure that an employee is who they say they are? For a company to be completely accountable, and trace fraud and other internal security breaches, it needs to be certain who is doing what within its IT system.
Charles Hayhoe is a senior executive with NEC business solutions division
Access management: Open the door and let me in ...
BY Peter Stephenson Sep 1, 2010
The advent of Access Management 2.0
Legislation: Friend or foe?
Friend or foe? Show your ID, please! |
Notes from the Undergrad: An undergraduate’s introduction to Anne Sexton
By Jane Robbins Mize Jane Robbins Mize is a senior in English and Liberal Arts Honors and is a current intern in the Ransom Center’s public affairs department. She recently worked in the Anne Sexton papers for her English class “Women’s Autobiographical Writings.”
After several undergraduate poetry courses, I had heard Anne Sexton’s name countless times. I’d read samples of her work in course packets and anthologies, and I knew she was a “confessional” poet and a contemporary of Sylvia Plath. But, I had never read a complete collection of her poems (I could not even name the title of one), and I was even less familiar with her family and career.
So when given the opportunity, I signed up to give an oral presentation on Anne Sexton’s life and work in my English class, “Women’s Autobiographical Writings.” In a preliminary conference with Professor Carol MacKay, she described to me the Ransom Center’s collection of Sexton’s manuscripts and suggested that I explore the archive myself before presenting. I unhesitatingly agreed and soon found myself in the Reading Room holding the manuscript of Sexton’s best-known collection, Live or Die.
Sexton began writing poetry as therapy for her post-partum depression in 1956, the year following the birth of her second daughter. Soon after, she began working with poets such as W. D. Snodgrass and Robert Lowell and developed a close friendship with Maxine Kumin. She published her first collection, To Bedlam and Partway Back, in 1960. Just six years later, Sexton released her most celebrated work, Live or Die, for which she was awarded the Pulitzer Prize in 1967.
The manuscript of Live or Die is, in a word, raw. Through it, I was able to experience Sexton’s work in an unembellished state. That is to say, my reading of the poems was not influenced by the presentation of the collection. I encountered no introduction or blurbs, biography, or portrait. Instead, I found only the table of contents, dedication, and poems themselves—in addition to frequent penciled corrections. In this way, the manuscript introduced me to Sexton’s work through the content and nature of her poems rather than the reputation that precedes them.
My relationship with Sexton slipped quickly from vague acquaintance to deep familiarity as I scanned her correspondences and sifted through her notes, photographs, and even the digitized pages of the scrapbooks and journals of her youth. Through the archive, I was able to develop a more complete portrait of Sexton than that which could be presented in a written biography. I was collecting the details and, through them, gaining a deeper understanding of the woman’s life, character, and creative process.
It is exceedingly rare to meet a writer and explore her work through her private, personal, and unpublished papers. At the Ransom Center, however, hundreds of authors and artists are waiting to be introduced. I look forward to many more first encounters.
Jane Robbins Mize works with materials in the Anne Sexton collection. Photo by Pete Smith.Undated snapshot of Anne Sexton. Unidentified photographer.
No CommentsJane Robbins MizeMay 16, 2014Manuscripts, Research, UndergraduatePermalink
A Graduation Diploma: “The Eviction Notice Written in Latin”
By Jean Cannon This week, The University of Texas at Austin prepares its podiums and fireworks for Saturday’s commencement ceremony, the 131st in the school’s history. Countless graduating seniors can be seen in front of Littlefield Fountain, posing for photographs beneath the Tower, wearing gowns and mortarboards and smiles. Some smiles are of elation, others, somewhat apprehensive: as anyone who has graduated from college will probably agree, the event creates conflicting emotions—happiness at having achieved a milestone and uncertainty about what the future may hold. Commencement is a bittersweet time for the staff at the Ransom Center, as we send former undergraduate interns Alyssa O’Connell, Alyse Camus, Alexandra Bass, Elizabeth Barnes, Patrick Naeve, Emily Neie, and Kelsey McKinney out into the world to seek their—no doubt impressive—fortunes. Our interns have been valued colleagues and friends, and we will miss their energy, intelligence, and good company.
The navigation of this crossroads of school’s ending and adulthood’s beginning has resulted in a genre of address practiced each spring in colleges across the country: the commencement speech. In honor of our graduating seniors, we’ve investigated the myriad drafts of commencement speeches held in the manuscript collections at the Ransom Center, searching for advice that might help as the new alumni move forward to jobs, graduate schools, new cities, and unknown adventures.
Throughout the past few decades, writers and thinkers as disparate as Norman Mailer, William Faulkner, Diane Johnson, Lillian Hellman, Nancy Wilson Ross, David Foster Wallace, Elizabeth Hardwick, and Spalding Gray have advised graduates entering post-university life using a wide range of strategies, from the sprawling anecdote to the political call to action to the spiritual meditation. Some, like David Foster Wallace in his acclaimed 2005 speech at Kenyon College, have used humor (the diploma? “An eviction notice written in Latin”) to mesmerize the audience before presenting graduates with the difficult challenge of maintaining a heightened awareness of the choices they make each day, each hour.
Playwright Terrence McNally, speaking to a group of graduating artists at Julliard, encouraged a policy of absolute honesty with one’s self: to create beauty and meaning according to one’s own standards, not the standards of the outlying world.
While scribbled notes reveal the difficulties writers faced in settling on the right topic for a graduation speech (“The one thing you do not do at a graduation is talk about depressing matters,” wrote Norman Mailer), many of the manuscript collections reveal writers’ deep misgivings about being qualified with enough wisdom to address a graduating audience at all, or feeling overwhelmed by the importance of the task. Spalding Gray, for example, known for the self-effacing humor that made his autobiographical performances and writings so popular, assured graduating seniors in his hometown of Providence, Rhode Island, that, “My heroes are still the ones that do their best in the face of not knowing.” His speech emphasizes modesty and reverence for a large, mysterious world. Alongside this speech is a one-page document titled “The Graduation Speech I Never Made,” in which Gray questions his ability to recognize the importance of his diploma (he couldn’t remember where it was) or of a commencement ceremony (admitting he skipped his own). Accepting his spurious relationship to official commencement traditions, he encourages students thusly: “Feel free to make up a life. If you don’t like the one you have, make up another. This could be a very creative outlet.”
In a 1976 address to Mount Holyoke graduates, dramatist Lillian Hellman encouraged students to advocate free speech, individual liberties, and public service: “The highest compliment I can pay you, or any group that calls itself educated, is that you believe it is your duty to make reforms in this great country.” Hellman had famously been blacklisted by the House of Un-American Activities in the early 1950s.
Speaking to the all-female class at Bennett Women’s College in 1957, novelist Nancy Wilson Ross discussed the freedoms already achieved by women—the freedoms to vote, to receive higher education, to pursue careers, and to divorce—and encouraged the graduates to think deeply about the spiritual satisfaction that these freedoms bring. “Serenity comes from inside; it is not something you can lay on from the outside or acquire with objects and possessions and in a world like the present we are going to have to get it, if we get it at all, by interior disciplines.”
We wish to assure graduates that the Ransom Center archives bear witness to the fact that the individual road to “the eviction notice written in Latin” is not always easy. Often alongside drafts of commencement speeches, usually delivered late in a writer’s career, are papers that document a writer’s own struggles in college: citations for drinking, notices of academic probation, and letters home threatening to drop out of school. In the interest of discretion, we will restrain from naming names, but rest assured that even literary luminaries had their share of troubling transcripts, embarrassing yearbook photos, and take-home essays abysmally flunked. And the failures and successes that followed the diplomas? Too numerous too count. The individual roads to the podiums were certainly paved with highs and lows—and, perhaps most importantly, perseverance. We send the class of 2014 best wishes for the education that begins once commencement ends.
Please click on thumbnails below to view larger images.
David Foster Wallace’s commencement address “This is Water,” delivered to Kenyon College graduates in 2005, is cited by numerous magazines and websites as the one of the most affecting graduation speeches ever delivered. With his trademark combination of wit and sagacity, Wallace assured graduates that they had benefitted from their humanities educations by refining their cognition: “‘Learning how to think’ really means learning how to exercise some control over how and what you think. It means being conscious and aware enough to choose what you pay attention to and to choose how you construct meaning from experience. Because if you cannot exercise this kind of choice in adult life, you will be totally hosed.”Spalding Gray advised graduates to embrace the wonder of the unknown. Gray related that when his young son Forrest asked him for a scary story, Gray responded “‘Oh my dear one. . .look around you. This is the scary story.’” But Gray also noted that “what I don’t add to it and should is that it is also the story about wonder and boredom and self pity, dreck, transcendence, and love.”Spalding Gray’s “The Graduation Speech I Never Made” reads like a warm-up exercise created by an anxious speechwriter. Its concluding sentences, which include strikeouts and misspelled words, read: “I’m sorry to say I have no advice to give. How could I deign [sic] to give advice when my life is held together like an ill-made birds nest, and I am still surprised as well as shocked by each new dawn?” In 1983 author Diane Johnson encouraged graduating students at the University of California, Berkeley to head into post-graduate life with a dedication to continuing personal achievement: “When you leave college the life-long task of self-improvement becomes your social duty, and, incidentally, your surest chance of happiness.”Playwright Terrence McNally’s address to the graduating performance artists of Julliard on May 22, 1998, emphasized the vital role of arts in contemporary culture. McNally urged the graduates to go forward confident of society’s need for their talents: “The world needs you. Maybe they don’t know it but they do. I just hope you know how badly you’re needed. . . .The world is waiting for you and what you have to give them is yourself.”
No CommentsJean CannonMay 16, 2014Manuscripts, UndergraduatePermalink
University of Texas at Austin partners with online learning initiative
By Abigail Cain Ransom Center Senior Research Curator of Photography Roy Flukinger and University of Texas at Austin Professor of Philosophy Daniel Bonevac will be teaching an online course this fall on “Ideas of the Twentieth Century.”
When University of Texas at Austin Professor of Philosophy Daniel Bonevac and Ransom Center Senior Research Curator of Photography Roy Flukinger taught the course “Ideas of the Twentieth Century” last fall, they had 100 students.
This fall, they will teach over 20,000.
“Ideas of the Twentieth Century” is one of the courses offered by The University of Texas at Austin as part of the UT System’s partnership with edX, a nonprofit online learning initiative. Launched by Harvard University and the Massachusetts Institute of Technology in 2012, edX collaborates with universities across the country to offer massive open online courses (MOOCs). MOOCs boast unlimited enrollment and are free for all participants.
Of the classes submitted by The University of Texas at Austin for the upcoming school year, four are currently open for registration and will begin September 15. Besides “Ideas of the Twentieth Century,” those interested can also take “Energy 101,” “Age of Globalization,” and “Take Your Medicine: The Impact of Drug Development.”
Bonevac and Flukinger’s course explores the changing mindsets and morals of the past century through the lenses of philosophy, literature, art, and history. Although they have taught this course five times before as one of the University’s Signature Courses for incoming freshmen, the class had to be adapted for an online audience.
“Our time is much more limited in teaching the online course, so each session had to be reduced down to the more basic concepts, trends, and ideas,” Flukinger said. “And, obviously, the other fact that you miss immediately is the interchange of ideas and discussion with your students. The production studio tends to be a much more detached environment than the customary give-and-take of the classroom. But such are always the tradeoffs with any mass media. And, at the same time, I do find it very invigorating to attempt to expand our teaching to a much larger and more diverse global community.”
No CommentsAbigail CainSeptember 5, 2013News, Public Programs, UndergraduatePermalink
Seminar exposes students to the Ransom Center’s photography holdings
By Ady Wetegrove Dr. Sherre L. Paris—lecturer at The University of Texas School of Journalism—teaches her undergraduate class “A Cultural History of Photography” at the Ransom Center. During the three-hour-long-seminar, which meets every Tuesday in a classroom adjacent to the Ransom Center’s Reading Room, undergraduates work with primary source materials from the Center’s photography collections. “Cultural Compass” spoke with Dr. Paris about her experience teaching at the Ransom Center. No CommentsAdy WetegroveMarch 28, 2013Photography, Research, UndergraduatePermalink
Ransom Center to offer summer undergraduate internships
By Jennifer Tisdale Former undergraduate intern Rachel Platis worked on selecting photographs for an exhibition. Photo by Pete Smith.
The Harry Ransom Center will support six undergraduate internships during the summer of 2013, four from The University of Texas at Austin and two from another accredited college or university.
The 14-hour-per-week positions will provide undergraduates with a hands-on and behind-the-scenes look at the operation of a humanities research center. Selected interns will choose from a variety of opportunities within the Center, including working with archives, exhibitions, marketing, public affairs, and curatorial departments of art, film, manuscripts, performing arts, photography, and rare books.
Learn more about the internships and application process. March 15 is the deadline to apply.
The internships will begin on June 10 and end August 16, 2013.
The Creekmore and Adele Fath Charitable Foundation has provided generous funding for these internships.
No CommentsJennifer TisdaleJanuary 24, 2013News, UndergraduatePermalink
Notes from the Undergrad: The Penguin Illustrated Collapse
By Alyssa O'connell Alyssa O’Connell is an English Honors junior in Professor Janine Barchas’s seminar, “The Paperback,” in which students used the Ransom Center’s collections to research the history of paperbacks.
Among today’s reading public, the ubiquitous Penguin Books are nearly synonymous with the notion of mass-market paperbacks. The publishing house’s continual commercial triumphs since Allen Lane founded it in 1935 have provided inexpensive literary texts for readers of all ages. Despite its successes, however, Penguin has also faced failure, and one such misstep occurred only three years after the company’s inception.
On May 18, 1938, Allen Lane introduced a new paperback series, the Penguin Illustrated Classics. Ten out-of-copyright novels, short stories, and poetry collections were released simultaneously and sold at the low cost of six pence each, which is the equivalent of around $1 to $2 in modern currency. The titles were Pride and Prejudice by Jane Austen, A Sentimental Journey by Laurence Sterne, Some Tales of Mystery and Imagination by Edgar Allan Poe, Walden by Henry David Thoreau, Selected Poems by Robert Browning, Robinson Crusoe by Daniel Defoe (in two volumes), Typee by Herman Melville, The Story of My Heart by Richard Jefferies, and Gulliver’s Travels by Jonathan Swift. Every book featured at least 12 woodcut illustrations by reputable wood-engravers of the twentieth century.
Penguin’s inspiration for the books came in part from a fellow member of the Lane family. Allen Lane’s uncle, John Lane, was co-founder of The Bodley Head publishing house. From the company’s beginnings in 1887 and into the 1920s and 1930s, The Bodley Head published elite illustrated hardbacks in small quantities at high prices. Because there was a woodcut revival in the 1930s, the nephew believed it was the perfect market to present such illustrated texts with wood engravings in the new, accessible, and inexpensive paperback format. To highlight the artists, each front cover featured the illustrator’s name in slightly smaller print than the author’s name. Also, while the front flap of the dust jacket provided information about the author, the back flap offered a biography of the wood engraver. Penguin, therefore, endorsed the artists nearly as strongly as it promoted the writers.
Despite its hopes and efforts, Penguin soon found the Illustrated Classics struggling in bookstores. World War II was approaching, and the refined series alienated consumers who sought simplicity and current information. The journalistic Penguin Specials, a different Allen Lane product that offered plain aesthetics and up-to-date intelligence, became extremely popular while the experimental Penguin Illustrated Classics failed to rouse much interest. Furthermore, as illustrated texts, the poor quality Classics did not impress customers. The cheap, thin paper could not support the rather bold art of the wood engravers, thus undermining Penguin’s venture to merge sophistication with an economical product.
Ultimately, the Penguin Illustrated Classics failed to secure a niche in the market, belonging neither with the expensive hardbacks that had inspired them nor among the pre-war softcovers associated with their publisher. Penguin Books could not transform The Bodley Head’s concept into one of mass production, and the series soon vanished from British bookstores. Allen Lane, who remained with Penguin Books from 1935 until his death in 1970, encountered a disappointing initial failure that forced him to abandon his idea of uniting sophisticated hardback trends with affordable paperbacks.
Notes from the Undergrad: Student finds passage to past through diary is a journey full of surprises
Notes from the Undergrad: Signature Course delves into works, life of Russell Banks
Please click the thumbnails to view full-size images.
"The Pickwick Club" by Charles Dickens. 1842. In 1837, Christian Bernhard Tauchnitz (1816–1895) founded the Leipzig printing and publishing firm that became famous for its inexpensive, paperback English-language editions of British and American authors. The simple Tauchnitz cover became iconic in the publishing world; it was first used in the 1840s and remained virtually unchanged for nearly a century. This 1842 edition of "The Pickwick Club" was one of the first paperbacks published by Tauchnitz, and the first of a long run of Dickens novels that the company would distribute in continental Europe. More than 2,000 of the now-rare Tauchnitz editions, recognized for their influence in gaining attention for English-language authors in Europe, are located at the Ransom Center, as well as a substantial collection of papers (1931–1954) associated with Albatross Verlag, the publisher that later absorbed the Tauchnitz firm."Have Gat—Will Travel" by Richard S. Pranther. 1957. Throughout the late 1930s, Penguin Books and Pocket Books dominated the American paperback industry with their cheap reprints of books that had already appeared in hardcover. Fawcett Books, a smaller company that marketed primarily crime novels and westerns to a male audience, had difficulty paying copyright costs for existing titles. In the late 1940s, therefore, Fawcett introduced Gold Medal Books, a line of 25-cent paperback originals. Gold Medal Books was the first paperback imprint to use exclusively original material, and it launched the careers of multiple pulp writers—such as Richard S. Pranther and Kurt Vonnegut—who abandoned magazines to get advances from Fawcett. Gold Medal Books also became well known for their aggressive and sensational advertising campaigns, as you can gather from the moxie-filled copy on the back cover of this 1957 edition of "Have Gat—Will Travel." The Ransom Center’s Ellery Queen book collection houses a large number of Gold Medal Books published by Fawcett in the 1940s and 1950s."The Intelligent Woman’s Guide to Socialism, Capitalism, Sovietism & Fascism" by George Bernard Shaw. 1937. In 1937, Allen Lane expanded Penguin Books to include a “Pelican” imprint that specialized in non-fiction titles. George Bernard Shaw’s 1937 political tract "The Intelligent Woman’s Guide to Socialism, Capitalism, Sovietism & Fascism" was the first book published by Penguin under its Pelican imprint. For this edition Shaw wrote a new introduction on the subjects of bolshevism and fascism. His introduction became the first original writing published by Penguin and thus a forerunner of the “paperback original” that came to dominate the paperback book trade in later years."What Hitler Wants" by E. O. Lorimer. 1939. Following the success of his fiction paperbacks in the mid-1930s, Allen Lane turned his attention toward global affairs as Britain entered World War II. As this title reveals, Penguin played a role in politics as well as in literature and design, and its left-leaning stance figured into Britain’s war and postwar efforts. After the Labour Party came to office in 1945, the new Prime Minister Clement Attlee declared that the accessibility of left-leaning reading during the war helped his party succeed: “After the WEA [Workers’ Educational Association] it was Lane and his Penguins which did most to get us into office at the end of the war.”"Oliver Twist" by Charles Dickens. 1943. This edition of "Oliver Twist" is part of the Ransom Center’s Armed Services Editions collection, which houses more than 1,000 paperback editions printed for soldiers during World War II. The U.S. Army began publishing Armed Services Editions in 1943, hoping the portable volumes would entertain soldiers between duties. By the time the army stopped publishing the editions four years later, they had distributed more than 123 million copies of 1,300 titles to soldiers on active duty on the battlefields in Europe and the Far East. The subjects of the Armed Services Editions ranged from mystery and adventure tales to the classics. The paperbacks were generally produced in a horizontal format with a picture of the original hardback’s dust jacket."Lady Chatterley’s Lover" by D. H. Lawrence. 1960. Perhaps the most controversial paperback ever published by Penguin Books was the unexpurgated version of "Lady Chatterley’s Lover" in 1960. Allen Lane and his company were tried by the government under the British Obscene Publications Act of 1959, and were forced to prove the “literary merit” of a book that featured frank sexual content and a copious amount of expletives. Lane and Penguin won the highly publicized trial, and the following year Lane dedicated a second paperback edition of the novel to the jurors who decided the case in his favor. The D. H. Lawrence collection at the Ransom Center contains correspondence related to the obscenity trial centered on "Lady Chatterley’s Lover," as well as four drafts of the novel itself."Malaeska, the Indian Wife of the White Hunter" by Mrs. Ann Stephens. 1860. In American publishing, one of the most important forerunners of pulp paperback fiction was the dime novel of the late-nineteenth century. "Malaeska, the Indian Wife of the White Hunter" is generally considered the first dime novel: it is the first in a series published by the company Beadle and Adams, beginning in 1860. It sold 65,000 copies within three months of publication, setting off a craze for sensational and inexpensive fiction. The Ransom Center houses more than 850 dime novels published by the firm Beadle & Adams in its dime novel collection. The collection includes dime novels by Buffalo Bill Cody, who wrote for the series, as well as the mounted head of a buffalo shot by Cody. There are also dime novels found in the Ellery Queen book collection."What Maisie Knew" by Henry James. Book cover design by Edward Gorey. 1954. In 1953 Anchor Books, the paperback division of Doubleday, centered its efforts on marketing classic works of literature to libraries and students. The imprint was created by then-25-year-old Jason Epstein, who would go on to become editorial director of Random House for more than 40 years. Epstein introduced the trade paperback format (larger in size and higher in price than mass-market paperbacks) and hired the young artist Edward Gorey as his Art Editor. Gorey worked for Epstein from 1953 to 1960, and the artist’s distinct lettering and design layout helped make the Anchor Books series a wild success. Never abandoning his distinctive combination of the whimsical with the morbid, Gorey created covers for classic works by authors as disparate as Franz Kafka, Collette, James Conrad, and Stendhal. The Ransom Center holds numerous Anchor paperbacks featuring cover artwork by Gorey and material related to Gorey’s life and career in its Edward Gorey collection."Howl and Other Poems" by Allen Ginsberg. Published in 1956 by City Lights Pocket Bookshop, signed by Ginsberg and inscribed to Edith Sitwell. In 1955, writer Lawrence Ferlinghetti, owner of San Francisco’s City Lights Bookshop, launched the first American publishing company dedicated to editions of poetry printed in paperback. With its iconic cover and small size, City Lights Publishers’ Pocket Poetry Series became an enormous success and published such well-known poets as Denise Levertov, Gregory Corso, and Frank O’Hara. Ferlinghetti and City Lights are perhaps best known for their role in the widely publicized obscenity trial revolving around the publication of Allen Ginsberg’s "Howl and other Poems" in 1956. Drafts of the poems in this volume, as well as correspondence related to the trial, are housed in the Allen Ginsberg collection at the Ransom Center.Title page of "Malaeska, the Indian Wife of the White Hunter" by Mrs. Ann Stephens. 1860."The Case of the Velvet Claws" by Erle Stanley Gardner. 1948. Like many genre authors of his generation, mystery writer Erle Stanley Gardner got his start by publishing stories in pulp fiction magazines such as "Black Mask" and "Detective Fiction Weekly." These magazines were known for their low-quality paper, inexpensive prices, and escapist, sensational tales featuring tough-talking heroes, pretty girls, exotic settings, and mysterious villains. Eventually the pulp magazines of the 1920s and 1930s would be replaced by new media such as radio, TV, comics, and films—and, in particular, cheap paperbacks. Gardner was one of the first of the pulp writers to make the switch to paperbacks, a move that quickly increased his popularity and finances. Other writers that successfully transitioned from pulp magazines to paperbacks include Edgar Rice Burroughs, Ray Bradbury, H. P. Lovecraft, Raymond Chandler, and Dashiell Hammett. The Erle Stanley Gardner collection at the Ransom Center houses pulp magazines and novels that span the author’s nearly 50-year career as a crime and mystery writer."Le terze rime di Dante" by Dante Alighieri. Published in 1502 by Aldus Manutius of the Aldine Press. The sixteenth-century Italian printer and publisher Aldus Manutius is generally credited with first developing the publishing methods that would lead to the modern paperback. Many of his publications were issued in octavo format (the size of which roughly corresponds to modern trade and mass-market paperbacks) to produce small, easily portable editions of popular works. Manutius also standardized grammar, introducing the comma and semi-colon, and produced the first italic type. The Ransom Center’s Aldine Press collection houses more than 900 volumes of Aldine Press books published between 1494 and 1588. In 1501, Aldus began to use his signature printer's device, the Aldine anchor and dolphin. This type of branding would be one of the most distinctive marks of later paperback companies, such as Penguin and Pocket, who published centuries after Manutius."Walden" by Henry David Thoreau. 1938. Seeking a new, high-end market, Penguin experimented with a line of Illustrated Classics in 1937. For the first print run, Arthur Lane chose works (such as "Walden") that were out of copyright, so the money saved on royalties could be put toward commissioning artists. Lane hired Robert Gibbings, the owner of the Golden Cockerell Press from 1924 to 1933, to become Art Editor for Penguin Illustrated Classics in 1938. Gibbings was an expert on wood engravings and commissioned highly qualified artists to illustrate the novels. Under his direction, the Illustrated Classics books featured elaborately illustrated title pages, each with its own distinct penguin. The Ransom Center holds many of these early pictorial classics in its book collection, as well as material related to Gibbings and his illustrations in its Golden Cockerell Press collection."A Farewell to Arms" by Ernest Hemingway. 1935. This edition of "A Farewell to Arms" was part of the initial ten-book print run of Penguin’s launch in 1935. Other titles in the series included Agatha Christie’s "The Mysterious Affair at Styles" and Dorothy Sayers’s "The Unpleasantness at the Bellona Club." As you can see from this cover, Penguin paperbacks emphasized the company’s branding rather than the subject or author of the work; the original covers included the trademark drawing of the penguin but only rarely included illustrations pertaining to the book’s content. The covers were color-coded: orange for fiction, green for crime, and blue for non-fiction."Terrible Tales" by George Sala. 1873. The story collection "Terrible Tales" is an example of the “penny dreadful” that was enormously popular in Britain in the mid- to late-nineteenth century. Penny dreadfuls, as well as the melodramatic “yellowback” novels often sold in railway stations, were the forerunners of the pulp fiction paperbacks of the ensuing century. Penny dreadfuls were printed on cheap (pulp) paper and aimed toward working-class adolescent boys: most of the penny dreadfuls featured lurid stories of murderers or highwaymen such as Sweeney Todd or Dick Turpin. When they first appeared, these cheap periodicals cost a penny; in later years the prices fluctuated, but the name “penny dreadful” came to encompass all sensationalized publications aimed primarily at children and young adults. The Ransom Center holds numerous examples of nineteenth-century pulp fiction in its Robert Wolff collection of Victorian literature.Back cover of "Have Gat—Will Travel" by Richard S. Pranther. 1957.
3 CommentsAlyssa O'connellNovember 29, 2012Books, UndergraduatePermalink
English Honors seminar course on David Foster Wallace gives undergraduates a look into Wallace’s archive
By Emily Neie Graduate intern Jenn Shapland, center, shares annotated books from Wallace’s library and research materials he used while writing “Infinite Jest.” Photo by Pete Smith.
Before spring of last year, I had only heard David Foster Wallace referenced by acquaintances and a TV show character with an affinity for oversized novels. When I was applying for my undergraduate internship at the Ransom Center, I noticed that the Center had acquired Wallace’s archive and opened it for research. I knew that a course on Wallace was being offered by the University as an English Honors seminar during the fall semester, and the opportunity to combine my academic studies with my new internship seemed like a perfect way to enhance my first experience with Wallace’s work. What I believed to be a simple coincidence turned out to be an unforgettable journey down the rabbit hole that is the mind of David Foster Wallace.
My first experience with Wallace was his essay A Supposedly Fun Thing I’ll Never Do Again, and I immediately fell in love with his wit and intimate voice. I would need aforementioned love to lay the foundation for my relationship with Infinite Jest, which has been admittedly rocky, yet rewarding. My professor, Heather Houser, has done an excellent job planning our exposure to Wallace, introducing us to his style in shorter, more light-hearted bursts before throwing us headfirst into the waters of Infinite Jest. She also planned two class trips to the Ransom Center to view items pulled from Wallace’s archive so that we could read marginalia written in miniscule handwriting, correspondence with editors and fans, and annotations in books that he used for research. When I asked her why she thought it was so important to bring our class to see Wallace’s archive firsthand, she replied, “Wallace’s letters, manuscripts, and notes show him to be a painstaking writer and reader. Writing was a laborious, often distressing process for Wallace. Students see this in the sheaves of drafts and series of letters between Wallace and his editors and friends.”
There is something about looking at an author’s handwriting, and leafing through his personal library that grounds you. This was a person, with a life and loved ones: an actual person wrote these books I’m reading, you think, and that realization can be sudden and startling. I am not quite sure why it is easy to forget about the human element of literature, but my time with the Wallace archive helped me remember that I am studying a brilliant person’s imagination incarnate.
I agree with this statement from my classmate Aaron Levine: “We as a class are privileged… most people who read Infinite Jest do not get to read it in segments and then have hour-and-a-half conversations with a room full of inquisitive minds.” It has been an even greater privilege to be taught by a professor who understands the value of pushing the limits of undergraduate study, and to have access to the unique resources that the Ransom Center has to offer. The experiences I have had as an undergraduate scholar at the Ransom Center have enriched my adventures as an intern, as well as my future academic endeavors. In fact, I am planning to research the Ransom Center’s collections for my upcoming undergraduate English Honors thesis.
Students in the David Foster Wallace course view a cinema book that Wallace read while working on “Infinite Jest.” Photo by Pete Smith.
No CommentsEmily NeieNovember 20, 2012Manuscripts, UndergraduatePermalink
By Kelsey McKinney Each Friday, the Ransom Center shares photos from throughout the week that highlight a range of activities and collection holdings. We hope you enjoy these photos that reveal some of the everyday happenings at the Center.
Undergraduate intern Kelsey Handler unfolds a painting made by a Devil's Island prisoner from the René Belbenoit Collection. Photo by Kelsey McKinney.
Ransom Center members enjoy an exclusive tour of the current exhibition, Filmmaker and special effects pioneer Tom Smith discusses his work at the KLRU studios. Photo by Pete Smith.
No CommentsKelsey McKinneyApril 27, 2012Exhibitions, Film, Membership, Photo Friday, UndergraduatePermalink
Video: The Undergraduate Visitor at the Ransom Center
By Io Montecillo Each year, thousands of undergraduates come to the Harry Ransom Center to visit with a class, attend one the Center’s programs, or view an exhibition.
Since its founding, the Ransom Center has been an important resource for undergraduates at The University of Texas at Austin. Harry Ransom believed that meaningful undergraduate education was not complete without exposure to rare books and manuscripts.
The Ransom Center continues to maintain this vision to encourage undergraduate interaction with its collections and is launching a new resource that provides information about the many opportunities available to undergraduates.
Whether an entering freshman or a graduating senior, students can explore and be inspired by the offerings of the Ransom Center. Through exposure to and interaction with collection materials—whether it be a manuscript, photograph, artwork, or rare book—students can open the door to the creative process.
Undergraduate students tour the Ransom Center galleries. Photo by Pete Smith.
No CommentsIo MontecilloMarch 27, 2012Multimedia, Public Programs, Research, UndergraduatePermalink
The Door to Opportunity: Undergraduate Internships at the Ransom Center
By Kelsey McKinney Undergraduate intern Kelsey McKinney with the authors' door at the Ransom Center. Photo by Pete Smith.
[/caption]
Each academic year, the Ransom Center hosts undergraduate interns sponsored by various programs and departments at The University of Texas at Austin. For the 2012–2013 academic year, the Center is pleased to announce the addition of four Ransom Center–sponsored undergraduate intern positions. Students do not need to be affiliated with any particular program or department but must be full-time undergraduate students at The University of Texas at Austin. Application materials should be delivered to the Administrative Suite on the third floor of the Ransom Center by April 9, 2012. Below, current undergraduate intern Kelsey McKinney discusses her internship experience at the Ransom Center.
I fell in love with the Ransom Center at first sight. It was my freshman fall semester at The University of Texas at Austin, and my English class visited the Ransom Center to view Anne Sexton manuscripts in the reading room. In addition to the manuscripts, we saw Anne Sexton’s Royal Quiet De Luxe typewriter. That typewriter showed me that the Ransom Center is a diverse place with hidden gems to discover. As an undergraduate intern, that belief has only been confirmed.
I began working at the Ransom Center in August 2011. At the time, The Greenwich Village Bookshop Door: A Portal to Bohemia, 1920–1925 exhibition had recently opened, and I was offered the opportunity to work on a related project with the Ransom Center’s own authors’ door. The door, located deep within the fifth-floor stacks, began as a tribute to the Greenwich Village bookshop door. Since the 1970s, visiting artists and writers have been invited to sign the door. As of today, the door has 212 signatures. I began a project to document all of the signatures, many of which verged on being illegible. Having horrible handwriting myself, the match was ideal. I spent hours with the door, and it allowed me to interact with author archives and Ransom Center staff. The work was exciting and fulfilling. Each time I deciphered another signature was just as exciting as the first. Today, 206 of the 212 signatures are identified.
There are so many collections and so many incredible projects to take on that there is something for everyone here. More than any specific project I have worked on during my time as an intern, I value most the knowledge I have gained through interaction with Ransom Center staff and scholars. Each day here, I learn more. As an intern in the public affairs department, I have researched and written blog posts. For these, I have learned from the Ransom Center collections and holdings. That knowledge, though, is only the beginning. Ultimately, the benefit of working with intelligent, interesting, and passionate people is that they share those passions willingly. I have learned about the evolution to digital photography, how to conserve a decaying book, how exhibitions are formed, and how collections are organized. Every person at the Ransom Center is a person to learn from. The greatest testament to this, I believe, is how unmanageably tall my book stack has grown during my time here. The tasks and projects I have completed have improved my writing and research skills, but it is the level of intelligent, jovial, and interesting conversation that has taught me the most.
The University of Texas at Austin not only provides an excellent education for its undergraduate students, but also works to couple that education with compelling undergraduate experiences. Ideally, these experiences encompass the core values of the University: learning, freedom, discovery, leadership, individual opportunity, and responsibility. My time at the Ransom Center has developed within me every one of those values. I have learned more than I could ever describe, discovered dozens of new authors, encountered new ideas, and was granted the freedom to enjoy every step of the process. This undergraduate experience is one I would never trade.
1 CommentKelsey McKinneyMarch 22, 2012News, UndergraduatePermalink1 |
Insulin secretion disrupted by increased fatty acids
September 9, 2013 Patients with type 2 diabetes have increased levels of circulating glucose and fatty acids, which lead to disease complications. In healthy individuals, β cells within pancreatic islets release insulin in response to glucose and incretins, which are gastrointestinal hormones. Coordination between β cells is predicted to be important for insulin release.
In this issue of the Journal of Clinical Investigation, David Hodson and colleagues at Imperial College London demonstrate that ? cell-? cell interactions are important for insulin secretion in human islets and that these interactions are regulated by incretins. The authors found that increased fatty acid levels suppressed incretin-associated insulin release. These findings indicate that therapies aimed at maintaining ? cell connectivity may be useful for restoring glucose balance in type 2 diabetes.
Explore further: Absolute incretin effect reduced in type 2 diabetes
Lipotoxicity disrupts incretin-regulated human ? cell connectivity, J Clin Invest. DOI: 10.1172/JCI68459
Pancreatic ? cell dysfunction is pathognomonic of type 2 diabetes mellitus (T2DM) and is driven by environmental and genetic factors. ? cell responses to glucose and to incretins such as glucagon-like peptide-1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP) are altered in the disease state. While rodent ? cells act as a coordinated syncytium to drive insulin release, this property is unexplored in human islets. In situ imaging approaches were therefore used to monitor in real time the islet dynamics underlying hormone release. We found that GLP-1 and GIP recruit a highly coordinated subnetwork of ? cells that are targeted by lipotoxicity to suppress insulin secretion. Donor BMI was negatively correlated with subpopulation responses to GLP-1, suggesting that this action of incretin contributes to functional ? cell mass in vivo. Conversely, exposure of mice to a high-fat diet unveiled a role for incretin in maintaining coordinated islet activity, supporting the existence of species-specific strategies to maintain normoglycemia. These findings demonstrate that ? cell connectedness is an inherent property of human islets that is likely to influence incretin-potentiated insulin secretion and may be perturbed by diabetogenic insults to disrupt glucose homeostasis in humans.
Journal reference: Journal of Clinical Investigation
Absolute incretin effect reduced in type 2 diabetes
(HealthDay) -- For patients with type 2 diabetes mellitus (T2DM) the absolute incretin effect is reduced compared with healthy individuals, but its relative importance is increased, particularly in first-phase insulin secretion, ...
New mechanism regulating insulin secretion may explain genetic susceptibility to diabetes
New Zealand research revealing a new mechanism for how glucose stimulates insulin secretion may provide a new explanation for how a gene that makes people more susceptible to diabetes – called TCF7L2 – actually contributes ...
Fractalkine: New protein target for controlling diabetes
Researchers at the University of California, San Diego School of Medicine have identified a previously unknown biological mechanism involved in the regulation of pancreatic islet beta cells, whose role is to produce and release ...
Botox proteins could hold cure for diabetes
Scientists believe the proteins that are targeted by cosmetic surgery treatment Botox could hold the secret to treating and even curing Type 2 diabetes.
Cell study offers more diabetic patients chance of transplant
Diabetic patients could benefit from a breakthrough that enables scientists to take cells from the pancreas and change their function to produce insulin.
No rebirth for insulin secreting pancreatic beta cells
Pancreatic beta cells store and release insulin, the hormone responsible for stimulating cells to convert glucose to energy. The number of beta cells in the pancreas increases in response to greater demand for insulin or ... |
More than half of all cancer is preventable, experts say
More than half of all cancer is preventable, and society has the knowledge to act on this information today, according to health researchers. Investigators now outline obstacles they say stand in the way of making a huge dent in the cancer burden in the United States and around the world.
More than half of all cancer is preventable, and society has the knowledge to act on this information today, according to health researchers.
Credit: iStockphoto
More than half of all cancer is preventable, and society has the knowledge to act on this information today, according to Washington University public health researchers at the Siteman Cancer Center in St. Louis.
In a review article published in Science Translational Medicine March 28, the investigators outline obstacles they say stand in the way of making a huge dent in the cancer burden in the United States and around the world.
"We actually have an enormous amount of data about the causes and preventability of cancer," says epidemiologist Graham A. Colditz, MD, DrPH, the Niess-Gain Professor at the School of Medicine and associate director of prevention and control at the Siteman Cancer Center. "It's time we made an investment in implementing what we know."
What we know, according to Colditz and his co-authors, is that lifestyle choices people make and that society can influence in a number of ways -- from tobacco use to diet and exercise -- play a significant role in causing cancer. Specifically, the researchers cite data demonstrating that smoking alone is responsible for a third of all cancer cases in the United States. Excess body weight and obesity account for another 20 percent.
But beyond individual habits, they argue that the structure of society itself -- from medical research funding to building design and food subsidies -- influences the extent of the cancer burden and can be changed to reduce it.
The obstacles they see to implementing broad cancer prevention strategies are:
Skepticism that cancer can be prevented. Smoking rates in different states demonstrate that 75 percent of lung cancer in the United States could be prevented with elimination of cigarette smoking.
The short-term focus of cancer research. Benefits of prevention may be underestimated because they take decades to show up, and research funding often spans five years or less.
Intervening too late in life to prevent cancer. Strategies like vaccination against cancer-causing viruses, such as the human papilloma virus that causes cervical cancer, work best when begun early, in this case before young people begin sexual activity.
Research focuses on treatment, not prevention. Treatments focus only on a single organ after diagnosis but behavioral changes reduce cancer and death rates from many chronic diseases.
Debate among scientists. They say health experts have a moral responsibility to highlight cancer risk factors even without knowing the biological mechanism by which they cause cancer.
Societal factors that affect health. Tobacco policy and government subsidies don't do enough to discourage unhealthy behavior, and in some cases they make the unhealthy options more accessible, especially in low-income communities.
Lack of collaboration across disciplines. Scientists and health experts must work together to learn what causes cancer, communicate that to the public and work with community leaders to implement policies that help people lead healthier lives, they say.
The complexity of implementing broad changes. With so many players involved, from health-care providers to government regulators to individuals, it will be difficult to implement broad change over the long term.
According to the American Cancer Society, an estimated 1,638,910 new cancer cases will be diagnosed this year in the United States. Also this year, 577,190 Americans are expected to die of cancer. Only heart disease kills more people in this country. And Colditz's research has shown that these cancer prevention strategies would reduce the burden of heart disease and other chronic conditions as well.
Despite the obstacles, Colditz and his colleagues point to some successes that they say demonstrate that broad change is possible. One example is the relatively quick elimination of unhealthy trans fats from the national diet. And the National Cancer Institute (NCI) has reported that lung cancer rates are declining in both men and women, supporting the benefits of tighter tobacco control policy.
"After working in public health for 25 years, I've learned that if we want to change health, we need to change policy," says co-author Sarah J. Gehlert, PhD, the E. Desmond Lee Professor of Racial and Ethnic Diversity at the Brown School of Social Work and the School of Medicine. "Stricter tobacco policy is a good example. But we can't make policy change on our own. We can tell the story, but it requires a critical mass of people to talk more forcefully about the need for change."
The above post is reprinted from materials provided by Washington University in St. Louis. The original item was written by Julia Evangelou Strait. Note: Materials may be edited for content and length.
G. A. Colditz, K. Y. Wolin, S. Gehlert. Applying What We Know to Accelerate Cancer Prevention. Science Translational Medicine, 2012; 4 (127): 127rv4 DOI: 10.1126/scitranslmed.3003218
Washington University in St. Louis. "More than half of all cancer is preventable, experts say." ScienceDaily. ScienceDaily, 28 March 2012. <www.sciencedaily.com/releases/2012/03/120328154433.htm>.
Washington University in St. Louis. (2012, March 28). More than half of all cancer is preventable, experts say. ScienceDaily. Retrieved September 1, 2015 from www.sciencedaily.com/releases/2012/03/120328154433.htm
Washington University in St. Louis. "More than half of all cancer is preventable, experts say." ScienceDaily. www.sciencedaily.com/releases/2012/03/120328154433.htm (accessed September 1, 2015).
Economic Burden of Cancer Extends Into Survivorship
May 13, 2015 The economic burden of cancer extends beyond diagnosis and treatment, and concludes that cancer survivors face thousands of dollars of excess medical expenses every year, a new study concludes. ... read more Health Insurance Coverage Among Cancer Patients Varies Greatly by Demographics and Cancer Type
Apr. 27, 2015 Among patients with cancer, rates of health insurance coverage vary by patient demographics and by cancer type, a new analysis has found. The researchers found that younger, non-white, unmarried ... read more Physicians Play Critical Role in Ensuring Bladder Cancer Patients Understand Link Between Smoking, Their Disease
Nov. 10, 2014 When bladder cancer patients are well-informed by their physicians, they acknowledge that tobacco use was likely the cause of their disease. At least half of bladder cancer cases diagnosed in the ... read more US Performs Worst on Potentially Preventable Death Rates Compared to France, Germany, and UK
Aug. 29, 2012 The United States lags three other industrialized nations -- France, Germany, and the United Kingdom -- in its potentially preventable death rate, and in the pace of improvement in preventing deaths ... read more Strange & Offbeat |
Penn Medicine Honored for its Historic Role in the History of Microbiology Share This Page
Penn Medicine Honored for its Historic Role in the History of Microbiology May 22, 2009 PHILADELPHIA – The University of Pennsylvania was honored by The American Society for Microbiology last Friday with a plaque dedication ceremony celebrating the designation of its third Milestones in Microbiology site. Formerly known as the Laboratory of Hygiene, the current Vagelos Laboratories resides on the University of Pennsylvania campus. Honorary speakers included Arthur H. Rubenstein, MBBCh, Dean, Perelman School of Medicine; Alison O’Brien, PhD, President, American Society for Microbiology; and William B. Whitman, PhD, Trustee and Director of the Editorial Offices, Bergey’s Manual Trust. The Institute of Hygiene opened at the University of Pennsylvania on February 2, 1892 and the name quickly changed to the Laboratory of Hygiene. The building was the first of its kind to be built specifically as a bacteriology laboratory. The new laboratory held the University of Pennsylvania’s first formal courses in bacteriology. Students studying medical, dental, veterinary, engineering, and natural science learned about public health and bacteriology within the new walls of the laboratory. Well-known bacteriologist Alexander C. Abbott, one of the founders of the American Society for Microbiology, started his profession in the Laboratory. “The University of Pennsylvania is honored to be recognized as a pioneer in the field of bacteriology,” said Rubenstein. “We are so proud to keep that tradition alive with our work and research done within our laboratories.” The original Laboratory of Hygiene is now the Roy and Diana Vagelos Laboratories located at 3340 Smith Walk on campus. The 102,000 square feet building is used for research in bioengineering, chemistry, chemical engineering, and medicine. ###
Penn's School of Medicine is currently ranked #3 in the nation in U.S.News & World Report's survey of top research-oriented medical schools; and, according to the National Institutes of Health, received over $366 million in NIH grants (excluding contracts) in the 2008 fiscal year. Supporting 1,700 fulltime faculty and 700 students, the School of Medicine is recognized worldwide for its superior education and training of the next generation of physician-scientists and leaders of academic medicine.
The University of Pennsylvania Health System (UPHS) includes its flagship hospital, the Hospital of the University of Pennsylvania, rated one of the nation’s top ten “Honor Roll” hospitals by U.S.News & World Report; Pennsylvania Hospital, the nation's first hospital; and Penn Presbyterian Medical Center, named one of the nation’s “100 Top Hospitals” for cardiovascular care by Thomson Reuters. In addition UPHS includes a primary-care provider network; a faculty practice plan; home care, hospice, and nursing home; three multispecialty satellite facilities; as well as the Penn Medicine Rittenhouse campus, which offers comprehensive inpatient rehabilitation facilities and outpatient services in multiple specialties.
Penn Medicine is one of the world's leading academic medical centers, dedicated to the related missions of medical education, biomedical research, and excellence in patient care. Penn Medicine consists of the Raymond and Ruth Perelman School of Medicine at the University of Pennsylvania (founded in 1765 as the nation's first medical school) and the University of Pennsylvania Health System, which together form a $5.3 billion enterprise.
Contacts Marc Kaplan For Patients and the General Public: |
Healthcare Costs Concerns Impact Provider Rationing Behavior
A study found that more than half of providers rationed some medical services from patients because of healthcare costs in the past six months.
By Jacqueline Belliveau
July 22, 2016 - It is not uncommon to hear patients say that healthcare costs are going up, especially as more individuals enroll in high-deductible health plans. But, some providers oftentimes question if they should be responsible for helping to control costs.
For some providers, rationing certain healthcare services based on patient affordability has been a viable option for decreasing healthcare spending.
According to a recent survey in the Journal of General Internal Medicine, more than half of physicians reported that they have withheld some medical interventions from patients because of healthcare cost concerns in the past six months.
“This study highlights the challenging nature of being a physician in the United States with regard to resource utilization,” explained the authors of the study. “Every day clinical decisions involve complex issues, often requiring a series of subtle judgments by an individual physician for each patient (and the patient’s family), which collectively add up to tremendous costs or cost savings.”
Is Radiation Overuse Contributing to Higher Healthcare Costs?Group Purchasing Increases Healthcare Supply Chain SavingsHealthcare Price Variation a Challenge for State, Local Leaders
While a majority of providers participate in some form of healthcare rationing, most limit it to medical services with small benefits, explained the study. The clinical services that are frequently withheld are prescription drugs (48.3 percent) and MRIs (44.5 percent).
The study explained that these may be the most withheld services because MRIs are expensive in outpatient practices and oftentimes require prior authorizations, while prescription drugs are usually reimbursed using a separate payment system and are subject to input from pharmacy benefit managers.
In contrast, more intensive services are the least likely to be rationed. Treatments that were less likely to be rationed included referrals to intensive care units (10.9 percent), surgery (20.2 percent), and hospital admission (18.8 percent).
However, most of the respondents explained that they do not frequently withhold treatments and less than five percent reported daily rationing behaviors.
On average, one-third of physicians stated that they ration prescription drugs and one-fourth ration MRIs at least monthly.
Researchers also found that specialty, political leaning, and practice setting were the primary drivers behind healthcare rationing.
For example, surgical and procedural specialists were significantly less likely to report withholding medical services based on cost concerns than primary care physicians. The study explained that specialists who are “further downstream in care may have less ability, incentive, or need to ration.”
Similarly, the survey showed that physicians that identified themselves as holding liberal views were less likely to ration healthcare services.
In terms of practice setting, researchers revealed that small or solo practices were more likely to report rationing behavior than physicians in medical groups or health maintenance organizations. Researchers attributed this trend among solo practices to the “ration-by-proxy” phenomenon.
“Physicians become rationing agents of insurance companies because of the paperwork burden and excessive hoops of prior authorizations or excessive out-of-pocket costs that are set up by payers and pharmacy benefit managers,” the study explained.
“Solo practitioners have fewer resources to deal with the paperwork and other barriers; it may be easier not to make the effort in the first place when they know that their efforts will likely be in vain or will not be compensated.”
Despite the majority of physicians exhibiting rationing behavior, there was still a negative connation to the word “rationing.” Some providers stated that helping to reduce patient out-of-pocket expenses by withholding services did not constitute healthcare rationing.
The study explained that there is a complex relationship between behavior and attitude with healthcare rationing, which could indicate more subconscious influences of clinical decision-making. However, healthcare costs were one of the significant factors in making healthcare decisions for providers.
“These decisions are faced several times per patient encounter within the context of larger decisions about inpatient vs. outpatient treatment, medical vs. surgical options, and resource-intensive therapies such as dialysis,” the study stated. “The collective outcome of these decisions can mean the difference between high-cost and low-cost healthcare.”
Dig Deeper:
• How to Bend Healthcare’s Cost Curve Over the Next Decade
• How to Maximize Revenue Capture with Low Costs, High Quality
Healthcare CostsHealthcare Revenue CycleRevenue Cycle Management
Healthcare Price Variation a Challenge for State, Local LeadersLean Primary Care Improves Physician Productivity, CostsPCP Awareness of Healthcare Costs Cuts Low-Value Resource Use
Understanding MACRA: Everything you need to know about MIPS and positive payment adjustmentsNavigating the Electronic Payment ProcessUnderstanding MIPS: Advancing Care Information (ACI)
HRSA Grants to Boost Healthcare Employment for Primary Care |
Neoadjuvant Interferons: Critical for Effective PD-1–Based Immunotherapy in TNBC
Natasha K. Brockwell, Katie L. Owen, Damien Zanker, Alex Spurling, Jai Rautela, Hendrika M. Duivenvoorden, Nikola Baschuk, Franco Caramia, Sherene Loi, Phillip K. Darcy, Elgene Lim and Belinda S. Parker
Natasha K. Brockwell
Department of Biochemistry and Genetics, La Trobe Institute for Molecular Science, La Trobe University, Melbourne, Victoria, Australia.
Katie L. Owen
Damien Zanker
Alex Spurling
Jai Rautela
Hendrika M. Duivenvoorden
Nikola Baschuk
Franco Caramia
Cancer Immunology Program, Peter MacCallum Cancer Centre, Parkville, Victoria, Australia.
Sherene Loi
Cancer Immunology Program, Peter MacCallum Cancer Centre, Parkville, Victoria, Australia.Sir Peter MacCallum Department of Oncology, The University of Melbourne, Parkville, Victoria, Australia.
Phillip K. Darcy
Cancer Immunology Program, Peter MacCallum Cancer Centre, Parkville, Victoria, Australia.Sir Peter MacCallum Department of Oncology, The University of Melbourne, Parkville, Victoria, Australia.Department of Pathology, University of Melbourne, Parkville, Victoria, Australia.Department of Immunology, Monash University, Clayton, Victoria, Australia.
Elgene Lim
Garvan Institute of Medical Research, Darlinghurst, Sydney, Australia.St. Vincent's Hospital, University of New South Wales, Darlinghurst, Sydney, Australia.
Belinda S. Parker
DOI: 10.1158/2326-6066.CIR-17-0150 Published October 2017
The lack of targeted therapies available for triple-negative breast cancer (TNBC) patients who fail to respond to first-line chemotherapy has sparked interest in immunotherapeutic approaches. However, trials utilizing checkpoint inhibitors targeting the PD-1/PD-L1 axis in TNBC have had underwhelming responses. Here, we investigated the interplay between type I IFN signaling and the PD-1/PD-L1 axis and tested the impact of combining IFN inducers, as immune activators, with anti–PD-1, to induce an antimetastatic immune response. Using models of TNBC, we demonstrated an interplay between type I IFN signaling and tumor cell PD-L1 expression that affected therapeutic response. The data revealed that the type I IFN-inducer poly(I:C) was an effective immune activator and antimetastatic agent, functioning better than anti–PD-1, which was ineffective as a single agent. Poly(I:C) treatment induced PD-L1 expression on TNBC cells, and combined poly(I:C) and anti–PD-1 treatment prolonged metastasis-free survival in a neoadjuvant setting via the induction of a tumor-specific T-cell response. Use of this combination in a late treatment setting did not impact metastasis-free survival, indicating that timing was critical for immunotherapeutic benefit. Together, these data demonstrated anti–PD-1 as an ineffective single agent in preclinical models of TNBC. However, type I IFN inducers were effective immune activators, and neoadjuvant trials combining them with anti–PD-1 to induce a sustained antitumor immune response are warranted. Cancer Immunol Res; 5(10); 871–84. ©2017 AACR.
Immunotherapy has gained momentum as a viable option to treat a subset of cancers. Therapies targeting immune checkpoint proteins such as cytotoxic T-Lymphocyte antigen 4 (CTLA4) and the programmed death-1 (PD-1) receptor have revolutionized the treatment of metastatic melanoma (1, 2). The inhibitory action of PD-1 bound to its ligand (PD-L1) dampens immune activation—a mechanism exploited by tumor cells via upregulation of cell-surface PD-L1 expression to evade immune detection and subsequent tumor cell elimination (3, 4). Studies exploring the efficacy of treatments such as nivolumab and pembroluzimab, PD-1–specific antibodies, have demonstrated 1-year survival rates of over 73% in patients with metastatic melanoma, a vast improvement over post-chemotherapy survival (5, 6). Extended follow-up into the durable response of nivolumb reports a 5-year overall survival rate of 34%; this is more than double the previous survival rate for patients with metastatic melanoma receiving chemotherapy (7). Therefore, such agents are now being trialed in other cancer types, including breast cancer.
In breast cancer, use of anti–PD-1/PD-L1 has received most attention in the triple-negative breast cancer (TNBC) subtype. TNBC tumors have high PD-L1 expression compared with other subtypes (8, 9) and a high degree of tumor-infiltrating lymphocytes (TILs; ref. 10), suggesting that they may be more immunogenic (11). Additionally, due to the lack of targeted therapies available for this subtype, new approaches are urgently needed for patients who do not respond to first-line chemotherapy. Trials utilizing checkpoint inhibitors in metastatic TNBC patients are ongoing. Reported response rates are encouraging, albeit lower than those reported in melanoma. A phase 1b trial (NCT01848834) assessing the safety and efficacy of pembroluzimab in pretreated metastatic TNBC expressing PD-L1 reported a response rate of 18.5% in 27 patients, yet only 1 complete response and limited associated toxicities (12). In this pilot study, there was little correlation between the degree of PD-L1 positivity and clinical response. In fact, interrogation of PD-L1 expression in TNBC has revealed that high primary tumor PD-L1 expression predicts a favorable outcome (8, 9). Furthermore, PD-L1 expression directly correlates with the degree of TILs, which is another favorable prognostic factor (10, 13), suggesting that PD-L1 expression reflects an active antitumor immune microenvironment. These studies indicate that interactions between the immune system and breast cancer cells determine cell fate and risk of metastatic relapse in TNBC.
One family of cytokines implicated in an antitumor immune response are the type I interferons (IFNs; refs. 14, 15). We have shown the importance of tumor-intrinsic type I IFN signals in antitumor immunity and control of metastatic progression in breast cancer, whereby loss of tumor cell IFN regulatory factor (IRF) 7, a key transcription factor in the IFN signaling pathway, occurs in bone metastases in a syngeneic TNBC mouse model (16). Restoring tumor-cell IRF7 expression or systemic IFNα treatment could decrease bone metastasis and prolong survival, outcomes dependent on both innate and adaptive immune responses (16). In support of a metastasis-suppressive role of this pathway, loss of the IFN signature in primary breast tumors is associated with an increased risk of bone metastasis in patients (16). In multiple syngeneic TNBC mouse models, mice lacking the ability to respond to type I IFN signals [type I IFN receptor (IFNAR) deficient] are more susceptible to metastasis compared with wild-type mice (17). Furthermore, work in melanoma shows that IFN signaling is a tumor suppressive pathway; in particular, the downregulation of IFNAR1 contributes to aggressive metastatic melanoma (18). Together, this work implicates IFN-driven crosstalk between tumor cells and immune cells in the antitumor immune response during metastatic progression.
Type I IFNs have been used to treat melanoma (19), particularly in the adjuvant setting where such treatment prolongs disease-free survival in high-risk patients (20). However, type I IFN treatment has shown limited efficacy when tested in the context of advanced breast cancer (reviewed in ref. 14), possibly resulting from the lack of randomization within trials, coupled with treatment in late-stage treatment-refractory patients. Although few trials have explored the early treatment setting, several Toll-like receptor (TLR) agonists known to induce type I IFNs have demonstrated activity in early-stage breast cancer (14, 21). The combination of the TLR3 agonist poly(A:U) and chemotherapy (cyclophosphamide, methotrexate and 5-fluoro-uracil) or radiotherapy improved overall survival and 5-year relapse-free survival (14, 22). Despite this, the benefit of poly(A:U) or other IFN-based treatments as single agents or adjuvants to chemotherapy and radiotherapy has yet to be explored in early-stage TNBC trials.
Type I IFN-based treatments lead to upregulation of a multitude of IFN-stimulated genes (ISG) implicated in anticancer immune responses (14, 23, 24). This includes tumor-intrinsic changes (antigen presentation and stress ligand expression) and the activation of adaptive and innate immune components, such as CD8+, CD4+ T lymphocytes and natural killer (NK) cells (14, 15, 24), as well as promoting the secretion of IFNγ—a type II IFN that is cytotoxic (25, 26). However, an intrinsic brake on the IFN-based stimulation of immunity is the upregulation of immune checkpoints, including PD-L1 and PD-1 (27), which deactivate immune cells, largely to prevent autoimmunity (28). Such homeostatic strategies, however, could reduce the sustained impact of IFN-based therapeutic strategies. In line with this, therapeutic approaches combining immune activating agents with checkpoint blockade may be a viable immunotherapeutic strategy in patients.
This study investigates the utility of targeting type I IFN activation against, and in combination with, anti–PD-1 in both early and late treatment settings. As IFN-based immune activation can cause secondary dampening of immunity via PD-L1 induction (28), we hypothesized that PD-1 blockade would result in durable responses from immune activating therapies. We show that PD-1 blockade alone was ineffective as a single agent in several TNBC models regardless of treatment timing. We highlighted the anti-metastatic effect of targeting type I IFN activation via poly(I:C) administration and that its therapeutic benefit could be sustained via coadministration of anti–PD-1, particularly in the neoadjuvant treatment setting, and that this was associated with a sustained antitumor CD8+ T-cell response.
Cell lines and mice
Human breast cancer cell lines were obtained from ATCC and DMSZ. TNBC cell lines were grown in DMEM supplemented with 10% FBS (Gibco; CAL-120, MDA-MB-231, SUM159, HCC70, BT20, and HCC1806) or RPMI supplemented with 10% FCS + 5 μg/mL insulin (Sigma; BT549, SUM149, MDA-MB-456), HER2+ (HCC1954, SKBR3, MDA-MB-453), and ER+ (BT483, T47D, MCF7) cell lines were also grown in 10% RPMI. Murine cell lines (67NR, 66cl4, 4TO7, and 4T1) were sourced from Dr. Fred Miller, who derived the cell lines from a spontaneous mammary tumor that arose in a BALB/c mouse (29). The highly metastatic 4T1.2 subclone of the 4T1 line was derived in and sourced from Prof. Robin Anderson's laboratory (30, 31). The EO771 cell line was derived from a spontaneous primary tumor in a C57BL/6 mouse and was kindly provided by Prof. Robin Anderson (32). All cells were engineered to express the mCherry and/or luciferase (Luc2) reporter genes through retroviral transduction (MSCV). BALB/c cell lines were cultured in α-MEM (5% FBS), and C57BL/6 cell lines were cultured in DMEM (10% FBS). All cell lines (human/murine) were passaged using EDTA (0.01% w/v in PBS) and cultured for no longer than 4 weeks. Tumor lines were verified to be mycoplasma negative by the Victorian Infectious Diseases References Lab at regular intervals and before in vivo injection of cell lines (Melbourne, Vic, Australia).
C57BL/6 and BALB/c mice were obtained from the Walter and Eliza Hall Institute of Medical Research (Melbourne, Vic, Australia) and the Animal Resources Centre (Perth, WA, Australia). Mice were used between the ages of 8 and 12 weeks. All experiments were approved by the La Trobe Animal Experimentation ethics committee.
Flow-cytometry analysis
Analysis of cell-surface PD-L1 expression in vitro and in vivo (circulating and infiltrating lymphocytes) was completed by flow cytometry using the FACS Canto II (BD Biosciences), and data were analyzed using FlowJo software (TreeStar). To assess PD-L1 induction by IFNα (250 IU/mL, 500 IU/mL, or 1000 IU/mL) and IFNγ (5 ng/mL, 10 ng/mL, and 20 ng/mL; Shendoah) cell lines were treated 48 hours prior to flow cytometry. Poly(I:C) (10 μg/mL) in the presence or absence of MAR1 (10 μg/mL; Life Technologies) was transfected into cells using lipofectamine 2000 (10 μg/mL, Life Technologies) 24 hours prior to flow cytometry. Cells were stained with CD274-PE (Human; 1:50, M1H5; Cell Signaling Technologies, Mouse; 1:300, M1H5; BD Biosciences), IFNAR1-APC (1:300, MAR1-5A3; Biolegend), or relevant isotype controls (Human; mouse IgG1 к; Cell Signaling Technologies, Mouse; rat IgG2a к; Mouse IgG1 к eBiosciences; Biolegend). Data are represented as normalized mean fluorescence intensity (MFI) where the median fluorescent intensity and standard deviation of the sample is normalized to the isotype control:
Immune cell analysis
Blood obtained from the submandibular vein was used to profile circulating immune cells after red blood cell (RBC) lysis (155 mmol/L NH4Cl, 10 mmol/L KHCO3, 0.1 mmol/L EDTA, pH 7.3). Cells were stained with the following antibodies: CD8a-PE-Cy7 (53-6.7), CD4-APC-Cy7 (GK1.5), CD69-APC (H1.2F3), CD44-FITC (1M7), CD62L-BV421 (MEL-14), CD279-PE (J43), NK1.1-APC-Cy7 (PK136), NKP46-A700 (29A1.4), TCRβ-FITC (H57-597), CD11b-BV421 (M1/70), CD27-PerCP (LG-7F9; all from BD Biosciences), and NKG2D-PE-Cy7 (CX5; eBioscience) before being subjected to flow cytometry analysis.
Analysis of tumor-infiltrating lymphocytes was as above with the addition of mechanical and enzymatic [1 mg/mL collagenase I (Sigma) and 30 μg/mL DNAse I (Sigma) at 37°C] digestion to obtain a single-cell suspension before RBC lysis.
Intracellular cytokine staining (ICS) for IFNγ
To assess the number of antigen (Ag) specific CD8+ T cells present in the lungs of mice, a single-cell suspension was obtained using mechanical and enzymatic [1 mg/mL collagenase I (Sigma) and 30 μg/mL DNAse I (Sigma) at 37°C] digestion before RBC lysis (155 mmol/L NH4Cl, 10 mmol/L KHCO3, 0.1 mmol/L EDTA, pH 7.3). Cell suspension was then restimulated with 4T1.2 cells for 5 hours in the presence of brefeldin A (BFA; 10 μg/mL, Sigma) before staining with CD8α-APC (53-6.7; BD Biosciences) followed by IFNγ-PE (XMG1.2; BD Biosciences) in the presence of saponin (0.4% v/v; as previously described by Zanker and colleagues, ref. 33). Samples were then subjected to flow cytometry using the FACSCanto II (BD Biosciences), and data were analyzed using FlowJo software (TreeStar).
Bioinformatic interrogation of breast cancer TCGA gene expression data
The TCGA Human Breast Invasive Carcinoma normalized RNA quantities were accessed using the Firehose platform (34). The IFN (16, 35) and IFN core (HBEGF, STAT1, IRF7, IFI44, IL13RA1, CD86, CSF2RB, CD44, TLR3, IER3, IFITM3, RUNX3, and CTSS) signatures were compared with PDL1 (CD274) expression. Pearson correlation coefficients (r), scatter plots, and significance values were computed in R (version 3.3.2).
In vivo treatment and metastasis analysis
For in vivo experiments, 1 × 105 cells (EO771 or 4T1.2) were resuspended in PBS and injected into the fourth mammary fat pad (IMFP) in a 20 μL volume on day 0. Poly(I:C) (25 μg/mouse; Sigma) or saline was administered intravenously (i.v.), whereas anti–PD-1 (RPM1-14, Bioxcell) IgG (2A3, Bioxcell) was administered intraperitoneally (i.p.) at 250 μg/mouse. To evaluate the effect of poly(I:C) on immune cell activation in 4T1.2 tumor–bearing mice, poly(I:C) was administered thrice weekly from days 2 to 11 after tumor cell inoculation.
Mice receiving the combined treatment strategy (treatment before and after primary tumor resection) were randomized into groups and administered poly(I:C) on days 6, 8, 11, 13, 15, and 18 and anti–PD-1 on days 8, 11, 15, and 18.
For the late treatment setting, after primary tumor removal, mice received poly(I:C) on days 13, 15, 18, 20, 22, and 25, and anti–PD-1 on days 15, 18, 22, and 25.
For the neoadjuvant treatment setting, mice received poly(I:C) on days 2, 4, 6, 9, and 11, and anti–PD-1 on days 4, 6, 9, and 11.
Mammary tumors were resected on day 12 (BALB/C) or day 15 (C57BL/6) after tumor cell inoculation and weighed. Mice were sacrificed upon signs of metastatic distress with all mice being taken at the same time point for metastasis assays. At end point, mice were imaged using an IVIS Lumina XR-III (Caliper Life Sciences, Australia) under inhaled isoflurane anesthesia before lungs were rapidly excised and subjected to ex vivo imaging. mCherry fluorescence or bioluminescent intensity (12 minutes post-i.p. injection of 1.5 mg d-Luciferin; Gold technology) was measured and normalized between all images in a group using Living Image 4.4 software (Caliper Life Sciences). Metastatic burden was assessed using quantitative real-time PCR as described below. Survival curves were generated using Prism (GraphPad).
Quantification of metastatic burden
Real-time (RT) qPCR was used to quantify metastatic burden (as previously described by Eckhardt and colleagues, ref. 36) by comparing the ratio of mCherry (present in tumor cells) to vimentin (NC_000068, present in all cells) sequences in genomic DNA preparations from homogenized and proteinase K (100 μg/mL, Merck) digested lungs and spines. PCR reactions were performed using SsoAdvanced universal probes supermix reagents (BioRad) and C100 Thermal Cycler with CFX96/CFX384 RealTime System module (BioRad) and primers were as follows: mCherry FWD: 5′-GACCACCTACAAGGCCAAGAAG-3′; REV: 5′-AGGTGATGTCCAACTTGATGTTGA-3′; hydrolysis probe: 5′/56-FAM/CAGCTGCCC/ZEN/GGCGCCTACA/3IABkFQ/3′: mVimentin FWD: 5′- AGCTGCTAACTACCAGGACACTATTG-3′; REV: 5′-CGAAGGTGACGAGCCATCTC-3′; hydrolysis probe: 5′HEX/CTTTCATGTTTTGGATCTCATCCTGCAGG/TAMRA/3′. Metastatic burden (arbitrary units; AU) was based on the quantification cycle (Cq) for mCherry relative to vimentin and displayed as relative tumor burden (RTB) using the following equation:
Histology and immunohistochemistry (IHC)
Prior to paraffin embedding and sectioning, all tissues were fixed in 10% neutral-buffered formalin for 24 hours. For detection of PD-L1 expression, tissues were subjected to heat-induced epitope pressure cooker retrieval (110°C for 5 minutes) in EDTA buffer (1 mmol/L EDTA, pH 8) before incubating with anti–PD-L1 (AF1019; 1 μg/mL, R&D Biosystems) at 4°C overnight. Tissues were then incubated with enzyme-conjugated secondary antibody followed by incubation with Avidin/Biotinylated enzyme Complex (ABC; Vectastain) and visualization with the diaminobenzidine (DAB; Vectastain) color development system. Tissues were counterstained using hematoxylin.
Student two-tailed t tests were used to evaluate significant differences between groups. Mantel–Cox log-rank tests were used to evaluate differences in survival time. GraphPad Prism software (GraphPad) was used for all analyses. P < 0.05 was considered statistically significant.
IFNs induced PD-L1 expression in TNBC primary tumors
To determine the heterogeneity of PD-L1 expression, we first assessed differences in cell-surface PD-L1 expression using flow cytometry across a range of cell lines, representing different subtypes. Of the cell lines evaluated, the TNBC subtype expressed the highest baseline PD-L1 expression (Fig. 1A). HER2+ (ER−/PR−/HER2 amplified) and ER+ cell lines expressed varying levels of PD-L1; however, ER+ cells demonstrated the lowest expression (Fig. 1A). Although this pattern was concordant with PD-L1 expression in patient tissue cohorts (8, 9), expression was variable within our cell lines (Fig. 1A). As PD-L1 is an ISG and is induced in tumor cells by IFNγ (37), we assessed the impact of IFNα and IFNγ on cell-surface expression of PD-L1 in breast cancer cells. After a 48-hour incubation, IFNα and IFNγ treatment induced PD-L1 cell-surface expression in a range of human breast cancer cell lines (Fig. 1B).
Enhanced IFN signaling correlates with increases in PD-L1 expression in TNBC. Cell-surface PD-L1 expression determined by flow cytometry after staining with PE-conjugated anti–PD-L1 (M1H5) or isotype control (2A3). PD-L1 expression was measured in untreated cells (A) or cells treated with IFNα (B; 1,000 IU/mL) or IFNγ (10 ng/mL) for 48 hours prior to flow cytometry. FACS data are represented as normalized mean fluorescence intensity (MFI). n = 3; error bars, SEM; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 using Student t test. C, Correlation table representing the correlation of PD-L1 RNA expression with an IFN core list (also shown as a scatter plot in D) or full IFN signature in primary breast tumors (n = 1,212) from the TCGA RNAseq database. Pearson correlation coefficients (r) are indicated. All P values are P < 0.0001.
The cell line work suggested a correlation between IFN signaling and PD-L1 expression. To test whether such a correlation exists in patient-derived breast tumors, we utilized the TCGA RNAseq database to compare the expression of our previously identified type I IFN gene signature (16, 35) and PD-L1. We identified a correlation between the IFN signature and also a core list we have developed that represents an active signaling pathway (HBEGF, STAT1, IRF7, IFI44, IL13RA1, CD86, CSF2RB, CD44, TLR3, IER3, IFITM3, RUNX3, CTSS) and PD-L1 expression (Fig. 1C and D). A link between therapeutic IFN induction and PD-L1 expression in patients is yet to be tested, although our results support a link between an active type I IFN state and PD-L1 in TNBC patients.
IFN and IFN agonists increase PD-L1 expression both in vitro and in vivo
As with the human cells lines, mouse lines exhibited heterogeneous baseline PD-L1 cell-surface expression. The BALB/C series of cell lines (derived from a syngeneic TNBC mouse model) are well characterized for their metastatic propensity (29, 31). We observed that PD-L1 expression was higher in the nonmetastatic 67NR and weakly metastatic 66cl4 cell lines than in the highly metastatic 4T1 and 4T1.2 cell lines (Fig. 2A). The inverse correlation between PD-L1 expression and risk of metastasis is consistent with reports in TNBC patient tissues (8, 9). Regardless of baseline PD-L1 expression, both IFNα and IFNγ induced PD-L1 expression, up to 8- and 17-fold, respectively (Fig. 2A). Varying doses of IFN revealed a dose-dependent increase in PD-L1 expression (Supplementary Fig. S1A and S1B). As TLR agonists that stimulate IFN production are being trialed clinically, we wanted to test whether the TLR3 agonist poly(I:C) also increased PD-L1 expression. Transfection of cells with poly(I:C) for 24 hours significantly upregulated cell-surface PD-L1 expression (P > 0.05). Addition of MAR1, a type I IFNα receptor (IFNAR) blocking antibody, abrogated poly(I:C) induced PD-L1 upregulation (Fig. 2B), confirming that poly(I:C) is stimulating PD-L1 expression via type I IFN production/signaling. This finding was independent of intrinsic IFNAR expression, with no differences detected between all cell lines evaluated (Supplementary Fig. S1C). Next, we evaluated expression of PD-L1 in orthotopic 4T1 mammary tumors derived from mice that had either received recombinant IFNα or a vehicle control. Our results demonstrate an increase in intratumoural expression of PD-L1 in mice treated with IFNα compared with untreated (Fig. 2C, no detectable expression in control to moderate expression in 50% to 60% cells in treatment group). Similarly, there was an increase in the number of PD-L1–positive tumor cells and higher staining intensity in the 4T1.2 (30%, moderate intensity in control to 70% moderate–high intensity with treatment) and E0771 (5% low intensity to >70% high intensity staining) tumors of mice treated with poly(I:C) (Fig. 2C). These results were concordant with our in vitro analysis. Taken together, these data demonstrate that tumor cell PD-L1 expression can be induced by IFN and support the hypothesis that PD-L1 is a marker of elevated immune signaling.
IFN and type I IFN agonists increase PD-L1 expression in murine breast cancer cells in vitro and in vivo. Cell-surface PD-L1 expression determined by flow cytometry after staining with PE-conjugated anti–PD-L1 (M1H5) or isotype (2A3). Cells were treated in vitro with IFNα (1,000 IU/mL) or IFNγ (10 ng/mL) for 48 hours (A) or transfected with poly(I:C) (10 μg/mL) ± MAR1 (10 μg/mL) for 24 hours (B) as indicated before PD-L1 expression was measured by flow cytometry (n = 3). Error bars represent SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 using Student t tests. C, Immunohistochemical staining of PD-L1 expression in 4T1, 4T1.2, or E0771 primary tumors derived from mice that received IFNα (105 IU, i.p., thrice weekly), poly(I:C) (25 μg, i.v., thrice weekly) or saline (as indicated) prior to primary tumor resection. Tissues were stained using goat anti–PD-L1 (1 μg/mL) and PD-L1 expression visualized using DAB prior to nuclear counter-staining with hematoxylin. Representative pictures were taken of stained slides (n = 5 mice per group). Scale bars, 50 μm.
We also characterized the expression of activation ligands and PD-1 on the surface of circulating immune cells in tumor-bearing mice treated with poly(I:C). As expected, poly(I:C) led to enhanced CD4+ and CD8+ T- and NK-cell activation as indicated by the increase in activation ligands (CD69/NKG2D; Supplementary Fig. S2A and S2B). Further analysis of the NK cells revealed an increase in CD27+/−CD11b+ expression (Supplementary Fig. S2C). CD27+CD11b+ NK cells have an enhanced ability to secrete cytokines, and CD27−CD11b+ NK cells have efficient cytolytic function (38). Our results suggest that poly(I:C) treatment may enhance NK-cell activation and effector function, consistent with the known action of IFNs on immune activation. Both T and NK cells express PD-1, with poly(I:C) further increasing this expression, an effect more pronounced on NK cells (Supplementary Fig. S2D). Together, this suggested responses to poly(I:C) treatment could be improved if treatment also included anti–PD-1 to block the tumor cell PD-L1 interaction with cytotoxic T-cell or NK-cell PD-1 to further enhance an antitumor immune response.
Poly(I:C) and anti–PD-1 combination treatment slowed tumor growth and metastases
The EO771-mCherry syngeneic model was used to assess the impact of poly(I:C) and/or anti–PD-1 on primary tumor growth. Cells were injected intra mammary fat pad (IMFP) and mice received a priming dose of poly(I:C), followed by the combination of poly(I:C) and anti–PD-1 or single agent therapy (Fig. 3A). Analysis of primary tumor weight on day 15 after tumor cell inoculation revealed that combination therapy reduced tumor weight, whereas single agents alone did not affect primary tumor size compared with control (Fig. 3B). At day 15 post-primary tumor resection, mCherry tumor cells were visualized by ex vivo fluorescence imaging, and a reduction in lung metastatic burden was evident in the combination therapy group. Quantification of mCherry fluorescence revealed that both poly(I:C) alone and in combination with anti–PD-1 decreased lung metastasis (Fig. 3C and D). Such an impact was not observed in the anti–PD-1 treatment group that received anti–PD-1 alone.
Antibody-mediated PD-1 blockade in combination with poly(I:C) reduces primary tumor weight. A, Experimental protocol indicating timing of therapy in C57BL/6 mice inoculated IMFP with 1 × 105 EO771 cells and treated with poly(I:C) (25 μg, i.v.) and anti–PD-1 (RPM1-14; 250 μg, i.p.). B, Tumor weight (mg) 15 days post tumor cell inoculation (n = 10 per group). C, Representative mCherry fluorescent imaging of ex vivo lungs collected from EO771 tumor–bearing mice 30 days after tumor cell inoculation (of 5 mice representative of larger cohort). D, Total radiant efficiency of mCherry fluorescent lungs calculated using Living Image software (Lumina; n = 5 mice per group). Error bars represent SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001 using Student t tests.
Analysis of circulating immune cells during treatment confirmed an increase in the proportion of T cells expressing CD69 in the combination treatment group (Supplementary Fig. S3A). Furthermore, analysis of the CD8+ T cells revealed an increase in the percentage of CD44+CD62L+ populations on day 14 in response to the combination treatment (Supplementary Fig. S3). Evidence suggests that CD44+CD62L+ CD8+ T cells are representative of a central memory population (39), suggesting that poly(I:C) both alone and in combination with anti–PD-1 can increase the central memory population.
Poly(I:C) and anti–PD-1 combination treatment increases tumor-specific T-cell response
In order to assess the impact of combination therapy in a more aggressive model, we used the highly metastatic 4T1.2-luc2 cell line. Cells were injected IMFP into BALB/C mice and treatment initiated when tumors were palpable (day 6; Fig. 4A). Analysis of primary tumor weight on day 12 post-inoculation revealed that the combination therapy significantly decreased primary tumor weight compared with single agents alone (P > 0.05; Fig. 4B). Ten days after primary tumor resection, bioluminescence was used to detect 4T1.2 lung metastases in vivo and ex vivo. Bioluminescence was visibly decreased in the combination therapy group, indicating a reduction in overall metastatic burden (Fig. 4C), specifically in the lung (Fig. 4D). Quantitative DNA analysis of resected organs confirmed that combination treatment reduced metastatic burden in the lungs (Fig. 4E) of these mice compared with single agent and control-treated mice. Analysis of the lymphocyte population in the lungs of these mice revealed that the combination therapy significantly increased the number of tumor cell-specific IFNγ-producing CD8+ T cells compared with poly(I:C) (P > 0.05; Fig. 4F and G). This increase in CD8+ T-cell activity offers some rationale into the effectiveness of combining poly(I:C) and anti–PD-1 therapy.
Antibody-mediated blockade of the PD-1/PD-L1 axis in combination with poly(I:C) decreases primary tumor weight and increases systemic expansion of tumor-specific CD8+ T cells. A, Treatment protocol for combination therapy of BALB/C mice inoculated IMFP with 1 × 105 4T1.2 cells and treated with poly(I:C) (25 μg, i.v.) and anti–PD-1 (RPM1-14; 250 μg, i.p.). B, Tumor weight (mg) 12 days after tumor cell inoculation (n = 15 per group). Bioluminescent imaging of (C) whole mice and (D) ex vivo lungs collected from 4T1.2 tumor–bearing mice 22 days after inoculation (n = 5 representative mice). E, Relative tumor burden (RTB) in lungs of mice represents mCherry DNA expression compared with vimentin (n = 15 per group). F, Single-cell suspensions of lung were restimulated in vitro with 4T1.2 cells in the presence of BFA (10 μg/mL). Following a five-minute incubation, CD8+ T cells were assessed for IFNγ production via flow cytometry after staining with APC-conjugated anti-CD8α (53-6.7) and PE-conjugated anti-IFNγ (XMG1.2) in an ICS assay. Absolute numbers per lung shown, n = 5 per group. G, Representative flow-cytometry plots for IFNγ and CD8 staining. Representative of two independent mouse experiments. Error bars represent SEM; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 using Student t tests.
Combination therapy was more effective in a neoadjuvant treatment setting
Having shown that the combination therapy was successful in this model, we wanted to test its impact in treatment settings relevant to the clinical context, mimicking either an early neoadjuvant setting before the detection of overt metastases or a late treatment setting whereby treatment commenced after primary tumor resection when metastases are detectable.
For the early neoadjuvant treatment setting, treatment commenced on day 2 and was ceased prior to primary tumor resection (Fig. 5A). Analysis of primary tumor weight revealed that poly(I:C) treatment reduced primary tumor weight compared with vehicle control and anti–PD-1 therapy groups (Fig. 5B), and the effect was more pronounced with combination therapy (Fig. 5B). Anti–PD-1 treatment alone had no effect on primary tumor weight. Analysis of tumor-infiltrating lymphocytes revealed that both single agents and combination therapy increased the total number of TILs (Fig. 5C). However, when we assessed the nature of these TILs, we found that only poly(I:C) treatment increased the percentage of CD8+ and CD4+ T cells expressing CD69 (Fig. 5D). Both poly(I:C) and the combination therapy increased the percentage of NK cells expressing CD69/NKG2D, suggesting an increase in the activation status of immune cells infiltrating the primary tumor (Fig. 5E). During treatment, we also assessed circulating immune cells where we detected an increase in the percentage of CD69+ and CD27+/−CD11b+ expressing NK cells in the poly(I:C) and the combination groups on day 10 (Fig. 5F). Thus, poly(I:C) not only increased TIL activation but also circulating immune cells, the latter of which likely combats metastatic spread.
Neoadjuvant poly(I:C) and combination therapy increases TIL activation. A, Treatment protocol for combination therapy of BALB/C mice injected with 1 × 105 4T1.2 cells IMFP and treated with poly(I:C) (25 μg, i.v.) and anti–PD-1 (RPM1-14; 250 μg, i.p.). B, Tumor weight (mg) 12 days after tumor cell inoculation (n = 29 per group; representative of 3 independent mouse experiments). C, Absolute number of lymphocytes obtained from the primary tumor per gram. Proportion of (D) CD8+, CD4+, and (E) NKp46+lymphocytes expressing CD69/NKG2D isolated from the primary tumor at the time of resection (D12). F, Percentage of NKp46+ lymphocytes expressing CD69/CD27/CD11b isolated from peripheral blood of 4T1.2 tumor–bearing BALB/C mice at day 10; n = 8 per group; error bars represent SEM; *, P < 0.05; **, P < 0.01; ***, P < 0.001 ****, P < 0.0001 using Student t test.
