Split (1)

train · 360k rows

image image	latex string	filename string
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Predictor} & \multicolumn{2}{c\|}{\textbf{Univariate analysis}} \\ \hline & \textbf{Odds ratio (95\% CI)} & \textbf{P-value} \\ \hline Age & 1.03 (1.00, 1.05)* & 0.01* \\ \hline Male & 0.65 (0.34, 1.22) & 0.18 \\ \hline APACHE II score & 1.10 (1.05, 1.16)* & <0.001* \\ \hline PaO2/FiO2 ratio & 0.97 (0.93, 1.00)* & 0.06* \\ \hline SOFA score & 1.35 (1.21, 1.50)* & <0.001* \\ \hline Vasopressor use & 2.54 (1.34, 4.81)* & 0.004* \\ \hline Aspirin use (ever) & 0.75 (0.37, 1.53)* & 0.43* \\ \hline Smoking & 0.82 (0.44, 1.53) & 0.54 \\ \hline Coronary artery disease & 1.20 (0.53, 2.71)* & 0.67* \\ \hline Diabetes mellitus & 1.41 (0.61, 3.24) & 0.42 \\ \hline Pre-admission statin & 0.95 (0.46, 1.97) & 0.90 \\ \hline COPD & 0.83 (0.33, 2.07) & 0.69 \\ \hline Cerebrovascular disease & 0.88 (0.23, 3.40) & 0.86 \\ \hline Alcohol abuse history or cirrhosis & 1.30 (0.67, 2.54) & 0.44 \\ \hline Sepsis & 1.63 (0.86, 3.09) & 0.13 \\ \hline \end{tabular} \end{table}	PMC4371625_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Subset} & \textbf{Intent} \\ \hline Training & Learning to fit the parameters of the classifier \\ \hline Validation & Estimate the error rate to tune the parameters of the classifier \\ \hline Testing & Estimate the true error rate to assess the classifier \\ \hline \end{tabular} \end{table}	PMC3231381_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{c\|}{\textbf{Reduced renal function}} & \multicolumn{3}{c\|}{\textbf{Albuminuira}} & \multicolumn{3}{c\|}{\textbf{CKD}} \\ \hline \textbf{Variables} & \textbf{\textbf{\textbf{OR}}} & \textbf{\textbf{\textbf{95\% CI}}} & \textbf{\textbf{\textbf{P value}}} & \textbf{\textbf{\textbf{OR}}} & \textbf{\textbf{\textbf{95\% CI}}} & \textbf{\textbf{\textbf{P value}}} & \textbf{\textbf{\textbf{OR}}} & \textbf{\textbf{\textbf{95\% CI}}} & \textbf{\textbf{\textbf{P value}}} \\ \hline Model 1 \\ \hline BMI (kg/m2) & 1.073 & 0.971-1.186 & 0.2 & 1.09 & 1.047-1.148 & <0.001* & 1.098 & 1.050-1.149 & <0.001* \\ \hline Waist circumference (cm) & 0.995 & 0.947-1.045 & 0.8 & 1.039 & 1.018-1.061 & <0.001* & 1.031 & 1.011-1.052 & 0.003* \\ \hline Body fat mass (kg) & 1.084 & 1.023-1.150 & 0.007* & 1.049 & 1.018-1.080 & 0.002* & 1.055 & 1.026-1.086 & <0.001* \\ \hline Body fat rate (\%) & 1.083 & 1.004-1.167 & 0.038* & 1.082 & 1.043-1.121 & <0.001* & 1.085 & 1.048-1.124 & <0.001* \\ \hline Serum irisin† & 0.987 & 0.721-1.353 & 0.9 & 0.948 & 0.820-1.096 & 0.5 & 0.949 & 0.826-1.091 & 0.5 \\ \hline Serum irisin \\ \hline (Quartile 2 vs. Quartile 1) & 1.616 & 0.669-3.906 & 0.3 & 0.926 & 0.605-1.416 & 0.7 & 1.007 & 0.671-1.511 & 1.0 \\ \hline (Quartile 3 vs. Quartile 1) & 1.228 & 0.493-3.057 & 0.7 & 1.287 & 0.859-1.926 & 0.2 & 1.340 & 0.908-1.979 & 0.1 \\ \hline (Quartile 4 vs. Quartile 1) & 0.766 & 0.278-2.110 & 0.6 & 0.740 & 0.479-1.141 & 0.2 & 0.721 & 0.474-1.096 & 0.1 \\ \hline Model 2 \\ \hline BMI (kg/m2) & 1.074 & 0.958-1.205 & 0.2 & 1.100 & 1.046-1.156 & <0.001* & 1.102 & 1.049-1.158 & <0.001* \\ \hline Waist circumference (cm) & 1.011 & 0.959-1.066 & 0.7 & 1.038 & 1.015-1.061 & 0.001* & 1.034 & 1.011-1.057 & 0.003* \\ \hline Body fat mass (kg) & 1.093 & 1.020-1.172 & 0.012* & 1.053 & 1.019-1.087 & 0.002* & 1.059 & 1.026-1.093 & <0.001* \\ \hline Body fat rate (\%) & 1.088 & 1.000-1.183 & 0.1 & 1.083 & 1.042-1.125 & <0.001* & 1.087 & 1.047-1.129 & <0.001* \\ \hline Serum irisin † & 0.992 & 0.697-1.412 & 1.0 & 0.914 & 0.784-1.066 & 0.3 & 0.917 & 0.859-1.379 & 0.3 \\ \hline Serum irisin \\ \hline (Quartile 2 vs. Quartile 1) & 1.738 & 0.640-4.722 & 0.3 & 0.760 & 0.477-1.209 & 0.2 & 0.848 & 0.542-1.326 & 0.5 \\ \hline (Quartile 3 vs. Quartile 1) & 1.334 & 0.471-3.780 & 0.6 & 1.106 & 0.711-1.719 & 0.7 & 1.191 & 0.775-1.831 & 0.4 \\ \hline (Quartile 4 vs. Quartile 1) & 0.607 & 0.183-2.008 & 0.4 & 0.641 & 0.401-1.024 & 0.1 & 0.620 & .392-0.980 & 0.041* \\ \hline Model 3 \\ \hline BMI (kg/m2) & 1.031 & 0.910-1.167 & 0.6 & 1.053 & 0.996-1.113 & 0.1 & 1.052 & 0.996-1.110 & 0.1 \\ \hline Waist circumference (cm) & 0.997 & 0.945-1.053 & 0.9 & 1.023 & 0.998-1.048 & 0.1 & 1.017 & 0.993-1.041 & 0.2 \\ \hline Body fat mass (kg) & 1.076 & 0.999-1.159 & 0.1 & 1.034 & 0.998-1.071 & 0.1 & 1.039 & 1.004-1.076 & 0.029* \\ \hline Body fat rate (\%) & 1.062 & 0.969-1.164 & 0.2 & 1.046 & 1.002-1.092 & 0.039* & 1.049 & 1.006-1.093 & 0.025* \\ \hline Serum irisin† & 0.946 & 0.660-1.357 & 0.8 & 0.910 & 0.771-1.073 & 0.3 & 0.906 & 0.772-1.064 & 0.2 \\ \hline Serum irisin \\ \hline (Quartile 2 vs. Quartile 1) & 1.609 & 0.579-4.472 & 0.4 & 0.786 & 0.485-1.272 & 0.3 & 0.873 & 0.549-1.388 & 0.6 \\ \hline (Quartile 3 vs. Quartile 1) & 1.185 & 0.407-3.448 & 0.8 & 1.050 & 0.658-1.673 & 0.8 & 1.123 & 0.713-1.769 & 0.6 \\ \hline (Quartile 4 vs. Quartile 1) & 0.507 & 0.147-1.746 & 0.3 & 0.611 & 0.373-1.000 & 0.050* & 0.572 & 0.353-0.927 & 0.023* \\ \hline \end{tabular} \end{table}	PMC4365765_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Person years (PY)} & \textbf{Cases} & \textbf{Rate (per 100 PY)} & \textbf{95\% CI} \\ \hline Age (months) \\ \hline [0 -- 6] & 986 & 88 & 8.93 & 7.24 -11.00 \\ \hline (6 - 12] & 1005 & 42 & 4.18 & 3.09 -5.65 \\ \hline (12 - 18] & 921 & 7 & 0.76 & 0.36 -1.59 \\ \hline Calendar month \\ \hline January & 223 & 25 & 11.20 & 7.57 -16.57 \\ \hline February & 226 & 24 & 10.64 & 7.13 -15.87 \\ \hline March & 227 & 14 & 6.18 & 3.66 -10.43 \\ \hline April & 229 & 12 & 5.23 & 2.97 -9.21 \\ \hline May & 235 & 4 & 1.70 & 0.64 -4.54 \\ \hline June & 238 & 3 & 1.26 & 0.41 -3.90 \\ \hline July & 245 & 2 & 0.82 & 0.20 -3.27 \\ \hline August & 251 & 3 & 1.20 & 0.39 -3.71 \\ \hline September & 254 & 3 & 1.18 & 0.38 -3.66 \\ \hline October & 257 & 12 & 4.67 & 2.65 -8.22 \\ \hline November & 262 & 18 & 6.88 & 4.33 -10.91 \\ \hline December & 266 & 17 & 6.39 & 3.98 -10.29 \\ \hline Year of observation \\ \hline 2000 & 138 & 7 & 5.07 & 2.42 -10.63 \\ \hline 2001 & 399 & 17 & 4.26 & 2.65 -6.85 \\ \hline 2002 & 427 & 22 & 5.15 & 3.39 -7.82 \\ \hline 2003 & 436 & 30 & 6.88 & 4.81 -9.84 \\ \hline 2004 & 503 & 18 & 3.58 & 2.25 -5.68 \\ \hline 2005 & 527 & 23 & 4.36 & 2.90 -6.56 \\ \hline 2006 & 481 & 20 & 4.16 & 2.68 -6.44 \\ \hline Total & 2912 & 137 & 4.70 & 3.98 -5.56 \\ \hline \end{tabular} \end{table}	PMC2749027_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline [Mn(ClO4)(C30H34N6)]ClO4 & F000 = 1516 \\ \hline Mr = 732.47 & m−3 Dx = 1.527 Mg \\ \hline Monoclinic, Cc & Mo Kα radiation λ = 0.71073 Å \\ \hline Hall symbol: C -2yc & Cell parameters from 3537 reflections \\ \hline a = 14.223 (5) Å & θ = 2.6–22.9º \\ \hline b = 14.121 (5) Å & mm−1 µ = 0.64 \\ \hline c = 16.504 (6) Å & T = 293 (2) K \\ \hline β = 105.987 (6)º & Stick, yellow \\ \hline Å3 V = 3186.6 (19) & 0.25 × 0.25 × 0.20 mm \\ \hline Z = 4 \\ \hline \end{tabular} \end{table}	PMC2960601_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline N: & the number of expression samples. \\ \hline X: & the expression level of gene X in ith sample. \\ \hline Y: & the expression level of gene Y in the ith sample. \\ \hline \end{tabular} \end{table}	PMC4454876_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline Rigaku Saturn CCD area-detector diffractometer & 3746 independent reflections \\ \hline Radiation source: rotating anode & 2835 reflections with I > 2σ(I) \\ \hline multilayer & Rint = 0.053 \\ \hline mm-1 Detector resolution: 14.63 pixels & θmax = 27.9°, θmin = 1.7° \\ \hline φ and ω scans & h = −9→9 \\ \hline Absorption correction: multi-scan (CrystalClear; Rigaku/MSC, 2005) & k = −31→31 \\ \hline Tmin = 0.957, Tmax = 0.974 & l = −12→10 \\ \hline 15993 measured reflections \\ \hline \end{tabular} \end{table}	PMC3151869_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Test and measured function} & \textbf{N} & \textbf{F} & \textbf{p} & h\textbf{p} 2 & \textbf{Post hoc test} & \textbf{Post hoc adjusted for IQ} \\ \hline Measures of working memory & Control:18 ADHD-\textbf{p}sych: 20 ADHD-\textbf{p}rison: 30 \\ \hline Digit S\textbf{p}an & & 21.29 & <.001 & .396 & C>Psych > Prison & C > Psych = Prison \\ \hline S\textbf{p}an Board & & 24.88 & <.001 & .434 & C>Psych > Prison & C > Psych = Prison \\ \hline Conners’ CPT II & Control:18 ADHD-\textbf{p}sych: 20 ADHD-\textbf{p}rison: 27 \\ \hline CCPT reaction time \\ \hline Hit RT & & .48 & .617 & .015 & C = Psych = Prison & C = Psych = Prison \\ \hline CCPT variability \\ \hline Variability & & 26.38 & <.001 & .460 & C = Psych < Prison & C = Psych < Prison \\ \hline Hit RT block change & & .29 & .749 & .009 & C = Psych = Prison & C = Psych = Prison \\ \hline Hit SE block change & & .165 & .848 & .005 & C = Psych = Prison & C = Psych = Prison \\ \hline Hit RT ISI change & & 1.22 & .302 & .038 & C = Psych = Prison & C = Psych = Prison \\ \hline Hit SE ISI change & & .662 & .519 & .021 & C = Psych = Prison & C = Psych = Prison \\ \hline Perseverations & & 8.66 & <.001 & .218 & C = Psych < Prison & C = Psych < Prison \\ \hline CCPT accuracy \\ \hline Omission errors & & 16.23 & <.001 & .344 & C = Psych < Prison & C = Psych < Prison \\ \hline Commission errors & & 12.61 & <.001 & .289 & C = Psych < Prison & C = Psych < Prison \\ \hline Detectability (d’) & & 9.21 & <.001 & .229 & C < Prison Psych = C Psych = Prison & C < Prison Psych = C Psych = Prison \\ \hline Res\textbf{p}onse style (beta) & & 4.27 & .018 & .121 & Psych < Prison Psych = C Prison = C & Psych < Prison Psych = C Prison = C \\ \hline \end{tabular} \end{table}	PMC3016316_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Personality disorders and certain other non-psychotic mental disorders} & \textbf{Psychophysiological disorders} \\ \hline Sexual deviations & \textbf{Psychophysiological disorders} (physical disorders of presumably psychogenic origin) \\ \hline e.g. homosexuality, fetishism, pedophilia, transvestism, exhibitionism . . . & Psychophysiological genito-urinary disorders‘- such as disturbances in menstruation and mic- turition, dyspareunia, and impotence in which emotional factors play a causative role’ \\ \hline \end{tabular} \end{table}	PMC3549574_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Type of diet} & \textbf{Groups} & \textbf{Treatment} \\ \hline \multirow{2}{}{Normal diet} & ND & Normal diet only + saline \\ \hline ND240 & Normal diet + 240 mg/kg of body weight GE \\ \hline \multirow{5}{}{High-fat diet} & HFD & High-fat diet only + saline \\ \hline HFD60 & High-fat diet + 60 mg/kg of body weight of GE \\ \hline HFD120 & High-fat diet + 120 mg/kg of body weight of GE \\ \hline HFD240 & High-fat diet + 240 mg/kg of body weight of GE \\ \hline HFDMET & High-fat diet + 2 mg/kg of body weight of metformin \\ \hline \end{tabular} \end{table}	PMC3662117_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Good outcome (n = 133)} & \textbf{Poor outcome (n = 39)} & \textbf{P value} \\ \hline Age (year) \\ \hline Sex (female) (\%) & 32.3 & 46.2 & 0.11 \\ \hline Hypertension (\%) & 77.4 & 84.6 & 0.33 \\ \hline Diabetes mellitus (\%) & 38.3 & 48.7 & 0.25 \\ \hline Hyperlipidemia (\%) & 50.4 & 38.5 & 0.19 \\ \hline Coronary artery disease (\%) & 1.5 & 12.8 & 0.002 \\ \hline Intra-cranial atherosclerosis (\%) & 23.3 & 30.8 & 0.34 \\ \hline Stroke sub-type \\ \hline Small vessel disease (\%) & 57.1 & 48.7 & 0.24 \\ \hline Large vessel disease (\%) & 39.1 & 51.3 \\ \hline Statin therapy groups \\ \hline Pre-existing statin use (\%) & 29.3 & 10.3 & 0.016 \\ \hline Median NIHSS (IQR) scores on admission & 3 (1-5) & 4 (3-8) & 0.009 \\ \hline Laboratory data on admission \\ \hline (X103/ml) White blood cells & 7.5 $\pm$ 0.2 & 7.6 $\pm$ 0.4 & 0.69 \\ \hline (X106/ml) Red blood cells & 4.6 $\pm$ 0.1 & 4.6 $\pm$ 0.1 & 0.73 \\ \hline (X104/ml) Platelet counts & 21.2 $\pm$ 0.6 & 19.5 $\pm$ 0.7 & 0.06 \\ \hline Total cholesterol (mg/dl) & 183.0 $\pm$ 4.2 & 187.8 $\pm$ 8.5 & 0.61 \\ \hline LDL-cholesterol (mg/dl) & 113.7 $\pm$ 3.7 & 114.3 $\pm$ 6.7 & 0.93 \\ \hline Triglyceride (mg/dl) & 143.1 $\pm$ 7.8 & 147.2 $\pm$ 8.5 & 0.82 \\ \hline HbA1c (\%) & 7.0 $\pm$ 0.2 & 7.4 $\pm$ 0.4 & 0.33 \\ \hline Systolic BP (mmHg) & 143.4 $\pm$ 1.8 & 140.6 $\pm$ 3.5 & 0.46 \\ \hline Diastolic BP (mmHg) & 83.8 $\pm$ 1.1 & 82.8 $\pm$ 2.1 & 0.67 \\ \hline Platelet markers on admission \\ \hline CD62P (\%)† & 3.45 $\pm$ 0.38 & 5.39 $\pm$ 0.89 & 0.024 \\ \hline CD63 (\%)† & 1.41 $\pm$ 0.12 & 1.99 $\pm$ 0.31 & 0.035 \\ \hline \end{tabular} \end{table}	PMC3387600_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline [Co2(C11H14NO2)4(C10H14N2O)2] & F(000) = 1316 \\ \hline Mr = 1243.25 & m−3 Dx = 1.322 Mg \\ \hline Monoclinic, P21/n & Mo Kα radiation, λ = 0.71073 Å \\ \hline Hall symbol: -P 2yn & Cell parameters from 9913 reflections \\ \hline a = 10.3518 (2) Å & θ = 2.2–28.3° \\ \hline b = 13.4393 (2) Å & mm−1 µ = 0.60 \\ \hline c = 22.5105 (3) Å & T = 100 K \\ \hline β = 94.189 (2)° & Block, blue \\ \hline Å3 V = 3123.32 (9) & 0.44 × 0.36 × 0.21 mm \\ \hline Z = 2 \\ \hline \end{tabular} \end{table}	