We next assessed the impact of therapy on metastatic burden. Bioluminescent imaging of the thoracic cavity 11 days post tumor-resection (experimental end point) revealed reduced lung metastasis in poly(I:C) and combination treated mice (Fig. 6A and B). RT-qPCR analysis revealed that, again, anti–PD-1 therapy alone had no impact on lung metastasis and that both poly(I:C) and the combination therapy abrogated metastatic burden in the lungs in the neoadjuvant setting (Fig. 6C). Analysis of immune populations in the lung revealed that only combination therapy induced IFNγ+ CD8+ T cells (Fig. 6D and E), suggesting that the addition of anti–PD-1 to poly(I:C) therapy was required to induce a sustained T-cell antitumor response and that this could prolong metastasis-free survival. To test, this we performed metastasis-free survival studies, mimicking the neoadjuvant setting with mice being individually monitored for evidence of metastasis (Fig. 7A). Poly(I:C) single-agent therapy prolonged metastasis-free survival compared with control, yet anti–PD-1 alone had no impact on survival (median survival, 30, 25, and 24 days, respectively; Fig. 7B). Combination therapy significantly extended overall survival in this aggressive model (median survival, 38 days; Fig. 7B, P > 0.05) compared with single agents alone, supporting the combination of poly(I:C) and anti–PD-1 for prolonged antitumor immune response.
Neoadjuvant poly(I:C) and combination therapy reduced metastatic burden. Bioluminescent imaging after d-Luciferin injection (1.5 mg, i.p.) of (A) whole mice and (B) ex vivo lungs collected from 4T1.2 tumor–bearing mice 23 days after tumor inoculation (of 5 mice representative of larger cohort; mice skirted during imaging to block any possible bioluminescence from the lower half to focus purely on thoracic cavity metastases). C, RTB in lungs represents mCherry tumor cell expression compared with Vimentin (n = 12 per group). D, Single-cell suspensions of lung were restimulated in vitro with 4T1.2 cells in the presence of BFA (10 μg/mL). Following a five-minute incubation, CD8+ T cells were assessed for IFNγ production via flow cytometry after staining with APC-conjugated anti-CD8α (53-6.7) and PE-conjugated anti-IFNγ (XMG1.2) in an ICS assay. Absolute numbers per lung shown, n = 5 per group. E, Representative flow-cytometry plots for IFNγ and CD8 staining. Representative of two independent mouse experiments. Error bars represent SEM; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 using Student t tests.
Neoadjuvant poly(I:C) combined with anti–PD-1 therapy prolonged survival. A and C, Treatment protocol for combination therapy of BALB/C mice injected with 1 × 105 4T1.2 cells IMFP and treated with poly(I:C) (25 μg, i.v.) and anti–PD-1 (RPM1-14; 250 μg, i.p.). B and D, Kaplan–Meier survival curve comparing metastasis-free survival in mice treated with vehicle, poly(I:C), anti–PD-1 (RMP1-14), or the combination [n = 15 per group; representative of two independent mouse experiments (B), n = 10 per group (D)]. Mice excluded due to primary tumor regrowth are indicated. *, P < 0.05; **, P < 0.01; ****, P < 0.0001 using Student t test.
Such a survival benefit was not observed in a late treatment setting, in the absence of a primary tumor. We again used the highly metastatic 4T1.2-luc cells, which were injected IMFP, and treatment was initiated after primary tumor resection (Fig. 7C). Comparison of survival between treatment groups revealed that neither single agents or combination therapies had an impact on metastasis-free survival, with a median survival of 23 to 24 days for all groups (Fig. 7D). This was in stark contrast to the observed impact of such therapies in the neoadjuvant setting, suggesting that immune-mediated elimination of tumor cells was not effective against overt metastases in the absence of a primary tumor.
This study highlights the antimetastatic effects of targeted type I IFN activation in multiple models of TNBC. Analysis of the interplay between IFNs and PD-L1 expression revealed the secondary upregulation of PD-L1 and PD-1 in response to enhanced immune activation and IFN production. Our in vivo analyses into coadministration of anti–PD-1 and poly(I:C) revealed that anti–PD-1 is ineffective as a stand-alone agent but can prolong the antitumor T-cell response and therapeutic benefit of poly(I:C), specifically in the neoadjuvant setting.
Investigating the interplay between enhanced IFN signaling and PD-L1 expression confirmed PD-L1 as an IFN-regulated gene in TNBC. PD-L1 is a known ISG that is upregulated in response to immune activating cytokines in both tumor and tumor-associated stromal cells (40). We found that a key set of type I IFN genes, encompassing essential transcription factors, correlated with PD-L1 expression in TNBC, as described by other groups in primary and metastatic melanoma (41). Tumoral PD-L1 expression reflects an active antitumor microenvironment (42), offering support as to why PD-L1 is a good prognostic factor in TNBC (8, 9). PD-L1 expression correlates with the presence of TILs, and tumors that are rich in immune cells or “hot” have been associated with a better prognosis in both TNBC and melanoma (10, 43–45). We have also previously shown that retained tumor-intrinsic IFN in the primary tumor is associated with increased relapse-free survival in breast cancer (16).
By using a treatment that directly enhances IFN signaling both in tumor and immune cells, we increased the intratumoral and microenvironmental immune activation in previously “immune cell poor” or “cold” tumors, which resulted in improved survival outcomes. As noted previously, there is a lack of utility of IFN-based treatments in breast cancer due to the inconsistent efficacy data in late metastatic treatment settings (14). Our data support the ineffectiveness of IFN-based treatments in the late metastatic treatment setting where poly(I:C) offered no survival benefit at all. This is in support of the continued success of IFN treatment in adjuvant high-risk melanoma, where it is used before overt metastases are present (20). Our study demonstrated that a neoadjuvant approach with poly(I:C) treatment was better for suppressing metastatic spread than later treatment settings. A benefit of a neoadjuvant approach rather than late-stage immunotherapy in TNBC has also been reported by others (46) and is consistent with previous breast cancer trials where poly (A:U) showed most promise in an early treatment setting (14). We hypothesize that a loss of intrinsic IFN signaling in the tumor may predict benefit from IFN-based therapies.
Clinical trials designed to test the efficacy of anti–PD-1/PD-L1 agents in breast cancer include patients have been based on the presence of tumoral PD-L1 expression. Our work, however, along with other work in breast and melanoma suggests that baseline PD-L1 expression is not a sufficiently sensitive predictor of response (6, 12). In a phase Ib clinical trial where TNBC patients were recruited based on PD-L1 positivity (>1%), the efficacy of pembroluzimab was underwhelming with a response rate of 18.5% (12). Another study suggested that anti–PD-1 was an effective single agent in a neoadjuvant TNBC mouse model (46). Our data, on the other hand, show a lack of efficacy of anti–PD-1 as a single agent in multiple models of TNBC. Others have similarly found a lack of response to anti–PD-1 in mouse models of TNBC (47). The lack of antimetastatic effect of anti–PD-1 reveals the inability of anti–PD-1 alone to induce an antitumor immune response. This demonstrates that a potent immune stimulator in addition to anti–PD-1 is required for an antimetastatic response. In line with a link between anti–PD-1 response and an active tumor-infiltrate, increased CD8+, CD3+, and CD45RO+ T-cell densities at the invasive tumor margin correlate with response to anti–PD-1 in melanoma (48). Although we have shown that both anti–PD-1 and poly(I:C) alone and in combination increase intratumoral lymphocytes, our data demonstrate that it is the nature of such TILs that correlates with response to therapy. Anti–PD-1 treatment alone was not sufficient for TIL activation in our study, whereas combination with poly(I:C) enhanced both T-cell and NK-cell activation, essentially heating up a previously immune-inactive tumor to promote antitumor response and benefit from anti–PD-1 therapy. Melanoma studies support this proposition, whereby stimulation of IFN signaling and immune activation in immune cell poor melanomas is necessary for anti–PD-1 treatment to be effective (41).
Although poly(I:C) was an effective agent in the neoadjuvant setting in our study, we also demonstrate a therapeutic benefit with the addition of anti–PD-1. The increase in overall survival from the combination therapy in a neoadjuvant setting is likely due to the induction of a tumor specific T-cell response, which works to eliminate metastases. In the context of neoadjuvant therapy, the presence of the primary tumor in situ allows for the priming of tumor-specific cytotoxic T cells (46). The combination therapy, which was superior to single agents in overall survival, correlated with an increase in tumor-specific cytotoxic T cells at the site of metastasis. This finding suggests that the combination therapy induced a self-renewing residential memory population within metastases, as demonstrated by elevated IFNγ+ CD8+ T cells persisting in the lung up to 12 days after treatment cessation, which is after the T-cell contraction phase. Induction of a memory population is likely critical for a sustained antimetastatic therapeutic response given that breast cancer recurrence can occur years after initial diagnosis (49). The immune targeting of micrometastases before the formation of overt metastases would represent a major therapeutic advance in TNBC. Others have also shown that targeting multiple suppressive pathways is more effective than using single agents alone (2, 47, 50, 51). Here, we demonstrate that increasing immune activation through type I IFN stimulation can enhance the efficacy of anti–PD-1 in TNBC through induction of a tumor-specific immune response. Studies that have sought to increase tumor intrinsic interferon signaling alone or in combination with anti–PD-1 in other cancers have also had successes, particularly with treatments that can activate cytotoxic T cells and decrease immune suppressive populations (41, 52, 53).
In summary, we have demonstrated the ineffectiveness of anti–PD-1 as a single agent and the potential clinical use of combination type I IFN inducers and anti–PD-1 therapy in preclinical TNBC models. Our findings reveal that IFN signaling must be stimulated to promote immune activation in order for anti–PD-1 to be effective. These findings should be considered when designing clinical trials evaluating anti–PD-1 therapies in TNBC. Future research into tumor-intrinsic IFN markers as predictive biomarkers of response to IFN-based and anti–PD-1 therapies is needed. Our research suggests that patients with immune “cold” tumors can be primed to respond to anti–PD-1 therapy via type I IFN-based therapy, and that elevated tumor-cell expression of PD-L1 may serve as a biomarker for this therapeutic approach.
This study highlights the antimetastatic effects of targeted type I IFN activation in multiple models of TNBC. Analysis of the interplay between IFNs and PD-L1 expression revealed the secondary upregulation of PD-L1 and PD-1 in response to enhanced immune activation and IFN production. Our in vivo analyses into coadministration of anti–PD-1 and poly(I:C) revealed that anti–PD-1 is ineffective as a stand-alone treatment but can prolong the antitumor T-cell response and therapeutic benefit of poly(I:C) in the neoadjuvant setting. Given current clinical trials using TLR agonists in oncology (54), our combination therapy can be directly translated into the clinical setting.
S. Loi reports receiving commercial research grants from Merck, Roche Genentech, Pfizer, and Bristol-Myers Squibb. E. Lim reports receiving commercial research grants from Novartis and Bayer. No potential conflicts of interest were disclosed by the other authors.
Conception and design: E. Lim, B.S. Parker
Development of methodology: D. Zanker, E. Lim
Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): N.K. Brockwell, K.L. Owen, D. Zanker, J. Rautela, E. Lim, B.S. Parker
Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): N.K. Brockwell, D. Zanker, F. Caramia, S. Loi, P.K. Darcy, E. Lim, B.S. Parker
Writing, review, and/or revision of the manuscript: N.K. Brockwell, K.L. Owen, D. Zanker, H.M. Duivenvoorden, F. Caramia, S. Loi, P.K. Darcy, E. Lim, B.S. Parker
Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): D. Zanker, A. Spurling, H.M. Duivenvoorden, N. Baschuk
Study supervision: E. Lim, B.S. Parker
This work was supported by grant funding from the National Health and Medical Research Council (NHMRC, APP1047747) and Cancer Council Victoria (APP1127757; B.S. Parker). Fellowship support was received from NHMRC and ARC (P.K. Darcy and B.S. Parker) and the National Breast Cancer Foundation (fellowship to E. Lim).
We acknowledge La Trobe Animal Research Training Facility (LARTF) for their support with animal work.
Note: Supplementary data for this article are available at Cancer Immunology Research Online (http://cancerimmunolres.aacrjournals.org/).
Received March 27, 2017.
Robert C,
Thomas L,
Bondarenko I,
O'Day S,
Weber J,
Garbe C,
Ipilimumab plus dacarbazine for previously untreated metastatic melanoma. N Engl J Med 2011;364:2517–26.
Ott PA,
Hodi FS,
. CTLA-4 and PD-1/PD-L1 blockade: new immunotherapeutic modalities with durable clinical benefit in melanoma patients. Clin Cancer Res 2013;19:5300–9.
Kataoka K,
Ogawa S
. Novel mechanism of immune evasion involving PD-L1 in various cancers. Transl Cancer Res 2016;5:S428–S32.
Beatty GL,
Gladney WL
. Immune escape mechanisms as a guide for cancer immunotherapy. Clin Cancer Res 2015;21:687–92.
Long GV,
Brady B,
Dutriaux C,
Maio M,
Mortier L,
Nivolumab in previously untreated melanoma without BRAF mutation. N Engl J Med 2015;372:320–30.
Schachter J,
Arance A,
Grob JJ,
Pembrolizumab versus ipilimumab in advanced melanoma. N Engl J Med 2015;372:2521–32.
Kluger H,
Sznol M,
Carvajal R,
Lawrence D,
Atkins M,
Abstract CT001: Durable, long-term survival in previously treated patients with advanced melanoma (MEL) who received nivolumab (NIVO) monotherapy in a phase I trial. Cancer Res 2016;76: no. 14 Supplement, CT001–CT001.
Beckers RK,
Selinger CI,
Vilain R,
Madore J,
Wilmott JS,
Harvey K,
Programmed death ligand 1 expression in triple-negative breast cancer is associated with tumour-infiltrating lymphocytes and improved outcome. Histopathology 2016;69:25–34.
Sabatier R,
Finetti P,
Mamessier E,
Adelaide J,
Chaffanet M,
Ali HR,
Prognostic and predictive value of PDL1 expression in breast cancer. Oncotarget 2015;7:5449–69.
Wimberly H,
Brown JR,
Schalper KA,
Haack H,
Silver MR,
Nixon C,
PD-L1 expression correlates with tumor-infiltrating lymphocytes and response to neoadjuvant chemotherapy in breast cancer. Cancer Immunol Res 2015;3:326–32.
Miller LD,
Chou JA,
Black MA,
Print C,
Chifman J,
Alistar A,
Immunogenic subtypes of breast cancer delineated by gene classifiers of immune responsiveness. Cancer Immunol Res 2016;4:600–10.
Nanda R,
Chow LQM,
Dees EC,
Berger R,
Gupta S,
Geva R,
Pembrolizumab in patients with advanced triple-negative breast cancer: Phase Ib KEYNOTE-012 Study. J Clin Oncol 2016;34:2460–7.
Provenzano E,
Dawson SJ,
Blows FM,
Liu B,
Shah M,
Association between CD8+ T-cell infiltration and breast cancer survival in 12,439 patients. Ann Oncol 2014;25:1536–43.
Parker BS,
Rautela J,
Hertzog PJ
. Antitumour actions of interferons: implications for cancer therapy. Nat Rev Cancer 2016;16:131–44.
Swann JB,
Hayakawa Y,
Zerafa N,
Sheehan KC,
Scott B,
Schreiber RD,
Type I IFN contributes to NK cell homeostasis, activation, and antitumor function. J Immunol 2007;178:7540–9.
Bidwell BN,
Slaney CY,
Withana NP,
Forster S,
Cao Y,
Loi S,
Silencing of Irf7 pathways in breast cancer cells promotes bone metastasis through immune escape. Nat Med 2012;18:1224–31.
Baschuk N,
Jayatilleke KM,
Xiao K,
Loss of host type-I IFN signaling accelerates metastasis and impairs NK-cell antitumor function in multiple models of breast cancer. Cancer Immunol Res 2015;3:1207–17.
Katlinskaya YV,
Katlinski KV,
Yu Q,
Ortiz A,
Beiting DP,
Brice A,
Suppression of type I interferon signaling overcomes oncogene-induced senescence and mediates melanoma development and progression. Cell Rep 2016;15:171–80.
Di Trolio R,
Simeone E,
Di Lorenzo G,
Buonerba C,
Ascierto PA
. The use of interferon in melanoma patients: a systematic review. Cytokine Growth Factor Rev 2015;26:203–12.
Ascierto PA,
Gogas HJ,
Algarra SM,
Mohr P,
Hansson J,
Adjuvant interferon alfa in malignant melanoma: an interdisciplinary and multinational expert review. Crit Rev Oncol Hematol 2013;85:149–61.
Lacour J,
Lacour F,
Spira A,
Michelson M,
Petit JY,
Delage G,
Adjuvant treatment with polyadenylic-polyuridylic acid in operable breast cancer: updated results of a randomised trial. Br Med J (Clin. Res. Ed). 1984;288:589–92.
Laplanche A,
Alzieu L,
Delozier T,
Berlie J,
Veyret C,
Fargeot P,
Polyadenylic-polyuridylic acid plus locoregional radiotherapy versus chemotherapy with CMF in operable breast cancer: a 14 year follow-up analysis of a randomized trial of the Federation Nationale des Centres de Lutte contre le Cancer (FNCLCC). Breast Cancer Res Treat 2000;64:189–91.
Dunn GP,
Bruce AT,
Shankaran V,
Uppaluri R,
Bui JD,
A critical function for type I interferons in cancer immunoediting. Nat Immunol 2005;6:722–9.
Zitvogel L,
Galluzzi L,
Kepp O,
Smyth MJ,
Kroemer G
. Type I interferons in anticancer immunity. Nat Rev Immunol 2015;15:405–14.
Brinkmann V,
Geiger T,
Alkan S,
Heusser CH
. Interferon alpha increases the frequency of interferon gamma-producing human CD4+ T cells. J Exp Med 1993;178:1655–63.
Nguyen KB,
Cousens LP,
Doughty LA,
Pien GC,
Durbin JE,
Biron CA
. Interferon alpha/beta-mediated inhibition and promotion of interferon gamma: STAT1 resolves a paradox. Nat Immunol 2000;1:70–6.
Lee SJ,
Jang BC,
Lee SW,
Yang YI,
Suh SI,
Park YM,
Interferon regulatory factor-1 is prerequisite to the constitutive expression and IFN-gamma-induced upregulation of B7-H1 (CD274). FEBS Lett 2006;580:755–62.
Riella LV,
Paterson AM,
Sharpe AH,
Chandraker A
. Role of the PD-1 pathway in the immune response. Am J Trans 2012;12:2575–87.
Aslakson CJ,
Miller FR
. Selective events in the metastatic process defined by analysis of the sequential dissemination of subpopulations of a mouse mammary tumor. Cancer Res 1992;52:1399–405.
Eckhardt BL,
van Laar RK,
Restall CM,
Natoli AL,
Tavaria MD,
Genomic analysis of a spontaneous model of breast cancer metastasis to bone reveals a role for the extracellular matrix. Mol Cancer Res 2005;3:1–13.
Lelekakis M,
Moseley JM,
Martin TJ,
Hards D,
Williams E,
Ho P,
A novel orthotopic model of breast cancer metastasis to bone. Clin Exp Metastasis 1999;17:163–70.
Casey AE,
Laster WR,
Ross GL
. Sustained enhanced growth of carcinoma EO771 in C57 black mice. Exp Biol Med 1951;77:358–62.
Zanker D,
Waithman J,
Yewdell JW,
Chen W
. Mixed proteasomes function to increase viral peptide diversity and broaden antiviral CD8+T cell responses. J Immunol 2013;191:52–9.
Broad Institute TCGA Genome Data Analysis Center. Analysis-ready standardized TCGA data from Broad GDAC Firehose 2016_01_28 run. Broad Institute of MIT and Harvard. 2016.
Touati N,
Tryfonidis K,
Caramia F,
Bonnefoi H,
Cameron D,
Slaets L,
Correlation between severe infection and breast cancer metastases in the EORTC 10994/BIG 1-00 trial: Investigating innate immunity as a tumor suppressor in breast cancer. Ann Oncol 2016;27:suppl_6, 256P–256P.
Francis PA,
Anderson RL
. Strategies for the discovery and development of therapies for metastatic breast cancer. Nat Rev Drug Discov 2012;11:479–97.
Soliman H,
Khalil F,
Antonia S
. PD-L1 expression is increased in a subset of basal type breast cancer cells. PLoS One 2014;9:e88557.
Fu B,
Wang F,
Sun R,
Ling B,
Tian Z,
Wei H
. CD11b and CD27 reflect distinct population and functional specialization in human natural killer cells. Immunology 2011;133:350–9.
Seder RA,
Ahmed R
. Similarities and differences in CD4+ and CD8+ effector and memory T cell generation. Nat Immunol 2003;4:835–42.
Cheon H,
Borden EC,
Stark GR
. Interferons and their stimulated genes in the tumor microenvironment. Semin Oncol 2014;41:156–73.
Bald T,
Landsberg J,
Lopez-Ramos D,
Renn M,
Glodde N,
Jansen P,
Immune cell-poor melanomas benefit from PD-1 blockade after targeted type I IFN activation. Cancer Discov 2014;4:674–87.
Taube JM,
Klein A,
Brahmer JR,
Pan X,
Kim JH,
Association of PD-1, PD-1 ligands, and other features of the tumor immune microenvironment with response to anti–PD-1 therapy. Clin Caner Res 2014;20:5064–74.
Adams S,
Gray RJ,
Demaria S,
Goldstein L,
Perez EA,
Shulman LN,
Prognostic value of tumor-infiltrating lymphocytes in triple-negative breast cancers from two phase III randomized adjuvant breast cancer trials: ECOG 2197 and ECOG 1199. J Clin Oncol 2014;32:2959–66.
Salgado R,
Denkert C,
Sirtaine N,
Klauschen F,
Pruneri G,
The evaluation of tumor-infiltrating lymphocytes (TILs) in breast cancer: recommendations by an International TILs Working Group 2014. Ann Oncol 2015;26:259–71.
Oble DA,
Loewe R,
Yu P,
Mihm MC
. Focus on TILs: prognostic significance of tumor infiltrating lymphocytes in human melanoma. Cancer Immun 2009;9:3.
Blake SJ,
Yong MCR,
Harjunpää H,
Ngiow SF,
Takeda K,
Improved efficacy of neoadjuvant compared to adjuvant immunotherapy to eradicate metastatic disease. Cancer Discov 2016;6:1382–99.
Beavis PA,
Milenkovski N,
Henderson MA,
John LB,
Allard B,
Adenosine receptor 2A blockade increases the efficacy of anti-PD-1 through enhanced antitumor T-cell responses. Cancer Immunol Res 2015;3:506–17.
Gibney GT,
Weiner LM,
Atkins MB
. Predictive biomarkers for checkpoint inhibitor-based immunotherapy. Lancet Oncol 2017;17:e542–51.
Banys M,
Hartkopf AD,
Krawczyk N,
Kaiser T,
Meier-Stiegen F,
Fehm T,
Dormancy in breast cancer. Breast Cancer (London). 2012;4:183–91.
Callahan MK,
Postow MA,
Wolchok JD
. CTLA-4 and PD-1 pathway blockade: combinations in the clinic. Front Oncol 2014;4:385.
Rajani K,
Parrish C,
Kottke T,
Thompson J,
Zaidi S,
Ilett L,
Combination therapy with reovirus and anti-PD-1 blockade controls tumor growth through innate and adaptive immune responses. Mol Ther 2016;24:166–74.
Mkrtichyan M,
Chong N,
Abu Eid R,
Wallecha A,
Singh R,
Rothman J,
Anti-PD-1 antibody significantly increases therapeutic efficacy of Listeria monocytogenes (Lm)-LLO immunotherapy. J Immunother Cancer 2013;1:15.
Gui J,
Chakraborty R,
Bhattacharya S,
Inactivation of interferon receptor promotes the establishment of immune privileged tumor microenvironment. Cancer Cell 2017;31:194–207.
Iribarren K,
Bloy N,
Buqué A,
Cremer I,
Eggermont A,
Fridman WH,
Trial Watch: Immunostimulation with Toll-like receptor agonists in cancer therapy. Oncoimmunology 2016;5:e1088631.
Thank you for sharing this Cancer Immunology Research article.
You are going to email the following Neoadjuvant Interferons: Critical for Effective PD-1–Based Immunotherapy in TNBC
Message Subject (Your Name) has forwarded a page to you from Cancer Immunology Research
Message Body (Your Name) thought you would be interested in this article in Cancer Immunology Research.
Cancer Immunol Res October 1 2017 (5) (10) 871-884; DOI: 10.1158/2326-6066.CIR-17-0150
Protocadherin-18 Regulates TIL Function
Costimulation Enhances Effector Function of Engager T Cells
Viral Immunotherapy for HPV+ Cancer |
Hydrophilic superparamagnetic nanoparticles: Synthesis, characterization, and performance in forward osmosis processes
Title:Hydrophilic superparamagnetic nanoparticles: Synthesis, characterization, and performance in forward osmosis processesAuthors:Ge, Qingchun; Su, Jincai; Chung, Tai Shung Neal; Amy, Gary L.Abstract:Forward osmosis (FO) is an emerging technology for desalination and water reuse. However, a big challenge is finding suitable draw solutes. In this work, we have synthesized magnetic nanoparticles (MNPs), investigated their potential as draw solutes in FO systems, and explored their recovery and reusability. A series of poly(ethylene glycol)diacid-coated (PEG-(COOH)2-coated) MNPs with different size distributions have been synthesized by means of the thermal decomposition method. The physical properties and chemical compositions of the resultant MNPs are fully characterized. Transmission electron microscopy (TEM) analyses show the characteristics of spherical morphology with narrow size distribution, and a mean size from 4.2 to 17.5 nm depending on the ratio of the two starting materials of PEG-(COOH)2 to ferric triacetylacetonate (Fe(acac)3). Vibrating sample magnetometer analyses confirm the magnetic behavior of the PEG-(COOH)2 MNPs. The PEG-(COOH)2 layer on the MNPs ascertained from Fourier transform infrared (FTIR) analysis and thermogravimetric analysis demonstrates a hydrophilic surface composition. The as-prepared PEG-(COOH)2 MNPs exhibit good dispersibility and generate high osmotic pressures in aqueous solutions. Water fluxes of >10 L m-2 h-1 are achieved across Hydration Technologies Inc. flat sheet membranes when deionized water is used as the feed solution. The MNPs can be easily recovered from draw solutions by applying a magnetic field. The MNPs remain active after nine runs of recycle but with a total water flux decrease of 21% due to slight aggregation. Results have demonstrated that using PEG-(COOH)2 MNPs as draw solutes is feasible in the FO process. © 2010 American Chemical Society.KAUST Department:Water Desalination and Reuse Research Center (WDRC); Biological and Environmental Sciences and Engineering (BESE) DivisionPublisher:American Chemical SocietyJournal:Industrial and Engineering Chemistry ResearchIssue Date:5-Jan-2011 DOI:10.1021/ie101013wType:ArticleISSN:08885885Sponsors:We thank King Abdullah University of Science and Technology (KAUST) for financial support (Grant No. R-279-000-265-597). Special thanks are due to Miss Wong Bo Yin Clara, Miss Ming Ming Ling, and Dr. Kaiyu Wang for their valuable suggestions.Appears in Collections:Articles; Water Desalination and Reuse Research Center (WDRC); Biological and Environmental Sciences and Engineering (BESE) DivisionFull metadata recordDC FieldValue Languagedc.contributor.authorGe, Qingchunen
dc.contributor.authorSu, Jincaien
dc.contributor.authorChung, Tai Shung Nealen
dc.contributor.authorAmy, Gary L.en
dc.identifier.doi10.1021/ie101013wen
dc.description.abstractForward osmosis (FO) is an emerging technology for desalination and water reuse. However, a big challenge is finding suitable draw solutes. In this work, we have synthesized magnetic nanoparticles (MNPs), investigated their potential as draw solutes in FO systems, and explored their recovery and reusability. A series of poly(ethylene glycol)diacid-coated (PEG-(COOH)2-coated) MNPs with different size distributions have been synthesized by means of the thermal decomposition method. The physical properties and chemical compositions of the resultant MNPs are fully characterized. Transmission electron microscopy (TEM) analyses show the characteristics of spherical morphology with narrow size distribution, and a mean size from 4.2 to 17.5 nm depending on the ratio of the two starting materials of PEG-(COOH)2 to ferric triacetylacetonate (Fe(acac)3). Vibrating sample magnetometer analyses confirm the magnetic behavior of the PEG-(COOH)2 MNPs. The PEG-(COOH)2 layer on the MNPs ascertained from Fourier transform infrared (FTIR) analysis and thermogravimetric analysis demonstrates a hydrophilic surface composition. The as-prepared PEG-(COOH)2 MNPs exhibit good dispersibility and generate high osmotic pressures in aqueous solutions. Water fluxes of >10 L m-2 h-1 are achieved across Hydration Technologies Inc. flat sheet membranes when deionized water is used as the feed solution. The MNPs can be easily recovered from draw solutions by applying a magnetic field. The MNPs remain active after nine runs of recycle but with a total water flux decrease of 21% due to slight aggregation. Results have demonstrated that using PEG-(COOH)2 MNPs as draw solutes is feasible in the FO process. © 2010 American Chemical Society.en
dc.description.sponsorshipWe thank King Abdullah University of Science and Technology (KAUST) for financial support (Grant No. R-279-000-265-597). Special thanks are due to Miss Wong Bo Yin Clara, Miss Ming Ming Ling, and Dr. Kaiyu Wang for their valuable suggestions.en
dc.publisherAmerican Chemical Societyen
dc.titleHydrophilic superparamagnetic nanoparticles: Synthesis, characterization, and performance in forward osmosis processesen
dc.contributor.departmentWater Desalination and Reuse Research Center (WDRC)en
dc.contributor.departmentBiological and Environmental Sciences and Engineering (BESE) Divisionen
dc.identifier.journalIndustrial and Engineering Chemistry Researchen
dc.contributor.institutionDepartment of Chemical and Biomolecular Engineering, National University of Singapore, Singapore 117576, Singaporeen
kaust.authorAmy, Gary L.en |
The Public Health Disparities Geocoding Project Monograph
Geocoding and Monitoring US Socioeconomic Inequalities in Health: An introduction to using area-based socioeconomic measures
Generating ABSMs
Analytic Methods
Multi-level Modeling
Case Example
U.S. Census Tract Poverty Data
Painting a Truer Picture of the Public's Health
A lack of socioeconomic data in most US public health surveillance systems.
Why is this a problem?
Absent these data, we cannot: (a) monitor socioeconomic inequalities in US health; (b) ascertain their contribution to racial/ethnic and gender inequalities in health; and (c) galvanize public concern, debate, and action concerning how we, as a nation, can achieve the vital goal of eliminating social disparities in health (Healthy People 2010 overarching objective #2)
Possible solution
Geocoding public health surveillance data and using census-derived area-based socioeconomic measures (ABSMs) to characterize both the cases and population in the catchment area, thereby enabling computation of rates stratified by the area-based measure of socioeconomic position. Knowledge gaps
Unknown which ABSMs, at which level of geography, would be most apt for monitoring US socioeconomic inequalities in health, overall and within diverse racial/ethnic-gender groups.
Methodologic study: The Public Health Disparities Geocoding Project
We accordingly launched the Public Health Disparities Geocoding Project to ascertain which ABSMs, at which geographic level (census block group [BG], census tract [CT], or ZIP Code [ZC]), would be suitable for monitoring US socioeconomic inequalities in the health. Drawing on 1990 census data and public health surveillance systems of 2 New England states, Massachusetts and Rhode Island, we analyzed data for: (a) 7 types of outcomes: mortality (all cause and cause-specific), cancer incidence (all-sites and site-specific), low birth weight, childhood lead poisoning, sexually transmitted infections, tuberculosis, and non-fatal weapons-related injuries, and (b) 18 different ABSMs. We conducted these analyses for both the total population and diverse racial/ethnic-gender groups, at all 3 geographic levels.
Our key methodologic finding was that the ABSM most apt for monitoring socioeconomic inequalities in health was the census tract (CT) poverty level, since it: (a) consistently detected expected socioeconomic gradients in health across a wide range of health outcomes, among both the total population and diverse racial/ethnic-gender groups, (b) yielded maximal geocoding and linkage to area-based socioeconomic data (compared to BG and ZC data), and (c) was readily interpretable to and could feasibly be used by state health department staff.Using this measure, we were able to provide evidence of powerful socioeconomic gradients for virtually all the outcomes studied, using a common metric, and further demonstrated that: (a) adjusting solely for this measure substantially reduced excess risk observed in the black and Hispanic compared to the white population, and (b) for half the outcomes, over 50% of cases overall would have been averted if everyone’s risk equaled that of persons in the least impoverished CT, the only group that consistently achieved Healthy People 2000 goals a decade ahead of time. Recommendation
US public health surveillance data should be geocoded and routinely analyzed using the CT-level measure “percent of persons below poverty,” thereby enhancing efforts to track—and improve accountability for addressing—social disparities in health.
State Health Departments that have issued reports using the methodology of the Public Health Disparities Geocoding Project
"The Health of Washington State Supplement: a statewide assessment addressing health disparities by race, ethnic group, poverty and education." September 2004. http://www.doh.wa.gov/HWS
The Virginia Department of Health Epidemiology Profile 2007. http://www.vdh.virginia.gov/epidemiology/DiseasePrevention/Profile2007.htm The 2008 Virginia Health Equity Report. http://www.vdh.state.va.us/healthpolicy/2008report.htm
For a related Canadian analyses, based on 1991 Census of Canada data and deaths from June 4, 1991 to December 31, 2001: Pampalon R, Hamel D, Gamache P. A comparison of individual and area-based socio-economic data for monitoring social inequalities in health. Health Reports 2009:20(4) available at: http://www.statcan.gc.ca/pub/82-003-x/2009004/article/11035/key-cle-eng.htm
This work was funded by the National Institutes of Health (1RO1HD36865-01) via the National Institute of Child Health & Human Development (NICHD) and the Office of Behavioral & Social Science Research (OBSSR).
Copyright © 2004 by the President and Fellows of Harvard College - The Public Health Disparities Geocoding Project. |
Scientists use DNA to ID rarest whale
Print The world's rarest whale, the spade-toothed beaked whale, has been spotted for the first time in New Zealand. The whale stranded and died on a beach in December 2010.
(New Zealand Department of Conservation)
The world's rarest whale has been spotted for the first time, in New Zealand, where two of the whales stranded themselves. The two spade-toothed beaked whales, a mother and calf, stranded and died on Opape Beach on the North Island of New Zealand, in December 2010. The mother was 17 feet long and the calf was 11 feet long. A report describing the whales and the analysis of their DNA appears in the Nov. 6 issue of the journal Current Biology. [pullquote] "Up until now, all we have known about the spade-toothed beaked whale was from three partial skulls collected from New Zealand and Chile over a 140-year period. It is remarkable that we know almost nothing about such a large mammal," Rochelle Constantine, a marine biologist at the University of Auckland in New Zealand, said in a statement. "This is the first time this species has ever been seen as a complete specimen, and we were lucky enough to find two of them." More On This...
Idaho scientist hopes to spot Bigfoot from the sky
Astrophysicist says he has found Superman's home planet
Digging History: The latest 67 discoveries from the ancient world
Artist illuminates science's deep-sea discoveries
At first, the animals were thought to be much more common Gray's beaked whales. Their identity came to light following routine DNA analysis, which was done as part of a 20-year program to collect data on beaked whale species in New Zealand waters. New Zealand is a known hotspot for whale stranding, and it has the highest rates and greatest diversities of stranded whale species in the world, the researchers report. The New Zealand Department of Conservation photographed the animals and collected tissue samples. "When these specimens came to our lab, we extracted the DNA as we usually do for samples like these, and we were very surprised to find that they were spade-toothed beaked whales," Constantine said. "We ran the samples a few times to make sure before we told everyone." The researchers said they have no idea why the whales have remained so elusive. "It may be that they are simply an offshore species that lives and dies in the deep ocean waters and only rarely wash[es] ashore," Constantine said. In Photos: Tracking Humpback Whales Gallery: Creatures from the Census of Marine Life Marine Marvels: Spectacular Photos of Sea Creatures Copyright 2012 OurAmazingPlanet, a TechMediaNetwork company. All rights reserved. This material may not be published, broadcast, rewritten or redistributed. Trending in Science
Scientists 'can't rule out' collision with asteroid flying by Earth in 2029
A bizarre new form of liquid water is discovered 3
Newborn star gorges on a 'space hamburger,' belching spinning jets 5
Amazing space photobomb: SpaceX Dragon and Falcon 9 Rocket photobomb each other |
MBSR (Mindfulness Based Stress Reduction)
Mindfulness based stress reduction, or MBSR, is structured course that teaches participants how to practise mindfulness through simple meditation and movement (based on Yoga stretches & Tai Chi). Developed over the past 30 years, courses teaching mindfulness have been extensively researched and found to have helped many people deal with a wide range of difficulties, from chronic pain to mental distress. They also offer a way of developing positive mental qualities and mental well-being.
Mindfulness has been recommended by the National Institute for Health and Clinical Excellence to help prevent relapse into depression. It is taught in a non-religious format and does not require belief in any spiritual tradition. The programme consists of one orientation session followed by eight two hour sessions in consecutive weeks. You will learn the skill of mindfulness using experiential exercises and gentle Yoga movements alongside a variety of mindful meditations. This will be supported through teaching and group discussion.
Participants will be encouraged to develop their own daily mindfulness practice and will be given a practice to do at home for the remaining 6 days, for approximately 45 minutes per day. You will be provided with audio CDs and a workbook. In joining the course you will be making a commitment, as best you can, to attending all sessions and doing the daily home practice. Making time for this can, at times, feel stressful but we encourage you to work with these difficulties. They are an important part of your journey.
Please note: Participants need to commit to attending all sessions.
Venue: Tara Room, Jamyang Buddhist Centre, 43 Renfrew Road, London SE11 4NA
Course Cost: £250 for evening course, £200 for morning course. Concessions available.
This includes: Introductory evening talk, 8 week course, one full practice day (lunch included), plus guided meditation CDs and a workbook.
Course application form can be found HERE.
· The course is mobility impaired and wheelchair accessible;
· Unfortunately we have no induction loop technology nor people trained in BSL (+British Sign Language) on site, but the course is accessible to the hard of hearing and lip readers;
· The content of the course does not rely on visual presentations so is accessible for the blind and partially sighted.
MBSR DROP IN CLASSES & FULL PRACTICE DAYS
Course graduates are supported and encouraged to continue their practice. A regularly monthly drop in session takes place normally on the last Friday of each month. Course graduates are also welcome to attend Full Practice days which take place at regular intervals throughout the year. Details from the London Centre for Mindfulness (LCfM) website.
Affiliated with FPMT
Find out more about FPMT here, the worldwide organisation Jamyang is affiliated with, or find a centre near you here
Join our monthly newsletter Gentle Voice
You can support Jamyang - please donate with JustGiving
Become a Jamyang Friend
Benefiting ourselves and others |
One of the great composers of the nineteenth century, Schumann was the quintessential artist whose life and work embody the idea of Romanticism in music. Schumann was uncomfortable with larger musical forms, such as the symphony and the concerto (nevertheless, representative works in these genres contain moments of great beauty), expressing the full range of his lyrical genius in songs and short pieces for piano. Schumann's extraordinary ability to translate profound, delicate and sometimes fleeting states of the soul is exemplified by works such as the song cycle Dichterliebe (A Poet's Love), after Heinrich Heine, and his brilliant collections of short piano pieces, including Phantasiestuecke (Fantastic Pieces), Kinderszenen (Scenes form Childhood), and Waldszenen (Forest Scenes). In his songs, as critics have remarked, Schumann attained the elusive union of music and poetry which Romantic poets and musicians defined as the ultimate goal of art.
Schumann's father was a bookseller who encouraged Robert's musical and literary talents. Robert started studying piano at age 10. In 1828, he enrolled at the University of Leipzig as a law student, although he found music, philosophy, and Leipzig's taverns more interesting than the law. He also began studies with a prominent Leipzig piano teacher, Friedrich Wieck. There was serious mental illness in Schumann's family, and the composer, who most likely suffered from a manic-depressive condition, approached madness with the typical Romantic combination of fear and fascination. A compulsive womanizer and a heavy drinker, Schumann led a life that aggravated his psychological problems. His efforts to become a concert pianist failed after he developed partial paralysis of his right hand. According to a conventional story, the injury resulted from Schumann's compulsive use of a finger-strengthening device, but newer research points to mercury poisoning due to treatment for syphilis. Schumann settled on a career as a composer and musical writer, co-founding the influential Neue Zeitschrift fuer Musik and attracting attention early with his prophetic praise of Chopin. Many of his articles take the form of dialogues featuring the "League of David," young artists fighting the "Philistines," and headed by his alter egos "Florestan" and "Eusebius," intended to represent the two contrasting facets one ebullient, the other reserved of his personality. Schumann's music, with its sharp changes in mood, also reflects his tumultuous inner life. Wieck's highly talented pianist daughter Clara grew up and fell in love with Schumann, to her father's horror. Despite Wieck's opposition, Clara and Robert gained the legal right to marry in 1840, a day before Clara's 21st birthday. During this period Schumann composed feverishly. Spellbound by a musical thought, he would work himself to exhaustion, enthusiastically cultivating a particular genre for a period of time. (For instance, 1841 was a "year of songs" in which he brought the Romantic song cycle to its apex). He virtually invented the short, poetic, descriptive Romantic piano work, and produced such works in glorious profusion in the late 1830s. Schumann tackled larger forms in the 1840s, partly at Clara's urging; his four mature symphonies retain a place in the repertoire, but his opera Genoveva failed. He held several musical jobs, teaching at the newly-founded Leipzig Conservatory, eventually becoming town music director in Düsseldorf, but without much success. On February 27, 1854, he threw himself into the freezing waters of the Rhine. After his rescue, he voluntarily entered an asylum. Although he had periods of lucidity, his condition deteriorated, and he died there in 1856, probably of tertiary syphilis. Year / Artwork
Davidsbuendlertaenze Opus 6
Murray Perahia - Piano
Fantasiestuecke Opus 12
Kinderszenen Opus 15
Martha Argerich - Piano
Frauenliebe and -leben Opus 42
Lenneke Ruiten - Soprano
Thom Janssen - Piano
Frauenlliebe und -leben Opus 42
This is the best low-budget LP ever!
Janet Baker - Alo
Martin Isepp - Piano
Symphony No 1 Opus 38 Spring
Gewandhaus Orchestra Leipzig cond. Franz Konwitschny
Renaud Capucon - Violin
Gautier Capucon - Cello
Piano Quintet Opus 44
Soolists
Solists
Andante and variations for two pianos, two cellos and horn
Mischa Maisky - Cello
Nathalie Gutman - Cello
Marie-Luise Neunecker - Horn
Alexandre Rabinovitch - Piano
Andante and variations for two pianos
Gabriela Montero - Piano
Manfred Overture Opus 115
Fantasiestuecke for Flugelhorn and Piano
Sergei Nakariakov - Flugelhorn
Adagio and Allegro Opus 70
Anna Stokes - Flute
Louisa Tuck - Cello
John Reid - Piano
Violin Sonata No 1
Géza Hosszu-Legocky - Violin
Maerchenbildern
Nibuko Imai - Viola
Märchenerzählungen, for clarinet, viola, and piano, Op.132
The Music Party |
NMR thermometer takes reactor's temperature
By Manisha Lalloo23 October 2013
Non-invasive technique can tease out hot and cold spots in reactors to help chemical engineers improve themScientists in the US have used NMR to create temperature maps of reactions taking place inside catalytic reactors. Their technique opens the door to an easy, non-invasive way to discover hot and cold ‘spots’ inside reactors.When optimising the design of reactors, chemical engineers use sensor probes, such as thermocouples, to determine the temperature of the reaction. But, with the most common catalytic reactions occurring between a solid and a gas, introducing a sensor inside the reactor can disrupt gas flow, meaning the parameters measured are, at best, an approximation.NPGA thermal map of gases reacting in a microreactor created using the NMR thermometer‘On a very big reactor if you insert a small probe it’s not a big deal, it doesn’t really affect the flow,’ says Louis Bouchard of the University of California, Los Angeles, US, who led the research. However, when working with microreactors, such as those used in green chemistry, this is no longer the case.Bouchard and his team used a magnetic field gradient across the reactor to determine temperature via NMR. By applying an uneven field they were able to encode for space, as different sites of the reactor experienced a different strength of field. They used NMR to probe the temperature in small ‘pixels’ of the reactor. At higher temperatures gas molecules moved faster, averaging out the magnetic gradient in their ‘pixel’, while at low temperatures gas molecules experienced an array of field strengths due to their static motion. Plotting this motional average allowed the team to accurately measure the temperature at different spots across the reactor.Bouchard used the technique to create millimetre scale temperature maps for the hydrogenation of propylene. The team also demonstrated their technique on an even smaller scale – tens of micrometres – by using parahydrogen as a reactant to increase signal strength.‘We can use our technique to probe the temperature and make sure it’s optimal throughout the whole volume of the reactor,’ says Bouchard. ‘Without this kind of information there are hot spots and cold spots, whereas ideally you’d like it to be uniform throughout the reactor.’Kai Jarosch, catalyst manager at Velocys, says: ‘Making temperature measurements in fixed bed reactors is always a balance between observing the situation and disturbing the situation. Getting this balance right is particularly important in applications such as microchannel and minichannel reactors where the physical dimensions of your catalyst, reaction channel and measurement device are of the same order of magnitude. [Bouchard’s technique] promises to provide a new route to model validation, as well as providing direct insight into the behaviour of small packed beds.’‘Microcatalytic reactors are very exciting new tools for the efficient syntheses of a number of chemicals,’ adds Jeffrey Reimer, a chemical engineer at the University of California, Berkeley, US. Reimer says this non-invasive method could provide new insight into these novel reactors.The team now hope to apply their technique to other systems, such as multi-step reactions, as well as using it to screen a number of different catalysts in parallel.References N N Jarenwattananon et al, Nature, 2013, DOI: 10.1038/nature12568 No comments
Related ArticlesResearchSolid 3D NMR evidence reaches the surface23 January 2017200-fold signal boost means silica spectroscopy could communicate catalyst configurations |
PreHypertenion: Does It Really Matters?
Picture source: http://ww1.prweb.com Even High-But-Normal Blood Pressure Elevates Stroke RiskPeople with prehypertension have a 55 percent higher risk of experiencing a future stroke than people without prehypertension, report researchers at the University of California, San Diego School of Medicine in a new meta-analysis of scientific literature published in the September 28 online issue of the journal Neurology. Prehypertension is clinical category created by experts in 2003 to describe patients whose blood pressure was elevated, but still considered within normal range. Hypertension or abnormally high blood pressure is a major risk factor for cardiovascular disease and strokes, but much less is known about the health threat posed of prehypertension, which is defined by a systolic pressure reading between 120 and 139 mmHg (the top number) and a diastolic reading between 80 and 89 mm Hg (the bottom number) “The experts reasoned that, generally speaking, the higher the blood pressure, the greater the risk of death and disease, possibly starting from within the normal blood range,” said Bruce Ovbiagele, MD, professor of neurosciences at UC San Diego School of Medicine and senior author of the study. However, Ovbiagele said, conclusive evidence was lacking, “so we decided to compile all the published studies in the scientific literature to date, and using statistical techniques find out if there is indeed a higher risk of future stroke in people with prehypertension, the extent of that risk, and whether particular characteristics were associated with higher stroke risk.” The researchers identified 12 relevant prospective cohort studies of prehypertension. All of the studies were derived from the general population. Four were from the United States, five from Japan, two from China and one from India. Combined, the studies involved more than 518,000 participants and covered periods ranging from 2.7 years to 32 years, with stroke occurrences documented. The prevalence of prehypertension in the studies ranged from 25 to 46 percent. In the United States, it’s estimated roughly one-third of adults have prehypertension. “Overall, people who had prehypertension (in the studies) were at a 55 percent higher risk of experiencing a future stroke than people without prehypertension,” said Ovbiagele. “This result held regardless of sex, race-ethnicity, blood pressure type (systolic or diastolic) or the type of stroke (ischemic or hemorrhagic).” The health risk was measurably greater for those whose blood pressure levels were at the high end of the “normal” spectrum. “We found that those people who fell within the higher range of prehypertension were at 79 percent higher risk of experiencing a future stroke,” Ovbiagele said. The findings should add clarity to the perceived health risk of prehypertension, said Ovbiagele. “Prehypertension has been controversial since its inception, with occasional accusations that it would not be used to diagnose sick people, but rather it would label healthy people whose blood pressure was towards the upper reaches of normal as unhealthy, without any compelling reason for doing so. Others complained that the new designation would needlessly expose people to blood pressure-reduction drugs, all to the benefit of pharmaceutical companies.” Thomas Hemmen, MD, PhD, director of the UC San Diego Stroke Program and a neurologist at the UC San Diego Sulpizio Cardiovascular Center who was not involved in the study, described it as “ground-breaking.” “Over the years, the blood pressure range identified as increasing stroke and cardiovascular risk has been lowered,” Hemmen said. “Now anything that’s above 115 is thought to increase risk. But we need more tools for diagnosing prehypertension. We need to learn more so that we can adjust risk and develop therapies. Hopefully, this study will lead to more research.” Both Hemmen and Ovbiagele note little empirical evidence exists to show that taking blood pressure-reducing drugs can prevent future strokes. “There just haven’t been any large studies,” Hemmen said. On the other hand, both doctors say the new findings should encourage persons with high-but-normal blood pressure to change unhealthy behaviors. “Young and middle-aged persons should check their blood pressure regularly. If they do fall into the higher range of prehypertension, they should take specific steps to modify their lifestyle, such as reducing salt intake and maintaining a normal weight,” said Ovbiagele. “Modifying one's lifestyle is relatively safe and could potentially lower not just the risk of future strokes, but possibly other complications of prolonged elevation of blood pressure, including heart attacks, heart failure and kidney disease.” Story Source: The above story is reprinted (with editorial adaptations by The Zestzfulness Team) from materials provided by the University of California – San Diego news Centre Journal Reference: M. Lee, J.L. Saver, B. Chang, K.-H. Chang Q. Hao and B. Ovbiagele. Presence of baseline prehypertension and risk of incident stroke A meta-analysis. Neurology, 2011 DOI: 10.1212/WNL.0b013e3182315234
Omega-3 & Osteoarthritis
Dick Smith?
Simple Lifestyle Changes Can Add a Decade or More ...
Kylie Minogue and the Giant Teddy Bear
Picture credit: http://static.ctia.in/images/artic...
HDL Yang Tinggi Menurunkan Risiko Kardiovaskular p...
AISO DONO LAH
Bersenam Sama Baik Sebagai Ubat Untuk Mencegah Mig...
Guidelines for Infant Sleep Safety and SIDS Reduct...
Sarah McKenzie
Deng Shen Khoo
Eating Your Greens Can Change the Effect of Your G...
Zestz for LAUGHS - Great Truths
Vitamin E Supplement May Increase Prostate Cancer ...
Celebrating the PRESENT : No Wants To Die
Higher HDL Lowers Cardiovascular Risk in Type 2
Zestz for LAUGHS - At The Pharmacy
Health Tip: Understanding Breast Cancer in Men
Exercise Just as Good as Drugs at Preventing Migra...
MENITIS SELEPAS KENCING (KENCING TIDAK 'TOS')
Smokers Twice as Likely to Have Strokes
Zestz for LAUGHS : Edwin's New Cell Phone
Zestz for LAUGHS - IT Sex
Even Minimal Exercise Reduces Mortality Risk In Me...
排尿过后的淌滴
Early to Bed and Early to Rise: It's Keeping Kids ...
Alcohol Impairs the Body's Ability to Fight Off Vi...
High Blood Pressure A Risk Factor For Cancer
Spicing Up Broccoli Boosts Its Cancer-Fighting Pow...
The Four Principles of Spirituality |
Antibody-based drug helps 'bridge' leukemia patients to curative treatment
Study reports complete cancer remission rate higher than conventional chemotherapy for acute lymphoblastic leukemia
In a randomized Phase III study of the drug inotuzumab ozogamicin, a statistically significant percentage of patients with acute lymphoblastic leukemia (ALL) whose disease had relapsed following standard therapies, qualified for stem cell transplants.
Inotuzumab ozogamicin, also known as CMC-544, links an antibody that targets CD22, a protein found on the surface of more than 90 percent of ALL cells. Once the drug connects to CD22, the ALL cell draws it inside and dies.
The study, which revealed complete remission rates of nearly 81 percent and significantly longer progression-free and higher overall survival rates than with standard therapies, was conducted at The University of Texas MD Anderson Cancer Center. Study findings were reported in the June 12 online issue of the New England Journal of Medicine.
"Forty-one percent of ALL patients in the study were able to proceed to transplant after receiving inotuzumab ozogamicin compared with the 11 percent we have seen qualify through standard chemotherapy," said Hagop Kantarjian, M.D., chair of Leukemia. "Given that stem cell transplant is considered the only curative treatment option, the ability of inotuzumab ozogamicin to increase the number of patients able to bridge to transplant is encouraging."
Donor stem cell transplants generally are considered curative for this aggressive form of leukemia with more than 6,500 American adults expected to be diagnosed with the disease in 2016. However, patients must be in complete remission before they are eligible for transplant.
Current therapies for adults with newly diagnosed B-cell ALL result in complete remission rates (CR) of 60 to 90 percent. However, many of those patients will relapse and only about 30 to 50 percent will achieve long-term, disease-free survival lasting more than three years.
"Standard chemotherapy regimens result in complete remission in 31 to 41 percent of patients who relapse earlier, and just 18 to 25 percent in those who relapse later," said Kantarjian. "Patients in the inotuzumab ozogamicin study had remission rates of 58 percent, higher than previously reported, possibly due to patients being treated later in the disease course."
The study reported moderate side effects, the most common being cytopenia, a disorder that reduces blood cell production, and liver toxicity. Funding was provided by Pfizer, Inc.
Materials provided by University of Texas M. D. Anderson Cancer Center. Note: Content may be edited for style and length.
Hagop M. Kantarjian, Daniel J. DeAngelo, Matthias Stelljes, Giovanni Martinelli, Michaela Liedtke, Wendy Stock, Nicola Gökbuget, Susan O’Brien, Kongming Wang, Tao Wang, M. Luisa Paccagnella, Barbara Sleight, Erik Vandendries, Anjali S. Advani. Inotuzumab Ozogamicin versus Standard Therapy for Acute Lymphoblastic Leukemia. New England Journal of Medicine, 2016; DOI: 10.1056/NEJMoa1509277
University of Texas M. D. Anderson Cancer Center. "Antibody-based drug helps 'bridge' leukemia patients to curative treatment: Study reports complete cancer remission rate higher than conventional chemotherapy for acute lymphoblastic leukemia." ScienceDaily. ScienceDaily, 12 June 2016. <www.sciencedaily.com/releases/2016/06/160612105823.htm>.
University of Texas M. D. Anderson Cancer Center. (2016, June 12). Antibody-based drug helps 'bridge' leukemia patients to curative treatment: Study reports complete cancer remission rate higher than conventional chemotherapy for acute lymphoblastic leukemia. ScienceDaily. Retrieved May 28, 2017 from www.sciencedaily.com/releases/2016/06/160612105823.htm
University of Texas M. D. Anderson Cancer Center. "Antibody-based drug helps 'bridge' leukemia patients to curative treatment: Study reports complete cancer remission rate higher than conventional chemotherapy for acute lymphoblastic leukemia." ScienceDaily. www.sciencedaily.com/releases/2016/06/160612105823.htm (accessed May 28, 2017).
Monoclonal Antibody Drug Superior to Chemotherapy for Advanced Acute Lymphoblastic Leukemia
Mar. 1, 2017 A Phase III clinical trial involving 101 centers in 21 countries revealed the monoclonal antibody blinatumomab to be more effective than standard chemotherapy for treatment of advanced acute ... read more Combining Targeted Drug With Chemotherapy Offers Longer Life to B-Cell Cancer Patients
May 30, 2015 Because of the significant benefit found in combining the targeted drug ibrutinib with standard chemotherapy for relapsed chronic lymphocytic leukemia or small lymphocytic lymphoma, an interim ... read more Personalized Cellular Therapy Achieves Complete Remission in 90 Percent of Acute Lymphoblastic Leukemia Patients Studied
Oct. 15, 2014 Ninety percent of children and adults with acute lymphoblastic leukemia who had relapsed multiple times or failed to respond to standard therapies went into remission after receiving an ... read more Sequential GO, Chemotherapy No Benefit for Older AML Patients According Trial
Oct. 22, 2013 Results of a randomized, phase III, trial show that sequential combination of gemtuzumab ozogamicin (GO) and standard chemotherapy provides no benefit for older patients with acute myeloid leukemia ... read more RELATED TERMS
Adult stem cell
Embryonic stem cell |
Wende Museum To Open The World's Largest Cold War Visual Archive In Historic Armory Building In Culver City, California
100,000 EASTERN EUROPEAN ARTIFACTS FROM 1949-1989 TO BE UNVEILED IN SUMMER 2014
CULVER CITY, Calif., Feb. 12, 2013 /PRNewswire/ -- The Wende Museum's archive of 100,000 artifacts and artworks from the Cold War era—the largest and most diverse collection of its kind in the world—will open summer 2014 in a new permanent home at the former National Guard Armory building in Culver City, California.The Wende's 75-year lease of the Culver City-owned Armory—a 1950 Cold War modernist structure—will be renovated in three phases, including a future addition of 20,000 square feet of storage and exhibition space on the one-acre property.The Wende was founded in 2002 by cultural historian Justinian Jampol to preserve the material culture of Cold War Eastern Europe and the Soviet Union—particularly East Germany—that quickly disappeared with the toppling of the Berlin Wall in 1989. The Museum's holdings are currently housed in three Southern California warehouses with public access limited to 1% of the collection. "The Wende collection is unparalleled," said Benedikt Taschen, the CEO and Founder of TASCHEN, who will publish an 800-page book on The Wende's East German collections in 2013.
The Wende Museum's collections and programs provide insight into the Cold War's socio-political realities and the personal histories of its populace. In addition to remnants of Checkpoint Charlie and the world's longest stretch of the original Berlin Wall in the United States, the collection includes paintings, photographs, posters, and films; experimental furniture and applied arts; decorative ceramics and sculptures; clothing, textiles, and tapestries; flags, banners and signs; books, scrapbooks, newspapers and magazines; and extensive East German and Soviet surveillance and communications equipment.Highlights from the collection include a ten-foot bronze sculpture of Lenin by the preeminent Russian artist Pavel Bondarenko, a complete set of the East German newspaper Neues Deutschland, and the personal papers, notes, and the Moabit prison manuscript of Erich Honecker, the notorious leader of East Germany.The Wende is a hybrid museum and educational institution with interdisciplinary resources for scholars, journalists, students, artists, and lifelong learners. The Museum's "Historical Witness Project" compiles oral histories from a cross section of inhabitants from Eastern Europe and the former Soviet Union. The Museum's internship program, sponsored in part by the Getty Trust, educates and trains students from regional and international universities. "Our new home at the Armory will make the collections accessible to the public and enhance the Wende's role as a center for cultural discovery," said Jampol.The Armory Building is located at 10808 Culver Boulevard in Culver City's cultural corridor that includes Sony Pictures Studios and the City's downtown restaurant hub. The Wende's main warehouse is currently located in Culver City at 5741 Buckingham Parkway. A capital campaign is being developed to match a $5 million lead gift from London-based Arcadia Fund, a private UK foundation whose mission is to protect endangered treasures of culture and nature (Please see www.arcadiafund.org.uk). For more information, call 310-216-1600 or go to www.wendemuseum.org.SOURCE The Wende Museum Published February 12, 2013 Reads 247 Copyright © 2013 SYS-CON Media, Inc. — All Rights Reserved.
Hitrons Solutions Inc. is distributor in the North American market for unique products and services of small and medium-size businesses, including cloud services and solutions, SEO marketing platforms, and mobile applications.Aug. 30, 2016 11:45 AM EDT Reads: 804read more & respond »MORE » Latest Stories[session] How to Monetize Your DataBy Elizabeth WhiteAug. 30, 2016Speaking Opportunities in Silicon ValleyBy Pat RomanskiAug. 30, 2016Gearing up for Digital TransformationBy PagerDuty BlogAug. 30, 2016DevOps and Docker Reference ArchitecturesBy Derek WeeksAug. 30, 2016[session] Hadoop in the CloudBy Pat RomanskiAug. 30, 2016A Guide to No Code, Low Code AppsBy Liz McMillanAug. 30, 2016The IoT for the Rest of UsBy Christopher HarroldAug. 30, 2016[session] Virtualized Apps and Private CloudBy Elizabeth WhiteAug. 30, 2016Cloud Is Now Seen as a Way to Better SecurityBy Dana GardnerAug. 30, 2016How to Sponsor @ThingsExpo By Elizabeth WhiteAug. 30, 2016Solving the Storage ProblemBy Stefan BernboAug. 30, 2016How Not to Build a CloudBy Christopher KeeneAug. 30, 2016When Compliance Comes Down to Security By Fouad KhalilAug. 30, 2016StarNet Adds Linux and Unix Desktops to X-Win32By Pat RomanskiAug. 30, 2016StarNet Communications to Exhibit at Cloud ExpoBy Elizabeth WhiteAug. 30, 2016 |
Maintaining Functioning Urban Ecosystems Can Significantly Improve Human Health and Well-Being
Kathryn Campbell, Victoria.
7 November 2012 Essay, Science & ToolsBiodiversity, Development, Ecosystem services, JusticeKathryn Campbell
With the global urban population expected to double to around 6.5 billion by 2050, the future outlook for biodiversity can be positive, particularly if biodiversity is seen as a part of the solution to some of our most urgent development challenges. Biodiversity underpins the functioning of the ecosystems on which we depend for our food and fresh water; aids in regulating climate, floods and diseases; provides medicines (traditional and modern components); offers recreational opportunities, mental health benefits and spiritual enrichment; and supports services such as soil formation, photosynthesis and nutrient cycling. Biodiversity also contributes to local livelihoods and economic development. All human health depends, ultimately, on ecosystem services that are made possible by biodiversity, ecosystems, and the products derived from them.
Given that the current trends for biodiversity loss are bringing us closer to a number of potential tipping points that would catastrophically reduce the capacity of ecosystems to provide the essential services upon which we all depend for our health and well-being (see Global Biodiversity Outlook 3, 2010), the predicted tripling of the global urban area between 2000 and 2030 has potentially grave impacts on biodiversity, ecosystems and human health. In addition, many of the possible consequences are likely to be most acute for the poor and marginalized, as they are more likely to rely directly on biodiversity and associated ecosystem services for their very survival. Although the impact on vulnerable populations may be more visible, all human populations are ultimately dependent on ecosystem services, and global urbanization will have knock-on effects for human health and development.
A standard of living adequate for the highest attainable level of health is often considered as a basic human right and therefore one of the most important indicators of development. As defined by the World Health Organization (WHO), health does not just mean freedom from illness, but a state of complete physical, mental and social wellbeing. Some suggest that a healthy environment should also be a basic human right and according to a recent Docs Talk blog by Dr. David R. Boyd, protection for the environment is already recognized as a right by ninety-five countries.
Many of the great development challenges, such as global environmental change, climate change and biodiversity loss, as well as food and water security, can be approached by considering the inter-linkages between human health, biodiversity and ecosystem services. Cities are critical laboratories for this kind of thinking. Because of the speed at which the world’s urban areas are expanding, and given that much of this is occurring in biodiversity hot spots (particularly Figure 1 in this link), there is a great opportunity to conduct further research on biodiversity-health connections and improve human health in cities through biodiversity conservation and ecosystem restoration.
Links between biodiversity and health
The linkages between biodiversity, ecosystem services and human health are complex and our understanding of the cause and effect relationships is continuing to develop. The reports of the Millennium Ecosystem Assessment (2005) and the Intergovernmental Panel on Climate Change (2007) highlighted that human health is affected by the state of the global environment and the health of ecosystems. Then in 2008, the highly acclaimed ”Sustaining life: How our health depends on biodiversity” by Dr. Eric Chivian and Dr. Aaron Bernstein at the Center for Health and the Global Environment, Harvard School of Public Health, was published with contributions from 100 leading scientists. In terms of the existing scientific literature on the specific relationships between human health, ecosystems and biodiversity, there are a number of potential mechanisms proposed and evidence is usually drawn from specific case studies.
A direct example of the linkages are the outbreaks of many diseases, including SARS, Ebola, hanta viruses, malaria, and the HIV pandemic, which have underlying causes related to human impacts on wildlife and ecosystems, such as land-use change, human encroachment into wilderness areas, and unsustainable bushmeat and livestock trade (Keesing et al. 2010). As a result of the relationship between biodiversity loss, ecosystem change and the emergence and spread of diseases, management can be viewed as an opportunity to conserve biodiversity and reduce health impacts by tackling the underlying causes (see Campbell et al. 2012).
Given these inextricable links between biodiversity, human populations and health, the Secretariat of the Convention on Biological Diversity (CBD) is undertaking a range of activities, with the vital support of partners, that further highlight these linkages and that support collaborative implementation.
1. A joint WHO Discussion Paper entitled Our Planet Our Health, Our Future, was launched at Rio+20 in June 2012 which examines the increasing opportunities for linking human health in the context of the three Rio Conventions (the United Nations Conventions on Biodiversity, Climate Change and Desertification) and highlights the opportunity to achieve further implementation of the Conventions and to contribute to improved human health outcomes;
2. The commencement of a series of regional capacity-building workshops, with the first for the Americas held in September 2012 and further workshops being planned for 2013 and 2014; and
3. A new Guide to Biodiversity and Health linkages, which acts a primer on these issues.
Of particular interest to many readers of this blog will be the recent launch of the Cities and Biodiversity Outlook: Action and Policy (CBO) at the Cities for Life Summit, which ran in parallel to the 11th meeting of the Conference of the Parties to the CBD (COP 11) on 15 October in Hyderabad, India.
CBO book cover.
CBO was produced by the Stockholm Resilience Centre, the Secretariat of the CBD and ICLEI (Local Governments for Sustainability), with contributions by more than 120 experts worldwide. The key messages and some of the highlights were the subject of a previous blog on The Nature of Cities by Thomas Elmqvist, from the Stockholm Resilience Centre, on 3 October 2012.
As outlined in CBO, urbanization does not have to be accompanied by increased traffic congestion, greater air pollution and more sedentary and isolated lifestyles without nature. There are opportunities for urban ecosystems to improve human health and for cities to conserve and restore ecosystems by considering the way our cities are designed, the way we live in cities and the policy decisions of cities and local authorities. As stated in CBO as key message 4, “maintaining functioning urban ecosystems can significantly improve human health and well-being”.
Urban expansion can better utilize nature-based solutions to reduce impacts on biodiversity and improve human health. Photo: Kathryn Campbell
Although some health and ecosystem service links may be more obvious, such as disease regulation and emergence, there are other connections that are less obvious, including the alarming rise in non-communicable diseases (NCDs) and benefits for biodiversity that can be achieved in parallel. More than 36 million people die every year from NCDs and almost 80% of NCD deaths now occur in low- and middle-income countries. With the projected number of deaths per year expected to reach 44 million deaths per year by 2020, this is a global health epidemic. The current evidence suggests that NCDs can largely be prevented through lifestyle decisions, such as increasing our dietary diversity, which can promote awareness of the value of biological diversity for food and nutrition and can lead to the improved protection of species, their genetic diversity and ecosystems; and getting more regular physical exercise, which can reduce greenhouse gas emissions, encourage greater appreciation of the environment, and benefit mental, physical, and emotional health as more time is spent in natural settings.
Case studies that illustrate the connection between design, ecosystems and human health
Case Study 1: The Healthy Parks, Healthy People Approach
Parks Victoria, a park management agency of the State Government of Victoria, Australia, launched the “Healthy Parks, Healthy People” (HPHP) approach in 2000. The goal was to emphasize the value of visiting parks and natural open spaces for the benefits they provide as healthy places for body, mind, and soul. Similar approaches have now developed around the world, including in Canada, the UK, and the USA. The Melbourne initiative that emerged from the first International HPHP Congress declared that parks are “integral to healthy people and a healthy environment” and that “human health depends on healthy ecosystems”. The Congress was also the springboard to a partnership with a national health insurance provider, which is now funding public preventative health activities and establishing a network of health professionals to encourage people to increase their physical activity by engaging in activities in parks.
The Healthy Parks, Healthy People concept is also being adapted to developing countries, beginning with HPHP Nepal, a partnership involving the International Union for Conservation of Nature, Parks Victoria, and the Nepalese government. A 2010 workshop in Kathmandu highlighted that HPHP and resulting lessons learned could indeed be applied in countries with different socioeconomic contexts. As Dr. Chhatra Amatya,
chairman of Chhahari Nepal for Mental Health, explained, “HPHP is all the more needed in a country like Nepal. Our children do not have space to play a game in a city”.
Visitors getting active in Melbourne’s urban parks network (Australia). Photos by Parks Victoria
(Reproduced from Cities and Biodiversity Outlook: Action and Policy, 2012)
Case Study 2: The Many Benefits of Urban and Peri-Urban Agriculture
Raising local crops and livestock can increase knowledge of and interest in the biophysical and food-growing processes, empower citizens to influence sources of food production, strengthen links to local food systems, and encourage healthier lifestyle choices. Greater food self-reliance, cheaper food prices, greater accessibility to fresh and nutritious products, and poverty alleviation are all key benefits that can arise from urban agriculture with sound decision-making and planning of the cities’ ecosystems. The advantages of urban and peri-urban agriculture have been noted by the UN Food and Agriculture Organization (FAO) and by the World Health Organization’s
There can be many benefits for health and biodiversity from well-planned and managed urban and peri-urban agriculture initiatives. Photo: Kathryn Campbell
Healthy Cities Programme, which appeals to local governments around the world to include urban and peri-urban agriculture in their urban plans.
Case Study 3: More Trees, Less Childhood Asthma: New York City
Rates of childhood asthma in the USA increased by 50 percent between 1980 and 2000, with the highest rates reported in poor urban communities. In New York City, where asthma is the leading cause of hospitalization among children under age 15, researchers at Columbia University studied the correlation between numbers of trees on residential streets and incidences of childhood asthma. They found that as the number of trees rose, the prevalence of childhood asthma tended to fall, even after data were adjusted for sociodemographics, population density, and proximity to pollution sources. How might trees reduce the risk for asthma? One explanation is that they help remove pollutants from the air. Another is that trees may be more abundant in neighborhoods that are well maintained in other ways, leading to lower exposure to allergens that trigger asthma. Yet another is that leafy neighborhoods encourage children to play outdoors, where they are exposed to microorganisms that help their immune systems develop properly. Further studies will provide a clearer picture of whether street trees really do make for healthier children. New York City is currently in the midst of planting a million new trees by 2017.
City and Subnational Biodiversity Summit, 15 and 16 October 2012
In addition to the launch of the Cities and Biodiversity Outlook (CBO) at the City and Subnational Biodiversity Summit at COP 11, the event was a demonstration of the strong commitment and the contribution that can be made by these levels to achievement of the Strategic Plan for Biodiversity 2011 – 2020 and its 20 Aichi Biodiversity Targets.
The Cities for Life Summit attracted more than 400 participants from 45 countries, including 60 mayors and governors. There were more than 50 presentations that highlighted a wide variety of themes including, among others, vertical cooperation between levels of government; progress on the Plan of Action on Local and Subnational Action for Biodiversity; support for the principle of greater integration and mainstreaming of biodiversity into other sectors including health, economic development, tourism and culture; and existing and potential activities at city and subnational levels. At its conclusion, the participants adopted the Hyderabad Declaration on Subnational Governments, Cities and other Local Authorities for Biodiversity which further supports their work towards achievement of the Strategic Plan for Biodiversity and seeks greater coordination between different levels of government.
Ways Forward
Our fundamental reliance on ecosystem services offers significant opportunities to more consistently recognize biodiversity and ecosystem services for human health and to contribute to biodiversity conservation in cities. Although the linkages between biodiversity, ecosystem services and human health are complex, an increasing focus on inter-disciplinary research is aiming to develop a more thorough understanding of the linkages between ecosystem services and the conditions under which health and environment co-benefits can be achieved, as well as the development of robust predictions of the health impacts of different approaches to ecosystem management (for example, the DIVERSITAS EcoHealth activities; and the Health & Ecosystems: Analysis of Linkages (HEAL) initiative. Further examination of these linkages in the context of cities would be another significant step forward.
There is increasing awareness of and interest in the inter-linkages between human health and ecosystem functioning and growing support for collaboration (for example Cooperation on Health and Biodiversity Initiative, COHAB. The impact on cities of using current knowledge in policy, and supporting emerging research, that leads to implementation can be substantial and far-reaching, particularly considering that approximately 60% of the projected total urban area in 2030 is yet to be constructed. We need to collectively seize this opportunity for the health of current and future generations and of the planet.
Kathryn has 20 years experience in protected areas and natural resource management with local authorities, sub-national governments and as a small business owner in Australia. She likes exploring new cities, spending time in nature with her family, and trying to knit and sew.
Manager, Healthy Parks Healthy People
Parks Victoria, Australia
Kathryn Campbell is Manager Healthy Parks Healthy People for Parks Victoria, having recently returned to Australia from a two year term as Programme Officer for Biodiversity and Health activities at the Convention on Biological Diversity (UNEP), in Montreal, Canada. Her work with Parks Victoria focuses on integrating the health benefits of parks and nature into everyday lives of Victorians so that they can reap the physical, mental and spiritual benefits of time spent in nature; healthy parks healthy people. She partners with governments, organizations and institutions and covers aspects of policy, programs, politics and implementation. Kathryn has 20 years experience in protected areas, parks and natural resource management with local authorities, sub-national governments and as a small business owner in Australia. Kathryn holds a Master’s degree in Environmental Science from Monash University and a Bachelor’s degree in Zoology from the University of Melbourne. She likes exploring new cities, spending time in nature with her family, and developing her visual arts skills that are inspired by nature.
View all posts by Kathryn Campbell →
← The Green Leap: Can We Construct Urban Communities that Conserve Biodiversity? Putting Nature Back Into the Natural Beauty of Rio de Janeiro →
4 thoughts on “Maintaining Functioning Urban Ecosystems Can Significantly Improve Human Health and Well-Being”
Pingback: More Trees in Urban Spaces Linked to Less Childhood Asthma | BioBE
Pingback: Working Beyond Park Boundaries to Benefit Public Health in Victoria, Australia | The Nature of Cities
Pingback: A Green Dream to Counter “Greenwashing” in Brazilian Cities | The Nature of Cities
Pingback: Let’s Reinvent the Wheel: Helping Local Governments Protect Nature | The Nature of Cities
An Antidote for the Unjust City: Planning to Stay
Mindy Thompson Fullilove, New York City
In 1993 or thereabouts I entered a contest for women to depict what they did on a particular day. That day, I went to meetings early in the morning at Harlem Hospital. I took photos of the abandoned buildings on West 136th, where I parked my car, and photos of...
How To Build a New Civic Infrastructure
Ben Hecht, Washington
In the United States of America cities have long been gateways to opportunity. For centuries, people from all over the country and the world, including my own grandparents, came to our cities chasing the promise of a better life. America’s bargain with its citizens, rich and poor was, in many...
Karachi and the Paralysis of Imagination
Mahim Maher, Karachi
You want to read about a vision of a just Karachi? The contract killer ($50 a hit) ripping up the road behind Disco Bakery on his Honda 200CC and the secret service colonel cracking skulls in a Clifton safehouse will both cite one vision: Dubai. This happens to also be the...
6 February 2013 Biodiversity and the City—Challenges for India Harini Nagendra, Bangalore
A predominantly rural country, India is rapidly urbanizing. Although only 30% of India’s population lives in cities now, this proportion is expected to increase to 50% in the next two decades. It is becoming increasingly important, therefore, to have a...
28 September 2014 Neighborhood Planning for Resilient and Livable Cities, Part 1 of 3: Why Do Neighborhoods Matter and Where Are We Going Wrong? Jayne Engle, Montreal
Nik Luka, Montreal
Jane Jacobs said: ‘Cities have the capability of providing something for everybody, only because, and only when, they are created by everybody.’ To embrace this idea that everyone has to be involved in creating cities is to recognize the vitality of neighborhoods as the scale at which most people relate to the city in their daily lives. Neighborhoods are, in...
5 January 2017 How a Little Endangered Fox Found Sanctuary in a California Oil Town Madhusudan Katti, Raleigh
If I were to ask you where I could find a healthy population of the endangered San Joaquin Kit Fox, you might be forgiven for not immediately saying, “Why, Bakersfield, of course!” Bakersfield? The Oil Capital of California? Yes, the very...
20 November 2016 A Barley Field Grows on Soviet Concrete Andrea Tamm and Ann Press, Tallinn
In the summer of 2016, the largest Soviet-era residential area of Estonia was living a new life. The district Lasnamäe, including Estonia’s capital city, Tallinn, was built in the late 70s, but it has fallen into stagnation. Little has changed...
Networks Planning Value Water Participation/Democracy Parks Justice Sustainability Conservation Livability Experiencing Nature What is urban nature? Awareness Biophilia Biodiversity Health Wildlife People Interactions Resilience Africa Art Education/Knowledge/Learning Stewardship Wetlands/Rivers/Streams South America Architecture North America Gardens Ecosystem services Culture Policy Asia Tools Pollution Disasters/Red zone Communities Design Landscape Development Climate change Economics |
to save this paper Pathways into and out of Poverty: A Study of Household Wealth Dynamics in Rural Kenya
Listed author(s):Muyanga, Milu
Jayne, Thomas S.
Burke, William J.
Registered author(s): William J. Burke Thomas S. Jayne Abstract For the past half-century, African governments and development agencies have experimented with a series of alternative approaches for addressing rural poverty, each giving way to a new paradigm as the persistence of poverty created disillusionment with prevailing approaches. These broad strategies included ‘growth and trickle down’ in the 1960s; basic human needs and state-led integrated rural development in the 1970s; structural adjustment and economic liberalization in the 1980s and 1990s; and, since 2000, a heterodox mix of donor budget support to empower government ownership in the design of participatory poverty reduction strategies, and resurgent interest in agricultural development. However, rural poverty in most of Sub-Saharan Africa appears to be declining only marginally. Yet some smallholder farm households have successfully climbed out of poverty, thus providing an opportunity to learn about the economic pathways that might enable other rural smallholders to do so. Conversely, some households that were once non-poor have now descended into poverty. If researchers and policy makers knew more about the factors associated with these dynamics, it might be possible to replicate these factors more broadly through poverty reduction strategies. The recent availability of longitudinal survey data provides a new means to analyze the dynamics of household asset accumulation and decumulation. This paper identifies the factors associated with smallholder farm households having ascended out of poverty or descended into poverty. Using a nationwide balanced panel of 1,256 farm households in 22 districts in Kenya interviewed in 1997, 2000, 2004 and 2007, we find that a relatively small fraction of the sample experienced either an appreciable improvement or decline in their relative asset wealth over this 10-year period. Over 70 percent of the sampled farm households are in roughly the same wealth position as they were 10 years earlier, although more households experienced an increase in asset wealth than a decline, which is consistent with Government of Kenya findings of declining national poverty rates over the same general period. For the 25 percent of households that did experience an appreciable change in asset wealth between 1997 and 2007, we revisited 84 of these households in 2008 with more detailed retrospective “life history” surveys to capture a wider range of factors influencing current household livelihoods. Households successfully accumulating assets and rising out of poverty (i) were more likely to have remained healthy and suffer no unexpected deaths during the decade prior to the start of the initial survey in 1997; (ii) were not adversely affected by mortality that did occur during the panel period; (iii) were consistently headed by a male; (iv) received relatively more land from their parents at the time the household was formed; and (v) parents who were relatively well-off and educated. Moreover, the ascenders were able to acquire more land, cultivate 70% more land, and increase their use of fertilizer over the 2000-07 period, consistent with the overall agricultural and economy-wide growth in Kenya that occurred during the 2004-2007 period. Among households reporting a significant decline in asset wealth, roughly half experienced unexpected shocks, such as premature death and chronic illness. These households reported spending 22% of their annual incomes and 47% of their assets on medicines and caregiving. Households with declining asset trajectories were also more likely to have turned from male to female headed due to male mortality, have two or more wives in the household, poorly educated household heads, fathers of household heads who were relatively uneducated, and relatively little land and other assets inherited from parents. Small inheritances among the “descenders” can be traced to a smaller amount of land per number of sons of the household head’s father. The descenders also tended to lose land and animal assets over the panel period (in some cases due to disease and need to pay for medical expenses) in sharp contrast to the ascenders. Perhaps surprisingly, the descenders were more likely to use fertilizer, had higher fertilizer application rates per acre cultivated, and were more likely to receive agricultural credit than the ascender households. Consistently better-off households were more likely to (i) have been male headed; (ii) have members with secondary and/or post-secondary educations; (iii) not be polygamous; (iv) received significantly more land and other assets at the time the household was formed. They were also less affected by mortality in the family. These consistently better-off households owned more land and applied more organic and inorganic fertilizer than either the ascenders or descenders. However, they were no more likely to receive agricultural credit or grow major cash crops than the descenders. These findings underscore the importance of staying healthy in households’ ability to produce agricultural surpluses, accumulate assets, and exit from poverty. Households’ agricultural performance and earnings over time is in many cases related to their lagged health status. The study also highlights the role of intergenerational wealth transfers. Poor households are able to transfer little to the next generation, which then makes it very difficult for them to climb out of poverty. Lastly, all three groups as well as the overall nationwide longitudinal sample of smallholder households reported a noteworthy increase in their usage of fertilizer over the 1997-2007 period of input market liberalization. The dramatic increase in fertilizer use during this period is correlated with an improvement in national maize yields and agricultural performance during the 2000-2007 period as well as a modest decline in rural poverty rates.
File URL: http://purl.umn.edu/103377Download Restriction: no
Paper provided by Agricultural and Applied Economics Association in its series 2011 Annual Meeting, July 24-26, 2011, Pittsburgh, Pennsylvania with number
Handle: RePEc:ags:aaea11:103377
Contact details of provider: Postal: 555 East Wells Street, Suite 1100, Milwaukee, Wisconsin 53202Phone: (414) 918-3190Fax: (414) 276-3349Web page: http://www.aaea.orgEmail: More information through EDIRC Related research
Keywords: poverty; assets; shocks; intergenerational transfers; Kenya; Food Security and Poverty; International Development; This paper has been announced in the following NEP Reports:NEP-AFR-2011-05-24 (Africa)
Cited by:Smale, Melinda & Mathenge, Mary K. & Jayne, Thomas S. & Magalhaes, Eduardo Castelo & Olwande, John & Kirimi, Lilian & Kamau, Mercy W. & Githuku, James, 2012.
"Income and Poverty Impacts of USAID-Funded Programs to Promote Maize, Horticulture, and Dairy Enterprises in Kenya, 2004-2010,"
Food Security International Development Working Papers 121864, Michigan State University, Department of Agricultural, Food, and Resource Economics.
Amanda Lenhardt & Andrew Shepherd, 2013.
"What has happened to the poorest 50%?,"
Brooks World Poverty Institute Working Paper Series 18413, BWPI, The University of Manchester.
Chapoto, Antony & Banda, Diana J. & Haggblade, Steven & Hamukwala, Priscilla, 2011.
"Factors Affecting Poverty Dynamics in Rural Zambia,"
Food Security Collaborative Working Papers 109888, Michigan State University, Department of Agricultural, Food, and Resource Economics.
Lubungu, Mary & Chapoto, Antony & Tembo, Gelson, 2012.
"Smallholder Farmers Participation in Livestock Markets: The Case of Zambian Farmers,"
When requesting a correction, please mention this item's handle: RePEc:ags:aaea11:103377. See general information about how to correct material in RePEc. |
Social Hierarchies and the Formation of Customary Property Law in Pre-Industrial China and England
Taisu Zhang, Duke Law SchoolFollow
comparative legal history, kinship, hierarchy, social status, social norms, custom, mortgages, Dian, Confucianism
Comparative lawyers and economists have often assumed that traditional Chinese laws and customs reinforced the economic and political dominance of elites and, therefore, were unusually “despotic” towards the poor. Such assumptions are highly questionable: Quite the opposite, one of the most striking characteristics of Qing and Republican property institutions is that they often gave significantly greater economic protection to the poorer segments of society than comparable institutions in early modern England. In particular, Chinese property customs afforded much stronger powers of redemption to landowners who had pawned their land. In both societies, land-pawning occurred far more frequently among poorer households than richer ones, but Chinese customary law allowed debtors to indefinitely retain redemption rights over collateralized property, whereas English debtors would generally lose the property permanently if they failed to redeem within one year.
This article argues that the comparatively “egalitarian” tendencies of Qing and Republican property institutions stemmed from the different ways Chinese and English rural communities allocated social status and rank. Hierarchical “Confucian” kinship networks dominated social and economic life in most Chinese villages. Within these networks, an individual’s status and rank depended, in large part, on his age and generational seniority, rather than personal wealth. This allowed many low-income households to enjoy status and rank quite disproportionate to their wealth. In comparison, substantial landed wealth was generally a prerequisite for high status in early modern England, effectively excluding lower-income households from positions of sociopolitical authority. Chinese smallholders possessed, therefore, significantly more social bargaining power, and were more capable of negotiating desirable property institutions. Paradoxically, the predominance of kinship hierarchies actually enhanced macro-level political and economic equality.
This is an author pre-print.
Taisu Zhang, Social Hierarchies and the Formation of Customary Property Law in Pre-Industrial China and England, 62 American Journal of Comparative Law 171- (2014)
Dominance (Psychology), Confucianism, Manners and customs, Mortgages, Comparative law, Kinship, Social norms, Social status
Asian History Commons, Comparative and Foreign Law Commons, Economic History Commons, European History Commons, Legal History Commons, Legal Theory Commons, Property Law and Real Estate Commons |
Cedars-Sinai Neuroscientists Pinpoint Key Gene Controlling Tumor Growth in Brain Cancers
AANS Neurosurgeon | Newsline
Discovery could result in more accurate prognoses and help fuel development of new treatmentsCedars-Sinai investigators have identified a stem cell-regulating gene that affects tumor growth in patients with brain cancer and can strongly influence survival rates of patients. The findings could move physicians closer to their goal of better predicting the prognosis of patients with brain tumors and developing more personalized treatments for them. To enhance understanding of how glioma cancer stem cells (GCSCs) reproduce and how they affect patient survival, investigators spent three years analyzing the genetic makeup of more than 4,000 brain tumors. During their investigation, they identified the gene, called ZEB1, that regulates tumor growth. The investigators’ analysis suggests that brain cancer patients who don’t have the gene tend to have lower survival rates. |
Wildfire and an example of its important link to the ecosystem
Soil Science Society of America (SSSA)
A dilemma is smouldering -- even as wildfires top the current headlines. New research highlights the practice of aggressive fire suppression by using studies at Lake Tahoe as an active example.
For centuries before white settlement, wildfire was a natural part of Sierran ecosystems, with minor fires sweeping through at intervals of 10 to 25 years.
Credit: Photo courtesy of Dale Johnson.
Traveling the western U.S. state of Nevada in the 1860s, a young American writer named Mark Twain heard a "world of talk" about the beauty of Lake Tahoe and so set out one August day to see the lake perched high in the Sierra Nevada Mountains. Determined to make the 11-mile journey on foot, Twain and his companions became briefly discouraged after toiling up one mountain and then another to no avail. But they trudged on until "at last the Lake burst upon us," Twain wrote in his 1872 book, Roughing It.
One hundred and fifty years later, visitors to this border region between California and Nevada still marvel at Lake Tahoe, but sadly the "jewel of the Sierra" is not the same gem it was in Twain's time. Boating on the lake during his trip, Twain said he could see rocks at least 80 feet below the surface -- a degree of clarity that scientists attribute to "ultra-oligotrophic" conditions, meaning exceptionally nutrient-poor and pure. Since the 1960s, however, Lake Tahoe's renowned water quality has been in slow decline, and exactly why "is the $64,000 question," says soil scientist Dale Johnson of the University of Nevada in Reno.
Damaging blazes sweep the Tahoe region regularly, and by the time Johnson teamed up with his University of Nevada colleague, Wally Miller -- an expert on Tahoe's water quality -- scientists already knew how catastrophic fires could affect downstream streams and lakes. Wildfire can leave slopes bare of vegetation and unprotected from erosion. Burning also releases nitrogen, phosphorus, sulfate, and other biochemicals locked in plants, wood, and soils, allowing the nutrients to run off downslope or seep into groundwater. But when Miller and Johnson began their studies, they discovered something that few, if anyone, had suspected: Not only could a major disturbance like fire affect Lake Tahoe, but so too could a lack of disturbance -- the absence of fire. "The results were very surprising and therefore very hard to publish," Johnson says. "No one believed it."
But the findings also lead to a dilemma. On one hand, wildfire is beneficial in that it burns away decades of accumulated organic material, which Johnson and Miller have shown can potentially be a slow but significant source of nutrients to Lake Tahoe. On the other hand, severe wildfire can also deplete forests of nitrogen and send pulses of nutrients downstream -- not to mention the damage it does to timber and private property.
"So what do you do?" Miller asks. The answer lately embraced by forest managers is to mimic the natural, Sierran fire regime that existed before aggressive fire suppression began. Managers will purposely light small, controlled fires to burn away accumulated woody debris. Or they'll remove wood with harvesting equipment or chip it on site.
But managers don't want to remove too many nutrients from the system, since they're needed to support future generations of trees. So Miller and Johnson have been studying the practices' impacts on nutrients and on water quality, just as they earlier investigated catastrophic wildfire and fire suppression.
The above post is reprinted from materials provided by Soil Science Society of America (SSSA). Note: Materials may be edited for content and length.
Madeline Fisher. A New Threat to Water Quality:Forest Fire Suppression. Soil Horizons, 2012; 53 (3): 3 DOI: 10.2136/sh2012-53-3-lf
Soil Science Society of America (SSSA). "Wildfire and an example of its important link to the ecosystem." ScienceDaily. ScienceDaily, 31 May 2012. <www.sciencedaily.com/releases/2012/05/120531165621.htm>.
Soil Science Society of America (SSSA). (2012, May 31). Wildfire and an example of its important link to the ecosystem. ScienceDaily. Retrieved November 29, 2015 from www.sciencedaily.com/releases/2012/05/120531165621.htm
Soil Science Society of America (SSSA). "Wildfire and an example of its important link to the ecosystem." ScienceDaily. www.sciencedaily.com/releases/2012/05/120531165621.htm (accessed November 29, 2015).
Soil Types
Wildland fire suppression
Morel mushroom
Smoulder
Reducing Catastrophic Wildfires Through Managed Burns
Sep. 18, 2015 A new article suggests catastrophic wildfire danger could be reduced by increasing use of planning burning in land management ... read more Lake Tahoe Research Provides New Insights on Global Change
Feb. 26, 2015 A study on how natural and human-made sources of nitrogen are recycled through the Lake Tahoe ecosystem provides new information on how global change may affect the iconic blue ... read more Study Shows Wildfires' Positive and Negative Economic Impacts
Sep. 14, 2012 Despite the disruptions they cause, large wildfires are a mixed economic bag for nearby communities, according to new ... read more More Catastrophic Fires Ahead for Western U.S.
Feb. 27, 2012 Catastrophic wildfires are on the rise in the western United States and a set of conditions may be contributing to a perfect storm for more fires, according to new ... read more Strange & Offbeat |
Clinical Focus
> LDL Cholesterol
Study: Statins Cost-Effective for Older Patients
But adverse effects could be an issue MedpageToday
by Salynn Boyles Salynn Boyles, Contributing Writer August 10, 2015 Treating all elderly people in the U.S. with lipid-lowering drugs would result in 8 million additional statin users and prevent 68,000 deaths from coronary heart disease, assuming the treatment caused no harm, researchers reported.
The computer-simulation modeling study showed generic statin use to be cost-effective in people ages 75 and older, but even a small increase in adverse events related to advanced age could offset this projected benefit, noted Michelle Odden, PhD, of Oregon State University in Corvallis, and colleagues.Read Full Article
There is a paucity of clinical data examining the safety and efficacy of statin treatment in elderly people without established heart disease, despite the widespread use of the drugs in this population, they wrote in the Annals of Internal Medicine.
Several observational studies have suggested that the link between elevated LDL cholesterol and cardiovascular outcomes is attenuated in older people, and other studies have raised concerns about possible geriatric-specific adverse effects related to statin use, including muscle pain and memory loss.
The most recent guidelines by the American College of Cardiology/American Heart Association (ACC/AHA) acknowledged this lack of data, citing the need for clinical trials examining the impact of statin use on cardiovascular outcomes in the elderly as a top research priority.
The ACC/AHA guidelines recommend statin treatment for primary prevention in the elderly based on individual patient risk profiles. Guidelines from the American Medical Directors Association recommend against routine statin treatment for adults ages 70 and older.
"Older people who are free of heart disease have been under-represented in the clinical trials, so we really don't know a lot about the risks and benefits of statin use in this population," Odden told MedPage Today.
Since no single trial has addressed the impact of statin treatment on the primary prevention of cardiovascular disease outcomes in an elderly population, the researchers merged findings from different studies in an attempt to better understand the risks and benefits.
"We took the best available data that we could find in this population and integrated it in a computer simulation of heart disease in the U.S. population," Odden said.
Using the Cardiovascular Disease Policy Model (CVDPM), which is an established computer simulation Markov model, along with National Health and Nutrition Examination Survey (NHANES) data and findings from the PROSPER trial of pravastatin in the elderly, the researchers estimated the costs and benefits of statin use in an elderly population. Outcome measures included myocardial infarction (MI), coronary heart disease (CHD) death, disability-adjusted life-years, and costs over a decade.
They used the CVDPM to run a 10-year simulation of U.S. adults, ages 75 to 94, in 2014 and followed through 2023.
Assuming no treatment harm, the computer model found that if everyone between the ages of 75 and 94 were treated with a statin, 105,000 incident MIs and 68,000 CHD deaths might be prevented over 10 years at an incremental cost per disability-adjusted life year of $25,200.
In their estimate of the magnitude of harm required to offset the beneficial effects of statins, the researchers considered statin-related cognitive impairment and statin-related declines in physical function.
In the model assuming treatment of everyone between the ages of 75 and 94, a reduction in disability-adjusted life years of as little as 0.003 was found to offset the benefit of treatment.
In an accompanying editorial, cardiologist Michael W. Rich, MD, of Washington University School of Medicine in St Louis, wrote that under this strategy, "any adverse drug effect that resulted in 1 fewer day of life free of disability would nullify the benefit of statins."
This finding highlights the fact that despite the low cost and potential benefits of statins in this population, "even very modest adverse effects attributable to statins tip the balance in the direction of harm," Rich wrote.
"Although the investigators have conducted an elegant series of analyses showing that cost should not be an important consideration in the decision to prescribe statins in older adults, I believe that the findings strongly support the view that when it comes to prescribing statins for primary prevention in older adults, less is more," he wrote.
Odden said the findings also highlight the need for more study of the risks and benefits of statins for primary prevention in the elderly.
The study was funded by the grants from the American Heart Association Western States Affiliate, the National Institute on Aging, and the National Institute for Diabetes and Digestive and Kidney Diseases.Odden and co-authors disclosed no relevant relationships with industry. One co-author disclosed serving as co-vice chair of the U.S. Preventive Services Task Force.Rich disclosed no relevant relationships with industry. 2015-01-12T00:00:00-0500
Source Reference: Odden M, et al "Cost-effectiveness and population impact of statins for primary prevention in adults aged 75 years or older in the United States" Ann Intern Med 2015; 162(8): 533-545.
More in Clinical Focus
Hint of Vision Benefit with Gene Therapy
Eyeing the Death of a Cell
Anti-VEGF Tx for Wet AMD Shows Benefit 5 Years Later
AAO: Fruit and Caffeine May Reduce AMD Risk |
Cells' grouping tactic points to new cancer treatments
The mechanism that cells use to group together and move around the body has been discovered by scientists at UCL -- a finding that has implications for the development of new cancer treatments.
The study, which used embryonic cells, points to a new way of treating cancer where therapy is targeted at the process of cancer cells grouping together. The aim is to stop cancer cells from spreading and causing secondary tumours.
In order for cells to migrate they form protrusions -- much like oars of a boat -- in the direction that they want to travel. However, if a single cell is isolated it produces these oars in all directions and ends up rowing in circles. To move around effectively cells must stick together before attempting to travel.
The study, published in the journal Developmental Cell, explains how this process works. Scientists have discovered that when cells group together the contact with other cells inhibits the formation of protrusions or 'oars'. This means that protrusions only form on the cells that are on the outside edges of the group, causing the group to move in specific direction as the group is pushed by the outermost 'leader' cells.
Dr Roberto Mayor, UCL Department of Cell and Developmental Biology and lead author of the research, said, "Being able to form a group with neighbour cells is advantageous for migration of embryonic cells as well as cancer cells during tumour metastasis -- they have strength in unity.
"The findings suggest an alternative way in which cancer treatments might work in the future if therapies can be targeted at the process of group formation to stop cancer cells from spreading and causing secondary tumours."
The experiments were carried out using neural crest cells, which are found next to the developing central nervous system in embryos. These cells can develop into a huge variety of different kind of cells including heart, face, skin and muscle cells. Scientists blocked surface molecules, proteins called N-cadherin, on the neural crest cells that are involved in forming contacts between cells. When they did this the power of the cells to group together was lost, along with any ability to migrate.
It is expected that inhibition of N-cadherin would have the same the effect in cancer cells, which also move in groups during metastasis. |
Explore > Wanderlust Review: Metafictional Murder in South Korea
Credit: @DiyaonKorea
From left: Deborah Smith, Han Yujoo, Houman Barekat
Ahead of this year’s upcoming International Translation Day at The British Library, last July saw a special Wanderlust event take place at Free Word.
Exploring the ways in which translated works push boundaries with form and language, Han Yujoo gave us insight into her haunting debut novel The Impossible Fairy Tale. The discussion was chaired by literary critic and founder of Review 31, Houman Barekat, with support from Tilted Axis founder and Man Booker Prize winner Deborah Smith (The Vegetarian).
Everyday violence, as seen first-hand by the author in South Korea’s capital, appears to dominate the novel, painting a clear picture of why South Korea is often referred to as ‘Hell Joseon’. The violence within the novel takes place in the protagonist’s school playground – children pull wings off butterflies, murder chicks and catapult their carcasses – conveying the presence of violence even at a low level.
The author strips the protagonist of an identity by naming her ‘the Child’, further dehumanising her against the novel’s violent backdrop and creating an impersonal relationship between her and the reader. The reader is aware that the Child is abused by her mother, yet this is not part of the direct narrative, making the reader feel uneasily disconnected to that part of the story. The Child, unnamed and overlooked, writes about her experience of abuse in a diary, communicating in written form the things she’s unable to say aloud. The author believes that it is important for children to have their own voice, ‘even if it’s in a code that only they can understand.’
Han Yujoo followed this by reading a passage from the novel in Korean. The rhythm, created through repetition in the language, was prominent, and both beautiful and transfixing to an audience of people largely unable understand a single word. There is something enchanting about listening to someone read in a language foreign to yours, especially when the structure is unusual. Since the words carry no meaning to foreign ears, the rhythm becomes even more crucial. Barekat noted that the novel’s language and short sentences are ‘as you would expect in a children’s story’ – the author successfully conveying the voice of the Child through the narration.
The use of wordplay was mentioned frequently at the Wanderlust event. Translator, Janet Hong, who was video-projected into the Free Word theatre from Canada, spoke about the transition of words and how she adapted them during the novel’s translation process. She discussed the difficulty of retaining multiple layers of meaning whilst preserving the logic the author uses to move from one word to the next. Touching on the significance of the meaning behind words, Hong noted the fine line between pleasant and unpleasant words. Used in a different context, a pleasant word like “sprinkles” in the example she gives, goes from being a cute nickname for a cat to the unsettling revelation of its murder. This was a particularly impactful moment during the event, met by a large round of applause from the audience in Janet’s absence. You can watch the full video below.
What strikes many readers most about Han Yujoo’s novel, unsurprisingly, is the structure and form. As the title of the event suggests, it falls into the category of metafiction. The author comments on the tragedy of what has happened by placing herself in the novel as a teacher who wakes up from an intense dream with knowledge of the first half of the novel, having taken place years earlier. Barekat notes that in this way, The Impossible Fairy Tale is like two novels in one – both a story in its own right, and a brilliant experimentation of language and form.
For the innovative way it plays with the structure of language, The Impossible Fairytale is a unique work of art. A strong debut from one of South Korea’s most exciting young voices.
Stephen Watts on Co-Translation
By Stephen Watts
Acclaimed poet, editor and translator, Stephen Watts, shares his views on the art and power of co-translation.
City Book, Country Book: Catalan Literature in Translation
By Mary Ann Newman
We asked the speakers from our Translation from Outside the Metropolis event to explore the topic further. Here, Mary Ann Newman, a translator of Catalan and Spanish, explores rural and urban issues in Catalan literature. |
Colorado River, Meet the Sea
Posted by Sandra Postel of National Geographic's Freshwater Initiative on April 12, 2013
This post is part of a series on the Colorado River Delta.
Walking the mudflats of the Colorado River Delta in northwestern Mexico, my feet touch silt and sediment that originated in the U.S. Rocky Mountains, hitchhiked with floodwaters through the Grand Canyon, and then, over the millennia, settled out here as the river slowed and meandered its way to the Gulf of California.
The delta defies all political borders and human constructs. Left to flow naturally, the Colorado River system is a connected and unified whole.
If a river is born with a destiny, it is to reach the sea. It carries sweet water, sediment, and nutrients to the coastal zone, where fisheries and marine life depend on it for sustenance and habitat. To disconnect a river from the sea is as consequential to the health of the ecosystem as it is to block the flow of blood to a vital organ in the human body: the whole suffers, and may die.
These thoughts roam my mind as the shoreline of El Golfo de Santa Clara, a small fishing town on the northeastern coast of the Gulf of California (also known as the Sea of Cortez), recedes from view. In a small, motorized boat, we are heading northwest into the Colorado River estuary.
There, before the big dams and diversions upstream, the river’s nutrient-rich freshwater mixed with the Gulf’s salty tides to form the perfect water chemistry and nursery grounds for Gulf corvina, totoaba, brown and blue shrimp, and other fisheries of commercial importance to the region’s economy and of cultural significance to the indigenous Cucapá.
But today no one is fishing in the estuary. It is illegal. The dozens of fishing boats that left El Golfo at dawn all headed south. The estuary is now part of a protected biosphere reserve and no-fishing zone, an attempt to give the fish – as well as the highly endangered vaquita, the world’s smallest porpoise – a chance to revive their numbers.
A Rich Estuary
The Gulf corvina, totoaba, and vaquita are found only in the Gulf of California; all three are extremely vulnerable to extinction. Historically each winter, adult totoaba, which can weigh up to 200 pounds (91 kilograms), migrated northward along the eastern coast of the Gulf to the estuary and delta, where they remained until spawning in spring.
I keep my eyes peeled for a surprise spotting, but no totoaba appear.
We stop the boat and climb up a bank. We are calf-deep in a beautiful grass that gives a green hue to the mudflats along this portion of the Sonoran coast. It is nipa, the ancient grain of the Cucapá – and what biologists now call Distichlis palmeri, or Palmer’s saltgrass.
It, too, has suffered along with the fisheries from the absence of the Colorado’s flow. The saltgrass needs an inflow of freshwater to reproduce. It used to grow waist-high and yield a tastier and more nutritious seed. But without the pulses of freshwater, the native grass is stunted, less dense and lacking in flavor.
Back in El Golfo, we meet up with a fisherman, José Armando Sánchez Olivares, who has fished in the Gulf for more than a quarter century. A strong man, who has seen many hard-working days on the sea, he speaks of concern for his community and the livelihoods that sustain it. Fish catches and incomes have declined, he explains, and people are going elsewhere to find jobs.
Sanchez Olivares is aware of the new bi-national commitment to give some water back to the delta, and of the possibility it creates for the Colorado River to once again reach the sea.
“If we see the Colorado River flow again,” he says, “we are going to feel stronger; our town will have the will to carry on.”
The Gift of El Niño
More research is needed to determine the quantity, quality, and timing of freshwater flows needed to rejuvenate habitat for the fisheries of the upper Gulf. But after the flood pulses that occurred several times during the 1990s, when El Niño weather patterns delivered high precipitation to the Colorado Basin, scientists documented an increase in the Gulf corvina population. Shrimp harvests, too, got a boost after river flows reached the estuary.
Ecologist and nature writer Gary Paul Nabhan describes vividly what he saw when flying over the delta after the El Niño-driven flood pulse of 1993. His words speak of the resilience of life in the upper Gulf (the Alto Golfo) when freshwater flows return:
I did not recognize how important such nutrients and freshwater flows were to the productivity of the marine community until I flew over it during the winter of 1993, when nearly 5 billion cubic meters of water entered the Alto Golfo due to unusually high winter rainfall regimes triggered by El Niño…. I saw the most remarkable biological phenomenon I had witnessed over my entire life. Huge algal blooms and huge eelgrass yields had stimulated invertebrate reproduction and a resurgence of corvina to the degree that we could see massive green patches out in the sea, streaming with enormous schools of fish. Thousands of dolphins and even whales had congregated around each of these patches of productivity. A feeding frenzy was going full tilt, the likes of which the Alto Golfo had experienced perhaps only five times over the previous thirty-five years.
The magnificent display Nabhan witnessed occurred just twenty years ago, long after the dams and diversions had begun siphoning off the yearly influx of water and nutrients so crucial to the Gulf’s fisheries. In this instance, El Niño was the benevolent provider. But it is unreliable: fifteen years have passed since a pulse of freshwater has reached the estuary and Upper Gulf.
The future of the fisheries, the town of El Golfo de Santa Clara, and the native saltgrass that sustained the Cucapá – as well as the rich diversity of birds and wildlife that thrive in the delta’s remnants wetlands – depend on whether the Colorado River is allowed to fulfill its destiny and once again reach the sea.
The answer is now largely in our hands.
Help restore water to the Colorado River by joining Change the Course. Sign up online or text ‘River’ to 77177.
Special thanks to Silk and Coca-Cola, Charter Sponsors for Change the Course. Additional funding generously provided by the Walton Family Foundation.
Sandra Postel is director of the Global Water Policy Project and Freshwater Fellow of the National Geographic Society. She is the author of several acclaimed books, including the award-winning Last Oasis, a Pew Scholar in Conservation and the Environment, and one of the “Scientific American 50.” She is co-creator of Change the Course, the national freshwater conservation and restoration campaign being piloted in the Colorado River Basin.
USA -Kansas
I agree with the previous posts by Rod Mason (England) that a series of desalination plants should be built all along California’s coasts. To restore a small portion of the flow of the river so it can once again reach the sea would be an ecological triumph. Perhaps that would help such fish as the totoaba (Totoaba macdonaldi) in its fight for survival.
John Gottes
Whittier, Califorinia
Ms Sandra: Thanks for the article! If I may inquire, how far were you able to travel up the Colorado River? Spring tide? Neap tide?
Hope to visit the area soon, in search of Port Isabel
To restore the freshwater flow of the Colorado River,one of the most powerful countries in the world should build Desalinations Plants for the Southern California Region.That would restore the Ecoligy in The Gulf of Cortez!
golfo de sta clara
es importante conservar la biovidersidad dentro de las areas protegidas no es por casualidad que existan diversas especies unicas en el mundo como es la vaquita marina, totoaba en tre otras unicas en el alto golfo,todo por las riqueza de la agua dulce del rio colorado, a falta de este se ha mirado la baja productividad y desarrollo de munchas especies propias de la reion
Aidan Bodeo-Lomicky
I have been working with the Vaquita for a few years now, and I am wondering if this undamming would be good for it. It used to be thought that a partial reason for the Vaquita’s decline was lack of freshwater flow to the Gulf of California, but this was disproven. I understand that rejeuvinating the ecosystem is good for all species, but it sounds like this will cause more fishermen to illegally use gillnets in the Vaquita’s range.
To restore the Colorado the Liberal Meccqa of Los Angeles would have to be abandoned. Even a staunch conservative knows you don’t build a city where there is no water.
Sharon Hester
Wasnt El Nino mentioned in winter of 1983? Fact checks a good idea.
Sandra Postel
Yes, there was also an El Nino event in the early eighties — a much bigger one than those in the nineties. |
Low back pain-related beliefs and likely practice behaviours among final-year cross-discipline health students
Briggs, Andrew
Slater, Helen
Smith, Anne
Parkin-Smith, G
Watkins, K
Chua, Jason
Background: Evidence points to clinicians' beliefs and practice behaviours related to low back pain (LBP), which are discordant with contemporary evidence. While interventions to align beliefs and behaviours with evidence among clinicians have demonstrated effectiveness, a more sustainable and cost-effective approach to positively developing workforce capacity in this area may be to target the emerging workforce. The aim of this study was to investigate beliefs and clinical recommendations for LBP, and their alignment to evidence, in Australian university allied health and medical students. Methods: Final-year students in chiropractic, medicine, occupational therapy, pharmacy and physiotherapy disciplines in three Western Australian universities responded to a survey. Demographic data, LBP-related beliefs data [modified Health Care Providers Pain and Impact Relationship Scale (HC-PAIRS) and the Back Pain Beliefs Questionnaire (BBQ) ] and activity, rest and work clinical recommendations for an acute LBP clinical vignette were collected.Results: Six hundred two students completed the survey (response rate 74.6%). Cross-discipline differences in beliefs and clinical recommendations were observed (p > 0.001). Physiotherapy and chiropractic students reported significantly more helpful beliefs compared with the other disciplines, while pharmacy students reported the least helpful beliefs. A greater proportion of chiropractic and physiotherapy students reported guideline-consistent recommendations compared with other disciplines. HC-PAIRS and BBQ scores were strongly associated with clinical recommendations, independent to the discipline of study and prior experience of LBP. Conclusions: Aligning cross-discipline university curricula with current evidence may provide an opportunity to facilitate translation of this evidence into practice with a focus on a consistent, cross-discipline approach to LBP management.
Briggs, A.M. and Slater, H. and Smith, A.J. and Parkin-Smith, G.F. and Watkins, K. and Chua, J. 2012. Low back pain-related beliefs and likely practice behaviours among final-year cross-discipline health students. European Journal of Pain. 17 (5): pp. 766-775.
European Journal of Pain
Increasing Accessibility to Science in Early Childhood Teacher Education Through Collaboration Between Teacher Educators and Science/Engineering Academics
Howitt, Christine; Blake, Elaine; Calais, Martina; Carnellor, Yvonne; Frid, Sandra; Lewis, Simon; Mocerino, Mauro; Parker, Lesley; Sparrow, Len; Ward, Jo; Zadnik, Marjan (2012)
Various reports have identifi ed urgent needs for science education in Australia, in particular, in relation to maintaining and increasing capability to teach science at all levels of schooling (e.g. Australian Academy ...
The utility of the STarT back screening tool in a population with chronic low back pain: A prospective study
Kendell, Michelle (2016)
Study design: Cross sectional (Study 1) and prospective (Study 2). Background: Chronic low back pain (LBP) is problematic with significant personal, social, and economic impact. The need to screen for indicators of poor ...
Establishing cross-discipline consensus on contraception, pregnancy and breast feeding-related educational messages and clinical practices to support women with rheumatoid arthritis: An Australian Delphi study
Briggs, Andrew; Jordan, J.; Ackerman, I.; Van Doornum, S. (2016)
Objective: Recognising the need for a best-practice and consistent approach in providing care to women with rheumatoid arthritis (RA) in relation to (1) general health, (2) contraception, (3) conception and pregnancy, (4) ... |
Gene Expression Analysis Direct from RNA
What is a Gene Array?
The Basics: What is a Gene Array?
Gene arrays are solid supports upon which a collection of gene-specific nucleic acids have been placed at defined locations, either by spotting or direct synthesis. In array analysis, a nucleic acid-containing sample is labeled and then allowed to hybridize with the gene-specific targets on the array. (In the literature, the term "target" can refer to either the nucleic acids attached to the array or the labeled nucleic acid of the sample. In this article, the nucleic acids attached to arrays are called "targets," whereas the labeled nucleic acids comprising the sample are called "probes.") Based on the amount of probe hybridized to each target spot, information is gained about the specific nucleic acid composition of the sample. The major advantage of gene arrays is that they can provide information on thousands of targets in a single experiment.
Currently the solid supports upon which nucleic acids are arrayed are either glass slides or nylon membranes. Typically, fluorescently labeled probes are used with glass arrays, while radiolabeled probes are used with membranes. Depending on the type of array, the arrayed nucleic acids may be composed of oligonucleotides, PCR products or cDNA vectors or purified inserts. The sequences may represent entire genomes and may include both known and unknown sequences or may be collections of sequences such as apoptosis-related genes or cytokines. Many pre-made and custom arrays are available from commercial manufacturers although many labs prepare their own arrays with the help of robotic arrayers. The methods of probe labeling, hybridization, and detection depend on the solid support to which the sequences are bound.
Many terms exist for naming gene arrays, including biochip, DNA chip, GeneChip® (a registered trademark of Affymetrix, Inc.), DNA array, microarray and macroarray. Generally when biochip, DNA chip or GeneChip is used, it refers to arrays on glass supports. Microarray and macroarray may be used to differentiate between spot size or the number of spots on the support. Gene arrays may be used for sequence identification (e.g. mutation analysis) or differential expression analysis of two or more RNA samples. This discussion will focus on the use of arrays for expression analysis.
Gene Arrays for Expression Analysis
Gene arrays have become a powerful approach for comparing complex sample RNA populations. Using array analysis, the expression profiles of normal and tumor tissues, treated and untreated cell cultures, developmental stages of an organism or tissue, and different tissues can be compared. A typical gene array experiment involves:
Isolating RNA from the samples to be compared
Converting the RNA samples to labeled cDNA via reverse transcription; this step may be combined with aRNA amplification
Hybridizing the labeled cDNA to identical membrane or glass slide arrays
Removing the unhybridized cDNA
Detecting and quantitating the hybridized cDNA, and
Comparing the quantitative data from the various samples
Some array manufacturers offer custom analysis services and may perform the probe labeling and hybridization reactions as a service.
Nylon Membrane Arrays
Nylon membrane arrays are typically hybridized with 33P-dNTP labeled probes and analyzed by a phosphorimager along with the appropriate software. A different array must be used for each sample analyzed. A typical experiment involves isolating RNA from two tissue or cell samples. The RNAs are reverse transcribed using labeled nucleotides and target specific, oligo dT, or random-sequence primers to create two labeled cDNA populations. The two cDNAs are hybridized to two identical arrays. After washing, the hybridized signal on each array is detected and analyzed. The signal emitting from each gene-specific spot is compared between the populations. Genes expressed at different levels in two samples generate different amounts of labeled cDNA and this results in spots on the array with different amounts of signal.
Glass Slide Arrays
Glass slide arrays analysis involves the same steps, but rather than labeling with isotopes during reverse transcription, probes for glass arrays are labeled with two distinct fluorescently labeled nucleotides and both probes are hybridized to the same array. Typically, one sample RNA is labeled with Cyanine 3-dNTP (Cy3) and the other with Cyanine 5-dNTP (Cy5). Each dye produces different color fluorescence. The two labeled RNA populations are hybridized to one glass slide and scanned using a fluorescent imager.
GeneChip
Affymetrix's GeneChips are glass slide arrays manufactured using special photolithographic methods and combinatorial chemistry, which allow the oligonucleotide spots to be synthesized directly onto the array substrate. The analysis procedure specifies that the RNA samples are converted to biotin-labeled cDNA, and each sample is hybridized to a separate GeneChip. The hybridized cDNA is then stained with a streptavidin-phycoerythrin conjugate and visualized with an array scanner.
Where once the bottleneck in gene expression analysis was the benchwork, with array analysis, it is the computer work. Because a single array experiment can generate thousands of data points, the primary challenge of the technique is making sense of the data. Many commercial companies provide image analysis software, including BioDiscovery (ImaGene) and Imaging Research (ArrayVision). Furthermore, many array manufacturers offer software specifically for the analysis of their arrays and offer the analysis as a service.
For membrane array analysis, a file of the data is generated by phosphoimaging and that file is then analyzed using software. The software will correlate spots to genes and can compare spot intensities for differential expression studies.
Glass array data is treated in much the same way, but the image's fluorescence is scanned and the software allows detection of each samples' fluorescence individually or simultaneously for analysis. Most software packages can analyze several arrays simultaneously.
Differences in expression of specific sequences are often validated by another method of analysis such as RT-PCR, Northern analysis or nuclease protection assays. These same methods can be used for relative or absolute quantitation of specific messages of interest identified by array analysis. |
Daily vibration may combat prediabetes in youth
Georgia Health Sciences University
Daily sessions of whole-body vibration may combat prediabetes in adolescents. In mice that mimic over-eating adolescents headed toward diabetes, 20 minutes of daily vibration for eight weeks restored a healthy balance of key pro- and anti-inflammatory mediators and was better than prescription drugs at reducing levels of hemoglobin A1c, the most accurate indicator of average blood glucose levels, according to new research.
Daily sessions of whole-body vibration may combat prediabetes in adolescents, dramatically reducing inflammation, average blood glucose levels and symptoms such as frequent urination, researchers report.
Zone diet
Diabetic diet
In mice that mimic over-eating adolescents headed toward diabetes, 20 minutes of daily vibration for eight weeks restored a healthy balance of key pro- and anti-inflammatory mediators and was better than prescription drugs at reducing levels of hemoglobin A1c, the most accurate indicator of average blood glucose levels, said Dr. Jack C. Yu, Chief of the Section of Plastic and Reconstructive Surgery at the Medical College of Georgia at Georgia Health Sciences University.
In normal mice, just four days of vibration also dramatically improved the ability to manage a huge glucose surge similar to that following a high-calorie, high-fat meal. "It's a very good sign," said Yu. "If you eat a pound of sugar, your blood glucose will go up. If you are prediabetic, it will go up even more and take longer to come down."
Interestingly, vibration did not produce similar changes in older, normal mice, Yu told researchers at the Third World Congress of Plastic Surgeons of Chinese Descent.
"This is our model: the average American teenager who eats too much," said Yu, who regularly operates on obese and often prediabetic adolescent males who want their abnormally large breasts reduced. "The only way to burn fat is to exercise. We shake the bone for you rather than the body's muscle shaking it. This is a highly efficient way to fool the bone into thinking we are exercising."
It's also one way to deal with the reality that many individuals simply will not exercise regularly, he said.
Yu, also a craniofacial surgeon who studies bone formation, said while it's unclear exactly how vibration produces these desirable results, it seems linked to the impact of movement on bone health. Vibration mimics the motion bones experience during exercise when muscles are doing the work. The slight bending and unbending of bone triggers remodeling so it can stay strong. One result is production of osteocalcin, a protein essential to bone building, which also signals the pancreas to get ready for food. While this prehistoric relationship is tied to the hunt for food, it doesn't work so well in 21st century living where folks are moving too little and eating too much, Yu said. The constant demand can produce resistance to the insulin required to use glucose as energy.
Additionally, the body tends to hold onto fat for energy and survival, which researchers think is key to the chronic inflammation found in obesity-related type 2 diabetes. The fat itself produces inflammatory factors; the immune system also can misidentify fat as an infection, resulting in even more inflammation but, unfortunately, not eliminating the fat.
The bottom line is an unbalanced immune response: too many aggressors like the immune system SWAT team member Th17 and too few calming regulating factors like FoxP3. Researchers looked in the mouse blood and found vibration produced a 125-fold increase in immune system homeostasis and similar results in the kidney. This included positive movement in other players as well, such as a five-fold reduction in what Yu calls the "nuclear fuel," gammaH2AX, an indicator that something is attacking the body's DNA.
The animal model researchers used has a defect in the receptor for leptin, the satiety hormone, so the mice uncharacteristically overeat. Vibration also significantly reduced the mouse's diabetic symptoms of excessive thirst and diluted urine, resulting from excessive urination. The mice also seemed to like it, Yu said.
Next steps include learning more about how vibration produces such desirable results and large-scale clinical studies to see if they hold true in adolescents.
Prediabetics can avoid type 2 diabetes by making healthy diet changes and increasing physical activity, according to the American Diabetes Association.
Vibration technology was originally developed by the former Soviet Union to try to prevent muscle and bone wasting in cosmonauts. MCG researchers reported in the journal Bone in 2010 that daily whole body vibration may help minimize age-related bone density loss.
Yu and Biomedical Engineer Karl H. Wenger developed the whole-body vibrator used for the animal studies. Study coauthors include Wenger as well as GHSU's Drs. Babak Baban, Sun Hsieh, Mahmood Mozaffari and Mohamad Masoumy.
The above story is based on materials provided by Georgia Health Sciences University. The original article was written by Toni Baker. Note: Materials may be edited for content and length.
Georgia Health Sciences University. "Daily vibration may combat prediabetes in youth." ScienceDaily. ScienceDaily, 19 October 2012. <www.sciencedaily.com/releases/2012/10/121019141258.htm>.
Georgia Health Sciences University. (2012, October 19). Daily vibration may combat prediabetes in youth. ScienceDaily. Retrieved November 24, 2014 from www.sciencedaily.com/releases/2012/10/121019141258.htm
Georgia Health Sciences University. "Daily vibration may combat prediabetes in youth." ScienceDaily. www.sciencedaily.com/releases/2012/10/121019141258.htm (accessed November 24, 2014).
Nipping Diabetes in the Blood
Jan. 27, 2014 � 79 million Americans are thought to have "prediabetes," a condition that puts them at risk of developing type-2 diabetes. Now researchers have discovered that a simple blood test can reveal ... full story
Family History of Diabetes Increases the Risk of Prediabetes by 26 Percent, With Effect Most Evident in Non-Obese
Aug. 22, 2013 � A study involving more than 8,000 participants has shown that people with a family history of diabetes see their risk of prediabetes increase by 26 ... full story
Whole Body Vibration Therapy Increases Bone Strength
June 17, 2013 � A treatment known as whole body vibration therapy significantly increases bone strength among adolescents with cerebral palsy, a new clinical trial from New Zealand ... full story
Hemoglobin A1c Testing Method Fails to Identify Kids With Diabetes, Study Shows
Nov. 21, 2011 � In 2009, the American Diabetes Association (ADA) recommended that Hemoglobin A1c be exclusively used for the diagnosis of diabetes in children. The simple test measures longer-term blood sugar levels ... full story
Daily Vibration May Help Aging Bones Stay Healthy
Oct. 25, 2010 � A daily dose of whole body vibration may help reduce the usual bone density loss that occurs with age, researchers report. Twelve weeks of daily, 30-minute sessions in 18-month old male mice -- which ... full story |
Antifibrinolytic drugs reduce blood loss during cardiac surgery
Oct 17, 2007 The amount of blood loss that occurs during major complex surgery is limited by the body’s ability to form blood clots. These close off small vessels and prevent more blood leaking out of the patient’s circulatory system. One problem is that the body also has mechanisms that break down blood clots.
This Cochrane Review concludes that drugs that slow down the rate at which these blood clots are dissolved, called anti-fibrinolytics, can significantly reduce blood loss, particularly during cardiac surgery, and reduce the need for re-operation because of continued bleeding. One of the effective drugs, tranexamic acid, is quite cheap and is likely to be cost effective, particularly in cardiac surgery.
The big question is whether the benefits of treatment with these drugs are offset by adverse effects, in particular thrombosis leading to an excess risk of heart attack and stroke. This has been a particular concern with aprotinin and some studies that did not use randomisation found an increased risk of these complications with this drug. However, this Cochrane Review of randomised controlled trials found no increase in the risk of thrombosis with aprotinin or tranexamic acid.
“Our review of over 200 clinical trials found that using anti-fibrinolytic drugs during surgery reduced bleeding and reduced the need for transfusions of red blood cells. Importantly they did not appear to increase the risk of serious adverse effects,” says lead researcher Professor David Henry, of the University of Newcastle, Waratah, Australia.
“This is an extremely important finding,” says Professor Mike Clarke, the UK Cochrane Centre Director. “It shows very strongly that anti-fibrinolytics, which are cheap, can dramatically reduce the need for blood transfusion. Blood is scarce, expensive and transfusions can be dangerous, so this is likely to be a very important finding globally.”
Source: John Wiley & Sons, Inc.
Explore further: What to do with kidneys from older deceased donors?
Magnetic nanoparticles can open the blood-brain barrier and deliver molecules directly to the brain, say researchers from the University of Montreal, Polytechnique Montréal, and CHU Sainte-Justine. This barrier runs inside ...
Detecting cyanide poisoning in 70 seconds
The diagnostic test to determine cyanide exposure takes 24 hours.
Targeting one enzyme is the key to tackling two tropical diseases
A way to combat malaria developed by scientists at Imperial College London and the University of York may also be effective against the deadly tropical disease leishmaniasis, new research has shown.
Keeping atherosclerosis in-check with novel targeted inflammation-resolving nanomedicines
Nanometer-sized "drones" that deliver a special type of healing molecule to fat deposits in arteries could become a new way to prevent heart attacks caused by atherosclerosis, according to a study in pre-clinical ...
Novel non-stick material joins portfolio of slippery surface technologies
More than 80 percent of microbial infections in the human body are caused by a build-up of bacteria, according to the National Institutes of Health. Bacteria cells gain a foothold in the body by accumulating ...
Millions of GMO insects could be set loose in Florida Keys (Update)
Millions of genetically modified mosquitoes could be released in the Florida Keys if British researchers win approval to use the bugs against two extremely painful viral diseases.
Obese British man in court fight for surgery
A British man weighing 22 stone (139 kilograms, 306 pounds) launched a court appeal Monday against a decision to refuse him state-funded obesity surgery because he is not fat enough.
2008 crisis spurred rise in suicides in Europe
The financial crisis that began to hit Europe in mid-2008 reversed a steady, years-long fall in suicides among people of working age, according to a letter published on Friday by The Lancet.
New food labels dished up to keep Europe healthy
A groundbreaking deal on compulsory new food labels Wednesday is set to give Europeans clear information on the nutritional and energy content of products, as well as country of origin.
Australia launches world-first plain cigarette pack laws
Australia introduced world-first plain packaging laws for cigarettes into parliament Wednesday, vowing not to bow to big tobacco's "intimidation tactics" and legal threats.
Overweight men have poorer sperm count
Overweight or obese men, like their female counterparts, have a lower chance of becoming a parent, according to a comparison of sperm quality presented at a European fertility meeting Monday.
Higher chance of twins after IVF for taller women: study
Taller women who become pregnant after receiving two embryos through in-vitro fertilisation have more chance of giving birth to twins, a Dutch study presented Monday found. |
Sample records for rotator cuff surgery
Biologics in rotator cuff surgery
Schär, Michael O; Rodeo, Scott A
Pathologies of the rotator cuff are by far the most common cause of shoulder dysfunction and pain. Even though reconstruction of the rotator cuff results in improved clinical outcome scores, including decreased pain, several studies report high failure rates. Orthopaedic research has therefore focused on biologically augmenting the rotator cuff reconstruction and improving tendon–bone healing of the rotator cuff. This biological augmentation has included the application of different platelet concentrates containing growth factors, mesenchymal stem cells, scaffolds and a combination of the above. The present review provides an overview over the biological augmentation options based upon current evidence.
Management of complications after rotator cuff surgery.
Parada, Stephen A; Dilisio, Matthew F; Kennedy, Colin D
Rotator cuff repair (RCR) is a common procedure performed by orthopedic surgeons via arthroscopic, open, or mini-open techniques. While this surgery is considered to be of low morbidity, several potential complications can arise either intraoperatively or during the postoperative time period. Some of these complications are related to the surgical approach (arthroscopic or open), while others are patient dependent. Many of these complications can be managed through nonoperative means; however, early recognition and timely treatment is essential in limiting the long-term sequela and improving patient outcome. There are several different ways to classify complications after RCR repair: timing, severity, preventability, whether or not the pathology is intra- or extra-articular, and the type of treatment necessary. It is essential that the surgeon is cognizant of the etiology contributing to the failed RCR surgery in order to provide timely and proper management. PMID:25532916
Acellular Dermal Matrix in Rotator Cuff Surgery.
Cooper, Joseph; Mirzayan, Raffy
The success of rotator cuff repair (RCR) surgery can be measured clinically (validated outcome scores, range of motion) as well as structurally (re-tear rates using imaging studies). Regardless of repair type or technique, most studies have shown that patients do well clinically. However, multiple studies have also shown that structurally, the failure rate can be very high. A variety of factors, including poor tendon quality, age over 63 years, smoking, advanced fatty infiltration into the muscle, and the inability of the tendon to heal to bone, have been implicated as the cause of the high re-tear rate in RCRs. The suture-tendon interface is felt to be the weakest link in the RCR construct, and suture pullout through the tendon is believed to be the most common method of failure. This review of the published literature seeks to determine if there is support for augmentation of RCR with acellular dermal matrices to strengthen the suture-tendon interface and reduce the re-tear rate. PMID:27552454
Rotator cuff problems
... tear occurs when one of the tendons is torn from the bone from overuse or injury. Causes ... surgery with a larger incision) to repair the torn tendon. Outlook (Prognosis) With rotator cuff tendinitis, rest, ...
... already torn from chronic rotator cuff problems. A partial tear may not require surgery. Instead, rest and ... Follow any discharge and self-care instructions you are given. You will be wearing a sling when you leave the hospital. ...
Rotator Cuff Injuries
... others can be very painful. Treatment for a torn rotator cuff depends on age, health, how severe ... is, and how long you've had the torn rotator cuff. Treatment for torn rotator cuff includes: ...
... days, such as in painting and carpentry Poor posture over many years Aging Rotator cuff tears TEARS ... also help prevent rotator cuff problems. Practice good posture to keep your rotator cuff tendons and muscles ...
Rotator Cuff Injuries.
Connors, G. Patrick
Many baseball players suffer from shoulder injuries related to the rotator cuff muscles. These injuries may be classified as muscular strain, tendonitis or tenosynovitis, and impingement syndrome. Treatment varies from simple rest to surgery, so it is important to be seen by a physician as soon as possible. In order to prevent these injuries, the…
... cuff are common. They include tendinitis, bursitis, and injuries such as tears. Rotator cuff tendons can become ... cuff depends on age, health, how severe the injury is, and how long you've had the ...
Rotator cuff repair - series (image)
... shoulder and arm bones. The tendons can be torn from overuse or injury. ... Surgery to repair a torn rotator cuff is usually very successful at relieving pain in the shoulder. The procedure is less predictable at returning strength ...
Arthroscopic rotator cuff repair.
Burkhart, Stephen S; Lo, Ian K Y
Arthroscopic rotator cuff repair is being performed by an increasing number of orthopaedic surgeons. The principles, techniques, and instrumentation have evolved to the extent that all patterns and sizes of rotator cuff tear, including massive tears, can now be repaired arthroscopically. Achieving a biomechanically stable construct is critical to biologic healing. The ideal repair construct must optimize suture-to-bone fixation, suture-to-tendon fixation, abrasion resistance of suture, suture strength, knot security, loop security, and restoration of the anatomic rotator cuff footprint (the surface area of bone to which the cuff tendons attach). By achieving optimized repair constructs, experienced arthroscopic surgeons are reporting results equal to those of open rotator cuff repair. As surgeons' arthroscopic skill levels increase through attendance at surgical skills courses and greater experience gained in the operating room, there will be an increasing trend toward arthroscopic repair of most rotator cuff pathology. PMID:16757673
Efficacy of Different Rotator Cuff Repair Techniques.
Gurnani, Navin; van Deurzen, Derek Friedrich Petrus; Flipsen, Mark; Raven, Eric Ernest Joseph; van den Bekerom, Michel Pieter Jozef
The purpose of this review article is to describe the currently used techniques for rotator cuff repair and after treatment. The literature was searched for the different surgical techniques and additional treatment including: [1] full arthroscopic and arthroscopic assisted rotator cuff repair, [2] acromioplasty as an additional treatment to rotator cuff repair, [3] the use of plasma rich platelets (PRP) after rotator cuff repair, [4] the single and double row fixation techniques, [5] long head of the biceps brachii tenotomy or tenodesis with rotator cuff repair, [6] scaffolds in rotator cuff surgery, and [7] early motion or immobilization after rotator cuff repair. The rationale, the results, and the scientific evidence were reported for the eligible procedures. PMID:26055023
Factors affecting rotator cuff healing.
Mall, Nathan A; Tanaka, Miho J; Choi, Luke S; Paletta, George A
Several studies have noted that increasing age is a significant factor for diminished rotator cuff healing, while biomechanical studies have suggested the reason for this may be an inferior healing environment in older patients. Larger tears and fatty infiltration or atrophy negatively affect rotator cuff healing. Arthroscopic rotator cuff repair, double-row repairs, performing a concomitant acromioplasty, and the use of platelet-rich plasma (PRP) do not demonstrate an improvement in structural healing over mini-open rotator cuff repairs, single-row repairs, not performing an acromioplasty, or not using PRP. There is conflicting evidence to support postoperative rehabilitation protocols using early motion over immobilization following rotator cuff repair. PMID:24806015
Free biceps tendon autograft to augment arthroscopic rotator cuff repair.
Obma, Padraic R
Arthroscopic rotator cuff repairs have become the standard of treatment for all sizes of tears over the past several years. Current healing rates reported in the literature are quite good, but improving the healing potential of rotator cuff repairs remains a challenging problem. There has been an increase recently in the use of augmentation of rotator cuff repairs with xenografts or synthetics for large and massive tears. Biceps tenodesis is often indicated as part of the treatment plan while one is performing rotator cuff surgery. A subpectoral biceps tenodesis provides a source of autograft to augment rotator cuff repairs of all sizes. Two techniques are presented to augment rotator cuff repairs with a free biceps tendon autograft. This is a novel idea in an attempt to improve healing rates and long-term results of rotator cuff repairs of all sizes. PMID:24400197
Rotator cuff - self-care
... tendons that attach to the bones of the shoulder joint, allowing the shoulder to move and remain stable. Common rotator cuff ... can help when you feel pain in your shoulder. An ice pack applied to the shoulder 20 ...
Implementation of a Shoulder Soft Tissue Injury Triage Service in a UK NHS Teaching Hospital Improves Time to Surgery for Acute Rotator Cuff Tears.
Bateman, Marcus; Davies-Jones, Gareth; Tambe, Amol; Clark, David I
Shoulder problems account for 2.4% of GP consultations in the United Kingdom and of those 70% are related to the rotator cuff. Many rotator cuff tears are of a degenerate nature but they can occur as a result of trauma in 8% of cases. Evidence suggests that patients with traumatic rotator cuff tears gain a better outcome in terms of pain and function if the tear is repaired early after injury. A specialist shoulder soft tissue injury clinic was set up in a large UK NHS teaching hospital with the primary purpose in the first year to halve the length of time patients with traumatic rotator cuff tears had to wait to consult a specialist and double the number of patients undergoing surgical repair within three months. The secondary purpose was to ensure that the new clinic was utilised to capacity by the end of the first year. The clinic was later expanded to manage patients with acute glenohumeral joint (GHJ) or acromioclavicular joint (ACJ) dislocations and identify those patients requiring surgical stabilisation. The new service involved referral of all patients presenting to the Accident & Emergency department with recent shoulder trauma and either an inability to raise the arm over shoulder height with a normal set of radiographs, or a confirmed GHJ or ACJ dislocation; to a specialist clinic run by an experienced upper limb physiotherapist. Patients were reassessed and referred for further imaging if required. Those patients found to have traumatic rotator cuff tears or structural instability lesions were listed for expedited surgery. The clinic ran alongside a consultant-led fracture clinic giving fast access to surgical decision-making. The service was reviewed after 3, 6, and 12 months and findings compared to a sample of 30 consecutive patients having undergone rotator cuff repair surgery via the previous pathway. 144 patients were referred to the clinic in the first year: 62 with rotator cuff symptoms, 38 with GHJ instability, 13 with ACJ instability, and 33
A randomised controlled trial comparing continuous supraclavicular and interscalene brachial plexus blockade for open rotator cuff surgery.
Koh, W U; Kim, H J; Park, H S; Choi, W J; Yang, H S; Ro, Y J
Continuous interscalene block is an approved modality for postoperative pain control, but it may cause hemidiaphragmatic paresis. In this study we aimed to determine whether continuous supraclavicular block would provide postoperative analgesia comparable to that of continuous interscalene block and reduce the incidence of hemidiaphragmatic paresis. Patients scheduled for open rotator cuff repair were randomly allocated to receive continuous interscalene (n = 38) or supraclavicular block (n = 37). Both participants and assessing clinicians were blinded to the group allocation. The primary endpoint was the mean pain intensity 24 h after the surgery. Postoperative mean (SD) pain scores at 24 h were similar in the supraclavicular and interscalene groups (2.57 (1.71) vs 2.84 (1.75) respectively; p = 0.478). The incidence of complete or partial hemidiaphragmatic paresis was lower in the supraclavicular group at 1 h after admission to the postanaesthetic care unit and 24 h after the surgery [25 (68%) vs 38 (100%); p = 0.001 and 14 (38%) vs 27 (71%) respectively; p = 0.008]. Continuous supraclavicular block provided comparable analgesia compared with interscalene block with a reduced incidence of complete or partial hemidiaphragmatic paresis for 24 h following surgery. PMID:26954669
... doctors because of a rotator cuff problem. A torn rotator cuff will weaken your shoulder. This means ... or more of the rotator cuff tendons is torn, the tendon no longer fully attaches to the ...
Rotator Cuff Tear Shape Characterization
Goodwin, David Steven; Kaplan, Daniel James; Fralinger, David; Gyftopoulos, Soterios; Meislin, Robert J.; Jazrawi, Laith M.
Objectives: Proper surgical planning requires accurate and reliable pre-operative patient information. The more comprehensive the data, the more the surgeon can tailor a general surgical technique to an individual patient’s unique anatomy. A previous retrospective study demonstrated that three-dimensional magnetic resonance imaging more accurately characterized rotator cuff tears compared to two-dimensional images when checked against intra-operative pictures. The purpose of this study was to determine if three-dimensional MRI imaging would continue to be more accurate than two-dimensional imaging in a prospective study. Methods: Patients were prospectively included if they had a full-thickness primary rotator cuff tear on pre-operative MRI. Intra-op videos were taken from the posterior and lateral portals, with a grasper fully mobilizing the torn tendon in each view. 7 surgeons then reviewed the videos and independently characterized the shape of the tears into crescent, U-shaped tears, L-shaped tears, or massive tears. This was considered the gold-standard. Two musculoskeletal radiologists reviewed the corresponding MRI studies independently and blind to the arthroscopic findings and characterized the shape on the basis of the tear’s retraction and size 2D MRI. The 3D reconstructions of each cuff tear were reviewed by each radiologist to characterize the shape. Statistical analysis included 95% confidence intervals and fleiss’s kappa. Results: 37 patients were enrolled in the study. Among the 7 surgeons, agreement on cuff tear was 93% ( =.87). The accuracy for differentiating between crescent-shaped, longitudinal, and massive tears using measurements on 2D MRI was 73.4% for reader 1 and 71.2% for reader 2. The accuracy for tear shape characterization into crescent and longitudinal U- or L-shaped using 3D MRI was 92% for reader 1 and 94% for reader 2. When further characterizing the longitudinal tears as massive or not using 3D MRI, both readers had an
Treatment of lesions of the rotator cuff.
Saggini, R; Cavezza, T; Di Pancrazio, L; Pisciella, V; Saladino, G; Zuccaro, M C; Bellomo, R G
The impingement syndrome and tendinopathy of the rotator cuff are the most common causes (complaints) of pain and disability of the shoulder. The aim of this study is to evaluate the efficacy of a specific rehabilitative protocol, integrated with the administration of a nutritional supplement, in the conservative rehabilitative treatment, as well as in post-surgery, of patients with lesions of the rotator cuff. Two groups with syndrome of the rotator cuff were formed to follow different therapeutic courses, in relation to the choice of each subject to undergo the conservative treatment (Arm A) or the surgical one (Arm B). In Arm A the study included the association of therapy with ESWT (shock waves) with the proprioceptive Multi Joint System, for rehabilitating joint movement and muscle strength of the shoulder, and a specific nutritional supplement to reduce the pain and conserve the cartilage tissue. Between February 2009 and June 2009, we enrolled 30 subjects (randomized into three homogenous groups A1, A2, A3), average age 45±10 years, with rotator cuff syndrome with calcification of the shoulder, diagnosed through clinical examination and investigative instruments (X-ray, echography or NMR). In Arm B, from September 2009 to January 2010, we enrolled 50 patients (randomized into two groups, B1 and B2), 24 male (average age 58.4: min 28 and max 78) and 26 females (average age 59.5: min 30 and max 80), who had undergone rotator cuff operations and acromionplasty for non-massive lesions without important gleno-humeral instability, with either open or arthroscopic procedures. The analysis of the results of Arm A highlights that in terms of reducing pain the main benefits were found in Group A1 where the supplement was given. From the analysis of the data of Arm B, in both groups an improvement of the first 4 items evaluated was evident. In Group B1, 84 percent of the patients declared to be satisfied and improved and 16 percent were dissatisfied; in Group B2
Ultrasound determination of rotator cuff tear repairability
Tse, Andrew K; Lam, Patrick H; Walton, Judie R; Hackett, Lisa
Background Rotator cuff repair aims to reattach the torn tendon to the greater tuberosity footprint with suture anchors. The present study aimed to assess the diagnostic accuracy of ultrasound in predicting rotator cuff tear repairability and to assess which sonographic and pre-operative features are strongest in predicting repairability. Methods The study was a retrospective analysis of measurements made prospectively in a cohort of 373 patients who had ultrasounds of their shoulder and underwent rotator cuff repair. Measurements of rotator cuff tear size and muscle atrophy were made pre-operatively by ultrasound to enable prediction of rotator cuff repairability. Tears were classified following ultrasound as repairable or irreparable, and were correlated with intra-operative repairability. Results Ultrasound assessment of rotator cuff tear repairability has a sensitivity of 86% (p < 0.0001) and a specificity of 67% (p < 0.0001). The strongest predictors of rotator cuff repairability were tear size (p < 0.001) and age (p = 0.004). Sonographic assessments of tear size ≥4 cm2 or anteroposterior tear length ≥25 mm indicated an irreparable rotator cuff tear. Conclusions Ultrasound assessment is accurate in predicting rotator cuff tear repairability. Tear size or anteroposterior tear length and age were the best predictors of repairability. PMID:27582996
A Comparison of Rehabilitation Methods After Arthroscopic Rotator Cuff Repair
Yi, Anthony; Villacis, Diego; Yalamanchili, Raj; Hatch, George F. Rick
Context: Despite the significant attention directed toward optimizing arthroscopic rotator cuff repair, there has been less focus on rehabilitation after rotator cuff repair surgery. Objective: To determine the effect of different rehabilitation protocols on clinical outcomes by comparing early versus late mobilization approaches and continuous passive mobilization (CPM) versus manual therapy after arthroscopic rotator cuff repair. Data Sources: PubMed was searched for relevant articles using the keywords rotator cuff, rotator, cuff, tears, lacerations, and rehabilitation to identify articles published from January 1980 to March 2014. Study Selection: Inclusion criteria consisted of articles of level 1 or 2 evidence, written in the English language, and with reported outcomes for early versus late mobilization or rehabilitation with CPM versus manual therapy after primary arthroscopic rotator cuff repair. Exclusion criteria consisted of articles of level 3, 4, or 5 evidence, non-English language, and those with significantly different demographic variables between study groups. Included studies were evaluated with the Consolidated Standards of Reporting Trials criteria. Study Design: Systematic review. Level of Evidence: Level 2. Data Extraction: Level of evidence, study type, number of patients enrolled, number of patients at final follow-up, length of follow-up, age, sex, rotator cuff tear size, surgical technique, and concomitant operative procedures were extracted from included articles. Postoperative data included clinical outcome scores, visual analog score for pain, shoulder range of motion, strength, and rotator cuff retear rates. Results: A total of 7 studies met all criteria and were included in the final analysis. Five studies compared early and late mobilization. Two studies compared CPM and manual therapy. Conclusion: In general, current data do not definitively demonstrate a significant difference between postoperative rotator cuff rehabilitation
Current Biomechanical Concepts for Rotator Cuff Repair
For the past few decades, the repair of rotator cuff tears has evolved significantly with advances in arthroscopy techniques, suture anchors and instrumentation. From the biomechanical perspective, the focus in arthroscopic repair has been on increasing fixation strength and restoration of the footprint contact characteristics to provide early rehabilitation and improve healing. To accomplish these objectives, various repair strategies and construct configurations have been developed for rotator cuff repair with the understanding that many factors contribute to the structural integrity of the repaired construct. These include repaired rotator cuff tendon-footprint motion, increased tendon-footprint contact area and pressure, and tissue quality of tendon and bone. In addition, the healing response may be compromised by intrinsic factors such as decreased vascularity, hypoxia, and fibrocartilaginous changes or aforementioned extrinsic compression factors. Furthermore, it is well documented that torn rotator cuff muscles have a tendency to atrophy and become subject to fatty infiltration which may affect the longevity of the repair. Despite all the aforementioned factors, initial fixation strength is an essential consideration in optimizing rotator cuff repair. Therefore, numerous biomechanical studies have focused on elucidating the strongest devices, knots, and repair configurations to improve contact characteristics for rotator cuff repair. In this review, the biomechanical concepts behind current rotator cuff repair techniques will be reviewed and discussed. PMID:23730471
Rotator cuff injuries in adolescent athletes.
Weiss, Jennifer M; Arkader, Alexandre; Wells, Lawrence M; Ganley, Theodore J
The cause of rotator cuff injuries in the young athlete has been described as an overuse injury related to internal impingement. Abduction coupled with external rotation is believed to impinge on the rotator cuff, specifically the supraspinatus, and lead to undersurface tears that can progress to full-thickness tears. This impingement is believed to be worsened with increased range of motion and instability in overhead athletes. A retrospective review of seven patients diagnosed with rotator cuff injuries was performed to better understand this shoulder injury pattern. The type of sport played, a history of trauma, diagnosis, treatment method, and outcome were noted. Six patients were male and one was a female. Baseball was the primary sport for four patients, basketball for one, gymnastics for one, and wrestling for one. The following injury patterns were observed: two patients tore their subscapularis tendon, two sustained avulsion fractures of their lesser tuberosity, one tore his rotator interval, one tore his supraspinatus, and one avulsed his greater tuberosity. Only four patients recalled a specific traumatic event. Three patients were treated with arthroscopic rotator cuff repair, three with miniopen repair, and one was treated with rehabilitation. Six of the seven patients returned to their preinjury level of sport after treatment. Rotator cuff tears are rare in the adolescent age group. The injury patterns suggest that acute trauma likely accounts for many rotator cuff tears and their equivalents in the young patient. Adolescents with rotator cuff tears reliably return to sports after treatment. The possibility of rotator cuff tears in skeletally immature athletes should be considered. The prognosis is very good once this injury is identified and treated. PMID:22668571
Analysis of Direct Costs of Outpatient Arthroscopic Rotator Cuff Repair.
Narvy, Steven J; Ahluwalia, Avtar; Vangsness, C Thomas
Arthroscopic rotator cuff surgery is one of the most commonly performed orthopedic surgical procedures. We conducted a study to calculate the direct cost of arthroscopic repair of rotator cuff tears confirmed by magnetic resonance imaging. Twenty-eight shoulders in 26 patients (mean age, 54.5 years) underwent primary rotator cuff repair by a single fellowship-trained arthroscopic surgeon in the outpatient surgery center of a major academic medical center. All patients had interscalene blocks placed while in the preoperative holding area. Direct costs of this cycle of care were calculated using the time-driven activity-based costing algorithm. Mean time in operating room was 148 minutes; mean time in recovery was 105 minutes. Calculated surgical cost for this process cycle was $5904.21. Among material costs, suture anchor costs were the main cost driver. Preoperative bloodwork was obtained in 23 cases, adding a mean cost of $111.04. Our findings provide important preliminary information regarding the direct economic costs of rotator cuff surgery and may be useful to hospitals and surgery centers negotiating procedural reimbursement for the increased cost of repairing complex tears. PMID:26761928
Clinical Examination of the Rotator Cuff
Jain, Nitin B.; Wilcox, Reginald; Katz, Jeffrey N.; Higgins, Laurence D.
Rotator cuff tears are the leading cause of shoulder pain and shoulder-related disability accounting for 4.5 million physician visits in the United States annually. A careful history and structured physical examination are often sufficient for diagnosing rotator cuff disorders. We are not aware of a clinical review article that presents a structured physical examination protocol of the rotator cuff for the interested clinician. To fill this void, we present a physical examination protocol developed on the basis of review of prior literature and our clinical experience from dedicated shoulder practices. Our protocol includes range of motion testing using a goniometer, strength testing using a dynamometer, and select special tests. Among the many tests for rotator cuff disorders that have been described, we chose ones that have been more thoroughly assessed for sensitivity and specificity. This protocol can be used to isolate the specific rotator cuff tendon involved. The protocol can be typically completed in 15 minutes. We also discuss the clinical implications and limitations of the physical examination maneuvers described in our protocol. This protocol is thorough yet time-efficient for a busy clinical practice. It is useful in diagnosis of rotator cuff tears, impingement syndrome, and biceps pathology. PMID:23332909
No prosthetic management of massive and irreparable rotator cuff tears
Garofalo, Raffaele; Cesari, Eugenio
A massive rotator cuff tear is not necessarily irreparable. Number of tendons involved, muscle-tendon unit quality, and decreased acromionhumeral distance (AHD) are as important as tear size in determining reparability of lesion. Massive and irreparable rotator cuff tears cannot be anatomically repaired to the bone and are a common source of pain and disability even in middle-aged patients. In these patients when conservative management has failed, it is possible to perform different surgical techniques. A functional repair can help to restore the horizontal force couple of the cuff on the humeral head and to increase the AHD. Debridement of irreparable tears and biceps tenotomy or tenodesis can have a role in low functional demand patients but results deteriorate over time. Recently, several commercially available tissue-engineered biological and synthetic scaffolds have been developed to augment rotator cuff repairs. The aim is to provide a mechanical improvement in case of poor quality tissue at time zero and give a support to have a better cuff healing. In selected cases, the scaffold can be used also to bridge tendon defect. Patients who not have pseudoparalysis, cuff tear arthropathy and with intact deltoid function can benefit from tendon transfers with satisfactory outcomes. These different procedures should be chosen for each patient with selected criteria and after a satisfactory explanation about the really possible expectation after surgery.
Occult Interpositional Rotator Cuff - an Extremely Rare Case of Traumatic Rotator Cuff Tear
Lin, Cheng-Li; Su, Wei-Ren; Jou, I-Ming
Traumatic interposition of a rotator cuff tendon in the glenohumeral joint without recognizable glenohumeral dislocation is an unusual complication after shoulder trauma. Here we report the clinical and imaging presentations of a 17-year-old man with trapped rotator cuff tendons in the glenohumeral joint after a bicycle accident. The possible trauma mechanism is also discussed. PMID:22247643
Rotator cuff tears: An evidence based approach
Sambandam, Senthil Nathan; Khanna, Vishesh; Gul, Arif; Mounasamy, Varatharaj
Lesions of the rotator cuff (RC) are a common occurrence affecting millions of people across all parts of the globe. RC tears are also rampantly prevalent with an age-dependent increase in numbers. Other associated factors include a history of trauma, limb dominance, contralateral shoulder, smoking-status, hypercholesterolemia, posture and occupational dispositions. The challenge lies in early diagnosis since a high proportion of patients are asymptomatic. Pain and decreasing shoulder power and function should alert the heedful practitioner in recognizing promptly the onset or aggravation of existing RC tears. Partial-thickness tears (PTT) can be bursal-sided or articular-sided tears. Over the course of time, PTT enlarge and propagate into full-thickness tears (FTT) and develop distinct chronic pathological changes due to muscle retraction, fatty infiltration and muscle atrophy. These lead to a reduction in tendon elasticity and viability. Eventually, the glenohumeral joint experiences a series of degenerative alterations - cuff tear arthropathy. To avert this, a vigilant clinician must utilize and corroborate clinical skill and radiological findings to identify tear progression. Modern radio-diagnostic means of ultrasonography and magnetic resonance imaging provide excellent visualization of structural details and are crucial in determining further course of action for these patients. Physical therapy along with activity modifications, anti-inflammatory and analgesic medications form the pillars of nonoperative treatment. Elderly patients with minimal functional demands can be managed conservatively and reassessed at frequent intervals. Regular monitoring helps in isolating patients who require surgical interventions. Early surgery should be considered in younger, active and symptomatic, healthy patients. In addition to being cost-effective, this helps in providing a functional shoulder with a stable cuff. An easily reproducible technique of maximal strength and
Rotator cuff tear measurement by arthropneumotomography
Kilcoyne, R.F.; Matsen, F.A. III
Five years of experience with a method of shoulder arthrography using upright tomography in cases of suspected or known rotator cuff tears has demonstrated its effectiveness. The value of the procedure lies in its ability to demonstrate the size of the cuff tear and the thickness of the remaining cuff tissue. This information provides the surgeon with a preoperative estimate of the difficulty of the repair and the prognosis for a good functional recovery. In 33 cases, there was good correlation between the upright thin-section tomogram findings and the surgical results. The tomograms provided better information about the size of the tear and the quality of the remaining cuff than did plain arthrograms.
Gender Affects Early Postoperative Outcomes of Rotator Cuff Repair
Ye, Hee-Uk; Jung, Jae-Won; Lee, Young-Kuk
Background The literature does not provide consistent information on the impact of patients' gender on recovery after rotator cuff repair. The purpose of this study was to determine whether gender affects pain and functional recovery in the early postoperative period after rotator cuff repair. Methods Eighty patients (40 men and 40 women) were prospectively enrolled. Pain intensity and functional recovery were evaluated, using visual analog scale (VAS) pain score and range of motion on each of the first 5 postoperative days, at 2 and 6 weeks and at 3, 6, and 12 months after surgery. Perioperative medication-related adverse effects and postoperative complications were also assessed. Results The mean VAS pain score was significantly higher for women than men at 2 weeks after surgery (p = 0.035). For all other periods, there was no significant difference between men and women in VAS pain scores, although women had higher scores than men. Mean forward flexion in women was significantly lower than men at 6 weeks after surgery (p = 0.033) and the mean degree of external rotation in women was significantly lower than men at 6 weeks (p = 0.007) and at 3 months (p = 0.017) after surgery. There was no significant difference in medication-related adverse effects or postoperative complications. Conclusions Women had more pain and slower recovery of shoulder motion than men during the first 3 months after rotator cuff repair. These findings can serve as guidelines for pain management and rehabilitation after surgery and can help explain postoperative recovery patterns to patients with scheduled rotator cuff repair. PMID:26217471
Rotator Cuff Tendinitis and Tear (Beyond the Basics)
... is usually treated with ice, antiinflammatory drugs, and physical therapy. (See 'Rotator cuff injury treatment' below.) Rotator cuff ... small- to medium-size tears usually improve with physical therapy exercises, stopping painful activities, and, in some cases, ...
Muscle atrophy and fatty infiltration after an acute rotator cuff repair in a sheep model
Luan, Tammy; Liu, Xuhui; Easley, Jeremiah T.; Ravishankar, Bharat; Puttlitz, Christian; Feeley, Brian T.
Summary Introduction rotator cuff tears (RCTs) are the most common tendon injury seen in orthopedic patients. Muscle atrophy and fatty infiltration of the muscle are crucial factors that dictate the outcome following rotator cuff surgery. Though less studied in humans, rotator cuff muscle fibrosis has been seen in animal models as well and may influence outcomes as well. The purpose of this study was to determine if the rotator cuff would develop muscle changes even in the setting of an acute repair in a sheep model. We hypothesized that fatty infiltration and fibrosis would be present even after an acute repair six months after initial surgery. Methods twelve female adult sheep underwent an acute rotator cuff tear and immediate repair on the right shoulder. The left shoulder served as a control and did not undergo a tear or a repair. Six months following acute rotator cuff repairs, sheep muscles were harvested to study atrophy, fatty infiltration, and fibrosis by histological analysis, western blotting, and reverse transcription polymerase chain reaction (RT-PCR). Results the repair group demonstrated an increase expression of muscle atrophy, fatty infiltration, and fibrosis related genes. Significantly increased adipocytes, muscle fatty infiltration, and collagen deposition was observed in rotator cuff muscles in the tendon repair group compared to the control group. Conclusions rotator cuff muscle undergoes degradation changes including fatty infiltration and fibrosis even after the tendons are repair immediately after rupture. Level of Evidence Basic Science Study. PMID:26261789
Biological aspects of rotator cuff healing
Wildemann, Britt; Klatte, Franka
Summary Tendon tears of the rotator cuff show a high prevalence in today’s population. Patients suffer from permanent pain and disability, and surgical reconstruction may be the only possibility for abatement. The complex process of tendon-bone healing leads to mechanically inferior scar-tissue, which often results in retears or non-healing. In the current literature, factors such as patients age, sex and fatty muscle infiltration are highly correlated to the presence of rotator cuff tears and the incidence of retears. To improve the tendon tissue quality after surgical reconstructions biologically based strategies with use of growth factors arouse more and more interest in the last years. However, to optimize the treatment of rotator cuff tears the biological background of tears and retears must be investigated in more detail. This article will elucidate different aspects that have an impact on rotator cuff healing and give a brief insight in tendon/ligament cell culture and animal studies focusing on growth factor treatments. PMID:23738265
Rotator Cuff Tears: Surgical Treatment Options
... topic.cfm?topic=A00064 Surgery to repair a torn rotator cuff most o en involves re-attaching ... Recommended Your doctor may recommend surgery for a torn rotator cuff if your pain does not improve ...
Glycosaminoglycans of human rotator cuff tendons: changes with age and in chronic rotator cuff tendinitis.
Riley, G P; Harrall, R L; Constant, C R; Chard, M D; Cawston, T E; Hazleman, B L
OBJECTIVES--To analyse the glycosaminoglycans of the adult human rotator cuff tendon matrix, to characterise changes in the glycosaminoglycan composition with age and in chronic rotator cuff tendinitis. METHODS--Rotator cuff (supraspinatus) tendons (n = 84) and common biceps tendons (n = 26) were obtained from cadavers with no history of tendon pathology (age range 11-95 years). Biopsies of rotator cuff tendons (supraspinatus and subscapularis tendons, n = 53) were obtained during open shoulder surgery to repair shoulder lesions (age range 38-80 years). Glycosaminoglycans were extracted by papain digestion and analysed by cellulose acetate electrophoresis, the carbazole assay for uronic acid and the dimethylmethylene blue dye-binding assay for sulphated glycosaminoglycans. Some digests were analysed for keratan sulphate by 5D4 monoclonal antibody ELISA. Soluble proteoglycans were extracted in 4M guanidine hydrochloride and analysed by 4-15% SDS PAGE. RESULTS--The mean (SD) sulphated glycosaminoglycan (GAG) content of the normal cadaver supraspinatus tendon was 12.3 (4.3) micrograms/mg dry weight, between three and ten times greater than in the common biceps tendon [1.2 (0.6) micrograms/mg dry weight]. The major GAG was chondroitin sulphate [6.9 (2.6) micrograms/mg dry weight], with a smaller proportion of dermatan sulphate [2.5 (1.2) micrograms/mg dry weight]. In contrast, the common biceps tendon contained predominantly dermatan sulphate [0.8 (0.2) microgram/mg dry weight] with less chondroitin sulphate [0.2 (0.2) microgram/mg dry weight]. There was no difference in the concentration of hyaluronan in these tendons [9.3 (2.8) micrograms/mg dry weight and 10.8 (4.3) micrograms/mg dry weight respectively] and there was no significant change of hyaluronan with age. Keratan sulphate was a small but significant component of the supraspinatus tendon [0.43 (0.33) microgram/mg dry weight, n = 25], whereas there was little or none in the common biceps tendon [0.04 (0
Investigating the cellular origin of rotator cuff muscle fatty infiltration and fibrosis after injury
Liu, Xuhui; Ning, Anne Y.; Chang, Nai Chen; Kim, Hubert; Nissenson, Robert; Wang, Liping; Feeley, Brian T.
Summary Background rotator cuff muscle atrophy, fibrosis and fatty infiltration are common complications after large and massive rotator cuff tears. Currently, there are no effective treatments for these muscle pathologies after injury. Furthermore, the cellular source for fibrotic and adipose tissues in rotator cuff muscle after injury remains unknown. In this study, we proposed that two groups of muscle resident progenitors, Tie2+ muscle mesenchymal progenitors and PDGFRα+ fibro/adipogenic progenitor cells (FAPs), contribute significantly to rotator cuff muscle fibrosis and fatty infiltration. Methods we tested our hypothesis using reporter mice. Rotator cuff muscles from Tie2-GFP and PDGFRα-GFP reporter mice were harvested at 2 and 6 weeks after unilateral massive rotator cuff tear surgeries. Immunofluorescent staining for fibroblast and adipocyte markers was conducted. Results our results showed significant co-localization of Tie2+ cells with fibrotic markers vimentin and αSMA. In the PDGFRα-GFP reporter mice, GFP signal was seen in only a small fraction of cells staining positive for vimentin and αSMA. However, PDGFRα showed significant co-localization with adipocyte markers, including PPAR-γ, adiponectin, and perilipin A. Oil red O staining confirmed that the mature adipocytes appearing in rotator cuff muscles after injury are also PDGFRα+. Conclusion these data demonstrated that the Tie2+ muscle mesenchymal progenitors are the major source of fibroblasts while PDGFRα+ FAPs are the major source of adipocytes in rotator cuff muscle fatty infiltration. Basic Science Study. PMID:27331027
Imaging of the Rotator Cuff With Optical Coherence Tomography.
Hartshorn, Timothy; Ren, Jian; Vangsness, C Thomas
This study evaluated the utility of optical coherence tomography (OCT) in imaging porcine and human rotator cuff (RTC) tissue, analyzed its effectiveness in identifying clinical pathology, and correlated these findings with histologic examination. Twelve human cadaveric and 6 porcine shoulders were evaluated. Six-millimeter-wide bone sections were harvested from the proximal humerus of each specimen, with each containing the entire enthesis of the respective RTC tendon, as well as 2 cm of tendon medial to the enthesis. Only the supraspinatus tendon was evaluated in the human specimens, whereas the enthesis of multiple RTC tendons were evaluated in the porcine model. All specimens were imaged using OCT and correlated with histologic evaluation. Optical coherence tomography evaluation of macroscopically healthy tissue consistently showed an easily identifiable banding pattern (birefringence) in contrast to a disorganized, homogeneous appearance in grossly diseased tissue. Optical coherence tomography was more effective for qualitative evaluation of RTC tissue, identification of bursal-sided RTC tears, and localization of calcific deposits, whereas intrasubstance tendon delaminations and partial articular-sided tendon avulsion lesions were relatively more difficult to identify. Optical coherence tomography correlated well with histologic evaluation in all specimens. Optical coherence tomography provides high-resolution, subsurface imaging of rotator cuff tissue in real-time to a depth of up to 4 mm with excellent correlation to histology in a cadaveric model. Optical coherence tomography could be an effective adjunctive tool for the identification and localization of rotator cuff pathology. The use of OCT in arthroscopic shoulder surgery potentially provides a minimally invasive modality for qualitative assessment of rotator cuff pathology. This may allow for a decrease in soft tissue dissection, improved qualitative assessment of cuff tissue, and improved patient
Management of failed rotator cuff repair: a systematic review
Lädermann, Alexandre; Denard, Patrick J; Burkhart, Stephen S
Importance Recurrent tear after rotator cuff repair (RCR) is common. Conservative, and open and arthroscopic revisions, have been advocated to treat these failures. Aim or objective The purpose of this systematic review was to evaluate the different options for managing recurrent rotator cuff tears. Evidence review A search was conducted of level I through 4 studies from January 2000 to October 2015, to identify studies reporting on failed RCR. 10 articles were identified. The overall quality of evidence was very low. Findings Mid-term to long-term follow-up of patients treated conservatively revealed acceptable results; a persistent defect is a well-tolerated condition that only occasionally requires subsequent surgery. Conservative treatment might be indicated in most patients, particularly in case of posterosuperior involvement and poor preoperative range of motion. Revision surgery might be indicated in a young patient with a repairable lesion, a 3 tendon tear, and in those with involvement of the subscapularis. Conclusions and relevance The current review indicates that arthroscopic revision RCR can lead to improvement in functional outcome despite a high retear rate. Further studies are needed to develop specific rehabilitation in the case of primary rotator cuff failure, to better understand the place of each treatment option, and, in case of repair, to optimise tendon healing. PMID:27134759
I.S.Mu.L.T - Rotator Cuff Tears Guidelines.