PMC3050165_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \multirow{2}{*}{\textbf{Total sample}} & \multicolumn{2}{c\|}{\textbf{\textbf{Doctors} v. nurses}} & \multicolumn{4}{c\|}{\textbf{4 Occupational subgroups}} \\ \hline & & \textbf{Doctors} & \textbf{Nurses} & \textbf{Gynecologists} & \textbf{Anesthetists} & \textbf{Delivery room nurses} & \textbf{Midwives} \\ \hline & N & 96 & 47 & 49 & 26 & 21 & 26 & 23 \\ \hline Staﬀ attitudes & Coef. R (P) & 0.620 (.000) & 0.583 (.000) & 0.602 (.000) & 0.506 (.000) & 0.667 (.000) & 0.613 (.000) & 0.749 (.000) \\ \hline Subjective norms & Coef. (P) R & 0.404 (.000) & 0.492 (.000) & 0.344 (.000) & 0.703 (.000) & 0.469 (.002) & 0.464 (.000) & 0.213 (.177) \\ \hline \end{tabular} \end{table}	PMC3168851_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline F2 Refinement on & Primary atom site location: structure-invariant direct methods \\ \hline Least-squares matrix: full & Secondary atom site location: difference Fourier map \\ \hline R[F2 2σ(F2)] > = 0.059 & Hydrogen site location: inferred from neighbouring sites \\ \hline wR(F2) = 0.133 & H-atom parameters constrained \\ \hline S = 1.18 & 1/[σ2(Fo 2) (0.045P)2 w = + + 0.6856P] 2 2)/3 where P = (Fo + 2Fc \\ \hline 2591 reflections & (Δ/σ)max < 0.001 \\ \hline 181 parameters & Å−3 Δρmax = 0.16 e \\ \hline 0 restraints & Å−3 Δρmin = −0.18 e \\ \hline \end{tabular} \end{table}	PMC2979806_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{I(task)} & \textbf{U(N)} & \textbf{B(N)} & \textbf{Difference I-U} & \textbf{Difference I-B} & \textbf{Difference U-B} \\ \hline tasks n = 15 & r = 0.92 & r = 0.86 & r = 0.81 & t = 4.64 * & t = 1.84 * & t.100* \\ \hline valid trials n = 525 & r = 0.47 & r = 0.44 & r = 0.46 & t = 5.13 * & t = 0.52 n.s. & t.100* \\ \hline \end{tabular} \end{table}	PMC2748701_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline C15H12N2O5S & F000 = 688 \\ \hline Mr = 332.33 & m−3 Dx = 1.405 Mg \\ \hline Orthorhombic, Pna21 & Mo Kα radiation, λ = 0.71073 Å \\ \hline Hall symbol: P 2c -2n & Cell parameters from 17706 reflections \\ \hline a = 16.3588 (10) Å & θ = 2.5–30.5º \\ \hline b = 9.6451 (6) Å & mm−1 µ = 0.23 \\ \hline c = 9.9603 (6) Å & T = 230 K \\ \hline Å3 V = 1571.56 (17) & Needle, colourless \\ \hline Z = 4 & 0.60 × 0.20 × 0.20 mm \\ \hline \end{tabular} \end{table}	PMC2969438_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Factors}} & \multicolumn{2}{c\|}{\textbf{Parity n (\%)}} & \multirow{2}{}{\textbf{P-value}} \\ \hline \textbf{1-3 (n=112)} & \textbf{$\geq$4 (n=84)} \\ \hline Instrumental delivery (n=46) & 11 (23.91) & 35 (76.09) & 0.001 \\ \hline Spontaneous vertex delivery (n=87) & 38 (43.68) & 49 (56.32) & 0.001 \\ \hline Cesarean section (n=63) & 41 (65.08) & 22 (34.92) & 0.122 \\ \hline Prolonged rupture of membranes (n=57) & 33 (57.89) & 24 (42.11) & 0.892 \\ \hline Meconium staining (n=15) & 11 (73.33) & 4 (26.67) & 0.147 \\ \hline Maternal Fever(n=43) & 19 (44.19) & 24 (55.81) & 0.052 \\ \hline Anemia at delivery(n=113) & 45 (38.17) & 68 (61.83) & 0.00 \\ \hline \end{tabular} \end{table}	PMC4359420_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{All treatments n = 599} & \textbf{IFNb-1a IM n = 102} & \textbf{IFNb-1a SC n = 101} & \textbf{IFNb-1b n = 93} & \textbf{GA n = 172} & \textbf{NAT n = 131} & \textbf{p-value Between treatment groups} \\ \hline n (\%) & 482 (80.5) & 83 (81.4) & 83 (82.2) & 83 (89.3) & 140 (81.4) & 93 (71.0) & 0.015a \\ \hline at MS onset, y mean (SD) & 28.6 (9.3) & 28.2 (8.3) & 27.4 (9.8) & 28.5 (8.8) & 30.1 (10.3) & 28.0 (8.2) & 0.125b \\ \hline at treatment start, y mean (SD) & 37.5 (10.1) & 37.3 (9.5) & 36.9 (10.7) & 36.1 (9.7) & 38.6 (10.7) & 37.7 (9.4) & 0.386b \\ \hline duration at treatment start, y (IQR) & 7.2 (3.4, 12.4) & 7.0 (3.2, 13.7) & 7.7 (3.6, 12.4) & 6.4 (2.8, 10.4) & 6.5 (3.1, 11.7) & 8.1 (4.4, 12.9) & 0.137c \\ \hline at treatment start median (IQR) & 3 (2,4) & 3.75)c 2.5 (1.5, & 4)c 2.5 (1.5, & 4)c 2.5 (1.5, & 4)c 2.5 (2, & 4.5)c 4 (2.5, & 0.0001c \\ \hline \end{tabular} \end{table}	PMC3602083_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Patient} & \textbf{Tumor size (cm)} & \textbf{Operation} & \textbf{Histology} & \textbf{Grade} & \textbf{Operation} time & \textbf{Blood Tx (units)} \\ \hline 1 & 12 & WTR & LS & G1 & 160 & 1 \\ \hline 2 & 20 & WTR & LMS & G1 & 200 & 2 \\ \hline 3 & 6 & MWTR + RSO & FS & G2 & 235 & 1 \\ \hline 4 & 8 & WTR & NF & & 120 & - \\ \hline 5 & 17 & WTR & L & & 280 & 2 \\ \hline 6 & 30 & MWTR & LS & G3 & 380 & 3 \\ \hline 7 & 8 & WTR & FR & & 150 & - \\ \hline 8 & 12 & WTR & LS & G1 & 210 & 2 \\ \hline 9 & 16 & WTR & LMS & G1 & 280 & 1 \\ \hline 10 & 19 & MWTR & LMS & G2 & 190 & - \\ \hline 11 & 30 & MWTR + LN & LS & G2 & 230 & 4 \\ \hline 12 & 15 & WTR + SP & PRG & G3 & 240 & 3 \\ \hline 13 & 25 & WTR & ANGF & & 320 & 2 \\ \hline 14 & 6 & MWTR & LMS & G1 & 140 & - \\ \hline 15 & 11 & MWTR & MFH & G2 & 180 & - \\ \hline 16 & 7 & WTR & SWN & & 110 & - \\ \hline 17 & 8 & WTR & NF & & 200 & 2 \\ \hline 18 & 5 & MWTR & MFH & G1 & 100 & 1 \\ \hline 19 & 3 & WTR & LS & G1 & 90 & 1 \\ \hline 20 & 16 & MWTRa & LS & G2 & 215 & - \\ \hline 21 & 4 & WTR & LMS & G1 & 130 & - \\ \hline 22 & 17 & WTR + SP + WRS & MFH & G2 & 360 & 5 \\ \hline 23 & 15 & WTR & LS & G1 & 225 & 1 \\ \hline 24 & 24 & BPYb & LS & G3 & 70 & - \\ \hline 25 & 2 & WTR & MFH & G1 & 115 & 3 \\ \hline 26 & 8 & WTR + LHC & MFH & G2 & 260 & 7 + 4 FFP \\ \hline 27 & 4 & WTR & PRG & & 120 & 1 \\ \hline 28 & 10 & BPYc & HL & G3 & 70 & - \\ \hline \end{tabular} \end{table}	PMC4404658_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Independent Variable} & \textbf{Coefficient} & \textbf{Standard Error} & \textbf{p-value} \\ \hline Distance from Index Case House (m) & 20.022 & 0.004 & ,0.001 \\ \hline Age (yrs) & 0.006 & 0.028 & 0.823 \\ \hline Female & 20.165 & 0.224 & 0.460 \\ \hline Intercept & 20.982 & 0.390 & 0.012 \\ \hline \end{tabular} \end{table}	PMC3398976_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Colunas1} & \textbf{Nuclei from mononucleated cells} & \textbf{Nuclei from binucleated cells} & \textbf{Nuclei from multinucleated cells} \\ \hline Control & 100.00\% & 0.00\% & 0.00\% \\ \hline mg/ml +2 a 250 days & 27.50\% & 33.75\% & 38.75\% \\ \hline +4 mg/ml b 250 days & 38.10\% & 36.19\% & 25.71\% \\ \hline +8 mg/ml c 250 days & 51.18\% & 28.35\% & 20.47\% \\ \hline +2 mg/ml d 125 days & 31.48\% & 25.93\% & 42.59\% \\ \hline mg/ml +4 e 125 days & 50.94\% & 13.21\% & 35.85\% \\ \hline +8 mg/ml f 125 days & 44.78\% & 32.84\% & 22.39\% \\ \hline +2 mg/ml g 62.5 days & 23.81\% & 33.33\% & 42.86\% \\ \hline +4 h mg/ml 62.5 days & 41.46\% & 39.02\% & 19.51\% \\ \hline mg/ml +8 i 62.5 days & 50.00\% & 25.00\% & 25.00\% \\ \hline \end{tabular} \end{table}	PMC3071733_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline D—H···A & D—H & H···A & D···A & D—H···A \\ \hline N1—H1N···O1i & 0.84 (2) & 2.15 (2) & 2.979 (2) & 175 (3) \\ \hline O3—H3O···O2ii & 0.84 (2) & 1.84 (2) & 2.681 (3) & 171 (4) \\ \hline \end{tabular} \end{table}	PMC3050143_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Characteristic} & \textbf{Year 1 [n = 27 families]} & \textbf{Year 2 [n = 23 families]} & \textbf{Year 3 [n = 18 families]} \\ \hline Gender \\ \hline PWD [n = 27] & 11 M: 16 F & 10 M: 13 F & 7 M: 11 F \\ \hline CP [n = 28] & 12 M: 16 F & 10 M: 13 F & 8 M: 10 F \\ \hline Caring Relationship \\ \hline Spouse & 19 & 19 & 14 \\ \hline Child & 6 & 3 & 3 \\ \hline Niece & 1 & 1 & 1 \\ \hline Daughter-in-Law & 1 & 0 & 0 \\ \hline FAST \\ \hline 1–4 & 20 & 15 & 10 \\ \hline 5-6C & 5 & 5 & 5 \\ \hline 6D-7 F & 2 & 3 & 3 \\ \hline PWD Age range [yrs] & 56-88 & — & — \\ \hline CP Age range [yrs] & 30-88 & — & — \\ \hline Residence \\ \hline Community & 27 & 17 & 13 \\ \hline [Live with PWD] & [24] & [16] & [12] \\ \hline Facility with spouse & 0 & 3 & 1 \\ \hline Facility PWD alone & 0 & 3 & 4 \\ \hline Reason for Leaving Study & N/A & [4 lost in Yr 2] & [5 lost in Yr 3] \\ \hline Death of PWD & & 2 \\ \hline Death of Spouse & & 0 & 2 \\ \hline Moved/Lost Contact & & 2 & 2 \\ \hline Refusal & & 0 & 1 \\ \hline \end{tabular} \end{table}	PMC4600313_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\ \hline S1 & 0.0455 (7) & 0.0354 (7) & 0.0488 (7) & 0.0000 (5) & 0.0153 (5) & 0.0014 (4) \\ \hline N1 & 0.0414 (18) & 0.042 (2) & 0.0431 (18) & 0.0055 (16) & 0.0106 (14) & −0.0030 (16) \\ \hline C9 & 0.057 (3) & 0.046 (3) & 0.047 (2) & −0.001 (2) & 0.014 (2) & −0.011 (2) \\ \hline C10 & 0.037 (2) & 0.044 (3) & 0.041 (2) & 0.0036 (18) & 0.0143 (16) & 0.0044 (18) \\ \hline C13 & 0.070 (4) & 0.075 (4) & 0.055 (3) & −0.012 (3) & 0.005 (2) & −0.016 (3) \\ \hline C3 & 0.096 (5) & 0.112 (6) & 0.070 (4) & 0.050 (4) & 0.020 (3) & 0.021 (4) \\ \hline C4 & 0.045 (2) & 0.039 (2) & 0.037 (2) & 0.0094 (19) & 0.0076 (16) & 0.0005 (17) \\ \hline C1 & 0.044 (2) & 0.057 (3) & 0.051 (2) & 0.010 (2) & 0.0128 (18) & −0.005 (2) \\ \hline C11 & 0.040 (2) & 0.064 (3) & 0.056 (3) & 0.000 (2) & 0.0167 (19) & 0.002 (2) \\ \hline C5 & 0.059 (3) & 0.036 (3) & 0.061 (3) & 0.005 (2) & 0.019 (2) & −0.003 (2) \\ \hline C2 & 0.052 (3) & 0.079 (4) & 0.057 (3) & 0.016 (3) & 0.010 (2) & 0.002 (3) \\ \hline C15 & 0.039 (2) & 0.080 (4) & 0.045 (2) & 0.006 (2) & 0.0099 (18) & −0.011 (2) \\ \hline C7 & 0.058 (3) & 0.078 (4) & 0.053 (3) & 0.014 (3) & 0.022 (2) & 0.015 (3) \\ \hline C6 & 0.066 (3) & 0.049 (3) & 0.074 (3) & 0.002 (3) & 0.026 (3) & 0.013 (3) \\ \hline C14 & 0.062 (3) & 0.086 (4) & 0.056 (3) & 0.013 (3) & 0.008 (2) & −0.022 (3) \\ \hline O2 & 0.0622 (19) & 0.0412 (19) & 0.0631 (19) & 0.0148 (15) & 0.0206 (15) & 0.0029 (15) \\ \hline O1 & 0.0529 (18) & 0.055 (2) & 0.070 (2) & −0.0140 (16) & 0.0216 (15) & 0.0053 (17) \\ \hline C8 & 0.074 (3) & 0.065 (4) & 0.050 (3) & 0.012 (3) & 0.022 (2) & −0.008 (2) \\ \hline C12 & 0.039 (2) & 0.091 (4) & 0.061 (3) & −0.018 (3) & 0.009 (2) & −0.003 (3) \\ \hline \end{tabular} \end{table}	PMC2979217_table_4
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Hypothesis} & \textbf{Model outcome} & \textbf{Performance model hypotheses} \\ \hline H1 & Not supported & Trust will have a positive inﬂuence on an Effective Family Business Culture. \\ \hline H2 & Supported & Conﬁdence in Management will have a positive inﬂuence on an Effective Family Business Culture. \\ \hline H3 & Supported & Shared Vision will have a positive inﬂuence on Effective Family Business Culture. \\ \hline H4 & Not supported & Role Clarity/Role Conﬂict will have a positive/negative inﬂuence, respectively, on an Effective Family Business Culture. \\ \hline H5 & Partially supported & Organizational Development and Professional Networking will have a positive inﬂuence on an Effective Family Business Culture. \\ \hline H6 & Not supported & Growth Orientation will have a positive inﬂuence on an Effective Family Business Culture. \\ \hline H7 & Not supported & Family Functionality will have a positive inﬂuence on an Effective Family Business Culture. \\ \hline H8 & Supported & Effective Family Business Culture will have a positive inﬂuence on the Financial Performance of a Family Business. \\ \hline \end{tabular} \end{table}	PMC4436804_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Determinant (1–7)}} & \multirow{2}{}{\textbf{Aerobic M (sd)}} & \multirow{2}{}{\textbf{Strength M (sd)}} & \multirow{2}{}{\textbf{t (df)}} & \multirow{2}{*}{\textbf{p}} \\ \hline \\ \hline Possible & 5.36 (1.53) & 4.20 (1.82) & −11,76 (313) & < .001 \\ \hline Facilities & 5.54 (1.37) & 4.74 (1.66) & −9,87 (313) & < .001 \\ \hline Fit/strong & 3.63 (1.63) & 4.39 (1.55) & −8,35 (313) & < .001 \\ \hline Worse/better & 4,58 (1.33) & 4.15 (1.16) & −5,85 (313) & < .001 \\ \hline Enjoyable & 4,42 (1.31) & 3.61 (1.30) & −9,62 (313) & < .001 \\ \hline Good & 4,73 (1.45) & 4.26 (1.35) & −5,69 (313) & < .001 \\ \hline Allowed when wanted & 5,82 (1.08) & 4.82 (1.38) & −12,50 (313) & < .001 \\ \hline Encouraged when wanted & 5,75 (1.02) & 4.33 (1.46) & −16,96 (313) & < .001 \\ \hline Ex\textbf{p}ectation & 4,74 (1.62) & 2.88 (1.54) & −18,35 (313) & < .001 \\ \hline \end{tabular} \end{table}	PMC4589906_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline & \textbf{Component score} \\ \hline Diarrhea & 0.979 \\ \hline Respiratory Infection & 0.963 \\ \hline Asthma & 0.951 \\ \hline Malaria & 0.639 \\ \hline Meningitis & 0.928 \\ \hline \end{tabular} \end{table}	PMC3367281_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\ \hline Cu1 & 0.01695 (15) & 0.03034 (19) & 0.02010 (17) & −0.00004 (11) & 0.00198 (11) & 0.00009 (11) \\ \hline N1 & 0.0208 (10) & 0.0252 (11) & 0.0259 (11) & 0.0019 (8) & 0.0041 (8) & 0.0001 (8) \\ \hline N2 & 0.0281 (11) & 0.0278 (11) & 0.0344 (13) & 0.0062 (9) & 0.0069 (9) & 0.0071 (9) \\ \hline N3 & 0.0216 (10) & 0.0235 (10) & 0.0208 (10) & 0.0011 (8) & 0.0032 (8) & 0.0011 (8) \\ \hline N4 & 0.0216 (10) & 0.0311 (11) & 0.0215 (11) & 0.0046 (8) & 0.0014 (8) & 0.0020 (8) \\ \hline N5 & 0.0289 (12) & 0.0416 (13) & 0.0292 (12) & 0.0109 (10) & 0.0005 (9) & 0.0034 (10) \\ \hline N6 & 0.0296 (12) & 0.0479 (14) & 0.0270 (12) & 0.0077 (10) & −0.0029 (9) & 0.0014 (10) \\ \hline O1 & 0.0290 (9) & 0.0262 (9) & 0.0270 (9) & 0.0039 (7) & −0.0024 (7) & −0.0009 (7) \\ \hline O2 & 0.0226 (9) & 0.0409 (11) & 0.0252 (9) & −0.0061 (7) & 0.0014 (7) & 0.0041 (8) \\ \hline O3 & 0.0296 (10) & 0.0339 (11) & 0.0494 (12) & −0.0008 (8) & −0.0039 (9) & −0.0045 (9) \\ \hline O4 & 0.0200 (8) & 0.0334 (9) & 0.0252 (9) & −0.0042 (7) & 0.0025 (7) & −0.0016 (7) \\ \hline O5 & 0.0286 (9) & 0.0254 (9) & 0.0345 (10) & −0.0078 (7) & 0.0075 (8) & −0.0030 (7) \\ \hline O6 & 0.0190 (8) & 0.0371 (10) & 0.0355 (11) & −0.0002 (7) & −0.0033 (7) & 0.0005 (8) \\ \hline O7 & 0.0344 (10) & 0.0431 (11) & 0.0197 (9) & 0.0051 (8) & −0.0020 (7) & 0.0007 (8) \\ \hline O8 & 0.0414 (11) & 0.0213 (9) & 0.0285 (10) & −0.0001 (7) & 0.0031 (8) & −0.0014 (7) \\ \hline O9 & 0.0346 (10) & 0.0515 (12) & 0.0228 (10) & 0.0007 (9) & −0.0018 (8) & 0.0052 (8) \\ \hline O10 & 0.0373 (15) & 0.0287 (14) & 0.0387 (16) & 0.000 & −0.0132 (12) & 0.000 \\ \hline C1 & 0.0227 (12) & 0.0253 (12) & 0.0230 (12) & 0.0054 (9) & 0.0028 (9) & 0.0014 (10) \\ \hline C2 & 0.0293 (13) & 0.0261 (13) & 0.0362 (15) & 0.0037 (10) & 0.0091 (11) & 0.0080 (11) \\ \hline C3 & 0.0259 (12) & 0.0323 (14) & 0.0234 (13) & −0.0025 (10) & 0.0042 (10) & 0.0004 (10) \\ \hline C4 & 0.0232 (12) & 0.0266 (13) & 0.0240 (13) & 0.0002 (9) & 0.0045 (9) & 0.0018 (10) \\ \hline C5 & 0.0265 (13) & 0.0324 (14) & 0.0251 (14) & −0.0007 (10) & 0.0010 (10) & 0.0025 (10) \\ \hline C6 & 0.0394 (16) & 0.0489 (17) & 0.0257 (15) & −0.0065 (13) & 0.0023 (12) & −0.0080 (12) \\ \hline C7 & 0.0467 (18) & 0.0411 (17) & 0.0453 (19) & −0.0024 (14) & 0.0146 (14) & −0.0121 (14) \\ \hline C8 & 0.0323 (16) & 0.0386 (17) & 0.059 (2) & 0.0095 (12) & 0.0086 (14) & −0.0033 (14) \\ \hline C9 & 0.0267 (13) & 0.0375 (15) & 0.0376 (16) & 0.0063 (11) & −0.0033 (11) & 0.0043 (12) \\ \hline S1 & 0.0193 (3) & 0.0228 (3) & 0.0205 (3) & −0.0010 (2) & 0.0009 (2) & −0.0003 (2) \\ \hline \end{tabular} \end{table}	PMC3089299_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{c\|}{\textbf{All feature set}} & \multicolumn{2}{c\|}{\textbf{Reduced feature set}} \\ \hline & \textbf{\textbf{Training accuracy (\%)}} & \textbf{\textbf{Test accuracy (\%)}} & \textbf{\textbf{Training accuracy (\%)}} & \textbf{\textbf{Test accuracy (\%)}} \\ \hline ANN & 100.00 & 97.67 & 100.00 & 95.50 \\ \hline SVM & 86.00 & 80.00 & 85.33 & 84.00 \\ \hline \end{tabular} \end{table}	PMC3505639_table_3
	\begin{\textbf{t}able} \cen\textbf{t}ering \label{\textbf{t}ab:\textbf{t}ablelabel} \begin{\textbf{t}abular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \mul\textbf{t}icolumn{2}{c\|}{\\textbf{t}ex\textbf{t}bf{In\\textbf{t}ex\textbf{t}bf{p}u\textbf{t}/Hz}} & \\textbf{t}ex\textbf{t}bf{Connec\textbf{t}ivi\textbf{t}y/Hz} & \\textbf{t}ex\textbf{t}bf{P} & \\textbf{t}ex\textbf{t}bf{SD} & \\textbf{t}ex\textbf{t}bf{p} & \textbf{t} \\ \hline In\\textbf{t}ex\textbf{t}bf{p}u\textbf{t} a\textbf{t} (L)STG & \textbf{0.1356} & \textbf{-} & \textbf{1.0000} & \textbf{0.1131} & \textbf{10−4 3.333 ×} & \textbf{3.791} \\ \hline In\\textbf{t}ex\textbf{t}bf{p}u\textbf{t} a\textbf{t} (R)STG & 0.2551 & \textbf{-} & \textbf{1.0000} & 0.0950 & 0.000 & 8.495 \\ \hline (L)HG \textbf{t}o (L)STG & \textbf{-} & 0.0018 & 0.8138 & 0.0129 & 10−2 5.617 × & 0.435 \\ \hline (L)HG \textbf{t}o (R)HG & \textbf{-} & 0.0145 & 0.8492 & 0.0250 & 10−3 8.250 × & 1.838 \\ \hline (L)HG \textbf{t}o (R)STG & \textbf{-} & 0.0101 & 0.5235 & 0.0204 & 10−2 1.275 × & 1.562 \\ \hline (L)STG \textbf{t}o (L)HG & \textbf{-} & 0.0973 & \textbf{1.0000} & 0.0974 & 10−3 1.000 × & 3.158 \\ \hline (L)STG \textbf{t}o (R)HG & \textbf{-} & 0.0801 & \textbf{1.0000} & 0.0856 & 10−3 1.333 × & 2.959 \\ \hline (L)STG \textbf{t}o (R)STG & \textbf{-} & 0.0238 & 0.5243 & 0.0321 & 10−3 3.667 × & 2.346 \\ \hline (R)HG \textbf{t}o (L)HG & \textbf{-} & 0.0199 & 0.9322 & 0.0283 & 10−3 4.417 × & 2.231 \\ \hline (R)HG \textbf{t}o (L)STG & \textbf{-} & 0.0011 & 0.8553 & 0.0119 & 10−2 6.500 × & −0.288 \\ \hline (R)HG \textbf{t}o (R)STG & \textbf{-} & 0.0042 & 0.7825 & 0.0136 & 10−2 2.908 × & 0.988 \\ \hline (R)STG \textbf{t}o (L)HG & \textbf{-} & 0.1716 & \textbf{1.0000} & 0.1432 & \textbf{10−4 3.333 ×} & 3.790 \\ \hline (R)STG \textbf{t}o (L)STG & \textbf{-} & 0.0233 & 0.9134 & 0.0395 & 10−3 8.000 × & 1.860 \\ \hline (R)STG \textbf{t}o (R)HG & \textbf{-} & 0.1339 & \textbf{1.0000} & 0.1032 & 10−4 2.500 × & 4.101 \\ \hline \end{\textbf{t}abular} \end{\textbf{t}able}	PMC3432259_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline D—H···A & D—H & H···A & D···A & D—H···A \\ \hline O2—H2···N1 & 0.82 & 2.31 & 2.760 (7) & 115. \\ \hline N1—H1···O2i & 0.90 & 1.84 & 2.742 (7) & 179. \\ \hline \end{tabular} \end{table}	PMC3275041_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Factor} & \textbf{\% (n)} \\ \hline Reduction of pain & 30\% (7) \\ \hline Ease of walking & 26\% (6) \\ \hline Increase in comfort & 17\% (4) \\ \hline Reduction or prevention of wounds & 9\% (2) \\ \hline More stability & 9\% (2) \\ \hline Being able to do activities again & 4\% (1) \\ \hline Easy donning and doffing & 4\% (1) \\ \hline \end{tabular} \end{table}	PMC3404931_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Variables} & \textbf{Regression Coefficients(95\% CI)} \\ \hline Literacy & 21.44 (22.61, 20.26) \\ \hline Poor households & 1.10 (0.33, 1.87) \\ \hline Urban population & 20.62 (21.29, 0.05) \\ \hline Vulnerable population & 20.46 (2.96, 0.04) \\ \hline Total fertility rate & 29.7 (15.99, 43.49) \\ \hline Institutional birth & 0.29 (20.10, 0.68) \\ \hline Caesarean rate & 5.08 (1.84, 8.33) \\ \hline \end{tabular} \end{table}	PMC3694862_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & & \multicolumn{5}{c\|}{\textbf{Total}} & \multicolumn{3}{c\|}{\textbf{Excluding cases within 5 years}} \\ \hline & & \textbf{\textbf{\textbf{\textbf{P}}}erson-years} & \textbf{\textbf{No. of cases}} & \textbf{HR1 (95\% CI)} & \textbf{\textbf{\textbf{P}}} & \textbf{\textbf{HR2 (95\% CI)}} & \textbf{\textbf{\textbf{P}}} & \textbf{\textbf{No. of cases}} & \textbf{\textbf{HR2 (95\% CI)}} & \textbf{\textbf{\textbf{P}}} \\ \hline Men \\ \hline & & & \multicolumn{5}{c\|}{\textbf{Total} cancer} \\ \hline & Never use & 220,948 & 2152 & 1.00 (reference) & & 1.00 (reference) & & 1210 & 1.00 (reference) \\ \hline & \textbf{\textbf{\textbf{P}}}ast use & 28,863 & 324 & 0.98 (0.87-1.10) & 0.8 & 0.98 (0.87-1.10) & 0.8 & 167 & 0.95 (0.80-1.11) & 0.5 \\ \hline & Recent use & 9603 & 102 & 1.00 (0.82-1.22) & 0.97 & 1.01 (0.83-1.23) & 0.9 & 59 & 1.05 (0.80-1.36) & 0.7 \\ \hline & Consistent use & 10,863 & 139 & 1.11 (0.94-1.32) & 0.2 & 1.10 (0.93-1.31) & 0.3 & 75 & 1.13 (0.89-1.43) & 0.3 \\ \hline & & & \multicolumn{5}{c\|}{Cardiovascular disease} \\ \hline & Never use & 203,013 & 934 & 1.00 (reference) & & 1.00 (reference) & & 490 & 1.00 (reference) \\ \hline & \textbf{\textbf{\textbf{P}}}ast use & 26,639 & 125 & 0.91 (0.75-1.09) & 0.3 & 0.89 (0.73-1.07) & 0.2 & 61 & 0.86 (0.66-1.12) & 0.3 \\ \hline & Recent use & 8889 & 31 & 0.71 (0.50-1.02) & 0.06 & 0.72 (0.51-1.04) & 0.08 & 15 & 0.66 (0.39-1.10) & 0.1 \\ \hline & Consistent use & 10,059 & 53 & 1.03 (0.78-1.36) & 0.8 & 1.02 (0.77-1.35) & 0.9 & 28 & 1.04 (0.71-1.53) & 0.8 \\ \hline Women \\ \hline & & & \multicolumn{5}{c\|}{\textbf{Total} cancer} \\ \hline & Never use & 248,659 & 1299 & 1.00 (reference) & & 1.00 (reference) & & 698 & 1.00 (reference) \\ \hline & \textbf{\textbf{\textbf{P}}}ast use & 44,237 & 287 & 1.19 (1.04-1.35) & 0.01 & 1.17 (1.02-1.33) & 0.02 & 157 & 1.21 (1.01-1.44) & 0.04 \\ \hline & Recent use & 15,217 & 101 & 1.25 (1.02-1.53) & 0.03 & 1.24 (1.01-1.52) & 0.04 & 56 & 1.26 (0.96-1.66) & 0.1 \\ \hline & Consistent use & 18,892 & 97 & 0.94 (0.76-1.16) & 0.6 & 0.92 (0.75-1.13) & 0.4 & 47 & 0.82 (0.61-1.11) & 0.2 \\ \hline & & & \multicolumn{5}{c\|}{Cardiovascular disease} \\ \hline & Never use & 227,570 & 530 & 1.00 (reference) & & 1.00 (reference) & & 262 & 1.00 (reference) \\ \hline & \textbf{\textbf{\textbf{P}}}ast use & 40,586 & 116 & 1.11 (0.91-1.36) & 0.3 & 1.08 (0.88-1.32) & 0.5 & 63 & 1.24 (0.94-1.64) & 0.1 \\ \hline & Recent use & 13,918 & 43 & 1.30 (0.95-1.77) & 0.1 & 1.32 (0.97-1.81) & 0.08 & 20 & 1.26 (0.80-1.99) & 0.3 \\ \hline & Consistent use & 17,309 & 26 & 0.60 (0.40-0.89) & 0.01 & 0.60 (0.41-0.89) & 0.01 & 14 & 0.70 (0.41-1.21) & 0.2 \\ \hline \end{tabular} \end{table}	PMC3146872_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\ \hline Fe1 & 0.0226 (3) & 0.0153 (3) & 0.0243 (3) & 0.0050 (2) & −0.0034 (2) & −0.0004 (2) \\ \hline Fe2 & 0.0269 (4) & 0.0200 (3) & 0.0247 (3) & 0.0056 (2) & −0.0043 (2) & −0.0003 (2) \\ \hline C1 & 0.0253 (14) & 0.0248 (14) & 0.0301 (15) & 0.0088 (12) & 0.0027 (11) & −0.0011 (11) \\ \hline C2 & 0.0261 (14) & 0.0260 (14) & 0.0284 (15) & 0.0082 (12) & 0.0021 (11) & −0.0013 (11) \\ \hline C3 & 0.0369 (17) & 0.0282 (15) & 0.0302 (16) & 0.0083 (13) & 0.0019 (13) & 0.0059 (12) \\ \hline C4 & 0.0357 (16) & 0.0215 (14) & 0.0403 (17) & 0.0090 (13) & 0.0041 (13) & 0.0059 (12) \\ \hline C5 & 0.0251 (14) & 0.0225 (14) & 0.0355 (16) & 0.0079 (12) & 0.0054 (12) & 0.0003 (12) \\ \hline C6 & 0.0277 (15) & 0.0226 (13) & 0.0314 (15) & 0.0088 (12) & 0.0006 (12) & −0.0004 (11) \\ \hline C7 & 0.0242 (14) & 0.0258 (15) & 0.0432 (18) & 0.0083 (12) & 0.0023 (13) & −0.0049 (13) \\ \hline N1 & 0.0259 (12) & 0.0187 (11) & 0.0308 (13) & 0.0071 (10) & −0.0003 (10) & 0.0014 (9) \\ \hline O1 & 0.0403 (13) & 0.0383 (13) & 0.0492 (14) & 0.0153 (11) & −0.0089 (11) & −0.0151 (11) \\ \hline O2 & 0.0407 (13) & 0.0349 (12) & 0.0411 (13) & 0.0033 (10) & −0.0026 (10) & 0.0113 (10) \\ \hline O3 & 0.0366 (12) & 0.0278 (11) & 0.0308 (11) & 0.0047 (9) & −0.0072 (9) & 0.0010 (8) \\ \hline O4 & 0.0367 (12) & 0.0228 (10) & 0.0314 (11) & 0.0071 (9) & −0.0096 (9) & −0.0011 (8) \\ \hline O5 & 0.0320 (11) & 0.0320 (12) & 0.0439 (13) & 0.0104 (10) & 0.0072 (10) & 0.0046 (10) \\ \hline O6 & 0.0572 (15) & 0.0302 (12) & 0.0434 (14) & 0.0136 (11) & −0.0134 (11) & −0.0088 (10) \\ \hline O7 & 0.0367 (13) & 0.0198 (11) & 0.0632 (16) & 0.0040 (10) & −0.0020 (11) & −0.0008 (10) \\ \hline O8 & 0.0469 (16) & 0.075 (2) & 0.066 (2) & 0.0196 (16) & 0.0038 (14) & 0.0019 (16) \\ \hline O9 & 0.116 (3) & 0.054 (2) & 0.163 (5) & 0.019 (2) & 0.041 (3) & 0.000 (2) \\ \hline \end{tabular} \end{table}	PMC2960407_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Name} & \textbf{DNA sequence (5′ to 3′)} \\ \hline YAP1-GFP_fw2 & ccgctctagaactagtggatcccccgggctgcaggaattccgaagtg gagcagtttacag \\ \hline YAP1-GFP_rv1 & gaattgggacaactccagtgaaaagttcttctcctttactgttcatatgctt attcaaagc \\ \hline GFP_UP & agtaaaggagaagaacttttcactg \\ \hline GFP_rv1 & ctaaagggaacaaaagctgggtaccgggccccccctcgagttaccct gttatccctagcg \\ \hline FW_HXT2_RT & tgagacagaacaggagcc \\ \hline RV_HXT2_RT & cacatcagacaagctagcg \\ \hline RT_HXT7_UP & tgcttccgtgggtgtcacc \\ \hline RT_HXT7_DOWN & tggcttgtcatcgtgagtc \\ \hline RT_MDH2_UP & ggtggtatcgggcagtcg \\ \hline RT_MDH2_ DOWN & cagggacgtcaggcatgg \\ \hline HXK1_5_RTPCR & tcaagaccactctgccagaa \\ \hline HXK1_3_RTPCR & ttggatctttgcttgcgtca \\ \hline RT-GAC1_FW & actcatgctacgcctgatgg \\ \hline RT-GAC1_RV & tcgaatcatgagggatggcg \\ \hline GSY1_3_RTPCR & attccaaccccattctcttcc \\ \hline GSY1_5_RTPCR & tgattgaaacagaccaagcga \\ \hline HXK1_5_RTPCR & tcaagaccactctgccagaa \\ \hline ARN1 For & tgagacagaacaggagcc \\ \hline ARN1 Rev & cacatcagacaagctagcg \\ \hline PHO84_F_RTPCR & tgctagagacggtaagccgccaa \\ \hline PHO84_R_RTPCR & atgggctggaagattcaatg \\ \hline RT-PHO11_12_FW & tcctgcttgggacgatgatg \\ \hline RT-PHO11_12_RV & tcatagcctggtcccgtttg \\ \hline RT-PHO5_FW & tcccttaggcaaactagccg \\ \hline RT-PHO5_RV & gagccgttgaattgacgagtg \\ \hline HSP12For & atgtctgacgcaggtagaaaag \\ \hline HSP12 Rev & ccttcagcgttatccttgcc \\ \hline HSP26 For & ggcggcttaagaggctac \\ \hline HSP26 Rev & gacaccaggaaccacgac \\ \hline RT-INO1_FW & ctccactttagtggcctcgg \\ \hline RT-INO1_RV & ttcgccttcaagcgttgttg \\ \hline RT_TUB2_For & caggtcagtgtggtaacc \\ \hline RT_TUB2_Rev & ttggcccacacgttgccc \\ \hline \end{tabular} \end{table}	PMC4578605_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{IAV Dynamin dependent}} & \multirow{2}{}{\textbf{IAV Dynaminindependent}} & \multirow{2}{}{\textbf{VV WR}} & \multirow{2}{}{\textbf{VV IHD-J}} & \multirow{2}{*}{\textbf{CVB}} \\ \hline \\ \hline Fluid uptake \\ \hline Induction & NO & YES & YES & YES \\ \hline Co-localization & NO & YES & YES & & YES \\ \hline Cytoskeleton \\ \hline Actin & NO & YES & YES & YES \\ \hline Myosins & NO & YES & YES & YES \\ \hline GTPases \\ \hline Rac1 & NO & NO & YES & YES/NO & NO \\ \hline Cdc42 & NO & NO & YES/NO & YES \\ \hline Rab5 & YES & YES & YES & YES & YES \\ \hline Kinases \\ \hline PAK1 & NO & YES & YES & YES \\ \hline PI(3)kinase & YES & YES & YES & NO \\ \hline Receptor Tyrosine kinases & NO & YES & YES & YES \\ \hline Protein kinase C & YES/NO & YES & YES & YES & YES \\ \hline SFK (src family kinases) & NO & YES & & & YES \\ \hline Others \\ \hline Na+/H+ exchange & NO & YES & YES & YES & YES \\ \hline Acidification & YES & YES & YES & NO & NO \\ \hline Dynamin 2 & YES & NO & NO & NO & NO \\ \hline \end{tabular} \end{table}	PMC3068995_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Name} & \textbf{ATCC number} & \textbf{Cancer type} & \textbf{Organ/cell type} \\ \hline AGS & CRL-1739 & Adenocarcinoma & Stomach/Epithelial cell \\ \hline Caco-2 & HTB-37 & Adenocarcinoma & Colon/Epithelial cell \\ \hline HeLa & CCL-2 & Adenocarcinoma & Cervix/Epithelial cell \\ \hline HOG & - & Oligodendrocytoma & Brain/Oligodendrocyte \\ \hline HT-29 & HTB-38 & Adenocarcinoma & Colon/Epithelial cell \\ \hline SH-SY5Y & CRL-2266 & Neuroblastoma & Brain/Neuron \\ \hline STTG1 & CRL-1718 & Astrocytoma & Brain/Astrocyte \\ \hline \end{tabular} \end{table}	PMC3293732_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Set} & \textbf{Oligonucleotide} & \textbf{59 to 39 DNA sequence} \\ \hline A & W2EctoCOFP.1 & CATGGGATCCCAGAATTACTGGGAACACCCGTATCAG \\ \hline A & W2EctoCORP.1 & GCATGCCTCGAGACTGCAGTCATTTCATTTTATCGTAGGTCGGTTTGTGCTCAGGG \\ \hline B & 3D7EctoCOFP.1 & CATGGGATCCCAGAACTACTGGGAACATCCGTATCAGAACTCAGACG \\ \hline B & 3D7EctoCORP.1 & GCATGCCTCGAGACTGCAGTCATTTCATCTTGTCATACGTCGGTTTATGTTCAGG \\ \hline C & HB3EctoCOFP.1 & CATGGGATCCCAAAATTACTGGGAACATCCGTATCAGAACAGTGATG \\ \hline C & HB3EctoCORP.1 & GCATGCCTCGAGTCATTTCATATTATCATAGGTTGGCTTGTGTTCCGGG \\ \hline D & FVOEctoCOFP.1 & CATGGGATCCCAGAACTATTGGGAGCACCCATATCAGAAAAGCGACG \\ \hline D & FVOEctoCORP.1 & GCATGCCTCGAGTCATTTCATATTATCGTAGGTTGGTTTATGTTCCGG \\ \hline E & W2AMA1TFP.1 & GGACTAGTGGAAGAGGACAGAATTATTGGGAACATCCATATC \\ \hline E & W2AMA1TRP.1 & CCGCTCGAGTCAACAATTTCCATCGACCCATAATCCGAATTTTGC \\ \hline F & W2AMA1PFP.1 & CCGCTCGAGATTAATGAGGTGTGTTGGGAAACAGAAGAAAAAAAC \\ \hline F & W2AMA1PRP.1 & CGGGGTACCTTGAAAAATTATCAAATAAATTATTAGGTTTTTAAAATTA \\ \hline G & PfAMA1UnistrainFp.1 & GAGAAAATTATACTGCGTATTATTATTGAGCGCCTTTGAG \\ \hline G & PfAMA1UnistrainRp.1 & GCTGAAAAATATGATAAAATGGATGAACCACAAGATTATGGG \\ \hline H & 3D7AMACOKpnFMP.1 & AAAGTCGGTACCATTAATGTACTTGTTATAAATTGTACAAAAATGAGAAAATTATACTGCG \\ \hline H & 3D7AMACOPstRMP.1 & CATGCTGCAGACTAGTTCAGTAATAAGGTTTTTCCATCAGAACCGGTGTGGTATGGGACGC \\ \hline I & 3D7-GD1FMP.1 & CTGAACGGTATGCGTGACTTCTACAAAAACAATGAATACGTGAAGAATCTGGATGAGCTG \\ \hline I & 3D7-GD1RMP.1 & CGTATTCATTGTTTTTGTAGAAGTCACGCATACCGTTCAGAGTCATCGGCGACATCAGAGG \\ \hline J & FVOAMACOKpnFMP.1 & AAAGTCGGTACCATTAATGTACTTGTTATAAATTGTACAAAAATGAGAAAATTATACTGCG \\ \hline J & FVOAMACOPstRMP.1 & CATGCTGCAGACTAGTTTAATAATATGGTTTTTCCATCAGCACAGGCGTAGTGTGACTCGC \\ \hline K & FVO-EH1FMP.1 & CCCTGGACGAGATGCGTCACTTTTATAAAGACAATAAATACGTTAAAAACCTGGATGAACTG \\ \hline K & FVO-EH1RMP.1 & CGTATTTATTGTCTTTATAAAAGTGACGCATCTCGTCCAGGGTCATCGGAGAAATCAGCGGG \\ \hline L & W2AMACOKpnFMP.1 & AAAGTCGGTACCATTAATGTACTTGTTATAAATTGTACAAAAATGAGAAAATTATACTGCG \\ \hline L & W2AMACOPstRMP.1 & CATGCTGCAGACTAGTTCAATAATACGGCTTTTCCATCAGAACCGGGGTGGTATGACTTGC \\ \hline M & W2-EH1FMP.1 & CTGGATGAGATGCGTCACTTCTACAAAGACAACAAAGACGTGAAAAATCTGGATGAACTGACC \\ \hline M & W2-EH1RMP.1 & GTCTTTGTTGTCTTTGTAGAAGTGACGCATCTCATCCAGCGTCATAGGAGACATCAGCGG \\ \hline N & W2-QH1FMP.1 & CTGGATCAGATGCGTCACCTGTACAAAGACAACGAAGACGTGAAAAATCTGGATGAACTGACC \\ \hline N & W2-QH1RMP.1 & GTCTTCGTTGTCTTTGTACAGGTGACGCATCTGATCCAGCGTCATAGGAGACATCAGCGG \\ \hline O & W2-GD1FMP.1 & CTGAATGGTATGCGTGACTTCTACAAAAACAACGAAGACGTGAAAAATCTGGATGAACTGACC \\ \hline O & W2-GD1RMP.1 & GTCTTCGTTGTTTTTGTAGAAGTCACGCATACCATTCAGCGTCATAGGAGACATCAGCGG \\ \hline P & W2-DR1FMAP.1 & CTGGATGATATGCGTCGTTTCTACAAAGACAACGAAGACGTGAAAAATCTGGATGAACTGACC \\ \hline P & W2-DR1RMP.1 & GTCTTCGTTGTCTTTGTAGAAACGACGCATATCATCCAGCGTCATAGGAGACATCAGCGG \\ \hline Q & W2-QD1FMP.1 & CTGGATCAGATGCGTGACTTCTACAAAAACAACGAAGACGTGAAAAATCTGGATGAACTGACC \\ \hline Q & W2-QD1RMP.1 & GTCTTCGTTGTTTTTGTAGAAGTCACGCATCTGATCCAGCGTCATAGGAGACATCAGCGG \\ \hline R & W2-DN1FMP.1 & CTGGACGACATGCGTAACTTCTACAAAGACAATGAAGACGTGAAAAATCTGGATGAACTGACC \\ \hline R & W2-DN1RMP.1 & GTCTTCATTGTCTTTGTAGAAGTTACGCATGTCGTCCAGCGTCATAGGAGACATCAGCGG \\ \hline \end{tabular} \end{table}	PMC3515520_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multicolumn{2}{c\|}{\textbf{Medians (min-max) log DNA (qPCR)}} \\ \hline & \textbf{2 day-old} & \textbf{30 day-old} & \textbf{P*} \\ \hline Universal & 13.2 (11.0 to 14.5) & 12.3 (9.3 to 14.2) & 0.0108 \\ \hline Bacteroidetes & 11.4 (8.4 to 12.9) & 11.2 (9.3 to 12.4) & 0.9519 \\ \hline Enterococcus & 7.9 (6.5 to 9.3) & 5.7 (4.1 to 7.3) & ,0.0001 \\ \hline Escherichia & 8.2 (4. 3 to 8.9) & 5.3 (2.8 to 6.5) & ,0.0001 \\ \hline Fusobacteria & 8.6 (6.0 to 10.4) & 7.8 (6.4 to 9.7) & 0.1051 \\ \hline \end{tabular} \end{table}	PMC3681940_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline D—H···A & D—H & H···A & D···A & D—H···A \\ \hline C3—H3···O1 & 0.93 & 2.36 & 2.703 (2) & 101 \\ \hline C6—H6···O2iv & 0.93 & 2.52 & 3.296 (3) & 142 \\ \hline C22—H22···Cg1xi & 0.93 & 2.95 & 3.683 (3) & 137 \\ \hline \end{tabular} \end{table}	PMC3007010_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{c\|}{\textbf{Baseline}} & \multicolumn{3}{c\|}{\textbf{5 year follow-up}} \\ \hline & \textbf{Diabetes (n = 299)} & \textbf{Controls (n = 112)} & \textbf{\textbf{p value}} & \textbf{Diabetes (n = 241)} & \textbf{Controls (n = 128)} & \textbf{\textbf{p value}} \\ \hline (years)a Diabetes duration & 5.1 (2.9, 7.7) & & & 9.6 (7.5, 12.6) \\ \hline Insulin pump users (\%) & 53.3 & & & 61.3 \\ \hline Age (years) & 13.7 (2.8) & 13.4 (2.5) & 0.207 & 18.7 (2.8) & 18.7 (2.9) & 0.895 \\ \hline Girls, n (\%) & 150 (50.2) & 64 (57.1) & 0.224 & 129 (53.5) & 72 (56.3) & 0.661 \\ \hline Height (cm) & 160.5 (14.4) & 157.6 (13.3) & 0.060 & 171.2 (9.1) & 172.1 (9.2) & 0.383 \\ \hline Weight (kg) & 54.8 (16.7) & 48.5 (13.2) & <0.001 & 71.0 (14.6) & 66.9 (12.5) & 0.006 \\ \hline (kg/m2) BMI & 20.8 (3.9) & 19.2 (3.1) & <0.001 & 24.1 (4.3) & 22.5 (3.4) & <0.001 \\ \hline Waist circumference (cm) & 71.1 (10.0) & 66.8 (6.6) & <0.001 & 79.0 (9.6) & 75.5 (8.2) & <0.001 \\ \hline Systolic blood pressure (mmHg) & 101 (10.1) & 98 (10) & 0.025 & 112 (11) & 111 (10) & 0.656 \\ \hline Diastolic blood pressure (mmHg) & 60 (8) & 58 (7) & 0.017 & 70 (8) & 68 (8) & 0.024 \\ \hline HbA1c (\%) [mmol/mol, SD] & 8.4 (1.2) [68, 13.1] & 5.3 (0.3) [34, 3.3] & <0.001 & 9.0 (1.4) [75, 15.3] & 5.2 (0.3) [33, 3.3] & <0.001 \\ \hline Total cholesterol (mmol/L) & 4.6 (0.8) & 4.3 (0.7) & 0.001 & 4.8 (1.0) & 4.4 (1.0) & 0.001 \\ \hline HDL (mmol/L) & 1.8 (0.4) & 1.7 (0.4) & 0.048 & 1.6 (0.5) & 1.6 (0.4) & 0.161 \\ \hline LDL (mmol/L) & 2.5 (0.7) & 2.3 (0.7) & 0.016 & 2.7 (0.8) & 2.5 (0.8) & 0.014 \\ \hline (mmol/L)a Triglycerides & 0.7 (0.5, 0.9) & 0.7 (0.5, 0.9) & 0.367 & 0.9 (0.6, 1.3) & 0.8 (0.6, 1.0) & 0.024 \\ \hline Apolipoprotein B (g/L) & 0.74 (0.19) & 0.66 (0.17) & <0.001 & 0.90 (0.26) & 0.79 (0.23) & <0.001 \\ \hline Apolipoprotein A1 (g/L) & 1.55 (0.28) & 1.44 (0.33) & 0.001 & 1.56 (0.31) & 1.48 (0.27) & 0.006 \\ \hline ApoB/ApoA1 & 0.5 (0.2) & 0.5 (0.3) & 0.698 & 0.6 (0.2) & 0.5 (0.2) & 0.025 \\ \hline (mg/mmol)a Urine albumin/creatinine & 0.70 (0.40, 1.30) & 0.63 (0.36, 1.33) & 0.688 & 0.65 (0.30, 1.55) & 0.34 (0.19, 0.90) & 0.001 \\ \hline \end{tabular} \end{table}	PMC4582642_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Application} & \textbf{In vivo model} & \textbf{Type of formulation} & \textbf{Reference} \\ \hline \multirow{3}{}{Intraperitoneal} & Immunomodulation & Solution (water) & \textbf{[65]} \\ \hline \multirow{2}{}{Intravenous Candida infection} & Solution (methanol) & [77] \\ \hline Suspension (methanol) & [75] \\ \hline \multirow{2}{}{Intravaginal} & \multirow{2}{}{Vaginal infection} & Cream (o/w emulsion) & [70] \\ \hline Suspension & [79] \\ \hline Intravenous & Intravenous Candida infection & Solution (water) & [78] \\ \hline \multirow{7}{}{Orally} & Anti-inflammation, antinociceptive and would healing potential (incision/excision models) & Suspension (0.5\% sodium carboxy methyl cellulose (CMC)) & [72] \\ \hline Excision and incision wound & Suspension (extract in vehicle) & [74] \\ \hline \multirow{2}{}{Immunomodulation} & Suspension (1\% sodium carboxy methyl cellulose (CMC)) & [66] \\ \hline Suspension (1\% w/v aqueous gum acacia) & [67] \\ \hline Intravenous Candida infection & Solution (aqueous) & [76] \\ \hline Oral cavity children affections & Mouthwash (water) & [81] \\ \hline Subclinical mastitis & Crude extracts (cooked and powder leaves) & [80] \\ \hline & \multirow{2}{}{Excision and incision wound} & Ointment (vehicle) & [72] \\ \hline & Cream (aqueous) & [71] \\ \hline \multirow{2}{}{Topically} & \multirow{4}{*}{Excision wound} & Cream (aqueous) & [73] \\ \hline Ointment (w/w) & [69] \\ \hline & Ointment (w/w) & [90] \\ \hline & Ointment (vehicle) & [68] \\ \hline \end{tabular} \end{table}	PMC4561301_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Variable} & \multicolumn{3}{c\|}{\textbf{Gross Waiting Time (logarithm)}} \\ \hline & \textbf{Tobit1 (Weber B Fracture)} & \textbf{OLS (Stenosis)} & \textbf{OLS (Conisation)} \\ \hline Privately Insured & -0.362 (0.191) & -0.152 (0.148) & -0.084 (0.107) \\ \hline Insurance Status Questioned & 0.535 (0.138)* & 0.148 (0.156) & 0.008 (0.088) \\ \hline Privately Owned Hospital & -0.231 (0.127)* & 0.174 (0.236) & -0.227 (0.116)* \\ \hline Public Hospital & -0.223 (0.098) & -0.093 (0.141) & -0.116 (0.076) \\ \hline Number of Beds & 0.075 (0.129) & 0.519 (0.205) & 0.239 (0.119) \\ \hline Intercept & -0.093 (0.087) & 1.981(0.175)* & 1.995(0.076)*** \\ \hline Observations & 68 uncensored/144 censored & 165 & 230 \\ \hline F-Value/LR Chi2 & 20.67 & 1.33 & 3.06 \\ \hline Prob > F/Prob > Chi2 & 0.0021 & 0.2489 & 0.0068 \\ \hline Adj. R2 or Pseudo R2 (Mc Fadden) & 0.0473 & 0.0120 & 0.0512 \\ \hline \end{tabular} \end{table}	PMC2803779_table_4
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Nematode} & \textbf{Length (μm)} & \textbf{Oesophagus} & \textbf{Caudal end} & \textbf{Refs} \\ \hline Aelurostrongylus abstrusus & 300-390 & Non-rhabditiform; 1/3 - 1/2 the length of the larvae & Notched and S-shaped & [97,131] \\ \hline Angiostrongylus vasorum & 310-400 & Non-rhabditiform; 1/3 - 1/2 the length of the larvae & Tip with a dorsal spine and a sinus wave curve & [21,93] \\ \hline Oslerus rostratus & 335-412 & Non-rhabditiform; 1/3 - 1/2 the length of the larvae & Constriction anterior to the end; tip with a kinked appearance & [21,93] \\ \hline Oslerus osleri Filaroides spp. & ~250 & Non-rhabditiform; 1/3 - 1/2 the length of the larvae & Absence of dorsal spines and S-shaped end with a slight kink & [91,93] \\ \hline Crenosoma vulpis & 240-310 & Non-rhabditiform; 1/3 - 1/2 the length of the larvae & Pointed and straight tail & [127] \\ \hline Strongyloides stercoralis & 150-390 & Rhabditiform (corpus, isthmus, valvulated bulb); 1/4 the length of the larvae & Pointed and straight tail & [93] \\ \hline Hookworm larvae & 290-360 \\ \hline \end{tabular} \end{table}	PMC2923136_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Limited cutaneous SSc (n = 32)} & \textbf{Diffuse cutaneous SSc (n = 20)} & \textbf{p Value} \\ \hline Patients with at least one cardiac MRI abnormality, n (\%) & 24 (75) & 15 (75) & 1.00 \\ \hline Morphological abnormalities \\ \hline Increased signal intensity in T2-weighted sequence, n (\%) & 2 (7) & 4 (20) & 0.20 \\ \hline Thinned LV myocardium, n (\%) & 8 (25) & 7 (35) & 0.44 \\ \hline LV dilatation, n (\%) & 1 (3) & 2 (10) & 0.55 \\ \hline RV hypertrophy, n (\%) & 1 (3) & 1 (5) & 1.00 \\ \hline RV dilatation, n (\%) & 5 (16) & 6 (30) & 0.29 \\ \hline Pericardial effusion, n (\%) & 7 (22) & 3 (15) & 0.72 \\ \hline Functional abnormalities \\ \hline LV kinetic abnormalities, n (\%) & 10 (31) & 6 (30) & 0.92 \\ \hline RV kinetic abnormalities, n (\%) & 3 (9) & 2 (10) & 1.00 \\ \hline Mean (SD) LV ejection fraction, \% & 59 (10) & 62 (7) & 0.20 \\ \hline Impaired LV ejection fraction & 11 (34) & 1 (5) & 0.02 \\ \hline ml/m2 Mean (SD) LV end-diastolic volumes, & 68 (14) & 69 (17) & 1.00 \\ \hline Mean (SD) cardiac output, l/min & 4.8 (1.4) & 5.6 (1.3) & 0.04 \\ \hline Mean (SD) RV ejection fraction, \% & 52 (12) & 50 (10) & 0.31 \\ \hline Impaired RV ejection fraction, n (\%) & 6 (19) & 5 (25) & 0.73 \\ \hline Mean (SD) RV end-diastolic volumes, ml/m2 & 73 (11) & 87 (28) & 0.03 \\ \hline LV diastolic dysfunction on transmitral flow analysis, n (\%) & 11/29 (38) & 4/14 (7) & 0.41 \\ \hline Delayed contrast enhancement, n (\%) & 6 (19) & 5 (25) & 0.73 \\ \hline \end{tabular} \end{table}	PMC2770106_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{Coefficient} & \textbf{Odds Ratio} & \textbf{95\% C.I.} & \textbf{p-value} \\ \hline CCL18 & 2.91 & 18.31 & 4.95–67.70 & ,0.0001 \\ \hline CD44 & 23.25 & 0.039 & 0.004–0.35 & 0.0036 \\ \hline PAI-1 & 20.72 & 0.48 & 0.096–2.44 & 0.38 \\ \hline BTA & 1.86 & 6.43 & 1.86–22.21 & 0.0033 \\ \hline \end{tabular} \end{table}	PMC3357344_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{S. No} & \textbf{Database} & \multicolumn{2}{c\|}{\textbf{No of BAC-End reads harbouring regions of similarity}} & \textbf{No of hits as proportion of total reads@ number of BAC-End (\%)} & \textbf{Total HSP score} & \textbf{Proportion as \% of total length of BAC-End-sequences*} \\ \hline & & \textbf{e-5 cutoff} & \textbf{e-25 cutoff} \\ \hline 1 & Flax-EST & 21,532 & - & 26.8 & 5,303,617 & 9.7 \\ \hline 2 & NCBI-EST & 17,038 & - & 21.2 & 3,349,832 & 6.1 \\ \hline 3 & NCBI-Protein-nr & 24,962 & 14,288 & (e-5) 31.1 (e-25) 17.8 & - & - \\ \hline \end{tabular} \end{table}	PMC3113786_table_7