Oliva, Francesco; Piccirilli, Eleonora; Bossa, Michela; Via, Alessio Giai; Colombo, Alessandra; Chillemi, Claudio; Gasparre, Giuseppe; Pellicciari, Leonardo; Franceschetti, Edoardo; Rugiero, Clelia; Scialdoni, Alessandro; Vittadini, Filippo; Brancaccio, Paola; Creta, Domenico; Buono, Angelo Del; Garofalo, Raffaele; Franceschi, Francesco; Frizziero, Antonio; Mahmoud, Asmaa; Merolla, Giovanni; Nicoletti, Simone; Spoliti, Marco; Osti, Leonardo; Padulo, Johnny; Portinaro, Nicola; Tajana, Gianfranco; Castagna, Alex; Foti, Calogero; Masiero, Stefano; Porcellini, Giuseppe; Tarantino, Umberto; Maffulli, Nicola
Despite the high level achieved in the field of shoulder surgery, a global consensus on rotator cuff tears management is lacking. This work is divided into two main sessions: in the first, we set questions about hot topics involved in the rotator cuff tears, from the etiopathogenesis to the surgical treatment. In the second, we answered these questions by mentioning Evidence Based Medicine. The aim of the present work is to provide easily accessible guidelines: they could be considered as recommendations for a good clinical practice developed through a process of systematic review of the literature and expert opinion, in order to improve the quality of care and rationalize the use of resources. PMID:26958532
I.S.Mu.L.T - Rotator Cuff Tears Guidelines
Anomalous biceps origin from the rotator cuff
Banerjee, Samik; Patel, Vipul R
Variations in the origin of the long head of biceps tendon (LHBT) have been described in literature; however, its clinical significance remains uncertain. We describe in this report, the history, physical examination and the arthroscopic findings in a patient who had an anomalous origin of the LHBT from the rotator cuff, resulting in restriction of range of motion. This anomalous origin of the long head of biceps tendon causing capsular contracture and restriction of movements leading to secondary internal impingement, has not been extensively reported in the literature. Shoulder arthroscopists should be aware that, although, an uncommon clinical condition, the aberrant congenital origin of the LHBT from the rotator cuff can rarely become pathologic in middle age and lead to shoulder dysfunction. In such cases, release of the anomalous band may be required, along with the treatment of other concomitant intraarticular pathologies in the glenohumeral joint. PMID:25593361
Review article: Risk factors for poor outcome following surgical treatment for rotator cuff tear.
Sahni, V; Narang, A M
The Medline database was searched using key words: 'rotator cuff', 'tear', and 'treatment'. 12 studies that involved (1) surgical treatment for rotator cuff tear, (2) measurement of pre- and post-operative pain score, functional score, and/or patient satisfaction, (3) patients that failed to improve functionally or had poor satisfaction, (4) preoperative examination of risk factors that could lead to poor outcome, and (5) a minimum follow-up of 6 months were reviewed to identify risk factors associated with poor outcome following surgical treatment for rotator cuff tear. The most common risk factor was tear size, followed by open compensation claim, age, and time from injury to surgery. PMID:27574276
Delivered growth factor therapy to improve healing after rotator cuff repair
Cheung, Emilie V; Silverio, Luz; Yao, Jeffrey
Background Degenerative rotator cuff tears are a significant cause of shoulder pain in the aging population. Rotator cuff repair surgery may be more successful when growth factors are delivered to the repair site. This study was designed to determine the cellular processes involved in normal bone-to-tendon healing and the current approaches used for biologic augmentation of rotator cuff repair. Methods This review focuses on animal studies of rotator cuff repair and early human trials. Results Regular bone-to-tendon healing forms a fibrous junction between tendon and bone that is markedly different from the original bone-to-tendon junction. Tendon augmentation with cellular components serves as scaffolding for endogenous fibroblastic cells and a possible source of growth factors and fibroblastic cells. Extracellular matrices provide a scaffold for incoming fibroblastic cells. However, research in extracellular matrices is not conclusive due to intermanufacturer variation and the lack of human subject research. Growth factors and platelet-rich plasma are established in other fields of research and show promise, but have not yet been rigorously tested in rotator cuff repair augmentation. Conclusions Rotator cuff repair can benefit from biologic augmentation. However, research in this field is still young and has not yet demonstrated that the benefits in healing rates are significant enough to merit regular clinical use. Randomized controlled trials will elucidate the use of biologic augmentation in rotator cuff repairs. PMID:24198519
Assessment and treatment strategies for rotator cuff tears
Al-Hakim, Wisam; Noorani, Ali
Tears of the rotator cuff are common and becoming an increasingly frequent problem. There is a vast amount of literature on the merits and limitations of the various methods of clinical and radiological assessment of rotator cuff tears. This is also the case with regard to treatment strategies. Certain popular beliefs and principles practiced widely and the basis upon which they are derived may be prone to inaccuracy. We provide an overview of the historical management of rotator cuff tears, as well as an explanation for how and why rotator cuff tears should be managed, and propose a structured methodology for their assessment and treatment.
Evaluation of Internet Information About Rotator Cuff Repair.
Lawson, Kevin A; Codella, Stephen; Ciccotti, Michael G; Kane, Patrick W; Duncan, Ian C; Cohen, Steven B
The content and quality of Internet websites are not governed or regulated. Therefore, patients who consult the Internet may receive outdated or incorrect medical information. Researchers have analyzed the quality of web information about various orthopedic surgeries, but no such analysis has been performed on websites covering rotator cuff repair. We conducted a study to evaluate and analyze rotator cuff repair information available to the general public through the Internet; to assess changes in the quality of information over time; to determine if sites sponsored by academic institutions offered higher-quality information; and to assess whether the readability of the material varied according to DISCERN scores. Two Internet searches were conducted, in 2011 and 2014. The 3 most commonly used search engines were used to search for rotator cuff repair. The first 50 websites from each search engine were evaluated for authorship and content. The DISCERN instrument was used to analyze the quality of each website's health information. The 2011 search revealed 21% of websites were associated with an academic institution, 38% were authored by a hospital or physician group, and 11.5% were industry-sponsored. The 2014 search revealed a similar distribution of contributors. The highest DISCERN scores were given to academic institution websites (51.6) and public education websites (49). There was no correlation between readability and DISCERN scores. Websites associated with academic institutions produced the highest-quality medical information. Over the past few years, authorship and content have changed little with respect to Internet information about rotator cuff repair. PMID:26991581
Vitamin D and the immunomodulation of rotator cuff injury
Dougherty, Kaitlin A; Dilisio, Matthew F; Agrawal, Devendra K
Tendon-to-bone healing after rotator cuff repair surgery has a failure rate of 20%–94%. There has been a recent interest to determine the factors that act as determinants between successful and unsuccessful rotator cuff repair. Vitamin D level in patients is one of the factors that have been linked to bone and muscle proliferation and healing, and it may have an effect on tendon-to-bone healing. The purpose of this article is to critically review relevant published research that relates to the effect of vitamin D on rotator cuff tears and subsequent healing. A review of the literature was conducted to identify all studies that investigate the relationship between vitamin D and tendon healing, in addition to its mechanism of action. The data were then analyzed in order to summarize what is currently known about vitamin D, rotator cuff pathology, and tendon-to-bone healing. The activated metabolite of vitamin D, 1α,25-dihydroxyvitamin D3, affects osteoblast proliferation and differentiation. Likewise, vitamin D plays a significant role in the tendon-to-bone healing process by increasing the bone mineral density and strengthening the skeletal muscles. The 1α,25-dihydroxyvitamin D3 binds to vitamin D receptors on myocytes to stimulate growth and proliferation. The form of vitamin D produced by the liver, calcifediol, is a key initiator of the myocyte healing process by moving phosphate into myocytes, which improves function and metabolism. Investigation into the effect of vitamin D on tendons has been sparse, but limited studies have been promising. Matrix metalloproteinases play an active role in remodeling the extracellular matrix (ECM) of tendons, particularly deleterious remodeling of the collagen fibers. Also, the levels of transforming growth factor-β3 positively influence the success of the surgery for rotator cuff repair. In the tendon-to-bone healing process, vitamin D has been shown to successfully influence bone and muscle healing, but more research is
Arthroscopic Superior Capsule Reconstruction for Irreparable Rotator Cuff Tears
Mihata, Teruhisa; Lee, Thay Q.; Itami, Yasuo; HASEGAWA, Akihiko; Ohue, Mutsumi; Neo, Masashi
Objectives: An arthroscopic superior capsule reconstruction, in which the fascia lata autograft attached medially to the superior glenoid and laterally to the greater tuberosity, restores shoulder stability and muscle balance in patients with irreparable rotator cuff tears; consequently, it improves shoulder function specifically deltoid muscle function and relieves pain. We assessed the clinical outcome of arthroscopic superior capsule reconstruction (Figure 1) in 100 consecutive patients with irreparable rotator cuff tears. Specifically, we focused on the rates of return to sport and work. Methods: From 2007 to 2014, we performed arthroscopic superior capsule reconstruction on 107 consecutive patients (mean 66.7 years; range, 43 to 82) with irreparable rotator cuff tears that had failed conservative treatment. Seven patients were lost to follow-up because of other medical problems or reasons. In the remaining 100 patients there were 56 supraspinatus and infraspinatus tears; 39 supraspinatus, infraspinatus, and subscapularis tears; 3 supraspinatus, infraspinatus, teres minor, and subscapularis tears; and 2 supraspinatus, infraspinatus, and teres minor tears. Physical examination, radiography, and MRI were performed before surgery; at 3, 6, and 12 months after surgery; and yearly thereafter. Rates of return to sport and work were also investigated in those patients who had been employed (34 patients: 21 manual workers, 10 farmers, 1 butcher, 1 cook, and 1 athletic trainer) or played sport (26 patients: 6 golf, 4 table tennis, 4 swimming, 3 martial arts, 2 baseball, 2 yoga, 1 tennis, 1 badminton, 1 skiing, 1 mountain-climbing, and 1 ground golf) before injury. Results: The average preoperative American Shoulder and Elbow Surgeons (ASES) score was 31.6 points (range, 3.3 to 63.3 points) and the average Japanese Orthopaedic Association (JOA) score was 51.6 points (26.5 to 68.5 points). Average postoperative clinical outcome scores all improved significantly at final
Complications of rotator cuff surgery—the role of post-operative imaging in patient care
Thakkar, R S; Thakkar, S C; Srikumaran, U; Fayad, L M
When pain or disability occurs after rotator cuff surgery, post-operative imaging is frequently performed. Post-operative complications and expected post-operative imaging findings in the shoulder are presented, with a focus on MRI, MR arthrography (MRA) and CT arthrography. MR and CT techniques are available to reduce image degradation secondary to surgical distortions of native anatomy and implant-related artefacts and to define complications after rotator cuff surgery. A useful approach to image the shoulder after surgery is the standard radiography, followed by MRI/MRA for patients with low “metal presence” and CT for patients who have a higher metal presence. However, for the assessment of patients who have undergone surgery for rotator cuff injuries, imaging findings should always be correlated with the clinical presentation because post-operative imaging abnormalities do not necessarily correlate with symptoms. PMID:24734935
Rotator Cuff Tear Consequent to Glenohumeral Dislocation.
Gilotra, Mohit N; Christian, Matthew W; Lovering, Richard M
The patient was a 21-year-old collegiate running back who was tackled during a football game and sustained a posterior glenohumeral dislocation. He was referred to an orthopaedist and presented 3 weeks after the injury, and, following examination, further imaging was ordered by the orthopaedist due to rotator cuff weakness. Magnetic resonance imaging showed a complete tear of the supraspinatus and infraspinatus, as well as a posterior Bankart lesion, a subscapularis tear, and a dislocation of the biceps long head tendon into the reverse Hill-Sachs lesion. J Orthop Sports Phys Ther 2016;46(8):708. doi:10.2519/jospt.2016.0413. PMID:27477475
Performance After Rotator Cuff Tear and Operative Treatment: A Case-Control Study of Major League Baseball Pitchers
Namdari, Surena; Baldwin, Keith; Ahn, Albert; Huffman, G. Russell; Sennett, Brian J.
Context: Little is known about pitching performance or lack of it among Major League Baseball (MLB) pitchers who undergo operative treatment of rotator cuff tears. Objective: To assess pitching performance outcomes in MLB players who needed operative treatment of rotator cuff tears and to compare performance in these athletes with that in a control group of MLB players. Design: Case-control study. Setting: Publicly available player profiles, press releases, and team injury reports. Patients or Other Participants: Thirty-three MLB pitchers with documented surgery to treat rotator cuff tears and 117 control pitchers who did not have documented rotator cuff tears were identified. Main Outcome Measure(s): Major League Baseball pitching attrition and performance variables. Results: Players who underwent rotator cuff surgery were no more likely not to play than control players. Performance variables of players who underwent surgery improved after surgery but never returned to baseline preoperative status. Players who needed rotator cuff surgery typically were more experienced and had better earned run averages than control players. Conclusions: Pitchers who had symptomatic rotator cuff tears that necessitated operative treatment tended to decline gradually in performance leading up to their operations and to improve gradually over the next 3 seasons. In contrast to what we expected, they did not have a greater attrition rate than their control counterparts; however, their performances did not return to preoperative levels over the course of the study. PMID:21669100
Rotator Cuff Disease and Injury--Evaluation and Management.
Williams, Randy
This presentation considers the incidence, evaluation, and management of rotator cuff disease and injury. Pathogenesis, symptoms, physical findings, treatment (therapeutic and surgical), and prevention are discussed. It is noted that rotator cuff problems, common in athletes, are usually related to an error in training or lack of training. They…
Calcific tendinitis of the rotator cuff: a review.
Kachewar, Sushil G; Kulkarni, Devidas S
Calcifying tendinitis of the rotator cuff is a common disorder; its underlying mechanism still remains unknown. Although details of the clinical presentation(s) and pathological changes which are associated with calcific tendinitis are available, conservative management of this condition remains a topic of debate. About 90% of the patients can be treated non - operatively, but as some are resistant to conservative treatment; newer techniques or surgery should be indicated. Rheumatologists and radiologists have often described this shoulder abnormality, leading to its progressive differentiation from other painful shoulder syndromes. The conservative treatment includes the use of non - steroidal anti - inflammatory agents, roentegen therapy, physical modalities for controlling the pain and for preventing loss of joint mobility, local steroid injections, and open or arthroscopic surgeries. Results of non - operative treatments have also been satisfactory. These include heat, cold, range of motion and pendulum exercises, diathermy, short - wave, and radiation therapy. Rest, immobilization with a sling, and oral non - steroidal and steroid anti - inflammatory medications have also been mentioned. This review aimed at looking at calcific tendinitis of the rotator cuff with a wide vision in the light of modern advances; while at the same time, not disregarding the past experiences. PMID:23998102
Calcific Tendinitis of the Rotator Cuff: A Review
Calcifying tendinitis of the rotator cuff is a common disorder; its underlying mechanism still remains unknown. Although details of the clinical presentation(s) and pathological changes which are associated with calcific tendinitis are available, conservative management of this condition remains a topic of debate. About 90% of the patients can be treated non – operatively, but as some are resistant to conservative treatment; newer techniques or surgery should be indicated. Rheumatologists and radiologists have often described this shoulder abnormality, leading to its progressive differentiation from other painful shoulder syndromes. The conservative treatment includes the use of non – steroidal anti – inflammatory agents, roentegen therapy, physical modalities for controlling the pain and for preventing loss of joint mobility, local steroid injections, and open or arthroscopic surgeries. Results of non – operative treatments have also been satisfactory. These include heat, cold, range of motion and pendulum exercises, diathermy, short – wave, and radiation therapy. Rest, immobilization with a sling, and oral non – steroidal and steroid anti – inflammatory medications have also been mentioned. This review aimed at looking at calcific tendinitis of the rotator cuff with a wide vision in the light of modern advances; while at the same time, not disregarding the past experiences. PMID:23998102
Biologically based strategies to augment rotator cuff tears
Schaer, M.; Schober, M.; Berger, S.; Boileau, P.; Zumstein, M. A.
Lesions of the rotator cuff (RC) are among the most frequent tendon injuries. In spite of the developments in both open and arthroscopic surgery, RC repair still very often fails. In order to reduce the failure rate after surgery, several experimental in vitro and in vivo therapy methods have been developed for biological improvement of the reinsertion. This article provides an overview of the current evidence for augmentation of RC reconstruction with growth factors. Furthermore, potential future therapeutic approaches are discussed. We performed a comprehensive search of the PubMed database using various combinations of the keywords “tendon,” “rotator cuff,” “augmentation,” “growth factor,” “platelet-rich fibrin,” and “platelet-rich plasma” for publications up to 2011. Given the linguistic capabilities of the research team, we considered publications in English, German, French, and Spanish. We excluded literature reviews, case reports, and letters to the editor. PMID:22787334
Rehabilitation following rotator cuff repair: a survey of current UK practice
Bateman, Marcus
Background Rotator cuff disorders, including rotator cuff tears, are common and can be treated conservatively or surgically. Data suggest that the incidence of surgery to repair the rotator cuff is rising. Despite this rise, the most effective approach to postoperative rehabilitation, a critical component of the recovery process, is not well developed. The present study aimed to describe current practice in the UK in relation to rehabilitation following rotator cuff repair. Methods An electronic survey was developed and disseminated to UK based physiotherapists and surgeons involved with rotator cuff repair. Results One hundred valid responses were received. Although there is a degree of variation, current practice for the majority of respondents consists of sling immobilization for 4 weeks to 6 weeks. During this time, passive movement would be commenced before active movement is introduced towards the end of this phase. Resisted exercise begins 7 weeks to 12 weeks postoperatively, alongside return to light work. A progressive resumption of function, including manual work and sport, is advised from approximately 13 weeks. Conclusions In the context of the current literature, it might be suggested that the current approach to rehabilitation following rotator cuff repair for the majority of respondents is somewhat cautious and has not progressed for over a decade.
Management of disorders of the rotator cuff: proceedings of the ISAKOS upper extremity committee consensus meeting.
Arce, Guillermo; Bak, Klaus; Bain, Gregory; Calvo, Emilio; Ejnisman, Benno; Di Giacomo, Giovanni; Gutierrez, Vicente; Guttmann, Dan; Itoi, Eiji; Ben Kibler, W; Ludvigsen, Tom; Mazzocca, Augustus; de Castro Pochini, Alberto; Savoie, Felix; Sugaya, Hiroyuki; Uribe, John; Vergara, Francisco; Willems, Jaap; Yoo, Yon Sik; McNeil, John W; Provencher, Matthew T
The goal of this article is to consolidate the International Society of Arthroscopy, Knee Surgery & Orthopaedic Sports Medicine (ISAKOS) Upper Extremity Committee's (UEC's) current knowledge on rotator cuff disease and management, as well as highlight key unresolved issues. The rotator cuff is an anatomically complex structure important for providing glenohumeral function and stability as part of a closed chain system. Current consensus suggests rotator cuff injuries are most accurately diagnosed, at levels similar to diagnosis by magnetic resonance imaging, with a combination of cuff- and impingement-specific clinical tests. Updates in the understanding of acromion morphology, the insertional anatomy of the rotator cuff, and the role of suprascapular nerve release may require changes to current classification systems and surgical strategies. Although initial management focuses on nonoperative protocols, discussion continues on whether surgery for isolated impingement is clinically more beneficial than rehabilitation. However, clear indications have yet to be established for the use of single- versus double-row repair because evidence confirms neither is clinically efficacious than the other. Biceps tenodesis, however, in non-isolated cuff tears has proven more successful in addressing the etiology of shoulder pain and yields improved outcomes over tenotomy. Data reviewing the benefits of tendon transfers, shoulder prostheses, and mechanical scaffolds, as well as new research on the potential benefit of platelet-rich plasma, pluripotential stem cells, and gene therapies, will also be presented. PMID:24041864
Management of Rotator Cuff and Impingement Injuries in the Athlete
Williams, Gerald R.; Kelley, Martin
Objective: To review current concepts of the pathophysiology, diagnosis, and treatment of rotator cuff and impingement injuries in the athlete. Data Sources: The information we present was compiled from a review of classic and recently published material regarding rotator cuff and impingement injuries. These materials were identified through a search of a personal literature database compiled by the authors, as well as by selective searching of the MEDLINE. In addition, much of the information presented represents observations and opinions of the authors developed over 8 to 10 years of treating shoulder injuries in athletes. Data Synthesis: Biomechanics of the normal shoulder and pathophysiology of rotator cuff injuries in the athletic population are discussed, followed by a summary of the important diagnostic features of rotator cuff and impingement injuries. The principles of rehabilitation are extensively presented, along with indications and important technical aspects of selected surgical procedures. General principles and specific protocols of postoperative rehabilitation are also summarized. Conclusions/Recommendations: Rotator cuff and impingement injuries in the athletic population are multifactorial in etiology, exhibiting significant overlap with glenohumeral instability. Nonoperative treatment is successful in most athletic patients with rotator cuff and impingement injuries. When nonoperative treatment fails, arthroscopic surgical techniques such as rotator cuff repair and subacromial decompression may be successful in returning the athlete to competition. ImagesFigure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7.Figure 8.Figure 9.Figure 10.Figure 11.Figure 12.Figure 13. PMID:16558644
Living with a symptomatic rotator cuff tear ‘bad days, bad nights’: a qualitative study
Background Rotator cuff tears are a common cause of shoulder pain. There is an absence of information about symptomatic rotator cuffs from the patients’ perspective; this limits the information clinicians can share with patients and the information that patients can access via sources such as the internet. This study describes the experiences of people with a symptomatic rotator cuff, their symptoms, the impact upon their daily lives and the coping strategies utilised by study participants. Methods An interpretive phenomenological analysis approach was used. 20 participants of the UKUFF trial (The United Kingdom Rotator Cuff Surgery Trial) agreed to participate in in-depth semi-structured interviews about their experiences about living with a symptomatic rotator cuff tear. Interviews were digitally recorded and fully transcribed. Field notes, memos and a reflexive diary were used. Data was coded in accordance with interpretive phenomenological analysis. Peer review, code-recode audits and constant comparison of data, codes and categories occurred throughout. Results The majority of patients described intense pain and severely disturbed sleep. Limited movement and reduced muscle strength were described by some participants. The predominantly adverse impact that a symptomatic rotator cuff tear had upon activities of daily living, leisure activities and occupation was described. The emotional and financial impact and impact upon caring roles were detailed. Coping strategies included attempting to carry on as normally as possible, accepting their condition, using their other arm, using analgesics, aids and adaptions. Conclusions Clinicians need to appreciate and understand the intensity and shocking nature of pain that may be experienced by participants with known rotator cuff tears and understand the detrimental impact tears can have upon all areas of patient’s lives. Clinicians also need to be aware of the potential emotional impact caused by cuff tears and to
Rotator Cuff Damage: Reexamining the Causes and Treatments.
Nash, Heyward L.
Sports medicine specialists are beginning to reexamine the causes and treatments of rotator cuff problems, questioning the role of primary impingement in a deficient or torn cuff and trying new surgical procedures as alternatives to the traditional open acromioplasty. (Author/CB)
Using your shoulder after surgery
... you it is ok. If you had rotator cuff surgery or other ligament or labral surgery, you ... Saunders; 2009:chap 20. Read More Osteoarthritis Rotator cuff problems Rotator cuff repair Shoulder arthroscopy Shoulder pain ...
Synthetic Patch Rotator Cuff Repair: A 10-year Follow-Up
Shepherd, Henry M.; Lam, Patrick H.; Murrell, George A. C.
Background The present study aimed to determine the long-term outcome as a result of the use of synthetic patches as tendon substitutes to bridge massive irreparable rotator cuff defects. Methods All patients who previously had a rotator cuff repair with a synthetic patch (2-mm Gore DUALMESH ePTFE patch; Gore, Flagstaff, AZ, USA; or a 2.87-mm Bard PTFE Felt pledgets; CR Bard, Warwick, RI, USA) were followed-up at a minimum of 8.5 years postoperatively. Assessment of shoulder pain, function, range of motion, strength and imaging was performed. Results Six patients had an interpositional repair with a synthetic patch. One patient had died. In the remaining five patients, the mean tear size at repair was 27 cm2. At 9.7 years postoperatively, all the patches remained in situ and no patient required further surgery. The repair was intact in four out of five patients. Patients had improved external rotation and abduction compared to before surgery (p < 0.02). Conclusions We describe the long-term outcomes of patients who had undergone synthetic patch rotator cuff repair for an irreparable rotator cuff tear. At 9.7 years postoperatively, patients reported less severe and more infrequent pain, as well as greater overall shoulder function, compared to before surgery. Patients also had increased passive external rotation and abduction. All the patches remain in situ and there have been no further operations on these shoulders. PMID:27582907
Current evidence for effectiveness of interventions to treat rotator cuff tears.
Huisstede, Bionka M A; Koes, Bart W; Gebremariam, Lukas; Keijsers, Ellen; Verhaar, Jan A N
In this systematic review we assessed effectiveness of non-surgical and (post)surgical interventions for symptomatic rotator cuff tears (RotCuffTear). The Cochrane Library, PubMed, Embase, Cinahl, and Pedro were searched for relevant systematic reviews and randomized controlled trials (RCTs). Two reviewers independently selected relevant studies, extracted data and assessed the methodological quality. Three Cochrane reviews (7 RCTs) and 14 RCTs were included (3 non-surgery, 10 surgery, 8 post-surgery). For small or medium RotCufftears, moderate evidence was found in favour of surgery versus physiotherapy in mid- and long-term. In surgery, tendon-to-bone fixation with one metal suture anchor loaded with double sutures (TB) was more effective (moderate evidence) than a side-to-side repair with permanent sutures (SS) in the mid- and long-term; limited evidence for effectiveness was found in favour of debridement versus anchor replacement and suture repair of the type II SLAP tear in the long-term. Further, no evidence was found in favour of any non-surgical, surgical or post-surgical intervention. In conclusion, although surgery seems to give better results compared to non-surgery and TB is more effective than SS in rotator cuff repair (RCR), it remains hard to draw firm evidence-based conclusions for effectiveness of non-surgical or (post)surgical interventions to treat RotCuffTears. More research is clearly needed. PMID:21146445
Tests for diagnosing subacromial impingement syndrome and rotator cuff disease
Clinical examination techniques need to allow the physician to determine the underlying pathology of a patient’s condition with confidence. This review examines the evidence for two common conditions: impingement and rotator cuff disease
Augmentation of Rotator Cuff Repair With Soft Tissue Scaffolds
Thangarajah, Tanujan; Pendegrass, Catherine J.; Shahbazi, Shirin; Lambert, Simon; Alexander, Susan; Blunn, Gordon W.
Background Tears of the rotator cuff are one of the most common tendon disorders. Treatment often includes surgical repair, but the rate of failure to gain or maintain healing has been reported to be as high as 94%. This has been substantially attributed to the inadequate capacity of tendon to heal once damaged, particularly to bone at the enthesis. A number of strategies have been developed to improve tendon-bone healing, tendon-tendon healing, and tendon regeneration. Scaffolds have received considerable attention for replacement, reconstruction, or reinforcement of tendon defects but may not possess situation-specific or durable mechanical and biological characteristics. Purpose To provide an overview of the biology of tendon-bone healing and the current scaffolds used to augment rotator cuff repairs. Study Design Systematic review; Level of evidence, 4. Methods A preliminary literature search of MEDLINE and Embase databases was performed using the terms rotator cuff scaffolds, rotator cuff augmentation, allografts for rotator cuff repair, xenografts for rotator cuff repair, and synthetic grafts for rotator cuff repair. Results The search identified 438 unique articles. Of these, 214 articles were irrelevant to the topic and were therefore excluded. This left a total of 224 studies that were suitable for analysis. Conclusion A number of novel biomaterials have been developed into biologically and mechanically favorable scaffolds. Few clinical trials have examined their effect on tendon-bone healing in well-designed, long-term follow-up studies with appropriate control groups. While there is still considerable work to be done before scaffolds are introduced into routine clinical practice, there does appear to be a clear indication for their use as an interpositional graft for large and massive retracted rotator cuff tears and when repairing a poor-quality degenerative tendon. PMID:26665095
Physiotherapy assessment of patients with rotator cuff pathology
Pathology of the rotator cuff and sub-acromial bursa are considered to be the main cause of shoulder pain and dysfunction. In the absence of trauma, conservative care, including physiotherapy is the primary treatment. This paper aims to present the key features of a physiotherapy assessment, excluding diagnostic tests for rotator cuff pathology. It describes and explores how assessment can be used to direct management options and develop a treatment plan.
Improved apparatus for predictive diagnosis of rotator cuff disease
Pillai, Anup; Hall, Brittany N.; Thigpen, Charles A.; Kwartowitz, David M.
Rotator cuff disease impacts over 50% of the population over 60, with reports of incidence being as high as 90% within this population, causing pain and possible loss of function. The rotator cuff is composed of muscles and tendons that work in tandem to support the shoulder. Heavy use of these muscles can lead to rotator cuff tear, with the most common causes is age-related degeneration or sport injuries, both being a function of overuse. Tears ranges in severity from partial thickness tear to total rupture. Diagnostic techniques are based on physical assessment, detailed patient history, and medical imaging; primarily X-ray, MRI and ultrasonography are the chosen modalities for assessment. The final treatment technique and imaging modality; however, is chosen by the clinician is at their discretion. Ultrasound has been shown to have good accuracy for identification and measurement of full-thickness and partial-thickness rotator cuff tears. In this study, we report on the progress and improvement of our method of transduction and analysis of in situ measurement of rotator cuff biomechanics. We have improved the ability of the clinician to apply a uniform force to the underlying musculotendentious tissues while simultaneously obtaining the ultrasound image. This measurement protocol combined with region of interest (ROI) based image processing will help in developing a predictive diagnostic model for treatment of rotator cuff disease and help the clinicians choose the best treatment technique.
EXERCISE REHABILITATION IN THE NON-OPERATIVE MANAGEMENT OF ROTATOR CUFF TEARS: A REVIEW OF THE LITERATURE
Edwards, Peter; Ebert, Jay; Joss, Brendan; Bhabra, Gev; Ackland, Tim; Wang, Allan
The incidence of rotator cuff tears increases with age, with full-thickness rotator cuff tears present in approximately 25% of individuals in their sixties, and more than 50% of those in their eighties. While surgery is considered an effective treatment, recurrent tears at the insertion site are common, especially with degenerative tears, which are frequent in the older population. More recently, there has been increasing interest in exercise rehabilitation and physical therapy as a means to manage partial and full thickness tears of the rotator cuff by addressing weakness and functional deficits. Recent studies have suggested that patients opting for physical therapy have demonstrated high satisfaction, an improvement in function, and success in avoiding surgery. When considering the increasing rate of shoulder surgery and the associated economic and social burden rotator cuff surgery places on both the patient and the health care system, non-surgical management such as physical therapy and exercise may, in selected cases, be a treatment alternative to surgical repair. The purpose of this clinical commentary is to provide an overview of rotator cuff pathology and pathogenesis, and to present an evidence-based case for the role of conservative rehabilitation in the management of rotator cuff injuries. Level of Evidence Level 5 PMID:27104061
Rotator Cuff Tears in the Elderly Patients
Geary, Michael B.
Rotator cuff tears (RCT) are a common clinical problem in the geriatric population, and debate exists over how to best provide pain relief and restore shoulder function. Treatment options can be broadly divided into nonsurgical and surgical, with the majority of patients initially placed on a trial of conservative therapy. For those with irreparable RCT, low functional demand, or interest in nonoperative management, there are a number of nonsurgical treatments to consider, including rehabilitation and injections of corticosteroids, hyaluronate, and platelet-rich plasma. Surgical treatment is increasingly common, as geriatric patients remain active with high functional demands. Studies in elderly populations have demonstrated satisfactory healing and clinical results following surgical repair. Predictors of poor outcome after repair are large tear size as well as higher stages of fatty infiltration. Decompression is a less invasive surgical option that has been shown to provide short-term pain relief, though the lasting effects may deteriorate over time. A number of factors must be weighed when considering which patients are likely to benefit from surgical intervention. PMID:26328240
Tendon transfer for irreparable rotator cuff tears: indications and surgical rationale
Merolla, Giovanni; Chillemi, Claudio; Franceschini, Vincenzo; Cerciello, Simone; Ippolito, Giorgio; Paladini, Paolo; Porcellini, Giuseppe
Summary Background: treatment of symptomatic irreparable rotator cuff tears is extremely challenging because, at present, there are no ideal solutions to this problem. Many patients respond favorably to nonsurgical treatment. However, when conservative measures fail to improve the patient’s pain and disability, surgery should be considered. Methods: different surgical techniques are available and the choice of the most appropriate procedure depends on the presenting symptoms, age of the patient, functional demand, medical comorbidities, joint stability and presence of arthritic changes. The transposition of the surrounding muscles to replace the rotator cuff function represents a viable option in the treatment of younger patients without glenohumeral osteoarthritis and with severe functional limitation. Purpose: aim of this study is to give an overview of the currently available evidence regarding tendon transfer procedures for irreparable rotator cuff tears. PMID:25767779
Arthroscopic treatment options for irreparable rotator cuff tears of the shoulder
Anley, Cameron M; Chan, Samuel KL; Snow, Martyn
The management of patients with irreparable rotator cuff tears remains a challenge for orthopaedic surgeons with the final treatment option in many algorithms being either a reverse shoulder arthroplasty or a tendon transfer. The long term results of these procedures are however still widely debated, especially in younger patients. A variety of arthroscopic treatment options have been proposed for patients with an irreparable rotator cuff tear without the presence of arthritis of the glenohumeral joint. These include a simple debridement with or without a biceps tenotomy, partial rotator cuff repair with or without an interval slide, tuberplasty, graft interposition of the rotator cuff, suprascapular nerve ablation, superior capsule reconstruction and insertion of a biodegradable spacer (Inspace) to depress the humeral head. These options should be considered as part of the treatment algorithm in patients with an irreparable rotator cuff and could be used as either as an interim procedure, delaying the need for more invasive surgery in the physiologically young and active, or as potential definitive procedures in the medically unfit. The aim of this review is to highlight and summarise arthroscopic procedures and the results thereof currently utilised in the management of these challenging patients. PMID:25405083
Pre-Existing Rotator Cuff Tears as a Predictor of Outcomes in National Football League Athletes
Gibbs, Daniel; Lynch, Thomas Sean; Gomberawalla, M. Mustafa; Schroeder, Greg; LaBelle, Mark; Hollett, Brian P.; Saltzman, Matthew; Nuber, Gordon W.
. 5.7, p=0.04) and significantly fewer games (47.1 vs. 68.4, p=0.04) than matched control athletes without rotator cuff tears (Table 1B). Additionally, these athletes started significantly fewer games (23.7 vs. 43.0, p=0.02) and had significantly worse performance scores (0.97 vs. 1.33, p=0.01) when compared to controls. When comparing those who had surgical intervention on their rotator cuff tears with those treated non-operatively, there were no statistically significant differences identified in outcome measures, including round drafted (3.7 vs. 4.8, p=0.17) and performance score (0.18 vs. 1.36, p=0.16) (Table 1C). Conclusion: NFL athletes with pre-existing rotator cuff tears were less likely to be drafted. Those drafted had decreased career longevity as well as diminished career performance when compared to matched control players. Additionally, athletes who had previous surgical intervention on a torn rotator cuff trended toward a worse draft status and career performance score, but these results were not statistically significant. Players with rotator cuff tears, regardless of whether or not they had surgery, demonstrated significantly shortened careers and decreased performance scores compared to players without rotator cuff tears. These results will help both players and physicians at the NFL Combine manage expectations of draft potential, career longevity and success.
Arthroscopic Transosseous Rotator Cuff Repair: Technical Note, Outcomes, and Complications
Black, Eric M.; Lin, Albert; Srikumaran, Uma; Jain, Nitin; Freehill, Michael T.
The goal of this study was to review the authors’ initial experience with arthroscopic transosseous rotator cuff repair. Thirty-one patients with full-thickness rotator cuff tears underwent arthroscopic transosseous rotator cuff repair over a 15-month period. Preoperatively, demographics and subjective scores were recorded. Postoperatively, pain levels, subjective shoulder values, satisfaction scores, American Shoulder and Elbow Surgeons (ASES) scores, complications, and reoperations were noted with a minimum 2-year follow-up. The relationships between pre- and intraoperative variables and outcome scores were determined with univariate analysis. Average patient age was 56 years, and 23 patients (74%) were men. Twenty patients (65%) underwent primary rotator cuff repair, and 11 patients (35%) underwent revision repair. Average time to follow-up was 26 months. Average preoperative pain level and subjective shoulder value were 5.1 of 10 and 35%, respectively. Average postoperative scores included pain level of 0.9 of 10, subjective shoulder value of 84%, satisfaction score of 90.6 of 100, and ASES score of 86.3 of 100. There were 3 (9.7%) major and 2 (6%) minor complications. Patients undergoing revision rotator cuff repair had significantly worse outcomes (pain level, subjective shoulder value, ASES score; P<.05) compared with those undergoing primary repair, and cortical augmentation did not significantly affect outcome. Overall, outcomes after arthroscopic transosseous rotator cuff repair are good, although patients undergoing revision repair do not have the same outcomes as those undergoing primary cuff repair. The procedure is not without complications (9.7% major, 6% minor complications). Cortical augmentation may be used to supplement fixation, although it does not necessarily affect outcomes. Patients without such augmentation may be at increased risk for suture cutout through the bone. PMID:25970360
Biceps Lesion Associated With Rotator Cuff Tears
Jeong, Ho Yeon; Kim, Jung Youn; Cho, Nam Su; Rhee, Yong Girl
Background: Various tenodesis methods are being used for long head of the biceps tendon lesions. However, there is no consensus on the most appropriate surgical method. Hypothesis: There are significant differences in incidence of cosmetic deformity and persistent bicipital pain between open subpectoral and arthroscopic intracuff tenodesis groups. Study Design: Cohort study; Level of evidence, 3. Methods: This study included 72 patients who underwent biceps tenodesis and rotator cuff repair between January 2009 and May 2014 and who were followed for at least 1 year. Open subpectoral tenodesis was performed in 39 patients (group A), and arthroscopic intracuff tenodesis was performed in 33 patients (group B). Results: In group A, the mean visual analog scale (VAS) score for pain during motion and mean University of California, Los Angeles (UCLA) and Constant scores significantly improved from 4.6, 18.6, and 64.5 preoperatively to 1.9, 30.5, and 86.5 at last follow-up, respectively (P < .001 for all). In group B, these scores significantly improved from 5.1, 17.6, and 62.9 preoperatively to 1.8, 31.5, and 85.9 at last follow-up, respectively (P < .001 for all). Popeye deformity was noted in 2 (5.2%) patients from group A and 5 (15.6%) patients from group B (P = .231). Additionally, persistent bicipital tenderness was noted in 1 (2.6%) patient from group A and 8 (24.2%) patients from group B (P = .012). Conclusion: Both open subpectoral tenodesis and arthroscopic intracuff tenodesis show good clinical outcomes for long head of the biceps tendon lesions. However, open subpectoral tenodesis may be more appropriate, considering the low incidence of Popeye deformity and tenderness. PMID:27231699
Calcific tendinitis of the rotator cuff.
ElShewy, Mohamed Taha
Calcific tendinitis within the rotator cuff tendon is a common shoulder disorder that should be differentiated from dystrophic calcification as the pathogenesis and natural history of both is totally different. Calcific tendinitis usually occurs in the fifth and sixth decades of life among sedentary workers. It is classified into formative and resorptive phases. The chronic formative phase results from transient hypoxia that is commonly associated with repeated microtrauma causing calcium deposition into the matrix vesicles within the chondrocytes forming bone foci that later coalesce. This phase may extend from 1 to 6 years, and is usually asymptomatic. The resorptive phase extends from 3 wk up to 6 mo with vascularization at the periphery of the calcium deposits causing macrophage and mononuclear giant cell infiltration, together with fibroblast formation leading to an aggressive inflammatory reaction with inflammatory cell accumulation, excessive edema and rise of the intra-tendineous pressure. This results in a severely painful shoulder. Radiological investigations confirm the diagnosis and suggest the phase of the condition and are used to follow its progression. Although routine conventional X-ray allows detection of the deposits, magnetic resonance imaging studies allow better evaluation of any coexisting pathology. Various methods of treatment have been suggested. The appropriate method should be individualized for each patient. Conservative treatment includes pain killers and physiotherapy, or "minimally invasive" techniques as needling or puncture and aspiration. It is almost always successful since the natural history of the condition ends with resorption of the deposits and complete relief of pain. Due to the intolerable pain of the acute and severely painful resorptive stage, the patient often demands any sort of operative intervention. In such case arthroscopic removal is the best option as complete removal of the deposits is unnecessary. PMID
Calcific tendinitis of the rotator cuff
Calcific tendinitis within the rotator cuff tendon is a common shoulder disorder that should be differentiated from dystrophic calcification as the pathogenesis and natural history of both is totally different. Calcific tendinitis usually occurs in the fifth and sixth decades of life among sedentary workers. It is classified into formative and resorptive phases. The chronic formative phase results from transient hypoxia that is commonly associated with repeated microtrauma causing calcium deposition into the matrix vesicles within the chondrocytes forming bone foci that later coalesce. This phase may extend from 1 to 6 years, and is usually asymptomatic. The resorptive phase extends from 3 wk up to 6 mo with vascularization at the periphery of the calcium deposits causing macrophage and mononuclear giant cell infiltration, together with fibroblast formation leading to an aggressive inflammatory reaction with inflammatory cell accumulation, excessive edema and rise of the intra-tendineous pressure. This results in a severely painful shoulder. Radiological investigations confirm the diagnosis and suggest the phase of the condition and are used to follow its progression. Although routine conventional X-ray allows detection of the deposits, magnetic resonance imaging studies allow better evaluation of any coexisting pathology. Various methods of treatment have been suggested. The appropriate method should be individualized for each patient. Conservative treatment includes pain killers and physiotherapy, or “minimally invasive” techniques as needling or puncture and aspiration. It is almost always successful since the natural history of the condition ends with resorption of the deposits and complete relief of pain. Due to the intolerable pain of the acute and severely painful resorptive stage, the patient often demands any sort of operative intervention. In such case arthroscopic removal is the best option as complete removal of the deposits is unnecessary. PMID
Arthroscopic technique for patch augmentation of rotator cuff repairs.
Labbé, Marc R
The patient is placed in the lateral position, and an arthroscopic cuff repair is performed according to standard techniques. The line of repair is usually in the shape of a "T" or an "L." The repair is viewed through the lateral portal, with fluid inflow through the scope. Mattress sutures are placed in the anterior and posterior portions of the cuff, with respect to the line of repair, just medial to the most medial point of the tear. The sutures are placed in accordance with margin convergence suture passing methods. Next, 2 double-stranded suture anchors are placed into the lateral aspect of the greater tuberosity, which can be used to secure the anterior and posterior portions of the rotator cuff as well as the patch. The cuff sutures are tied first; then, the patch is addressed. The graft is sized by placement of a ruled probe or similar device into the subacromial space. The length of each side of the "rectangle" is measured to obtain the dimensions of the patch. The patch is then cut to fit the measurements. If the patch material is elastic, a slightly smaller than measured graft is cut to provide tension on the repair. The arthroscope is then moved to the posterior portal, and a large (8 mm) cannula, with a dam, is placed into the lateral portal. All sutures are brought out of the lateral cannula, and corresponding ends of each suture are held together in a clamp. The sutures are placed in their respective orientations once outside the cannula (e.g., anterior-medial, anterior-lateral), covering all 4 quadrants. Care is taken to ensure that the sutures have no twists and are not wrapped around one another. The sutures are passed through the graft, in mattress fashion, with a free needle, in their respective corners and clamped again. The graft is then grasped with a small locking grasper on its medial edge and is passed through the cannula into the subacromial space. The clamps holding the sutures are then gently pulled to remove the slack. A smaller (5 mm
A Survey of Expert Opinion Regarding Rotator Cuff Repair.
Acevedo, Daniel C; Paxton, E Scott; Williams, Gerald R; Abboud, Joseph A
Many patients with rotator cuff tears have questions for their surgeons regarding the surgical procedure, perioperative management, restrictions, therapy, and ability to work after a rotator cuff repair. The purpose of our study was to determine common clinical practices among experts regarding rotator cuff repair and to assist them in counseling patients. We surveyed 372 members of the American Shoulder and Elbow Surgeons (ASES) and the Association of Clinical Elbow and Shoulder Surgeons (ACESS); 111 members (29.8%) completed all or part of the survey, and 92.8% of the respondents answered every question. A consensus response (>50% agreement) was achieved on 49% (24 of 49) of the questions. Variability in responses likely reflects the fact that clinical practices have evolved over time based on clinical experience. PMID:25031385
Complications Following Arthroscopic Rotator Cuff Tear Repair
Audigé, Laurent; Blum, Raphael; Müller, Andreas M.; Flury, Matthias; Durchholz, Holger
Background Valid comparison of outcomes after surgical procedures requires consensus on which instruments and parameters should be used, including the recording and evaluation of surgical complications. An international standard outlining the terminology and definitions of surgical complications in orthopaedics is lacking. Purpose This study systematically reviewed the literature for terms and definitions related to the occurrence of negative events or complications after arthroscopic rotator cuff repair (ARCR) with specific focus on shoulder stiffness. Study Design Systematic review; Level of evidence, 4. Methods PubMed, EMBASE, Cochrane Library, and Scopus databases were searched for reviews, clinical studies, and case reports of complications associated with ARCR. Reference lists of selected articles were also screened. The terminology of complications and their definitions were extracted from all relevant original articles by a single reviewer and verified by a second reviewer. Definitions of shoulder stiffness or equivalent terms were tabulated. Results Of 654 references published after 2007 and obtained from the search, 233 full-text papers (44 reviews, 155 studies, 31 case reports, and 3 surgical technique presentations) were reviewed. Twenty-two additional references cited for a definition were checked. One report defined the term surgical complication. There were 242 different terms used to describe local events and 64 to describe nonlocal events. Furthermore, 16 definitions of terms such as frozen shoulder, shoulder stiffness, or stiff painful shoulder were identified. Diagnosis criteria for shoulder stiffness differed widely; 12 various definitions for restriction in range of motion were noted. One definition included a gradation of stiffness severity, whereas another considered the patient’s subjective assessment of motion. Conclusion The literature does not consistently report on complications after ARCR, making valid comparison of the incidence of
[Bony avulsions of the rotator cuff : Arthroscopic concepts].
Greiner, S; Scheibel, M
Bony avulsions of the rotator cuff and isolated greater or lesser tuberosity fractures are rare injuries and a clear consensus regarding classification and therapy does not yet exist. Conservative therapy is limited, especially in injuries with displaced fragments and in these cases surgical treatment is frequently indicated. The ongoing development of arthroscopic techniques has led to quite a number of reports about arthroscopically assisted or total arthroscopic techniques in the treatment of these injuries. The advantages and disadvantages of arthroscopic concepts for the treatment of bony avulsions of the rotator cuff are presented with reference to the current literature. PMID:21153534
A comparison of prospective and retrospective assessment of functional outcome after rotator cuff repair.
Tashjian, Robert Z; Bradley, Michael P; Tocci, Stephen; Henn, Ralph F; Rey, Jesus; Green, Andrew
Prospective outcome studies are generally considered to be better than retrospective studies. The purpose of this study was to assess correlations between prospective and retrospective outcome assessment after rotator cuff repair. One-hundred and twelve patients (118 shoulders) with chronic rotator cuff tears were evaluated at a mean of 54 months (34-85) after rotator cuff repair, using several outcome measures including a retrospective assessment of improvement. The retrospective assessment of post-operative pain, function, and quality of life had fair correlations with the prospectively determined improvement (R = .23-.25, P < .01). Post-operative patient satisfaction was more highly correlated with all retrospective evaluations than with the prospective improvement in all functional outcome measures. Retrospective and prospective evaluations of the outcome of rotator cuff repair are different. Patient satisfaction has a greater correlation with retrospective outcomes. Retrospective evaluation may aid in supplementing prospective evaluations, as it may better reflect a patient's perception of the success after surgery. PMID:18693118
Rat rotator cuff tendon-to-bone healing properties are adversely affected by hypercholesterolemia
Beason, David P.; Tucker, Jennica J.; Lee, Chang Soo; Edelstein, Lena; Abboud, Joseph A.; Soslowsky, Louis J.
Background Rotator cuff tendon tears represent a major component of reported orthopaedic injuries. In addition, more than one quarter of U.S. adults either currently have high cholesterol levels or have reduced their previously high cholesterol levels through the use of pharmaceuticals. Our clinical data have already linked hypercholesterolemia to full-thickness rotator cuff tears, and experimental data from our laboratory have shown effects on native tendon properties in multiple species. The objective of this study was to evaluate healing of supraspinatus tendons in our rat rotator cuff injury model. We hypothesized that tendon healing would be inferior in rats receiving a high-cholesterol diet for 6 months compared with those receiving standard chow. Methods All animals were subjected to a unilateral supraspinatus detachment and repair surgery, with contralateral limbs serving as within-animal comparative data. Animals continued their respective diet courses, and their supraspinatus tendons were biomechanically or histologically evaluated at 2, 4, and 8 weeks postoperatively. Results Biomechanical testing revealed a significant reduction in normalized stiffness in hypercholesterolemic rats compared with controls at 4 weeks after injury, whereas histologic analyses showed no significant differences in collagen organization, cellularity, or cell shape between groups. Conclusion On the basis of our findings, hypercholesterolemia may have a detrimental biomechanical effect on tendon healing in our rat rotator cuff injury and repair model. Level of evidence Basic Science Study, Animal Model. PMID:24295837
Do Outcomes Differ after Rotator Cuff Repair for Patients Receiving Workers’ Compensation?
Balyk, R.; Luciak-Corea, C.; Otto, D.; Baysal, D.
Comparisons of outcomes after rotator cuff repair between Worker’s Compensation Board (WCB) recipients and nonrecipients generally do not consider patient, injury, and shoulder characteristics. We compared preoperative differences between WCB recipients and nonrecipients and determined the impact on their 6-month postoperative outcome. We evaluated a prospective cohort of 141 patients with full-thickness rotator cuff tears, 36 of whom (26%) were WCB recipients, preoperatively and 3 and 6 months after rotator cuff repair. Their mean age was 54.0 ± 10.4 years (standard deviation) and 102 (72%) patients were male. Shoulder range of motion, Western Ontario Rotator Cuff (WORC) index, and American Shoulder and Elbow Surgeons’ score were used to evaluate outcomes. We performed regression analyses to control for baseline differences in age, baseline scores, smoking status, symptom duration, injury type, and associated biceps disorder between WCB recipients and nonrecipients. WCB recipients were younger and more likely to smoke, have a traumatic injury, and undergo surgery within 6 months of injury. WCB recipients had lower recovery for all outcomes when these differences were not considered but when differences were accounted for, only 6-month WORC scores were lower in WCB recipients. Clinicians should consider preoperative characteristics before concluding WCB recipients experience less recovery after surgical repair. Level of Evidence: Level I, prognostic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18784971
Early rehabilitation affects functional outcomes and activities of daily living after arthroscopic rotator cuff repair: a case report
Shimo, Satoshi; Sakamoto, Yuta; Tokiyoshi, Akinari; Yamamoto, Yasuhiro
[Purpose] The effect of early rehabilitation protocols after arthroscopic rotator cuff repair is currently unknown. We examined short-term effects of early rehabilitation on functional outcomes and activities of daily living after arthroscopic rotator cuff repair. [Subject and Methods] An 82-year-old male fell during a walk, resulting in a supraspinatus tear. Arthroscopic rotator cuff repair was performed using a single-row technique. He wore an abduction brace for 6 weeks after surgery. [Results] From day 1 after surgery, passive range of motion exercises, including forward flexion and internal and external rotation were performed twice per day. Starting at 6 weeks after surgery, active range of motion exercises and muscle strengthening exercises were introduced gradually. At 6 weeks after surgery, his active forward flexion was 150°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 36 points. At 20 weeks after surgery, his active forward flexion was 120°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 0 points. [Conclusion] These protocols are recommended to physical therapists during rehabilitation for arthroscopic rotator cuff repair to support rapid reintegration into activities of daily living. PMID:27064886
Early rehabilitation affects functional outcomes and activities of daily living after arthroscopic rotator cuff repair: a case report.
COMPREHENSIVE STRENGTH TRAINING PROGRAM FOR A RECREATIONAL SENIOR GOLFER 11-MONTHS AFTER A ROTATOR CUFF REPAIR
Meira, Erik P.; En Gilpin, Hui; Brunette, Meredith
Background and Purpose: Golf is a popular sport played by hundreds of thousands of individuals of all ages and of varying skill levels. An orthopedic or sports-related injury and/or surgery may limit an individual's sport participation, require him/her to complete a course of rehabilitation, and initiate (or resume) a sport-specific training program. Unlike the availability of evidence to guide postsurgical rehabilitation and sport-specific training of athletes from sports other than golf, there have only been two reports describing outcomes after surgery and for golfers. The purpose of this case report is to present a post-rehabilitation return to sport-training program for a recreational golfer 11-months after a rotator cuff repair. Case Description: The subject, a 67-year old female, injured her right shoulder requiring a rotator cuff repair 11-months prior to her participation in a golf fitness training program. The subject participated in six training sessions over seven week period consisting of general strengthening exercises (including exercises for the rotator cuff), exercises for the core, plyometrics, and power exercises. Outcomes: The subject made improvements in power and muscular endurance of the core. She was able to resume golf at the completion of the training program. Discussion: The subject was able to make functional improvements and return to golf after participation in a comprehensive strength program. Additional studies are necessary to improve program design for golfers who wish to return to sport after shoulder surgery. PMID:22163096
RESULTS OF SURGICAL TREATMENT OF DENERATIVE ARTHROPATHY OF THE ROTATOR CUFF USING HEMIARTHROPLASTY- CTA®
Filho, Rômulo Brasil; Ribeiro, Fabiano Rebouças; Tenor, Antonio Carlos; Filho, Cantidio Salvador Filardi; da Costa, Guilherme Barbieri Leme; Storti, Thiago Medeiros; da Costa Garcia, André; Lutfi, Hilton Vargas
Objective: To assess results of CTA® partial shoulder arthroplasty for treatment of degenerative arthropathy of the rotator cuff. Methods: Between December 2006 and June 2009, 23 shoulders of 23 patients were submitted to CTA® type partial shoulder arthroplasty for treatment of arthropathy secondary to rotator cuff injury. Post-operative follow up time ranged from 6 to 35 months. Mean age was 74.1 years. Patients were predominantly female, representing 78.3% of cases. The right limb was affected in 18 patients. All patients had undergone at least 6 months of physiotherapy without improvement of the algetic picture, and being submitted to surgery by the same surgical team. None of the patients had history of surgery on the affected shoulder. The method elected for assessing patients during post-operative follow up was based on UCLA scoring criteria. Results: Improvement in pain was observed in all patients after arthroplasty. Mean UCLA pain score was 9.22 (ranging from 10 to 8). Mean function was 6 (10 to 2). Active frontal flexion was 2.39 (highest score 4 and lowest 0). Mean frontal flexion force was 4.09, maximum was 5 and minimum 3. Mean score on the UCLA was 26.52. 95% were satisfied with the surgery. Conclusion: CTA® type partial shoulder arthroplasty produced satisfactory results in the treatment of degenerative arthropathy of the rotator cuff and had a low rate of complications. PMID:27028431
EVALUATION OF THE RESULTS FROM REOPERATIONS ON PATIENTS WITH ROTATOR CUFF LESIONS
Miyazaki, Alberto Naoki; Fregoneze, Marcelo; Santos, Pedro Doneux; da Silva, Luciana Andrade; do Val Sella, Guilherme; Santos, Ruy Mesquita Maranhão; de Souza, Adriano; Estelles, José Renato Depari; Checchia, Sérgio Luiz
Objectives: To assess the results from open or arthroscopic surgical treatment on patients with symptomatic recurrence of rotator cuff injuries. Methods: Between December 1990 and July 2007, 30 patients were assessed and underwent reoperation performed by the Shoulder and Elbow Surgery Group of the Department of Orthopedics and Traumatology, Fernandinho Simonsen Wing, Santa Casa de São Paulo, because of dehiscence of the rotator cuff suture. The study included patients with symptomatic recurrence of the injury and with at least 24 months of postoperative follow-up. Results: According to the UCLA evaluation criteria, 21 patients (70%) showed excellent or good outcomes; and nine patients (30%) showed fair or poor outcomes. Conclusion: Open or arthroscopic surgical treatment of recurrent rotator cuff injuries tended to present worse results than from the primary repair. In this study, we found that 70% of the results were excellent and good. The presence of extensive injuries in the reoperation tended to evolve with larger numbers of unsatisfactory results. In our study, we obtained better results from arthroscopic surgery than from open surgery. PMID:27026985
Effectiveness of Subacromial Anti-Adhesive Agent Injection after Arthroscopic Rotator Cuff Repair: Prospective Randomized Comparison Study
Oh, Chung Hee; Oh, Joo Han; Kim, Sae Hoon; Cho, Jae Hwan; Yoon, Jong Pil
Background Arthroscopic rotator cuff repair generally has a good clinical outcome but shoulder stiffness after surgery due to subacromial adhesion is one of the most common and clinically important complications. Sodium hyaluronate (HA) has been reported to be an anti-adhesive agent in a range of surgical procedures. However, there are few reports of the outcomes of arthroscopic rotator cuff repair of the shoulder. This study examined whether a subacromial injection of HA/carboxymethylated cellulose (CMC) affected the postoperative shoulder stiffness and healing of rotator cuff repair, as well as the safety of an injection. Methods Between January 2008 and May 2008, 80 consecutive patients with arthroscopic rotator cuff repair were enrolled. The patients were assigned randomly to the HA/CMC injection group (n = 40) or control group (n = 40). All patients were evaluated using the visual analog scale (VAS) for pain, passive range of motion at 2, 6 weeks, 3, 6, 12 months after surgery, and the functional scores at 6, 12 months postoperatively. Cuff healing was also evaluated using CT arthrography or ultrasonography at 6 or 12 months after surgery. Results The HA/CMC injection group showed faster recovery of forward flexion at 2 weeks postoperatively than the control group but the difference was not statistically significant (p = 0.09). There were no significant difference in pain VAS, internal rotation, external rotation and functional scores between two groups at each follow-up period. The functional scores improved 6 months after surgery in both groups but there were no differences between the two groups. The incidence of unhealed rotator cuff was similar in the two groups. There were no complications related to an injection of anti-adhesive agents including wound problems or infections. Conclusions A subacromial injection of an anti-adhesive agent after arthroscopic rotator cuff repair tended to produce faster recovery in forward flexion with no adverse effects on
Midterm clinical outcomes following arthroscopic transosseous rotator cuff repair
Flanagin, Brody A.; Garofalo, Raffaele; Lo, Eddie Y.; Feher, LeeAnne; Castagna, Alessandro; Qin, Huanying; Krishnan, Sumant G.
Purpose: Arthroscopic transosseous (TO) rotator cuff repair has recently emerged as a new option for surgical treatment of symptomatic rotator cuff tears. Limited data is available regarding outcomes using this technique. This study evaluated midterm clinical outcomes following a novel arthroscopic TO (anchorless) rotator cuff repair technique. Materials and Methods: A consecutive series of 107 patients and 109 shoulders underwent arthroscopic TO (anchorless) rotator cuff repair for a symptomatic full-thickness tear. Pre and postoperative range of motion (ROM) was compared at an average of 11.8 months. Postoperative outcome scores were obtained at an average of 38.0 months. Statistical analysis was performed to compare pre and postoperative ROM data. Univariate analysis was performed using Student's t-test to compare the effect of other clinical characteristics on final outcome. Results: Statistically significant improvements were noted in forward flexion, external rotation and internal rotation (P < 0.0001). Average postoperative subjective shoulder value was 93.7, simple shoulder test 11.6, and American Shoulder and Elbow Surgeons (ASES) score 94.6. According to ASES scores, results for the 109 shoulders available for final follow-up were excellent in 95 (87.1%), good in 8 (7.3%), fair in 3 (2.8%), and poor in 3 (2.8%). There was no difference in ROM or outcome scores in patients who underwent a concomitant biceps procedure (tenodesis or tenotomy) compared with those who did not. Furthermore, there was no significant difference in outcome between patients who underwent either biceps tenodesis or tenotomy. Age, history of injury preceding the onset of pain, tear size, number of TO tunnels required to perform the repair, and presence of fatty infiltration did not correlate with postoperative ROM or subjective outcome measures at final follow-up. Two complications and four failures were noted. Conclusions: Arthroscopic TO rotator cuff repair technique leads to
EXTENSIVE ROTATOR CUFF INJURIES: AN EVALUATION OF ARTHROSCOPIC REPAIR OUTCOMES
Miyazaki, Alberto Naoki; Fregoneze, Marcelo; Santos, Pedro Doneux; Silva, Luciana Andrade; Eduardo, Cesar Moreira Mariz Pinto Rodrigo Tormin Ortiz; Checchia, Sergio Luiz
To assess the outcomes of the surgical treatment of extensive rotator cuff injuries through arthroscopy. Methods: Between June 1998 and October 2006, 61 patients with extensive rotator cuff injuries and submitted to surgical arthroscopy technique by the Shoulder and Elbow Group of the Department of Orthopaedics and Traumatology, Santa Casa de Misericórdia Medical School were reassessed. The study included all patients with at least two tendons affected or with retraction at least on two tendons up to the glenoidal cavity edge and with at least 12 months of follow-up. Results: According to UCLA's evaluation criteria, 54 (89%) patients showed excellent or good outcomes; no fair outcome in none of the patients; and seven (11%) poor outcomes. A satisfaction rate of 92% was reported. Postoperative joint motion went from a mean lifting value of 93° to 141°, the mean lateral rotation went from 32° to 48° and the mean medial rotation went from L1 to T10. These differences were regarded as statistically significant. Conclusion: The arthroscopic repair of extensive rotator cuff injuries leads to satisfactory outcomes for most of the patients, with a high satisfaction degree. PMID:26998466
Tendon graft substitutes-rotator cuff patches.
Coons, David A; Alan Barber, F
Over the past few years, many biologic patches have been developed to augment repairs of large or complex tendon tears. These patches include both allograft and xenografts. Regardless of their origins, these products are primarily composed of purified type I collagen. Many factors should be considered when choosing an augmentation patch including tissue origin, graft processing, cross-linking, clinical experience, and physical properties. The purpose of this article is to familiarize the sports medicine community with several tendon augmentation grafts: GraftJacket (Wright Medical Technology, Arlington, TN), CuffPatch (Organogenesis, Canton, MA, licensed to Arthrotek, Warsaw, IN), Restore (Depuy, Warsaw, IN), Zimmer Collagen Repair (Permacol) patch (Tissue Science Laboratories Covington, GA, licensed to Zimmer, Warsaw, IN), TissueMend (TEI Biosciences, Boston, MA, licensed to Stryker Howmedica Osteonics, Kalamazoo, MI), OrthoADAPT (Pegasus Biologics, Irvine, CA), and BioBlanket (Kensey Nash, Exton, PA). PMID:17135966
Arthroscopic Rotator Cuff Repair Using the Undersurface Technique
Rubenis, Imants; Lam, Patrick H.; Murrell, George A.C.
Background: Arthroscopic rotator cuff repair has traditionally been performed in the subacromial space from the bursal side of the tendon. The undersurface rotator cuff repair technique involves the arthroscope remaining in the glenohumeral joint, thus viewing the tendon from its undersurface during repair without a bursectomy or acromioplasty. Purpose: To compare the clinical and structural outcomes of undersurface rotator cuff repair with bursal-side repair. Study Design: Cohort study; Level of evidence, 3. Methods: A retrospective analysis of prospectively collected data was conducted on 2 cohorts of patients who had undergone arthroscopic rotator cuff repair with knotless suture anchors configured in a single-row formation using inverted mattress–style sutures from either the bursal side (n = 100) or undersurface (n = 165) of the supraspinatus tendon. Data were collected preoperatively, intraoperatively, and at 1 week, 6 weeks, 3 months, 6 months, and 2 years postoperatively. At each time point, patients completed a modified L’Insalata questionnaire to assess patient-ranked pain scores and were clinically examined using standardized tests. Ultrasound examination was performed at 6 months and 2 years to assess the integrity of the repair. Results: At 2 years postoperatively, patients in both cohorts had significantly less pain and less difficulty with overhead activities compared with preoperative levels (P < .001). The type of repair performed (bursal or undersurface) did not affect the ability to perform overhead activities at 2 years. At 2 years, both groups also had similar retear rates (21% for bursal side, 23% for undersurface). The mean operative time for the arthroscopic rotator cuff repair was 32 minutes when performed from the bursal side and 20 minutes when performed from the undersurface (P < .001). Conclusion: Arthroscopic rotator cuff repair, whether performed from the subacromial space or glenohumeral joint, resulted in decreased levels of
COMPARISON OF COMPLEMENTARY EXAMS IN THE DIAGNOSIS OF ROTATOR CUFF INJURIES
El-Kouba, Gabriel; Andreas Huber, Thomas; Freitas, José Renato Wilke; Steglich, Valdir; Ayzemberg, Henrique; Santos, Adriano M.
The aim of this study was to evaluate the accuracy of simple radiography, ultrasound and magnetic resonance imaging (MRI) in diagnosing rotator cuff injuries, comparing their findings with open or arthroscopic surgery findings. Methods: Protocols of the Shoulder and Elbow Surgery Service for patients undergoing surgical treatment for rotator cuff injuries diagnosed by means of radiography, ultrasound and/or MRI between 2002 and 2007 were evaluated. Based on the data gathered, we analyzed the sensitivity, specificity, positive predictive value, negative predictive value and accuracy of these complementary examinations, compared with the findings during the surgical procedures. Results: This study included 147 patients with a mean age of 46.09 years. All the patients had undergone a radiography examination, 101 had undergone ultrasound examination and 72 had undergone MRI. We found sensitivity of 13.8%, specificity of 2.6% and accuracy of 30% with radiography; sensitivity of 57.6%, specificity of 29.6% and accuracy of 51.4% with ultrasound; and sensitivity of 86.6%, specificity of 22.2% and accuracy of 63.3% with MRI. Conclusion: Radiography was found to be a specific examination when the mirror sign was present. MRI and ultrasound were shown to be reliable methods with high accuracy for diagnosing rotator cuff injuries. PMID:27022589
Shoulder Impingement/Rotator Cuff Tendinitis
.org Shoulder Impingement/Rotator Cuff Tendinitis Page ( 1 ) One of the most common physical complaints is shoulder pain. Your shoulder is made up of several ... is vulnerable to many different problems. The rotator cuff is a frequent source of pain in the ...
Open Rotator Cuff Tear Repair Using Deltopectoral Approach
Guity, Mohammad Reza; Eraghi, Amir Sobhani
Background: The goal of this study was to evaluate the outcome of the open repair of rotator cuff tears via the deltopectoral approach in patients unable to afford arthroscopic repair costs. Methods: We evaluated 80 consecutive patients who were treated for full-thickness rotator cuff tears by open repair through the deltopectoral approach. There were 48 men and 32 women at a mean age of 60.1 years (range, 35-80 years). Preoperative and postoperative clinical assessments were performed with the Constant score, American Shoulder and Elbow Surgeons (ASES) score, modified University of California Los Angeles (UCLA) score, and pain visual analog scale. Results: The mean follow-up period was 30.6 months (range, 18-48 months). At final follow-up visits, the ASES, Constant score, and modified UCLA score were found to have improved significantly from 33.56, 39.24, and 13.0 to 85.64, 81.46, and 32.2, respectively (P <0.01). Pain, as measured on a visual analog scale, was improved significantly (P <0.01). The mean time for recovering the full range of motion was 2.5 months. Postoperative pain at 48 hours and at 6 weeks was relatively low. There were no cases of intractable stiffness. Conclusion: The deltopectoral approach for open rotator cuff repair produced satisfactory results and reduces rate of shoulder stiffness and postoperative pain. PMID:26622080
Biologic and pharmacologic augmentation of rotator cuff repairs.
Edwards, Sara L; Lynch, T Sean; Saltzman, Matthew D; Terry, Michael A; Nuber, Gordon W
As rotator cuff repair techniques have improved, failure of the tendon to heal to the proximal humerus is less likely to occur from weak tendon-to-bone fixation. More likely causes of failure include biologic factors such as intrinsic tendon degeneration, fatty atrophy, fatty infiltration of muscle, and lack of vascularity of the tendons. High failure rates have led to the investigation of biologic augmentation to potentially enhance the healing response. Histologic studies have shown that restoration of the rotator cuff footprint during repair can help reestablish the enthesis. In animal models, growth factors and their delivery scaffolds as well as tissue engineering have shown promise in decreasing scar tissue while maintaining biomechanical strength. Platelet-rich plasma may be a safe adjuvant to rotator cuff repair, but it has not been shown to improve healing or function. Many of these strategies need to be further defined to permit understanding of, and to optimize, the biologic environment; in addition, techniques need to be refined for clinical use. PMID:21980023
A randomised controlled feasibility study investigating the use of eccentric and concentric strengthening exercises in the treatment of rotator cuff tendinopathy
Adams, Nicola
Objectives: To conduct a feasibility study to compare concentric and eccentric rotator cuff strengthening exercises for rotator cuff tendinopathy. Methods: A total of 11 patients with rotator cuff tendinopathy who were on the waiting list for arthroscopic subacromial decompression surgery were randomised to perform eccentric rotator cuff strengthening exercises, concentric strengthening exercises or no exercises. Patients were evaluated in terms of levels of pain and function using the Oxford Shoulder Score and a Visual Analogue Scale initially, at 4 weeks and at 8 weeks. Results: The study design was found to be acceptable to patients and achieved a high level of 86% compliance. The drop-out rate was 0%. Two patients performing eccentric strengthening exercises improved sufficiently to cancel their planned surgery. Conclusion: Further research in this area is recommended. The study design was feasible and power calculations have been conducted to aid future research planning. PMID:26770702
Predictors of Outcomes after Arthroscopic Double-row Rotator Cuff Repair in 155 Cases
Katthagen, Jan Christoph; Millett, Peter J.; Espinoza-Ervin, Christopher; Horan, Marilee P.; Ho, Charles P.; Warth, Ryan J.; Dornan, Grant
Objectives: The purpose of this study was to analyze predictors of clinical outcomes of knotted versus knotless double-row self-reinforcing rotator cuff repairs of full-thickness rotator cuff tears with propensity score matching. Methods: Patients with arthroscopic repair of full-thickness rotator cuff tears involving the supraspinatus tendon using either a knotted or knotless linked, self-reinforcing double-row technique were included in the study. Preoperative subjective evaluation was performed using the ASES and SF-12 PCS scores. After a minimum two-year follow-up period, ASES and SF-12 PCS scores were collected again along with the SANE score, the QuickDASH score, and patient satisfaction. All data were collected prospectively and retrospectively reviewed. Postoperative ASES and SF-12 PCS scores were then modeled using inverse propensity score weighting in a multiple linear regression model (MLR) with multiple imputations. Age, sex, baseline ASES score, length of follow-up, number of anchors, worker’s compensation, previous cuff repair, and double-row repair technique (knotted or knotless) were the covariates used in this model. Results: 155 shoulders in 151 patients (109 men, 42 women; mean age at time of surgery 59±10 years) were eligible for inclusion. Outcomes data were available for 130 of 148 shoulders (87.8%) after exclusion of seven shoulders (4.5%) that underwent revision rotator cuff repair before final follow up (n=33/39 in the knotted group [84.6%]; n=97/109 [88.9%] in the knotless group).The mean follow-up was 2.9 years (range, 2.0-5.4 years). Overall, postoperative outcomes scores were significantly improved when compared to preoperative baselines (p<0.05), with a median postoperative ASES score of 97 for the entire cohort. Our model showed that previous rotator cuff repair had a significant negative effect on postoperative ASES (β = -12.7, p<0.001) and SF-12 PCS scores (β = -5.0, p = 0.036). A workers’ compensation claim (β = -10.6, p
The development and validation of a questionnaire for rotator cuff disorders: The Functional Shoulder Score
Ibrahim, Edward F; Petrou, Charalambos; Galanos, Antonis
Background The purpose of the present study was to validate the Functional Shoulder Score (FSS), a new patient-reported outcome score specifically designed to evaluate patients with rotator cuff disorders. Methods One hundred and nineteen patients were assessed using two shoulder scoring systems [the FSS and the Constant–Murley Score (CMS)] at 3 weeks pre- and 6 months post-arthroscopic rotator cuff surgery. The reliability, validity, responsiveness and interpretability of the FSS were evaluated. Results Reliability analysis (test–retest) showed an intraclass correlation coefficient value of 0.96 [95% confidence interval (CI) = 0.92 to 0.98]. Internal consistency analysis revealed a Cronbach's alpha coefficient of 0.93. The Pearson correlation coefficient FSS-CMS was 0.782 pre-operatively and 0.737 postoperatively (p < 0.0005). There was a statistically significant increase in FSS scores postoperatively, an effect size of 3.06 and standardized response mean of 2.80. The value for minimal detectable change was ±8.38 scale points (based on a 90% CI) and the minimal clinically important difference for improvement was 24.7 ± 5.4 points. Conclusions The FSS is a patient-reported outcome measure that can easily be incorporated into clinical practice, providing a quick, reliable, valid and practical measure for rotator cuff problems. The questionnaire is highly sensitive to clinical change.
Rotator cuff injuries: current perspectives and trends for treatment and rehabilitation☆
Vieira, Fabio Antonio; Olawa, Paul Juma; Belangero, Paulo Santoro; Arliani, Gustavo Gonçalves; Figueiredo, Eduardo Antônio; Ejnisman, Benno
Objective To map out the approaches used by Brazilian orthopedists in treating complete tears of the rotator cuff. Methods A multiple-choice questionnaire was handed out to 232 orthopedists at the 45th Brazilian Congress of Orthopedics and Traumatology. Of these, 207 were returned but five were incomplete and were excluded. Thus, 202 questionnaires were used. Results Among the orthopedists who answered the questionnaires, around 60% were from the southeastern region and 46% were shoulder and elbow surgeons. There was a significant association (p < 0.05) between length of experience and number of rotator cuff repairs performed per year. There was also a significant association (p < 0.05) between shoulder specialty and the following variables: arthroscopic technique, use of anchors in a single-row configuration, mean time taken for an indication for surgery to be made in cases of traumatic and degenerative lesions, use of a specific protocol for postsurgical rehabilitation, return to sport and indication of irreparable injuries. Conclusions Brazilian shoulder surgeons have well-established approaches toward treating rotator cuff injuries. Most of these approaches differ significantly from those of other specialties. This shows the importance of placing value on training in preparing shoulder specialists in this country. PMID:27218075
All-Arthroscopic Patch Augmentation of a Massive Rotator Cuff Tear: Surgical Technique
Chalmers, Peter N.; Frank, Rachel M.; Gupta, Anil K.; Yanke, Adam B.; Trenhaile, Scott W.; Romeo, Anthony A.; Bach, Bernard R.; Verma, Nikhil N.
Surgical management of massive rotator cuff tears remains challenging, with failure rates ranging from 20% to 90%. Multiple different arthroscopic and open techniques have been described, but there is no current gold standard. Failure after rotator cuff repair is typically multifactorial; however, failure of tendon-footprint healing is often implicated. Patch augmentation has been described as a possible technique to augment the biology of rotator cuff repair in situations of compromised tendon quality and has shown promising short-term results. The purpose of this article is to describe our preferred surgical technique for arthroscopic rotator cuff repair with patch augmentation. PMID:24400198
Effect of tamoxifen on fatty degeneration and atrophy of rotator cuff muscles in chronic rotator cuff tear: An animal model study.
Cho, Edward; Zhang, Yue; Pruznak, Anne; Kim, H Mike
Fatty degeneration of the rotator cuff muscles is an irreversible change resulting from chronic rotator cuff tear and is associated with poor clinical outcomes following rotator cuff repair. We evaluated the effect of Tamoxifen, a competitive estrogen receptor inhibitor, on fatty degeneration using a mouse model for chronic rotator cuff tear. Sixteen adult mice were divided into two diet groups (Tamoxifen vs. Regular) and subjected to surgical creation of a large rotator cuff tear and suprascapular nerve transection in their left shoulder with the right shoulder serving as a control. The rotator cuff muscles were harvested at 16 weeks and subjected to histology and RT-PCR for adipogenic and myogenic markers. Histology showed substantially decreased atrophy and endomysial inflammation in Tamoxifen group, but no significant differences in the amount of intramuscular adipocytes and lipid droplets compared to the Regular group. With RT-PCR, the operated shoulders showed significant upregulation of myogenin and PPAR-γ, and downregulation of myostatin compared to the nonsurgical shoulder. No significant differences of gene expression were found between the two diet groups. Our study demonstrated that tamoxifen diet leads to decreased muscle atrophy and inflammatory changes following chronic rotator cuff tear, but has no apparent effect on adipogenesis. PMID:26121952
Low-term results from non-conventional partial arthroplasty for treating rotator cuff arthroplasthy☆
Tenor Júnior, Antônio Carlos; de Lima, José Alano Benevides; de Vasconcelos, Iúri Tomaz; da Costa, Miguel Pereira; Filho, Rômulo Brasil; Ribeiro, Fabiano Rebouças
Objective To evaluate the evolution of the functional results from CTA® hemiarthroplasty for surgically treating degenerative arthroplathy of the rotator cuff, with a mean follow-up of 5.4 years. Methods Eighteen patients who underwent CTA® partial arthroplasty to treat degenerative arthroplathy of the rotator cuff between April 2007 and June 2009 were reevaluated, with minimum and mean follow-ups of 4.6 years and 5.4 years, respectively. Pre and postoperative parameters for functionality and patient satisfaction were used (functional scale of the University of California in Los Angeles, UCLA). All the patients underwent prior conservative treatment for 6 months and underwent surgical treatment because of the absence of satisfactory results. Patients were excluded if they presented any of the following: previous shoulder surgery; pseudoparalysis; insufficiency of the coracoacromial arch (type 2 B in Seebauer's classification); neurological lesions; or insufficiency of the deltoid muscle and the subscapularis muscle. Results With a mean follow-up of 5.4 years, 14 patients considered that they were satisfied with the surgery (78%); the mean range of joint motion for active elevation improved from 55.8° before the operation to 82.0° after the operation; the mean external rotation improved from 18.9° before the operation to 27.3° after the operation; and the mean medial rotation remained at the level of the third lumbar vertebra. The mean UCLA score after the mean follow-up of 5.4 years was 23.94 and this was an improvement in comparison with the preoperative mean and the mean 1 year after the operation. Conclusion The functional results from CTA® hemiarthroplasty for treating rotator cuff arthroplasty in selected patients remained satisfactory after a mean follow-up of 5.4 years. PMID:26229938
Effect of a Sleep Aid in Analgesia after Arthroscopic Rotator Cuff Repair
Cho, Chul-Hyun; Lee, Young-Kuk; Shin, Hong-Kwan; Hwang, Ilseon
Purpose The aim of this study was to evaluate the effects and safety of a sleep aid for postoperative analgesia in patients undergoing arthroscopic rotator cuff repair. Materials and Methods Seventy-eight patients were prospectively assigned to either the zolpidem group (multimodal analgesia+zolpidem; 39 patients) or the control group (multimodal analgesia; 39 patients). Self-rated pain levels were assessed twice a day using a visual analog scale (VAS). The need for additional rescue analgesic, duration of functional recovery, and adverse effects were assessed for the first 5 days after surgery. Results The mean number of times that additional rescue analgesic was required during 5 days after surgery was 2.1±2.0 in the zolpidem group and 3.3±2.8 in the control group, a significant difference. There were no significant differences between the two groups in mean VAS pain scores during the first 5 days after surgery, although the zolpidem group had lower VAS pain scores than the control group. Additionally, there were no significant differences in duration of functional recovery and adverse effects between the two groups. Conclusion The use of zolpidem for analgesia after arthroscopic rotator cuff repair provided a significant reduction in the need for rescue analgesic without increasing adverse effects. Nevertheless, mean VAS pain scores during the first 5 days after surgery did not differ between the zolpidem group and the control group. PMID:25837184
Interposition Porcine Acellular Dermal Matrix Xenograft Successful Alternative in Treatment for Massive Rotator Cuff
Neumann, Julie; Zgonis, Miltiadis H.; Reay, Kathleen Dolores; Mayer, Stephanie W.; Boggess, Blake; Toth, Alison P.
improved from 133.2° to 157.9° (P=0.003), 51.56° to 64.25° (P=0.001), and 49.8° to 74.0° (P<0.001), respectively. Manual strength (10 point scale) in supraspinatus and infraspinatus increased from 7.3 to 8.9 (P<0.001) and 7.4 to 9.4 (P<0.001), respectively. Using a dynamometer, supraspinatus quantitative strength was a mean of 68.6N and infraspinatus quantitative strength was a mean of 50.6N. Ultrasound evaluation of repairs showed 33 (89.1%) to be fully intact, three (8.1%) had partial tears, and one repair (2.7%) was not intact. The one patient whose repair was not intact by ultrasound was a revision repair. No infections, evidence of inflammatory reaction, tissue rejection, or major adverse outcomes were identified. Three patients underwent ipsilateral shoulder surgery for lysis of adhesions due to post-operative decreased ROM during the follow-up period. Conclusion: Following repair of massive rotator cuff tears with interposition porcine acellular dermal matrix xenografts, patients had significant improvement in pain, range of motion, strength and reported good subjective function based on M-ASES and SF-12 scores. The repair was completely intact in 89% of patients, a vast improvement compared with results reported for primary repairs of massive rotator cuff tears. Tissue grafts such as the porcine acellular graft used in our study hold great promise in the treatment of massive, retracted rotator cuff tears.
[Recent experience with reconstruction operations in ruptures of the rotator cuff.].
Chomiak, J
, the operation is of a high technical standard, and consquential postoperative fixation and rehabilitation after treatment are provided. Key words: injury of the rotator cuff, surgery of the rotator cuff. PMID:20470617
PROSPECTIVE AND COMPARATIVE STUDY ON FUNCTIONAL OUTCOMES AFTER OPEN AND ARTHROSCOPIC REPAIR OF ROTATOR CUFF TEARS
de Castro Veado, Marco Antônio; Castilho, Rodrigo Simões; Maia, Philipe Eduardo Carvalho; Rodrigues, Alessandro Ulhôa
Objective: To prospectively assess the surgical results from patients undergoing repairs to rotator cuff injuries via open and arthroscopic procedures, with regard to functional and clinical features, and by means of ultrasound examinations, and to compare occurrences of renewed tearing. Methods: Sixty patients underwent operations performed by the same surgeon (29 via open surgery and 31 via arthroscopy), to repair complete rotator cuff tears. The procedures were performed at Hospital Governor Israel Pinheiro (HGIP) and Mater Dei Hospital in Belo Horizonte, Minas Gerais, between August 2007 and February 2009. The patients were assessed functionally by means of the UCLA score before and after the operation, and magnetic resonance imaging was done before the operation. All the patients were reassessed at least 12 months after the operation, and an ultrasound examination was also performed at this time. Results: Out of the 29 patients who underwent open surgery, 27 (93.1%) presented good or excellent results, with a mean UCLA score of 32 after the operation. Their mean follow-up was 14 months. Three patients presented renewed tearing on ultrasound, of whom one remained asymptomatic. Out of the 31 patients who underwent arthroscopic procedures, 29 (93.5%) presented good or excellent results, with a mean UCLA score of 33 after the operation. Their mean follow-up was 19 months. Two patients presented renewed tearing, of whom one remained asymptomatic and one evolved with loosening of an anchor, with an unsatisfactory result. Conclusion: The repairs on rotator cuff injuries presented good results by means of both open surgery and arthroscopy, with similar functional results in the two groups and similar rates of renewed tearing. PMID:27027052
PDGFRα+ Progenitor Cells Contribute to Muscle Fibroadipogensis Following Massive Rotator Cuff Tears in a Mouse Model
Jensen, Andrew; Dar, Ayelet; Eliasberg, Claire; Kelley, Benjamin; Devana, Sai; McAllister, David R.; Petrigliano, Frank A.
Objectives: Rotator cuff tears affect an estimated 10% of patients over the age of 60, leading to significant activity related pain and decreased quality of life. After sustaining a tear, the rotator cuff musculature often undergoes muscle atrophy and fatty degeneration, which have been shown to result in poor clinical outcomes and high failure rates for surgical repairs. The cellular processes underlying these fibroadipogenic changes remain unknown although PDGFRβ+ cells have previously been implicated. Recently, it has been demonstrated in hind limb muscle that following acute, reversible injury via Cardiotoxin injection, PDGFRα-expressing cells are responsible for fibrotic and adipogenic muscle degeneration. Our study aimed to distinguish between the contribution of PDGFRα+ PDGFRβ+ cells and PDGFRα- PDGFRβ+ cells to fibroadipogenesis following massive rotator cuff tears. Methods: We performed supraspinatus tenotomy and denervation (TT+DN) operations on 8-10 week-old PDGFRβ-Cre x mTmG mice. These transgenic mice express GFP in cells co-expressing PDGFRβ, which allows PDGFRβ+ cell populations to be tracked via their GFP expression. At 5 days, 2-, 4- and 6-weeks postop, these mice and sham surgery controls were sacrificed and their supraspinatus muscles were harvested. We stained tissue sections with Oil Red O and Picro Sirius to compare levels of adipogenesis and fibrosis after TT+DN, respectively. In addition, sectioned muscle tissues were immuno-labeled with anti-PDGFRα and anti-PDGFRβ to assess differences in PDGFRα+ PDGFRβ+ cell localization. GFP expression was used to trace PDGFRβ cells and their progenies after TT+DN. Dissociated cells from supraspinatus tissue of TT+DN versus sham mice were either analyzed by flow cytometry for PDGFRα and GFP expression at established postop time points or sorted and cultured for in vitro differentiation experiments to assess the fibroadipogenic potential of these cell populations. Results: Oil Red O and
Association between alcohol consumption and rotator cuff tear
Passaretti, Daniele; Candela, Vittorio; Venditto, Teresa; Giannicola, Giuseppe; Gumina, Stefano
Background and purpose — Long-term alcohol intake is associated with various negative effects on capillary microcirculation and tissue perfusion. We hypothesized that alcohol consumption might be a risk factor for both the occurrence and the severity of rotator cuff tears (RCTs). Patients and methods — A case-control study was performed. We studied 249 consecutive patients (139 men and 110 women; mean age 64 (54–78) years) who underwent arthroscopic rotator cuff repair. Tear size was determined intraoperatively. The control group had 356 subjects (186 men and 170 women; mean age 66 (58–82) years) with no RCT. All participants were questioned about their alcohol intake. Participants were divided into: (1) non-drinkers if they consumed less than 0.01 g of ethanol per day, and (2) moderate drinkers and (3) excessive drinkers if women (men) consumed > 24 g (36 g) per day for at least 2 years. Results — Total alcohol consumption, wine consumption, and duration of alcohol intake were higher in both men and women with RCT than in both men and women in the control group. Excessive alcohol consumption was found to be a risk factor for the occurrence of RCT in both sexes (men: OR = 1.7, 95% CI: 1.2–3.9; women: OR = 1.9, 95% CI: 0.94–4.1). Massive tears were associated with a higher intake of alcohol (especially wine) than smaller lesions. Interpretation — Long-term alcohol intake is a significant risk factor for the occurrence and severity of rotator cuff tear in both sexes. PMID:26610042
Association between alcohol consumption and rotator cuff tear.
Background and purpose - Long-term alcohol intake is associated with various negative effects on capillary microcirculation and tissue perfusion. We hypothesized that alcohol consumption might be a risk factor for both the occurrence and the severity of rotator cuff tears (RCTs). Patients and methods - A case-control study was performed. We studied 249 consecutive patients (139 men and 110 women; mean age 64 (54-78) years) who underwent arthroscopic rotator cuff repair. Tear size was determined intraoperatively. The control group had 356 subjects (186 men and 170 women; mean age 66 (58-82) years) with no RCT. All participants were questioned about their alcohol intake. Participants were divided into: (1) non-drinkers if they consumed less than 0.01 g of ethanol per day, and (2) moderate drinkers and (3) excessive drinkers if women (men) consumed > 24 g (36 g) per day for at least 2 years. Results - Total alcohol consumption, wine consumption, and duration of alcohol intake were higher in both men and women with RCT than in both men and women in the control group. Excessive alcohol consumption was found to be a risk factor for the occurrence of RCT in both sexes (men: OR = 1.7, 95% CI: 1.2-3.9; women: OR = 1.9, 95% CI: 0.94-4.1). Massive tears were associated with a higher intake of alcohol (especially wine) than smaller lesions. Interpretation - Long-term alcohol intake is a significant risk factor for the occurrence and severity of rotator cuff tear in both sexes. PMID:26610042
Magnetic resonance appearance of bioabsorbable anchor screws for double row arthroscopic rotator cuff repairs
Pawaskar, Aditya C; Kekatpure, Aashay; Cho, Nam-Su; Rhee, Yong-Girl; Jeon, In-Ho
Background: Little is known about the bioabsorbable, anchor related postoperative changes in rotator cuff surgery, which has become more popular recently. The purpose of the present study was to use magnetic resonance imaging (MRI) to analyze the degradation of bioabsorbable anchors and to determine the incidences and characteristics of early postoperative reactions around the anchors and their mechanical failures. Materials and Methods: Postoperative MRIs of 200 patients who underwent arthroscopic rotator cuff repair were retrospectively analyzed. The tissue reactions around the bioanchors included fluid accumulations around the anchor, granulation tissue formation and changes in the condition of the surrounding osseous structure. The condition of the bioanchor itself was also examined, including whether the bioanchor failed mechanically. In the case of mechanical failure, the location of the failure was noted. Serial MRIs of 18 patients were available for analysis. Results: The total number of medial row bioanchors was 124, while that of the lateral row was 338. A low signal intensity rim suggestive of sclerosis surrounded all lateral row bioanchors. Ninety three lateral row bioanchors (27%) showed a rim with signal intensity similar to or less than that of surrounding bone, which was granulation tissue or foreign body reaction (FBR). Similar signal intensity was seen around nine medial row bioanchors (7%). Fluid accumulation was seen around 4 lateral row bioanchors (1%) and around 14 medial row bioanchors (11%). Five lateral row bioanchors showed the breakage, while there was none in the medial row bioanchors. There were nine cases with a cuff re-tear (4.5%). There was no evidence of affection of glenohumeral articular surfaces or of osteolysis around any bioanchor. In serial MRI, there was no change in appearance of the bioanchors, but the granulation tissue or FBR around four bioanchors and the fluid around one bioanchor showed a decrease in successive MRI
Predicting Rotator Cuff Tears Using Data Mining and Bayesian Likelihood Ratios
Lu, Hsueh-Yi; Huang, Chen-Yuan; Su, Chwen-Tzeng; Lin, Chen-Chiang
Objectives Rotator cuff tear is a common cause of shoulder diseases. Correct diagnosis of rotator cuff tears can save patients from further invasive, costly and painful tests. This study used predictive data mining and Bayesian theory to improve the accuracy of diagnosing rotator cuff tears by clinical examination alone. Methods In this retrospective study, 169 patients who had a preliminary diagnosis of rotator cuff tear on the basis of clinical evaluation followed by confirmatory MRI between 2007 and 2011 were identified. MRI was used as a reference standard to classify rotator cuff tears. The predictor variable was the clinical assessment results, which consisted of 16 attributes. This study employed 2 data mining methods (ANN and the decision tree) and a statistical method (logistic regression) to classify the rotator cuff diagnosis into “tear” and “no tear” groups. Likelihood ratio and Bayesian theory were applied to estimate the probability of rotator cuff tears based on the results of the prediction models. Results Our proposed data mining procedures outperformed the classic statistical method. The correction rate, sensitivity, specificity and area under the ROC curve of predicting a rotator cuff tear were statistical better in the ANN and decision tree models compared to logistic regression. Based on likelihood ratios derived from our prediction models, Fagan's nomogram could be constructed to assess the probability of a patient who has a rotator cuff tear using a pretest probability and a prediction result (tear or no tear). Conclusions Our predictive data mining models, combined with likelihood ratios and Bayesian theory, appear to be good tools to classify rotator cuff tears as well as determine the probability of the presence of the disease to enhance diagnostic decision making for rotator cuff tears. PMID:24733553
The temporal outcomes of open versus arthroscopic knotted and knotless rotator cuff repair over 5 years
Lucena, Thomas R; Lam, Patrick H; Millar, Neal L
Background The present study aimed to determine how repair technique influenced structural and clinical outcomes at 5 years post-surgery. Methods Three cohorts of patients had repair of a symptomatic rotator cuff tear using (i) an open double-row mattress repair technique (n = 25); (ii) arthroscopic single-row simple suture knotted technique (n = 25); or (iii) arthroscopic single-row inverted mattress knotless technique (n = 36) by one surgeon. Standardized patient- and examiner-determined outcomes were obtained pre-operatively and postoperatively with a validated protocol, ultrasound were also performed at the same time. Results Retear occurred more often after open repair (48%) at 5 years than after arthroscopic knotted (33%) and arthroscopic knotless (26%) repair. Retear was associated with increasing age, pre-operative tear size and weaker pre-operative and 5 years postoperative cuff strength. Between 2 years and 5 years, the open repair group experienced an increase in the frequency of pain during activity, as well as in the difficulty experienced and the severity of pain during overhead activities (p < 0.05) and, at 5 years, also experienced more difficulty with overhead activities, compared to the arthroscopic knotless repair group. Conclusions At 5-year follow-up, arthroscopic rotator cuff repair techniques resulted in fewer retears and better outcomes compared to an open double-row technique.
Contractile dysfunction of the shoulder (rotator cuff tendinopathy): an overview
Littlewood, Chris
It is now over a decade since the features defining a contractile dysfunction of the shoulder were first reported. Since this time, some progress has been made to better understand this mechanical syndrome. In response to these developments, this narrative review will explore current understanding in relation to pathology, diagnosis, treatment, and prognosis of this syndrome with reference to literature specifically relating to contractile dysfunction but also literature relating to rotator cuff tendinopathy where necessary. The review not only identifies the strengths of the mechanical diagnosis and therapy approach with reference to a contractile dysfunction of the shoulder but also identifies where further progress needs to be made. PMID:24179329
Interrater reproducibility of clinical tests for rotator cuff lesions
Ostor, A; Richards, C; Prevost, A; Hazleman, B; Speed, C
Background: Rotator cuff lesions are common in the community but reproducibility of tests for shoulder assessment has not been adequately appraised and there is no uniform approach to their use. Objective: To study interrater reproducibility of standard tests for shoulder evaluation among a rheumatology specialist, rheumatology trainee, and research nurse. Methods: 136 patients were reviewed over 12 months at a major teaching hospital. The three assessors examined each patient in random order and were unaware of each other's evaluation. Each shoulder was examined in a standard manner by recognised tests for specific lesions and a diagnostic algorithm was used. Between-observer agreement was determined by calculating Cohen's κ coefficients (measuring agreement beyond that expected by chance). Results: Fair to substantial agreement was obtained for the observations of tenderness, painful arc, and external rotation. Tests for supraspinatus and subscapularis also showed at least fair agreement between observers. 40/55 (73%) κ coefficient assessments were rated at >0.2, indicating at least fair concordance between observers; 21/55 (38%) were rated at >0.4, indicating at least moderate concordance between observers. Conclusion: The reproducibility of certain tests, employed by observers of varying experience, in the assessment of the rotator cuff and general shoulder disease was determined. This has implications for delegation of shoulder assessment to nurse specialists, the development of a simplified evaluation schedule for general practitioners, and uniformity in epidemiological research studies. PMID:15361389
Comma Sign–Directed Repair of Anterosuperior Rotator Cuff Tears
Dilisio, Matthew F.; Neyton, Lionel
The comma sign was described as an arthroscopic landmark to identify the torn subscapularis stump to mobilize and repair the tendon in anterosuperior rotator cuff tears. It was hypothesized that it is composed of the humeral attachments of the superior glenohumeral and coracohumeral ligaments. This arthroscopic finding has since become accepted orthopaedic nomenclature pathognomonic for subscapularis tears and a key component of subscapularis tear classification. We propose an alternative theory of the pathoanatomy of the comma sign in anterosuperior rotator cuff tears and present the technique of comma sign–directed repairs of combined subscapularis and supraspinatus lesions. After appropriate releases, tendon-to-tendon repair of the distal-superior aspect of the comma sign to the upper border of the remnant subscapularis results in anatomic re-creation of the intra-articular portion of the torn subscapularis with concomitant reduction of the anterior leading edge of the supraspinatus and reconstitution of the rotator cable complex. A tension-free, single-anchor subscapularis repair is then performed to secure the tendon to the lesser tuberosity. After subscapularis repair, the supraspinatus that was previously retracted to the glenoid rim takes the appearance of a crescent-type tear that is easily approximated to its anatomic insertion. PMID:25685676
Effects of corticosteroids and hyaluronic acid on torn rotator cuff tendons in vitro and in rats.
Nakamura, Hidehiro; Gotoh, Masafumi; Kanazawa, Tomonoshin; Ohta, Keisuke; Nakamura, Keiichirou; Honda, Hirokazu; Ohzono, Hiroki; Shimokobe, Hisao; Mitsui, Yasuhiro; Shirachi, Isao; Okawa, Takahiro; Higuchi, Fujio; Shirahama, Masahiro; Shiba, Naoto; Matsueda, Satoko
Corticosteroids (CS) or hyaluronic acid (HA) is used in subacromial injection for the conservative treatment of rotator cuff tears (RCT); this study addresses the question of how CS and HA affect the tendon tissue and fibroblasts in vitro and in rats. Cell proliferation assays were performed in human tendon fibroblasts from RCT. Rats underwent surgery to create RCT, and the surgical sites were injected with CS or HA. The rotator cuff tendons were subjected to biomechanical testing, microscopic and immunohistochemical analysis of proliferating cell nuclear antigen (PCNA), and ultrastructural analysis. Cell proliferation was significantly decreased with CS in vitro (p < 0.05). Maximal load of CS-treated tendons was significantly decreased compared with that of HA-treated tendons (p < 0.05), as well as PCNA(+) cells at 2 weeks (p < 0.05). Ultrastructural observations of the CS-treated rats detected apoptosis of tendon fibroblasts 24 h after surgery. Histological and biomechanical data 4 weeks after surgery were not significant among the three groups. Unlike HA, CS caused cell death, and inhibition of the proliferation of tendon fibroblasts, leading to a delay of tendon healing involved and a subsequent decrease of biomechanical strength at the surgical site. PMID:26174562
REHABILITATION AFTER ARTHROSCOPIC ROTATOR CUFF REPAIR: CURRENT CONCEPTS REVIEW AND EVIDENCE-BASED GUIDELINES
Westgard, Paul; Chandler, Zachary; Gaskill, Trevor R.; Kokmeyer, Dirk; Millett, Peter J.
Purpose: To provide an overview of the characteristics and timing of rotator cuff healing and provide an update on treatments used in rehabilitation of rotator cuff repairs. The authors' protocol of choice, used within a large sports medicine rehabilitation center, is presented and the rationale behind its implementation is discussed. Background: If initial nonsurgical treatment of a rotator cuff tear fails, surgical repair is often the next line of treatment. It is evident that a successful outcome after surgical rotator cuff repair is as much dependent on surgical technique as it is on rehabilitation. To this end, rehabilitation protocols have proven challenging to both the orthopaedic surgeon and the involved physical therapist. Instead of being based on scientific rationale, traditionally most rehabilitation protocols are solely based on clinical experience and expert opinion. Methods: A review of currently available literature on rehabilitation after arthroscopic rotator cuff tear repair on PUBMED / MEDLINE and EMBASE databases was performed to illustrate the available evidence behind various postoperative treatment modalities. Results: There is little high-level scientific evidence available to support or contest current postoperative rotator cuff rehabilitation protocols. Most existing protocols are based on clinical experience with modest incorporation of scientific data. Conclusion: Little scientific evidence is available to guide the timing of postsurgical rotator cuff rehabilitation. To this end, expert opinion and clinical experience remains a large facet of rehabilitation protocols. This review describes a rotator cuff rehabilitation protocol that incorporates currently available scientific literature guiding rehabilitation. PMID:22530194
Postoperative pain control after arthroscopic rotator cuff repair.
Uquillas, Carlos A; Capogna, Brian M; Rossy, William H; Mahure, Siddharth A; Rokito, Andrew S
Arthroscopic rotator cuff repair (ARCR) can provide excellent clinical results for patients who fail to respond to conservative management of symptomatic rotator cuff tears. ARCR, however, can be associated with severe postoperative pain and discomfort that requires adequate analgesia. As ARCR continues to shift toward being performed as an outpatient procedure, it is incumbent on physicians and ambulatory surgical centers to provide appropriate pain relief with minimal side effects to ensure rapid recovery and safe discharge. Although intravenous and oral opioids are the cornerstone of pain management after orthopedic procedures, they are associated with drowsiness, nausea, vomiting, and increased length of hospital stay. As health care reimbursements continue to become more intimately focused on quality, patient satisfaction, and minimizing of complications, the need for adequate pain control with minimal complications will continue to be a principal focus for providers and institutions alike. We present a review of alternative modalities for pain relief after ARCR, including cryotherapy, intralesional anesthesia, nerve blockade, indwelling continuous nerve block catheters, and multimodal anesthesia. In choosing among these modalities, physicians should consider patient- and system-based factors to allow the efficient delivery of analgesia that optimizes recovery and improves patient satisfaction. PMID:27079219
Tissue discrimination in magnetic resonance imaging of the rotator cuff
Meschino, G. J.; Comas, D. S.; González, M. A.; Capiel, C.; Ballarin, V. L.
Evaluation and diagnosis of diseases of the muscles within the rotator cuff can be done using different modalities, being the Magnetic Resonance the method more widely used. There are criteria to evaluate the degree of fat infiltration and muscle atrophy, but these have low accuracy and show great variability inter and intra observer. In this paper, an analysis of the texture features of the rotator cuff muscles is performed to classify them and other tissues. A general supervised classification approach was used, combining forward-search as feature selection method with kNN as classification rule. Sections of Magnetic Resonance Images of the tissues of interest were selected by specialist doctors and they were considered as Gold Standard. Accuracies obtained were of 93% for T1-weighted images and 92% for T2-weighted images. As an immediate future work, the combination of both sequences of images will be considered, expecting to improve the results, as well as the use of other sequences of Magnetic Resonance Images. This work represents an initial point for the classification and quantification of fat infiltration and muscle atrophy degree. From this initial point, it is expected to make an accurate and objective system which will result in benefits for future research and for patients’ health.
Optimizing the management of full-thickness rotator cuff tears.
Murray, Jayson; Gross, Leeaht
The American Academy of Orthopaedic Surgeons has developed Appropriate Use Criteria (AUC) on Optimizing the Management of Full-Thickness Rotator Cuff Tears (RC). Evidence-based information, in conjunction with clinical expertise of physicians, was used to develop the criteria to improve patient care and obtain best outcomes while considering the subtleties and distinctions necessary in making clinical decisions. The RC AUC Writing Panel began the development of the clinical scenarios by identifying clinical indications typical of patients commonly presenting with full-thickness rotator cuff tears in clinical practice, as well as from the current evidence-based clinical practice guidelines and its supporting literature. The 432 patient scenarios and 5 treatments were developed by the Writing Panel, a group of clinicians who are specialists in this AUC topic. Next, the Review Panel, a separate group of volunteer physicians, independently reviewed these materials to ensure that they were representative of patient scenarios that clinicians are likely to encounter in daily practice. Finally, the multidisciplinary Voting Panel (made up of specialists and nonspecialists) rated the appropriateness of treatment of each patient scenario using a 9-point scale to designate a treatment as appropriate (median rating, 7 to 9), may be appropriate (median rating, 4 to 6), or rarely appropriate (median rating, 1 to 3). PMID:24292933
Prognostic factors for clinical outcomes after rotator cuff repair
Pécora, José Otávio Reggi; Malavolta, Eduardo Angeli; Assunção, Jorge Henrique; Gracitelli, Mauro Emílio Conforto; Martins, João Paulo Sobreiro; Ferreira, Arnaldo Amado
OBJECTIVE: To identify prognostic factors of postoperative functional outcomes. METHODS: Retrospective case series evaluating patients undergoing rotator cuff repair, analyzed by the UCLA score (pre and 12-month postoperative) and Magnetic Resonance Imaging (preoperative). Patients' intrinsic variables related to the injury and intervention were evaluated. Multivariate linear regression analysis was performed to determine variables impact on postoperative functional assessment. RESULTS: 131 patients were included. The mean UCLA score increased from 13.17 ± 3.77 to 28.73 ± 6.09 (p<0,001). We obtained 65.7% of good and excellent results. Age (r= 0.232, p= 0.004) and reparability of posterosuperior injuries (r= 0.151, p= 0.043) correlated with the functional assessment at 12 months. After multivariate linear regression analysis, only age was associated (p = 0.008). CONCLUSIONS: The surgical treatment of rotator cuff tears lead to good and excellent results in 65.6% of patients. Age was an independent predictor factor with better clinical outcomes by UCLA score in older patients. Level of Evidence IV, Case Series. PMID:26207092
Deltoid detachment consequent to open surgical repair of massive rotator cuff tears.
Gumina, S; Di Giorgio, G; Perugia, D; Postacchini, F
Deltoid detachment is one of the complications in open rotator cuff repair. Although it is often described, the actual prevalence, time at which it occurs and the predisposing causes are still unknown. We prospectively studied 112 patients with massive rotator cuff tears with a mean age of 67. The surgical approach was performed with a lateral para-acromial incision. Clinical assessment was performed with Constant's method. Of the 112 patients, 9 (8%) had deltoid detachment. It occurred about 3 months after surgery. Of the nine patients, two underwent revision surgery for the deltoid trans-bone reattachment. At the follow-up, the patients with deltoid detachment had a mean increase of only 5.5 points in the Constant score compared to that of 16.9 obtained by the control group. Deltoid reattachment, performed on the two patients, provided a mean increase of 7 points only with respect to the post-operative control at the 4th month. Considering the unsatisfactory functional result consequent to deltoid detachment and the slight improvement obtained with the reattachment, we recommend the following: use suture thread thicker than #2, do not use a simple stitch and avoid extending acromioplasty to the lateral margin of the acromion. PMID:17410365
Deltoid detachment consequent to open surgical repair of massive rotator cuff tears
Di Giorgio, G.; Perugia, D.; Postacchini, F.
Deltoid detachment is one of the complications in open rotator cuff repair. Although it is often described, the actual prevalence, time at which it occurs and the predisposing causes are still unknown. We prospectively studied 112 patients with massive rotator cuff tears with a mean age of 67. The surgical approach was performed with a lateral para-acromial incision. Clinical assessment was performed with Constant’s method. Of the 112 patients, 9 (8%) had deltoid detachment. It occurred about 3 months after surgery. Of the nine patients, two underwent revision surgery for the deltoid trans-bone reattachment. At the follow-up, the patients with deltoid detachment had a mean increase of only 5.5 points in the Constant score compared to that of 16.9 obtained by the control group. Deltoid reattachment, performed on the two patients, provided a mean increase of 7 points only with respect to the post-operative control at the 4th month. Considering the unsatisfactory functional result consequent to deltoid detachment and the slight improvement obtained with the reattachment, we recommend the following: use suture thread thicker than #2, do not use a simple stitch and avoid extending acromioplasty to the lateral margin of the acromion. PMID:17410365
Results of the repair of acute rotator cuff tears is not influenced by tear retraction
Butler, Bryan R.; Byrne, Abigail N.; Higgins, Laurence D.; Shah, Anup; Fowler, Rachel L.
Purpose: This study evaluated retraction in the setting of acute rotator cuff tears and determined its effects on patient outcomes and tendon repair integrity. Materials and Methods: A total of 22 patients had surgery within 6 weeks or less from the time of injury. Fifteen of these patients were prospectively followed at a minimum of 2 years; average 40.5 months (range 24-69). Pre-operative objective and subjective outcomes were compared. Tendon repair integrity was assessed with ultrasound at a minimum of 1 year from surgery. The population was stratified into Group 1 (8 patients) with minimal intra-operative medial tendon retraction to the mid-line level of the humeral head and Group 2 (7 patients) with a large medial tendon retraction to the glenohumeral joint or greater. Results: The average time to surgery from the onset of symptoms was 27 days (range, 6-42). Post-operative motion increased significantly for external rotation and forward elevation, 77% of patients were pain free, 80% were completely satisfied, and 100% would have the surgery again. Group 1 (small retraction) versus Group 2 (large retraction) showed that post-operative pain levels, satisfaction, range of motion, strength, subjective shoulder value (95.4% vs. 92.3%), Constant Score (80.8 vs. 78.1), and American Society of Shoulder and Elbow Surgeons (96.2 vs. 93.5) scores were not statistically different. Ultrasound showed a tendon repair integrity rate of 87%. 2 patients who did have a re-tear were in Group 2, yet had comparative outcomes. Conclusion: In acute rotator cuff tears, equal patient satisfaction, pain scores, range of motion, strength, and outcome measures should be expected with surgical repair despite the level of retraction. Level of Evidence: Therapeutic level IV PMID:24167400
Platelets and plasma stimulate sheep rotator cuff tendon tenocytes when cultured in an extracellular matrix scaffold.
Kelly, Brian A; Proffen, Benedikt L; Haslauer, Carla M; Murray, Martha M
The addition of platelet-rich plasma (PRP) to rotator cuff repair has not translated into improved outcomes after surgery. However, recent work stimulating ligament healing has demonstrated improved outcomes when PRP or whole blood is combined with an extracellular matrix carrier. The objective of this study was to evaluate the effect of three components of blood (plasma, platelets, and macrophages) on the in vitro activity of ovine rotator cuff cells cultured in an extracellular matrix environment. Tenocytes were obtained from six ovine infraspinatus tendons and cultured over 14 days in an extracellular matrix scaffold with the following additives: (1) plasma (PPP), (2) plasma and platelets (PAP), (3) plasma and macrophages (PPPM), (4) plasma, platelets and macrophages (PAPM), (5) phosphate buffered saline (PBS), and (6) PBS with macrophages (PBSM). Assays measuring cellular metabolism (AlamarBlue), proliferation (Quantitative DNA assay), synthesis of collagen and cytokines (SIRCOL, TNF-α and IL-10 ELISA, and MMP assay), and collagen gene expression (qPCR) were performed over the duration of the experiment, as well as histology at the conclusion. Plasma was found to stimulate cell attachment and spreading on the scaffold, as well as cellular proliferation. Platelets also stimulated cell proliferation, cellular metabolism, transition of cells to a myofibroblast phenotype, and contraction of the scaffolds. The addition of macrophages did not have any significant effect on the sheep rotator cuff cells in vitro. In vivo studies are needed to determine whether these changes in cellular function will translate into improved tendon healing. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:623-629, 2016. PMID:26419602
Labrum and rotator cuff injuries in the throwing athlete.
Menge, Travis J; Byram, Ian R; Boykin, Robert E; Bushnell, Brandon D
The large amount of force imparted across the shoulder during the act of throwing makes the glenohumeral joint highly susceptible to injury in the athlete performing overhead throwing motions. The bony incongruity of the shoulder enables greater range of motion than any other joint in the body, but it also results in significant strain on the surrounding soft tissues during the throwing motion. Throwers can present with acute injuries, but more commonly they suffer from chronic overuse conditions resulting from repetitive overload. Proper management requires early recognition with treatment directed toward the athlete's safe return to sports. Failure to institute an appropriate management strategy may result in significant complications, including prolonged disability, progression of symptoms, and further injury. We discuss the functional anatomy, pathophysiology, clinical presentation, evaluation, and treatment of common injuries of the glenoid labrum and rotator cuff in the overhead throwing athlete. PMID:25599876
Application of Pain Quantitative Analysis Device for Assessment of Postoperative Pain after Arthroscopic Rotator Cuff Repair
Mifune, Yutaka; Inui, Atsuyuki; Nagura, Issei; Sakata, Ryosuke; Muto, Tomoyuki; Harada, Yoshifumi; Takase, Fumiaki; Kurosaka, Masahiro; Kokubu, Takeshi
Purpose : The PainVision™ system was recently developed for quantitative pain assessment. Here, we used this system to evaluate the effect of plexus brachialis block on postoperative pain after arthroscopic rotator cuff repair. Methods : Fifty-five patients who underwent arthroscopic rotator cuff repair were included in this study. First 26 cases received no plexus brachialis block (control group), and the next 29 cases received the plexus brachialis block before surgery (block group). Patients completed the visual analog scale at 4, 8, 16, and 24 hours after surgery, and the intensity of postoperative pain was assessed with PainVision™ at 16 hours. The postoperative use of non-steroidal anti-inflammatory agents was also recorded. Results : The pain intensity at 16 hours after surgery assessed by PainVision™ was significantly lower in the block group than in the control group (block, 252.0 ± 47.8, control, 489.0 ± 89.1, P < 0.05). However, there were no differences in the VAS values at 16 hours between the 2 groups (block, 4.3 ± 0.6, control, 5.7 ± 0.4, P = N.S.). The pain intensity and VAS at 16 hours after surgery were highly correlated (r = 0.59, P = 0.006 in the block group and r = 0.62, P = 0.003 in the control group). The effect size of the assessment by PainVision™ was bigger than that of VAS (r=0.31 in VAS and 0.51 in Pain vision). Conclusion : The PainVision™ system could be useful to evaluate postoperative pain because it enables the quantification and comparison of pain intensity independent of individual pain thresholds. PMID:26157522
Repair Integrity and Clinical Outcomes Following Arthroscopic Rotator Cuff Repair
Williams, Ariel A.; Mark, P.; DiVenere, Jessica Megan; Klinge, Stephen Austin; Arciero, Robert A.; Mazzocca, Augustus D.
Objectives: To prospectively evaluate the effect of early versus delayed motion on repair integrity on 6-month postoperative magnetic resonance imaging (MRI) scans following rotator cuff repair, and to correlate repair integrity with clinical and functional outcomes. We hypothesized that repair integrity would differ between the early and delayed groups and that patients with repair failures would have worse clinical and functional outcomes. Methods: This was a prospective, randomized, single blinded clinical trial comparing an early motion (post-op day 2-3) to a delayed motion (post-op day 28) rehabilitation protocol following arthroscopic repair of isolated supraspinatus tears. All patients underwent MRI at 6 months post-operatively as part of the study protocol. A blinded board-certified and fellowship-trained orthopaedic surgeon (not part of the surgical team) reviewed operative photos and video to confirm the presence of a full thickness supraspinatus tear and to ensure an adequate and consistent repair. The same surgeon along with a blinded sports medicine fellowship-trained musculoskeletal radiologist independently reviewed all MRIs to determine whether the repair was intact at 6 months. Outcome measures were collected by independent evaluators who were also blinded to group assignment. These included the Western Ontario Rotator Cuff (WORC) index, Single Assessment Numeric Evaluation (SANE) ratings, pain scores, sling use, and physical exam data. Enrolled patients were followed at 6 weeks, 6 months, and 1 year. Results: From October 2008 to April 2012, 73 patients met all inclusion criteria and were willing to participate. 36 patients were randomized to delayed motion and 37 were randomized to early motion. The final study group at 6 months consisted of 58 study participants. Postoperative MRIs were obtained on all of these patients at 6 months regardless of whether or not they were progressing as expected. These MRIs demonstrated an overall failure rate of
Latissimus dorsi tendon transfer for massive, irreparable posterosuperior rotator cuff tears: surgical technique.
Qadir, Rabah; Romine, Lucas; Yao, David C; Duncan, Scott F M
Massive rotator cuff tears remain a complex and challenging problem for both the patient and the surgeon. Although significant advancements in surgical techniques as well as technology for arthroscopic and mini-open rotator cuff repairs have been made, many massive tears result in failed repair with continued progressive tendon retraction and degeneration. In cases when primary tendon to bone healing is impractical, latissimus dorsi tendon transfer provides promising and reproducible clinical results. Herein, we present a latissimus tendon transfer surgical technique, a procedure we have used as a salvage operation for failed arthroscopic/mini-open primary rotator cuff repair. PMID:24854152
Healing rates for challenging rotator cuff tears utilizing an acellular human dermal reinforcement graft
Agrawal, Vivek
Purpose: This study presents a retrospective case series of the clinical and structural outcomes (1.5 T MRI) of arthroscopic rotator cuff repair with acellular human dermal graft reinforcement performed by a single surgeon in patients with large, massive, and previously repaired rotator cuff tears. Materials and Methods: Fourteen patients with mean anterior to posterior tear size 3.87 ± 0.99 cm (median 4 cm, range 2.5–6 cm) were enrolled in the study and were evaluated for structural integrity using a high-field (1.5 T) MRI at an average of 16.8 months after surgery. The Constant-Murley scores, the Flexilevel Scale of Shoulder Function (Flex SF), scapular plane abduction, and strength were analyzed. Results: MRI results showed that the rotator cuff repair was intact in 85.7% (12/14) of the patients studied. Two patients had a Sugaya Type IV recurrent tear (2 of 14; 14.3%), which were both less than 1 cm. The Constant score increased from a preoperative mean of 49.72 (range 13–74) to a postoperative mean of 81.07 (range 45–92) (P value = 0.009). Flexilevel Scale of Shoulder Function (Flex SF) Score normalized to a 100-point scale improved from a preoperative mean of 53.69 to a postoperative mean of 79.71 (P value = 0.003). The Pain Score improved from a preoperative mean of 7.73 to a postoperative mean of 13.57 (P value = 0.008). Scapular plane abduction improved from a preoperative mean of 113.64° to a postoperative mean of 166.43° (P value = 0.010). The strength subset score improved from a preoperative mean of 1.73 kg to a postoperative mean of 7.52 kg (P value = 0.006). Conclusions: This study presents a safe and effective technique that may help improve the healing rates of large, massive, and revision rotator cuff tears with the use of an acellular human dermal allograft. This technique demonstrated favorable structural healing rates and statistically improved functional outcomes in the near term. Level of Evidence: 4. Retrospective case series. PMID
Management of In-Season Concurrent Rotator Cuff Tear With Shoulder Instability in Professional Contact Football Athletes; Respect the Career Goals!
Mueller, Maike; Hoy, Gregory; Branson, Ruben
Introduction Professional sports injuries are usually all dealt with at one single operation to return the player to the sport after appropriate rehabilitation. We questioned the assumption that rotator cuff tears must be repaired concurrently with instability syndromes, and aimed to allow a professional rugby league player to achieve career goals by NOT correcting all pathology at one surgery. Case Presentation A professional rugby league player presented with acute shoulder instability on a setting of a chronic full thickness rotator cuff tear. We performed an “in season” arthroscopic stabilization on an elite rugby league player, leaving a previously diagnosed large full thickness rotator cuff tear untreated. This allowed aggressive rehabilitation and return to contact competition at 12 weeks post-surgery. The player achieved a long held career goal of winning a premiership ring before undertaking rotator cuff repair at the end of the season. Latest follow up at seven years (still at elite level) demonstrated an asymptomatic shoulder. Conclusions The assumption that all pathology found at surgical exploration requires correction to play at elite level is not universally correct. We postulate that whilst rotator cuff deficiency has severe long-term sequelae, it is shoulder instability alone that prevents high level contact sports participation. Career goal management is an important part of managing elite level athletes. We have demonstrated that by careful management of the specific pathology preventing participation can allow elite athletes to achieve career goals without compromising long-term health. PMID:27217928
Gene polymorphism of IL-6 and MMP-3 decreases passive range of motion after rotator cuff repair
Ling, Yan; Peng, Cheng; Liu, Chenguang; Zhang, Na; Yue, Shouwei
Objectives: Post-operative stiffness is common after rotator cuff repair, given the difference in susceptibility and severity, the genetic factors may be involved. Interleukin 6 (IL-6) and Matrix metalloproteinases 3 (MMP-3) were previous found as key cytokines in the pathologies of adhesive capsulitis. The present study aims to investigate whether variants within the IL-6 and MMP-3 gene contributed to post-operative stiffness in a Chinese Han population. Methods: A total of 188 patients diagnosed with rotator cuff tears treated with mini-open surgery were enrolled in this study, among which 87 patients were diagnosed as post-operative stiffness and the remaining 101 patients as controls. All subjects were genotyped for IL-6 and MMP-3 SNPs. Results: The rs1800796 of IL-6 and rs679620 of MMP-3 were found significantly associated with increased susceptibility and severity of post-operative stiffness. Conclusion: The rs1800796 SNP of IL-6 and rs650108 SNP of MMP-3 were associated with increased risk of post-operative stiffness susceptibility and severity. This finding can be used in guiding the rehabilitation procedure after rotator cuff surgery, in another word, those with the genetic susceptibility factors should receive a more radical rehabilitation procedure and those without the susceptibility factors can be more conservative. PMID:26191285
Tissue Engineering for Rotator Cuff Repair: An Evidence-Based Systematic Review
Maffulli, Nicola; Longo, Umile Giuseppe; Loppini, Mattia; Berton, Alessandra; Spiezia, Filippo; Denaro, Vincenzo
The purpose of this systematic review was to address the treatment of rotator cuff tears by applying tissue engineering approaches to improve tendon healing, specifically platelet rich plasma (PRP) augmentation, stem cells, and scaffolds. Our systematic search was performed using the combination of the following terms: “rotator cuff”, “shoulder”, “PRP”, “platelet rich plasma”, “stemcells”, “scaffold”, “growth factors”, and “tissue engineering”. No level I or II studies were found on the use of scaffolds and stem cells for rotator cuff repair. Three studies compared rotator cuff repair with or without PRP augmentation. All authors performed arthroscopic rotator cuff repair with different techniques of suture anchor fixation and different PRP augmentation. The three studies found no difference in clinical rating scales and functional outcomes between PRP and control groups. Only one study showed clinical statistically significant difference between the two groups at the 3-month follow up. Any statistically significant difference in the rates of tendon rerupture between the control group and the PRP group was found using the magnetic resonance imaging. The current literature on tissue engineering application for rotator cuff repair is scanty. Comparative studies included in this review suggest that PRP augmented repair of a rotator cuff does not yield improved functional and clinical outcome compared with non-augmented repair at a medium and long-term followup. PMID:25098365
Following rotator cuff tears, the remaining (intact) tendons are mechanically altered
Perry, Stephanie M.; Getz, Charles L.; Soslowsky, Louis J.
Although presumed, damage in the remaining (intact) rotator cuff tendons in the presence of an isolated supraspinatus tendon tear or multiple tendon tear has not been well studied. This study utilized an animal model of multiple rotator cuff tendon tears to investigate alterations in the remaining (intact) tendon mechanical properties at 4 and 8 weeks post-injury. Twenty-four animals served as uninjured controls, while seventy-two were divided among the tendon detachment groups (supraspinatus tendon detachment, supraspinatus+infraspinatus tendon detachment, supraspinatus+subscapularis tendon detachment). We found the remaining (intact) rotator cuff tendons have decreased mechanical properties in the presence of rotator cuff tears. Remaining (intact) subscapularis and infraspinatus tendon cross-sectional area increased, while tendon modulus decreased after both one and two tendon tears. Additionally, the remaining (intact) tendon cross-sectional areas continued to increase with time post-injury. These alterations could potentially lead to further tendon damage and tear progression. PMID:19095175
Dynamic Three-Dimensional Shoulder Mri during Active Motion for Investigation of Rotator Cuff Diseases
Tempelaere, Christine; Pierrart, Jérome; Lefèvre-Colau, Marie-Martine; Vuillemin, Valérie; Cuénod, Charles-André; Hansen, Ulrich; Mir, Olivier; Skalli, Wafa; Gregory, Thomas
Background MRI is the standard methodology in diagnosis of rotator cuff diseases. However, many patients continue to have pain despite treatment, and MRI of a static unloaded shoulder seems insufficient for best diagnosis and treatment. This study evaluated if Dynamic MRI provides novel kinematic data that can be used to improve the understanding, diagnosis and best treatment of rotator cuff diseases. Methods Dynamic MRI provided real-time 3D image series and was used to measure changes in the width of subacromial space, superior-inferior translation and anterior-posterior translation of the humeral head relative to the glenoid during active abduction. These measures were investigated for consistency with the rotator cuff diseases classifications from standard MRI. Results The study included: 4 shoulders with massive rotator cuff tears, 5 shoulders with an isolated full-thickness supraspinatus tear, 5 shoulders with tendinopathy and 6 normal shoulders. A change in the width of subacromial space greater than 4mm differentiated between rotator cuff diseases with tendon tears (massive cuff tears and supraspinatus tear) and without tears (tendinopathy) (p = 0.012). The range of the superior-inferior translation was higher in the massive cuff tears group (6.4mm) than in normals (3.4mm) (p = 0.02). The range of the anterior-posterior translation was higher in the massive cuff tears (9.2 mm) and supraspinatus tear (9.3 mm) shoulders compared to normals (3.5mm) and tendinopathy (4.8mm) shoulders (p = 0.05). Conclusion The Dynamic MRI enabled a novel measure; ‘Looseness’, i.e. the translation of the humeral head on the glenoid during an abduction cycle. Looseness was better able at differentiating different forms of rotator cuff disease than a simple static measure of relative glenohumeral position. PMID:27434235
Diagnostic accuracy of clinical examination features for identifying large rotator cuff tears in primary health care
Cadogan, Angela; McNair, Peter; Laslett, Mark; Hing, Wayne; Taylor, Stephen
Objectives: Rotator cuff tears are a common and disabling complaint. The early diagnosis of medium and large size rotator cuff tears can enhance the prognosis of the patient. The aim of this study was to identify clinical features with the strongest ability to accurately predict the presence of a medium, large or multitendon (MLM) rotator cuff tear in a primary care cohort. Methods: Participants were consecutively recruited from primary health care practices (n = 203). All participants underwent a standardized history and physical examination, followed by a standardized X-ray series and diagnostic ultrasound scan. Clinical features associated with the presence of a MLM rotator cuff tear were identified (P<0.200), a logistic multiple regression model was derived for identifying a MLM rotator cuff tear and thereafter diagnostic accuracy was calculated. Results: A MLM rotator cuff tear was identified in 24 participants (11.8%). Constant pain and a painful arc in abduction were the strongest predictors of a MLM tear (adjusted odds ratio 3.04 and 13.97 respectively). Combinations of ten history and physical examination variables demonstrated highest levels of sensitivity when five or fewer were positive [100%, 95% confidence interval (CI): 0.86–1.00; negative likelihood ratio: 0.00, 95% CI: 0.00–0.28], and highest specificity when eight or more were positive (0.91, 95% CI: 0.86–0.95; positive likelihood ratio 4.66, 95% CI: 2.34–8.74). Discussion: Combinations of patient history and physical examination findings were able to accurately detect the presence of a MLM rotator cuff tear. These findings may aid the primary care clinician in more efficient and accurate identification of rotator cuff tears that may require further investigation or orthopedic consultation. PMID:24421626
[Controversies in the therapy of rotator cuff tears. Operative or nonoperative treatment, open or arthroscopic repair?].
Lorbach, O
Rotator cuff tears are a common cause of shoulder pain that may lead to severe impairment of shoulder function with significant limitation of the quality of life. Furthermore, they are associated with high direct and indirect costs.Conservative therapy and various surgical procedures for rotator cuff repair are all possible treatment options. Therefore, the correct treatment for a symptomatic rotator cuff tear is important.The conservative therapy may be considered as an alternative treatment option for a symptomatic rotator cuff tear in patients with small or incomplete tears with no fatty atrophy or tendon retraction, with only slight pain, and in older patients with few functional demands. Surgical treatment is recommended after failed conservative treatment lasting 3-6 months, with the corresponding psychological strain. Moreover, surgical treatment should be considered as a primary treatment option for a symptomatic rotator cuff tear in young patients with high functional demands, patients with a high level of physical strain in their jobs, large tears, and tears where there is already significant muscle atrophy or tendon retraction.Arthroscopic treatment is considered to be the gold standard because of the better cosmetic results and treatment of concomitant pathological conditions, the lower levels of postoperative pain, the potentially lower risk of shoulder stiffness, and more focused adhesiolysis. However, arthroscopy does not improve clinical results. Because of the current financial situation, however, open rotator cuff repair is still a viable alternative. PMID:26694070
A new tear pattern of the rotator cuff and its treatment: Fosbury flop tears
Lädermann, Alexandre; Denard, Patrick J.; Kolo, Frank C.
Purpose: The purpose of this report is to describe a new full-thickness tear pattern of the posterosuperior rotator cuff with reversal healing. We describe the specific radiologic signs associated with this tear pattern and the arthroscopic rotator cuff repair technique. Materials and Methods: A prospective radiologic and clinical study collected all patients with a magnetic resonance imaging arthrogram that underwent an arthroscopic rotator cuff repair over a 1 year period. Results: Among 97 patients, five demonstrated a tear of the posterosuperior rotator cuff with reversal healing. Characteristic radiographic findings included a thicker tendon than normal, the presence of a stump and accumulation of liquid in the superior-medial part of the subacromial bursa, and adhesions between the supraspinatus tendon and the wall of the subacromial bursa. Conclusion: Avulsion of the posterosuperior rotator cuff with reversal healing on its bursal-side is a less common condition. This type of lesion and distinct radiographic signs that can be recognized to facilitate anatomic repair of the rotator cuff. Level of evidence: Level IV. PMID:25709239
Rotator cuff injury in patients over the age of 65 years: evaluation of function, integrity and strength☆
de Castro Veado, Marco Antonio; Prata, Eric Fontes; Gomes, David Correia
Objective To retrospectively evaluate the results from patients who underwent arthroscopic treatment for rotator cuff injuries, among those aged over 65 years, observing integrity, function and strength. Methods Thirty-five shoulders were operated between July 2005 and July 2010, and 28 shoulders were re-evaluated regarding elevation strength and external rotation, using a digital dynamometer. Integrity was evaluated by means of ultrasound examinations. The patients, whose mean age was 70.54 years (ranging from 65 to 82 years), were followed up for a minimum of 26 months and mean of 51.18 months (ranging from 26 to 82 months). To evaluate function, the UCLA score, the Simple Shoulder Test (SST) and a visual analog scale (VAS) for pain were used. Results In analyzing the ultrasound scans, it was observed that the integrity of the rotator cuff was maintained in 75% of the cases at the end of the follow-up, along with the improvement in the UCLA score, which evolved from 17.46 to 32.39, i.e. excellent and good results in 89.28%. The mean SST and VAS indices were 9.86 and 1.5 respectively. Conclusion Arthroscopic surgery to repair rotator cuff injuries in patients over the age of 65 years leads to improved function and pain relief, with maintenance of the integrity of the repair. The data on muscle strength were inconclusive. PMID:26229937
Teres Minor Hypertrophy is a Common and Negative Predictor of Outcomes after Rotator Cuff Repair
Tokish, John M.; Thigpen, Charles A.; Kissenberth, Michael J.; Hunt, Quinn; Tolan, Stefan John; Swinehart, S. Dane; Shelley, Christina; Hawkins, Richard J.
Objectives: The teres minor has received increased attention in its role as a rotator cuff muscle, particularly in the setting of large infraspinatus tears. Studies have shown that it plays an important beneficial role after total (TSA) and reverse (RSA) shoulder arthroplasty, as well as in maintenance of function in the setting of infraspinatus wasting in patients with large rotator cuff tears. No study, however, has investigated how often teres minor hypertrophy occurs in a population of rotator cuff tears, whether it occurs in the absence of infraspinatus tearing, or whether it is a positive or negative prognostic indicator on outcomes after rotator cuff repair. The purpose of this study was to determine the prevalence of teres minor hypertrophy in a cohort of patients undergoing rotator cuff repair, and to determine its prognostic effect, if any, on outcomes after surgical repair. Methods: Over a 3 year period, all rotator cuff repairs performed in a single practice by 3 American Shoulder and Elbow Society (ASES) member surgeons were collected. One hundered forty-four patients who had preoperative and postoperative (ASES) outcomes (minimum 2 year), and preoperative Magnetic Resonance Imaging (MRI) were included in the study. All MRIs were evaluated for rotator cuff tear tendon involvement, tear size, and Goutallier changes of each muscle. In addition, occupational ratios were determined for the supraspinatus, infraspinatus, and teres minor muscles. Patients were divided into 2 groups, based upon whether they had teres minor hypertrophy or not, based on a previously established definition. A 2 way univariate ANOVA was used to determine the effect of teres minor hypertrophy(tear size by hypertrophy) and Goutallier changes(tear size by fatty infiltration) on ASES change scores(α=0.05) Results: Teres minor hypertrophy was a relatively common finding in this cohort of rotator cuff patients, with 51% of all shoulders demonstrating hypertrophy. Interestingly, in
Rehabilitation following rotator cuff repair: a systematic review
Bateman, Marcus; Clark, David; Selfe, James; Watkinson, Duncan; Walton, Mike; Funk, Lennard
Background The aim of this systematic review was to evaluate the effectiveness of rehabilitation programmes following surgical repair of the rotator cuff with emphasis upon length of immobilisation and timing of introduction of load. Methods An electronic search of CENTRAL, MEDLINE and PEDro was undertaken to August 2014 and supplemented by hand searching. Randomised controlled trials were included, quality appraised using the PEDro scale and synthesised via meta-analysis or narrative synthesis, based upon levels of evidence, where appropriate. Results Twelve studies were included. There is strong evidence that early initiation of rehabilitation does not adversely affect clinical outcome but there is a marginally higher, statistically non-significant, incidence of tendon re-tear (OR 1.3; 95% CI 0.72 to 2.2). There is strong evidence that initiation of functional loading early in the rehabilitation programme does not adversely affect clinical outcome. Discussion Concern about early initiation of rehabilitation and introduction of gradual functional load does not appear warranted but this should be considered in a context of potential for Type II error. There is further need to evaluate approaches that foster early initiation of rehabilitation and gradual introduction of functional load as well as considering key outcomes such as return to work.
Assessment and characterization of in situ rotator cuff biomechanics
Trent, Erika A.; Bailey, Lane; Mefleh, Fuad N.; Raikar, Vipul P.; Shanley, Ellen; Thigpen, Charles A.; Dean, Delphine; Kwartowitz, David M.
Rotator cuff disease is a degenerative disorder that is a common, costly, and often debilitating, ranging in severity from partial thickness tear, which may cause pain, to total rupture, leading to loss in function. Currently, clinical diagnosis and determination of disease extent relies primarily on subjective assessment of pain, range of motion, and possibly X-ray or ultrasound images. The final treatment plan however is at the discretion of the clinician, who often bases their decision on personal experiences, and not quantitative standards. The use of ultrasound for the assessment of tissue biomechanics is established, such as in ultrasound elastography, where soft tissue biomechanics are measured. Few studies have investigated the use of ultrasound elastography in the characterization of musculoskeletal biomechanics. To assess tissue biomechanics we have developed a device, which measures the force applied to the underlying musculotendentious tissue while simultaneously obtaining the related ultrasound images. In this work, the musculotendinous region of the infraspinatus of twenty asymptomatic male organized baseball players was examined to access the variability in tissue properties within a single patient and across a normal population. Elastic moduli at percent strains less than 15 were significantly different than those above 15 percent strain within the normal population. No significant difference in tissue properties was demonstrated within a single patient. This analysis demonstrated elastic moduli are variable across individuals and incidence. Therefore threshold elastic moduli will likely be a function of variation in local-tissue moduli as opposed to a specific global value.
ARTHROSCOPIC TREATMENT OF CALCIFYING TENDINITIS OF THE ROTATOR CUFF
Neto, Arnaldo Amado Ferreira; Trevizani, Cassio Silva; Benegas, Eduardo; Malavolta, Eduardo Angeli; Gracitelli, Mauro Emílio Conforto; Bitar, Alexandre Carneiro; Neto, Francisco José dos Santos
To evaluate the clinical and radiographic results from arthroscopic surgical treatment of the rotator cuff in patients with calcifying tendinitis. Method: A retrospective study was conducted on twenty patients who underwent arthroscopic treatment for calcifying tendinitis of the shoulder between March 1999 and November 2005. Six patients were excluded due to loss of follow-up. The average follow-up period was 41.4 months. Eight patients (57%) were female and six (43%) were male. The right side was affected in 10 cases (71%) and the left in four cases (29%). Nine cases (64%) had calcification in the supraspinatus tendon, two (14%) in the infraspinatus tendon, and three (21%) in both tendons. Results: In all cases, resection of the calcium deposits was performed by means of a needle (Jelco® No. 14) in combination with curettage (mini-curette). Two shoulders (14%) underwent subacromial decompression, and one (7%) underwent excision of the distal clavicle. A tendon-tendon suture was performed in three shoulders (21%). None of the patients underwent tendon-bone reinsertion. The mean score obtained on the UCLA scale was 33 points (26-35), thus indicating that a majority of patients had good results. In the final radiographic evaluation, none of the patients showed signs of calcification. Conclusion: Arthroscopic treatment of calcifying tendinitis of the shoulder safely allows excision of the calcification, leading to good results in relation to shoulder pain and function. PMID:27022591
Rotator cuff tears after total shoulder arthroplasty in primary osteoarthritis: A systematic review
Levy, David M.; Abrams, Geoffrey D.; Harris, Joshua D.; Bach, Bernard R.; Nicholson, Gregory P.; Romeo, Anthony A.
Rotator cuff tears have been reported to be uncommon following total shoulder arthroplasty (TSA). Postoperative rotator cuff tears can lead to pain, proximal humeral migration, and glenoid component loosening. The purpose of this paper was to evaluate the incidence of post-TSA rotator cuff tears or dysfunction in osteoarthritic patients. A systematic review of multiple databases was performed using preferred reporting items for systematic reviews and meta-analyses guidelines. Levels I-IV evidence clinical studies of patients with primary osteoarthritis with a minimum 2-year follow-up were included. Fifteen studies with 1259 patients (1338 shoulders) were selected. Student's t-tests were used with a significant alpha value of 0.05. All patients demonstrated significant improvements in motion and validated clinical outcome scores (P < 0.001). Radiographic humeral head migration was the most commonly reported data point for extrapolation of rotator cuff integrity. After 6.6 ± 3.1 years, 29.9 ± 20.7% of shoulders demonstrated superior humeral head migration and 17.9 ± 14.3% migrated a distance more than 25% of the head. This was associated with an 11.3 ± 7.9% incidence of postoperative superior cuff tears. The incidence of radiographic anterior humeral head migration was 11.9 ± 15.9%, corresponding to a 3.0 ± 13.6% rate of subscapularis tears. We found an overall 1.2 ± 4.5% rate of reoperation for cuff injury. Nearly all studies reported indirect markers of rotator cuff dysfunction, such as radiographic humeral head migration and clinical exam findings. This systematic review suggests that rotator cuff dysfunction following TSA may be more common than previously reported. IV, systematic review of Levels I-IV studies. PMID:27186060
Biologic Treatments for Sports Injuries II Think Tank-Current Concepts, Future Research, and Barriers to Advancement, Part 2: Rotator Cuff.
Murray, Iain R; LaPrade, Robert F; Musahl, Volker; Geeslin, Andrew G; Zlotnicki, Jason P; Mann, Barton J; Petrigliano, Frank A
Rotator cuff tears are common and result in considerable morbidity. Tears within the tendon substance or at its insertion into the humeral head represent a considerable clinical challenge because of the hostile local environment that precludes healing. Tears often progress without intervention, and current surgical treatments are inadequate. Although surgical implants, instrumentation, and techniques have improved, healing rates have not improved, and a high failure rate remains for large and massive rotator cuff tears. The use of biologic adjuvants that contribute to a regenerative microenvironment have great potential for improving healing rates and function after surgery. This article presents a review of current and emerging biologic approaches to augment rotator cuff tendon and muscle regeneration focusing on the scientific rationale, preclinical, and clinical evidence for efficacy, areas for future research, and current barriers to advancement and implementation. PMID:27099865
Evidence for an Inherited Predisposition Contributing to the Risk for Rotator Cuff Disease
Tashjian, Robert Z.; Farnham, James M.; Albright, Frederick S.; Teerlink, Craig C.; Cannon-Albright, Lisa A.
Background: A genetic predisposition has been suggested to contribute to the risk for development of rotator cuff disease on the basis of observed family clusters of close relatives. We used a population-based resource combining genealogical data for Utah with clinical diagnosis data from a large Utah hospital to test the hypothesis of excess familial clustering for rotator cuff disease. Methods: The Utah Population Database contains combined health and genealogical data on over two million Utah residents. Current Procedural Terminology, Fourth Revision, codes (29827, 23412, 23410, and 23420) and International Classification of Diseases, Ninth Revision, codes (726.1, 727.61, and 840.4) entered in patient records were used to identify patients with rotator cuff disease. We tested the hypothesis of excess familial clustering using two well-established methods (the Genealogical Index of Familiality test and the estimation of relative risks in relatives) in the overall study group (3091 patients) and a subgroup of the study group diagnosed before the age of forty years (652 patients). Results: The Genealogical Index of Familiality test in patients diagnosed before the age of forty years showed significant excess relatedness for individuals with rotator cuff disease in close and distant relationships (as distant as third cousins) (p = 0.001). The relative risk of rotator cuff disease in the relatives of patients diagnosed before the age of forty years was significantly elevated for second degree (relative risk = 3.66, p = 0.0076) and third degree (relative risk = 1.81, p = 0.0479) relatives. Conclusions: We analyzed a set of patients with diagnosed rotator cuff disease and a known genealogy to describe the familial clustering of affected individuals. The observations of significant excess relatedness of patients and the significantly elevated risks to both close and distant relatives of patients strongly support a heritable predisposition to rotator cuff disease
OUTCOME OF ROTATOR CUFF REPAIR IN SNYDER TYPE Cl AND C2 LESIONS, CONSIDERING SMOKERS AND NONSMOKERS
Júnior, Sérgio Correa Pinto; Luciano, Lessandro Gesser; Zotto, Crischiman Dal; Vieira, Felipe Fantozzi; Klassen, Ralf; Rodrigues, Airton; Neto, Francisco José dos Santos
Objective: To evaluate the influence of smoking on the results from surgical repair of Snyder type C1 and C2 complete lesions of the rotator cuff. Methods: We evaluated 166 patients who had undergone surgical treatment for Snyder type C1 and C2 complete lesions of the rotator cuff, between June 2002 and December 2006. The inclusion criteria were a minimum follow-up period of 24 months and the absence of previous surgery on the affected shoulder. Patients with other associated injuries were excluded. We evaluated smoking and nonsmoking patients in accordance with the criteria of the World Health Organization (WHO). Female patients (119) predominated over male patients (47), and the mean age was 57 years (38 to 78). Out of the 166 patients evaluated, 21 were classified as smokers and 145 as nonsmokers. The final results were evaluated using the UCLA (University of California at Los Angeles) criteria and statistical analysis was performed using the Epi Info® software. Results: According to the UCLA criteria, smokers had a final average of 32.6 points, while non-smokers had 33.8. Postoperative statistical analysis revealed a difference between the two groups, such that non-smoking patients had a better outcome. Conclusion: Smoking interferes with the final results from repairs of small and medium-sized lesions of the rotator cuff. PMID:27026963
Elevated plasma levels of TIMP-1 in patients with rotator cuff tear
Background and purpose Extracellular matrix remodeling is altered in rotator cuff tears, partly due to altered expression of matrix metalloproteinases (MMPs) and their inhibitors. It is unclear whether this altered expression can be traced as changes in plasma protein levels. We measured the plasma levels of MMPs and their tissue inhibitors (TIMPs) in patients with rotator cuff tears and related changes in the pattern of MMP and TIMP levels to the extent of the rotator cuff tear. Methods Blood samples were collected from 17 patients, median age 61 (39–77) years, with sonographically verified rotator cuff tears (partial- or full-thickness). These were compared with 16 age- and sex-matched control individuals with sonographically intact rotator cuffs. Plasma levels of MMPs and TIMPs were measured simultaneously using Luminex technology and ELISA. Results The plasma levels of TIMP-1 were elevated in patients with rotator cuff tears, especially in those with full-thickness tears. The levels of TIMP-1, TIMP-3, and MMP-9 were higher in patients with full-thickness tears than in those with partial-thickness tears, but only the TIMP-1 levels were significantly different from those in the controls. Interpretation The observed elevation of TIMP-1 in plasma might reflect local pathological processes in or around the rotator cuff, or a genetic predisposition in these patients. That the levels of TIMP-1 and of certain MMPs were found to differ significantly between partial and full-thickness tears may reflect the extent of the lesion or different etiology and pathomechanisms. PMID:23043271
Arthroscopic Management of Full-Thickness Rotator Cuff Tears in Major League Baseball Pitchers: The Lateralized Footprint Repair Technique.
Dines, Joshua S; Jones, Kristofer; Maher, Patrick; Altchek, David
Clinical outcomes of surgical management of full-thickness rotator cuff tears in professional baseball players have been uniformly poor. We conducted a study to investigate return-to-play data and functional performance using a novel arthroscopic repair technique. We hypothesized that arthroscopic rotator cuff repair would result in a high rate of return to professional pitching and favorable functional outcomes. We identified 6 consecutive Major League Baseball (MLB) pitchers who underwent surgical repair of full-thickness rotator cuff injuries using the lateralized footprint repair technique. At most recent follow-up, patients were evaluated to determine their ability to return to athletic activity. Functional outcomes were also assessed using player performance statistics. By mean follow-up of 66.7 months (range, 23.2-94.6 months), 5 (83%) of the 6 pitchers had returned to their preinjury level of competition for at least 1 full season. Despite the high rate of return to MLB play, few pitchers resumed pitching productivity at their preoperative level; mean number of innings pitched decreased from 1806.5 to 183.7. A slight performance reduction was also found in a comparison of preoperative and postoperative pitching statistics. Of note, the return rate was higher for players over age 30 years than for those under 30 years. Overhead athletes require a delicate balance of shoulder mobility and stability to meet functional demands. Anatomical adaptations at the glenohumeral joint should be considered when performing rotator cuff repair in these patients in order to preserve peak functional performance. This novel repair technique affords a high rate of return to MLB play, though elite overhead throwers should be counseled that pitching productivity might decrease after surgery. PMID:26991564
High incidence of acute full-thickness rotator cuff tears
Abu-Zidan, Fikri; Lunsjo, Karl
Background and purpose Epidemiological studies of full-thickness rotator cuff tears (FTRCTs) have mainly investigated degenerative lesions. We estimated the population-based incidence of acute FTRCT using a new diagnostic model. Patients and methods During the period November 2010 through October 2012, we prospectively studied all patients aged 18–75 years with acute onset of pain after shoulder trauma, with limited active abduction, and with normal conventional radiographs. 259 consecutive patients met these inclusion criteria. The patients had a median age of 51 (18–75) years. 65% were males. The patients were divided into 3 groups according to the clinical findings: group I, suspected FTRCT; group II, other specific diagnoses; and group III, sprain. Semi-acute MRI was performed in all patients in group I and in patients in group III who did not recover functionally. Results We identified 60 patients with FTRCTs. The estimated annual incidence of MRI-verified acute FTRCT was 16 (95% CI: 11–23) per 105 inhabitants for the population aged 18–75 years and 25 (CI: 18–36) per 105 inhabitants for the population aged 40–75 years. The prevalence of acute FTRCT in the study group was 60/259 (23%, CI: 18–28). The tears were usually large and affected more than 1 tendon in 36 of these 60 patients. The subscapularis was involved in 38 of the 60 patients. Interpretation Acute FTRCTs are common shoulder injuries, especially in men. They are usually large and often involve the subscapularis tendon. PMID:25708526
Is the Supraspinatus Muscle Atrophy Truly Irreversible after Surgical Repair of Rotator Cuff Tears?
Chung, Seok Won; Kim, Sae Hoon; Tae, Suk-Kee; Yoon, Jong Pil; Choi, Jung-Ah
Background Atrophy of rotator cuff muscles has been considered an irreversible phenomenon. The purpose of this study is to evaluate whether atrophy is truly irreversible after rotator cuff repair. Methods We measured supraspinatus muscle atrophy of 191 patients with full-thickness rotator cuff tears on preoperative magnetic resonance imaging and postoperative multidetector computed tomography images, taken at least 1 year after operation. The occupation ratio was calculated using Photoshop CS3 software. We compared the change between pre- and postoperative occupation ratios after modifying the preoperative occupation ratio. In addition, possible relationship between various clinical factors and the change of atrophy, and between the change of atrophy and cuff integrity after surgical repair were evaluated. Results The mean occupation ratio was significantly increased postoperatively from 0.44 ± 0.17 to 0.52 ± 0.17 (p < 0.001). Among 191 patients, 81 (42.4%) showed improvement of atrophy (more than a 10% increase in occupation ratio) and 33 (17.3%) worsening (more than a 10% decrease). Various clinical factors such as age tear size, or initial degree of atrophy did not affect the change of atrophy. However, the change of atrophy was related to repair integrity: cuff healing failure rate of 48.5% (16 of 33) in worsened atrophy; and 22.2% (18 of 81) in improved atrophy (p = 0.007). Conclusions The supraspinatus muscle atrophy as measured by occupation ratio could be improved postoperatively in case of successful cuff repair. PMID:23467404
Clinical evidence in the treatment of rotator cuff tears with hyaluronic acid
Osti, Leonardo; Buda, Matteo; Buono, Angelo Del; Osti, Raffaella; Massari, Leo
Summary Purpose the aim of this quantitative review is to document potential benefit and adverse effects of hyaluronic acid (HA) injection into the shoulder with rotator cuff tears. Methods a systematic literature search was performed in english PubMed, Medline, Ovid, Google Scholar and Embase databases using the combined key words “hyaluronic acid”, “rotator cuff tear”, “hyaluronate”, “shoulder”, “viscosupplementation”, with no limit regarding the year of publication. Articles were included if they reported data on clinical and functional outcomes, complications in series of patients who had undergone HA injection for management of rotator cuff tears. Two Authors screened the selected articles for title, abstract and full text in accordance with predefined inclusion and exclusion criteria. The papers were accurately analyzed focusing on objective rating scores reported. Results a total of 11 studies, prospective, 7 were randomized were included by full text. A total of 1102 patients were evaluated clinically after different HA injection compare with corticosteroid injection, physically therapies, saline solution injection and control groups. The use of HA in patients with rotator cuff tears improve VAS and functional score in all trials that we have analyzed. Conclusion intra-articular injection with HA is effective in reducing pain and improving function in shoulder with rotator cuff tears and without severe adverse reaction. Level of evidence Level I. PMID:26958534
Clinical and Radiological Evaluation after Arthroscopic Rotator Cuff Repair Using Suture Bridge Technique
Lee, Kwang Won; Bae, Kyoung Wan; Choy, Won Sik
Background We retrospectively assessed the clinical outcomes and investigated risk factors influencing retear after arthroscopic suture bridge repair technique for rotator cuff tear through clinical assessment and magnetic resonance arthrography (MRA). Methods Between January 2008 and April 2011, sixty-two cases of full-thickness rotator cuff tear were treated with arthroscopic suture bridge repair technique and follow-up MRA were performed. The mean age was 56.1 years, and mean follow-up period was 27.4 months. Clinical and functional outcomes were assessed using range of motion, Korean shoulder score, Constant score, and UCLA score. Radiological outcome was evaluated with preoperative and follow-up MRA. Potential predictive factors that influenced cuff retear, such as age, gender, geometric patterns of tear, size of cuff tear, acromioplasty, fatty degeneration, atrophy of cuff muscle, retraction of supraspinatus, involved muscles of cuff and osteolysis around the suture anchor were evaluated. Results Thirty cases (48.4%) revealed retear on MRA. In univariable analysis, retear was significantly more frequent in over 60 years age group (62.5%) than under 60 years age group (39.5%; p = 0.043), and also in medium to large-sized tear than small-sized tear (p = 0.003). There was significant difference in geometric pattern of tear (p = 0.015). In multivariable analysis, only age (p = 0.036) and size of tear (p = 0.030) revealed a significant difference. The mean active range of motion for forward flexion, abduction, external rotation at the side and internal rotation at the side were significantly improved at follow-up (p < 0.05). The mean Korean shoulder score, Constant score, and UCLA score increased significantly at follow-up (p < 0.01). The range of motion, Korean shoulder score, Constant score, and UCLA score did not differ significantly between the groups with retear and intact repairs (p > 0.05). The locations of retear were insertion site in 10 cases (33.3%) and
The response of tenocytes to commercial scaffolds used for rotator cuff repair.
Smith, R D; Carr, A; Dakin, S G; Snelling, S J; Yapp, C; Hakimi, O
Surgical repairs of rotator cuff tears have high re-tear rates and many scaffolds have been developed to augment the repair. Understanding the interaction between patients' cells and scaffolds is important for improving scaffold performance and tendon healing. In this in vitro study, we investigated the response of patient-derived tenocytes to eight different scaffolds. Tested scaffolds included X-Repair, Poly-Tape, LARS Ligament, BioFiber (synthetic scaffolds), BioFiber-CM (biosynthetic scaffold), GraftJacket, Permacol, and Conexa (biological scaffolds). Cell attachment, proliferation, gene expression, and morphology were assessed. After one day, more cells attached to synthetic scaffolds with dense, fine and aligned fibres (X-Repair and Poly-Tape). Despite low initial cell attachment, the human dermal scaffold (GraftJacket) promoted the greatest proliferation of cells over 13 days. Expression of collagen types I and III were upregulated in cells grown on non-cross-linked porcine dermis (Conexa). Interestingly, the ratio of collagen I to collagen III mRNA was lower on all dermal scaffolds compared to synthetic and biosynthetic scaffolds. These findings demonstrate significant differences in the response of patient-derived tendon cells to scaffolds that are routinely used for rotator cuff surgery. Synthetic scaffolds promoted increased cell adhesion and a tendon-like cellular phenotype, while biological scaffolds promoted cell proliferation and expression of collagen genes. However, no single scaffold was superior. Our results may help understand the way that patients' cells interact with scaffolds and guide the development of new scaffolds in the future. PMID:26815643
Do changes in hand grip strength correlate with shoulder rotator cuff function?
Herrington, Lee; Hoyle, Rebecca; Prescott, Evie; Bellamy, Nathan
Background Shoulder pain as a result of rotator cuff pathology is one of the most common musculoskeletal complaints presenting within primary care. Assessment of hand grip strength has been proposed as an indicator of rotator cuff function. This experimental study assessed the relationship between grip strength and shoulder lateral rotator muscle strength in a number of different shoulder positions, aiming to investigate whether such a relationship existed and whether grip strength could be used as a functional assessment tool for the posterior cuff. Methods Twenty-seven healthy, physically active, volunteers (19 males, eight females) with no history of shoulder, upper limb or neck injury comprised the study group. The mean (SD) age was 19.8 (5.7) years (range 18 years to 23 years). Grip strength (measured with hand grip dynamometer) and lateral rotator strength (measured with a hand held dynamometer) was measured at neutral, 90° abduction, and 90° abduction with 90° external rotation. Results The correlation between grip strength and shoulder lateral rotation strength ranged between r = 0.91 (r2 = 0.84) and r = 0.72 (r2 = 0.52) across all positions. Conclusions A strong correlation between grip strength and lateral rotator strength was shown at all positions for both left and right hands, suggesting that assessment of grip strength could be used as a rotator cuff monitor of recruitment function. PMID:27583010
Long-term outcome and structural integrity following open repair of massive rotator cuff tears
Bartl, Christoph; Kouloumentas, Pannos; Holzapfel, Konstantin; Eichhorn, Stefan; Wörtler, Klaus; Imhoff, Andreas; Salzmann, Gian M
Background: Surgical repair of massive rotator cuff tears is associated with less favorable clinical results and a higher retear rate than repair of smaller tears, which is attributed to irreversible degenerative changes of the musculotendinous unit. Materials and Methods: During the study period, 25 consecutive patients with a massive rotator cuff tear were enrolled in the study and the tears were repaired with an open suture anchor repair technique. Preoperative and postoperative clinical assessments were performed with the Constant score, the simple shoulder test (SST) and a pain visual analog scale (VAS). At the final follow-up, rotator cuff strength measurement was evaluated and assessment of tendon integrity, fatty degeneration and muscle atrophy was done using a standardized magnetic resonance imaging protocol. Results: The mean follow-up period was 70 months. The mean constant score improved significantly from 42.3 to 73.1 points at the final follow-up. Both the SST and the pain VAS improved significantly from 5.3 to 10.2 points and from 6.3 to 2.1, respectively. The overall retear rate was 44% after 6 years. Patients with an intact repair had better shoulder scores and rotator cuff strength than those with a failed repair, and also the retear group showed a significant clinical improvement (each P<0.05). Rotator cuff strength in all testing positions was significantly reduced for the operated compared to the contralateral shoulder. Muscle atrophy and fatty infiltration of the rotator cuff muscles did not recover in intact repairs, whereas both parameters progressed in retorn cuffs. Conclusions: Open repair of massive rotator tears achieved high patient satisfaction and a good clinical outcome at the long-term follow-up despite a high retear rate. Also, shoulders with retorn cuffs were significantly improved by the procedure. Muscle atrophy and fatty muscle degeneration could not be reversed after repair and rotator cuff strength still did not equal that of
The Simple Cow Hitch Stitch Technique for Arthroscopic Rotator Cuff Repair and Stabilization Using Knotless Suture Anchors
Hawi, Nael; Krettek, Christian; Hawi, Ahmed; Meller, Rupert
The tissue-suture interface is the most vulnerable and challenging part of adequate restoration and fixation in rotator cuff repair. We describe a simple stitch technique for arthroscopic rotator cuff repair using knotless suture anchors based on the cow hitch. The simple cow hitch stitch technique is easy to perform, especially under difficult conditions, and provides excellent initial fixation strength as required for integration of the reinserted cuff and for shoulder stabilization. PMID:26258030
Simvastatin reduces fibrosis and protects against muscle weakness after massive rotator cuff tear
Davis, Max E; Korn, Michael A; Gumucio, Jonathan P; Harning, Julie A; Saripalli, Anjali L; Bedi, Asheesh; Mendias, Christopher L
Background Chronic rotator cuff tears are a common source of shoulder pain and disability, and patients with chronic cuff tears often have substantial weakness, fibrosis, inflammation and fat accumulation. Identifying therapies to prevent the development of these pathologies will likely have a positive impact on clinical outcomes. Simvastatin is a drug with demonstrated anti-inflammatory and anti-fibrotic effects in many tissues, but had not previously been studied in the context of rotator cuff tears. We hypothesized that following the induction of a massive supraspinatus tear, simvastatin would protect muscles from a loss of force production and fibrosis. Methods We measured changes in muscle fiber contractility, histology and biochemical markers of fibrosis and fatty infiltration in rats that received a full-thickness supraspinatus tear and were treated with either carrier alone or simvastatin. Results Compared to vehicle treated controls, simvastatin did not have an appreciable effect on muscle fiber size, but treatment did increase muscle fiber specific force by 20%. Simvastatin also reduced collagen accumulation by 50%, but did not effect triglyceride content of muscles. Several favorable changes in the expression of genes and other markers of inflammation, fibrosis and regeneration were also observed. Conclusions Simvastatin partially protected muscles from the weakness that occurs as a result of chronic rotator cuff tear. Fibrosis was also markedly reduced in simvastatin treated animals. While further studies are necessary, statin medication could potentially help to improve outcomes for patients with rotator cuff tears. PMID:25213828
Synovial Chondromatosis of the Subacromial Bursa Causing a Bursal-Sided Rotator Cuff Tear
Neumann, Julie A.; Garrigues, Grant E.
Synovial chondromatosis is an uncommon condition, and involvement of the shoulder is even more rare. We report on a 39-year-old female who presented with symptoms, radiographic features, and intraoperative findings consistent with multiple subacromial loose bodies resulting in a partial-thickness, bursal-sided rotator cuff tear of the supraspinatus muscle. She was treated with an arthroscopic removal of loose bodies, complete excision of the subacromial/subdeltoid bursa, acromioplasty, and rotator cuff repair. To our knowledge, this is the first report of arthroscopic treatment for a bursal-sided, partial-thickness rotator cuff tear treated with greater than two-year clinical and radiographic follow-up. We utilized shoulder scores, preoperative and postoperative range of motion, and imaging to assess the results of treatment and surveillance for recurrence in our patient after two-year follow-up. PMID:25861500
Synovial chondromatosis of the subacromial bursa causing a bursal-sided rotator cuff tear.
Neumann, Julie A; Garrigues, Grant E
Correlation between Rotator Cuff Tears and Repeated Subacromial Steroid Injections: A Case-Controlled Study
Bhatia, M; Singh, B; Nicolaou, N; Ravikumar, KJ
INTRODUCTION Concern exists regarding potential damage to the rotator cuff from repeated corticosteroid injections into the subacromial space. PATIENTS AND METHODS In this retrospective, case-controlled study, 230 consecutive patients presenting to three orthopaedic units with subacromial impingement and investigated as an end-point with magnetic resonance imaging (MRI) of the shoulder were divided into groups having received less than three or three or more subacromial injections of corticosteroids. RESULTS With no significant difference in age and sex distribution, analysis by MRI showed no significant difference between the two groups in the incidence of rotator cuff tear (P < 1.0). CONCLUSIONS This suggests that corticosteroid use in patients with subacromial impingement should not be considered a causative factor in rotator cuff tears. PMID:19409148
Rotator cuff biology and biomechanics: a review of normal and pathological conditions.
Huegel, Julianne; Williams, Alexis A; Soslowsky, Louis J
The glenohumeral joint is a complex anatomic structure commonly affected by injury such as tendinopathy and rotator cuff tears. This review presents an up-to-date overview of research on tendon biology and structure, shoulder joint motion and stability, tendon healing, and current and potential future repair strategies. Recent studies have provided information demonstrating the serious impact on uninjured tissues after a rotator cuff tear or other cause of altered shoulder joint mechanics. Another major focus of recent research is biological augmentation of rotator cuff repair with the goal of successfully reinstating normal tendon-to-bone structure. To effectively treat shoulder pathologies, clinicians need to understand normal tendon biology, the healing process and environment, and whole shoulder stability and function. PMID:25475598
Rotator cuff disorders: How to write a surgically relevant magnetic resonance imaging report?
Tawfik, Ahmed M; El-Morsy, Ahmad; Badran, Mohamed Aboelnour
Evaluation of rotator cuff is a common indication for magnetic resonance imaging (MRI) scanning of the shoulder. Conventional MRI is the most commonly used technique, while magnetic resonance (MR) arthrography is reserved for certain cases. Rotator cuff disorders are thought to be caused by a combination of internal and external mechanisms. A well-structured MRI report should comment on the relevant anatomic structures including the acromial type and orientation, the presence of os acromiale, acromio-clavicular degenerative spurs and fluid in the subacromial subdeltoid bursa. In addition, specific injuries of the rotator cuff tendons and the condition of the long head of biceps should be accurately reported. The size and extent of tendon tears, tendon retraction and fatty degeneration or atrophy of the muscles are all essential components of a surgically relevant MRI report. PMID:24976930
[Irreparable rotator cuff tears. Debridement, partial reconstruction, tendon transfer or reversed shoulder arthroplasty].
Patzer, Th; Hufeland, M; Krauspe, R
Therapeutic options for the treatment of irreparable rotator cuff tears are fluent, are dependent on the patients' claims and demands and on the grade of the ongoing cuff tear arthropathy.A partial rotator cuff reconstruction with sufficient tenolysis combined with interval slide techniques to restore the anterior and posterior force couple may be indicated if there is no fatty degeneration > grade 3 of the rotator cuff muscles in a well-centered joint. The margin convergence technique with side-by-side adaptation of the tendon limbs may reduce the load on the reconstructed tendons.The role of the suprascapular nerve, which can probably be constricted by the retracted rotator cuff, and its therapy has not been completely clarified. When distinct symptoms are present neurolysis may be reasonable.Tendon transfers can be indicated in a cooperative patient < 65 years with a higher grade of muscular atrophy but without degenerative changes > grade II according to Hamada with the loss of active external rotation but performable active flexion. For posterosuperior tears the latissimus dorsi or recently the teres major tendon transfer to the rotator cuff footprint may be appropriate. For nonreconstructable anterosuperior tears a partial transfer of the pectoralis major tendon is possible.Careful subacromial debridement combined with biceps tenotomy and a cautious or reversed decompression may reduce the pain temporarily without having an influence on active motion until with the loss of active elevation the indication for a reversed shoulder arthroplasty is reached.In the mean time, absorbable subacromial spacers may re-center the humeral head, but the effectiveness of this therapy on clinical outcome should be analyzed in further studies. PMID:26768144
Predictors of Pain and Function in Patients With Symptomatic, Atraumatic Full-Thickness Rotator Cuff Tears
Harris, Joshua D.; Pedroza, Angela; Jones, Grant L.