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{GenBank Acc. No.} & \textbf{Fold change F. ananassa/F. vesca UP} & \textbf{Sequence Description} \\ \hline GT149212 & 226.0 & LRR serine-threonine protein kinase \\ \hline DY667473 & 81.3 & LRR serine-threonine protein kinase \\ \hline GW402842 & 79.8 & rac gtp binding protein arac7 \\ \hline DV439123 & 40.4 & serine-threonine protein kinase \\ \hline GT150368 & 33.6 & receptor protein \\ \hline DY673796 & 31.7 & serine-threonine protein kinase \\ \hline DV438802 & 26.4 & phosphoinositide binding \\ \hline GT149729 & 17.6 & type-b response regulator \\ \hline GT149402 & 14.4 & auxin-repressed protein \\ \hline CX661768 & 14.0 & auxin influx carrier protein \\ \hline GT151327 & 9.3 & gasa4-like protein \\ \hline CX662081 & 7.4 & auxin-induced protein \\ \hline DY676267 & 6.0 & glutamate-gated kainate-type ion channel receptor subunit 5 \\ \hline DY672414 & 5.3 & auxin influx transport protein \\ \hline GT150907 & 5.1 & brassinosteroid insensitive 1- associated receptor kinase 1 \\ \hline DV439901 & 4.7 & gasa4-like protein \\ \hline DY675461 & 4.5 & conserved hypothetical protein \\ \hline DY676028 & 4.3 & auxin-repressed protein \\ \hline DY671913 & 4.2 & two-component system sensor histidine kinase response \\ \hline DV438250 & 4.2 & conserved hypothetical protein \\ \hline \end{tabular} \end{table}	PMC2996999_table_10
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Maximal clique} & \textbf{Size} \\ \hline {CMA1, AGT, ACE} & 3 \\ \hline {Hypertension, AGT, ACE, AGTR1} & 4 \\ \hline {Hypertension, AGT, ACE, REN} & 4 \\ \hline {Hypertension, AGT, PRCP, REN} & 4 \\ \hline {Hypertension, CYP11B2, CYP11B1, HSD11B2} & 4 \\ \hline {Hypertension, GNB3} & 2 \\ \hline {Hypertension, PNMT} & 2 \\ \hline {Hypertension, SCNN1B, SCNN1G} & 3 \\ \hline {SAH, SCNN1G} & 2 \\ \hline {CYP17, CYP11B2, CYP11B1, HSD11B2} & 4 \\ \hline {AGTR2, AGT, AGTR1} & 3 \\ \hline \end{tabular} \end{table}	PMC2721841_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Substrate} & \textbf{g−1) Wet mass N (mg} & \textbf{g−1) Wet mass C (mg} & \textbf{C/N ratio} & \textbf{TS (\%)} & \textbf{oDM (\%)} \\ \hline Maize silage & 4.35 & 196.86 & 45.3:1 & 41.19 & 94.59 \\ \hline Algal-bacterial mix & 18.65 & 98.33 & 5.3:1 & 30.30 & 97.71 \\ \hline \end{tabular} \end{table}	PMC4395902_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & & & & \multicolumn{2}{c\|}{\textbf{S T U D Y G R O U P S}} \\ \hline \textbf{Parameter} & \textbf{Unit} & \textbf{Zone} & \textbf{Sham} & \textbf{MM + veh} & \textbf{MM + Zol} & \textbf{MM + PTH} \\ \hline & & z1 & 0.12 $\pm$ 0.02 & 0.06* 0.19 $\pm$ & 0.06* 0.19 $\pm$ & 0.06* 0.19 $\pm$ \\ \hline Cartilage & mm3 & z2 & 0.20 $\pm$ 0.02 & 0.04 0.11 $\pm$ & 0.03 0.12 $\pm$ & 0.06** 0.12 $\pm$ \\ \hline \multirow{2}{}{Volume} & & z3 & 0.19 $\pm$ 0.04 & 0.04 0.23 $\pm$ & 0.05* 0.23 $\pm$ & 0.06* 0.23 $\pm$ \\ \hline & z1 & 0.14 $\pm$ 0.02 & 0.06* 0.18 $\pm$ & 0.04* 0.18 $\pm$ & 0.07* 0.18 $\pm$ \\ \hline Cartilage & mm & z2 & 0.23 $\pm$ 0.02 & 0.04 0.15 $\pm$ & 0.03 0.15 $\pm$ & 0.06** 0.15 $\pm$ \\ \hline Thickness & & z3 & 0.23 $\pm$ 0.04 & 0.20 $\pm$ 0.03 & 0.21 $\pm$ 0.03 & 0.20 $\pm$ 0.05 \\ \hline \end{tabular} \end{table}	PMC4635572_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline C16H11N3O3 & F000 = 608 \\ \hline Mr = 293.28 & m−3 Dx = 1.487 Mg \\ \hline Monoclinic, P21 & Mo Kα radiation λ = 0.71073 Å \\ \hline Hall symbol: P 2yb & Cell parameters from 4482 reflections \\ \hline a = 7.3783 (14) Å & θ = 3.2–27.5º \\ \hline b = 23.878 (5) Å & mm−1 µ = 0.11 \\ \hline c = 7.4371 (14) Å & T = 93 (2) K \\ \hline β = 90.775 (3)º & Block, white \\ \hline Å3 V = 1310.2 (4) & 0.40 × 0.30 × 0.23 mm \\ \hline Z = 4 \\ \hline \end{tabular} \end{table}	PMC2960006_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Macrophages(\%)} & \textbf{Lymphocytes(\%)} & \textbf{Neutrophils(\%)} \\ \hline Decoy & 98.62 $\pm$ 0.40 & 0.60 $\pm$ 0.47 & 0.79 $\pm$ 0.56 \\ \hline NS & 98.94 $\pm$ 1.03 & 0.59 $\pm$ 0.70 & 0.48 $\pm$ 0.38 \\ \hline Pr > Chi-Square & 0.7728 & 0.766 & 0.3094 \\ \hline \end{tabular} \end{table}	PMC2751757_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Species} & \textbf{AUC (mean $\pm$ SD)} & \textbf{KappaMTP} & \textbf{KappaMTSS} & \textbf{KappaMTP}* & \textbf{KappaMTSS}* \\ \hline Asian elephant (m) & 0.97660.003 & 0.703 & 0.768 & 0.385 & 0.320 \\ \hline Asian elephant (h) & 0.93560.007 & 0.499 & 0.703 & - & - \\ \hline Cheetah (m) & 0.91360.013 & 0.425 & 0.661 & 0.658 & 0.554 \\ \hline Cheetah (h) & 0.80560.016 & 0.581 & 0.797 & - & - \\ \hline Lion (m) & 0.94460.004 & 0.512 & 0.690 & 0.403 & 0.376 \\ \hline Lion (h) & 0.86560.011 & 0.410 & 0.600 & - & - \\ \hline Oryx (m) & 0.96160.005 & 0.465 & 0.780 & 0.543 & 0.779 \\ \hline Oryx (h) & 0.95360.006 & 0.502 & 0.770 & - & - \\ \hline \end{tabular} \end{table}	PMC2943917_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline Acupoint rationale & (1) According to meridian theory of traditional Chinese medicine. (2) MA-TF1 (ear shenmen), MA-AT1 (ear subcortex). \\ \hline Acupressure detail & (1) Bilateral ear acupoints. (2) Four magnetic beads. (3) Magnetic beads on the skin surface in acupressure group (AG), and without magnetic beads in sham group. (4) Pressure feeling. (5) Alternating ears for 3 min at each point. (6) Magnet bead, 200 Gauss, Xiang Yu international Co., Ltd., Taiwan. \\ \hline Treatment regimen & (1) Four times (after 3 meals and before bedtime) every day for 4 weeks. \\ \hline Cointerventions & (1) None of herbs, moxibustion, cupping, massage, exercise, advice dietary or lifestyle modification. \\ \hline Practitioner background & (1) License-certificated Chinese medical doctor with more than eight years of acupuncture experience. \\ \hline Control intervention & (1) Nil. \\ \hline \end{tabular} \end{table}	PMC3358095_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline Bruker SMART CCD diffractometer & 2611 independent reflections \\ \hline Radiation source: fine-focus sealed tube & 2532 reflections with I > 2σ(I) \\ \hline Monochromator: graphite & Rint = 0.016 \\ \hline mm-1 Detector resolution: 10.0 pixels & θmax = 27.0º \\ \hline T = 173(2) K & θmin = 2.7º \\ \hline φ and ω scans & h = −10→10 \\ \hline Absorption correction: multi-scan (SADABS; Sheldrick, 1999) & k = −23→23 \\ \hline Tmin = 0.842, Tmax = 0.857 & l = −6→13 \\ \hline 9543 measured reflections \\ \hline \end{tabular} \end{table}	PMC2961290_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline D—H···A & D—H & H···A & D···A & D—H···A \\ \hline N1—H1···O1i & 0.89 (2) & 1.95 (2) & 2.837 (2) & 174.1 (17) \\ \hline \end{tabular} \end{table}	PMC3275030_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{(cells/μm2)} & \textbf{ATRA} & \textbf{TGF-β} & \textbf{TGF-β} \textbf{ATRA} + & \textbf{Control} & \textbf{Syngeneic} & \textbf{P value} \\ \hline \multicolumn{2}{c\|}{Inflammatory cells} \\ \hline 2w & 0 & 0 & 0 & 14.9 $\pm$ 18.72 & 0 & 0.132 \\ \hline 4w & 496.1 $\pm$ 68.4 & 891.4 $\pm$ 80.9 & 93.2 $\pm$ 45.2 & 1842.5 $\pm$ 68.4 & 0 & <0.001 \\ \hline 8w & 1356.0 $\pm$ 260.7 & 1843.2 $\pm$ 252.8 & 152.9 $\pm$ 52.9 & 1872.4 $\pm$ 106.3 & 29.8 $\pm$ 6.5 & <0.001 \\ \hline Foxp3+ cells \\ \hline 2w & 21.9 $\pm$ 1.4 & 4.9 $\pm$ 0.6 & 16.7 $\pm$ 5.4 & 10.3 $\pm$ 2.7 & 25.6 $\pm$ 1.8 & <0.001 \\ \hline 4w & 24.7 $\pm$ 0.6 & 29.4 $\pm$ 6.5 & 47.9 $\pm$ 2.2 & 22.2 $\pm$ 9.1 & 44.9 $\pm$ 6.7 & 0.004 \\ \hline 8w & 32.5 $\pm$ 5.1 & 36.9 $\pm$ 4.3 & 52.6 $\pm$ 4.8 & 25.5 $\pm$ 6.2 & 36.4 $\pm$ 7.3 & 0.001 \\ \hline IL-17+ cells \\ \hline 2w & 5.5 $\pm$ 1.0 & 8.5 $\pm$ 0.8 & 2.4 $\pm$ 0.4 & 8.1 $\pm$ 0.6 & 3.3 $\pm$ 1.2 & 0.017 \\ \hline 4w & 3.5 $\pm$ 2.3 & 3.5 $\pm$ 0.2 & 5.1 $\pm$ 1.6 & 46.7 $\pm$ 12.4 & 5.1 $\pm$ 0.8 & <0.001 \\ \hline 8w & 7.9 $\pm$ 1.7 & 8.7 $\pm$ 1.2 & 2.9 $\pm$ 1.3 & 50.0 $\pm$ 4.8 & 3.8 $\pm$ 1.1 & <0.001 \\ \hline \end{tabular} \end{table}	PMC4395899_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Uniprot accession number} & \textbf{Protein name} & \textbf{Peptides identified by MS/MS} & \textbf{Species-specific peptide} & \textbf{Trypsin unique peptide} & \textbf{Other proteins witn the same peptide} \\ \hline \multirow{6}{}{B0WIS4} & Trypsin 1 & R.AAYVPAYNQNQCNSA YAR.Y & Yes & No & Q1KWX6 (Trypsin-like fragment) - C. quinquefasciatus \\ \hline & R.IVGGFEISIADAPHQVSL QSR.G & Yes & Yes & - \\ \hline & R.GSHICGGSIISPK.W & Yes & Yes & - \\ \hline & R.NTIDYDYSLLELK.S & Yes & Yes & - \\ \hline & K.WILTAAHCTDGASVS NLR.I & Yes & Yes & - \\ \hline & K.HASGGSVISIK.R & - & - & Not predicted by Skyline \\ \hline \multirow{3}{}{B0WE94} & Trypsin 2 & R.DEPADESQSLVSGWG DTR.S & No & No & Q962G7 / Q56GM3 (Trypsin) - Culex pipiens \\ \hline & R.LEFGHAVQPVDLVR.D & No & No & Q962G7 / Q56GM3 (Trypsin) - Culex pipiens \\ \hline & R.GVLVPLVNR.E & No & No & Q962G7 / Q56GM3 (Trypsin) - Culex pipiens \\ \hline \multirow{3}{}{B0XCW2} & Trypsin 4 & K.GCAQPDYYGVYAD VEK.A & Yes & Yes & - \\ \hline & K.DFDFALLR.L & Yes & Yes & - \\ \hline & R.VGSSYDYQGGTVIDV AGM TIHPR.Y & - & - & Not predicted by Skyline \\ \hline \multirow{3}{}{B0X667} & Trypsin 5 & K.IIGGFPAEQGDTLHQ VSIR.F & Yes & Yes & - \\ \hline & K.GCGLAAYPGIYSDVA YYR.G & Yes & Yes & - \\ \hline & R.GWIDSCLAGK.C & Yes & Yes & - \\ \hline \multirow{4}{}{B0XES8} & Trypsin 7 & K.DACLGDSGGPLTCS GK.V & Yes & Yes & - \\ \hline & R.DYALLNLAK.S & Yes & Yes & - \\ \hline & R.AVDVPIADHDR.C & Yes & Yes & - \\ \hline & R.GGQLIAVTR.K & - & - & Not predicted by Skyline \\ \hline B0X870 & SP24D & K.LGESIEYDELSQPIAL YEGD DLPK.D & - & - & Not predicted by Skyline \\ \hline \multirow{2}{}{B0W9S9} & Serine protease 1/2 & R.TGETFVDNQATVSG FGR.T & Yes & No & C. quinquefasciatus - Q23731 (Serine protease) \\ \hline & R.TVDGGPVSPTK.N & Yes & No & C. quinquefasciatus - Q23731 (Serine protease) \\ \hline B0WW44 & Cationic trypsin & R.IVVHPQYAEGNLAN DIAVIR.V & Yes & Yes & - \\ \hline \end{tabular} \end{table}	PMC4502911_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variables} & \textbf{Household wealth} & \textbf{Immunised (\%)} & \textbf{Crude RR (95\%CI)} & \textbf{Adjusted RR (95\%CI)} & \textbf{P-value} \\ \hline \multirow{3}{}{BCG(n = 739)} & Least poor & 182(90\%) & 1 & 1 & - \\ \hline Middle & 249(92\%) & 1.01(0.96, 1.07) & 1.02(0.95,1.07) & 0.643 \\ \hline Poorest & 266(95\%) & 1.03(0.98,1.08) & 1.03(0.98,1.08) & 0.152 \\ \hline \multirow{3}{}{Penta 1(n = 725)} & Least poor & 172(85\%) & 1 & 1 & - \\ \hline Middle & 245(91\%) & 1.00(0.98,1.03) & 1.01(0.98,1.04) & 0.463 \\ \hline Poorest & 256(91\%) & 0.99(0.94,1.05) & 1.00(0.94,1.07) & 0.756 \\ \hline \multirow{3}{}{Penta 2 (n = 679)} & Least poor & 162(80\%) & 1 & 1 & - \\ \hline Middle & 224(83\%) & 0.96(0.91,1.03) & 0.96(.091,1.03) & 0.409 \\ \hline Poorest & 233(83\%) & 0.97(0.93,1.02) & 0.97(0.93,1.02) & 0.728 \\ \hline \multirow{3}{}{Penta 3 (n = 648)} & Least poor & 151(74\%) & 1 & 1 & - \\ \hline Middle & 212(78\%) & 1.03(0.97,1.10 & 1.04(0.98,1.10) & 0.221 \\ \hline Poorest & 222(79\%) & 1.01(0.96,1.06) & 1.02(0.97,1.08) & 0.414 \\ \hline \multirow{3}{*}{Measles (n = 690)} & Least poor & 146(72\%) & 1 & 1 & - \\ \hline Middle & 202(75\%) & 0.98(0.89,1.08) & 0.98(0.89,1.08) & 0.720 \\ \hline Poorest & 202(72\%) & 0.96(0.89,1.08) & 0.96(0.89,1.04) & 0.402 \\ \hline \end{tabular} \end{table}	PMC3439329_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{c\|}{\textbf{Scoliosis group}} & \multicolumn{2}{c\|}{\textbf{Control group}} \\ \hline \textbf{Parameter} & \textbf{\textbf{Statistical test}} & \textbf{\textbf{P value}} & \textbf{\textbf{Statistical test}} & \textbf{\textbf{P value}} \\ \hline AP/CL & Shapiro-Wilk & 0.95 & Shapiro-Wilk & 0.42 \\ \hline LR/CL & Shapiro-Wilk & <0.001 & Shapiro-Wilk & <0.001 \\ \hline LR/AP & Shapiro-Wilk & <0.001 & Shapiro-Wilk & <0.001 \\ \hline \end{tabular} \end{table}	PMC4556047_table_0