Background Although the prevalence of full-thickness rotator cuff tears increases with age, many patients are asymptomatic and may not require surgical repair. The factors associated with pain and loss of function in patients with rotator cuff tears are not well defined. Purpose To determine which factors correlate with pain and loss of function in patients with symptomatic, atraumatic full-thickness rotator cuff tears who are enrolled in a structured physical therapy program. Study Design Cross-sectional study; Level of evidence, 3. Methods A multicenter group enrolled patients with symptomatic, atraumatic rotator cuff tears in a prospective, nonrandomized cohort study evaluating the effects of a structured physical therapy program. Time-zero patient data were reviewed to test which factors correlated with Western Ontario Rotator Cuff (WORC) index and American Shoulder and Elbow Surgeons (ASES) scores. Results A total of 389 patients were enrolled. Mean ASES score was 53.9; mean WORC score was 46.9. The following variables were associated with higher WORC and ASES scores: female sex (P = .001), education level (higher education, higher score; P <.001), active abduction (degrees; P = .021), and strength in forward elevation (P = .002) and abduction (P = .007). The following variables were associated with lower WORC and ASES scores: male sex (P = .001), atrophy of the supraspinatus (P = .04) and infraspinatus (P = .003), and presence of scapulothoracic dyskinesia (P < .001). Tear size was not a significant predictor (WORC) unless comparing isolated supraspinatus tears to supraspinatus, infraspinatus, and subscapularis tears (P = .004). Age, tear retraction, duration of symptoms, and humeral head migration were not statistically significant. Conclusion Nonsurgically modifiable factors, such as scapulothoracic dyskinesia, active abduction, and strength in forward elevation and abduction, were identified that could be addressed nonoperatively with therapy. Therefore
Age-related changes of mitochondrial transcription factor a expression in rotator cuff degeneration
Ichiseki, Toru; Ueda, Shusuke; Ueda, Yoshimichi; Kaneuji, Ayumi; Kawahara, Norio; Matsumoto, Tadami
One cause of rotator cuff tears is thought to be age-related degenerative changes occurring in the rotator cuff. Using Rat rotator cuff we determined age-related changes in mitochondrial transcription factor A (TFAM) expression in rotator cuff degeneration to clarify the presence/absence of mitochondrial stress. The materials used were rotator cuffs (supraspinatus) of 5-, 24-, 48-, and 100-week-old Wistar Rats (five animals each). Histopathological study revealed a 4-layer structure consisting of a bone layer, calcified cartilage layer, non-calcified cartilage layer, and tendinous component), with age-related narrowing of the non-calcified cartilage layer confirmed to be present. In an immunohistochemical TFAM study positive findings of the non-calcified cartilage layer were less prominent in the 100-week-old group. In an Enzyme-Linked Immunosorbent Assay (ELISA) study, these were more prominent in the 5-week-old to 24-week-old groups, and slightly less so in the 48-week-old group as compared to the 24-week-old one. In the 100-week-old group as compared to the 24-week-old one they were significantly less prominent (p<0.05). The non-calcified cartilage layer is a major site for the dispersion of mechanical energy, and the change in TFAM expression noted at the same site in the present study and the results of ELISA suggest that age-related changes in mitochondrial stress may be one cause of rotator cuff degeneration. PMID:26692954
Increased Upper Trapezius Muscle Stiffness in Overhead Athletes with Rotator Cuff Tendinopathy
Leong, Hio Teng; Hug, François; Fu, Siu Ngor
Although excessive tension of the upper trapezius (UT) is thought to contribute to rotator cuff tendinopathy, no study examined UT tension in athletes with and without rotator cuff tendinopathy. Here we used UT shear modulus measured using ultrasound shear wave elastography as an index of muscle stiffness/tension. The aims of this study were twofold: 1) to determine whether the UT muscle shear modulus is altered in athletes with rotator cuff tendinopathy compared to asymptomatic athletes, and 2) to detect optimal cut-off points of UT shear modulus in identifying athletes with rotator cuff tendinopathy. Forty-three male volleyball players (17 asymptomatic and 26 with rotator cuff tendinopathy, mean age = 22.9±3.5 years) participated in the study. UT shear modulus was quantified during active arm holding at 30° and 60° of shoulder abduction and passive arm positioning at 0°, 30° and 60° of shoulder abduction. During the active tasks, the UT shear modulus was higher in athletes with rotator cuff tendinopathy than the asymptomatic athletes (p = 0.002), regardless the arm position. During the passive tasks, athletes with rotator cuff tendinopathy exhibited a higher UT shear modulus than asymptomatic athletes only at 0° of shoulder abduction (13.0±2.5 kPa vs 10.2±1.8 kPa, p = 0.001). When considering the active task, an optimal cut-off shear modulus of 12.0 kPa at 30° of shoulder abduction (sensitivity = 0.84, specificity = 0.57, AUC = 0.757, p = 0.008) and 9.5 kPa at 60° of shoulder abduction (sensitivity = 0.88, specificity = 0.67, AUC = 0.816, p = 0.002) was detected. When considering the passive task at 0° of shoulder abduction, a cut-off of 12.2 kPa was found (sensitivity = 0.73, AUC = 0.817, p = 0.001). Findings from the present study show that monitoring passive and active UT muscle shear modulus may provide important information for the prevention/rehabilitation of rotator cuff tendinopathy. PMID:27159276
Increased Upper Trapezius Muscle Stiffness in Overhead Athletes with Rotator Cuff Tendinopathy.
The Role of the Peripheral and Central Nervous Systems in Rotator Cuff Disease
Bachasson, Damien; Singh, Anshuman; Shah, Sameer; Lane, John G.; Ward, Samuel R.
Rotator cuff (RC) disease is an extremely common condition associated with shoulder pain, reduced functional capacities and impaired quality of life. It primarily involves alterations in tendon health and mechanical properties that can ultimately lead to tendon failure. RC tendon tears induce progressive muscular changes that negatively impact surgical reparability of the RC tendons and clinical outcomes. At the same time, a significant base of clinical data suggests a relatively weak relationship between RC integrity and clinical presentation, emphasizing the multifactorial aspects of RC disease. This review aims to summarize the potential contribution of peripheral, spinal and supraspinal neural factors that may: (i) exacerbate structural and functional muscle changes induced by tendon tear, (ii) compromise the reversal of these changes during surgery and rehabilitation, (iii) contribute to pain generation and persistence of pain, iv) impair shoulder function through reduced proprioception, kinematics and muscle recruitment, and iv) help to explain interindividual differences and response to treatment. Given the current clinical and scientific interest in peripheral nerve injury in the context of RC disease and surgery, we carefully reviewed this body of literature with a particular emphasis for suprascapular neuropathy that has generated a large number of studies in the past decade. Within this process, we highlight the gaps in current knowledge and suggest research avenues for scientists and clinicians. PMID:26189809
Perivascular Stem Cells Diminish Muscle Atrophy and Retain Viability in a Rotator Cuff Tear Model
Eliasberg, Claire; Jensen, Andrew; Dar, Ayelet; Kowalski, Tomasz J.; Murray, Iain; Khan, Adam Z.; Natsuhara, Kyle; Garagozlo, Cameron; McAllister, David R.; Petrigliano, Frank A.
Objectives: Rotator cuff tears (RCTs) are a common cause of shoulder pain and often necessitate surgical repair. Muscle changes including atrophy, fibrosis, and fatty degeneration can develop after RCTs, which may compromise surgical repair and clinical outcomes. Lipoaspirate-derived human perivascular stem cells (PSCs) have demonstrated myogenic and angiogenic potential in other small animal models of muscle injury. We hypothesized that the administration of PSCs following massive RCTs may help to diminish these muscle changes in a small animal model. Methods: A total of 90 immunodeficient mice were used (15 groups, N=6). Each was assigned to one of three surgical groups: i) sham, ii) supraspinatus and infraspinatus tendon transection (TT), or iii) TT and suprascapular nerve denervation (TT+DN). PSCs were harvested from human lipoaspirate and sorted using fluorescence-activated cell sorting into small blood vessel residing pericytes (CD146+ CD34- CD45- CD31-) and large blood perivascular adventitial cells (CD146- CD34+ CD45- CD31-). Mice received either a) no injection, b) saline injection, c) pericyte injection, or d) adventitial cell injection at the time of the index procedure or at two weeks following index surgery. The supraspinatus muscles were harvested six weeks after the index procedure. Muscle atrophy was assessed by measuring percent wet muscle weight change for each sample. Muscle fiber cross-sectional area (CSA), fibrosis, and fatty degeneration were analyzed using Image J™. Additionally, pericytes and adventitial cells were transduced with a luciferase-containing construct. Animals were given injections of luciferin and imaged using IVIS to track in vivo bioluminescence following injections to assess cell viability. Results: Treatment with PSC injection after TT resulted in less wet weight loss and greater muscle fiber CSA than control groups (P<0.05). The TT+DN groups treated with PSC injections two weeks post-op also had less muscle weight loss
Medium- to long-term results of a randomized controlled trial to assess the efficacy of arthoscopic-subacromial decompression versus mini-open repair for the treatment of medium-sized rotator cuff tears
Birch, Ann; Temperley, David; Odak, Saurabh; Walton, Michael J; Haines, John F; Trail, Ian
Background We report on the medium- to long-term results of a randomized controlled trial (RCT) aiming to determine whether rotator cuff repair confers any advantage over arthroscopic sub-acromial decompression (ASAD) alone in the management of medium-sized rotator cuff tears. Methods Ethical approval was sought to follow-up patients previously enrolled in a completed and previously published RCT comparing the outcome of ASAD with mini-open cuff repair for the treatment of rotator cuff tear. Forty-two patients were enrolled in the original study, with a mean of 64 years (range 54 years to 77 years). Results Fifteen of the original 17 patients randomized to ASAD alone and 18 of the original 25 patients randomized to cuff repair were available for follow-up. Each patient underwent American Shoulder and Elbow Surgeons (ASES), Disabilities of the Arm, Shoulder and Hand (DASH) and Constant scoring, and clinical and ultrasound examination. Mean duration of follow-up was 7 years (range 5 years to 11 years). There was no statistically significant difference in terms of ASES, DASH and Constant scores at follow-up between the two groups. Some 33% of patients in the cuff-repair group had a proven re-rupture on ultrasound. This patient subgroup had significantly worse Constant scores compared to patients where the repair remained intact. None of the patients from either group developed cuff-tear arthropathy requiring arthroplasty surgery. Conclusions In this medium- to longer-term study, there is no demonstrable significant benefit of cuff repair over decompression alone for the treatment of medium-sized rotator cuff tears, in terms of ASES, DASH and Constant scores for pain, function and strength modules. The presence of cuff tear does not necessitate surgical repair. This conclusion should drive surgical strategies and shared decision-making between patients and surgeons. PMID:27583006
Clinical Outcomes of Conservative Treatment and Arthroscopic Repair of Rotator Cuff Tears: A Retrospective Observational Study
Lee, Woo Hyung; Do, Hyun Kyung; Lee, Joong Hoon; Kim, Bo Ram; Noh, Jee Hyun; Choi, Soo Hyun; Chung, Sun Gun; Lee, Shi-Uk; Choi, Ji Eun; Kim, Seihee; Kim, Min Jee
Objective To compare the clinical outcomes following conservative treatment and arthroscopic repair in patients with a rotator cuff tear. Methods In this retrospective study, patients aged >50 years with a symptomatic rotator cuff tear were reviewed. The rotator cuff tendons were evaluated using ultrasonography, shoulder magnetic resonance imaging or MR arthrography, and the patients with either a high-grade partial-thickness or small-to-medium-sized (≤3 cm) full-thickness tear were included in this study. The primary outcome measures were a pain assessment score and range of motion (ROM) at 1-year follow-up. The secondary outcomes were the rate of tear progression or retear along with the rate of symptom aggravation after the treatments. Results A total of 357 patients were enrolled, including 183 patients that received conservative treatment and 174 patients who received an arthroscopic repair. The pain assessment score (p<0.001) and the ROM in forward flexion (p<0.001) were significantly improved in both groups. The ROM in internal rotation did not significantly change after conservative treatment and arthroscopic repair. The pain assessment score and ROM were not significantly different between the two groups. Retear was observed in 9.6% of patients who had an arthroscopic repair and tear progression was found in 6.7% of those who underwent conservative treatment. The proportion of aggravation for pain and ROM did not significantly differ between the two groups. Conclusion The effectiveness of conservative treatment is not inferior to arthroscopic repair for patients >50 years old with a less than medium-sized rotator cuff tear in a 1-year follow-up period. Further study is warranted to find the optimal combination of conservative treatment for a symptomatic rotator cuff tear. PMID:27152275
A New Technique for Patch Augmentation of Rotator Cuff Repairs
Mihara, Shuzou; Ono, Teruyasu; Inoue, Hirofumi; Kisimoto, Tetsurou
Massive rotator cuff tears defying primary repair have been treated with debridement, arthroscopic subacromial decompression, partial repair, muscle-tendon transfer, and joint prosthesis, among other techniques. However, the treatment results have not been satisfactory compared with those of small- to medium-sized rotator cuff tears; each procedure has its merits and demerits, and currently, there is no single established method. For massive rotator cuff tears defying primary repair, the arthroscopic patch graft procedure has been reported as an effective surgical procedure, and this procedure is chosen as the first-line treatment in our department. In this procedure, suture anchors are generally used to fix the patch graft to the footprint on the side of the greater tuberosity. However, tendon-to-bone healing is frequently difficult to achieve, and bone-to-bone healing seems more advantageous for the repair of the rotator cuff attachment site. To improve the results of treatment, a new patch graft procedure was developed, in which the iliotibial ligament with bone was collected at Gerdy's tubercle and the bone was anchored to the footprint on the side of the greater tuberosity. With this procedure, excellent results were obtained, although only short-term results are available at present. The technique and its results so far are reported. PMID:25126505
Effect of methylprednisolone use on the rotator cuff in rats: biomechanical and histological study☆
Ghellioni, Gustavo Vinícius; da Silva, Lucas Souto; Piovezan, Anna Paula; Martins, Rafael Olívio
Objective To evaluate the influence of treatment with different doses of methylprednisolone on the mechanical resistance and possible histological alterations of the rotator cuff tendon in rats. Methods Male Wistar rats were divided randomly into four treatment groups: sham, vehicle or 0.6 mg/kg or 6.0 mg/kg of methylprednisolone. Changes to mechanical resistance (in N) and histological parameters (fibrillar appearance, presence of collagen, edema and vascular proliferation) of the rotator cuff tendon were evaluated. The analyses were conducted after administration of one treatment (24 h afterwards), two treatments (7 days afterward) or three treatments (14 days afterwards), into the subacromial space. Results Seven and fourteen days after the treatments were started, it was found that in a dose-dependent manner, methylprednisolone reduced the mechanical resistance of the rotator cuff tendon (p < 0.05 in relation to the vehicle group). Modifications to the histological parameters were observed on the 7th and 14th days after the first infiltration, especially regarding the presence of collagen and vascular proliferation, for the dose of 0.6 mg/kg of methylprednisolone, and also regarding the presence of collagen, edema and vascular proliferation for the dose of 6.0 mg/kg of corticoid. Conclusion The results obtained demonstrated a relationship between methylprednisolone use through infiltration into the subacromial space and reduction of the mechanical resistance of and histological modifications to the rotator cuff tendon in rats. PMID:26229927
Eccentric training as a new approach for rotator cuff tendinopathy: Review and perspectives
Camargo, Paula R; Alburquerque-Sendín, Francisco; Salvini, Tania F
Excessive mechanical loading is considered the major cause of rotator cuff tendinopathy. Although tendon problems are very common, they are not always easy to treat. Eccentric training has been proposed as an effective conservative treatment for the Achilles and patellar tendinopathies, but less evidence exists about its effectiveness for the rotator cuff tendinopathy. The mechanotransduction process associated with an adequate dose of mechanical load might explain the beneficial results of applying the eccentric training to the tendons. An adequate load increases healing and an inadequate (over or underuse) load can deteriorate the tendon structure. Different eccentric training protocols have been used in the few studies conducted for people with rotator cuff tendinopathy. Further, the effects of the eccentric training for rotator cuff tendinopathy were only evaluated on pain, function and strength. Future studies should assess the effects of the eccentric training also on shoulder kinematics and muscle activity. Individualization of the exercise prescription, comprehension and motivation of the patients, and the establishment of specific goals, practice and efforts should all be considered when prescribing the eccentric training. In conclusion, eccentric training should be used aiming improvement of the tendon degeneration, but more evidence is necessary to establish the adequate dose-response and to determine long-term follow-up effects. PMID:25405092
Symptoms of Pain Do Not Correlate with Rotator Cuff Tear Severity
Dunn, Warren R.; Kuhn, John E.; Sanders, Rosemary; An, Qi; Baumgarten, Keith M.; Bishop, Julie Y.; Brophy, Robert H.; Carey, James L.; Holloway, G. Brian; Jones, Grant L.; Ma, C. Benjamin; Marx, Robert G.; McCarty, Eric C.; Poddar, Sourav K.; Smith, Matthew V.; Spencer, Edwin E.; Vidal, Armando F.; Wolf, Brian R.; Wright, Rick W.
Background: For many orthopaedic disorders, symptoms correlate with disease severity. The objective of this study was to determine if pain level is related to the severity of rotator cuff disorders. Methods: A cohort of 393 subjects with an atraumatic symptomatic full-thickness rotator-cuff tear treated with physical therapy was studied. Baseline pretreatment data were used to examine the relationship between the severity of rotator cuff disease and pain. Disease severity was determined by evaluating tear size, retraction, superior humeral head migration, and rotator cuff muscle atrophy. Pain was measured on the 10-point visual analog scale (VAS) in the patient-reported American Shoulder and Elbow Surgeons (ASES) score. A linear multiple regression model was constructed with use of the continuous VAS score as the dependent variable and measures of rotator cuff tear severity and other nonanatomic patient factors as the independent variables. Forty-eight percent of the patients were female, and the median age was sixty-one years. The dominant shoulder was involved in 69% of the patients. The duration of symptoms was less than one month for 8% of the patients, one to three months for 22%, four to six months for 20%, seven to twelve months for 15%, and more than a year for 36%. The tear involved only the supraspinatus in 72% of the patients; the supraspinatus and infraspinatus, with or without the teres minor, in 21%; and only the subscapularis in 7%. Humeral head migration was noted in 16%. Tendon retraction was minimal in 48%, midhumeral in 34%, glenohumeral in 13%, and to the glenoid in 5%. The median baseline VAS pain score was 4.4. Results: Multivariable modeling, controlling for other baseline factors, identified increased comorbidities (p = 0.002), lower education level (p = 0.004), and race (p = 0.041) as the only significant factors associated with pain on presentation. No measure of rotator cuff tear severity correlated with pain (p > 0.25). Conclusions
Ultrasound Dimensions of the Rotator Cuff and Other Associated Structures in Korean Healthy Adults.
Kim, Kyeongwon; Kim, Hong Geum; Song, Daeheon; Yoon, Jung Yoon; Chung, Myung Eun
In evaluating patients complaining of shoulder pain, ultrasonography is an emerging imaging tool due to convenience, low cost, high sensitivity and specificity. However, normative values of ultrasound dimensions of the shoulder to be compared with pathologic findings in Korean adults are not provided yet. We evaluated the ultrasound dimensions of the rotator cuff, long head of biceps tendon, deltoid muscle and acromioclavicular joint in Korean healthy adults. Shoulder ultrasonography was performed on 200 shoulders from 100 healthy adults. The dimensions of the thickness of rotator cuff (supraspinatus, infraspinatus, subscapularis tendon), deltoid muscle, long head of biceps tendon, subacromial subdeltoid bursa, and acromioclavicular joint interval were measured in a standardized manner. Differences in measurements among sex, age, and dominant arms were compared. The thickness of rotator cuff tendons (supraspinatus, infraspinatus, subscapularis) and deltoid muscle were significantly different between men and women. The thickness of subacromial subdeltoid bursa was significantly different between men and women for non-dominant side. In rotator cuff tendon measurements, the differences between dominant and non-dominant shoulders were not significant, which means the asymptomatic contralateral shoulder can be used to estimate the normal reference values. When stratified by age divided by 10 years, the measurements of supraspinatus, subscapularis and deltoid thickness showed tendency of increase with the age. The acromioclavicular joint interval, on the other hand, revealed decreasing tendency. This report suggests normative values of ultrasound dimensions of healthy Korean population with varying age, and can be useful as reference values in evaluating shoulder pathology, especially in rotator cuff tendon pathology. PMID:27510393
Ultrasound for the detection of full-thickness rotator cuff tears: the learning curve for an orthopaedic surgeon using a novel training method
Ibrahim, Edward F; Petrou, Charalambos
Background The present study aims to add to the body of evidence delineating the learning curve for a shoulder surgeon to become proficient in focussed ultrasound for the detection of full-thickness rotator cuff tears, as well as to describe a learning method for this skill. Methods Consecutive patients who were scheduled to undergo an arthroscopy for rotator cuff disease were scanned immediately before surgery by a senior shoulder surgeon with limited previous experience of shoulder ultrasound. The presence or absence of a full-thickness rotator cuff tear on scan was compared with intra-operative findings as the gold standard. Results Two hundred and ten shoulders were scanned over three equal learning periods. Comparing predictive values from the first to the third training period, sensitivity improved from 0.86 to 0.95, specificity from 0.92 to 0.98, negative predictive value from 0.94 to 0.98, and positive predictive value from 0.82 to 0.95. Conclusions The high predictive values obtained in the present study for surgeon-led detection of cuff tears using ultrasound are comparable with those quoted for musculoskeletal radiologists in the literature. The present study adds evidence that a shoulder surgeon can achieve accelerated learning of this skill and offers some potentially time-saving and patient-friendly alternatives to existing guidelines.
Partial rotator cuff injury in athletes: bursal or articular?☆
Carvalho, Cassiano Diniz; Cohen, Carina; Belangero, Paulo Santoro; Figueiredo, Eduardo Antônio; Monteiro, Gustavo Cará; de Castro Pochini, Alberto; Andreoli, Carlos Vicente; Ejnisman, Benno
A painful shoulder is a very common complaint among athletes, especially in the case of those in sports involving throwing. Partial lesions of the rotator cuff may be very painful and cause significant functional limitation to athletes’ sports practice. The incidence of partial lesions of the cuff is variable (13–37%). It is difficult to make the clinical and radiological diagnosis, and this condition should be borne in mind in the cases of all athletes who present symptoms of rotator cuff syndrome, including in patients who are diagnosed only with tendinopathy. Objective To evaluate the epidemiological behavior of partial lesions of the rotator cuff in both amateur and professional athletes in different types of sports. Methods We evaluated 720 medical files on athletes attended at the shoulder service of the Discipline of Sports Medicine at the Sports Traumatology Center, Federal University of São Paulo. The majority of them were men (65%). Among all the patients, 83 of them were diagnosed with partial lesions of the rotator cuff, by means of ultrasonography or magnetic resonance, or in some cases using both. We applied the binomial test to compare the proportions found. Result It was observed that intra-articular lesions predominated (67.6%) and that these occurred more frequently in athletes in sports involving throwing (66%). Bursal lesions occurred in 32.4% of the athletes, predominantly in those who did muscle building (75%). Conclusion Intra-articular lesions are more frequent than bursal lesions and they occur predominantly in athletes in sports involving throwing, while bursal lesions were more prevalent in athletes who did muscle building. PMID:26417568
Single-row vs. double-row arthroscopic rotator cuff repair: clinical and 3 Tesla MR arthrography results
Background Arthroscopic rotator cuff repair has become popular in the last few years because it avoids large skin incisions and deltoid detachment and dysfunction. Earlier arthroscopic single-row (SR) repair methods achieved only partial restoration of the original footprint of the tendons of the rotator cuff, while double-row (DR) repair methods presented many biomechanical advantages and higher rates of tendon-to-bone healing. However, DR repair failed to demonstrate better clinical results than SR repair in clinical trials. MR imaging at 3 Tesla, especially with intra-articular contrast medium (MRA), showed a better diagnostic performance than 1.5 Tesla in the musculoskeletal setting. The objective of this study was to retrospectively evaluate the clinical and 3 Tesla MRA results in two groups of patients operated on for a medium-sized full-thickness rotator cuff tear with two different techniques. Methods The first group consisted of 20 patients operated on with the SR technique; the second group consisted of 20 patients operated on with the DR technique. All patients were evaluated at a minimum of 3 years after surgery. The primary end point was the re-tear rate at 3 Tesla MRA. The secondary end points were the Constant-Murley Scale (CMS), the Simple Shoulder Test (SST) scores, surgical time and implant expense. Results The mean follow-up was 40 months in the SR group and 38.9 months in the DR group. The mean postoperative CMS was 70 in the SR group and 68 in the DR group. The mean SST score was 9.4 in the SR group and 10.1 in the DR group. The re-tear rate was 60% in the SR group and 25% in the DR group. Leakage of the contrast medium was observed in all patients. Conclusions To the best of our knowledge, this is the first report on 3 Tesla MRA in the evaluation of two different techniques of rotator cuff repair. DR repair resulted in a statistically significant lower re-tear rate, with longer surgical time and higher implant expense, despite no
The MRI geyser sign: acromioclavicular joint cysts in the setting of a chronic rotator cuff tear.
Cooper, H John; Milillo, Ralph; Klein, Devon A; DiFelice, Gregory S
We present the case of a 71-year-old man with a large acromioclavicular (AC) joint cyst successfully managed with surgical excision. AC joint cysts are soft tissue masses generally signifying underlying rotator cuff pathology. Traditionally, these cysts were identified with shoulder arthrography as a "geyser" of fluid escaping through the AC joint. Magnetic resonance imaging (MRI) is today's preferred imaging modality; we describe the MRI equivalent of the "geyser sign," signifying synovial fluid escaping through the cuff defect, across the subacromial bursa, and decompressing superiorly through a degenerated AC joint. Surgical management is preferred for symptomatic cysts. Based on a review of limited retrospective case series, recommendations for management of these lesions are as follows. Repair of the rotator cuff is preferable whenever possible. In the case of an irreparable defect, good results can be achieved through excisional AC joint arthroplasty and resection of the cyst base. Aspiration of these cysts should not be attempted, due to the high recurrence rate and potential for a draining sinus. Hemiarthroplasty also may be effective in indirectly decompressing these cysts; but given the invasive nature of this procedure, it should be reserved for patients who are also symptomatic from cuff arthropathy. PMID:21869946
Reverse Shoulder Arthroplasty for Management of Postinfectious Arthropathy With Rotator Cuff Deficiency.
Morris, Brent J; Waggenspack, Wame N; Laughlin, Mitzi S; Elkousy, Hussein A; Gartsman, Gary M; Edwards, T Bradley
Treatment of patients with rotator cuff deficiency and arthritis in the setting of a prior glenohumeral infection (postinfectious arthropathy) is complex, with little evidence to guide treatment. The current authors present their approach to management of these patients and clinical outcomes after reverse shoulder arthroplasty (RSA). All primary RSAs performed for postinfectious arthropathy and rotator cuff deficiency with native glenohumeral joints were identified in a prospective shoulder arthroplasty registry. Eight patients with a minimum of 2-year follow-up were included in the analysis. Clinical outcomes, including the Constant score, the American Shoulder and Elbow Surgeons (ASES) score, the Western Ontario Osteoarthritis Shoulder (WOOS) index, the Single Assessment Numeric Evaluation (SANE) score, and range of motion measurements, were assessed preoperatively and at final follow-up. At an average follow-up of 4.4 years, no patient had a clinically detectable recurrence of infection. Significant improvements were noted in all outcome scores from preoperative evaluation to final follow-up after RSA, including Constant score (P=.003), ASES score (P<.001), WOOS index (P=.002), SANE score (P=.025), forward flexion (P<.001), abduction (P<.001), and external rotation (P=.020). Seven of 8 patients reported they were satisfied or very satisfied at final follow-up. Reverse shoulder arthroplasty can be performed in patients without significant medical comorbidities in the setting of postinfectious arthropathy and rotator cuff deficiency with a low risk of recurrence of infection. Significant clinical improvements were noted at short-term follow-up. PMID:26270757
Effects of therapeutic ultrasound and exercise on pain, function, and isokinetic shoulder rotator strength of patients with rotator cuff disease
Analan, Pınar Doruk; Leblebici, Berrin; Adam, Mehmet
[Purpose] The aim of this prospective, double-blind, randomized, placebo-controlled study was to evaluate the effects of therapeutic continuous ultrasound (US) on patients with rotator cuff disease. [Subjects and Methods] Twenty-two patients were treated with a standard physiotherapy program consisting of a hot-pack, transcutaneous electrical nerve stimulation (TENS), exercises, and US that was supervised by the same physiotherapist. The patients were randomly assigned to either a group that received true US (n=11) or one that received sham US (n=11). [Results] There were significant differences between the pre- and post-intervention UCLA Shoulder Rating Scale and Constant-Murley Shoulder Outcome scores, VAS, and external rotation (ER) peak torque 60°/second values for both the true and sham US groups. However, the between-group differences were not statistically significant. [Conclusion] In patients with rotator cuff disease, physiotherapy interventions effectively treat the pain, improve the clinical status, and increase the muscle strength of the shoulder ER at a low constant angular velocity, with functional improvement being seen immediately after treatment. However, at the end of the intervention, the US had yielded no additional efficacy to the physiotherapy treatment regimen of the patients with rotator cuff disease. PMID:26644656
Arthroscopic Superior Capsular Reconstruction for Treatment of Massive Irreparable Rotator Cuff Tears
Hirahara, Alan M.; Adams, Christopher R.
Massive irreparable rotator cuff tears have been troublesome entities to treat, especially in younger patients. Few good options exist, leaving most patients in recent years receiving a reverse total shoulder arthroplasty. Reverse shoulder arthroplasty carries serious risks, a limited lifespan, and no other viable options should it fail. Recent biomechanical studies have shown that the superior capsule is critical to containing the glenohumeral joint reduced, allowing the larger muscles like the deltoid and pectoralis major to function properly. The superior capsular reconstruction is an anatomic reconstruction of the superior capsule to restore the normal restraint to superior translation that occurs with a deficient rotator cuff. The technique described in this article is an arthroscopic reconstruction of the superior capsule with dermal allograft. PMID:26870638
Comparison of rotator cuff muscle architecture between humans and other selected vertebrate species
Mathewson, Margie A.; Kwan, Alan; Eng, Carolyn M.; Lieber, Richard L.; Ward, Samuel R.
In this study, we compare rotator cuff muscle architecture of typically used animal models with that of humans and quantify the scaling relationships of these muscles across mammals. The four muscles that correspond to the human rotator cuff – supraspinatus, infraspinatus, subscapularis and teres minor – of 10 commonly studied animals were excised and subjected to a series of comparative measurements. When body mass among animals was regressed against physiological cross-sectional area, muscle mass and normalized fiber length, the confidence intervals suggested geometric scaling but did not exclude other scaling relationships. Based on the architectural difference index (ADI), a combined measure of fiber length-to-moment arm ratio, fiber length-to-muscle length ratio and the fraction of the total rotator cuff physiological cross-sectional area contributed by each muscle, chimpanzees were found to be the most similar to humans (ADI=2.15), followed closely by capuchins (ADI=2.16). Interestingly, of the eight non-primates studied, smaller mammals such as mice, rats and dogs were more similar to humans in architectural parameters compared with larger mammals such as sheep, pigs or cows. The force production versus velocity trade-off (indicated by fiber length-to-moment arm ratio) and the excursion ability (indicated by fiber length-to-muscle length ratio) of humans were also most similar to those of primates, followed by the small mammals. Overall, primates provide the best architectural representation of human muscle architecture. However, based on the muscle architectural parameters of non-primates, smaller rather than larger mammals may be better models for studying muscles related to the human rotator cuff. PMID:24072803
Long Head of the Biceps Pathology Combined with Rotator Cuff Tears
Ditsios, Konstantinos; Agathangelidis, Filon; Boutsiadis, Achilleas; Karataglis, Dimitrios; Papadopoulos, Pericles
The long head of the biceps tendon (LHBT) is an anatomic structure commonly involved in painful shoulder conditions as a result of trauma, degeneration, or overuse. Recent studies have pointed out the close correlation between LHBT lesions and rotator cuff (RCT) tears. Clinicians need to take into account the importance of the LHBT in the presence of other shoulder pathologies. This paper provides an up-to-date overview of recent publications on anatomy, pathophysiology, diagnosis, classification, and current treatment strategies. PMID:23209915
Arthroscopic Knotless, Double-Row, Extended Linked Repair for Massive Rotator Cuff Tears.
Greenspoon, Joshua A; Petri, Maximilian; Millett, Peter J
The management of massive rotator cuff tears remains a challenge for physicians, with failure rates being higher when compared with smaller tears. Many surgical treatment options exist including debridement with biceps tenodesis, complete repair, partial repair, repair with augmentation devices, superior capsule reconstruction, tendon transfer, and reverse total shoulder arthroplasty. The purpose of this article is to describe our preferred surgical technique for a complete arthroscopic repair using an extended linked, knotless, double-row construct. PMID:27330944
Surgical treatment of os acromiale with and without associated rotator cuff tears.
Abboud, Joseph A; Silverberg, David; Pepe, Mathew; Beredjiklian, Pedro K; Iannotti, Joseph P; Williams, Gerald R; Ramsey, Matthew L
Nineteen consecutive patients treated surgically for meso-os acromiale and subacromial pathology were reviewed retrospectively, with a mean length of follow-up of 40 months (range, 24-94 months). Of the patients, 11 (58%) were treated with acromioplasty in the presence of a stable os acromiale; 8 patients (42%) underwent open reduction-internal fixation for an unstable and painful os fragment. Of the 19 patients, 8 (42%) with an os acromiale had an associated full-thickness rotator cuff tear. Overall, only 10 of 19 patients (53%) achieved a satisfactory result. All 8 patients (100%) treated with open reduction-internal fixation achieved union of the os fragment, although only 3 (37.5%) achieved a satisfactory result. Of the 11 patients who underwent acromioplasty, only 7 (64%) achieved a satisfactory result. The outcome of surgical management of symptomatic meso-os acromiale with concomitant rotator cuff pathology was satisfactory in 4 of 8 patients in our study group. The rate of satisfactory results was similar in patients with (50%) and without (55%) associated rotator cuff tears. When we analyzed our results to exclude workers' compensation patients, 80% achieved satisfactory results (compared with only 22% in our workers' compensation group). PMID:16679224
Exercise Therapy for Total Tear of Rotator Cuff: A Case Report
Nejati, Parisa; Akbari, Faramarz
Background Shoulder pain is one of the most common problems in ages older than 60 years of age. Rotator cuff pathology is the most common etiology of shoulder pain. Most of rotator cuff pathologies are treated conservatively in old ages and exercise therapy is not an accepted intervention for management of rotator cuff tear yet. Case presentation The case was a man of 53 years age with shoulder pain who had total tear of supraspinatus tendon and biceps tendinitis in the right shoulder. He had regularly gone swimming, mountain climbing and running in the last 10 years. The case was managed by exercise therapy for 3 months and physical modalities for 20 sessions. Shoulder pain and his function and right shoulder range of motion increased after 3 months. Para clinical findings did not change after treatment, though. The improvements continued 15 months after the beginning of the treatment. Conclusion Exercise therapy was very effective for improving pain and function in total tear of supraspinatus tendon and tendinitis of biceps. PMID:24868434
A Canine Non-Weight-Bearing Model with Radial Neurectomy for Rotator Cuff Repair
Ji, Xiaoxi; Bao, Nirong; An, Kai-Nan; Amadio, Peter C.; Steinmann, Scott P.; Zhao, Chunfeng
Background The major concern of using a large animal model to study rotator cuff repair is the high rate of repair retears. The purpose of this study was to test a non-weight-bearing (NWB) canine model for rotator cuff repair research. Methods First, in the in vitro study, 18 shoulders were randomized to 3 groups. 1) Full-width transections repaired with modified Mason-Allen sutures using 3-0 polyglactin suture, 2) Group 1 repaired using number 2 (#2) polyester braid and long-chain polyethylene suture, and 3) Partial-width transections leaving the superior 2 mm infraspinatus tendon intact without repair. In the in vivo study of 6 dogs, the infraspinatus tendon was partially transected as the same as the in vitro group 3. A radial neurectomy was performed to prevent weight bearing. The operated limb was slung in a custom-made jacket for 6 weeks. Results In the in vitro study, mean ultimate tensile load and stiffness in Group 2 were significantly higher than Group 1 and 3 (p<0.05). In the in vivo study, gross inspection and histology showed that the preserved superior 2-mm portion of the infraspinatus tendon remained intact with normal structure. Conclusions Based on the biomechanical and histological findings, this canine NWB model may be an appropriate and useful model for studies of rotator cuff repair. PMID:26107616
Evaluation of muscular activity duration in shoulders with rotator cuff tears using inertial sensors and electromyography.
Duc, Cyntia; Pichonnaz, Claude; Bassin, Jean-Philippe; Farron, Alain; Jolles, Brigitte M; Aminian, Kamiar
Shoulder disorders, including rotator cuff tears, affect the shoulder function and result in adapted muscle activation. Although these adaptations have been studied in controlled conditions, free-living activities have not been investigated. Based on the kinematics measured with inertial sensors and portable electromyography, the objectives of this study were to quantify the duration of the muscular activation in the upper trapezius (UT), medial deltoid (MD) and biceps brachii (BB) during motion and to investigate the effect of rotator cuff tear in laboratory settings and daily conditions. The duration of movements and muscular activations were analysed separately and together using the relative time of activation (T(EMG/mov)). Laboratory measurements showed the parameter's reliability through movement repetitions (ICC > 0.74) and differences in painful shoulders compared with healthy ones (p < 0.05): longer activation for UT; longer activation for MD during abduction and tendency to shorter activation in other movements; shorter activation for BB. In daily conditions, T(EMG/mov) for UT was longer, whereas it was shorter for MD and BB (p < 0.05). Moreover, significant correlations were observed between these parameters and clinical scores. This study thus provides new insights into the rotator cuff tear effect on duration of muscular activation in daily activity. PMID:25390457
In Vivo Measurement of Rotator Cuff Tear Tension: Medial Versus Lateral Footprint Position.
Dierckman, Brian D; Wang, David W; Bahk, Michael S; Burns, Joseph P; Getelman, Mark H
We conducted a study to evaluate in vivo tension applied to the rotator cuff tendon positioned at the medial versus lateral footprint during arthroscopic rotator cuff repair. We evaluated 20 consecutive patients who underwent arthroscopic rotator cuff repair. During repair, a grasper was inserted through a lateral portal, and a digital weigh scale was attached. The tendon was grasped and translated to the medial footprint, and tension recorded. After a relaxation period, the tendon edge was translated to the lateral footprint, and tension recorded. Mean (SD) tension was 0.41 (0.33) pound when tendons were positioned at the medial footprint and 2.21 (1.20) pounds when they were positioned at the lateral footprint, representing a 5.4-fold difference (P < .0001). For smaller tears (≤20 mm anterior-posterior), 7.6 times less tension was applied to the tendons when pulled to the medial versus lateral footprint. For larger tears, 4.1 times less tension was applied to the tendons when pulled to the medial versus lateral footprint. This study demonstrated a significant, 5.4-fold increase in tension when the tendon edge was reduced to the lateral as opposed to the medial footprint in vivo. PMID:26991588
Effects of humeral head compression taping on the isokinetic strength of the shoulder external rotator muscle in patients with rotator cuff tendinitis
Kim, Moon-Hwan; Oh, Jae-Seop
[Purpose] The purpose of this study was to examine the effects of humeral head compression taping (HHCT) on the strength of the shoulder external rotator muscle in patients with rotator cuff tendinitis. [Subjects and Methods] Twenty patients with rotator cuff tendinitis were recruited. The shoulder external rotator strength was measured using a Biodex isokinetic dynamometer system. A paired t-test was performed to evaluate within-group differences in the strength of the shoulder external rotator muscle. [Results] Significantly higher shoulder external rotator peak torque and peak torque per body weight were found in the HHCT condition than in the no-taping condition. [Conclusion] HHCT may effectively increase the shoulder external rotator muscle strength in patients with rotator cuff tendinitis. PMID:25642053
Pectoralis major transfer for the treatment of irreparable anterosuperior rotator cuff tears
Gavriilidis, Iosif; Magosch, Petra; Lichtenberg, Sven; Habermeyer, Peter
The purpose of this study was to evaluate the outcome of subcoracoid pectoralis major transfer for the treatment of irreparable anterosuperior rotator cuff tears. This type of tear involves complete rupture of the subscapularis in combination with either the supraspinatus alone or the supraspinatus and infraspinatus. These ruptures are characterised by a poor quality of the rotator cuff that does not allow for a direct tendon-to-bone reconstruction. Between 2000 and 2006, 15 patients were treated using a deltopectoral approach and transfer of the clavicular part of the pectoralis major to the lesser tuberosity and to the anterior part of the greater tuberosity. After an average follow-up (follow-up rate 100%) of 37 months the average functional rating using the Constant and Murley score (CS) increased from 51.73 ± 16.18 to 68.17 ± 8.84 points (p = 0.005). The mean subcategories of the Constant score for pain (p = 0.005), activities of daily living (p = 0.008) but not for range of motion (p = 0.9), significantly improved. At follow-up 13 patients (87%) were available for magnetic resonance imaging (MRI) of the shoulder. Nine patients (70%) had an intact transferred pectoralis major muscle, two (15%) had one that was thin but intact and two patients a rupture (one complete). Two patients had postoperative haematoma and one patient developed cuff tear arthropathy. The good results confirm that pectoralis major transfer is a reliable treatment option for irreparable anterosuperior rotator cuff injuries with significant improvement in pain and function. PMID:19434410
Clinical and Magnetic Resonance Imaging Results of Arthroscopic Repair of Intratendinous Partial-thickness Rotator Cuff Tears
Xiao, Jian; Cui, Guo-Qing
Background: Partial-thickness rotator cuff tears (PTRCTs) are being diagnosed more often because of high-resolution magnetic resonance imaging (MRI). Compared with articular and bursal side tears, there have been few studies about evaluating the clinical and structural outcomes after intratendinous tear repair. Methods: From 2008 to 2012, 33 consecutive patients with intratendinous PTRCTs underwent arthroscopic repair. All of them were retrospectively evaluated. The University of California at Los Angeles (UCLA) and constant scores were evaluated before operation and at the final follow-up. Postoperative cuff integrity was determined using MRI according to Sugaya's classification. Results: At the 2-year follow-up, the average UCLA score increased from 16.7 ± 1.9 to 32.5 ± 3.5, and the constant score increased from 66.2 ± 10.5 to 92.4 ± 6.9 (P < 0.001). Twenty seven patients received follow-up MRI examinations at an average of 15.2 months after surgery. Of these 27 patients, 22 (81.5%) had a healed tendon, and five patients had partial tears. There was no association between functional and anatomic results. Conclusions: For intratendinous PTRCT, clinical outcomes and tendon healing showed good results at a minimum 2-year after arthroscopic repair. PMID:26021507
Magnetic Resonance Imaging of Rotator Cuff Tears in Shoulder Impingement Syndrome
Freygant, Magdalena; Dziurzyńska-Białek, Ewa; Guz, Wiesław; Samojedny, Antoni; Gołofit, Andrzej; Kostkiewicz, Agnieszka; Terpin, Krzysztof
Summary Background Shoulder joint is a common site of musculoskeletal pain caused, among other things, by rotator cuff tears due to narrowing of subacromial space, acute trauma or chronic shoulder overload. Magnetic resonance imaging (MRI) is an excellent modality for imaging of soft tissues of the shoulder joint considering a possibility of multiplanar image acquisition and non-invasive nature of the study. The aim of this study was to evaluate the prevalence of partial and complete rotator cuff tears in magnetic resonance images of patients with shoulder impingement syndrome and to review the literature on the causes and classification of rotator cuff tears. Material/Methods We retrospectively analyzed the results of 137 shoulder MRI examinations performed in 57 women and 72 men in Magnetic Resonance facility of the Department of Radiology and Diagnostic Imaging at the St. Jadwiga the Queen Regional Hospital No. 2 in Rzeszow between June 2010 and February 2013. Examinations were performed using Philips Achieva 1.5T device, including spin echo and gradient echo sequences with T1-, T2- and PD-weighted as well as fat saturation sequences in transverse, frontal and sagittal oblique planes. Patients were referred from hospital wards as well as from outpatient clinics of the subcarpathian province. Results The most frequently reported injuries included partial supraspinatus tendon tear and complete tearing most commonly involved the supraspinatus muscle tendon. The smallest group comprised patients with complete tear of subscapularis muscle tendon. Among 137 patients in the study population, 129 patients suffered from shoulder pain, including 57 patients who reported a history of trauma. There was 44% women and 56% men in a group of patients with shoulder pain. Posttraumatic shoulder pain was predominantly reported by men, while women comprised a larger group of patients with shoulder pain not preceded by injury. Conclusions Rotator cuff injury is a very common
No difference in long-term development of rotator cuff rupture and muscle volumes in impingement patients with or without decompression.
Ketola, Saara; Lehtinen, Janne; Elo, Petra; Kortelainen, Seppo; Huhtala, Heini; Arnala, Ilkka
Background and purpose - Arthroscopic acromioplasty is still commonly used in the treatment of shoulder impingement syndrome, even though its benefits are questioned; randomized controlled studies have not shown any benefits when compared to non-operative treatment. In this randomized study, we investigated whether operative treatment protects from later rotator cuff rupture and whether it has any effect on the development of rotator cuff muscle volume. Patients and methods - 140 stage-II impingement patients were randomized to a structured exercise group (n = 70) or to an operative group (n = 70). In the operative group, arthroscopic acromioplasty was performed, after which a similar structured exercise program was begun. MRI of the shoulder was done at baseline and at 5 years. Results - There were no statistically significant differences in either the amount of perforating ruptures of the supraspinatus tendon or in the changes in muscle volume at 5 years. The grading of muscle fatty degeneration showed worse results in the operative group, but this difference was not statistically significant. Interpretation - In this study, we found that arthroscopic acromioplasty does not have any long-term benefit based on radiological findings of muscle volumes. Also, the frequency of later rotator cuff rupture was similar irrespective of whether or not surgery was performed. Acromioplasty is not justified as a treatment for dynamic shoulder impingement syndrome. PMID:27348693
Evaluation of functional results from shoulders after arthroscopic repair of complete rotator cuff tears associated with traumatic anterior dislocation
Godinho, Glaydson Gomes; Freitas, José Márcio Alves; de Oliveira França, Flávio; Santos, Flávio Márcio Lago; de Simoni, Leandro Furtado; Godinho, Pedro Couto
Objective To evaluate the clinical outcome of arthroscopic rotator cuff fixation and, when present, simultaneous repair of the Bankart lesion caused by traumatic dislocation; and to assess whether the size of the rotator cuff injury caused by traumatic dislocation has any influence on the postoperative clinical outcomes. Methods Thirty-three patients with traumatic shoulder dislocation and complete rotator cuff injury, with at least two years of follow up, were retrospectively evaluated. For analysis purposes, the patients were divided into groups: presence of fixed Bankart lesion or absence of this lesion, and rotator cuff lesions smaller than 3.0 cm (group A) or greater than or equal to 3.0 cm (group B). All the patients underwent arthroscopic repair of the lesions and were evaluated postoperatively by means of the UCLA (University of California at Los Angeles) score and strength measurements. Results The group with Bankart lesion repair had a postoperative UCLA score of 33.96, while the score of the group without Bankart lesion was 33.7, without statistical significance (p = 0.743). Group A had a postoperative UCLA score of 34.35 and group B, 33.15, without statistical significance (p = 0.416). Conclusion The functional outcomes of the patients who only presented complete rotator cuff tearing after traumatic shoulder dislocation, which underwent arthroscopic repair, were similar to the outcomes of those who presented an associated with a Bankart lesion that was corrected simultaneously with the rotator cuff injury. The extent of the original rotator cuff injury did not alter the functional results in the postoperative evaluation. PMID:27069884
Mini-Open Suture Bridge Repair with Porcine Dermal Patch Augmentation for Massive Rotator Cuff Tear: Surgical Technique and Preliminary Results
Lee, Sung-Moon; Lee, Young-Kuk; Shin, Hong-Kwan
Background The aim of this study was to describe the mini-open suture bridge technique with porcine dermal patch augmentation for massive rotator cuff tear and to assess preliminary clinical and radiological results. Methods Five patients with massive rotator cuff tear for which it was not possible to restore the anatomical footprint underwent mini-open suture bridge repair using a porcine dermal patch. The patients' average age was 53.4 years (range, 45 to 57 years), and the average duration of follow-up was 20.6 months (range, 14 to 26 months). Patients were evaluated with preoperative and postoperative outcome measures, including a visual analog scale (VAS) for pain, the University of California Los Angeles (UCLA) score, and the American Shoulder and Elbow Surgeons (ASES) score. The structural integrity of repaired rotator cuffs was assessed by magnetic resonance imaging 6 months postoperatively. Results The average VAS pain score, UCLA score, and ASES score improved from 6.8, 15.4, and 39.4 preoperatively to 0.8, 31.2, and 86.4 postoperatively (p = 0.041, 0.042, and 0.043, respectively). Magnetic resonance images obtained at an average of 8 months after surgery showed that four patients had intact repair integrity with graft incorporation. One patient had a re-tear with partial healing but still had a satisfactory clinical outcome. There was no intraoperative or postoperative complication in any patient. Conclusions Mini-open suture bridge repair with porcine dermal patch augmentation can be an option in young patients with high physical demands and massive rotator cuff tears for which it is not possible to restore the anatomical footprint. PMID:25177460
Massive rotator cuff tear associated with acute traumatic posterior shoulder dislocation: report of two cases and literature review.
Luenam, Suriya; Kosiyatrakul, Arkaphat
A massive rotator cuff tear in association with acute traumatic posterior glenohumeral dislocation is rare. To our knowledge, only four documented cases have been reported in the literature. We present two additional cases of such injury secondary to the traffic accident. The first patient had an unsuccessful closed reduction due to the posterior instability while the second developed the profound shoulder weakness following the reduction. From the findings of our cases together with the previous reports, every patient had a unique injury mechanism of high-energy directed axial loading on an outstretched, adducted, and internally rotated arm. The glenohumeral capsule and rotator cuff were uniformly avulsed from the humeral attachment, and the supraspinatus and infraspinatus were always involved. However, the clinical presentations were variable based on the severity of the associated rotator cuff tear. The outcomes of operative treatment in this type of injury with the open repair were favorable. PMID:22782426
Initial treatment of complete rotator cuff tear and transition to surgical treatment: systematic review of the evidence
Abdul-Wahab, Taiceer A.; Betancourt, Jean P.; Hassan, Fadi; Thani, Saeed Al.; Choueiri, Hened; Jain, Nitin B.; Malanga, Gerard A.; Murrell, William D.; Prasad, Anil; Verborgt, Olivier
Summary Background rotator cuff tear affects many people. Natural history, and evidence for non-operative treatment remains limited. Our objective is to assess evidence available for the efficacy and morbidity of commonly used systemic medications, physiotherapy, and injections alongside evaluating any negative long-term effects. Methods a systematic search was performed of PubMed, Cochrane, EMBASE and CINAHL dates (1 January 1960 – 1 December 2014), search terms: ‘rotator cuff tear’, ‘natural history’, ‘atraumatic’, ‘injection’, ‘physiotherapy’ or ‘physical therapy’, ‘injection’, ‘corticosteroid’, ‘PRP‘, ‘MSC’, risk of conservative treatment’, and ‘surgical indication’. Results eleven studies were included. The mean Coleman Methodology Score modified for conservative therapy is 69.21 (range 88–44) (SD 12.31). This included 2 RCTs, 7 prospective, and 2 retrospective studies. Evidence suggests it is safe to monitor symptomatic rotator cuff tears, as tear size and symptoms are not correlated with pain, function, and/or ultimate outcome. Conclusions complete rotator cuff tears may be effectively treated with injections, exercise in the short and intermediate terms respectively. Negative effect of corticosteroids on rotator cuff tissue has not been demonstrated. Timing to end conservative treatment is unknown, but likely indicated when a patient demonstrates increased weakness and loss of function not recoverable by physiotherapy. PMID:27331030
Towards predictive diagnosis and management of rotator cuff disease: using curvelet transform for edge detection and segmentation of tissue
Pai Raikar, Vipul; Kwartowitz, David M.
Degradation and injury of the rotator cuff is one of the most common diseases of the shoulder among the general population. In orthopedic injuries, rotator cuff disease is only second to back pain in terms of overall reduced quality of life for patients. Clinically, this disease is managed via pain and activity assessment and diagnostic imaging using ultrasound and MRI. Ultrasound has been shown to have good accuracy for identification and measurement of rotator cuff tears. In our previous work, we have developed novel, real-time techniques to biomechanically assess the condition of the rotator cuff based on Musculoskeletal Ultrasound. Of the rotator cuff tissues, supraspinatus is the first that sees degradation and is the most commonly affected. In our work, one of the challenges lies in effectively segmenting and characterizing the supraspinatus. We are exploring the possibility of using curvelet transform for improving techniques to segment tissue in ultrasound. Curvelets have been shown to give optimal multi-scale representation of edges in images. They are designed to represent edges and singularities along curves in images which makes them an attractive proposition for use in ultrasound segmentation. In this work, we present a novel approach to the possibility of using curvelet transforms for automatic edge and feature extraction for the supraspinatus.
Biological augmentation of rotator cuff repair using bFGF-loaded electrospun poly(lactide-co-glycolide) fibrous membranes.
Zhao, Song; Zhao, Jingwen; Dong, Shikui; Huangfu, Xiaoqiao; Li, Bin; Yang, Huilin; Zhao, Jinzhong; Cui, Wenguo
Clinically, rotator cuff tear (RCT) is among the most common shoulder pathologies. Despite significant advances in surgical techniques, the re-tear rate after rotator cuff (RC) repair remains high. Insufficient healing capacity is likely the main factor for reconstruction failure. This study reports on a basic fibroblast growth factor (bFGF)-loaded electrospun poly(lactide-co-glycolide) (PLGA) fibrous membrane for repairing RCT. Implantable biodegradable bFGF-PLGA fibrous membranes were successfully fabricated using emulsion electrospinning technology and then characterized and evaluated with in vitro and in vivo cell proliferation assays and repairs of rat chronic RCTs. Emulsion electrospinning fabricated ultrafine fibers with a core-sheath structure which secured the bioactivity of bFGF in a sustained manner for 3 weeks. Histological observations showed that electrospun fibrous membranes have excellent biocompatibility and biodegradability. At 2, 4, and 8 weeks after in vivo RCT repair surgery, electrospun fibrous membranes significantly increased the area of glycosaminoglycan staining at the tendon-bone interface compared with the control group, and bFGF-PLGA significantly improved collagen organization, as measured by birefringence under polarized light at the healing enthesis compared with the control and PLGA groups. Biomechanical testing showed that the electrospun fibrous membrane groups had a greater ultimate load-to-failure and stiffness than the control group at 4 and 8 weeks. The bFGF-PLGA membranes had the highest ultimate load-to-failure, stiffness, and stress of the healing enthesis, and their superiority compared to PLGA alone was significant. These results demonstrated that electrospun fibrous membranes aid in cell attachment and proliferation, as well as accelerating tendon-bone remodeling, and bFGF-loaded PLGA fibrous membranes have a more pronounced effect on tendon-bone healing. Therefore, augmentation using bFGF-PLGA electrospun fibrous
Evaluation of the results from arthroscopic surgical treatment of rotator cuff injuries in patients aged 65 years and over☆
Miyazaki, Alberto Naoki; da Silva, Luciana Andrade; Santos, Pedro Doenux; Checchia, Sergio Luiz; Cohen, Carina; Giora, Taís Stedile Busin
Objectives To evaluate the results from arthroscopic surgical treatment of rotator cuff injuries in patients aged 65 years and over. Methods Between 1998 and 2009, 168 patients underwent operations. Five cases were excluded. The remaining 163 patients were stratified according to their age group: 65–69 years (49.1%), 70–74 (26.4%) and 75 years and over (24.5%). Their mean age was 71 years (range: 65–83). There were 63 male patients (38.7%). The mean length of time with pain, from the onset of symptoms to the surgery, was 23 months (range: 2 days to 240 months). Sixty-two patients (38%) reported histories of trauma and 26 (16%) reported that their pain worsened through exertion. Results From the UCLA criteria, 80.4% of the results were excellent, 16% good, 1.8% fair and 1.8% poor. Complications occurred in 11%. The final clinical result did not show any correlation with age progression, injury size or tendons affected. However, there was a significant association (p < 0.001) between the presence of trauma and larger injuries. The length of time between the onset of symptoms and the surgical procedure had a significant relationship (p < 0.027) with the postoperative results: the longer this time was, the worse the results were. Conclusion Arthroscopic treatment of rotator cuff injuries in patients aged 65 years and over presented excellent and good results in 96.4% of the cases, according to the UCLA assessment, with a low complication rate. Advanced age did not show any influence on the postoperative clinical evolution, but the earlier the surgical treatment was instituted, the better the results were. PMID:26229935
Treatment options for irreparable postero-superior cuff tears in young patients
Galasso, Olimpio; Familiari, Filippo; Gasparini, Giorgio
Rotator cuff tears (RCTs) occur more commonly with advanced age, with most rotator cuff abnormalities in patients less than 30 years old being painful tendinoses or partial-thickness RCTs. Irreparable postero-superior cuff tears has been reported as frequent as 7% to 10% in the general population, and the incidence of irreparable RCTs in young patients is still unknown. Several surgical procedures have been proposed for young patients with irreparable postero-superior RCTs, such as rotator cuff debridement, partial rotator cuff repair, biceps tenotomy/tenodesis, rotator cuff grafting, latissimus dorsi tendon transfer, and reverse shoulder arthroplasty. After being thoroughly investigated in open surgery, arthroscopic techniques for latissimus dorsi tendon transfer have been recently described. They have been shown to be an adequate option to open surgery for managing irreparable postero-superior RCTs refractory to conservative management. PMID:26601058
Treatment options for irreparable postero-superior cuff tears in young patients.
PLATELET-RICH PLASMA IN ARTHROSCOPIC REPAIRS OF COMPLETE TEARS OF THE ROTATOR CUFF
Malavolta, Eduardo Angeli; Gracitelli, Mauro Emilio Conforto; Sunada, Edwin Eiji; Benegas, Eduardo; de Santis Prada, Flavia; Neto, Raul Bolliger; Rodrigues, Marcelo Bordalo; Neto, Arnaldo Amado Ferreira; de Camargo, Olavo Pires
Objective: To evaluate shoulder functional results and the retear rate of arthroscopic repair of the rotator cuff augmented with platelet-rich plasma (PRP).Methods: Prospective case series with single-row arthroscopic repair of the rotator cuff augmented with PRP. Only cases of isolated supraspinatus tears with retraction of less than 3 cm were included in this series. The PRP used was obtained by apheresis. It was applied on liquid consistency in its activated form, with the addition of autologous thrombin. Patients were evaluated after 12 months of the surgical procedure. The Constant-Murley, UCLA and VAS scales were used, and the retear rate was assessed using magnetic resonance imaging (MRI). Results: Fourteen patients were evaluated (14 shoulders). The mean Constant-Murley score was 45.64 ± 12.29 before the operation and evolved to 80.78 ± 13.22 after the operation (p < 0.001). The UCLA score increased from 13.78 ± 5.66 to 31.43 ± 3.9 (p < 0.001). The patients’ pain level decreased from a median of 7.5 (p25% = 6, p75% = 8) to 0.5 (p25% = 0, p75% = 3) (p = 0.0013) according to the VAS score. None of the patients presented complete retear. Three patients (21.4%) showed partial retear, without transfixation. Only one patient developed complications (adhesive capsulitis). Conclusion: Patients submitted to arthroscopic rotator cuff repair augmented with PRP showed significant functional improvement and none of them had complete retearing. PMID:27047894
Towards the development of a novel experimental shoulder simulator with rotating scapula and individually controlled muscle forces simulating the rotator cuff.
Baumgartner, Daniel; Tomas, Daniel; Gossweiler, Lukas; Siegl, Walter; Osterhoff, Georg; Heinlein, Bernd
A preclinical analysis of novel implants used in shoulder surgery requires biomechanical testing conditions close to physiology. Existing shoulder experiments may only partially apply multiple cycles to simulate postoperative, repetitive loading tasks. The aim of the present study was therefore the development of an experimental shoulder simulator with rotating scapula able to perform multiple humeral movement cycles by simulating individual muscles attached to the rotator cuff. A free-hanging, metallic humerus pivoted in a polyethylene glenoid is activated by tension forces of linear electroactuators to simulate muscles of the deltoideus (DELT), supraspinatus (SSP), infraspinatus/teres minor and subscapularis. The abductors DELT and SSP apply forces with a ratio of 3:1 up to an abduction angle of 85°. The rotating scapular part driven by a rotative electro actuator provides one-third to the overall arm abduction. Resulting joint forces and moments are measured by a 6-axis load cell. A linear increase in the DELT and SSP motors is shown up to a maximum of 150 and 50 N for the DELT and SSP, respectively. The force vector in the glenoid resulted in 253 N at the maximum abduction. The present investigation shows the contribution of individual muscle forces attached to the moving humerus to perform active abduction in order to reproducibly test shoulder implants. PMID:24170552
Deltoid muscle shape analysis with magnetic resonance imaging in patients with chronic rotator cuff tears
Background It seems appropriate to assume, that for a full and strong global shoulder function a normally innervated and active deltoid muscle is indispensable. We set out to analyse the size and shape of the deltoid muscle on MR-arthrographies, and analyse its influence on shoulder function and its adaption (i.e. atrophy) for reduced shoulder function. Methods The fatty infiltration (Goutallier stages), atrophy (tangent sign) and selective myotendinous retraction of the rotator cuff, as well as the thickness and the area of seven anatomically defined segments of the deltoid muscle were measured on MR-arthrographies and correlated with shoulder function (i.e. active abduction). Included were 116 patients, suffering of a rotator cuff tear with shoulder mobility ranging from pseudoparalysis to free mobility. Kolmogorov-Smirnov test was used to determine the distribution of the data before either Spearman or Pearson correlation and a multiple regression was applied to reveal the correlations. Results Our developed method for measuring deltoid area and thickness showed to be reproducible with excellent interobserver correlations (r = 0.814–0.982). The analysis of influencing factors on active abduction revealed a weak influence of the amount of SSP tendon (r = −0.25; p < 0.01) and muscle retraction (r = −0.27; p < 0.01) as well as the stage of fatty muscle infiltration (GFDI: r = −0.36; p < 0.01). Unexpectedly however, we were unable to detect a relation of the deltoid muscle shape with the degree of active glenohumeral abduction. Furthermore, long-standing rotator cuff tears did not appear to influence the deltoid shape, i.e. did not lead to muscle atrophy. Conclusions Our data support that in chronic rotator cuff tears, there seems to be no disadvantage to exhausting conservative treatment and to delay implantation of reverse total shoulder arthroplasty, as the shape of deltoid muscle seems only to be influenced by natural aging
Effect of Angiogenesis-Related Cytokines on Rotator Cuff Disease: The Search for Sensitive Biomarkers of Early Tendon Degeneration
Savitskaya, Yulia A.; Izaguirre, Aldo; Sierra, Luis; Perez, Francisco; Cruz, Francisco; Villalobos, Enrique; Almazan, Arturo; Ibarra, Clemente
Background: Hallmarks of the pathogenesis of rotator cuff disease (RCD) include an abnormal immune response, angiogenesis, and altered variables of vascularity. Degenerative changes enhance production of pro-inflammatory, anti-inflammatory, and vascular angiogenesis-related cytokines (ARC) that play a pivotal role in the immune response to arthroscopic surgery and participate in the pathogenesis of RCD. The purpose of this study was to evaluate the ARC profile, ie, interleukin (IL): IL-1β, IL-6, IL-8, IL-10, vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and angiogenin (ANG), in human peripheral blood serum and correlate this with early degenerative changes in patients with RCD. Methods: Blood specimens were obtained from 200 patients with RCD and 200 patients seen in the orthopedic clinic for nonrotator cuff disorders. Angiogenesis imaging assays was performed using power Doppler ultrasound to evaluate variables of vascularity in the rotator cuff tendons. Expression of ARC was measured by commercial Bio-Plex Precision Pro Human Cytokine Assays. Results: Baseline concentrations of IL-1β, IL-8, and VEGF was significantly higher in RCD patients than in controls. Significantly higher serum VEGF levels were found in 85% of patients with RCD, and correlated with advanced stage of disease (r = 0.75; P < 0.0005), average microvascular density (r = 0.68, P < 0.005), and visual analog score (r = 0.75, P < 0.0002) in RCD patients. ANG and IL-10 levels were significantly lower in RCD patients versus controls. IL-1β and ANG levels were significantly correlated with degenerative tendon grade in RCD patients. No difference in IL-6 and bFGF levels was observed between RCD patients and controls. Patients with degenerative changes had markedly lower ANG levels compared with controls. Power Doppler ultrasound showed high blood vessel density in patients with tendon rupture. Conclusion: The pathogenesis of RCD is associated with an imbalance
Arthroscopic Changes of the Biceps Pulley in Rotator Cuff Tear and Its Clinical Significance in Relation to Treatment
Choi, Chang Hyuk; Kim, Se Sik; Lee, Ju Hwan
Background In the case of rotator cuff tears, the biceps pulley can be stressed by the unstable biceps tendon, and this can subsequently affect the stability of the subscapularis tendon. Therefore, it is important to distinguish between normal variations and lesions of the biceps pulley that affect anterosuperior lesions in cases of rotator cuff tears. Methods From January 2002 through November 2010, we observed biceps pulley and associated anterosuperior lesions in 589 of 634 cases (93%) of arthroscopic rotator cuff repair, including 72 cases (12.2%) of small tears, 219 cases (37.2%) of medium tears, 134 cases (22.8%) of large tears, and 164 cases (27.8%) of massive tears. We classified normal stretched biceps pulleys as type I, stretched biceps pulleys with mild changes as type II, those with a partial tear as type III, and torn pulleys as type IV. Results We were able to classify 589 cases of biceps pulleys as type I, II, III, or IV associated lesions in rotator cuff tears. Type I was seen in 91 cases (15.4%), type II in 216 cases (36.7%), type III in 157 cases (26.7%), and type IV in 101 cases (17.1%); unidentified cases numbered 24 (4.1%). Nearly three-quarters, 73.3%, of the cases (432/589) had associated anterosuperior lesions, and combined treatment for the associated lesions was administered in 29.2% (172/589) of cases. Conclusions Biceps pulley lesions with more than partial tears were identified in 48% of rotator cuff tear cases. The incidence and severity of pulley lesions were related to the rotator cuff tear size, the status of the long head of the biceps tendon and subscapularis tendon lesion, and the treatment methods. PMID:26330960
EVALUATION OF THE RESULTS FROM ARTHROSCOPIC REPAIR ON ROTATOR CUFF INJURIES AMONG PATIENTS UNDER 50 YEARS OF AGE
Miyazaki, Alberto Naoki; Fregoneze, Marcelo; Santos, Pedro Doneux; da Silva, Luciana Andrade; do Val Sella, Guilherme; Santos, Ruy Mesquita Maranhão; de Souza, Adriano; Checchia, Sérgio Luiz
Objective: To assess the results from arthroscopic surgical treatment of rotator cuff injuries among patients under 50 years of age. Methods: Sixty-three patients with rotator cuff injuries who underwent arthroscopic surgical treatment performed by the Shoulder and Elbow Group of the Department of Orthopedics and Traumatology, in the Fernandinho Simonsen wing of Santa Casa Medical School, São Paulo, between August 1998 and December 2007, were reassessed. The study included all patients with rotator cuff injuries who were under 50 years of age and had been followed up postoperatively for at least 24 months. Results: According to the UCLA evaluation criteria, 59 patients (92%) showed excellent and good results; five (8%) showed fair results; and none showed poor results. The postoperative evaluation showed that the mean range of motion was 145° for elevation, 47° for lateral rotation and T10 for medial rotation. Unsatisfactory results were associated with prolonged duration of the injury, with a statistically significant relationship. Conclusion: Arthroscopic repair of rotator cuff injuries in young patients produces excellent or good results for most patients. PMID:27047819
MRI-Arthroscopic Correlation in Rotator Cuff Tendon Pathologies; A Comparison between Various Centers
Sefidbakht, Sepideh; Momenzadeh, Omid Reza; Dehghani, Sakineh; Gerami, Hadi
Background: Magnetic resonance imaging (MRI) has long been considered a perfect imaging study for evaluation of shoulder pathologies despite occasional discrepancies between MR reports and arthroscopic findings. In this study we aim to evaluate impact of imaging center as an indicator of image quality on accuracy of MRI reports in diagnosis of rotator cuff tendon pathologies. Methods: We reviewed MR reports of 64 patients who underwent arthroscopy in university center hospital. MRIs were done in various centers including both university-affiliated and out-centers. All studies were reported by two radiologists in consensus unaware of the arthroscopic results or previous reports. An inter-observer agreement analysis using the kappa statistics was performed to determine consistency among imaging and surgical reports. Results: Kappa values for out-centers were as follows: 0.785 for biceps, 0.469 for suscapularis, 0.846 for supraspinatus and 0.785 for infraspinatus tendons. In university centers values were 0.799 for biceps, 0.802 for suscapularis, 0.789 for supraspinatus and 0.770 for infraspinatus tendons. Conclusion: Image reporting in university centers with proficient sequences increased accuracy of diagnosis in 3/4 of evaluated features and showed subtle decreased inter-observer agreement in 1/4 of features. Uniformity of the scanners and protocols as well as evaluation on a workstation rather than hard copies cumulatively resulted in a meaningful increase in the accuracy of the same radiologists in diagnosis of rotator cuff tendon tear. PMID:27200392
Stem cell therapy in the management of shoulder rotator cuff disorders
Mora, Maria Valencia; Ibán, Miguel A Ruiz; Heredia, Jorge Díaz; Laakso, Raul Barco; Cuéllar, Ricardo; Arranz, Mariano García
Rotator cuff tears are frequent shoulder problems that are usually dealt with surgical repair. Despite improved surgical techniques, the tendon-to-bone healing rate is unsatisfactory due to difficulties in restoring the delicate transitional tissue between bone and tendon. It is essential to understand the molecular mechanisms that determine this failure. The study of the molecular environment during embryogenesis and during normal healing after injury is key in devising strategies to get a successful repair. Mesenchymal stem cells (MSC) can differentiate into different mesodermal tissues and have a strong paracrine, anti-inflammatory, immunoregulatory and angiogenic potential. Stem cell therapy is thus a potentially effective therapy to enhance rotator cuff healing. Promising results have been reported with the use of autologous MSC of different origins in animal studies: they have shown to have better healing properties, increasing the amount of fibrocartilage formation and improving the orientation of fibrocartilage fibers with less immunologic response and reduced lymphocyte infiltration. All these changes lead to an increase in biomechanical strength. However, animal research is still inconclusive and more experimental studies are needed before human application. Future directions include expanded stem cell therapy in combination with growth factors or different scaffolds as well as new stem cell types and gene therapy. PMID:26029341
The efficacy of therapeutic ultrasound for rotator cuff tendinopathy: A systematic review and meta-analysis.
Desmeules, François; Boudreault, Jennifer; Roy, Jean-Sébastien; Dionne, Clermont; Frémont, Pierre; MacDermid, Joy C
A systematic review and meta-analysis on the efficacy of therapeutic ultrasound (US) in adults suffering from rotator cuff tendinopathy. A literature search was conducted in four databases for randomized controlled trials (RCT) published until 12/2013, comparing the efficacy of US to any other interventions in adults suffering from rotator cuff tendinopathy. The Cochrane Risk of Bias tool was used to evaluate the risk of bias of included studies. Data were summarized qualitatively or quantitatively. Eleven RCTs with a low mean methodological score (50.0% ± 15.6%) were included. Therapeutic US did not provide greater benefits than a placebo intervention or advice in terms of pain reduction and functional improvement. When provided in conjunction with exercise, US therapy is not superior to exercise alone in terms of pain reduction and functional improvement (pooled mean difference of the Constant-Murley score: -0.26 with 95% confidence interval of -3.84 to 3.32). Laser therapy was found superior to therapeutic US in terms of pain reduction. Based on low to moderate level evidence, therapeutic US does not provide any benefit compared to a placebo or advice, to laser therapy or when combined to exercise. More methodologically sound studies on the efficacy of therapeutic US are warranted. PMID:25824429
Computer-Aided Diagnosis of Different Rotator Cuff Lesions Using Shoulder Musculoskeletal Ultrasound.
Chang, Ruey-Feng; Lee, Chung-Chien; Lo, Chung-Ming
The lifetime prevalence of shoulder pain approaches 70%, which is mostly attributable to rotator cuff lesions such as inflammation, calcific tendinitis and tears. On clinical examination, shoulder ultrasound is recommended for the detection of lesions. However, there exists inter-operator variability in diagnostic accuracy because of differences in the experience and expertise of operators. In this study, a computer-aided diagnosis (CAD) system was developed to assist ultrasound operators in diagnosing rotator cuff lesions and to improve the practicality of ultrasound examination. The collected cases included 43 cases of inflammation, 30 cases of calcific tendinitis and 26 tears. For each case, the lesion area and texture features were extracted from the entire lesions and combined in a multinomial logistic regression classifier for lesion classification. The proposed CAD achieved an accuracy of 87.9%. The individual accuracy of this CAD system was 88.4% for inflammation, 83.3% for calcific tendinitis and 92.3% for tears. Cohen's k was 0.798. On the basis of its diagnostic performance, clinical use of this CAD technique has promise. PMID:27381057
Antioxidant's cytoprotective effects on rotator cuff tenofibroblasts exposed to aminoamide local anesthetics.
Kim, Ra Jeong; Hah, Young-Sool; Kang, Jae-Ran; Park, Hyung Bin
Local anesthetics (LA) are among the drugs most frequently used for musculoskeletal problems, in procedures ranging from diagnosis to postoperative pain control. The cytotoxicity of LA is an emerging area of concern. The purpose of this study was to determine whether cyanidin, an antioxidant, exerts cytoprotective effects against tenofibroblast death induced by LA. Primary cultured human rotator cuff tenofibroblasts were used to evaluate the cytotoxicity of these LA: Ropivacaine (0.075%), Bupivacaine (0.05%), and Lidocaine (0.2%). The effects of cyanidin (100 μg/ml) on the cytotoxicity induced by these LA were investigated. Cell viability, ROS production, caspase-3/7 activity, and expressions of phospho-extracellular signal-regulated kinases (ERK), phospho-p38, phospho-c-Jun N-terminal kinase (JNK), and cleaved PARP-1 were evaluated. Exposure to LA significantly induced cell death (p < 0.001), ROS production (p ≤ 0.04), the activation of caspase-3/7 (p < 0.001), and the increased expressions of phospho-ERK, phospho-p38, phospho-JNK, and cleaved PARP-1. These LA-induced cytotoxic effects were reduced by cyanidin. These data indicate that cyanidin, an antioxidant, has cytoprotective effects against LA-induced cytotoxicity to rotator cuff tenofibroblasts. PMID:25639557
Effects of Preoperative Non-Steroidal Anti-Inflammatory Drugs on Pain Mitigation and Patients' Shoulder Performance Following Rotator Cuff Repair
Rouhani, Alireza; Tabrizi, Ali; Elmi, Asghar; Abedini, Naghi; Mirza Tolouei, Fardin
Purpose: Pain is one of the most important factors adversely affecting clinical outcomes of operated patients. The present study aims at evaluating effects of preoperative COX2 non-steroidal anti-inflammatory inhibitors on pain mitigation and performance of patients with shoulder rotator cuff tear. Methods: This case-control study was conducted on 60 patients suffering from rotator cuff injury candidate for arthroscopic repair. The patients were classified in two parallel and matched groups. One group (case group) was treated using Celecoxib (200mg/12h) started 48 hours before surgery and continued for 10 days after operation. In the control group, the placebo was prescribed in the same way. Postoperative pain, side effects, sleep disturbance, and short-term outcomes were compared between two groups using DASH questionnaire. Results: Postoperative pain in the Celecoxib group significantly decreased in comparison with the control one. The difference was statistically meaningful (P<0.001). Well motion ability was seen in 80% of patients of the Celecoxib group. It was 26.6% in the placebo group since pain inhibited them from exercising more motions. In this regard, there was a statistically meaningful difference between these two groups (P=0.02). Sleep disturbance was meaningfully at higher levels in the placebo group (P=0.001). Following up the patients for three months, it was made clear that performance of the Celecoxib group was better than that of the placebo one. Conclusion: COX2 inhibitors are well efficient in patients' pain management after arthroscopic rotator cuff repair surgery. It results in less life complications, less sleep disturbances, improvement of patients' short-term clinical outcome, and more quick recovery. PMID:25436192
Patient Reported Outcomes for Rotator Cuff Disease - Which PRO Should You Use?
Makhni, Eric Chugh; Hamamoto, Jason Taizo; Higgins, John; Patterson, Taylor; Romeo, Anthony A.; Verma, Nikhil N.
Objectives: Patient reported outcomes (PRO) are important clinical and research tools that are utilized by orthopedic surgeons in order to assess health outcomes following treatment. This is particularly so in the setting of rotator cuff pathology, in which several different validated patient reported outcomes exist. However, multiple recent studies have demonstrated a lack of standardization in the utilization of these scores. Moreover, many of these scores contain numerous components, thereby making them difficult to administer in a busy ambulatory setting. The goal of this study was to quantitatively assess the commonly used PRO for rotator cuff disease in order to identify the most efficient and comprehensive ones available for clinicians. Methods: Fifteen different PROs commonly used for rotator cuff pathology were selected for review. These outcome tools were assessed by the study team and reviewed for comprehensiveness with regards to assessment of pain, strength, activity, motion, and quality of life. The comprehensiveness and efficiency of each tool was evaluated by inclusion of questions addressing each domain. PROs were also evaluated with a focus of pain criteria (night pain, baseline/general pain, pain during activities of daily living, pain during sport, and pain during work). Finally, all PROs were assessed with regards to comprehensiveness in assessing activity scores (motion/stiffness, activities of daily living, sport, and work). Comprehensiveness scores were calculated by dividing the number of domains or subdomains present by the total domains or subdomains possible. Efficiency was calculated by dividing the number of domains present by the number of questions contained in each PRO. Results: The UCLA, Western Ontario Rotator Cuff Index (WORC), Disabilities of the Arm, Shoulder, and Hand (DASH), PENN, Shoulder Rating Questionnaire (SRQ), and Korean Shoulder Score (KSS) had an overall comprehensiveness score of 1.00 indicating all domains were
Systematic Review of All-Arthroscopic Versus Mini-Open Repair of Rotator Cuff Tears: A Meta-Analysis
Huang, Rongzhong; Wang, Sanrong; Wang, Yule; Qin, Xiaoxia; Sun, Yang
The objective of this study was to compare outcomes in patients with rotator cuff tears undergoing all-arthroscopic versus mini-open rotator cuff repair. A systematic review and meta-analysis of outcomes of all-arthroscopic repair versus mini-open repair in patients with rotator cuff repair was conducted. Studies meeting the inclusion criteria were screened and included from systematic literature search for electronic databases including Medline, Embase, Cochrane CENTRAL, and CINAHL library was conducted from 1969 and 2015. A total of 18 comparative studies including 4 randomized clinical trials (RCTs) were included. Pooled results indicate that there was no difference in the functional outcomes, range of motion, visual analog scale (VAS) score, and short-form 36 (SF-36) subscales. However, Constant-Murley functional score was found to be significantly better in patients with mini-open repair. However, the results of the review should be interpreted with caution due to small size and small number of studies contributing to analysis in some of the outcomes. All-arthroscopic and mini-open repair surgical techniques for the management of rotator cuff repair are associated with similar outcomes and can be used interchangeably based on the patient and rotator tear characteristics. PMID:26947557
Quantitative Assessment of Fat Infiltration in the Rotator Cuff Muscles using water-fat MRI
Nardo, Lorenzo; Karampinos, Dimitrios C.; Lansdown, Drew A.; Carballido-Gamio, Julio; Lee, Sonia; Maroldi, Roberto; Ma, C. Benjamin; Link, Thomas M.; Krug, Roland
Purpose To evaluate a chemical shift-based fat quantification technique in the rotator cuff muscles in comparison with the semi-quantitative Goutallier fat infiltration classification (GC) and to assess their relationship with clinical parameters. Materials and Methods The shoulders of 57 patients were imaged using a 3T MR scanner. The rotator cuff muscles were assessed for fat infiltration using GC by two radiologists and an orthopedic surgeon. Sequences included oblique-sagittal T1-, T2- and proton density-weighted fast spin echo, and six-echo gradient echo. The iterative decomposition of water and fat with echo asymmetry and least-squares estimation (IDEAL) was used to measure fat fraction. Pain and range of motion of the shoulder were recorded. Results Fat fraction values were significantly correlated with GC grades (p< 0.0001, kappa>0.9) showing consistent increase with GC grades (grade=0, 0%–5.59%; grade=1, 1.1%–9.70%; grade=2, 6.44%–14.86%; grade=3, 15.25%–17.77%; grade=4, 19.85%–29.63%). A significant correlation between fat infiltration of the subscapularis muscle quantified with IDEAL versus a) deficit in internal rotation (Spearman Rank Correlation Coefficient=0.39, 95% CI 0.13–0.60, p<0.01) and b) pain (Spearman Rank Correlation coefficient=0.313, 95% CI 0.049–0.536, p=0.02) was found but was not seen between the clinical parameters and GC grades. Additionally, only quantitative fat infiltration measures of the supraspinatus muscle were significantly correlated with a deficit in abduction (Spearman Rank Correlation Coefficient=0.45, 95% CI 0.20–0.60, p<0.01). Conclusion We concluded that an accurate and highly reproducible fat quantification in the rotator cuff muscles using water-fat MRI techniques is possible and significantly correlates with shoulder pain and range of motion. PMID:24115490
The American Society of Shoulder and Elbow Therapists' consensus statement on rehabilitation following arthroscopic rotator cuff repair.
Thigpen, Charles A; Shaffer, Michael A; Gaunt, Bryce W; Leggin, Brian G; Williams, Gerald R; Wilcox, Reg B
This is a consensus statement on rehabilitation developed by the American Society of Shoulder and Elbow Therapists. The purpose of this statement is to aid clinical decision making during the rehabilitation of patients after arthroscopic rotator cuff repair. The overarching philosophy of rehabilitation is centered on the principle of the gradual application of controlled stresses to the healing rotator cuff repair with consideration of rotator cuff tear size, tissue quality, and patient variables. This statement describes a rehabilitation framework that includes a 2-week period of strict immobilization and a staged introduction of protected, passive range of motion during weeks 2-6 postoperatively, followed by restoration of active range of motion, and then progressive strengthening beginning at postoperative week 12. When appropriate, rehabilitation continues with a functional progression for return to athletic or demanding work activities. This document represents the first consensus rehabilitation statement developed by a multidisciplinary society of international rehabilitation professionals specifically for the postoperative care of patients after arthroscopic rotator cuff repair. PMID:26995456
Are the good functional results from arthroscopic repair of massive rotator cuff injuries maintained over the long term?☆
Miyazaki, Alberto Naoki; Santos, Pedro Doneux; da Silva, Luciana Andrade; do Val Sella, Guilherme; Checchia, Sérgio Luiz; Yonamine, Alexandre Maris
Objective To evaluate whether the good and excellent functional results from arthroscopic repair of massive rotator cuff tears are maintained over the long term. Methods From the sample of the study conducted by our group in 2006, in which we evaluated the functional results from arthroscopic repair of massive rotator cuff tears, 35 patients were reassessed, 8 years after the first evaluation. The inclusion criteria were that these patients with massive rotator cuff tears operated by means of an arthroscopic technique, who participated in the previous study and achieved good or excellent outcomes according to the UCLA criteria. Patients whose results were not good or excellent in the first evaluation according to the UCLA criteria were excluded. Results Among the 35 patients reassessed, 91% of them continued to present good and excellent results (40% excellent and 51% good), while 3% presented fair results and 6% poor results. The time interval between the first and second evaluations was 8 years and the minimum length of follow-up since the immediate postoperative period was 9 years (range: 9–17 years), with an average of 11.4 years. Conclusion The good and excellent results from arthroscopic repair of massive rotator cuff tears were mostly maintained (91%), with the same level of function and satisfaction, even though 8 years had passed since the first assessment, with a follow-up period averaging 11.4 years. PMID:26962491
Effect of Bone Mineral Density on Rotator Cuff Tear: An Osteoporotic Rabbit Model
Chen, Xiaobin; Giambini, Hugo; Ben-Abraham, Ephraim; An, Kai-Nan; Nassr, Ahmad; Zhao, Chunfeng
Introduction An increased bone mineral density (BMD) in the proximity to tendon insertion can improve rotator cuff repair and healing. However, how a decrease of BMD in the humeral head affects the biomechanical properties of the rotator cuff tendon is still unclear. Previous studies have demonstrated ovariectomy in animals to lead to osteoporosis and decreased BMD, and Teriparatide (PTH) administration to improve BMD and strength of bone. This study aimed to explore the correlation between humeral head BMD and infraspinatus (ISP) tendon insertion strength, and if an increase in bone quantity of the humeral head can improve the strength of the rotator cuff. Materials and Methods Eighteen New England white rabbits were divided into the 3 groups: Control, Ovariectomy-Saline (OVX-Saline), and Ovariectomy-PTH (OVX-PTH). The OVX-Saline group and the OVX-PTH were administered daily saline and Teriparatide injections for 8 weeks starting at 17 weeks of OVX. BMD of the humeral head was measured, the ISP tendon failure load was tested and the failure stress was calculated. One specimen from each group was used for histological analysis. Linear regression analysis was used to derive equations for the BMD and failure stress. Results Significant differences were observed in the measured humeral head BMD of the Control and OVX-PTH groups compared to the OVX-Saline group (P = 0.0004 and P = 0.0024, respectively). No significant difference was found in failure stress among the three groups, but an expected trend with the control group and OVX-PTH group presenting higher failure strength compared to the OVX-Saline group. BMD at the humeral head showed a positive linear correlation with stress (r2 = 0.54). Histology results showed the superiority in OVX-PTH group ISP enthesis compared to the OVX-Saline group. Conclusion Bone loss of the humeral head leads to decreased tendon/bone insertion strength of the infraspinatus tendon enthesis. Teriparatide administration can increase bone
Reliability of Magnetic Resonance Imaging Assessment of Rotator Cuff: The ROW Study
Jain, Nitin B.; Collins, Jamie; Newman, Joel S.; Katz, Jeffrey N.; Losina, Elena; Higgins, Laurence D.