	\begi\textbf{n}{table} \ce\textbf{n}teri\textbf{n}g \label{tab:tablelabel} \begi\textbf{n}{tabular}{\|l\|l\|l\|l\|l\|l\|} \hli\textbf{n}e \textbf{Cli\textbf{n}ical a\textbf{n}d demographic characteristics} & \multicolum\textbf{n}{2}{c\|}{\textbf{Cases available}} & \multicolum\textbf{n}{2}{c\|}{\textbf{Chagas disease}} & \textbf{p value} \\ \hli\textbf{n}e & \multirow{2}{}{\textbf{n}} & \multirow{2}{}{\textbf{\%}} & \multirow{2}{}{Yes (\textbf{n} = 329 [41.6\textbf{\%}])} & \multirow{2}{}{No (\textbf{n} = 461 [58.4\textbf{\%}])} \\ \hli\textbf{n}e \\ \hli\textbf{n}e Age (mea\textbf{n} [SD]) & 789 & 58.3 [13.2] & 58.8 [11.4] & 58.0 [14.3] & 0.409 \\ \hli\textbf{n}e Age over 55 years & 789 & 62.0 & 63.5 & 60.9 & 0.449 \\ \hli\textbf{n}e Male sex & 790 & 55.3 & 53.5 & 56.6 & 0,384 \\ \hli\textbf{n}e No\textbf{n}-White & 773 & 82.4 & 85.8 & 80.0 & 0,038 \\ \hli\textbf{n}e Alcohol abuse & 779 & 7.3 & 5.8 & 8.4 & 0.176 \\ \hli\textbf{n}e Curre\textbf{n}t smoker & 790 & 15.6 & 11.2 & 18.7 & 0.005 \\ \hli\textbf{n}e Hyperte\textbf{n}sio\textbf{n} & 789 & 54.4 & 42.1 & 63.1 & 0.000 \\ \hli\textbf{n}e Diabetes mellitus & 789 & 11.8 & 9.5 & 13.4 & 0.086 \\ \hli\textbf{n}e Stroke & 790 & 13.7 & 17.3 & 11.1 & 0.012 \\ \hli\textbf{n}e Pacemaker & 789 & 8.2 & 15.2 & 3.3 & ,0.001 \\ \hli\textbf{n}e Cardioversio\textbf{n}a & 789 & 2.5 & 2.7 & 2.4 & 0.753 \\ \hli\textbf{n}e Rhythm \textbf{n}o\textbf{n}-si\textbf{n}us & 789 & 27.0 & 35.6 & 20.9 & 0.000 \\ \hli\textbf{n}e Atrial fibrillatio\textbf{n} & 789 & 8.2 & 10.0 & 7.0 & 0.122 \\ \hli\textbf{n}e dysfu\textbf{n}ctio\textbf{n}b LV & 621 & 66.8 & 71.1 & 63.7 & 0.530 \\ \hli\textbf{n}e Dysp\textbf{n}ea & 789 & 86.3 & 86.0 & 86.6 & 0.817 \\ \hli\textbf{n}e Edema & 778 & 60.8 & 62.7 & 59.5 & 0.370 \\ \hli\textbf{n}e Left heart thrombus & 599 & 2.8 & 2.9 & 2.8 & 0.936 \\ \hli\textbf{n}e PTCAc CABG or & 776 & 4.1 & 1.2 & 6.2 & 0.001 \\ \hli\textbf{n}e Coro\textbf{n}ary artery disease & 772 & 16.1 & 7.4 & 22.4 & ,0.001 \\ \hli\textbf{n}e Chro\textbf{n}ic re\textbf{n}al failure & 785 & 6.5 & 4.3 & 8.0 & 0.036 \\ \hli\textbf{n}e \e\textbf{n}d{tabular} \e\textbf{n}d{table}	PMC3327657_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Developed high fever n = 58} & \textbf{No high fever n = 105} & \textbf{P value} \\ \hline Age (years) \\ \hline Younger than 20 & 17 (29.3) & 32 (30.5) & 0.076 \\ \hline 20–34 & 40 (69.0) & 61 (58.1) \\ \hline 35 or older & 1 (1.7) & 12 (11.4) \\ \hline No. of previous live births \\ \hline 0 & 24 (41.4) & 41 (39.0) & 0.829 \\ \hline 1–3 & 29 (50.0) & 57 (54.3) \\ \hline 4+ & 5 (8.6) & 7 (6.7) \\ \hline Pre-delivery haemoglobin less than 11.5 g/dL & 6 (10.3) & 3 (2.9) & 0.053 \\ \hline Gestational age (weeks) \\ \hline Pre-term (less than 37) & 1 (1.7) & 5 (4.8) & 0.241 \\ \hline Term (37.0–40.9) & 47 (81.0) & 90 (85.7) \\ \hline Post-term (41 or more) & 10 (17.2) & 10 (9.5) \\ \hline Known previous PPH & 6 (10.3) & 2 (1.9) & 0.024 \\ \hline Multiple pregnancy & 0 (0.0) & 0 (0.0) & – \\ \hline Oxytocin given in third stage of labour or earlier & 0 (0.0) & 0 (0.0) & – \\ \hline Epidural given & 2 (3.4) & 3 (2.9) & 0.585 \\ \hline Suturing after delivery & 39 (67.2) & 79 (75.2) & 0.274 \\ \hline Placental delivery within 15 minutes & 48 (82.8) & 69 (65.7) & 0.021 \\ \hline Blood loss (ml) at time of treatment (median IQR) & 850 (750–950) & 850 (750–1000) & 0.322 \\ \hline \end{tabular} \end{table}	PMC2878599_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Rp model} & \textbf{Rs model} & \textbf{Number of parameters} & \textbf{Total R2} \\ \hline Exponential & Exponential & 4 & 0.71 \\ \hline Exponential & Logistic & 5 & 0.62 \\ \hline Exponential & Linear & 4 & 0.64 \\ \hline Logistic & Exponential & 5 & 0.83 \\ \hline Logistic & Logistic & 6 & 0.82 \\ \hline Logistic & Linear & 5 & 0.75 \\ \hline Linear & Exponential & 4 & 0.83 \\ \hline Linear & Logistic & 5 & 0.81 \\ \hline Linear & Linear & 4 & 0.73 \\ \hline \end{tabular} \end{table}	PMC4378508_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Treatment} & \textbf{Time after Infection (hours)} & \textbf{CFU/ml (log10)$\pm$SEM} \\ \hline untreated & 3 & 2.1360.09 \\ \hline CLDC & 3 & 3.1660.13 \\ \hline MPF & 3 & 3.3460.13 \\ \hline CLDC+MPF & 3 & 3.1060.09 \\ \hline untreated & 24 & 3.3060.23 \\ \hline CLDC & 24 & 5.3060.01 \\ \hline MPF & 24 & 4.7260.19 \\ \hline CLDC+MPF & 24 & 1.6060.35 \\ \hline \end{tabular} \end{table}	PMC2877747_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Group} & \textbf{Treatment} & \textbf{Sperm count (Total no. x 104/ml)} & \textbf{Motile sperm (Total no. x 104/ml)} & \textbf{Forward velocity (µm/sec)} & \textbf{Abnormal sperms (\%)} \\ \hline I & 1 ml propylene glycol & 56.40 $\pm$ 1.39 (100\%) & 52.40 $\pm$ 2.15 (100\%) & 127.63 $\pm$ 2.75 (100\%) & 11.40 $\pm$ 0.26 (100\%) \\ \hline II & 250 mg/kg body weight of benzene extract O.sanctum leaves & 32.00 $\pm$1.22* (56\%) & 24.00 $\pm$1.70* (45\%) & 63.16 $\pm$1.71* (49\%) & 62.03 $\pm$ 1.95* (544\%) \\ \hline \end{tabular} \end{table}	PMC4575751_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{All patients N = 199}} & \multirow{2}{}{\textbf{TP53 (+) group N = 110}} \\ \hline \\ \hline & \textbf{\textbf{OR/HR [95\%CI]}} & \textbf{\textbf{p-value}} & \textbf{\textbf{OR/HR [95\%CI]}} & \textbf{\textbf{p-value}} \\ \hline platinum-sensitivity1 High \\ \hline Survivin expression & 2.09 [1.04,4.17] & 0.036 & 5.04 [1.47,17.18] & 0.010 \\ \hline Residual tumour size \\ \hline 0 & 1.0 & & 1.0 \\ \hline 2 cm $\leq$ & 0.17 [0.05,0.54] & 0.003 & - \\ \hline > 2 cm & 0.09 [0.03,0.31] & 0.000 & 0.21 [0.06,0.73] & 0.014 \\ \hline Histological Grade \\ \hline Grade 2 & - & & 1.0 \\ \hline Grade 3 & - & & 0.06 [0.00,0.74] & 0.028 \\ \hline Grade 4 & - & & - \\ \hline Disease-free survival \\ \hline Survivin expression & 0.67 [0.48,0.91] & 0.013 & 0.44 [0.27,0.69] & 0.000 \\ \hline Residual tumour size \\ \hline 0 & 1.0 & & 1.0 \\ \hline $\leq$ 2 cm & 1.66 [0.99,2.78] & 0.052 & 2.33 [1.13,5.26] & 0.023 \\ \hline > 2 cm & 1.88 [1.09,2.78] & 0.022 & 3.09 [1.40,6.83] & 0.005 \\ \hline Overall survival \\ \hline Survivin expression & - & & 0.64 [0.45,0.89] & 0.010 \\ \hline Age (year) \\ \hline < 53 & - & & 1.0 \\ \hline $\geq$ 53 & - & & 1.68 [1.08,2.62] & 0.020 \\ \hline FIGO stage \\ \hline II B, IIC & - & & - \\ \hline III A, IIIB & - & & - \\ \hline III C & - & & 1.0 \\ \hline IV & - & & 2.76 [1.44,5.27] & 0.002 \\ \hline Residual tumour size \\ \hline 0 & 1.0 & & 1.0 \\ \hline 2 cm $\leq$ & 1.23 [1.22,4.07] & 0.009 & 2.23 [1.06,4.67] & 0.033 \\ \hline > 2 cm & 3.41 [1.88,6.18] & 0.000 & 2.99 [1.45,6.17] & 0.003 \\ \hline Histological Grade \\ \hline Grade 2 & 1.0 & & 1.0 \\ \hline Grade 3 & 2.92 [1.45,5.86] & 0.003 & 3.53 [1.45,8.61] & 0.005 \\ \hline Grade 4 & 2.98 [1.44,6.15] & 0.003 & 2.60 [1.01,6.69] & 0.047 \\ \hline \end{tabular} \end{table}	PMC3223127_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{R2 Model (adj. = 0.126)} & \textbf{2 Unst.B} & \textbf{3 SE} & \textbf{4 Beta} & \textbf{5 t} \\ \hline Constant & 0.988 & 0.350 & & 2.83 \\ \hline Too much aircraft noise & 0.704 & 0.219 & 0.400* & 3.22 \\ \hline Prefer other areas & −0.133 & 0.159 & −0.101 & −0.83 \\ \hline Personal reasons & −0.006 & 0.172 & −0.004 & −0.03 \\ \hline Activity/area relevance & −0.040 & 0.167 & −0.028 & −0.24 \\ \hline Area quality & −0.122 & 0.079 & −0.190 & −1.54 \\ \hline Earlier experience with the area & 0.457 & 0.262 & −0.200 & 1.74 \\ \hline \end{tabular} \end{table}	PMC2996215_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\ \hline C1 & 0.0253 (12) & 0.0218 (12) & 0.0201 (11) & −0.0001 (10) & 0.0032 (9) & −0.0043 (9) \\ \hline C4 & 0.0233 (11) & 0.0225 (12) & 0.0222 (11) & 0.0006 (9) & 0.0021 (9) & 0.0015 (9) \\ \hline S1 & 0.0239 (4) & 0.0169 (4) & 0.0181 (4) & −0.0004 (2) & 0.0046 (2) & −0.00107 (18) \\ \hline O3 & 0.0223 (8) & 0.0264 (9) & 0.0290 (8) & −0.0022 (7) & 0.0056 (7) & 0.0003 (7) \\ \hline O1 & 0.0336 (9) & 0.0348 (10) & 0.0187 (8) & 0.0010 (8) & 0.0062 (7) & −0.0046 (7) \\ \hline O2 & 0.0294 (9) & 0.0151 (8) & 0.0277 (8) & −0.0003 (7) & 0.0046 (7) & 0.0038 (6) \\ \hline N1 & 0.0286 (10) & 0.0129 (10) & 0.0220 (10) & 0.0015 (8) & 0.0061 (8) & −0.0028 (7) \\ \hline C10 & 0.0199 (11) & 0.0249 (13) & 0.0254 (12) & 0.0060 (9) & 0.0027 (9) & −0.0035 (9) \\ \hline C7 & 0.0186 (11) & 0.0154 (11) & 0.0236 (11) & 0.0038 (8) & 0.0046 (9) & −0.0017 (8) \\ \hline C11 & 0.0322 (13) & 0.0231 (12) & 0.0258 (12) & 0.0017 (10) & 0.0060 (10) & 0.0025 (9) \\ \hline C9 & 0.0187 (11) & 0.0223 (12) & 0.0339 (13) & −0.0017 (10) & 0.0008 (9) & −0.0041 (10) \\ \hline C14 & 0.0262 (13) & 0.0385 (15) & 0.0570 (18) & −0.0111 (12) & 0.0118 (12) & −0.0074 (13) \\ \hline C8 & 0.0177 (11) & 0.0179 (11) & 0.0305 (13) & −0.0004 (9) & 0.0042 (9) & 0.0032 (9) \\ \hline C12 & 0.0294 (12) & 0.0145 (11) & 0.0274 (12) & −0.0036 (9) & 0.0051 (9) & −0.0021 (9) \\ \hline C13 & 0.0329 (14) & 0.0476 (17) & 0.0281 (13) & 0.0003 (13) & 0.0019 (11) & −0.0059 (12) \\ \hline \end{tabular} \end{table}	PMC4645005_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Localization Systemic thrombolysis}} & \multirow{2}{}{\textbf{extracranial yes}} & \multirow{2}{}{\textbf{intracranial yes}} & \multirow{2}{}{\textbf{extracranial no}} \\ \hline \\ \hline n & 52 & 40 & 116 \\ \hline Affected side (right/left/both) & 44.2/53.8/1.9 & 45.0/55.0/0.0 & 45.2/53.9/0.9 \\ \hline NIH-SS on admission & 16.165.7 & 18.964.9 & 8.668.5 \\ \hline Demographic variables \\ \hline Age, years & 65.2617.4 & 69.2612.6 & 67.1612.6 \\ \hline Male sex & 65.4 & 55.0 & 71.6 \\ \hline Risk factors \\ \hline Hypertension & 61.5 & 67.5 & 74.8 \\ \hline Dyslipidemia & 29.4 & 30.6 & 53.5 \\ \hline Smoking & 26.9 & 12.5 & 38.2 \\ \hline Prior stroke or TIA & 17.3 & 20.0 & 27.6 \\ \hline Concomitant diseases \\ \hline Atrial fibrillation & 17.3 & 37.5 & 21.0 \\ \hline Diabetes mellitus & 15.4 & 20.0 & 26.7 \\ \hline Coronary heart disease & 12.0 & 22.2 & 23.5 \\ \hline Prior Medication \\ \hline Antiplatelet agents & 26.9 & 27.5 & 44.4 \\ \hline Anticoagulants & 0.0 & 4.8 & 8.1 \\ \hline Antihypertensive agents & 48.0 & 51.4 & 60.6 \\ \hline Statins & 10.0 & 2.7 & 14.1 \\ \hline \end{tabular} \end{table}	PMC3557237_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Week 1} & \textbf{Week 2} & \textbf{Week 4} & \textbf{Week 6} \\ \hline miR-126 & 3.11 & 7.93 & 4.56 & 2.33 \\ \hline miR-197 & 1.41 & 2.54 & 1.55 & 1.25 \\ \hline miR-341 & 1.23 & 2.37 & 1.62 & 1.39 \\ \hline miR-145 & 1.92 & 2.36 & 1.62 & 1.04 \\ \hline miR-30c & 1.63 & 2.26 & 1.55 & 1.18 \\ \hline miR-23b & 1.2 & 2.12 & 1.43 & 1.03 \\ \hline miR-199a & 1.19 & 2.11 & 1.38 & 1.19 \\ \hline miR-29a & 1.09 & 2.06 & 1.42 & 1.09 \\ \hline miR-129-3p & 1.56 & 2.04 & 1.5 & 1.31 \\ \hline miR-16 & 1.2 & 2.03 & 1.4 & 1.03 \\ \hline miR-495 & 1.27 & 2.02 & 1.36 & 1.14 \\ \hline \end{tabular} \end{table}	PMC3116478_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Model} & \textbf{Variable} & \multicolumn{3}{c\|}{\textbf{Men}} & \multicolumn{3}{c\|}{\textbf{Women}} \\ \hline & & \textbf{\textbf{Est.}} & \textbf{\textbf{St.error}} & \textbf{\textbf{Sign.}} & \textbf{\textbf{Est.}} & \textbf{\textbf{St.error}} & \textbf{\textbf{Sign.}} \\ \hline Basic model & Pref. Status & 0.266 & 0.048 & 0.000 & 0.089 & 0.032 & 0.005 \\ \hline \multirow{2}{}{Interaction with age} & Pref. Status & 0.631 & 0.126 & 0.000 & 0.265 & 0.081 & 0.001 \\ \hline Interaction var & −0.023 & 0.008 & 0.002 & −0.011 & 0.005 & 0.018 \\ \hline \multirow{2}{}{With chronic conditions & interaction with age} & Pref. Status & 0.575 & 0.127 & 0.000 & 0.255 & 0.081 & 0.002 \\ \hline Interaction var & −0.020 & 0.008 & 0.009 & −0.011 & 0.005 & 0.029 \\ \hline \end{tabular} \end{table}	PMC3552700_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{Genotypes} & \textbf{Year of divergence (95\% HPD)} \\ \hline 1 & A, B1, B2, B3, C1, C2, E, F & 1915 (1882–1941) \\ \hline 2 & G1, G2, G3, H1, H2 & 1954 (1937–1969) \\ \hline 3 & D1, D2, D3, D4, D5, D6, D7, D8, D9, D10, D11 & 1940 (1927–1952) \\ \hline \multicolumn{2}{c\|}{A} & 1948 (1941–1952) \\ \hline \multicolumn{2}{c\|}{B1} & 1974 (1966–1980) \\ \hline \multicolumn{2}{c\|}{B2} & 1980 (1976–1982) \\ \hline \multicolumn{2}{c\|}{B3} & 1979 (1972–1984) \\ \hline \multicolumn{2}{c\|}{C1} & 1942 (1930–1950) \\ \hline \multicolumn{2}{c\|}{C2} & 1969 (1959–1975) \\ \hline \multicolumn{2}{c\|}{D1} & 1951 (1943–1957) \\ \hline \multicolumn{2}{c\|}{D2} & 1979 (1971–1985) \\ \hline \multicolumn{2}{c\|}{D3} & 1977 (1972–1982) \\ \hline \multicolumn{2}{c\|}{D4} & 1974 (1968–1980) \\ \hline \multicolumn{2}{c\|}{D5} & 1978 (1971–1985) \\ \hline \multicolumn{2}{c\|}{D6} & 1973 (1957–1984) \\ \hline \multicolumn{2}{c\|}{D7} & 1966 (1960–1971) \\ \hline \multicolumn{2}{c\|}{D8} & 1983 (1975–1989) \\ \hline \multicolumn{2}{c\|}{D9} & 1988 (1979–1994) \\ \hline \multicolumn{2}{c\|}{D10} & 1992 (1983–1997) \\ \hline \multicolumn{2}{c\|}{D11} & 1976 (1965–1986) \\ \hline \multicolumn{2}{c\|}{E} & 1955 (1937–1965) \\ \hline \multicolumn{2}{c\|}{F} & 1943 (1932–1950) \\ \hline \multicolumn{2}{c\|}{G1} & 1965 (1951–1976) \\ \hline \multicolumn{2}{c\|}{G2} & 1994 (1991–1995) \\ \hline \multicolumn{2}{c\|}{G3} & 1993 (1990–1996) \\ \hline \multicolumn{2}{c\|}{H1} & 1978 (1971–1984) \\ \hline \multicolumn{2}{c\|}{H2} & 1986 (1977–1991) \\ \hline \end{tabular} \end{table}	PMC4486977_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Donor Funding Search Terms (Using ‘‘OR’’ Boolean Operator)} & & \textbf{Transition Search Terms (Using ‘‘OR’’ Boolean Operator)} & & \textbf{Health Area Search Terms (Using ‘‘OR’’ Boolean Operator)} \\ \hline Donor & \multirow{5}{}{AND} & \multirow{5}{}{Withdrawal Graduation Transition Sustainability Country ownership} & \multirow{5}{}{AND} & HIV \\ \hline Development assistance & Family planning \\ \hline \multirow{3}{}{Funding} & [none] \\ \hline \\ \hline \\ \hline \end{tabular} \end{table}	PMC4476864_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Event class} & \multicolumn{3}{c\|}{\textbf{Abstract}} & \multicolumn{3}{c\|}{\textbf{\textbf{\textbf{F}}ull text}} \\ \hline & \textbf{\textbf{R}} & \textbf{\textbf{P}} & \textbf{\textbf{F}} & \textbf{\textbf{R}} & \textbf{\textbf{P}} & \textbf{\textbf{F}} \\ \hline Gene_expression & 73.68 & 78.68 & 75.78 & 81.43 & 74.51 & 77.82 \\ \hline Transcription & 53.28 & 65.18 & 58.63 & 35.14 & 56.52 & 43.33 \\ \hline \textbf{\textbf{P}}rotein_catabolism & 42.86 & 85.71 & 57.14 & 100.00 & 100.00 & 100.00 \\ \hline \textbf{\textbf{P}}hosphorylation & 82.96 & 79.43 & 81.16 & 90.00 & 93.75 & 91.84 \\ \hline Localization & 25.86 & 75.00 & 38.46 & 82.35 & 70.00 & 75.68 \\ \hline SVT-TOTAL & 64.97 & 76.65 & 70.33 & 78.18 & 75.63 & 76.88 \\ \hline Binding & 45.24 & 49.84 & 47.43 & 37.50 & 31.58 & 34.29 \\ \hline EVT-TOTAL & 60.50 & 70.24 & 65.00 & 67.11 & 62.39 & 64.66 \\ \hline \textbf{\textbf{R}}egulation & 29.55 & 41.95 & 34.68 & 27.66 & 34.21 & 30.59 \\ \hline \textbf{\textbf{P}}os_regulation & 42.12 & 50.49 & 45.92 & 38.04 & 48.61 & 42.68 \\ \hline Neg_regulation & 44.33 & 48.98 & 46.54 & 31.25 & 40.54 & 35.29 \\ \hline \textbf{\textbf{R}}EG-TOTAL & 40.41 & 48.83 & 44.22 & 34.99 & 44.69 & 39.25 \\ \hline ALL-TOTAL & 50.06 & 59.33 & 54.30 & 48.31 & 53.43 & 50.74 \\ \hline \end{tabular} \end{table}	PMC4423724_table_4
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Country} & \textbf{Region} & \textbf{NGO} & \textbf{Type} & \textbf{Project Period} & \textbf{Estimated Children 0–59 Months in Project Area} & \textbf{Number of the 17 High- interventionsa impact} & \textbf{Project Cost USD} \\ \hline Cambodia & Kampong Thum & Adventist Development Relief Agency (ADRA) & Non- Care Group & 2001– 2006 & 17,477 & 11 & $1,891,059 \\ \hline Cambodia & Battambang & Catholic Relief Services (CRS) & Non- Care Group & 2001– 2006 & 24,896 & 10 & $2,023,057 \\ \hline Cambodia & Kampong Chhnang & International Relief and Development (IRD) & Non- Care Group & 2006– 2010 & 6217 & 12 & $1,749,948 \\ \hline Cambodia & Siem Reap & Red Cross & Care Group & 2005– 2008 & 43,610 & 12 & $2,000,096 \\ \hline Cambodia & Kompong Cham & World Relief (WR) & Care Group & 1998– 2002 & 12,167 & 7 & $1,333,376 \\ \hline Cambodia & Kompong Cham & World Relief (WR) & Care Group & 2003– 2007 & 12,875 & 8 & $1,583,376 \\ \hline Kenya & Western Province & African Medical and Research Foundation (AMREF) & Non- Care Group & 2005– 2010 & 31,644 & 6 & $2,139,312 \\ \hline Kenya & Rift Valley & HealthRight & Non- Care Group & 2006– 2010 & 48,844 & 7 & $2,249,261 \\ \hline Kenya & Coast & Plan International & Care Group & 2004– 2009 & 46,354 & 11 & $2,000,000 \\ \hline Malawi & Southern \textbf{Region} & International Eye Foundation & Non- Care Group & 2002– 2006 & 42,500 & 7 & $2,195,478 \\ \hline Malawi & Northern \textbf{Region} & World Relief (WR) & Care Group & 2000– 2004 & 36,732 & 5 & $1,333,331 \\ \hline Malawi & Northern \textbf{Region} & World Relief (WR) & Care Group & 2005– 2009 & 32,025 & 11 & $2,022,034 \\ \hline Mozambique & Sofala & Food for the Hungry (FH) & Care Group & 2006– 2010 & 60,666 & 9 & $2,026,191 \\ \hline Mozambique & Sofala & Food for the Hungry (FH) & Care Group & 2009– 2010 & 83,778 & 9 & $997,975 \\ \hline Mozambique & Manica and Sofala Provinces & Health Alliance International (HAI) & Non- Care Group & 2002– 2007 & 97,200 & 5 & $2,000,425 \\ \hline Mozambique & Gaza Province & World Relief (WR) & Care Group & 2004– 2009 & 33,451 & 10 & $3,333,333 \\ \hline Rwanda & Butare Province & Concern Worldwide & Non- Care Group & 2001– 2006 & 24,494 & 10 & $1,854,243 \\ \hline Rwanda & Kibungo & International Rescue Committee (IRC) & Non- Care Group & 2001– 2005 & 109,700 & 5 & $2,004,134 \\ \hline Rwanda & Cyangugu & World Relief (WR) & Care Group & 2001– 2006 & 24,021 & 10 & $1,933,657 \\ \hline \end{tabular} \end{table}	PMC4556014_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{\textbf{F}actor} & \textbf{df} & \textbf{F} & \textbf{p} \\ \hline Within subject effects \\ \hline Time & 9 & 60.5 & <0.001 \\ \hline Time × Test s\textbf{p}. & 18 & 6.9 & <0.001 \\ \hline Time × Consumer s\textbf{p}. & 9 & 29.8 & <0.001 \\ \hline Time × Test s\textbf{p}. × Consumer s\textbf{p}. & 18 & 12.8 & <0.001 \\ \hline Error & 108 \\ \hline Between subjects effects \\ \hline Consumer s\textbf{p}ecies & 2 & 100.0 & <0.001 \\ \hline Test s\textbf{p}ecies & 1 & 1426.6 & <0.001 \\ \hline Consumer s\textbf{p}. × Test s\textbf{p}. & 2 & 294.3 & <0.001 \\ \hline Error & 12 \\ \hline \end{tabular} \end{table}	PMC3526521_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Outcome} & \textbf{Measure of Effect (95 \% CI)} & \textbf{p-value} & \textbf{Heterogeneity} & \textbf{Authors’ conclusion} \\ \hline \multirow{7}{}{Complications} & 0.43 (0.15, 1.21) [13] & 0.11 & Moderate \\ \hline 0.31 (0.19, 0.49) [14] & <0.05 & Not present \\ \hline 1.92 (1.30, 2.85) [15] & N/A & Not present \\ \hline 0.83 (0.72, 0.91) [16] & N/A & Low & Favors antibiotics \\ \hline 0.54 (0.37, 0.78) [17] & 0.001 & Moderate \\ \hline 0.69 (0.54, 0.89) [18] & 0.004 & Not present \\ \hline 0.86 (0.59, 1.26) [19] & 0.44 & Not present \\ \hline \multirow{4}{}{Treatment efficacy} & 4.54 (3.02, 6.82) [13] & <0.001 & N/A \\ \hline 6.01 (4.27, 8.47) [15] & N/A & Not present & Favors surgery \\ \hline Crosses NI margin [16] & N/A & N/A \\ \hline 8.89 (5.94, 13.32) [18] & <0.001 & N/A \\ \hline \multirow{2}{}{Treatment failure} & 6.9 \% $\pm$ 4.4 \% [14] & N/A & N/A & Favors surgery \\ \hline 6.72 (3.48, 12.99) [17] & <0.001 & Moderate \\ \hline \multirow{3}{}{Readmissions} & 15 \% [13] \\ \hline 14.2 $\pm$ 10.6 \% [14] & & & Favors surgery \\ \hline 20 \% [18] \\ \hline \multirow{3}{}{Complicated appendicitis} & 0.46 (0.19, 1.12) [18] & 0.09 & High \\ \hline 0.58 (0.18, 1.90) [18] & 0.37 & Moderate & Inconclusive \\ \hline 0.73 (0.29, 1.84) [15] & N/A & Not present \\ \hline \multirow{3}{}{Pain/Analgesia} & ATB less pain [15] & <0.001 & N/A \\ \hline −1.55 (−1.96, −1.14) [17] & <0.001 & Not present & Favors antibiotics \\ \hline −0.13 (−0.28, 0.03) [17] & 0.11 & Low \\ \hline \multirow{5}{}{Length of hospital stay} & 0.11 (−0.22, 0.43) [13] & 0.53 & Moderate \\ \hline 0.66 (0.44, 0.87) [15] & <0.001 & Low \\ \hline (−0.06, 0.34 0.73) [17] & 0.09 & Low & Inconclusive \\ \hline 0.34 (−0.19, 0.87) [18] & 0.20 & Low \\ \hline 0.01 (−0.01, 0.03) [19] & 0.26 & High \\ \hline \multirow{2}{}{Time to return to work} & −0.19 (−0.33, −0.06) [17] & 0.005 & Not present & Favor antibiotics \\ \hline −5.20 (−6.99, −3.40) [19] & <0.001 & High \\ \hline \end{tabular} \end{table}	PMC4628279_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline C19H14Cl2O4 & F000 = 776 \\ \hline Mr = 377.20 & m−3 Dx = 1.477 Mg \\ \hline Monoclinic, P21/c & Mo Kα radiation λ = 0.71073 Å \\ \hline Hall symbol: -P 2ybc & Cell parameters from 6655 reflections \\ \hline a = 9.9116 (1) Å & θ = 2.4–33.5º \\ \hline b = 17.7480 (3) Å & mm−1 µ = 0.40 \\ \hline c = 10.1173 (2) Å & T = 100.0 (1) K \\ \hline β = 107.612 (1)º & Block, colourless \\ \hline Å3 V = 1696.32 (5) & 0.22 × 0.14 × 0.05 mm \\ \hline Z = 4 \\ \hline \end{tabular} \end{table}	PMC2968225_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Parameter} & \textbf{Value} & \textbf{Source} \\ \hline Interventional treatment effectiveness \\ \hline Monthly probability of recurrence after 1st and 2nd treatment \\ \hline Surgery & 0.00833 & NICE [44] \\ \hline ClosureFast & 0.00833 & Assumption \\ \hline UGFS & 0.00914 & NICE [44] \\ \hline Probability of top-up treatment \\ \hline Surgery & 0.05 & NICE [44] \\ \hline ClosureFast & 0.05 & NICE[44] \\ \hline UGFS & 0.20 & NICE [44] \\ \hline Probability of receiving 2nd intervention after recurrence & 0.75 & NICE [44] \\ \hline Treatment setting and costs \\ \hline Outpatient treatment proportion \\ \hline Surgery & 0.60 & Assumption \\ \hline ClosureFast & 0.90 & Assumption \\ \hline UGFS & 1.00 & Assumption \\ \hline Inpatient treatment costs \\ \hline Surgery & 2,218.02 € & DRG F39b \\ \hline ClosureFast & 2,218.02 € & DRG F39b \\ \hline Outpatient treatment costs \\ \hline Surgery & 639.45 € & OPS-Code 5–385.70* \\ \hline ClosureFast & 1,100.00 € & Assumption \\ \hline UGFS & 47.23 €* & EBM-Codes 03111, 30501, 30500 \\ \hline Monthly costs of conservative compression therapy & 11.45 € & Kemper et al. [72] \\ \hline \end{tabular} \end{table}	PMC3637434_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline \textbf{Inclusion criteria:} & \textbf{Exclusion criteria:} \\ \hline - Male gender & - Female gender \\ \hline - Age $\geq$18 years & - Bilateral hernia \\ \hline - Primary, unilateral, reducible inguinal hernia & - Scrotal hernia - Recurrent hernia \\ \hline \multirow{3}{*}{- Eligible for TEP (and general anesthesia)} & - Strangulated hernias (necessitating emergency hernia repair) \\ \hline - Collagen or connective tissue disorders, such as Marfan’s syndrome \\ \hline - Likely problems with maintaining follow-up (for example, patients with no fixed address or insufficient comprehension of Dutch language \\ \hline \end{tabular} \end{table}	PMC3404916_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Observed function} & \textbf{\textbf{SE}} & \textbf{Predicted function} & \textbf{\textbf{SE}} \\ \hline F6 & 0.433962 & 0.068079 & 0.351143 & 0.044893 \\ \hline F7 & 0.791045 & 0.049669 & 0.74696 & 0.041532 \\ \hline \end{tabular} \end{table}	PMC3501817_table_5
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline Oxford Diffraction Xcalibur (Sapphire2 large Be window) diffractometer & 2022 independent reflections \\ \hline Radiation source: Enhance (Mo) X-ray Source & 1798 reflections with I > 2σ(I) \\ \hline graphite & Rint = 0.016 \\ \hline mm-1 Detector resolution: 8.4 pixels & θmax = 25.0°, θmin = 2.9° \\ \hline ω scans & h = −14→13 \\ \hline Absorption correction: multi-scan (CrysAlis RED; Oxford Diffraction, 2009) & k = −9→10 \\ \hline Tmin = 0.968, Tmax = 1.000 & l = −13→13 \\ \hline 13393 measured reflections \\ \hline \end{tabular} \end{table}	PMC2979083_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\ \hline Cd & 0.0653 (4) & 0.0532 (4) & 0.0608 (4) & 0.0054 (3) & 0.0283 (3) & 0.0055 (3) \\ \hline Br1 & 0.0749 (6) & 0.0653 (5) & 0.0857 (7) & 0.0108 (4) & 0.0469 (6) & 0.0137 (5) \\ \hline Br2 & 0.0856 (7) & 0.0841 (6) & 0.0634 (7) & 0.0073 (5) & 0.0244 (6) & 0.0206 (5) \\ \hline Br3 & 0.0986 (7) & 0.0574 (5) & 0.0807 (7) & 0.0206 (5) & 0.0345 (6) & 0.0085 (5) \\ \hline Br4 & 0.0920 (7) & 0.0907 (7) & 0.0933 (8) & −0.0277 (6) & 0.0496 (7) & −0.0219 (6) \\ \hline N1 & 0.048 (4) & 0.063 (5) & 0.064 (5) & −0.004 (4) & 0.008 (4) & 0.015 (4) \\ \hline N2 & 0.064 (5) & 0.054 (4) & 0.054 (5) & 0.001 (3) & 0.022 (4) & 0.004 (4) \\ \hline C1 & 0.072 (6) & 0.083 (7) & 0.117 (9) & −0.013 (5) & 0.027 (7) & 0.013 (6) \\ \hline C2 & 0.075 (6) & 0.047 (5) & 0.089 (8) & 0.004 (5) & 0.029 (6) & 0.018 (5) \\ \hline C3 & 0.074 (6) & 0.054 (5) & 0.067 (7) & 0.005 (5) & 0.023 (5) & 0.001 (5) \\ \hline C4 & 0.055 (5) & 0.051 (5) & 0.042 (5) & −0.005 (4) & 0.008 (4) & 0.004 (4) \\ \hline C5 & 0.076 (6) & 0.040 (5) & 0.064 (6) & −0.013 (4) & 0.027 (5) & −0.009 (4) \\ \hline C6 & 0.065 (6) & 0.055 (5) & 0.075 (7) & −0.007 (4) & 0.020 (5) & 0.000 (5) \\ \hline C7 & 0.067 (6) & 0.058 (5) & 0.062 (6) & −0.003 (4) & 0.022 (5) & 0.002 (5) \\ \hline C8 & 0.071 (6) & 0.063 (5) & 0.062 (7) & −0.006 (5) & 0.029 (5) & 0.005 (5) \\ \hline C9 & 0.079 (6) & 0.076 (6) & 0.056 (6) & −0.009 (5) & 0.021 (6) & 0.001 (5) \\ \hline C10 & 0.059 (5) & 0.047 (4) & 0.045 (5) & 0.003 (4) & 0.028 (5) & 0.008 (4) \\ \hline C11 & 0.069 (6) & 0.073 (6) & 0.055 (6) & 0.008 (5) & 0.026 (6) & −0.006 (5) \\ \hline C12 & 0.064 (6) & 0.075 (6) & 0.058 (7) & 0.011 (5) & 0.032 (6) & 0.003 (5) \\ \hline C13 & 0.074 (6) & 0.069 (5) & 0.052 (6) & −0.006 (5) & 0.031 (6) & 0.000 (5) \\ \hline C14 & 0.053 (6) & 0.074 (6) & 0.067 (7) & −0.008 (4) & 0.033 (5) & −0.006 (5) \\ \hline C15 & 0.075 (6) & 0.086 (7) & 0.068 (7) & −0.006 (5) & 0.009 (6) & 0.006 (6) \\ \hline \end{tabular} \end{table}	PMC2959373_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline F2 Refinement on & Secondary atom site location: difference Fourier map \\ \hline Least-squares matrix: full & Hydrogen site location: inferred from neighbouring sites \\ \hline R[F2 2σ(F2)] > = 0.044 & H atoms treated by a mixture of independent and constrained refinement \\ \hline wR(F2) = 0.111 & 1/[σ2(Fo 2) (0.0443P)2] w = + 2 2)/3 where P = (Fo + 2Fc \\ \hline S = 1.01 & (Δ/σ)max = 0.001 \\ \hline 3346 reflections & Å−3 Δρmax = 0.15 e \\ \hline 162 parameters & Å−3 Δρmin = −0.20 e \\ \hline 0 restraints & Absolute structure: Flack (1983), 1288 Friedel pairs \\ \hline Primary atom site location: structure-invariant direct methods & Flack parameter: 0.00 (9) \\ \hline \end{tabular} \end{table}	PMC3007307_table_1