Background Physiatrists encounter patients with rotator cuff disorders and imaging is frequently an important component of their diagnostic assessment. However, there is paucity of literature on reliability of MRI assessment between shoulder specialists and musculoskeletal radiologists. Objective We assessed inter- and intra-rater reliability of MRI characteristics of the rotator cuff. Design Cross-sectional secondary analyses in a prospective cohort study Setting Academic tertiary care centers Patients Subjects with shoulder pain recruited from orthopedic and physiatry clinics Methods Two shoulder fellowship trained physicians (a physiatrist and a shoulder surgeon) jointly performed a blinded composite MRI review by consensus on 31 subjects with shoulder pain. Subsequently, MRI was reviewed by one fellowship trained musculoskeletal radiologist. Main Outcome Measures We calculated Cohen’s kappa coefficients and percent agreement among the two reviews (composite review of two shoulder specialists versus that of the musculoskeletal radiologist). Intra-rater reliability was assessed among the shoulder specialists by performing a repeat blinded composite MRI review. In addition to this repeat composite review, only one of the physiatry shoulder specialists performed an additional review. Results Inter-rater reliability (shoulder specialists versus musculoskeletal radiologist) was substantial for the presence or absence of tear (kappa=0.90; 95% CI=0.72, 1.00), tear-thickness (kappa=0.84;95% CI=0.70, 0.99), longitudinal size of tear (kappa=0.75;95% CI=0.44, 1.00), fatty infiltration (kappa=0.62; 95% CI=0.45, 0.79), and muscle atrophy (kappa=0.68; 95% CI=0.50, 0.86). There was only fair inter-rater reliability of transverse size of tear (kappa=0.20; 95% CI=0.00, 0.51). The kappa for intra-rater reliability was high for tear thickness (0.88; 95% CI=0.72, 1.00), longitudinal tear size (0.61; 95% CI=0.22, 0.99), fatty infiltration (0.89; 95% CI=0.80, 0.98), and muscle
The diagnostic value of the combination of patient characteristics, history, and clinical shoulder tests for the diagnosis of rotator cuff tear
Background It is unknown which combination of patient information and clinical tests might be optimal for the diagnosis of rotator cuff tears. This study aimed to determine the diagnostic value of nine individual clinical tests for evaluating rotator cuff tear and to develop a prediction model for diagnosing rotator cuff tear. Methods This prospective cohort study included 169 patients with shoulder complaints. Patients who reported a previous shoulder dislocation were excluded from the analysis (N = 69). One experienced clinician conducted 25 clinical tests of which 9 are specifically designed to diagnose rotator cuff pathology (empty can, Neer, Hawkins-Kenney, drop arm, lift-off test, painful arc, external rotation lag sign, drop sign, infraspinatus muscle strength test). The final diagnosis, based on magnetic resonance arthrography (MRA), was determined by consensus between the clinician and a radiologist, who were blinded to patient information. A prediction model was developed by logistic regression analysis. Results and discussion In this cohort, 38 patients were diagnosed with rotator cuff tears. The individual overall accuracy of the rotator cuff clinical tests was 61%–75%. After backward selection, the model determined that the most important predictors of rotator cuff tears were higher age and a positive Neer test. This internally validated prediction model had good discriminative ability (area under the receiver operating characteristic curve (AUC) = 0.73). Conclusion Our results showed that individual clinical shoulder tests had moderate diagnostic value for diagnosing rotator cuff tear. Our prediction model showed improved diagnostic value. However, the prediction value is still relatively low, supporting a low threshold for additional diagnostic tests for the diagnosis of rotator cuff tears. Level of evidence Study of diagnostic test: level I. PMID:25099359
Proteomics Perspectives in Rotator Cuff Research: A Systematic Review of Gene Expression and Protein Composition in Human Tendinopathy
Sejersen, Maria Hee Jung; Frost, Poul; Hansen, Torben Bæk; Deutch, Søren Rasmussen; Svendsen, Susanne Wulff
Background Rotator cuff tendinopathy including tears is a cause of significant morbidity. The molecular pathogenesis of the disorder is largely unknown. This review aimed to present an overview of the literature on gene expression and protein composition in human rotator cuff tendinopathy and other tendinopathies, and to evaluate perspectives of proteomics – the comprehensive study of protein composition - in tendon research. Materials and Methods We conducted a systematic search of the literature published between 1 January 1990 and 18 December 2012 in PubMed, Embase, and Web of Science. We included studies on objectively quantified differential gene expression and/or protein composition in human rotator cuff tendinopathy and other tendinopathies as compared to control tissue. Results We identified 2199 studies, of which 54 were included; 25 studies focussed on rotator cuff or biceps tendinopathy. Most of the included studies quantified prespecified mRNA molecules and proteins using polymerase chain reactions and immunoassays, respectively. There was a tendency towards an increase of collagen I (11 of 15 studies) and III (13 of 14), metalloproteinase (MMP)-1 (6 of 12), -9 (7 of 7), -13 (4 of 7), tissue inhibitor of metalloproteinase (TIMP)-1 (4 of 7), and vascular endothelial growth factor (4 of 7), and a decrease in MMP-3 (10 of 12). Fourteen proteomics studies of tendon tissues/cells failed inclusion, mostly because they were conducted in animals or in vitro. Conclusions Based on methods, which only allowed simultaneous quantification of a limited number of prespecified mRNA molecules or proteins, several proteins appeared to be differentially expressed/represented in rotator cuff tendinopathy and other tendinopathies. No proteomics studies fulfilled our inclusion criteria, although proteomics technologies may be a way to identify protein profiles (including non-prespecified proteins) that characterise specific tendon disorders or stages of tendinopathy. Thus
Intra-articular changes precede extra-articular changes in the biceps tendon following rotator cuff tears in a rat model
Peltz, Cathryn D.; Hsu, Jason E.; Zgonis, Miltiadis H.; Trasolini, Nicholas A.; Glaser, David L.; Soslowsky, Louis J.
Background Biceps tendon pathology is common with rotator cuff tears. The mechanisms for biceps changes, and therefore its optimal treatment, are unknown. Our objective was to determine the effect of rotator cuff tears on regional biceps tendon pathology. We hypothesized that histological and compositional changes would appear before organizational changes, both would appear before mechanical changes, and changes would begin at the tendon’s insertion site. Methods Sixty-five Sprague-Dawley rats received either detachment of supraspinatus and infraspinatus tendons or sham surgery. Rats were sacrificed at 1, 4 or 8 weeks for regional measurements of histological, compositional, organizational (1, 4 and 8 weeks) or mechanical properties (4 and 8 weeks only). Results One week following tendon detachments, decreased organization and more rounded cell shape were found in the intra-articular space of the biceps tendon. Aggrecan expression was increased along the entire length of the tendon while all other compositional changes were at the tendon’s proximal insertion into bone only. With time, this disorganization and more rounded cell shape extended the length of the tendon. Organizational and cell shape changes also preceded detrimental mechanical changes, as decreased modulus in the intra-articular space was found after 8 weeks. Conclusions Results support a degenerative component to pathology in the biceps tendon. Additionally, changes resembling a tendon exposed to compressive loading occurring first in the intra-articular space indicate that the biceps tendon plays an increased role as a load bearing structure against the humeral head in the presence of rotator cuff tears. PMID:21816629
Results of reconstruction of massive irreparable rotator cuff tears using a fascia lata allograft
Dimitrios, Varvitsiotis; Athanasios, Papaspiliopoulos; Eleni, Antipa; Xenofon, Papacharalampous; George, Flevarakis; John, Feroussis
Background: Despite the advances in surgical treatment options, massive rotator cuff (r-c) tears still represent a challenge for orthopedic surgeons. This study assesses the effectiveness of fascia lata allograft in reconstruction of massive and irreparable r-c tear and to evaluate the healing and functional outcomes. Materials and Methods: 68 patients (38 men, 30 women, mean age 64.9 years) with massive or irreparable r-c tears were treated with placement of fascia lata allograft to fill the defect between February 2006 and February 2010. At 43 months followup they were evaluated clinically using the constant score, preoperatively and postoperatively. Magnetic resonance imaging (MRI) and ultrasound were used postoperatively, to assess the integrity of the allograft at the repair site. Postoperatively, standard rehabilitation protocol was followed with gradual restoration. Results: Postoperative constant score increased from 32.5 preoperatively to 88.7 postoperatively. The most important was the pain relief from 2.4 preoperatively to 14.1 postoperatively and range of motion. The results of the MRI were not reliable, but the ultrasound was satisfactory. Finally, there was no infection or rejection of the graft in any of the patients. Conclusions: Despite advances in surgical methods, there is still not a universally accepted treatment for massive and irreparable rotator cuff tears, because the standard methods have dubious results, with excessive retear rates and poor outcomes, necessitating the need for new repair strategies. We documented significant clinical improvement using fascia lata allograft in the repair of massive irreparable r-c tear, acting as scaffold to bridge the defect, enhancing the healing at the repair site. PMID:26015630
Cementless surface replacement hemiarthroplasty for primary glenohumeral osteoarthritis: results of over 5-year follow-up in patients with or without rotator cuff deficiency
Al-Hadithy, Nawfal; Furness, Nicholas; Patel, Ronak; Jonas, Sam; Jobbagy, Attila; Lowdon, Ian
Background Cementless surface replacement hemiarthroplasty (CSRHA) is an established treatment for glenohumeral osteoarthritis; however, studies evaluating its role in arthritis with rotator cuff deficiency are limited. This study reviews the outcomes of CSRHA for glenohumeral osteoarthritis with and without rotator cuff tears. Methods 41 CSRHA (Mark III Copeland prosthesis) were performed for glenohumeral osteoarthritis with intact rotator cuffs (n = 21) and cuff-deficient shoulders (n = 20). Patients were assessed using Oxford and Constant questionnaires, patient satisfaction, range of motion measurements and by radiography. Results Mean age and follow-up were 75 years and 5.1 years, respectively. Functional gains were significantly higher in patients with intact rotator cuffs compared to cuff-deficient shoulders, with Oxford Shoulder Score improving from 18 to 37.5 and 15 to 27 and forward flexion improved from 60° to 126° and 44° to 77° in each group, respectively. Two patients with deficient cuffs had deficient subscapularis tendons; one of which was dislocated anteriorly. Conclusions CSRHA provides significant improvements in pain and function in patients with glenohumeral osteoarthritis. In patients with deficient cuffs, functional gains are limited, and should be considered in low-demand patients where pain is the primary problem. Caution should be taken in patients with a deficient subscapularis as a result of the risk of dislocation.
Infusion Methods for Continuous Interscalene Brachial Plexus Block for Postoperative Pain Control after Arthroscopic Rotator Cuff Repair
Byeon, Gyeong Jo; Yoon, Ji Uk; Kim, Eun Jung; Baek, Seung Hoon; Ri, Hyun Su
Background Infusion methods during regional analgesia using perineural catheters may influence the quality of postoperative analgesia. This study was conducted to compare the effects of combined or bolus-only infusion of 0.2% ropivacaine on the postoperative analgesia in interscalene brachial plexus block (ISBPB) with perineural catheterization. Methods Patients scheduled for arthroscopic rotator cuff repair were divided into two groups, one that would receive a combined infusion (group C, n = 32), and one that would receive intermittent infusion (group I, n = 32). A perineural catheter was inserted into the interscalene brachial plexus (ISBP) using ultrasound (US) and nerve stimulation, and 10 ml of 0.2% ropivacaine was administered. After the operation, group C received a continuous infusion of 4 ml/h, and a 4 ml bolus with a lockout interval of 60 min. Group I received only a 4 ml bolus, and the lockout interval was 30 min. Postoperative pain by the numeric rating scale (NRS) and the forearm muscle tone by the manual muscle test (MMT) were checked and evaluated at the following timepoints: preoperative, and postoperative 1, 4, 12, 24, 36, and 48 h. Supplemental opioid requirements, total consumed dose of local anesthetic, and adverse effects were compared between the two groups. Results Sixty-four patients completed the study and the postoperative values such as operation time, time to discharge, and operation site were comparable. There were no differences in NRS scores and supplemental opioid requirements between the two groups. The MMT scores of group I at 4 and 12 h after surgery were significantly higher than those of group C (P < 0.05). The total consumed dose of local anesthetic was significantly lower in group I than in group C (P < 0.05). The adverse effects were not different between the groups. Conclusions The bolus-only administration of 0.2% ropivacaine provided a similar analgesic effect with a lower total volume of local anesthetic and decreased
Is There an Association Between the “Critical Shoulder Angle” and Clinical Outcome after Rotator Cuff Repair?
Kirsch, Jacob Matthew; Nathani, Amit; Robbins, Christopher; Gagnier, Joel Joseph; Bedi, Asheesh; Miller, Bruce S.
Objectives: Variations in scapular morphology have been associated with the development of atraumatic rotator cuff tears (RCT). Current theories suggest a morphologic predisposition for altered shoulder biomechanics favoring the development of RCTs. The critical shoulder angle (CSA) is a radiographic measure that accounts for both glenoid inclination and lateral extension of the acromion, and angles >35 degrees are reported to be correlated with the development of degenerative RCTs. The impact of the CSA on outcomes following rotator cuff repair (RCR) has not previously been investigated. The purpose of this study was to investigate the relationship between the CSA and clinical outcomes after rotator cuff repair. Methods: As part of a prospective observational cohort study we obtained CSA measurements for 144 patients with documented full-thickness RCTs who were followed up for a minimum of 48 weeks. Patients were then stratified based on RCT etiology and treatment. Demographic data as well as The Western Ontario Rotator Cuff Index (WORC), American Shoulder and Elbow Surgeons (ASES) score and Visual Analog Scale (VAS) for pain were collected at baseline, four, eight, 16, 32 and 48 weeks. The CSA for all of the patients was measured retrospectively, with all assessors being blinded to the data and we calculated interclass correlation coefficients (ICC) to measure agreement. The statistical analysis included longitudinal multilevel regression modeling to investigate the association of the CSA and the WORC, ASES and VAS for pain. Results: Controlling for demographic and clinical characteristics, patients with CSAs less than 38 degrees reported better outcome scores over time compared to those with CSAs greater than 38 degrees (WORC: B=-106.6, p=0.025, ASES: B=4.83, p=0.0001, VAS: B=-12.99, p=0.0001). Interobserver and intraobserver reliability for CSA measurements resulted in an ICC of 0.969 and 0.982 respectively, indicating excellent agreement. Conclusion: We found
Effects of 8 weeks' specific physical training on the rotator cuff muscle strength and technique of javelin throwers.
Kim, Hyeyoung; Lee, Youngsun; Shin, Insik; Kim, Kitae; Moon, Jeheon
[Purpose] For maximum efficiency and to prevent injury during javelin throwing, it is critical to maintain muscle balance and coordination of the rotator cuff and the glenohumeral joint. In this study, we investigated the change in the rotator cuff muscle strength, throw distance and technique of javelin throwers after they had performed a specific physical training that combined elements of weight training, function movement screen training, and core training. [Subjects] Ten javelin throwers participated in this study: six university athletes in the experimental group and four national-level athletes in the control group. [Methods] The experimental group performed 8 weeks of the specific physical training. To evaluate the effects of the training, measurements were performed before and after the training for the experimental group. Measurements comprised anthropometry, isokinetic muscle strength measurements, the function movement screen test, and movement analysis. [Results] After the specific physical training, the function movement screen score and external and internal rotator muscle strength showed statistically significant increases. Among kinematic factors, only pull distance showed improvement after training. [Conclusion] Eight weeks of specific physical training for dynamic stabilizer muscles enhanced the rotator cuff muscle strength, core stability, throw distance, and flexibility of javelin throwers. These results suggest that specific physical training can be useful for preventing shoulder injuries and improving the performance for javelin throwers. PMID:25364111
FUNCTIONAL EVALUATION OF PATIENTS WHO HAVE UNDERGONE ARTHROSCOPIC DEBRIDEMENT TO TREAT MASSIVE AND IRREPARABLE TEARS OF THE ROTATOR CUFF
Veado, Marco Antônio de Castro; Rodrigues, Alessandro Ulhôa
To evaluate the results from patients who underwent arthroscopic debridement of extensive irreparable rotator cuff injuries. Methods: 27 patients were operated between 2003 and 2007, and 22 of them were evaluated. The surgical procedure consisted of arthroscopic debridement of the stumps of the tendons involved, bursectomy, removal of acromial osteophytes and, possibly, biceps tenotomy and tuberoplasty. Results: All the patients showed involvement of the supraspinatus and infraspinatus tendons at the preoperative stage. In the postoperative evaluation, 14 patients had a complete teres minor muscle, and three had partial tears of the subscapularis tendon. There was an improvement in the UCLA criteria, from 15 preoperatively to 31 postoperatively. There was no improvement in muscle strength, but there was a reduction in the pain. Conclusion: Arthroscopic debridement is a recommended procedure for elderly patients with irreparable rotator cuff tears, good range of motion and low functional demand, when the main objective is to diminish pain. PMID:27022590
TGF-β Small Molecule Inhibitor SB431542 Reduces Rotator Cuff Muscle Fibrosis and Fatty Infiltration By Promoting Fibro/Adipogenic Progenitor Apoptosis
Lee, Lawrence; Laron, Dominique; Ning, Anne Y.; Kim, Hubert T.; Feeley, Brian T.
Rotator cuff tears represent a large burden of muscle-tendon injuries in our aging population. While small tears can be repaired surgically with good outcomes, critical size tears are marked by muscle atrophy, fibrosis, and fatty infiltration, which can lead to failed repair, frequent re-injury, and chronic disability. Previous animal studies have indicated that Transforming Growth Factor-β (TGF-β) signaling may play an important role in the development of these muscle pathologies after injury. Here, we demonstrated that inhibition of TGF-β1 signaling with the small molecule inhibitor SB431542 in a mouse model of massive rotator cuff tear results in decreased fibrosis, fatty infiltration, and muscle weight loss. These observed phenotypic changes were accompanied by decreased fibrotic, adipogenic, and atrophy-related gene expression in the injured muscle of mice treated with SB431542. We further demonstrated that treatment with SB431542 reduces the number of fibro/adipogenic progenitor (FAP) cells—an important cellular origin of rotator cuff muscle fibrosis and fatty infiltration, in injured muscle by promoting apoptosis of FAPs. Together, these data indicate that the TGF-β pathway is a critical regulator of the degenerative muscle changes seen after massive rotator cuff tears. TGF-β promotes rotator cuff muscle fibrosis and fatty infiltration by preventing FAP apoptosis. TGF-β regulated FAP apoptosis may serve as an important target pathway in the future development of novel therapeutics to improve muscle outcomes following rotator cuff tear. PMID:27186977
Scapular and rotator cuff muscle activity during arm elevation: A review of normal function and alterations with shoulder impingement
Phadke, V; Camargo, PR; Ludewig, PM
Objective The purpose of this manuscript is to review current knowledge of how muscle activation and force production contribute to shoulder kinematics in healthy subjects and persons with shoulder impingement. Results The middle and lower serratus anterior muscles produce scapular upward rotation, posterior tilting, and external rotation. Upper trapezius produces clavicular elevation and retraction. The middle trapezius is primarily a medial stabilizer of the scapula. The lower trapezius assists in medial stabilization and upward rotation of the scapula. The pectoralis minor is aligned to resist normal rotations of the scapula during arm elevation. The rotator cuff is critical to stabilization and prevention of excess superior translation of the humeral head, as well as production of glenohumeral external rotation during arm elevation. Alterations in activation amplitude or timing have been identified across various investigations of subjects with shoulder impingement as compared to healthy controls. These include decreased activation of the middle or lower serratus anterior and rotator cuff, delayed activation of middle and lower trapezius, and increased activation of the upper trapezius and middle deltoid in impingement subjects. In addition, subjects with a short resting length of the pectoralis minor exhibit altered scapular kinematic patterns similar to those found in persons with shoulder impingement. Conclusion These normal muscle functional capabilities and alterations in patient populations should be considered when planning exercise approaches for the rehabilitation of these patients. PMID:20411160
Histologic evaluation of a biopsy specimen obtained 3 months after rotator cuff augmentation with GraftJacket Matrix.
Snyder, Stephen J; Arnoczky, Steven P; Bond, James L; Dopirak, Ryan
Understanding the cellular response to a biologic graft used in rotator cuff applications is important because foreign-body reactions and inflammation complications have historically been seen with xenograft-derived grafts. The purpose of this study was to histologically evaluate a biopsy specimen taken from a rotator cuff of a 62-year-old man 3 months after augmentation with an acellular human dermal graft, GraftJacket Matrix-MaxForce Extreme (Wright Medical Technology, Arlington, TN). The graft material was intact and filled with numerous elastic fibers and blood vessels. Extensive host cellular infiltration was evident along the margins of the graft, whereas the more central regions were more sparsely populated. Calcification and infection were not evident. There was little to no inflammatory response. The orientation of the collagen fibers indicated early organization of new tissue. The incorporation of the GraftJacket Matrix-MaxForce Extreme evidenced by cellular infiltration, alignment of collagen fibers, and blood vessel ingrowth shows that this graft exhibits key biologic factors of the remodeling process when used as an augmentation device in rotator cuff repair. PMID:19245998
Retrospective study of sonographic findings in bone involvement associated with rotator cuff calcific tendinopathy: preliminary results of a case series*
Nogueira-Barbosa, Marcello H.; Gregio-Junior, Everaldo; Lorenzato, Mario Muller
Objective The present study was aimed at investigating bone involvement secondary to rotator cuff calcific tendonitis at ultrasonography. Materials and Methods Retrospective study of a case series. The authors reviewed shoulder ultrasonography reports of 141 patients diagnosed with rotator cuff calcific tendonitis, collected from the computer-based data records of their institution over a four-year period. Imaging findings were retrospectively and consensually analyzed by two experienced musculoskeletal radiologists looking for bone involvement associated with calcific tendonitis. Only the cases confirmed by computed tomography were considered for descriptive analysis. Results Sonographic findings of calcific tendinopathy with bone involvement were observed in 7/141 (~ 5%) patients (mean age, 50.9 years; age range, 42-58 years; 42% female). Cortical bone erosion adjacent to tendon calcification was the most common finding, observed in 7/7 cases. Signs of intraosseous migration were found in 3/7 cases, and subcortical cysts in 2/7 cases. The findings were confirmed by computed tomography. Calcifications associated with bone abnormalities showed no acoustic shadowing at ultrasonography, favoring the hypothesis of resorption phase of the disease. Conclusion Preliminary results of the present study suggest that ultrasonography can identify bone abnormalities secondary to rotator cuff calcific tendinopathy, particularly the presence of cortical bone erosion. PMID:26811551
Quantitative Analysis of Three-Dimensional Distribution and Clustering of Intramuscular Fat in Muscles of the Rotator Cuff.
Santago, Anthony C; Vidt, Meghan E; Tuohy, Christopher J; Poehling, Gary G; Freehill, Michael T; Jordan, Jennifer H; Kraft, Robert A; Saul, Katherine R
The purpose of this study was to (1) develop and present a technique to quantitatively assess three-dimensional distribution and clustering of intramuscular fat and (2) use the technique to compare spatial characteristics of intramuscular fat in rotator cuff muscles of older adults with and without a supraspinatus tear. Moran's Index (I), an existing quantitative measure of clustering, was extended for use with MRI to allow comparisons across individuals with different size muscles. Sixteen older adults (>60 years) with (N = 6) and without (N = 10) a degenerative supraspinatus tear participated. Following 3D Dixon MRIs of the shoulder, which separates fat from water, rotator cuff muscles were segmented and sectioned and fat% and Moran's I were calculated to assess distribution and clustering, respectively. Moran's I ranged was 0.40-0.92 and 0.39-0.76 for the tear and control subjects, respectively. Compared to uninjured controls, tear subjects demonstrated increased fat distribution (p = 0.036) and clustering (p = 0.020) distally in the supraspinatus. Tear subjects had more pronounced distribution (p < 0.001) and clustering distally (p < 0.001) than proximally. Other rotator cuff muscles exhibited different patterns of fat clustering and distribution. This technique, which we applied to quantify spatial characteristics of intramuscular fat, can be applied to assess clustering of fat in other pathologies and tissues. PMID:26514349
Comparative analysis on arthroscopic sutures of large and extensive rotator cuff injuries in relation to the degree of osteopenia☆
Almeida, Alexandre; Atti, Vinícius; Agostini, Daniel Cecconi; Valin, Márcio Rangel; de Almeida, Nayvaldo Couto; Agostini, Ana Paula
Objective To analyze the results from arthroscopic suturing of large and extensive rotator cuff injuries, according to the patient's degree of osteopenia. Method 138 patients who underwent arthroscopic suturing of large and extensive rotator cuff injuries between 2003 and 2011 were analyzed. Those operated from October 2008 onwards formed a prospective cohort, while the remainder formed a retrospective cohort. Also from October 2008 onwards, bone densitometry evaluation was requested at the time of the surgical treatment. For the patients operated before this date, densitometry examinations performed up to two years before or after the surgical treatment were investigated. The patients were divided into three groups. Those with osteoporosis formed group 1 (n = 16); those with osteopenia, group 2 (n = 33); and normal individuals, group 3 (n = 55). Results In analyzing the University of California at Los Angeles (UCLA) scores of group 3 and comparing them with group 2, no statistically significant difference was seen (p = 0.070). Analysis on group 3 in comparison with group 1 showed a statistically significant difference (p = 0.027). Conclusion The results from arthroscopic suturing of large and extensive rotator cuff injuries seem to be influenced by the patient's bone mineral density, as assessed using bone densitometry. PMID:26229899
Radial extracorporeal shock-wave therapy in rotator cuff calcific tendinosis
Mangone, Giuseppe; Veliaj, Altin; Postiglione, Marco; Viliani, Tamara; Pasquetti, Pietro
The objective of the study is to evaluate the effectiveness of Radial Extracorporeal Shock-wave Therapy (RESWT) compared with High Power LASER Therapy (HPLT) for the treatment of patients with Rotator Cuff Calcific Tendinosis (RCCT). RCCT is widely diffused, it is painful and invalidating. It is an important public health problem with social and economic implications. The most common therapeutic approach is a physiotherapic one. Both HPLT and RESWT give positive results. There is a debate on which is to be preferred. Therefore there is need to obtain scientific evidence to support either case. An observational study was carried out in the period between October 2008 and September 2009 in our outpatient clinic with 62 patients, divided into 3 groups: group A 36 patients treated only with RESWT, group B 26 patients treated only with HPLT and group C 16 patients with only short term improvement with HPLT retreated with RESWT. Patients were evaluated with Constant-Murley scale before and after treatment (immediately, 1 month and 3 months) for mean constant score, pain and range of movement. Data were examined statistically with SPSS. Criteria for inclusion and exclusion were defined. Patients treated with HPLT have shown good clinical results but have returned to original syndrome 1 month after treatment. RESWT has given improvement after treatment extended in time (3 months) in terms of pain and recover of functionality with a limited number of applications. The evidence collected indicates that RESWT is the method of choice. PMID:22460011
Role of Serum Fibrinogen Levels in Patients with Rotator Cuff Tears
Longo, Umile Giuseppe; Petrillo, Stefano; Berton, Alessandra; Spiezia, Filippo; Loppini, Mattia; Maffulli, Nicola; Denaro, Vincenzo
Although rotator cuff (RC) tendinopathy is a frequent pathology of the shoulder, the real understanding of its aetiopathogenesis is still unclear. Several studies showed that RC tendinopathy is more frequent in patients with hyperglycemia, diabetes, obesity, or metabolic syndrome. This paper aims to evaluate the serum concentration of fibrinogen in patients with RC tears. Metabolic disorders have been related to high concentration of serum fibrinogen and the activity of fibrinogen has been proven to be crucial in the development of microvascular damage. Thus, it may produce progression of RC degeneration by reducing the vascular supply of tendons. We report the results of a cross-sectional frequency-matched case-control study comparing the serum concentration of fibrinogen of patients with RC tears with that of a control group of patients without history of RC tears who underwent arthroscopic meniscectomy. We choose to enrol in the control group patients with pathology of the lower limb with a likely mechanic, not metabolic, cause, different from tendon pathology. We found no statistically significant differences in serum concentration of fibrinogen when comparing patients with RC tears and patients who underwent arthroscopic meniscectomy (P = 0.5). Further studies are necessary to clarify the role of fibrinogen in RC disease. PMID:24817887
Comparison of ultrasonic suture welding and traditional knot tying in a rabbit rotator cuff repair model.
Nho, Shane J; Cole, Brian J; Mazzocca, Augustus D; Williams, James M; Romeo, Anthony A; Bush-Joseph, Charles A; Bach, Bernard R; Hallab, Nadim J
The purpose of this study is to evaluate ultrasonic suture welding of monofilament suture in an animal model of rotator cuff repair with biomechanical and histologic analyses. We randomly assigned 46 shoulders in 23 rabbits to 1 of 3 treatment groups: sham-operated (n = 15), knotted (n = 15), and welded (n = 16). Supraspinatus defects were surgically created and acutely repaired with suture anchors loaded with either No. 2-0 Ethibond for knotted group or No. 2-0 nylon for welded shoulders. Eighteen weeks postoperatively, all animals were killed, and the shoulders underwent either biomechanical testing or histologic analysis. The maximum stress of the sham-operated group (20.6 N/mm2) was significantly greater than that of both the knotted (10.2 N/mm2) and welded (8.3 N/mm2) groups (P < .05), but no differences were observed between the knotted and welded groups. Although some histologic changes were noted, none was considered to be significant to distinguish either group. PMID:16979062
A systematic review of the histological and molecular changes in rotator cuff disease
Dean, B. J. F.; Franklin, S. L.; Carr, A. J.
Introduction The pathogenesis of rotator cuff disease (RCD) is complex and not fully understood. This systematic review set out to summarise the histological and molecular changes that occur throughout the spectrum of RCD. Methods We conducted a systematic review of the scientific literature with specific inclusion and exclusion criteria. Results A total of 101 studies met the inclusion criteria: 92 studies used human subjects exclusively, seven used animal overuse models, and the remaining two studies involved both humans and an animal overuse model. A total of 58 studies analysed supraspinatus tendon exclusively, 16 analysed subacromial bursal tissue exclusively, while the other studies analysed other tissue or varying combinations of tissue types including joint fluid and muscle. The molecular biomarkers that were altered in RCD included matrix substances, growth factors, enzymes and other proteins including certain neuropeptides. Conclusions The pathogenesis of RCD is being slowly unravelled as a result of the significant recent advances in molecular medicine. Future research aimed at further unlocking these key molecular processes will be pivotal in developing new surgical interventions both in terms of the diagnosis and treatment of RCD. PMID:23610686
Fascia lata allograft bridging of a rotator cuff tear in a rabbit animal model
Varvitsiotis, Dimitrios; Papaspiliopoulos, Athanasios; Vlachou, Vasiliki; Feroussis, John; Papalois, Apostolos; Papacharalampous, Xenofon; Soucacos, Panayotis N.; Zoubos, Aristides
Purpose: Despite advances in surgical treatment options, large rotator cuff (r-c) tears still represent a challenge for orthopedic surgeons. The purpose of this study was to evaluate the temporary and spatial histological incorporation of fascia lata allografts, used for bridging artificially created defects of the r-c. Materials and Methods: Seventy-two rabbits were divided into two groups and a supraspinatus tendinous defect was created. Half of the rabbit population underwent repair only, while in the other half, the defect was bridged utilizing fascia lata allograft. The animals were euthanized at 2, 4, and 6 weeks postoperative. Half of the specimens were evaluated histologically and the other half underwent mechanical testing. Results: There was an increased remodeling activity, fibroblastic in growth and strong presence of collagen fibers observed at 6 weeks on both groups. A gradually increasing mechanical strength was noticed by week 6 and increased toughness was also found at the same time period. There was no significant difference observed between the two groups regarding their histological and mechanical properties. Conclusions: In the difficult scenario of a large irreparable tear where the simple suture of the remaining r-c is impossible, allograft bridging, could be used with satisfactory results. Clinical Relevance: Treatment Study, Level 1. PMID:25114414
Evidence for an Environmental and Inherited Predisposition Contributing to the Risk for Global Tendinopathies or Compression Neuropathies in Patients With Rotator Cuff Tears
Tashjian, Robert Z.; Farnham, James M.; Granger, Erin K.; Teerlink, Craig C.; Cannon-Albright, Lisa A.
Background: Rotator cuff tearing has been found to be clinically associated with other tendinopathies and compression neuropathies; a significant excess of these phenotypes has been seen in patients with rotator cuff tears. It is unclear if the association is secondary to environmental or genetic influences. Purpose: To examine population-based data for comorbid association of rotator cuff tearing and tendinopathies and compression neuropathies and to determine whether the association extends to relatives of patients with rotator cuff tears, which could suggest a genetic contribution. Study Design: Cross-sectional study; Level of evidence, 3. Methods: The Utah Population Database (UPDB) contains health and genealogical data on over 2 million Utah residents. Current Procedural Terminology, Fourth Revision, codes (CPT 4) and International Classification of Diseases, Ninth Revision, codes (ICD-9) entered in patient records were used to identify patients with rotator cuff tearing and with comorbid tendinopathies and compression neuropathies. We tested the hypothesis of excess familial clustering of these other phenotypes with rotator cuff tearing using a well-established method (estimation of relative risks) in the overall study group of rotator cuff patients (N = 1889). Results: Significantly elevated risk for elbow, hand/wrist, foot/ankle, knee, and hip tendinopathies, as well as for all tendinopathies and compression neuropathies, was observed in rotator cuff tear cases themselves (P < 2.8e–13), in their spouses (P < .02), and in their first-degree relatives (P < 5.5e–4). A significant excess of elbow (P = .01), foot/ankle (P = .04), and all tendinopathies (P = 3.1e–3) was also observed in second-degree relatives, and a significant excess of compression neuropathies (P = .03) was observed in third-degree relatives. Conclusion: The current study shows strong evidence of familial clustering of rotator cuff tearing with other tendinopathies and with compression
Maintaining endotracheal tube cuff pressure at 20 mm Hg to prevent dysphagia after anterior cervical spine surgery; protocol of a double-blind randomised controlled trial
Background In anterior cervical spine surgery a retractor is obligatory to approach the spine. Previous studies showed an increase of endotracheal tube cuff pressure after placement of a retractor. It is known that high endotracheal tube cuff pressure increases the incidence of postoperative dysphagia, hoarseness, and sore throat. However, until now no evidence supports the fact whether adjusting the endotracheal tube cuff pressure during anterior cervical spine surgery will prevent this comorbidity. We present the design of a randomized controlled trial to determine whether adjusting endotracheal tube cuff pressure after placement of a retractor during anterior cervical spine surgery will prevent postoperative dysphagia. Methods/design 177 patients (aged 18–90 years) scheduled for anterior cervical spine surgery on 1 or more levels will be included. After intubation, endotracheal tube cuff pressure is manually inflated to 20 mm Hg in all patients. Patients will be randomized into two groups. In the control group endotracheal tube cuff pressure is not adjusted after retractor placement. In the intervention group endotracheal tube cuff pressure after retractor placement is maintained at 20 mm Hg and air is withdrawn when cuff pressure exceeds 20 mm Hg. Endotracheal tube cuff pressure is measured after intubation, before and after placement and removal of the retractor. Again air is inflated if cuff pressure sets below 20 mmHg after removal of the retractor. The primary outcome measure is postoperative dysphagia. Other outcome measures are postoperative hoarseness, postoperative sore throat, degree of dysphagia, length of hospital stay, and pneumonia. The study is a single centre double blind randomized trial in which patients and research nurses will be kept blinded for the allocated treatment during the follow-up period of 2 months. Discussion Postoperative dysphagia occurs frequently after anterior cervical spine surgery. This may be related to high |
Title: Regulation of polyglycerophospholipid biosynthesis
Authors: Ross, Timothy Kieran
Abstract: Cardiac ischaemia is a condition in which there exists an imbalance between the myocardial oxygen demand and coronary arterial supply. Biochemical complications arising from cardiac ischaemia include ATP depletion, a net loss of adenine nucleotides, as well as an increase in $\rm\lbrack Ca\sp{2+}$), (P$\sb{\rm i}\rbrack,$ and $\rm\lbrack H\sp+\rbrack.$ Ironically, cells may endure a non-lethal period of ischaemia, only to succumb to reperfusion injury. Reperfusion injury is a consequence of cell reoxygenation whereby the proliferation of oxygen free radicals (and resultant oxidative stress), increased $\rm\lbrack Ca\sp{2+}\rbrack,$ continued ATP deprivation, and higher pH all contribute to the reversible formation of a non-selective permeability transition pore in the inner mitochondrial membrane. The opening of this pore results in the further decoupling the cell's oxidative phosphorylation mechanisms, resulting in a vicious cycle of pore formation and decreased cellular metabolic efficiency. Cyclosporin A(CSA), an immunosuppressant, has been found to reverse pore formation in the post-ischaemic heart. Our goal was to study the effects of the opening and closing of these pores on cardiolipin biosynthesis. (Abstract shortened by UMI.) |
How Secure Is Your Supplier?
By Margaret Millett
Companies use third-party vendors today to help accomplish their goals and objectives in a cost effective manner. However, by using third parties or service providers the board of directors and senior management are not relieved of their supervision responsibility. They must take the necessary steps to ensure third-party products and/or services are safe and sound, and comply with applicable laws, regulations, and security best practices.
Effective vendor oversight requires ongoing due diligence for providers to adjust for changing market and organisational risks. However, many organisations struggle to maintain their contracts and meet regulatory guidelines for due diligence. It is therefore important to establish standards and processes for monitoring and reviews which are structured and well defined, to ensure that there is consistency across the supplier network.
Vendor management policy
Many organisations have different business models and a complex network of assets located around the world. Third-party vendor relationships exist globally to support this business model. Given this key role, it is essential that companies seek to determine the ability of vendors to recover. They must ensure the effective management of vendor relationships and assess risk and compliance with company policies and controls while managing vendor relationships.
The systems and procedures for managing vendor-related risks, however, can be disjointed and ineffective, leading to significant control gaps throughout the lifecycle of a company-vendor relationship, from vendor selection to vendor termination. Ownership of the end-to-end vendor management process and key stakeholder responsibilities should be clearly assigned, to diminish company losses and vendor risks. A process to maintain risk ratings for critical vendors should be researched and implemented.
To ensure effective, regular oversight, a vendor management policy and governance framework should: identify how an organisation will inventory the vendors; identify the measures an organisation will use to assess the activities they perform; and identify the risk criteria that will apply to evaluate their controls. The process should also evaluate the quality of their crisis management plans, business continuity plans, and disaster recovery plans, testing methodologies, recovery time objectives, recovery point objectives and their use of additional third-party relationships.
Risks in the relationship
Vendor risk management is a concern for many organisations because vendors are key enablers to the current and future delivery to customers. There are a growing number of risks associated with outsourced vendors, particularly as the current financial environment is creating stress in the supply base with the potential to impair an individual company’s dependability and performance.
All organisations have known challenges in managing risk. Companies which do not secure effective vendor management programmes can suffer significant losses. There are no standards of evaluation and the triggers for contingency monitoring are undefined.
The following are potential liabilities:
Lack of an end-to-end process and tools which initiate effective risk management deployment if the need arises.
Diverse but uncoordinated efforts to address gaps in overall programme management (for example, info security, business impact analysis, insurance and contingency planning).
Lack of specific responsibilities and exposure tolerance for key vendors.
Lack of guidance on criteria for vendors at business unit or corporate level.
To facilitate the effective management of vendors, organisations should look to assemble a task force to assess the scope of vendor management within the company and best practices. This task force should address:
The agreed definition and scope of vendor management for the organisation.
The results of the recent internal audits (if available).
How vendor management should look within the company.
The next steps are needed to move towards an enterprise wide vendor management programme.
Stakeholders who should be involved to address those next steps.
In addition, executive management needs to consider the following areas:
Who owns the risk?
What organisational structure is best suited to address the risk?
Centralised
Risk mitigation strategy
Controls – evaluate the effectiveness of controls that ensure vendor service levels are being measured, monitored and reported to management and the vendor.
Risk specific mitigations – receive recommendations on risk mitigation actions.
Efficiency gains – existing significant opportunities for improving efficiency.
Executive management also needs to think about where the maturity level should be. Consideration should be given to:
Stakeholder involvement and buy-in outside of the primary owner (for example, procurement).
Integration of vendor/supply collaboration with business strategy and operations.
Value realised.
Vendor/supply relationships management programme maturity.
Formulating a strategy
A corporate vendor management programme will not be established after one meeting. The organisation must establish what it wants to incorporate into its vendor strategy and this will require time. The issue will have to be examined from all angles before the final policy is formulated. Some options are:
Level 1 – No formal programme.
Level 2 – A vendor management programme is established within each of the business units. Targeting and measurement of opportunities to manage risk and create value is nominal.
Level 3 – Enterprise-wide vendor management with clear links to business strategy is instituted. There is a systematic approach for targeting and measuring the value and risk.
Level 4 – Strategic planning occurs and specific responsibilities are assigned, activities, behaviours, and capabilities are embedded in all business processes as a part of the larger framework of organisational resiliency.
It is also necessary to establish which model will be adopted for the programme. These can be divided into three types: centralised; centre-led and decentralised. Each of these models has its own advantages and disadvantages.
Centralised model
High degree of standardization
Streamlines communication and decision making
Difficult to build and maintain internal business partner buy-in
Risk of disconnect with needs of the business
Centre-led model
Supports alignment of supplier relationship manager office with needs of business
Balances standardisation and sharing best practices with high stakeholder engagement
Creates governance complexity and requires a high degree of effectiveness in cross-business unit collaboration
Decentralised model
Supports alignment of supply relationship manager with needs of business
Effectiveness of collaboration with suppliers is variable
Undermines alignment between sourcing and management of post-award interactions with suppliers
Relationships with crossbusiness unit suppliers significantly sub-optimised
The model selected should best serve the company’s particular needs and have the most effective vendor accountability.
An external questionnaire should be created to document the business continuity management requirements. The objective should be to understand the BCM programme used by the vendor in support of the organisation. All personnel involved with operational readiness of the company should be surveyed for their feedback. The vendor responses will help an organisation determine their resiliency and the role a vendor plays in that adaptability.
A vendor questionnaire should consider the following areas with detailed questions about the support of the organisation:
Contractual agreement/Service Level Agreement
Crisis management plans
Business recovery plans
Network infrastructure plans
Business continuity plans
Disaster recovery plans
Vendor use of third party vendors associated with support to an organisation
An additional section should be included to ask detailed data centre questions. Below are some recommendations:
Fire exposure
Periodic performance reviews should be conducted to ensure service levels are being met and that sensitive information provided to the vendor has not been compromised. Monthly reviews are recommended.
Responses deemed to require the awareness and attention of executive management should be added to the ‘Vendor risk/SLA dashboard’ which is provided to management committee on a regular basis. Below are additional points to consider:
Has the vendor fully met the performance and SLA expectations over the past thirty days?
Has there been any disruption in workflow based on vendor performance in the past thirty days?
Has the vendor provided warning or created the expectation that workflow may be disrupted for any reason during the next thirty days?
Has the vendor reported a breach of their network, systems or facilities in the past thirty days?
Has the vendor provided information/results on tests of their internal security (physical or systems) controls conducted within the past thirty days?
Has the company conducted tests of the vendor’s internal security (physical or systems) controls within the past thirty days (and only with the vendor’s explicit, documented permission)?
As more companies face the challenge of increasing productivity, BC managers must be alert to potential pitfalls in the implementation and supervision of outside vendors to meet increasing demands. Risk is a constant factor that must be addressed and evaluated on a regular basis and management must always be on the look-out for potential risks with any vendor partnership.
Margaret J Millett, MBCP, is director of global continuity services at eBay Inc. She can be reached at [email protected]. |
The vitamin that keeps on giving
by KIM N. ARREY, RD September 2010
We know the role vitamin D plays in the prevention of osteoporosis and colon cancer. However, a flurry of recent studies have linked vitamin D to other diseases. These studies also indicate that a significant proportion of the population is deficient in vitamin D.
Cognitive impairment
Dr David Llewellyn and his colleagues in England studied 858 people 65 and over. Participants were followed for six years and underwent blood tests and three different tests of cognitive function at enrollment and every three years. Seniors with the lowest vitamin D levels had the greatest cognitive declines.(1)
A study, presented that the meeting of the Endocrine Society in June 2010, suggests that vitamin D plays a role in type 2 diabetes.(2) Dr Esther Kurg and her colleagues reviewed the charts of 124 adults and seniors who had type 2 diabetes. Approximately 90 percent had either a deficiency or low levels of vitamin D. Those with the lowest levels had the highest blood-sugar levels.
Another study linked low levels of vitamin D to higher all-cause mortality and cardiovascular mortality in patients with diabetes.(3)
The Uppsala Longitudinal Study of Adult Men looked at the link between blood levels of vitamin D and mortality.(4) It studied 1194 men whose mean age at the beginning of the study was 71 and found that men with low concentrations of vitamin D had a higher cardiovascular mortality.
Rheumatic conditions and autoimmune disorders
A study from Italy found that 85 percent of patients with rheumatic conditions had low levels of vitamin D. Surprisingly, taking 800 IU of vitamin D daily did not improve the vitamin D status of 60 percent of those who took the supplement.(5) In another study that looked at patients with autoimmune disorders, vitamin D had an effect on up to 229 genes, particularly those that are correlated to MS, Crohn’s disease, type 1 diabetes, lupus and some types of cancers.(6)
In July 2010 the Canadian Osteoporosis Society revised its clinical guidelines to include recommending “400-1000 IU of vitamin D without osteoporosis or conditions affecting vitamin D absorption. For adults over 50, supplements between 800 and 2000 IU are recommended.” (7)
All patients should be routinely screened for 25-OH vitamin D levels. Screening should ideally take place in the fall and winter months when the body is using its stores of vitamin D.(8)
1. JAMA and Archives Journals (2010, July 13). "Low vitamin D levels associated with cognitive decline." ScienceDaily. Retrieved August 22. 2010, from sciencedaily.com/releases/2010/07/100712162554.htm
2. "Poor Control of Diabetes may be liked to low vitamin D." Medical News Today. June 22, 2010. Retrieved August 22, 2010, from medicalnewstoday.com/articles/192437.php
3. Joergensen C, et al, "Vitamin D Levels and mortality in type 2 diabetes." Diabetes Care, 2010, July 6 (epub ahead of print)
4. Michaelsson K, et al. "Plasma vitamin D and mortality in older men: a community-based prospective cohort study." Am J Clin Nutri. 2010 Aug 18 (Epub ahead of print)
5. European League Against Rheumatism (2010, June 19). "Vitamin D deficiency across a range of rheumatic conditions." ScienceDaily. Retrieved August 23, 2010, from sciencedaily.com/releases/2010/06/100618081333.htm
6. "Vitamin D found to influence more than 200 genes," CTV.ca Retrieved on August 23, 2010. ctv.ca/servlet/ArticleNews/print/CTVNews/20100823/vitamin-d-genes-100823/2010
7. "Vitamin D: A key factor in good calcium absorption," The Osteoporosis Society of Canada, Retrieved August 23, 2010. osteoporosis.ca/index.php/ci_id/5536/la_id/1.htm
8. Moyad, Mark A. MD, MPH, "Vitamin D: A Rapid Review," Detmatology Review, 2009;21(1). |
Orthopaedics is the medical specialty that focuses on injuries and diseases of your body's musculoskeletal system. This complex system includes your bones, joints, ligaments, tendons, muscles, and nerves, and allows you to move, work, and be active.
We are providing the following resources to help you have the best orthopaedic health possible:
OrthoInfo is a trusted source of information about musculoskeletal conditions and injuries — how they are treated, as well as how they can be prevented. The articles and videos are developed by orthopaedic surgeons who are members of the American Academy of Orthopaedic Surgeons (AAOS). All of the content on the website is peer-reviewed by physician members of the OrthoInfo Editorial Board who are experts in their fields. This peer-review process ensures the accuracy and completeness of the content.
OrthoInfo
Articles and Information about Joint Replacement
Preparing for Joint Replacement Surgery
Informed Patient: Total Hip Replacement
Informed Patient: Total Knee Replacement
U.S. News and World Reports Health ranks orthopaedic hospitals on its Best Hospitals website. In the near future, hospitals that are participating in registries, including AJRR, will gain an additional quality checkmark – increasing their ranking on the list. Hospitals that participate in registries show a real commitment to quality initiatives that provide better outcomes to patients; better transparency to its community; and educating patients to make them more informed about their health care.
AJRR Report to the Public
Introducing, AJRR's 2016 Report to the Public About Hip and Knee Replacements, the first-ever patient summary of the clinical data available in our Annual Report.
2016 Report to the Public About Hip and Knee Replacements
Ever wonder why you sometimes see orthopaedics spelled differently? The word “orthopaedics” comes from the Greek root ortho (straight) and pais (child). On the other hand, the word “orthopedics” contains the Latin root pedis (foot). Rather than limiting all procedures to only the feet, AJRR prefers to include all procedures and stay with the traditional Greek roots. Most medical groups choose to remove the “a” from orthopaedics, however, the majority of the orthopaedic community, including AJRR, chooses to stick with the traditional spelling. Even though organizations and spell check may not agree, both spellings are technically correct!
Considering the number of ‘baby boomers’ reaching old age in the U.S. along with the prevalence of osteoarthritis and the growing obesity epidemic, it is expected that by 2030 there will be approximately 3.48 million total knee replacements and 572,000 hip replacements performed annually (Kurtz et al, 2007).
There are 719,000 total knee replacements and 332,000 hip replacements performed annually in the U.S. (data from the Centers for Disease Control and Prevention (CDC). This number will grow exponentially expediential with a more active and aging population.)
More than 7 million people in the U.S. have had a knee or hip replacement surgery
Hip and knee devices account for more than 85% of the joint reconstruction and replacement market
Joint registries demonstrate up to a 50% reduction in revision rates after registry initiation and identification of best practices
If the U.S. revision rates were cut by just 2%, Medicare could realize savings of over $65 million
You have questions? We have answers! |
Climate Change column: Preserve Cashes Ledge and save fish
By Charlotte Kahn Ipswich@wickedlocal
The “extreme” drought ended with 5.5 inches of rain in January, for which we thank the rain gods. But it’s sobering to recall that 14 inches of rain broke all records in the Mother’s Day Flood of 2006. And according to town historian Gordon Harris, “The five highest floods ever recorded on the Ipswich have occurred since April 1987.”
It doesn’t take a climate scientist to tell us that whiplashing weather patterns are breaking records with unnerving regularity — from historic drought to epic flood, Arctic blast to intolerable heat wave. Fossil-fuel emissions are rising into the atmosphere at rates higher than in millions of years, blanketing and warming the Earth. The Northeast is changing. The waters of the Gulf of Maine – Cape Cod to Nova Scotia — are now heating faster than 99 percent of the world’s oceans. Precipitation in the region is projected to increase by 70 percent — interspersed with longer droughts — this century.
In the face of accelerating change, we need to learn how handle extremes. Our wells and reservoirs almost ran dry during the drought. Yet during storms, rain rushes off the land into storm drains where it mixes with chemical pollutants and dog feces from roads and parking lots and excess nutrients and pesticides from lawns and gardens, flowing into rivers and marshes and washing over the coastal eelgrass that nurtures and protects young fish and shellfish, the “seed corn” of New England’s seafood industry.
Coastal pollution — along with rising temperatures, gas and oil drilling, mineral mining, ocean acidification and industrial fishing methods — is putting extreme pressure on New England’s fish and shellfish stocks. I learned that last week at the North Shore Technology Council’s Sustainability Forum at the Cummings Center in Beverly, where Conservation Law Foundation marine expert Peter Shelley said the demand for fish and shellfish is growing even as fossil fuels are heating the atmosphere and warming the oceans, sending some species to their doom. If we want marine fish to thrive, they need healthy environments in which to grow.
One thing we can do is to curtail pollution from runoff. How? Give time and space for rain and melting snow to filter down through soil and rock to the aquifers, from which we can then draw clean water as needed for farms, businesses and homes and replenish streams, rivers and reservoirs. Keep rainwater on the land through swales, dry wells and rain gardens and by deploying cisterns and rain barrels. Permeable paving — and there are many breakthroughs — on driveways and parking lots lets rain seep into the ground. Planting grass, shrubs or trees on bare spots and slopes absorbs runoff. Reducing or eliminating chemical fertilizers and pesticides keeps them out of storm drains. Non-toxic household cleaners keep poisons out of the town’s sewage system, which eventually flows into the sea.
But improving the survival of baby fish is not enough. We must also protect offshore marine environments of great significance, like Cashes Ledge, a small, but important, repository for fish and marine life 80 miles from Cape Ann, 100 miles from Boston. There, in one spot of still-pristine glory, species important to both the fishing industry and the biodiversity of the ocean — linked in ways we have yet to understand — can grow and reproduce at full capacity, replenishing stocks ocean-wide. If President Trump wants to preserve and create jobs — in this case storied New England livelihoods — he will protect Cashes Ledge now and for the ages by designating it as marine monument, perhaps the Trump Marine Monument of Cashes Ledge. And by helping fish thrive in shallow coastal waters and in the sea, we, too, will be protected from the extremes of climate change.
Ipswich resident Charlotte Kahn is a retired researcher/writer. |
New Partnership for Healthy Futures
Minister for Local Government and Minister for Aboriginal and Torres Strait Islander Partnerships
The Honourable Mark Furner
A $150,000 Palaszczuk Government partnership with one of Queensland’s largest Indigenous-controlled health organisations is helping to Close the Gap of disadvantage on National Close the Gap Day.
Minister for Local Government and Minister for Aboriginal and Torres Strait Islander Partnerships, Mark Furner today signed a significant agreement with the Institute for Urban Indigenous Health (IUIH).
“The Memorandum of Understanding on National Close the Gap Day is expected to deliver new school-based traineeship opportunities, employment opportunities and better health outcomes for Indigenous Queenslanders,” Mr Furner said.
“Up to $150,000 in funding over two years will be delivered to the Institute for Urban Indigenous Health to encourage and prepare more Indigenous Queenslanders to take up careers in health care.
“It gives Indigenous healthcare workers an unrivalled opportunity to make a positive contribution to the lives and health outcomes of family, friends and entire communities.
“The initiative highlights the Palaszczuk Government’s commitment to working in partnership with industry, enabling community-led solutions and resourcing on-the-ground initiatives to help Close the Gap on education, life expectancy, employment and economic participation.
“Signing today’s Memorandum of Understanding with the Institute is an important reminder that Closing the Gap isn’t something that can be achieved in isolation; it’s a collective initiative across communities, across industries and across the nation.
“We must work together for results.”
Institute for Urban and Indigenous Health Chief Executive Officer Adrian Carson said the new partnership would strengthen the organisation’s commitment to Indigenous Queenslanders.
“With almost 500 Indigenous employees, the Institute for Urban Indigenous Health and its four founding member organisations, Brisbane ATSICHS, Kambu Corporation for Health, Yulu-Burri-Ba, Kalwun Health is the biggest employer of Aboriginal and Torres Strait Islander people within the South East Queensland Region,” Mr Carson said.
“As a national leader in Indigenous healthcare service and employment, the Institute for Urban and Indigenous Health is perfectly positioned to generate meaningful outcomes in health, employment and economic participation.
“Quality of health is directly related to quality of life — all sectors must work together to help Indigenous Queenslanders live healthier, happier and longer lives.
Key MoU features include:
Supporting 10-school based trainees per year
Creating pathways to increase numbers of Indigenous trainees
Delivering post-traineeship placement and employment programs
Increasing retention rate of post-traineeship Aboriginal and Torres Strait Islander employees
Assisting IUIH to develop and deliver South East Queensland trainee models aimed at increasing the number of school-based traineeships
Assisting IUIH to develop its Procurement Strategy and Evaluation Framework.
The Institute for Urban Indigenous Health leads the planning, development and delivery of comprehensive primary healthcare services to the Indigenous population of South East Queensland.
Filed Under: News Tagged With: Aboriginal and Torres Strait Islander, Close the Gap, health, indigenous, traineeships, workforce
Skilling Queenslanders for Work’s successful projects announced as new funding round opens
Four ways job descriptions can help you and your team
ECT Mentoring and Coaching
Early Childhood Teachers often find it difficult to get to professional development. We know this. …
Queensland’s Workforce Readies for NDIS Jobs Bonanza
Queenslanders can look forward to a jobs boom and a stronger, more capable workforce thanks …
Children making meaning about their world: Language – Gold Coast
ACECQA’s Agency of the Child Workshops
Mental Health Issues at Work – What’s my role? |
New oral drug candidate for African sleeping sickness
A new oral-only treatment for sleeping sickness has entered Phase II/III clinical study in patients with late-stage sleeping sickness in the Democratic Republic of the Congo (DRC) and soon in Central African Republic (CAR). The study, initiated by the Drugs for Neglected Diseases initiative (DNDi) and its partners, will test the efficacy and safety of fexinidazole, with once-daily tablets for ten days.
Sleeping sickness – or human African trypanosomiasis – is fatal without treatment. Spread by the bite of a tsetse fly, the disease threatens the most remote areas of 36 sub-Saharan African countries and, while currently in a period of decline, is known to re-emerge to epidemic levels when surveillance efforts wane. Children below 15 years of age represent nearly a quarter of current patients and DRC alone accounts for the majority of reported cases throughout Africa.
Current treatments for stage 2 of the disease – or late stage, when the parasites cross the blood-brain barrier – are difficult to administer as they require infusions that are only possible within a hospital infrastructure, in addition to the heavy transport necessary to get them there. Patients living far from this type of structure often have to travel for days, even by foot, to access treatment centres.
'This is a major step in research and development for neglected tropical diseases. It shows that it is possible to bring a new chemical entity through the pipeline to offer an entirely new perspective on tackling a disease like sleeping sickness', comments Dr Bernard Pécoul, DNDi's Executive Director. 'It is by connecting all of our partners in the endemic countries and around the world with the support of engaged donors – all with a common goal – that we can and will continue to search for adapted treatments for these diseases', he added.
Fexinidazole is the first success of the extensive compound mining efforts pursued by DNDi within the nitroimidazole project initiated in 2005 to explore new and old nitroimidazole drug leads. The objective is to progress fexinidazole through this pivotal Phase II/III study in order to register the drug as a new treatment for stage 2 sleeping sickness caused by the parasite Trypanosoma brucei (T.b.) gambiense, as well as for stage 1 sleeping sickness and sleeping sickness caused by T.b. rhodesiense.
If ultimately successful, fexinidazole would be the first oral treatment to be used for both stage 1 and stage 2 sleeping sickness, thereby replacing the complicated diagnosis and treatment paradigm, which includes systematic lumbar punctures of every diagnosed patient to determine the stage of the disease before deciding which treatment to administer.
'This new chemical entity gives us hope of a drastically simplified way to care for our patients', said Dr Wilfried Mutombo, National Human African Trypanosomiasis Control Programme , DRC, Investigator and Coordinator of the fexinidazole trial. 'In addition, the investments made into renovating the laboratories and hospital wards, training personnel, and introducing adapted technologies that allow us to report in real time on each patient, has elevated an entire group of dedicated professionals to international clinical research standards', he added.
The study was initiated and is conducted by DNDi in collaboration with the Swiss Tropical and Public Health Institute (Swiss TPH) and the Human African Trypanosomiasis national control programmes of the Democratic Republic of the Congo and Central African Republic, in addition to collaboration with Médecins Sans Frontières (MSF). The French pharmaceutical company Sanofi and DNDi co-develop the drug: DNDi is responsible for preclinical, clinical, and pharmaceutical development, while Sanofi is responsible for the industrial development, registration, and production of the drug at its manufacturing sites.
Recruitment for the study will include 510 patients at five clinical sites in DRC and one site in Central African Republic.
More information: About the fexinidazole study
The efficacy and safety study is a pivotal, non-inferiority, open, multi-centric and randomized Phase II/III study. The treatment regimen for fexinidazole will consist of 1 dose of 1800mg (3 pills) once a day for the first 4 days and 1 dose of 1200mg (2 pills) once a day for the following 6 days (10 days in total). The reference treatment, NECT, which will be administered for 10 days as well, with 3 oral administrations per day of nifurtimox for 10 days in combination with 2 intra-venous infusions per day of elfornithine (2-hours long each) for 7 days. Two-thirds of patients will receive fexinidazole, and one-third will receive NECT. The study will measure the safety and efficacy of fexinidazole, with NECT as the active comparator. NECT is currently the first-line treatment for stage 2 of the disease, which notably has replaced since 2009 the toxic arsenic-based melarsoprol. The protocol for the fexinidazole study was reviewed by an international ethics working group convened by the Société Française et Francophone d'Ethique Médicale (SFFEM) with WHO support, before being approved by the national authorities and the MSF ethics committee.
Support for the study
This project is supported by the Bill & Melinda Gates Foundation, Médecins Sans Frontières, the Spanish Agency for International Development Cooperation (AECID), the British Department for International Development (DFID), the French Ministry of Foreign and European Affairs (MAEE), the GIZ on behalf of the Government of the Federal Republic of Germany, the Dutch Ministry of Foreign Affairs (DGIS), the Swiss Agency for Development and Cooperation (SDC), and other individual donors.
Provided by Drugs for Neglected Diseases Initiative
Open access initiative reveals drug hits for deadly neglected tropical diseases
The Drugs for Neglected Diseases initiative (DNDi) and Medicines for Malaria Venture (MMV) announce today the identification of three chemical series targeting the treatment of deadly neglected tropical diseases (NTDs), through ...
Old drug shows new promise to treat leishmaniasis
(Medical Xpress) -- A study published yesterday shows that a drug called fexinidazole could potentially be used to treat visceral leishmaniasis, a parasitic disease that kills 50 000 to 60 000 people ...
Drug resistance danger for sleeping sickness treatments
(PhysOrg.com) -- Drugs used to treat the epidemic disease African sleeping sickness must be used prudently to prevent the parasite acquiring resistance to current medicines, a new study at the University of Dundee has shown.
New face of sleeping sickness epidemiology highlights need for new tools
Recent developments have rekindled hopes of eliminating human African trypanosomiasis (HAT), more familiarly known as sleeping sickness, as a public health problem in those areas of sub-Saharan Africa where the disease is ...
Fly gut bacteria could control sleeping sickness
A new bacterial species, found in the gut of the fly that transmits African sleeping sickness, could be engineered to kill the parasite that causes the disease. The study, published in the International Journal of Systematic an ...
Leaders of the nation's system for helping people injured by vaccinations are vowing to better publicize the little-known program.
Type 2 diabetes: Added benefit of canagliflozin plus metformin is not proven
The fixed combination of canagliflozin with metformin (trade name: Vokanamet) has been approved since April 2014 for adults with type 2 diabetes mellitus in whom diet and exercise do not provide adequate glycaemic control. ...
US approves new, hard-to-abuse hydrocodone pill (Update)
U.S. government health regulators on Thursday approved the first hard-to-abuse version of the painkiller hydrocodone, offering an alternative to a similar medication that has been widely criticized for lacking ...
Some low-cost generic drugs that have helped restrain health care costs for decades are seeing unexpected price spikes of up to 8,000 percent, prompting a backlash from patients, pharmacists and now Washington ...
The cost of patients not taking their medications as prescribed can be substantial in terms of their health. Although a large amount of research evidence has tried to address this problem, there are no well-established ...
Foundation sells $3.3B in Vertex drug royalties
The Cystic Fibrosis Foundation says it has sold royalty rights worth $3.3 billion for innovative drugs it helped develop with Vertex Pharmaceuticals Incorporated. |
Phlebotomy course offers training in Bozeman, Great Falls
A new Montana State University healthcare course combines online learning with hands-on training to prepare students for the Certified Phlebotomy Technician exam. The course is designed for people who plan to work for a clinical laboratory, public health department, clinic or hospital.
Students will participate in a month-long online course and a weekend of hands-on training at MSU in Bozeman, followed by a 100-hour supervised clinical experience that can be scheduled in either Bozeman or Great Falls.
After completing the classroom and clinical practicum components of the course, MSU will endorse students to sit for their exam through the American Society for Clinical Pathology in order to become a Certified Phlebotomy Technician.
The online course begins Oct. 5 and enrollment is limited. The instructor is Sara Handl, who has been working as a clinical laboratory scientist for the past 18 years and teaches for MSU Extended University and MSU-Great Falls College of Technology.
To register or for a schedule and more information, go to MSU Extended University's professional development course catalog at: http://eu.montana.edu/profdev or call (406)994-6683.
Lesa Pribyl, (406)994-7441, [email protected] |
Piscinae
Author James Higginbotham
Publisher The University of North Carolina Press
Pisciculture--the process of raising fish--held a lasting fascination for the people of ancient Rome. Whether bred for household consumption, cultivated for sale at market, or simply kept in confinement for reasons of aesthetic appreciation, fish remained an important commodity and prominent cultural symbol throughout the periods of the Roman Republic and early Empire. Roman pisciculture reached its greatest level of sophistication, though, between the first century b.c. and the first century a.d. with the development of a highly specialized architectural element: the piscina, or artificial fishpond. Based on a thorough examination of the archaeological record and complemented by site plans, maps, and photographs, James Higginbotham's work represents the most comprehensive study of the fishponds of Roman Italy. Higginbotham covers the technical aspects of Roman fishponds--their design, construction, and operation--and places the piscinae within their social, political, and economic context. He argues that in a society fascinated by pisciculture, ownership of a fishpond was a powerful display of wealth and social status and, ultimately, a manifestation of the intense competition between aristocratic Roman families that would eventually lead to civil war.
Originally published in 1997.
A UNC Press Enduring Edition -- UNC Press Enduring Editions use the latest in digital technology to make available again books from our distinguished backlist that were previously out of print. These editions are published unaltered from the original, and are presented in affordable paperback formats, bringing readers both historical and cultural value. |
Should local leaders pursue devolution deals for health care?
Felicity Dormon
Place-based and integrated care is fashionable in health and social care policy. There are a plethora of initiatives aiming to make them happen. Examples include the better care fund, Integrated care pioneers, Vanguards, Sustainability and Transformation Plans and devolution deals.
Devolution deals are somewhat different to the other schemes – led by local government rather than the NHS, and potentially more amenable to integration with services outside of health and social care. They also come with increased local political involvement and scrutiny (and uncertainty about whether this is compensated by a reduction in national interference).
Local areas are left with the difficult decision of how to use their limited time and energy. Should they choose one initiative and make it work? Is it better to do as many as possible? Is an under the radar approach more likely to succeed? Or should they go for a devolution deal?
The health care deals agreed so far do not involve any devolution (transfer of power between political levels), and only modest delegation (transfer of power between administrative levels). Indeed, the most recent deals only mention health care when describing future negotiations, rather than anything concrete. Leaders might perhaps wonder if all the negotiation to get to a deal was worth the effort.
As we set out in our report Catalyst or distraction? The evolution of devolution in the English NHS there isn’t empirical evidence that devolved health care systems consistently outperform their centralised cousins. Theoretical arguments can be made both for and against devolution. For instance, proponents argue devolution will enable health inequalities to be better recognised and addressed, centrists counter that it will lead to fragmentation that ultimately increases inequalities.
Internationally, devolution decisions are a product of their political and cultural context. It is no different here – the devolution agenda is strongly politically driven, and in health care there are centralising pressures and financial risk for local areas countering this drive. Widespread deficits are leading to ever increasing central ‘grip’ on the NHS, unlikely to be countered by the stated interest of NHS Improvement in creating a permissive environment for local change.
Whether to pursue a devolution deal for health care involves a certain amount of crystal ball gazing: will command and control continue in the NHS or slacken if the finances are bought back under control? Will a deal be an aid or a hindrance in difficult local and national conversations about reconfiguring services and making savings? Will it make the leadership of an area pull together for common purpose, or try and outmanoeuvre each other to get a better slice of the pie? How will the public react to a deal?
Greater Manchester have judged the odds and decided they can do a better job of managing their services than the current arrangements (although central priorities, such as 7 day services, still appear in their work). Others have decided that they will fare better without the scrutiny and resources involved in seeking a deal.
Change, including the taking of educated risk, is urgently needed in the NHS. But evidence implies that any benefit for the NHS from decentralisation is not just uncertain, but unlikely; local leaders and policymakers alike need to proceed with care.
Felicity Dormon, Senior Policy Fellow at the Health Foundation, is currently on secondment to NHS England. You can follow Felicity on Twitter @FelicityTHF
Your email address will not be published on the site and will only be used if we need to contact you about your comment.
View our comments policy
Featured in collection:
More blogs by author
Policy in austerity - more work needed
There is not enough money in health care – at least to do what we are doing. From Whitehall to hospital ward this is an increasingly recognised fact. We talk about efficiency savings – but as the P...
The Mental Health Taskforce: opportunity knocks?
The NHS England mental health taskforce has published its report, a Five Year Forward View for Mental Health. The initial reaction has been positive – alongside some concern about the money and imp...
Devolution: the plot thickens
It seems like a lifetime ago that I wrote about the recently submitted devolution deals, but it was only September. A lot has changed in devolution policy since then, keeping true to its beginnings...
view all articles by this author >
Sciana: The Health Leaders Network
The Sciana network brings together outstanding leaders in health and health care policy and innovation across Europe. Sciana provides the space and time to share learning and take inspiration...
Is devolution good for health?
Three new devolution deals were announced alongside the Budget this week - East Anglia, Greater Lincolnshire and the West of England. Other than updating the devolution map, these deals contain lit...
Catalyst or distraction?
‘Devolution’ – the transfer of power from a higher to a lower level of government – is high on the political agenda in England, and looks likely to remain so for the course of this parliament at le...
The Heart of Devolution
Following on from the publication of Catalyst or distraction?, last week the Health Foundation hosted its first ever pecha kucha event to explore the opportunities presented by devolution of Englis...
View all related content > |
Molecular phylogeography of the asp viper Vipera aspis (Linnaeus 1758) in Italy: evidence for introgressive hybridization and mitochondrial DNA capture
.The occurrence of variation in body size and reproductive traits of Vipera aspis was assessed by analysing 74 reproductive females of different populations, collected throughout a large part of the distribution range of the taxon, from central-western France to central Italy. Six populations were analysed, two of plain habitats, in France and Italy, characterized by a Continental climate, whereas the other four derived from two coastal and two inland, hilly Italian habitats, respectively, showing a Mediterranean climate. Females of the French area showed the smallest mean body size, whereas the pre-and post-partum body masses of females from the coolest, central Italic area were significantly higher. Litter size varied among habitats and was significantly correlated with maternal body size. If the snout–vent length feature varied largely among offspring of different habitats (with the longest size occurring in representatives of the coastal, central Italian area), the average of both body mass and total mass of offsprings did not exhibit any clear pattern among populations colonizing different habitats. Nevertheless, relative litter mass was higher in the French continental populations, and lower in the coolest, Mediterranean, Italian ones. It is worth emphasizing the positive correlation between the snout–vent length feature of females and the total litter mass to environmental factors, such as hottest month temperature and total rainfall. The available literature records that female body size affects offspring size and fecundity. If the present study bolsters this correlation, it also rules out any other effect of female body size on the offspring characteristics analysed. Finally, evidence is provided for the role of climatic factors on life-history traits (e.g. pre-partum body mass) of asp vipers, although confounding effects pursued, for example, by food availability may occur.
Titolo: Molecular phylogeography of the asp viper Vipera aspis (Linnaeus 1758) in Italy: evidence for introgressive hybridization and mitochondrial DNA capture
Barbanera F
Zuffi MAL
Guerrini M
GENTILLI, AUGUSTO SERGIO
Tofanelli S
FASOLA, MAURO
Dini F.
MOLECULAR PHYLOGENETICS AND EVOLUTION
Abstract: .The occurrence of variation in body size and reproductive traits of Vipera aspis was assessed by analysing 74 reproductive females of different populations, collected throughout a large part of the distribution range of the taxon, from central-western France to central Italy. Six populations were analysed, two of plain habitats, in France and Italy, characterized by a Continental climate, whereas the other four derived from two coastal and two inland, hilly Italian habitats, respectively, showing a Mediterranean climate. Females of the French area showed the smallest mean body size, whereas the pre-and post-partum body masses of females from the coolest, central Italic area were significantly higher. Litter size varied among habitats and was significantly correlated with maternal body size. If the snout–vent length feature varied largely among offspring of different habitats (with the longest size occurring in representatives of the coastal, central Italian area), the average of both body mass and total mass of offsprings did not exhibit any clear pattern among populations colonizing different habitats. Nevertheless, relative litter mass was higher in the French continental populations, and lower in the coolest, Mediterranean, Italian ones. It is worth emphasizing the positive correlation between the snout–vent length feature of females and the total litter mass to environmental factors, such as hottest month temperature and total rainfall. The available literature records that female body size affects offspring size and fecundity. If the present study bolsters this correlation, it also rules out any other effect of female body size on the offspring characteristics analysed. Finally, evidence is provided for the role of climatic factors on life-history traits (e.g. pre-partum body mass) of asp vipers, although confounding effects pursued, for example, by food availability may occur. |
West Virginia 's Wildlife Conservation and Restoration Program By Kathy Leo
Despite more than a century of conservation work, much still remains to be done to ensure that all wildlife species will exist for future generations. In response to this challenge, Congress appropriated $50 million nationwide in 2001 for the Wildlife Conservation and Restoration Program (WCRP). West Virginia 's share of this funding is $483,000. Projects must involve wildlife species with the greatest conservation need. Because these projects require a 25 percent match of state funds, the actual total spent on projects amounts to $670,000. The match comes from the sale of rose-breasted grosbeak and white-tailed deer wildlife license plates. Congress appropriated the federal funds at the urging of the Teaming With Wildlife Coalition, made up of over 3,000 conservation organizations and businesses across the nation. Our West Virginia Teaming With Wildlife Coalition consists of 51 organizations and is still growing. This is a very exciting era for some of the state's lesser-known species, as this dedicated funding will ensure that attention is paid to creatures before they become endangered. West Virginia WCRP projects are divided in three categories: Conservation, Education and Recreation. Conservation Native Perennial Plant Management on Wildlife Management Areas. Wildlife managers have long recognized the need to create low-maintenance wildlife habitats on state managed lands. Several hundred acres on selected WMAs have been planted with native warm and cool season grasses, legumes and shrubs that provide food as well as nesting, winter and escape cover for a diversity of wildlife. Henslow's sparrows, grasshopper sparrows and meadowlarks benefit from the cover provided by warm season grasses. In addition, field sparrows, slate-colored juncos and cardinals can eat the seeds produced from these plantings. Redwing blackbirds, meadowlarks and field sparrows use cool season grasses as nesting cover, and meadow voles and several species of mice use these grasses as food. Partners In Flight. The West Virginia Partners in Flight working group was formed in 1994 and is composed of individuals from universities, state and federal government agencies, conservation groups and businesses. They are committed to the conservation of wild birds and their habitats through management, research, monitoring, and public information and education. In this project, a statewide system of bird point counts is being established. Currently there are 147 routes in 53 counties. Thus far, bird point counts are conducted in 29 of the 69 WMAs, with plans to establish routes in all of them. This information will help biologists to estimate bird populations as well as establish baseline numbers that will alert us to any changes in bird populations that may require conservation action. A songbird management guide will be available later this year from the DNR Wildlife Resources Section to help landowners make timber management decisions that benefit songbirds. Herpetological Atlas. Dr. Thomas K. Pauley is completing the state's first herpetological atlas that will form the basis of the second edition of the popular but now out-of-print field guide, Amphibians and Reptiles in West Virginia . The atlas, which will outline the distribution of amphibians and reptiles in the state, will be available in 2005. WCRP funds have also been used to study the life history of selected species as well as gather distribution information. Specifically, turtle distribution was studied in 10 major river systems of the state. Important Bird Areas Program. Data from nearly 40 years of Breeding Bird Surveys indicate that bird populations are declining across North America , and for many species, these declines are precipitous. While data from West Virginia show declines, most are less severe than the national trends. Because of the comparatively large populations of some of these birds in West Virginia , researchers from eastern states feel that West Virginia may provide source populations for bird species that have declined significantly in the region. Thus, it is imperative that West Virginia takes steps now to conserve these species. Important Bird Areas will serve as places for bird conservation, for monitoring and research activities, and for public education. A technical committee has been formed, and stakeholders will nominate sites around the state. The committee will select sites on science-based criteria to maximize bird conservation. In the future, once sites are identified, signs and a guide to the areas will be produced to make the public aware of their existence. Education Publications. The Mushrooms of West Virginia and the Central Appalachians by William C. Roody is a general identification guide to the mushrooms of this region. It features descriptions and beautiful color photographs of nearly 400 species. About 800 copies were donated to schools, public libraries, and university and college libraries throughout the state. Funds from WCRP also paid for the publication of five issues of West Virginia Wildlife magazine. Several brochures have been reprinted and new booklets on West Virginia tiger beetles and salamanders created. Educational Displays and Presentations. The Wildlife Diversity Program has several colorful and interactive educational displays for use at public functions. WCRP funding was used to update these and create new ones. In addition, staff are often called upon to give presentations across the state. New PowerPoint presentations are being developed on a variety of topics for distribution to DNR biologists for educational presentations. Interpretive Enhancements at the West Virginia State Wildlife Center at French Creek. New educational signs now grace the outdoor animal exhibits at the Center. A pond has been created complete with an observation platform. A new interpretive trail winds through 80 acres of beautiful old growth forest. School classes can use a new outdoor amphitheater and visitors can check out the new snake exhibit. Recreation Greenbottom Wildlife Management Area. Greenbottom WMA located near Huntington encompasses nearly 1,200 acres. Stretching along the banks of the Ohio River , this area contains 300 acres of forest, 180 acres of wetlands, 680 acres of agricultural land, and 40 acres of open water. The habitats of Greenbottom WMA support a wide array of wildlife, including 30 species of mammals, 105 species of birds in the summer and fall and 47 in the winter, 12 species of amphibians, and 5 species of reptiles. A boardwalk and observation platform that give an excellent view of the marshes have been constructed. Using a new educational booklet, visitors can take a self-guided tour. These are just a few of the many new opportunities made available to West Virginians who appreciate and enjoy our rich natural heritage. For more information, contact Kathy Leo at: DNR Wildlife Resources, P.O. Box 67, Elkins, WV 26241, phone: 304-637-0245 or email: [email protected]. Kathy Leo is the Wildlife Diversity Program Coordinator. Subscribe | Current Issue | Past Issues | Contact Us | WVDNR Home |
International CCN Society
The CCN family of proteins: a 25th anniversary picture
Perbal A.,International CCN Society | Perbal B.,French National Center for Scientific Research
Journal of Cell Communication and Signaling | Year: 2016
The CCN family of proteins is composed of six members, which are now well recognized as major players in fundamental biological processes. The first three CCN proteins discovered were designated CYR61, CTGF, and NOV because of the context in which they were identified. Both CYR61 and CTGF were discovered in normal cells, whereas NOV was identified in tumors. Soon after their discovery, it was established that they shared important and unique structural features and distinct biological properties. Based on these structural considerations, the three proteins were proposed to belong to a family that was designated CCN by P. Bork. Hence the CCN1, CCN2 and CCN3 acronyms. The family grew to six members a few years later with the description of three proteins WISP-1, WISP-2 and WISP-3 (CCN4, CCN5 and CCN6), that shared the same tetramodular and conserved structural features. With the functions of the CCN proteins being uncovered, this raised a nomenclature problem. A scientific committee convened in Saint Malo (France) proposed to apply the CCN nomenclature to the six members of the family. Although the unified nomenclature was proposed in order to avoid serious misconceptions and lack of precision associated with the use of the old acronyms, the acceptance of the new acronyms has taken time. In order to evaluate how the use of disparate nomenclatures have had an impact on the CCN protein field, we conducted a survey of the articles that have been published in this area since the discovery of the first CCN proteins and inception of the field. We report in this manuscript the confusion and serious deleterious scientific consequences that have stemmed from a disorganized usage of several unrelated acronyms. The conclusions that we have reached call for a unification that needs to overcome personal habits and feelings. Instead of allowing the CCN field to fully crystalize and gain the recognition that it deserves the usage of many different acronyms represents a danger that everyone must fight against in order to avoid its deliquescence. We hope that the considerations discussed in the present article will encourage all authors working in the CCN field to work jointly and succeed in building a strong and coherent CCN scientific community that will benefit all of us. © 2016 The International CCN Society
PubMed | International CCN Society and French National Center for Scientific Research
Type: Journal Article | Journal: Journal of cell communication and signaling | Year: 2016
The CCN family of proteins is composed of six members, which are now well recognized as major players in fundamental biological processes. The first three CCN proteins discovered were designated CYR61, CTGF, and NOV because of the context in which they were identified. Both CYR61 and CTGF were discovered in normal cells, whereas NOV was identified in tumors. Soon after their discovery, it was established that they shared important and unique structural features and distinct biological properties. Based on these structural considerations, the three proteins were proposed to belong to a family that was designated CCN by P. Bork. Hence the CCN1, CCN2 and CCN3 acronyms. The family grew to six members a few years later with the description of three proteins WISP-1, WISP-2 and WISP-3 (CCN4, CCN5 and CCN6), that shared the same tetramodular and conserved structural features. With the functions of the CCN proteins being uncovered, this raised a nomenclature problem. A scientific committee convened in Saint Malo (France) proposed to apply the CCN nomenclature to the six members of the family. Although the unified nomenclature was proposed in order to avoid serious misconceptions and lack of precision associated with the use of the old acronyms, the acceptance of the new acronyms has taken time. In order to evaluate how the use of disparate nomenclatures have had an impact on the CCN protein field, we conducted a survey of the articles that have been published in this area since the discovery of the first CCN proteins and inception of the field. We report in this manuscript the confusion and serious deleterious scientific consequences that have stemmed from a disorganized usage of several unrelated acronyms. The conclusions that we have reached call for a unification that needs to overcome personal habits and feelings. Instead of allowing the CCN field to fully crystalize and gain the recognition that it deserves the usage of many different acronyms represents a danger that everyone must fight against in order to avoid its deliquescence. We hope that the considerations discussed in the present article will encourage all authors working in the CCN field to work jointly and succeed in building a strong and coherent CCN scientific community that will benefit all of us.
“Knock once for yes, twice for no”
Perbal B.,International CCN Society
Previous studies have indicated that the expression of CCN3, a member of the CCN family of proteins, was tightly regulated during central nervous development and was associated with acquisition of cognitive functions in rats (Perbal, Mol Pathol 54(2):57–79, 2001; Su et al. Sheng Li Xue Bao 52(4):290–294, 2000) therefore suggesting that CCN3 might be involved in higher levels of physiological communication in the brain. In spite of the considerable amount of progress made into the understanding of neuronal organization and communication, reducing the knowledge gap between brain cellular biology and behavioral studies remains a huge challenge. Mind-to-mind communication has been the subject of numerous science fiction writings, intense research and emotional debates for many years. Scientists have tried for a long time to achieve transmission of messages between living subjects via non intrusive protocols. Thanks to the great progress made in imagery and neurosciences, another dimension of neuronal function in communication has now been documented. Two recent experimental demonstrations of direct brain to brain communication without physical contact (Grau et al. (2014) Conscious brain-to-brain communication in humans using non-invasive technologies. PLoS One. Aug 19;9(8)- - Rao et al. (2014) A direct brain-to-brain interface in humans. PLoS One. Nov 5;9(11)) pave the road to more sophisticated applications that could profoundly affect communications of humans with other humans, animals and machines. Although the wide use of such applications might seem a long way off, they raise quite a number of ethical, legal and societal issues. © 2015, The International CCN Society.
Flaws in the peer-Reviewing process : A critical look at a recent paper studying the role of CCN3 in renal cell carcinoma
A critical look at a recently published manuscript reporting the role of CCN3 in the regulation of clear cell renal cell carcinoma (RCC) biology raises several scientific concerns, and reveals flaws in the reviewing process which appear to have resulted in the dissemination of conclusions that are not supported by proper experimental procedures. In the example presented here, the observed biological effects are attributed to a high molecular weight "CCN3" protein which is detected by a single commercial antibody that was not shown in the experimental conditions used by the authors to be a valid reagent capable of stringently detecting the "canonical" CCN3 protein. Experiments establishing that inhibiting the production of high molecular weight "CCN3" protein would reverse these biological effects were not performed. The case discussed here clearly demonstrates that unreliable data can go through peer reviewing and be published. As the data can end up being cited and used as a potential reference by new investigators in the field, we believe that such data can throw roadblocks across the scientific path of inquiry and mislead investigations. We therefore raise awareness for the need of a more stringent peer reviewing process in which assurance can be had that the strength and precision of the data have been thoroughly checked by experts in the CCN field, and previous work properly referenced. © The International CCN Society 2012.
Focus on the patentability of computer programs
The Nuts and Bolts section of our Journal (mirrored on the ICCNS society web site), is meant to provide a very practical way to share useful information, that goes beyond the scope of cell signaling and basic CCN protein biology. Considering the number of requests we have had for information related to protection of Intellectual Property (IP), I am pleased to initiate what will be a series of articles that will focus on various IP topics. The inaugural topic is the protection of computer programs. Some colleagues may wonder how and why the patentability of computer programs is a topic of interest for scientists working on CCN proteins . . . As a matter of fact, to assist us in analyzing the potential involvement of CCN3 in human genetic diseases, we considered developing a computer program designed to analyze large amounts of data. Sharing the concepts and the computer program raised concerns regarding IP and protection of the software that we would handle. We believe that many colleagues have encountered similar problems. This article provides a short focus on computer program patentability. It is aimed to provide basic legal information, and to help our readers in understanding the process. It is not intended to replace IP counselors or technology transfer departments. Future articles will address other practical aspects of IP protection. © 2014 The International CCN Society.
Communication is the key.: Part 2 : Direct to consumer genetics in our future daily life ?
The considerable advances of genome sequencing over the past decades have had a profound impact on our daily life and opened up new avenues for the public to have access to their genetic information and learn more about their ancestry, genealogy and other traits that make each of us unique individuals. A very large number of individual single nucleotide polymorphisms (SNPs) have been associated to diseases whereas others have no known phenotype. For example, among the SNPs mapped within ccn1(cyr61), ccn2(ctgf), ccn3(nov), ccn4(wisp-1), ccn5(wisp-2) and ccn6 (wisp-3), only mutations within ccn4 were associated to PPD (the autosomal recessive skeletal disorder Progressive Pseudorheumatoid Dysplasia). On the occasion of this JCCS special issue on the roles of hormetic responses in adaptation, and response of living species to the modifications of their environment, it appeared that it was a good time to briefly review a topic that has been the subject of passionate discussions for the past few years, that is Direct to Consumer genetic tests (DTC GT). Based on the use of DNA analysis and identification of polymorphisms, DTC GT have been developed by several companies in the USA and in countries where there was no legal obstacle for customers to have direct access to their genetic information and manage their healthcare. Problems that arose and decisions that have been taken by regulatory agencies are presented and discussed in this editorial. The « freeze » of health-oriented DTC GT in the USA neither implies the end of DNA analysis nor « fun » applications, which are not aimed at providing risks estimates for particular illnesses. As shown in the example which is discussed in this editorial, DTC GT for cosmetic applications might be considered a fun application of great interest for companies such as L’Oréal, who recently developed the Makeup Genius mobile application. Other fun applications of DTC GT are discussed but there is no doubt that nothing will stop progress and it is most probable than within a few years from now all the tensions raised about these procedures will vanish to the profit and benefit of consumers. In any case, this will only be possible through an intensive communication effort, because …communication is the key ! © 2014, The International CCN Society.
7th international workshop on the CCN family of genes: Nice to be in nice
In this Editorial, I would like to provide our readers with a brief mid-year update about our activities and efforts to bring together researchers working on intercellular signaling proteins at international meetings. The roots emerged about 20 years ago in the discovery of three genes originally designated cyr61, ctgf, and nov. The proteins encoded by these genes were first proposed to constitute a family of proteins (CCN) which now comprises 6 members (CCN1, CCN2, CCN3, CCN4-6) including the wisp proteins. These proteins were recognized to share a striking structural organization and a high degree of identity although they exhibited quite distinct biological properties. After historical considerations regarding the reasons for using the CCN acronym, and how the ICCNS publishing landscape that drove the ICCNS from Cell Communication and Signaling to the Journal of Cell Communication and Signaling, this short update will focus on the 7th edition of the International Workshop on the CCN family of genes to be held in Nice, Oct 16-19, 2013. © 2013 The International CCN Society.
CCN3: The-pain-killer inside me
There is increasing evidence that metalloproteinases are involved in neuropathic pain [Dev et al., Expert Opin Investig Drugs 19:455-468 2010] Hence, the identification of molecules that can regulate MMP9 and MMP2 is warranted. In a recent publication, Kular et al. (2012) claim that CCN3 functions to decrease inflammatory pain via the regulation of two metalloproteinases, MMP2 and MMP9, in response to experimentally-induced inflammation. Their conclusion is based on the following observations: i) the expression of CCN3 was reduced following induction of pain by subcutaneous injection of complete Freund's adjuvent in rat's paw, ii) an inhibition of MMP9 decreased CFA-associated mechanical allodynia, iii) inhibition of CCN3 expression by siRNA led to an upregulation of MMP2 in the dorsal horn of the spinal cord (DHSC) and MMP9 in the dorsal root ganglia (DRG), iv) a partial effect of CCN3 on CFA-induced expression of MMP9 and MMP2 in DRG and DHSC following intrathecal injection of CCN3. Unfortunately, the conclusion of this study is weakened by the lack of experimental evidence showing a direct relationship between the expression of CCN3 and MMPs. Furthermore, several results contained in this manuscript only confirm data that were previously established by others. Owing to the wide range of activities which have been attributed to CCN3 (Perbal, Mol Pathol 54:57-79 2001, Brigstock, J Endocrinol 178:169-175 2003, Perbal, Lancet 363 (9402):62-64 2004, Perbal, Cell Commun Signal 4:6 2006, Holbourn et al. Trends Biochem Sci. 33:461-473 2008, Leask and Abraham, J Cell Sci 119:4803-4810 2006, Jun and Lau, Nat Rev Drug Discov 10:945-963 2011, Rachfal and Brigstock, Vitam Horm 70:69-103 2005), the mechanisms underlying the potential role of CCN3 in the expression of these MMPs in the context of inflammatory pain must be thoroughly studied before a meaningful conclusion can be reached. Indeed, Kular et al. description of variations in CCN3, MMP9 and MMP2 levels occurring simultaneously is not sufficient to draw a functional relationship between these three proteins. It should be noted that the expression of CCN3 was already reported to repress MMP9 (Benini et al., Oncogene 24:4349-4361 2005, Fukunaga-Kalabis et al., Oncogene 27:2552-2560 2008) and the roles of CCN3 in inflammatory processes has been extensively documented in the past few years (Bleau et al., Front Biosci 10:998-1009 2005, Lin et al., J Biol Chem 280:8229-8237 2005, Perbal, Cell Commun Signal 4:6 2006, Hughes et al., Diabetologia 50:1089-1098 2007, Lin et al., J Cell Commun Signal 4:141-153 2010, Pasmant et al., J Neuropathol Exp Neurol 69:60-69 2010, Shimoyama et al., Thromb Vasc Biol 30:675-682 2010, Lemaire et al., J Invest Dermatol 130:2517 2010, Chen and Lau, J Cell Commun Signal 4:63-69 2010, Le Dréau et al., Glia 58:1510-1521 2010, Rittié et al. J Cell Commun Signal 5:69-80 2011, Janune et al., J Cell Commun Signal 5:167-171 2011). In addition, the expression of CCN3 in the neurons of dorsal root ganglia and dorsal horn of the spinal horn in rat and human has also been documented (Su et al., C R Acad Sci III 321:883-892 1998, Mol Pathol 54:184-191 2001, Kocialkowski et al., Anat Embryol (Berl) 203:417-427 2001). Implication of CCN3 in cognitive functions (Su et al., Sheng Li Xue Bao 52:290-294 2000) and the possible involvement of CCN3 in the regulation of pain was already suggested almost a decade ago (Perbal, Expert Rev Mol Diagn 3:597-604 2003, Perbal et al., Mol Pathol 56:80-85 2003) with the demonstration of cell-specific effects of CCN3 on intracellular calcium stores and inhibition of anionic channels by CCN3 (Li et al., Mol Pathol 55:250-261 2002, Lombet et al., Cell Commun Signal 1:1 2003, Perbal, Expert Rev Mol Diagn 3:597-604 2003, Perbal et al., Mol Pathol 56:80-85 2003). Aside from these general aspects, and in the light of the potential participation of CCN3 in the whole process of pain sensing, the reader would have appreciated the discussion in this manuscript not being essentially a flat summary of the data presented, but a more thorough discussion of the possible role for CCN3 in the regulation of MMPs and its significance in the context of the wide biological functions of CCN3. © The International CCN Society 2012.
CCN proteins: A centralized communication network
The CCN family of proteins includes six members presently known as CCN1, CCN2, CCN3, CCN4, CCN5 and CCN6. These proteins were originally designated CYR61, CTGF, NOV, and WISP-1, WISP-2, WISP-3. Although these proteins share a significant amount of structural features and a partial identity with other large families of regulatory proteins, they exhibit different biological functions. A critical examination of the progress made over the past two decades, since the first CCN proteins were discovered brings me to the conclusion that most of our present knowledge regarding the functions of these proteins was predicted very early after their discovery. In an effort to point out some of the gaps that prevent us to reach a comprehensive view of the functional interactions between CCN proteins, it is necessary to reconsider carefully data that was already published and put aside, either because the scientific community was not ready to accept them, or because they were not fitting with the « consensus » when they were published. This review article points to avenues that were not attracting the attention that they deserved. However, it is quite obvious that the six members of this unique family of tetra-modular proteins must act in concert, either simultaneously or sequentially, on the same sites or at different times in the life of living organisms. A better understanding of the spatio-temporal regulation of CCN proteins expression requires considering the family as such, not as a set of single proteins related only by their name. As proposed in this review, there is enough convincing pieces of evidence, at the present time, in favor of these proteins playing a role in the coordination of multiple signaling pathways, and constituting a Centralized Communication Network. Deciphering the hierarchy of regulatory circuits involved in this complex system is an important challenge for the near future. In this article, I would like to briefly review the concept of a CCN family of proteins and critically examine the progress made over the past 10 years in the understanding of their biological functions and involvement in both normal and pathological processes. © 2013 The International CCN Society.
What kind of a life for a scientific journal?
PubMed | International CCN Society
In June 2015, Thomson Reuters informed our publisher Springer that the Journal of Cell Communication and Signaling, the official journal of the International CCN Society, had been selected for coverage in Thomson Reuters products and services. Beginning with V. 1 (1) 2007, this publication would be indexed and abstracted in Science Citation Index Expanded (also known as SciSearch), Journal Citation Reports/Science Edition, Biological Abstracts and BIOSIS Previews . In this fall editorial I briefly revisit a few milestones of the JCCS life since it was first created in 1988, with the deep and genuine willingness to help in the dissemination, in the highly competitive world of publishing, of the best quality science regarding the roles of CCN proteins in signaling. No more documents
Loading International CCN Society collaborators |
INTEGRATION OF FISHERIES INTO COASTAL AREA MANAGEMENT
2. Interactions
Both capture fisheries and aquaculture may generate positive and/or negative impacts on the coastal area and these need to be taken into account in the definition of policy measures for the sector. Synergistic and complementary impacts tend to be similar within the fisheries sector and between fisheries and the other sectors (they are hence dealt with together). Negative externalities generated by the fisheries sector tend to be different in capture fisheries compared to aquaculture (the two are therefore considered separately).
2.1 POSITIVE IMPACTS OF THE FISHERIES SECTOR
Positive impacts of the fisheries sector can be considered according to the three broad categories of effects the sector may have on: economic development; coastal area management; and ecosystem monitoring and rehabilitation.
2.1.1 Regional and national economic development
The fisheries sector, as with other economic activities, may provide a focus for overall economic development (e.g. in island states, such as Iceland, and in coastal countries with extensive coastlines and rich fisheries resources, such as Mauritania or Peru). Most frequently the sector will have a strong regional impact.
The resource rents that the sector generates, especially the capture fisheries subsector, can be used to finance investments within or outside the sector, provided a mechanism exists for such rents to be collected by a resource owner (usually the state).
One specific contribution of the sector is the employment opportunities it generates, especially in remote and marginal areas (see Section 1.1.1).
The fisheries sector contributes to domestic food security and self-sufficiency, although this objective may conflict with the desire to earn foreign exchange. In the Philippines, the shift in the utilization of coastal ponds from the production of milkfish largely for domestic consumption to the production of the more lucrative shrimp for export has had negative consequences on domestic supplies of milkfish. Valuable rice land may also have been lost as a result of conversion into, or salinization by, shrimp ponds (Primavera, 1994).
2.1.2 Coastal area management
The fishing industry can make a positive contribution to the wider objectives of coastal area management. Fishing activities (e.g. ports, fishing boats, landing sites and fish markets) contribute to shaping the landscape, giving it attributes that are attractive to many people, both those living permanently in the area and tourists. In addition, the relative dispersion of the activity, in particular artisanal fishing, may contribute to maintaining viable rural communities and balancing the trend towards growing coastal urbanization.
2.1.3 Ecosystem monitoring and rehabilitation
The fisheries sector is also an observer of the coastal environment capable of alerting the relevant authorities in case of some major hazard such as pollution. In addition, major changes in ecosystems are often first witnessed by fishers and fish farmers. Aquaculture can provide relief to overexploited species. Overexploitation, both biological and economical, is generally a result of the higher prices obtainable for such species, which in turn is what provides investors with good profitability from related aquaculture operations. By contributing to satisfying the demand for such species, aquaculture can have a positive impact on the state of wild species; higher supplies will tend to bring down prices, making capture fishing efforts less attractive. This effect has been noted in the case of salmon, for example. For some species, aquaculture may also contribute effectively to conservation. Tisdell (1989) gives the example of giant clams, a species that has been overexploited to the point of being listed in the Convention on International Trade in Endangered Species. However, not all countries are signatories to the Convention and even when they are, loopholes can be found. All species of giant clam have now been successfully bred in captivity and mariculture may therefore be used as an effective means of conservation.
2.2 COMPLEMENTARY INTERACTIONS PERTAINING TO FISHERIES There are a number of complementary interactions pertaining to the fisheries sector. These include market and non-market linkages and the use of collective goods and services.
2.2.1 Market linkages
Market linkages include intrasectoral interactions (e.g. between capture fisheries and ancillary activities such as net-making, or between capture fisheries and aquaculture through the supply of fishmeal), and cross-sectoral interactions (e.g. between forestry and fisheries through the supply of timber for boat-building, or between agriculture and aquaculture through the supply of feed).
2.2.2 Non-market linkages
The activity of fishing or fish farming is often included as an element of a household's wider production function. Inputs used (e.g. upstream production such as boats or gear) and outputs provided (e.g. fish caught) are exchanged within such households, outside the market. Such complementarities may in some cases determine part of the fisheries sector dynamics; for example, the supply of capital and labour of the fishing activity may evolve in close relation to agricultural activities undertaken by the household.
2.2.3 Use of collective goods and services
This includes for example, harbour facilities or road networks. Various sectors such as aquaculture, agriculture and tourism may also derive benefits from the existence of a natural (e.g. mangrove) or artificial (e.g. dyke) protection from erosion and storm surge.
2.3 NEGATIVE EXTERNALITIES GENERATED BY FISHERIES Most of the negative externalities generated by the fisheries sector are intrasectoral, i.e. they affect mainly the sector itself. 2.3.1 Negative externalities generated by capture fisheries
Negative externalities generated by capture fisheries include an excessive decrease in biomass, modification of the coastal environment, space congestion problems, subsectoral conflicts and impacts on other sectors.
Excessive decrease in biomass. In the absence of fishing, a fish stock will tend to some average size that reflects the carrying capacity of the environment and interactions with other species (predators, etc.). Changes in environmental conditions (e.g. exceptional conditions for larval survival or the increase in a predator stock) will alter the biomass of the stock. Fishing adds another predator to the system.
The reduction in biomass is not a problem in itself, provided management measures lead to the regeneration of the resource. However, it is an issue if the reduction is so great that the fish stock faces biological (and thus commercial) extinction. It is also an economic issue if, as a result of reduced biomass, high effort levels are required to produce a given catch where lower effort levels would be needed for the same catch if the fish stock were allowed to recover.
Modification of the coastal environment. Although all fishing methods involve some perturbation of the marine environment, some have an environmental impact that extends far beyond the target species, for example the use of poisons and explosives, trawling and the use of other moving gears that tend to plough the sea bed, thereby significantly perturbing the benthos. In addition, habitat might be affected when infrastructures such as harbours are built, involving the conversion of wetlands or the disappearance of some microhabitats or critical nursery space.6
Efforts aimed at a target species may affect other fish and non-fish species. This kind of problem affects particularly trawling and net-based fishing generally. The optimal mesh size required for one species may be smaller than for a second species found in the same area with the result that significant by-catches are taken of the second species. Where a trawl fishery exploits many species simultaneously, as in tropical waters, this problem may prove intractable. Stocks of larger species may be consistently biologically overexploited to the point of extinction. Introducing devices aimed at avoiding such wastage can entail prohibitive costs and the alternative to the by-catch may be not to fish at all. Space congestion problems. The development of capture fisheries also generates space congestion problems that may prove to be particularly stringent in the coastal area, especially near densely populated areas. This concerns the activity of fishing itself, but also fish landings, and shelter and maintenance of the fleet and gear, including associated infrastructure.
Subsectoral conflicts (industrial, artisanal, recreational). There are various sources of conflict within the fisheries sector. These include conflict for a particular fishing area or for the fish stock, or between artisanal and industrial fishers. For example, large-scale fishing vessels often operate closer to shore than the law allows. Conflicts also occur between commercial and recreational fisheries (see Box D.2).
BOX D.2
Fisheries and ecotourism
The coastal fisheries resources available to many countries constitute not only a source of food and income but also an important tourist attraction. The concept of ecotourism centres around the use of the resources of the coastal area for water sports such as swimming and diving, and the touristic interest of fish, coral reefs and other underwater resources. Sport fishing and diving are also gaining increasing importance for tourism. Touristic uses can be beneficial, for instance, game fishing generates substantial revenues and is selective, while for many reef-dependent species, localized fishing sanctuaries can help to reduce conflict between user groups.
However, with few exceptions, exploitation of sea and fisheries resources for tourism will usually lead to conflicts with more traditional fishing activities since fishers rarely reap the benefit from this alternative use of the resource they draw their livelihoods from. Simultaneously increasing tourism and fishing will thus always lead to allocation problems. Coordination of traditional fisheries, marine reserves and various forms of tourism is the best way to avoid conflicts among different users of coastal areas. Short- and long-term resource allocation strategies will have to be established in accordance with countries' economic and social needs. Impacts on other sectors. Impacts on other sectors in the coastal area relate essentially to the status of marine populations, pollution and the availability of space.
Decreased biomass or modification of species assemblages brought about by fishing may have cross-sectoral consequences where other users such as local diving operators or environmental conservation associations place a value on the affected species or species assemblages. The resulting conflicts may be particularly strong if the impacts concern non-fish species, such as marine mammals, sea birds or sea turtles. Insofar as conservationist activities are in the longer-term interests of fishers themselves, dialogue is required to overcome the dispute.7
In addition, the fishing industry affects other sectors through pollution, e.g. water pollution from fishing vessels, air pollution from fish smoking, fishing vessels and processing plants, or noise pollution from traffic generated by fishing activity, especially relating to the movement of fish from the market to the consumer. Waste generated by fish landing sites and tar balls on beaches creates substantial pollution and discourages tourism and bathing uses of the coast.
2.3.2 Negative externalities generated by aquaculture
The long-term trend in aquaculture appears to be towards intensification and increased control over the site and species characteristics (World Bank, 1992). The characteristics of coastal resources used by aquaculture, especially the fluid nature of water resources (and hence water quality) and lack of clearly defined resource-use rights8 explain most of the negative externalities generated by the sector.
Overexploitation. Aquaculture may contribute to various kinds of overexploitation. For example by affecting populations of wild seed (when aquaculture depends on wild stocks) and fishmeal species in cases of cultured species (such as salmon or shrimp which require high-protein feeds). In large-scale oyster culture (for example in France), where sharing the resource base implies sharing the overall trophic capacity of the coastal embayment (i.e. available primary production and other sources of nutrients), many growers assumed that by increasing individual stocks a greater share of the resource could be reaped. In fact, such competitive overstocking by growers can result in stagnation of total output (caused by excessive total biomass), decreased productivity, longer growing cycles, higher natural mortality and a greater risk of disease epidemics (Heral, Bacher and Deslous-Paoli, 1989). The main reason for this is that, while access is limited on the basis of area, productivity depends on the overall trophic capacity of the entire bay which is shared by all the sites in the area. This example demonstrates that limiting access is not always sufficient unless the correct variable is identified. A better approach in this case would be to limit overall production according to estimated carrying capacity, and share it among growers, taking measures to ensure that quotas are not exceeded.
Pollution and habitat degradation. Aquaculture itself can generate pollution through release of organic waste, chemicals and inorganic nutrients. For example:
the deposition of organic fish farm and bivalve waste has been shown to cause enrichment of the benthic ecosystem in the vicinity of fish farms, resulting in the formation of anoxic sediments, increased oxygen consumption by the sediment, the flow of dissolved nutrients and changes in the benthos;
some of the chemicals used in aquaculture (antibiotics, pesticides) may have toxic effects, possibly leading to increased pest and disease resistance, and potentially posing as a threat to human health;
inorganic nutrients (nitrogen and phosphorus) released by intensive aquaculture cages or ponds can lead to nutrient enrichment and, depending on site-specific conditions, to occasional phenomena of eutrophication of local ecosystems, especially in semi-enclosed coastal embayments (e.g. fjords, inlets). However, aquaculture is most often a victim of eutrophication caused by other sources, leading to fish deaths and a decline in fish quality.
Other negative impacts of aquaculture can arise from the clearing of mangroves, which are seen as an unproductive resource, their total goods and services being unrecognized,9 to build fish ponds (destruction of wetland habitats). It has been estimated that in the Philippines, severe mangrove loss occurred over the period 1967 to 1977 (WRI, 1986; Primavera, 1994). Moreover, in Thailand and Taiwan, Province of China, for example, intensive shrimp culture in coastal ponds has been observed to cause saltwater intrusion, leading to degradation of agricultural land, as well as to land subsidence (Insull, Barg and Martosubroto, 1995).
Impacts on ecosystem structure. Farmed fish may escape and pose a risk to wild species inhabiting open waters in the same area through competition for habitat and food. They may also spread disease. Also associated with the problem of escape is the effect that aquaculture might have on genetic diversity.
Subsectoral conflicts. Another source of negative impacts is linked to the economic and social effects that aquaculture development may have; large-scale aquaculture may result in the displacement of fishers, or other small-scale resource users, especially where common property resources are not regulated. Conflicts can be particularly severe between traditional aquaculturists producing for local needs, and commercial fish farming enterprises producing for export markets.
Impacts on other sectors. As with capture fisheries, the negative externalities generated by aquaculture activities are mainly intrasectoral although cross-sectoral impacts also exist. Aquaculture may limit public use of water space (e.g. physical obstructions to fisheries and navigation) or be seen as affecting landscape aesthetics in areas of natural scenic beauty, and this could lead to a decline in tourism. In this respect, it should be noted that the site requirements of aquaculture (sheltered, unpolluted waters) are often those valued by other users, primarily tourists.
2.4 NEGATIVE EXTERNALITIES GENERATED BY OTHER ACTIVITIES THAT AFFECT FISHERIES
Coastal waters are the ultimate recipient for pollutants coming from land, rivers, air and the sea. Coastal lagoons, estuaries, semi-enclosed seas and shallow littoral waters of the open coast seem to be the areas where most damage is concentrated. This will need to be considered in the definition of management strategies for the coastal area.
BOX D.3 Fisheries institutions and the other sectors Few coastal area management schemes neglect fisheries. However, the emphasis is often on the management of fishery habitats rather than the regulation of fishing effort or the establishment of quota schemes. The reasons for this are quite clear; fisheries are often an important economic sector in the coastal area and fishing communities reside therein. More importantly, fishing communities are often the segment of the coastal population most seriously affected by detrimental environmental effects and spatial competition with other sectors. However, there is the paradox that, as other economic sectors expand in the coastal area, the relative economic importance of fisheries declines, weakening the influence that fisheries sector institutions can exert on policy decisions.
In Trinidad, for example, the role of fisheries in terms of their contribution to national income and employment is minimal compared to that of other sectors, so it was not possible for a coastal management process to be headed by the Fisheries Department even though the latter had initiated such a process. In Sri Lanka, on the other hand, where fisheries play a relatively more important role in the coastal area, the management programme was initially located within the ministry responsible for fisheries even through the main concern was coastal erosion which threatened wider interests than fisheries. In the Maldives, integrated reef resource management has also been initiated by the ministry responsible for fisheries, but tourism interests clearly also weigh heavily.
In the United States, which promulgated coastal zone management legislation in the 1970s, fisheries management measures such as effort regulations and quotas are normally not dealt with in the coastal zone management programmes of the various states, but are handled through regional fisheries management councils. However, fisheries benefit from measures to maintain sensitive coastal ecosystems and measures to limit and reduce water pollution.
In the Philippines, fisheries sector institutions and fishing communities play a major role in coastal zone management programmes while coordination is done largely through intersectoral agencies such as the National Economic and Development Authority and the Department of Environment. Broad government responsibilities have been decentralized and delegated to local municipalities and, where fishing communities make up a large percentage of the local population, they can exert significant influence. However, the interests of small- and large-scale fishers are often in conflict, and local-level interests can be overruled through forces from the centre. Nevertheless, the degree of decentralization and delegation of management authority need to be important considerations of any demand that fisheries sector participants (such as fishers' organizations) may make on the institutional structure of coastal management programmes.
An important lesson from the above examples is that it is in the interests of the fisheries sector institutions to take the initiative of a process of coastal area management; this will usually allow them to exert more influence on future developments. In this regard, an important principle stated in the coastal zone management legislation (or policy) of some countries is to give priority to coast-dependent development. The application of this principle provides a first rationale for allocating scarce coastal resources by giving added weight to uses (or sectors) that by their very nature are dependent on inherent attributes of the coastal area. Fisheries and fishing communities clearly fall within this category whereas many activities of other sectors may not.
When complex intersectoral management problems arise in the coastal area, and the role of fisheries declines, the influence of fisheries sector institutions may depend on the kind of alliances they can create with other sectors or segments of the population on issues of common interest.
Fisheries agencies also need to change their orientation, developing more interest in what other sectors are planning to undertake in the coastal area. Furthermore, they need to develop or acquire expertise to be able to evaluate the consequences of these undertakings on the fisheries and fishing communities.
Source: Willmann, 1996.
2.4.1 Pollution Most aquatic pollution in coastal areas originates from land-based sources, the rest coming from shipping, waste dumping, oil production and offshore mining.10 Land-based pollution can be transported in a variety of ways (e.g. rivers, freshwater runoff, the atmosphere). Pollution may significantly decrease marine environmental quality. Population growth in coastal areas, which leads to urban development and changes in land and other resource uses, also induces various forms of pollution. A major factor is increased waste water discharge into the sea leading to nutrient and organic enrichment and ecosystem disruption, including adverse consequences of eutrophication and reduction of freshwater inflow caused by irrigation and urban uses.
Another common source of pollution is agricultural waste such as toxic compounds from pesticides. Many such compounds have long half-lives and consequently tend to have long-term effects. Industrial waste also comprises many toxic substances including heavy metals, radioactive elements, acids and industrial chemicals. Oil spills are another common source of acute pollution.
Aquatic pollution, even at low levels, may influence fish production in numerous ways: reduction of stocks by mass mortality (particularly of larval and juvenile fish); gradual decline or changes in species composition of fish populations or entire ecosystems; increased occurrence of diseases; slower growth rates; and deterioration of the food quality of fish. Long-term effects of aquatic pollution on fish should not be underestimated. Species may be disadvantaged through chronic effects such as tissue damage, impaired reproduction or abnormal larval development.
Pollution can have especially severe effects on shellfish. In Canada, for example, over 200 000 ha of near-shore waters are closed for shellfish harvesting because of pollution; in the United States, one-third of shellfish beds have been closed. On a larger scale, the crash of the entire fisheries economy of the Black Sea area as a result of pollution, overfishing and the introduction of exotic species that feed on fish larvae is estimated to cost some US$1 billion per year (Barg and Wijkstrom, 1994).
Both capture fisheries and aquaculture are affected by land-based pollution. The problem is at once `worldwide yet highly specific to different geographic, ecological, social and economic situations' (Dahl, 1993). As a result, there can be no unique solution although some general principles may perhaps be enunciated.
Many of these problems may be aggravated, if not actually caused by, coastal tourism. Tourism leads to increased sewage, much of which is left untreated, resource depletion and conflict (e.g. between recreational and commercial fishers). Such problems are likely to be especially severe in the case of islands (Bass, 1993). Because the principal gains from tourism are clearly priced and easily observable, whereas the environmental costs generally affect unpriced resources, there is a tendency to overestimate the net social benefits of tourism and, consequently, to favour this sector over competing ones such as fisheries. Rational resource use requires that all benefits and costs associated with an activity be identified.11
2.4.2 Perturbation of critical habitats
Civil engineering works (e.g. road construction, dams, ports) may place further stress on coastal ecosystems as a result of soil runoff and degradation of critical habitats. Similarly, agriculture and forestry activities, through their impact on soil stability, may affect coastal sedimentation.12 Because of their importance for the productivity of marine communities and because of their particular location in the coastal area, a number of critical habitats must be considered specifically, as growing pressures on them may have significant consequences for the fisheries sector. These include mangroves, sea grass, lagoons and estuaries (see Box D.1).
The common feature of these habitats is that they provide valuable services that are difficult to observe and are unpriced. Because they are difficult to observe, there is a tendency to ignore them, for example fishers themselves may trawl through sea grass meadows despite the impact that this may have on their own future welfare. In many cases the value of such resources is grossly underestimated, pointing to an urgent need for studies and research to demonstrate their value. Given the widespread impact on the fisheries sector, the fisheries authorities should take the lead in organizing such work. More importantly, since the resources are unpriced, there is no mechanism for their value to be reflected. As a result, overexploitation of such habitat resources follows in the same way that it does in open-access fisheries. 6 See also Section 2.4.2.
7 See Part A, Section 2.3.4, Figure A.8 and Box A.20.
8 See Part A, Section 2.2.2.
9 See Part A, Section 1.6.1 and Part C, Box C.1 and Figures C.1 and C.2.
10 See also Part A, Section 1.3 for more on inland sources of pollution.
11 See Part A, Section 1.6.3.
12 See Part A, Sections 1.1, 1.3 and 1.7. |
Forestlands and LEED certification: Green building standards should be expanded
By Scott Hayes Through good and bad times, Oregon's millions of acres of forests and woodlands help drive Oregon's economy and provide an array of public benefits. Our private forestlands support 120,000 jobs and the livelihoods of countless families that depend on forest products for consumer goods, according to a report from the National Forest Owners Alliance. These are not just large, corporate timberlands. Forty-four percent of the private forests in Oregon belong to family woodland owners. Over the past several years, several forest management certification programs have been created to gauge the sustainability of forests. These programs offer recognition to woodland owners who practice good forest management, and certification can also provide financial incentives. Unfortunately, third-party certification has become a contentious issue in the green building movement. As pressure increases on businesses to "go green," organizations have formed to provide a seal of approval on environmentally sustainable construction materials. The U.S. Green Building Council is one that encourages the construction of environmentally responsible buildings. Builders earn credits toward a green ranking, known as LEED, by using wood from certified forests. Unfortunately, the Green Building Council's standard is too narrow, granting credit only for wood certified by the Forest Stewardship Council. This policy can have a negative impact on small woodland owners. A few Oregon Small Woodlands Association members' woodlands are certified under the FSC. More than 95 percent of association members are certified under the American Tree Farm System, with a few boasting more than 50 years of certified management. Both are credible systems for family-managed small woodlands. Many large landowners and wood-processing mills use the Sustainable Forestry Initiative Standard. These three independent, credible third-party certification systems -- FSC, ATFS and SFIS -- should be recognized by the Green Building Council. The council's current policy fails to recognize the good forest management practiced by many family woodland owners and large forestland owners. Because logs harvested from FSC-certified lands in Oregon are limited, most forest products companies are not able to compete in this growing construction market. It is important that Oregon leaders know the facts about certification and how preferential treatment of one system over another can harm Oregon's woodland and forestland owners. Numerous ordinances, orders and regulations at the local, state and federal levels mandate that public funding for the construction of buildings go toward only LEED-certified builders. This means timber not certified by FSC will not get LEED credits and will likely not be used for these projects. Oregon's Rep. Kurt Schrader and former Gov. Ted Kulongoski have both supported adding multiple third-party wood-product certifications to the LEED system. They understand that using financial incentives to improve the management of private lands remains a worthy goal. Agencies, organizations and businesses that seek to promote this goal would be wise to promote all certification systems that encourage good forest management. Scott Hayes is a retired forester and president of the Oregon Small Woodlands Association. He and his wife live on a 40-acre woodland near Forest Grove. Opinion Resources |
A Study of Peer Instruction Methods with High School Physics Students
Karen Cummings and
Stephen G. Roberts
This paper reports on the results of an experiment to test the use of a Peer Instruction (PI) pedagogical model in a small class, high school environment. The study reports findings based on a population of 213 high school students attending algebra based physics courses, both Honors and A level, taught by 5 different instructors. The results show a correlation between use of Peer Instruction and improved student conceptual understanding, as demonstrated by gains on a pre-/post- assessment instrument (FCI). However, there also appears to be a number of other factors that strongly influence the resulting gains. In addition to instructor differences, the data seem to indicate that students who are more "physics-inclined" and can answer questions correctly prior to instruction and prior to any Peer Instruction discussion subsequently achieve higher gains as measured by the FCI. While this is to be expected, the use of normalized gains is intended to mitigate this result, but it appears to be prevalent nonetheless. This raises questions as to what degree the FCI gains can be attributed to the use of Peer Instruction, to teacher differences, to student ability level or to simply increased familiarity with the question types presented on the FCI.
Volume 1064, Pages 103-106
= Cooperative Learning
= Peer Instruction
- Achievement
= Instruments
- High School- Graduate/Professional
01.40.J-
01.50.F-
Conceptual Learning, PERC 2008, Peer-instruction, educational aids, educational courses, educational technology, laboratory techniques, research and development management, student experiments
<a href="http://www.compadre.org/PER/items/detail.cfm?ID=8019">Cummings, Karen, and Stephen G. Roberts. "A Study of Peer Instruction Methods with High School Physics Students." Paper presented at the Physics Education Research Conference 2008, Edmonton, Canada, July 23-24, 2008.</a>
K. Cummings and S. Roberts, presented at the Physics Education Research Conference 2008, Edmonton, Canada, 2008, WWW Document, (http://www.compadre.org/Repository/document/ServeFile.cfm?ID=8019&DocID=715).
K. Cummings and S. Roberts, A Study of Peer Instruction Methods with High School Physics Students, presented at the Physics Education Research Conference 2008, Edmonton, Canada, 2008, <http://www.compadre.org/Repository/document/ServeFile.cfm?ID=8019&DocID=715>.
Cummings, K., & Roberts, S. (2008, July 23-24). A Study of Peer Instruction Methods with High School Physics Students. Paper presented at Physics Education Research Conference 2008, Edmonton, Canada. Retrieved June 22, 2017, from http://www.compadre.org/Repository/document/ServeFile.cfm?ID=8019&DocID=715
Cummings, Karen, and Stephen G. Roberts. "A Study of Peer Instruction Methods with High School Physics Students." Paper presented at the Physics Education Research Conference 2008, Edmonton, Canada, July 23-24, 2008. http://www.compadre.org/Repository/document/ServeFile.cfm?ID=8019&DocID=715 (accessed 22 June 2017).
Cummings, Karen, and Stephen G. Roberts. "A Study of Peer Instruction Methods with High School Physics Students." Physics Education Research Conference 2008. Edmonton, Canada: 2008. 103-106 Vol. 1064 of PER Conference. 22 June 2017 <http://www.compadre.org/Repository/document/ServeFile.cfm?ID=8019&DocID=715>.
Author = "Karen Cummings and Stephen G. Roberts",
Title = {A Study of Peer Instruction Methods with High School Physics Students},
%A Karen Cummings%A Stephen G. Roberts%T A Study of Peer Instruction Methods with High School Physics Students%S PER Conference%V 1064%D July 23-24 2008%P 103-106%C Edmonton, Canada%U http://www.compadre.org/Repository/document/ServeFile.cfm?ID=8019&DocID=715%O Physics Education Research Conference 2008%O July 23-24%O application/pdf
%0 Conference Proceedings%A Cummings, Karen%A Roberts, Stephen G.%D July 23-24 2008%T A Study of Peer Instruction Methods with High School Physics Students%B Physics Education Research Conference 2008%C Edmonton, Canada%V 1064%P 103-106%S PER Conference%8 July 23-24%U http://www.compadre.org/Repository/document/ServeFile.cfm?ID=8019&DocID=715
A Study of Peer Instruction Methods with High School Physics Students:
Peer Instruction Problems: Introduction to the Method
The effect of grading incentive on student discourse in Peer Instruction
A modeling method for high school physics instruction |
World Trade Center identifications pushed forensic DNA technology
At the end of more than three years, New York City's Office of Chief Medical Examiner (OCME) identified 58 percent of the 9/11 World Trade Center attack victims, thanks to innovative genetic analysis techniques, intergovernmental and family cooperation and the perseverance of dedicated forensic scientists, according to a recent book by Robert C. Shaler, professor of biochemistry and molecular biology and director of the forensics science major program at Penn State. "As of April 2005, when the process was suspended, we had identified only 1,592 out of the presumed 2,749 who died," said Shaler, the former director of the department of forensic biology, OCME, New York City and the man responsible for overseeing the DNA identification of World Trade Center victims. From the destruction of the Twin Towers in 2001 until his retirement in July 2005, Shaler oversaw New York City's efforts in identifying victims through DNA analysis. In the process of identifications, he and his colleagues pushed the edges of science and the technologies applicable to forensic investigations.
Penn State scientists honored by AAAS
Four Penn State faculty members have been elected to the rank of Fellow in the American Association for the Advancement of Science (AAAS). The honorees are: Stephen J. Beckerman, associate professor of cultural anthropology, the College of the Liberal Arts; Daniel Larson, the Verne M. Willaman dean of the Eberly College of Science; Barbara J. Rolls, professor and the Helen A. Guthrie chair of nutritional sciences, College of Health and Human Development; and Ayusman Sen, professor and head of the Department of Chemistry, Eberly College of Science.
Some Like it Hot: Extreme lifestyles in the deep sea
If you're anything like me, the phrase "marine life" probably brings to mind those creatures which typically appear on our dinner plates, such as fish, shrimp, and lobster. Charles Fisher, host of this Wednesday's Research Unplugged conversation "Some like it hot: Extreme lifestyles in the deep sea," had a few more, lesser-known—and much less edible—marine animals to add to that list.
Probing Question: Could Mars ever be made habitable for human beings?
Terraforming Mars—making the Red Planet Earth-like, so that humans could live there—is an idea that has been around since at least the early 1970s, when Carl Sagan and others first raised it seriously. In the 1990s, science-fiction writer Kim Stanley Robinson based his 1,600-page Mars trilogy (Red Mars, Green Mars, Blue Mars) on the concept.
Ask the average person his or her birthday, and that person will respond immediately and confidently. Ask about the birthdays of parents or close friends, and the response may be slower but still accurate. But ask for the birthday of something we all share—our planet—and the response may well be a blank stare.
Probing Question: What is antimatter and why does it matter?
The place is England. The year is 1928. One of the founding theorists of
quantum mechanics, Paul Dirac, is scratching his head because solutions to his equations have yielded unexpected results. For the solutions to make sense, he reasons, there must be a particle that has the mass of an electron but the opposite charge. At the time, such a thing was not known to exist.
Several years pass before American physicist Carl Anderson observes a "positive" electron, or positron that confirms Dirac's prediction.
Probing Question: How long can humans live?
Before answering, says Robert Mitchell, professor of biology at Penn State, "We have to distinguish between maximum lifespan, which is as long as any human has ever lived, and life expectancy, which is how long you could live predictably, based on insurance statistics, for example."
Probing Question: Is ours the only universe?
Astronomers Chris Palma and Jane Charlton answer:
Palma: There's a distinction that needs to be made here. When we loosely throw around the term "universe," usually what we mean is the observable universe, what we can see from here on Earth. We know roughly how old the universe is—the current number is 13.7 billion years. And we know the speed of light. So anything that is within 13.7 billion light years from Earth we can see because light from that object has had enough time to reach us.
Penn State's research reactor celebrates 50 years
August 15, 2005, Penn State's Breazeale Nuclear Reactor celebrated 50 years as the longest continuously operating university reactor in the United States.
Novel technique offers new look at ancient diet dogma
A Penn State researcher is part of the team that developed techniques that have generated insights into dietary divergences between some of our human ancestors, allowing scientists to better understand the evolutionary path that led to the modern-day diets that humans consume. The researchers, including Alan Walker, Evan Pugh professor of biological anthropology and biology, investigated microscopic wear on the teeth of two species of ancient hominims.
Elevated CRP can foil diet's ability to lower cholesterol
For people with high levels of C-reactive protein (CRP), a marker in blood for inflammation that is strongly associated with heart disease, trying to lower LDL-cholesterol through modest diet changes alone may not work. Kirsten Hilpert, doctoral candidate in the nutrition option of Penn State's Integrative Biosciences program, conducted a small study of the Step 1 diet's effect on men and women with moderately elevated cholesterol. She found that those who also had elevated CRP levels couldn't lower their LDL-cholesterol numbers with the Step 1 cholesterol-lowering diet, even when soy protein, a food with an approved FDA heart health claim, was added to the diet. "Although there are specific dietary factors, like soy, that have been shown to lower blood cholesterol, not all people experience this benefit," Hilpert noted. "Our study suggests that if your CRP is elevated, you may not be able to reap the full benefit of the Step 1 Diet with or without soy."
Featured Site: Venture Deep Ocean
Biology professor Charles Fisher will spend most of June far from land, leading a research expedition to the Lau Basin between Tonga and Fiji in the South Pacific. The three-week cruise aboard the research vessel Melville is the latest in a series funded by the U.S. National Science Foundation.
Second forensic scientist to join CSI: Penn State
Mitchell M. Holland, one of the nation's leading forensic DNA scientists, is joining the faculty of Penn State's new forensics major program as associate professor of biochemistry and molecular biology. This fall, Penn State undergraduate students can enroll in the forensics major, administered by the Eberly College of Science, but the major is a University-wide, interdisciplinary program incorporating basic science courses with courses from anthropology; entomology; veterinary science and toxicology; crime, law and justice; ethics; statistics; and psychology. Seminars in other topics also will be developed, including forensics business and management and mass fatality management. Additionally, the forensics faculty will be involved in the University's outreach program and will offer summer courses to Penn State students and professionals in the field.
NYC forensic scientist to head CSI: Penn State
This July, Robert Shaler, director of forensic biology in New York City's Office of Chief Medical Examiner, will leave the city to head Penn State's new forensics major program. He supervised the massive DNA testing effort to identify thousands of victims of the 9/11 World Trade Center attacks. "This will be the most rigorous and comprehensive forensics program in the country for undergraduates," says Shaler, a Penn State alumnus. "Students will be exposed to the forensic sciences immediately beginning in the first year and then throughout the entire program. My expectation is that Penn State will be training the future benchmark scientists and leaders in the field." This fall, Penn State undergraduate students can enroll in the forensics major, administered by Penn State's Eberly College of Sciencea, but the major is a University-wide, interdisciplinary program incorporating basic science courses with courses from anthropology; entomology; veterinary science and toxicology; crime, law and justice; ethics; statistics and psychology. Seminars in other topics also will be developed such as forensics business and management and mass fatality management. Additionally, the forensics faculty will be involved in the University's outreach program and will offer summer courses to Penn State students and also professionals in the field.
'Unlearning Separation' topic for Research Unplugged
Chris Uhl, professor of biology, will discuss "Unlearning Separation" at noon Wednesday, April 6, at the Penn State Downtown Theatre. Uhl's discussion is the final of the spring season of Research Unplugged. The event is free to the public. Downtown restaurants will provide light refreshments. The afternoon will begin with a 10-15 minute introduction of the topic, followed by an open floor for questions and discussion. Research Unplugged is sponsored by the Office of Research Publications at Penn State as an outreach component of the Office of the Vice President for Research.
The Atlantic: August 14, 2017
The next chapter in a viral arms race
A highly lethal disease that controlled Australia’s rabbit problem initially evolved to be milder—but has since rebounded into a newly nasty form.
Forbes: June 30, 2017
The search for alien astroengineers
Looking for a lone signal from some far-flung alien civilization is one thing --- looking for its handiwork on galactic scales is quite another.
ATMs dispense more than money: Dirt on your cash
Graduate student Johanna Ohm and biology professor Andrew Read explain the current dirty money research and how to track disease in this piece for The Conversation.
How super is Monday's supermoon?
Penn State astronomer, Christopher Palma, has mixed feelings about what’s being billed as the upcoming “super-supermoon.” |
Caregiving and Japanese welfare
Japanese citizens in Singapore
Ying Shan Kung, National University of Singapore [About | Email]
Volume 17, Issue 2 (Article 6 in 2017). First published in ejcjs on 27 August 2017.
This article explores how Japan’s political economy has affected the lives of Japanese citizens living outside Japan. Japan’s approach to welfare and the family during the high economic growth period has created a gendered distribution of labour in the family, resulting in the male breadwinner and female caregiver model. In light of Japan’s recent economic stagnation, the Japanese state has attempted to encourage more women to take up regular employment. However, many Japanese women are unwilling to give up their roles as primary caregivers of the household. This article examines the reasons why Japanese citizens in Singapore may be unreceptive towards the idea of married women working, even though it is generally accepted and easy to do in Singapore. This article argues that the Japanese citizens interviewed hold on to notions of gendered caregiving and work that hinder women from balancing career and caregiving, despite their geographical removal from Japan.
Keywords: women, caregiving, welfare, family, Singapore, transnational movement.
An effective welfare system is instrumental in ensuring that every citizen of the nation is well-cared for and has access to a comfortable life. Nevertheless, there is a disparity in approaches adopted by nation-states towards welfare provision. As Borovoy (2010) explains, Japan’s welfare system contrasts with the European-style welfare state that allows citizens to be dependent on the state for social support. Instead, Japan relegates social support and welfare to the family. Scholars Schoppa (2006) and Allison (2013) have illustrated the workings of such a system, where the availability of females as caregivers and the prosperous economy during the economic miracle supported and perpetuated each other. Under this system, caregiving work was expected to be undertaken within the household and by females. Women were tasked to care for children and the elderly, while supporting their husbands’ careers. The perceived effectiveness of this system led to Japan being dubbed a ‘welfare super-power’ in the 1970s (Schoppa 2006, p. 36). Nevertheless, it is undoubtedly wrought with its share of limitations and contradictions. While scholars have previously analysed the limitations of Japan’s welfare system in relation to the fall of the economy, this article problematises the system further by exploring transnational movement of Japanese citizens.
Globalisation has brought with it increased movement of people and ideas across national borders. This is further exacerbated by the trend towards deregulation of labour and capital as prescribed by neoliberal values (Ong 2007, pp. 3-4). This article explores how ease of movement of people has made them more vulnerable to certain problems. The study of transnational movement and families is not new. Kelsky (2001) explores Japanese women’s romanticising of the West and white men, bringing in themes of race, class and gender. Her work has been influential in highlighting racial hierarchies and, more relevant to this article, how transnational movement has allowed some women to escape the constraints of the expected family and corporate structure in Japan. Thang and Toyota (2015) study Japanese women in marriages with Balinese men and shed light on how the women form families that adhere to Japanese social norms. The article is particularly significant in showing how the women construct ‘traditional’ families and retain their cultural roots despite being geographically removed from Japan. Similarly, this article attempts to unravel notions of family and caregiving through an ethnographic study of a group of Japanese in Singapore. This article begins by establishing the theoretical framework for welfare and family structure in Japan, before analysing some interviews with Japanese citizens in Singapore. I explore their ideas of marriage and caregiving, followed by their sense of liberation from living outside Japan. I argue that the interviewees hold on to notions of gendered caregiving and work that hinder women from balancing career and caregiving, despite their geographical removal from Japan.
Japanese state’s approach to welfare and the family
The high economic growth in Japan beginning in the 1950s allowed for a system where companies and families supported and reinforced each other, which in turn ensured Japan’s economic progress and stability at the time. Schoppa (2006, p. 2) introduced the term ‘convoy capitalism’ to illustrate how large firms supported and ushered smaller firms during the period of economic growth, while the government supported the economy through ‘its bank-centred financial system, cartels, and extensive regulations’. Economic stability made it possible for firms to promise lifetime employment to regular male workers and provide their families with an array of benefits such as housing subsidies and family wage (Borovoy 2010, p. 62). This Japanese management system, accompanied with state policies, created an environment that encouraged women to be full-time housewives. Many women were provided with pension, tax credits and other benefits that incentivised them not to take up regular work, as a high income would make them ineligible for the benefits. Instead, they became a source of flexible labour that was used to support regular male workers (Schoppa 2006, p. 11). Thus, many women, freed from participation in paid labour, became full-time caregivers, while men were freed from caregiving work and focussed on their roles as breadwinners (Borovoy 2010, p. 64). It is important to note, however, that the system of lifetime employment and benefits to employees was not a reality for most of the Japanese population (Sugimoto 2010, pp. 88-89). Nevertheless, the hegemony of this system shaped Japanese ideas and beliefs of gender roles, traces of which still can be found today.
The lack of state-provided welfare also pushed women to become full-time caregivers for their families. Although childcare leave was available for working women, the lack of childcare facilities meant that women were unable to work while ensuring that their children were cared for (Schoppa 2006, p. 162). In addition, they also had to be available at particular times of the day to care for their children. For example, they needed to attend PTA meetings and aid their children in preparing for competitive examinations. Childcare facilities that supported working mothers were in shortage and many did not complement the mothers’ working schedules (Schoppa 2006, p. 47). Eldercare facilities and services were insufficient and too limited to serve the older population, thus requiring someone from the family to provide care. These factors left women little choice but to take up the role of a caregiver for family members, while at the same time reflecting and sustaining the gendered division of work. This was exacerbated by social norms that advocate women to get married early and commit themselves to caring for their children and the elderly, while supporting their working husbands (Schoppa 2006, p. 64). The idea of gendered division of labour is not new, but has existed since the Tokugawa period. Confucian scholar Kaibara Ekken (1630-1714) posited that it was women’s jobs as wives to take care of domestic matters, while men were responsible for affairs outside the house (Sekiguchi 2010, p. 97). Thus, gender norms and policies that established gendered division of labour were mutually reinforcing.
At the same time, the family was called upon to take on caregiving responsibilities. Since the Meiji period, Japanese state emphasised the ‘moral duty’ of the family and communities to support those in need, shaming those who ‘send one of its own out to bother outsiders and to depend on others for assistance’ (Borovoy 2010, p. 60). The cut-backs on ‘social assistance and public care services’ as economic growth fell in the 1970s also meant that the family had to step up as providers of care and welfare (Borovoy 2010, pp. 60-61). Thus, in addition to the belief that caregiving should be carried out by women, it was also important that caregiving work remained within the family. This formed the basis for ‘Japanese-style welfare society’ (Schoppa 2006, p.65), where women and companies filled in the gaps in welfare by the government.
The aforementioned system of welfare in Japan, which depends on women for caregiving and firms for enabling women with the financial stability to engage in full-time caregiving, began to collapse by the end of the 1980s, just as more married women took up employment (Peng 2001, p. 191). This was further exacerbated in the decades that followed. In response to the long-term economic stagnation and decline in birth rate in the 1990s, the Japanese government introduced structural reforms based on neoliberal principles, among which included reform of the family structure. The government noted that the family structure of a male breadwinner and female caregiver was no longer relevant due to the economic stagnation and change in people’s values towards the family. The 2002 White Paper on ‘Structural Reform and the Everyday Life of the Family’ sought to encourage more flexible working practices while providing more facilities and support for childcare and eldercare (Takeda 2008, pp. 153-154, 157-159). Viewing women as an untapped source of labour, the reforms encouraged more married women to take up paid labour. Underlying the new dual-income family model was the expectation that women be productive individuals through employment. However, these reforms were limited, as women were still expected to fulfil their role as caregivers and struggled to juggle both their careers and caregiving (Takeda 2008, pp. 164-165).
How have the different forms of family structure, as prescribed by the state, affected the lives of Japanese citizens on the ground? In what ways and why are career and caregiving still incompatible for some Japanese women overseas? This article aims to answer these questions through interviews with Japanese citizens in Singapore.
Research method
This article draws on interviews that were part of a project exploring the reach of Japanese political economy into the lives of Japanese citizens living abroad. The participants included seven Japanese citizens living in Singapore, whose names have been changed in this article. All interviews were conducted in 2016, one-on-one by this author and four other researchers, in public spaces or at the respondent’s home. They were then transcribed and shared among the research collective. Thus, while emphasising the life story of one particular individual, Kaori, this article incorporates findings from all seven respondents. Although the research findings are based on a small group of respondents, I believe this rich set of interviews sheds light on how family structure and caregiving norms are interpreted and practised on the ground among Japanese citizens residing outside Japan.
Table 1: Profiles of respondents
Age (Birth year)
Year that they first visited Singapore
Kaori 35 (1981) 2007 Single
Megumi 27 (1989) 2015 Married
Kumiko 39 (1977) 2011 Divorced
Takuya 34 (1981) 2014 Single
Tomoko 54 (1962) 1995 Divorced
Rie 34 (1982) 2015 Divorced
Yumiko 46 (1970) 1990 Married
Marriage and the Japanese wife
Kaori has been working in Singapore for nine years, and is currently employed by a Japanese company in Singapore. Despite being a single, Japanese woman working overseas, she was not consciously seeking better career opportunities outside Japan. Instead, when asked about her future goals, she revealed her hope to become a full-time housewife, dedicated to supporting her future husband and caring for her future children. She said that, in this aspect, her ‘thinking is still conservative’, unlike that of other women who wish to pursue their careers. She noted that growing up, she and her peers held the notion that ‘girls don’t need to work’, even though her mother had helped out in the family business. Ideally, she would have preferred to get married at the age of 25 or 26, but ‘didn’t have any chance’. She felt that it was ‘quite late’ still to be unmarried at 35, and expressed her desire to get married in a few years’ time. When asked if she would want to continue working after she gets married, she said it would depend on her future husband, but that she would prefer to be a full-time housewife, as long as her husband’s income allows it. Whether she stays in Singapore or returns to Japan in future would also depend on her husband. Her words seem to indicate that she has internalised social norms of her time when women were expected to get married and support their husbands and their husbands’ careers from home. Also, her notion of family fits into the model of a male breadwinner and female caregiver, and she does not seem to think she has a responsibility to work. Thus, calls for reform of the family in the 2000s do not seem to have affected her ideals or life. Nevertheless, she notes how this family structure is dependent upon the condition that her future husband has a sufficient income to support the family. Thus, she is aware that her ideal family structure may not be achievable in the current economy. Even as the male breadwinner and female caregiver model was not a reality for most families at any point in Japanese history, and is even less possible today with the global recession, the hegemony of the model is exemplified by Kaori’s ideal family structure.
Other interviewees acknowledged the expectation on wives to play a supporting role to their husbands. Megumi gave up the opportunity to pursue her Masters degree in the UK in order to be with her husband when he was posted to Singapore for work. Despite wanting to pursue her teenage dream, she ‘just gave up’ because ‘marriage is not about one person’, but ‘all about the family’. Even though her husband did not object to her going to the UK alone, his family did not want her to do so. Explaining her decision not to go, she said that it was ‘not very good’ for her as a wife to live abroad and leave her husband alone. When asked to explain what she meant, she clarified, ‘In Japan, most of the people still think that the woman has to take care of the family even though you don't have kids, the woman is the main person who cooks, does the washing, that stuff. All my families were thinking that why don't you take care of him, your husband? This is not normal.’ Even though she was not explicitly told not to go to the UK, she felt that leaving to pursue her dream on her own would compromise her role as a wife supporting her husband. It is interesting to note, however, that her husband is due to return to Japan for work, while she has decided to stay in Singapore to pursue her career, explaining that it would be a waste to quit after three months. While her adopted family had expressed disapproval towards this decision, she said, ‘I also want to live my life’. Perhaps she was able better to justify being apart from her husband this time since she was staying in Singapore while her husband returned to Japan, instead of her leaving her husband to go overseas.
Megumi’s story reveals a conflict between her career and domestic responsibilities. While Allison (2013, pp. 155-156) argues that women choose to exit the struggle of being working mothers by giving up either their careers or marriage, transnational movement has complicated the situation further by making career and domestic responsibilities incompatible for Megumi, forcing her to give up one or the other. While she could go back to Japan and find a job there, she was determined ‘never [to] go back’ to a Japanese company, due to her distaste for the long working hours expected from full-time career track employees. As a result, for the time being, her husband’s career and her career require that they be located in different countries. The choice for neither of them to give up their careers to follow the other would seem to reflect equality between the two of them. However, it should be noted that while Megumi was expected to care for and support her husband, the same expectation was not placed on her husband. This reveals the inadequacies of Japanese reforms of the family. While women are expected to fulfil both their roles as productive individuals as well as domestic caregivers, the perceived harsh working conditions in Japan have pushed Megumi to pursue a career overseas instead. The availability of the option to work overseas is particular to today’s context of globalisation, where increased flows of labour and capital across territorial borders have brought ever more people to move overseas for work. However, this option makes it even more difficult for women to provide care and work full-time at the same time. Also, one should note that Megumi and her husband are not free to work in any country as they please. Megumi lists her husband’s ineloquence in English and reluctance for either to leave their stable jobs as reasons for them living away from each other.
Similarly, Kumiko noted, ‘Marriage in Japan is very restrictive for girls. It is not between you and me, it is more like [a] tie between families’. She was married to a Japanese man she had grown up with, but got a divorce after leaving him to work in Singapore. Although her husband-at-that-time originally supported her decision to work in Singapore, her extended stay in Singapore had implicated their marriage. She explained that he was ‘really like shocked and surprised. He thought I would probably stay for one or two years and then return to Japan but I didn't. And then we sort of decided to live our life separately because there is no point to keep the marriage as we have nothing in common. We are still talking and communicating but not like husband and wife’. Thus, their divorce seems to be largely attributed to them living separately from each other. Even though reforms of the family have given women the responsibility of engaging in paid labour, Kumiko’s pursuit of her career at the expense of her caregiving duties posed a problem to her marriage.
All three women have subverted the family structure prescribed by the reforms in the 2000s that assign women the responsibilities of taking up paid labour while caring for their families. Kaori seems to be completely comfortable relying on her future husband financially, while Megumi’s avoidance of working in a Japanese company has distanced her from domestic duties. Kumiko’s decision to pursue an overseas career rather than stay with her husband has resulted in problems for her marriage. The fact that Megumi, the only one of the three who is married and working while away from her husband, is the youngest is telling. This could indicate a shift in ideas of marriage and the family over time, away from the notion that married women have to prioritise caregiving duties over anything else.
Childcare support for working mothers in Singapore and Japan
In June 2015, the female labour force participation rate in Singapore was relatively high at 60.4%, not too far from the male labour force participation of 76.7% (Singapore Department of Statistics 2016). This can be attributed to the support provided to working mothers in terms of caregiving help and parent-friendly working environments. In 2015, there were 1256 child care centres in Singapore, with a total capacity of 123,327 places. Approximately 77% of these places were filled, and 91% of the children in these centres were enrolled in full-day programmes. In addition, there were 6,262 places for infant care, of which 60% were filled (Early Childhood Development Agency 2016). Thus, there is an abundance of places for childcare admission in Singapore, and childcare centres operate long hours to cater to the working hours of parents. In addition, domestic help is readily available. In the 1980s, in an effort to encourage mothers to work, Singapore began introducing foreign domestic workers from neighbouring countries to Singapore, and the hiring of domestic help is still widely practised today (Gomes 2011, p.148). In 2015, 231,500 work permits were granted to foreign domestic workers (Ministry of Manpower 2016b). Domestic duties previously undertaken by the wife, such as childcare, eldercare, cooking and cleaning, are assigned to foreign workers instead. The availability of childcare assistance releases women from domestic duties and enables them to take up paid labour.
In addition, Singapore law requires companies to provide parents with paid leave to care for their children. Parents are entitled to six days of childcare leave in a year if their child (up to seven years old) is a Singapore citizen, and two days if their child is not. Mothers are entitled to 16 weeks of maternity leave if their child is a Singaporean citizen, and 12 weeks if their child is not. In addition, fathers of citizen children are entitled to one week of paternity leave (Ministry of Manpower 2016a). These laws strive to create a suitable working environment that caters to the needs of parents.
Similarly, Japan has been pushing for mothers to take up paid labour. However, support for working mothers is still lacking, contributing to Japan’s low female labour force participation rate (Reynolds and Shimodoi 2014). One reason is that day care centres are not available to many children. A total of 45,315 children were on the waiting list for admission into government-sponsored day care centres in 2015 (Ministry of Health, Labour and Welfare 2016), while private centres are expensive and thus unattainable to many (Begley 2016). Affordable foreign domestic help like that in Singapore is not available in Japan either, due to Japan’s strict immigration policies (Line and Poon 2013).
Tolerance and understanding for working mothers in the workplace also leaves much room for improvement. The term matahara, or maternity harassment, has emerged in recent years, indicating growing concern for discrimination of mothers in the workplace. Matahara is defined as harassment, termination of contract or demotion in the office due to pregnancy or childbirth. The number of matahara victims was estimated to be 170,000 in 2015. In a 2015 survey conducted by Matahara Net with 186 victims, approximately 30% received harassment from male superiors, while approximately 13% from Human Resource departments. Cases of the latter revealed a lack of awareness of the law regarding paid maternity and childcare leave, or blatant disregard for the law. In addition, approximately 23% of the victims received harassment from female superiors or colleagues. Thus, matahara is not solely attributed to gender discrimination, but also particular values towards work that view taking maternity or childcare leave as shirking of office duties. In contrast to the taking of sick leave, which is seen as inevitable and acceptable, taking maternity or childcare leave is seen as something one should be responsible for. Approximately 44% of the victims had to work long hours and regular overtime, and 42% took less than two days of leave in a year. Poor working conditions contribute to a breeding ground for matahara. Efforts by the victims to seek help from the company were mostly in vain, with 70% being dismissed or receiving worse treatment. Most of those who sought help from the Ministry of Labour were also dissatisfied with the assistance received (Igaya 2015).
Given Singapore’s relative success and Japan’s struggles with encouraging married women and mothers to work, it would be useful to study how Japanese citizens think about the working environment for mothers in Singapore, and investigate reasons that prevent Japanese women from working.
Reception towards support for working mothers
When asked to elaborate on her preference to be a full-time housewife rather than work after she has children, Kaori said, ‘It’s difficult to do both.’ She added, ‘I don’t like to hire maid, also. I don’t have this culture thing.’ While she notes that having domestic help in Singapore is much more affordable than in Japan, she is not receptive towards the idea. She explained, ‘[I] don’t know what they doing. So, [it is] better [if] I do [domestic chores] myself.’ It is interesting that she uses culture to explain her reluctance to hire domestic help. Culture is particular to a group of people, and commonly associated with beliefs and values shaped by interaction within the group (Spencer-Oatey 2012, pp.3-7). Therefore, her opposition against domestic help can be attributed to deeply-rooted ideas that have been ingrained in her when she was growing up in Japan. Her social background, education and socialisation are some factors that would have shaped her ideas and attitude towards caregiving, making her reluctant to make use of available caregiving help in Singapore.
When asked whether she thinks it would be tough to take care of her children alone, Kaori said that she ‘will try’ and that she might get the help of her in-laws when the time comes. In other words, she would be willing to accept help from her in-laws, people considered within the family, but not someone outside the family. Takuya felt similarly towards childcare. Having relocated to Singapore in hopes of advancing his career, he works long hours, sometimes ending at 10:00 PM. He expressed that he wanted his future wife to be a full-time housewife, and that childcare centres are ‘not good’, since children need contact and interaction with their parents. His ideal family mirrors that in which he grew up, as his father spent long hours at work while his mother was a full-time housewife. It is interesting that his ideal fits into the male breadwinner and female caregiver model, despite him having lived outside Japan for approximately half his childhood and youth. This suggests that even if Japanese government succeeds in creating an environment conducive for mothers to take up employment, existing Japanese notions of family and gender norms might prevent people from being receptive to the idea.
Despite the availability of domestic help and childcare facilities in Singapore, the two interviewees expressed a preference to have caregiving remain within the family. Their view towards caregiving supports the stance that Japanese state has taken in its efforts to minimise government expenditure on welfare. Even though the Japanese government has made efforts, exemplified by the Angel Plans in 1994 and 1999, to provide more childcare facilities (Schoppa 2006, pp.170-172), Kaori and Takuya still hold on to the notion that a child should be primarily cared for by family members.
Other interviewees also found companies in Singapore more willing to make concessions to working mothers. Tomoko noted that in Singapore, it is common for women to work even after getting married and giving birth, and companies were more flexible towards the women’s needs. She found it amusing that some women even took one-week leaves to care for their children during the major examinations. Megumi also observed that many women in Singapore continue to work, and have working hours adjusted to cater to school hours. While such practices are unquestioned in Singapore, she said that in Japan, others would think ‘you don’t work so much’ or are ‘not very serious’. Rie works in a Japanese company in Singapore that provides childcare facilities and childcare leave for mothers. She said, however, that ‘Japanese women generally feel insecure to take these up as they fear that they would be burdening others’ or ‘that they would be replaced easily when they return to the workplace’.
Among the interviewees, the environment in Singapore is conceived to be more understanding and flexible towards working women than that in Japan. While some Japanese women are quick to take advantage of this and continue working, others are less willing to make use of domestic help or childcare services because they would rather have caregiving remain within the family, or feel that working mothers may be a burden to their companies. Matahara is a societal problem, not just because women are being discriminated in the workforce, but because it reflects the persisting notion among perpetuators that mothers ought to focus their energies on caring for their children and that caregiving is incompatible with a full-time career. The fact that working mothers themselves feel hesitant to take their entitled days of leave shows how ideas of responsibility in the workplace, as encouraged by the 2000s reforms of the family, may make it more difficult for women to juggle both career and caregiving. Also, the assumption that caregiving should be done by the mother seems to be so deeply embedded in people like Kaori, that even after living in Singapore for many years and being exposed to the practice of hiring domestic help, she is unwilling to take advantage of it. Thus, even if a friendlier environment towards working mothers is successfully constructed in Japan, Japanese women may be reluctant to make use of it due to deeply-rooted ideas of childcare. Furthermore, the notion that caregiving and paid work are incompatible poses a problem to the reformed family model.
Life outside Japan
Kaori would prefer to live outside Japan after she gets married. She explained, ‘I don’t know people, right? So I don’t need to care about what they think. But [in] Japan, you know, I need to care about people, what they think.’ When asked to elaborate, she said that, in Japan, she had to face comments from relatives, friends and neighbours. ‘Because I’m quite old, but still not get married yet. So people think, why is she… Maybe she’s a bit high standard, or something like this. So, this is bothering me. And then, you know, like, if I get married and I live in Japan, then who is the partner, what is he doing, you know. What is his background, or what is he like. Everything. But here, overseas, I don’t know people. So people don’t bother me.’ With regards to her living outside Japan, the only thing that concerned Kaori was her family. She revealed, ‘I worry about my parents. They’re getting old. So if something happen[s], then I can’t fly to Japan so fast, right? Other than that, I don’t mind. That’s why I live here for long.’ She does not feel the need to stay in Japan, and would be happy in any country that allowed her to fulfil her role as a wife and mother. Living outside Japan freed her from having to consider the opinions of people around her, and thus, she felt more comfortable outside Japan.
Similarly, Yumiko stated that the best thing about living in Singapore was not having to care so much about others. She explained that it is easier to live as you please, in contrast to Japan where people think ‘too much about others’. Thus, she feels that Japanese people are sometimes hindered from doing what they would want to do, in fear of what people may think about them. In addition, moving back to Japan is out of the question for her. Notwithstanding her husband being unable to converse in Japanese, she felt that after spending her entire adult life in Singapore, she has become unfamiliar with the norms and expectations for an adult in Japan and would not be able to fit back in. A similar point was also raised by Rie, who pointed out that Japanese ‘are really conscious about people around them’, and think that ‘you are not living in this world alone so you cannot do things as you like’. She also emphasised that this is ‘just a natural way of doing things’, a norm that is assumed in Japan. She notes that this could be ‘quite stressful’.
The three interviewees noted a need to be more conscious of others when in Japan, and conceive it as something particular to Japanese culture. They reveal a common sense of constriction, of not being able to live and behave freely when in Japan. Thus, both Kaori and Yumiko feel much more at ease living outside Japan, and identified this as a reason for not wanting to return to Japan. It is worth highlighting that disapproval towards domestic help and over-sensitivity to what others think are both conceived to be particular to Japanese culture. While Kaori has chosen to live outside Japan in order to escape from the particularities of Japanese culture that constrain her, other aspects of her culture such as ideas on caregiving persist. The ease and proliferation of transnational movement has enabled her to exit Japan and live more freely elsewhere. However, deeply entrenched ideas towards caregiving and family are some reasons why career and caregiving are still incompatible for her and other Japanese women outside Japan.
The particular economic and welfare structure of Japan’s high-growth period characterised by convoy capitalism, the Japanese management system, and Japanese-style welfare society reflect and contribute to social norms that assign women to be caregivers of the family. However, Japan’s prolonged economic downturn has triggered structural reform policies in the 2000s targeted at changing familial and gender norms, so as to encourage married women to work (Takeda 2008, p.154). Nevertheless, as seen in interviews with Japanese citizens in Singapore, some Japanese still hold on to past notions of marriage and childcare. Thus, even though they live outside Japan and have easier access to caregiving support, they still find that working while caring for their families is a struggle.
Women are especially important to the Japanese government, which sees them as a source of flexible labour and the target of policies to boost the low fertility rates. However, the persisting notion that career and caregiving are incompatible poses a key problem that the government must tackle. The provision of childcare and eldercare services would be important, but even this would be limited, if women are unwilling to utilise them due to their notions of caregiving. Also, it is necessary to dispel the notions that women have to be key caregivers for the family and that workers should not burden their employees, before widespread acceptance of women in the workplace can occur. There is a need to change extant gendered notions of caregiving and work before policies and laws that encourage women to work and reproduce are able to produce significant results.
Allison, A., 2013. Precarious Japan. Durham: Duke University Press.
Begley, S., 2016. Japan’s Prime Minister Pledges to Fix Country’s Daycare Problem. Time [online], 14 March 2016. Available from: http://time.com/4258530/japan-day-care-shinzo-abe [Accessed 18 April 2016].
Borovoy, A., 2010. Japan as Mirror: Neoliberalism’s Promise and Costs. In: Carol J. G., ed. Ethnographies of Neoliberalism. Philadelphia: University of Pennsylvania Press, 60-74.
Early Childhood Development Agency, 2016. Quarterly Report: Statistics on Child Care Services [online]. Singapore: Early Childhood Development Agency. Available from: https://www.childcarelink.gov.sg/ccls/uploads/Statistics_on_child_care(STENT).pdf [Accessed 18 April 2016].
Gomes, C., 2011. Maid-in-Singapore: Representing and Consuming Foreign Domestic Workers in Singapore Cinema. Asian Ethnicity, 12 (2), 141-154.
Igaya, C., 2015. Matahara hakusho de higai jittai akiraka ni josei joshi kara mo bōgen: orosu no wa kantan jū kazoereba owaru. The Huffington Post [online], 30 March 2015. Available from: http://www.huffingtonpost.jp/2015/03/30/story_n_6967312.html [Accessed 18 April 2016].
Kelsky, K., 2001. Women on the Verge: Japanese Women, Western Dreams. Durham: Duke University Press.
Line, B. and Poon, L., 2013. How Other Countries Handle Immigration. National Geographic [online], 30 June 2013. Available from: http://news.nationalgeographic.com/news/2013/06/130630-immigration-reform-world-refugees-asylum-canada-japan-australia-sweden-denmark-united-kingdom-undocumented-immigrants [Accessed 18 April 2016].
Ministry of Health, Labour and Welfare, 2016. Heisei 27 nen 4 gatsu no hōikuentō no taiki jidōsū to sonogo (heisei 27 nen 10 gatsu jiten) no jōkyō ni tsuite [online]. Japan: Ministry of Health, Labour and Welfare. Available from: http://www.mhlw.go.jp/file/04-Houdouhappyou-11907000-Koyoukintoujidoukateikyoku-Hoikuka/0000078425.pdf [Accessed 18 April 2016].
Ministry of Manpower, 2016a. Childcare Leave Eligibility and Entitlement [online]. Singapore: Ministry of Manpower. Available from: http://www.mom.gov.sg/employment-practices/leave/childcare-leave/eligibility-and-entitlement [Accessed 18 April 2016].
Ministry of Manpower, 2016b. Foreign Workforce Numbers [online]. Singapore: Ministry of Manpower. Available from: http://www.mom.gov.sg/documents-and-publications/foreign-workforce-numbers [Accessed 18 April 2016].
Ong, A., 2007. Neoliberalism as a Mobile Technology. Transactions of the Institute of British Geographers, 32 (1), 3-8.
Peng, I., 2001. Women in the Middle: Welfare State Expansion and Devolution in Japan. Social Politics, 8 (2), 191-196.
Reynolds, I. and Shimodoi, K., 2014. Foreign Domestics Seen as Aiding Working Mothers. The Japan Times [online], 20 May 2014. Available from: http://www.japantimes.co.jp/news/2014/05/20/national/foreign-domestics-seen-aiding-working-mothers/#.VxFPLaR96hc [Accessed 18 April 2016].
Schoppa, L. J., 2006. Race for the Exits: The Unraveling of Japan’s System of Social Protection. Ithaca: Cornell University Press.
Sekiguchi, S., 2010. Confucian Morals and the Making of a ‘Good Wife and Wise Mother’: From ‘Between Husband and Wife there is Distinction’ to ‘As Husbands and Wives be Harmonious’. Social Science Japan Journal, 13 (1), 95-113.
Singapore Department of Statistics, 2016. Latest Data [online]. Singapore: Singapore Department of Statistics. Available from: http://www.singstat.gov.sg/statistics/latest-data [Accessed 18 April 2016].
Sugimoto, Y., 2010. An Introduction to Japanese Society. Cambridge: Cambridge University Press.
Takeda, H., 2008. Structural Reform of the Family and the Neoliberalisation of Everyday Life in Japan. New Political Economy, 13 (2), 153-172.
Thang, L. L. and Toyota, M., 2015. Making ‘Traditional’ Families in Transnational Settings: Japanese Women in Balinese-Japanese Marriages. In: Aoyama, T., Dales, L. and Dasgupta, R., eds. Configurations of Family in Contemporary Japan. New York: Routledge, 107-117.
Ying Shan Kung is a Japanese Studies undergraduate in the National University of Singapore. Her research interests are cultural diversity and transnational movement.
Article copyright Ying Shan Kung.
Page created 27 August 2017, last modified 27 August 2017. |
Obesity and Asthma — What's the Connection?You can't always prevent asthma, but studies are finding a new risk factor that you may be able to do something about. Find out how obesity and asthma are related, and what you can do to manage your asthma.By Diana RodriguezMedically reviewed by Niya Jones MD, MPH
If you're overweight or obese and often find yourself wheezing and having trouble catching your breath but don't know why, asthma may be to blame. Likewise if you have a history of asthma, but now find your asthma symptoms more difficult to control, obesity may be the culprit. Recently, experts have begun to recognize and investigate a possible link between obesity and asthma. In fact, the link between asthma and obesity may now be recognized too much — a study published in the medical journal CHEST found that obese patients are at risk of being incorrectly diagnosed with asthma, due to the similarity of symptoms, such as breathlessness. In the study, about one-third of obese patients were misclassified with asthma. One study, published in the August 2013 issue of the American Journal of Epidemiology, found that overweight and obese children had a higher chance of developing asthma — with more severe symptoms.
Obesity and Asthma: Determining the True Link
The idea that obesity and asthma may be linked is a fairly new one, so there isn't a whole lot of data to go on, explains Beth A. Miller, MD, associate professor at the University of Kentucky College of Medicine and director of the UK HealthCare Asthma, Allergy and Sinus Clinic in Lexington. The association between the two conditions can be striking — several studies have shown that obese children and teenagers were twice as likely to have asthma as children at a healthier body weight. Another study of more than 1,000 people found that obese adults with asthma are almost five times more likely than non-obese asthmatics to be hospitalized due to asthma. And an August 2012 study linked obesity with worse asthma flare-ups in seniors.
"There are studies that suggest that physiologically, obesity can cause asthma," says Dr. Miller. "We think it's because in obese people their lungs are under-expanded, therefore they take smaller breaths ... [making] their lung airways … more narrow" and prone to irritation. It has been long recognized that airway swelling and inflammation help to trigger asthma attacks. Obesity, as defined by a body mass index (BMI) of 30 or higher, and asthma are also thought to be linked by inflammation. Researchers have "found that [obese] asthmatics ... have more chronic low-grade systemic inflammation," says Miller, meaning that they suffer from inflammation that affects the whole body. "Asthma is a chronic inflammatory disease. Because obese patients have this inflammation … obese patients [may be] more likely to be asthmatic." The Impact of Obesity on Asthma
Based on this initial research, it appears there is a link between obesity and asthma — one that can be supported by what experts already know about each individual disease. So what does this mean for you and your health? Obesity can worsen asthma symptoms and make them more difficult manage. Simply being obese may put you at increased risk of developing asthma. In addition to being hospitalized more frequently due to their asthma, obese asthmatics have also been found to experience a poorer quality of life than asthmatics that aren't obese. Asthma, Obesity, and Other Conditions
Miller also points out that it's important not to forget about all the indirect ways that asthma and obesity may be linked. Obese people, for instance, are also more likely to experience acid reflux, which can both trigger and mimic asthma symptoms, Miller says. Sleep apnea, a condition that leads to difficulty breathing and decreased oxygen levels at night, is also common among obese people, and it is associated with asthma-like symptoms such as wheezing and shortness of breath as well. Will It Help to Lose Weight?
Weight loss is an important step toward better health for anyone who is overweight or obese, but perhaps even more so for those with asthma. Research shows that obese people with asthma who lose weight may experience an improvement in their asthma symptoms. Weight loss would certainly be a recommended part of any asthma treatment plan for someone who is obese, particularly if he has poorly controlled asthma requiring frequent hospitalizations, notes Miller. While it’s critical to consider other factors, such as smoking and allergies, that also need to be managed, obesity shouldn't be overlooked in asthma management. "It's definitely an important component of their disease that needs to be considered," stresses Miller. Learn more in the Everyday Health Asthma Center.
Last Updated: 08/28/2013 | Next Article: Risk Factors And Warning Signs For Type 2 Diabetes » Leave a comment
More on Asthma
Asthma Information Articles
What Causes Asthma?
The Anatomy of an Asthma Attack
Childhood Asthma
The Link between Air Pollution and Asthma Asthma and Indoor Air Pollution
Preparing an Asthma Attack Action Plan
Understanding Allergic Asthma
Smoking and Asthma
'Hearing' Asthma: What's a Wheeze?
Asthma Glossary
10 Key Questions About Asthma
Questions to Ask Your Doctor About Asthma
Obesity and Asthma: What's the Connection?
How Weather Affects Asthma
Glossary of Asthma Terms
Asthma Inhaler Primatene Mist Going Off the Market
Use of Asthma Controller Meds on the Rise Among United States Kids
Some Asthma Drugs Raise Risk of Complications, Especially in Kids
More Children Using Preventive Asthma Drugs |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.