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline & & \textbf{PI1} & \textbf{PI2} \\ \hline \multirow{2}{}{FMA} & R & −.501 & −.589* \\ \hline P & .034 & .010 \\ \hline \multirow{2}{}{MA} & R & .427 & .530 \\ \hline P & .077 & .0024 \\ \hline \end{tabular} \end{table}	PMC3443436_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{Changes induced by volume expansion (Group 1)} & \textbf{Changes induced by introduction/ increase in norepinephrine (Group 2)} \\ \hline CIpc versus CItd \\ \hline Bland-Altman analysis for the changes in absolute value & Bias, -0.20 $\pm$ 0.63 L/min/m2 & Bias, -0.05 $\pm$ 0.74 L/min/m2 \\ \hline Linear regression for the changes in percentage & r = 0.72 (P < 0.05) & r = 0.78 (P < 0.05) \\ \hline \multirow{4}{}{Ability of CIpc to detect an increase in CItd $\geq$ 15\%} & Cut-off, CIpc increase $\geq$ 12\% & Cut-off, CIpc increase $\geq$ 15\% \\ \hline Specificity, 74 (49 to 91)\% & Specificity, 93 (68 to 99)\% \\ \hline Specificity, 95 (76 to 99)\% & Specificity, 88 (69 to 97)\% \\ \hline Area under the ROC curve, 0.878 (0.736 to 0.960) & Area under the ROC curve, 0.924 (0.795 to 0.983) \\ \hline CIpw versus CItd \\ \hline Bland-Altman analysis for the changes in absolute value & Bias, -0.23 $\pm$ 0.95 L/min/m2 & Bias, -0.01 $\pm$ 1.75 L/min/m2 \\ \hline Linear regression for the changes in percentage & r = 0.33 (P < 0.05) & r = -0.03 (P = 0.65) \\ \hline \multirow{4}{}{Ability of CIpw to detect an increase in CItd $\geq$ 15\%} & Cut-off, CIpw increase $\geq$8\% & Cut-off, CIpw increase $\geq$34\% \\ \hline Sensitivity, 56 (33 to 80)\% & Sensitivity, 27 (8 to 55)\% \\ \hline Specificity, 71 (48 to 89)\% & Specificity, 96 (80 to 99)\% \\ \hline Area under the ROC curve, 0.564 (0.398 to 0.720)a & Area under the ROC curve, 0.541 (0.377 to 0.700)a \\ \hline \end{tabular} \end{table}	PMC2911755_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \multicolumn{9}{c\|}{\textbf{Prevalence of HPV}} \\ \hline \multicolumn{3}{c\|}{\textbf{HPV 16-related types (31, 33, 35, 52, and 58)}} & \multicolumn{3}{c\|}{\textbf{HPV 18-related types (39, 45, 59, 68)}} & \multicolumn{3}{c\|}{\textbf{HPV 51 Y 66}} \\ \hline \textbf{\textbf{\textbf{Type of HPV}}} & \textbf{\textbf{\textbf{Number of sex workers}}} & \textbf{\textbf{\textbf{\%}}} & \textbf{\textbf{\textbf{Type of HPV}}} & \textbf{\textbf{\textbf{Number of sex workers}}} & \textbf{\textbf{\textbf{\%}}} & \textbf{\textbf{\textbf{Type of HPV}}} & \textbf{\textbf{\textbf{Number of sex workers}}} & \textbf{\textbf{\textbf{\%}}} \\ \hline HPV 16 & 81 sex workers & 38.9\textbf{\textbf{\textbf{\%}}} & HPV 18 & 48 sex workers & 23.1\textbf{\textbf{\textbf{\%}}} & HPV 51 & 52 sex workers & 25\textbf{\textbf{\textbf{\%}}} \\ \hline HPV 31 & 59 sex workers & 28.4\textbf{\textbf{\textbf{\%}}} & HPV 39 & 45 sex workers & 21.6\textbf{\textbf{\textbf{\%}}} & HPV 66 & 38 sex workers & 18.3\textbf{\textbf{\textbf{\%}}} \\ \hline HPV 33 & 52 sex workers & 25\textbf{\textbf{\textbf{\%}}} & HPV 45 & 38 sex workers & 18.3\textbf{\textbf{\textbf{\%}}} \\ \hline HPV 35 & 39 sex workers & 18.8\textbf{\textbf{\textbf{\%}}} & HPV 56 & 50 sex workers & 24\textbf{\textbf{\textbf{\%}}} \\ \hline HPV 52 & 68 sex workers & 32.7\textbf{\textbf{\textbf{\%}}} & HPV 59 & 23 sex workers & 11.1\textbf{\textbf{\textbf{\%}}} \\ \hline HPV 58 & 54 sex workers & 26\textbf{\textbf{\textbf{\%}}} & HPV 68 & 31 sex workers & 14.9\textbf{\textbf{\textbf{\%}}} \\ \hline \end{tabular} \end{table}	PMC3415090_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline D—H···A & D—H & H···A & D···A & D—H···A \\ \hline O1W—H1W···O1i & 0.97 (5) & 1.90 (5) & 2.865 (4) & 174 (5) \\ \hline O1W—H2W···O1ii & 0.92 (6) & 1.97 (6) & 2.873 (4) & 168 (5) \\ \hline N1—H1A···O2 & 0.86 & 2.36 & 2.715 (4) & 106 \\ \hline N1—H1A···O1W & 0.86 & 2.05 & 2.886 (4) & 165 \\ \hline C8—H8A···O1W & 0.93 & 2.49 & 3.290 (5) & 144 \\ \hline \end{tabular} \end{table}	PMC2983546_table_4
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Aboriginal} & \textbf{Torres Strait Islander} & \textbf{Overall} & \textbf{P-value} \\ \hline Anxious or depressed & & & & <0.001 \\ \hline No & 37 (39) & 18 (19) & 55 (29) \\ \hline Slightly & 47 (49) & 75 (77) & 122 (63) \\ \hline Moderately & 12 (12) & 4 (4) & 16 (8) \\ \hline Pain & & & & 0.01 \\ \hline None & 58 (60) & 79 (81) & 137 (71) \\ \hline Moderate & 31 (32) & 15 (16) & 46 (24) \\ \hline Severe & 5 (5) & 3 (3) & 8 (4) \\ \hline Unbearable & 2 (2) & 0 & 2 (1) \\ \hline Self-reported health status & & & & 0.008 \\ \hline Excellent or very good & 12 (13) & 30 (31) & 42 (22) \\ \hline Good & 50 (52) & 41 (42) & 91 (47) \\ \hline Fair or poor & 34 (35) & 26 (27) & 60 (31) \\ \hline Tired & & & & <0.001 \\ \hline All or most of the time & 20 (21) & 6 (6) & 26 (13) \\ \hline Some of the time & 50 (52) & 38 (39) & 88 (46) \\ \hline A little or none of the time & 26 (27) & 53 (55) & 79 (41) \\ \hline \end{tabular} \end{table}	PMC4405873_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{No. of patients} & \textbf{Percentage (\%)} \\ \hline Median age & 40(range,19-74) \\ \hline Gender \\ \hline Male & 9 & 64 \\ \hline Female & 5 & 36 \\ \hline KPS \\ \hline 60 & 1 & 7 \\ \hline 70 & 4 & 29 \\ \hline 80 & 6 & 43 \\ \hline 90 & 2 & 14 \\ \hline 100 & 1 & 7 \\ \hline Primary tumor stage \\ \hline Stage I & 1 & 7 \\ \hline Stage II & 3 & 21 \\ \hline Stage III & 4 & 29 \\ \hline Stage IV & 5 & 36 \\ \hline Unclear & 1 & 7 \\ \hline Primary tumor \\ \hline Sinus paranasal & 5 & 36 \\ \hline Nasopharynx carcinoma & 3 & 21 \\ \hline Larynx & 2 & 14.3 \\ \hline Hypopharyngeal carcinoma & 1 & 7 \\ \hline Nasal cavity & 1 & 7 \\ \hline Mandible & 1 & 7 \\ \hline Infratemporal fossa & 1 & 7 \\ \hline Previous surgery & 8 & 57 \\ \hline Previous chemotherapy & 6 & 43 \\ \hline Previous radiotherapy & 12 & 86 \\ \hline One & 7 & 50 \\ \hline Two & 4 & 29 \\ \hline Four & 1 & 7 \\ \hline Previous cumulative dose(Gy) \\ \hline $\leq$50 Gy & 2 & 14 \\ \hline 50 ~ 100 Gy & 5 & 36 \\ \hline >100 Gy & 5 & 36 \\ \hline Median dose(Gy) & 70(range,50-250) \\ \hline \end{tabular} \end{table}	PMC2919543_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Models and covariates} & \multicolumn{3}{c\|}{\textbf{Percent \textbf{\textbf{p}}redicted FEV1}} & \multicolumn{3}{c\|}{\textbf{Severity of Asthma Score}} \\ \hline & \textbf{\textbf{β}} & \textbf{\textbf{se}} & \textbf{\textbf{p}} & \textbf{\textbf{β}} & \textbf{\textbf{se}} & \textbf{\textbf{p}} \\ \hline Sociodemogra\textbf{\textbf{p}}hics and behavioral characteristics \\ \hline Age (years) & -0.56 & 0.15 & <0.001 & 0.10 & 0.05 & 0.03 \\ \hline High school education or less & -9.25 & 3.67 & 0.01 \\ \hline Not em\textbf{\textbf{p}}loyed & -4.48 & 3.14 & 0.16 & 1.75 & 1.05 & 0.10 \\ \hline Currently em\textbf{\textbf{p}}loyed, VGDF (ref: em\textbf{\textbf{p}}loyed, no VGDF) & -0.74 & 2.83 & 0.80 & 1.75 & 0.91 & 0.06 \\ \hline Light smoker (<10 \textbf{\textbf{p}}ack years) & 1.01 & 3.03 & 0.74 \\ \hline Heavy smoker ($\geq$10 \textbf{\textbf{p}}ack years) (ref: never smoked) & 3.76 & 4.40 & 0.39 \\ \hline Adj. R2 (cumulative) & \multicolumn{3}{c\|}{0.12 } & \multicolumn{3}{c\|}{0.07 } \\ \hline Hou\textbf{\textbf{se}}hold biologics and antigen-antibody status \\ \hline Total dust wt bedroom (\textbf{\textbf{p}}er 100 g) & -2.23 & 0.58 & <0.001 \\ \hline Dog owner & & & & 0.80 & 0.85 & 0.34 \\ \hline Elevated anti-Can f1 s\textbf{\textbf{p}}ecific IgE & -9.79 & 3.28 & 0.003 & 2.81 & 1.08 & 0.01 \\ \hline Adj. R2 (cumulative) & \multicolumn{3}{c\|}{0.22 } & \multicolumn{3}{c\|}{0.10 } \\ \hline Indoor air quality \\ \hline Wall dam\textbf{\textbf{p}}ness, \% moisture & & & & -0.23 & 0.16 & 0.17 \\ \hline Any hou\textbf{\textbf{se}}\textbf{\textbf{p}}lants & & & & -1.52 & 1.10 & 0.17 \\ \hline Air filter in home & -2.89 & 2.76 & 0.30 & 1.95 & 0.89 & 0.03 \\ \hline Coal/wood heat (vs. electric or gas) & 1.31 & 3.82 & 0.73 & -1.82 & 1.23 & 0.14 \\ \hline Adj. R2 (cumulative) & \multicolumn{3}{c\|}{0.21} & \multicolumn{3}{c\|}{0.14 } \\ \hline Metals in BR dust (u\textbf{\textbf{p}}\textbf{\textbf{p}}er quartile) \\ \hline Co\textbf{\textbf{p}}\textbf{\textbf{p}}er & & & & -1.84 & 1.04 & 0.08 \\ \hline Iron & & & & -1.67 & 0.95 & 0.08 \\ \hline Magnesium & 4.40 & 2.85 & 0.13 \\ \hline Zinc & & & & 1.26 & 1.05 & 0.23 \\ \hline Adj. R2 (cumulative) & \multicolumn{3}{c\|}{0.21} & \multicolumn{3}{c\|}{0.17 } \\ \hline External environment \\ \hline Census Block Grou\textbf{\textbf{p}} Factors \\ \hline Factor 1: Poor (working/unem\textbf{\textbf{p}}loyed) & & & & 0.36 & 0.39 & 0.35 \\ \hline Factor 2: Suburban homeowners & -4.38 & 1.53 & 0.005 \\ \hline Distance (m) to nearest road & 0.28 & 0.08 & <0.001 & -0.02 & 0.03 & 0.41 \\ \hline Urban/built environment & 5.23 & 3.30 & 0.11 & -1.44 & 1.03 & 0.16 \\ \hline Air Quality Factor 2: Higher NO2, summer wind s\textbf{\textbf{p}}eed, and winter tem\textbf{\textbf{p}}erature; lower winter wind s\textbf{\textbf{p}}eed & -2.11 & 0.93 & 0.03 & 0.28 & 0.30 & 0.36 \\ \hline Adj. R2 (full model) & \multicolumn{3}{c\|}{0.30 *} & \multicolumn{3}{c\|}{0.16} \\ \hline \end{tabular} \end{table}	PMC2887801_table_2
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Level of theory} & \textbf{Endo-form cm-1 Eendo /} & \textbf{\textbf{cm-1 Erelax /}} & \textbf{Exo-form cm-1 Eexo,} & \textbf{\textbf{cm-1 Erelax /}} & \textbf{E cm-1 /} \\ \hline MP2/aug-cc-pVDZ & 4,312 (2,455) & 121 / 11 & 2,561 (1,349) & 2,009 / 57 & 1,751 (1,106) \\ \hline MP2/aug-cc-pVTZ & 3,602 (2,789) & 81 / 34 & 2,228 (1,687) & 2,004 / 86 & 1,374 (1,102) \\ \hline MP2/aug-cc-pVQZ & 3,127 & & 1,985 & & 1,142 \\ \hline \end{tabular} \end{table}	PMC3274231_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{UreA source} & \textbf{Amount of proteins used (ng)} & \textbf{OD/mm2 Density in (standard deviation)} & \textbf{UreA concentration (ng) in extracts (\% of total)} & \textbf{n° of recombinant proteins extracted from each spore} \\ \hline Fusion 1 \\ \hline \multirow{3}{}{Purified UreA} & 6.25 ng & 38.9 ($\pm$ 0.08) & NA \\ \hline 3.12 ng & 19,1 ($\pm$ 0.11) & NA \\ \hline 1.56 ng & 9.8 ($\pm$ 0.06) & NA \\ \hline \multirow{3}{}{KH17 (CotB-UreA1)} & 5.00 μg & 30,4 ($\pm$ 0,03) & 4.93 (0.10) \\ \hline 2.50 μg & 15,1 ($\pm$ 0,01) & 2.51 (0.10) & 103 1.1 × \\ \hline 1.25 μg & 7,4 ($\pm$ 0,02) & 1.12 (0.09) \\ \hline Fusion 2 \\ \hline \multirow{3}{}{Purified UreA} & 25.0 ng & 127.8 ($\pm$ 0.02) & NA \\ \hline 12.5 ng & 63,3 ($\pm$ 0.01) & NA \\ \hline 6.25 ng & 32.1 ($\pm$ 0.04) & NA \\ \hline \multirow{3}{}{KH10 (CotC-UreA1 wt background)} & 2.50 μg & 99.1 ($\pm$ 0.07) & 16.55 (0.66) \\ \hline 1.25 μg & 48.6 ($\pm$ 0.09) & 8.14 (0.65) & 103 9.6 × \\ \hline 0.625 μg & 23.6 ($\pm$ 0.10) & 4.37 (0.70) \\ \hline \multirow{3}{}{KH11 (CotC-UreA1 cotC background)} & 2.50 μg & 117.4 ($\pm$ 0.03) & 20.82 (0.83) \\ \hline 1.25 μg & 57.7 ($\pm$ 0.08) & 10.35 (0.83) & 103 15 × \\ \hline 0.625 μg & 28.9 ($\pm$ 0.21) & 5.15 (0.82) \\ \hline \multirow{3}{}{KH12 (CotC-UreA1 cotC cotU background)} & 2.50 μg & 63.9 ($\pm$ 0.03) & 11.10 (0.44) \\ \hline 1.25 μg & 30.7 ($\pm$ 0.01) & 5.71 (0.46) & 103 7.2 × \\ \hline 0.625 μg & 15.4 ($\pm$ 0.03) & 2.93 (0.47) \\ \hline Fusion 3 \\ \hline \multirow{3}{}{Purified UreA} & 25.0 ng & 131.2 ($\pm$ 0.30) & NA \\ \hline 12.5 ng & 64,1 ($\pm$ 0.11) & NA \\ \hline 6.25 ng & 31.6 ($\pm$ 0.22) & NA \\ \hline \multirow{3}{}{KH23 (CotG-UreA cotG background)} & 5.00 μg & 135,7 ($\pm$ 0.25) & 28.42 (0.57) \\ \hline 2.50 μg & 68,2 ($\pm$ 0.37) & 14.73 (0.59) & 103 5.3 × \\ \hline 1.25 μg & 34,7 ($\pm$ 0,05) & 7.15 (0.57) \\ \hline \end{tabular} \end{table}	PMC2841587_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \multirow{4}{}{\textbf{\textbf{P}arameter}} & \multirow{4}{}{\textbf{Control group (\textbf{P}lacebo) n = 9 4 m, 5 f}} & \multirow{4}{}{\textbf{Treatment group (Liraglutide) n = 9 4 m, 5 f}} & \multirow{4}{}{\textbf{P}} \\ \hline \\ \hline \\ \hline \\ \hline Age [days] & 60 $\pm$ 0.14 & 60 $\pm$ 0.14 & 1.00 \\ \hline Body weight [kg] & 15 $\pm$ 1.00 & 16 $\pm$ 0.73 & 0.41 \\ \hline MMGTT \\ \hline AUC glucose & 17839 $\pm$ 682 & 18375 $\pm$ 881 & 0.80 \\ \hline AUC insulin & 2956 $\pm$ 187 & 3296 $\pm$ 261 & 0.30 \\ \hline IVGTT \\ \hline AUC glucose & 13015 $\pm$ 592 & 12821 $\pm$ 458 & 0.86 \\ \hline AUC insulin & 719 $\pm$ 69 & 862 $\pm$ 75 & 0.08 \\ \hline \end{tabular} \end{table}	PMC4362632_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{FA\%} & \textbf{C} & \textbf{D} & \textbf{D}/\textbf{EVOO} & \textbf{D}/\textbf{OOHF} & \textbf{D}/\textbf{OOLF} & \textbf{EVOO} & \textbf{OOHF} & \textbf{OOLF} \\ \hline \textbf{C}14:0 & 2.30 $\pm$ 0.36 & 2.19 $\pm$ 0.49 & 2.08 $\pm$ 0.34 & 2.18 $\pm$ 0.33 & 2.26 $\pm$ 0.43 & 2.23 $\pm$ 0.34 & 1.94 $\pm$ 0.28 & 1.93 $\pm$ 0.30 \\ \hline \textbf{C}16:0 & 25.96 $\pm$ 1.32 & 26.44 $\pm$ 1.90 & 22.34 $\pm$ 1.71§§ & 25.15 $\pm$ 1.89 & 24.17 $\pm$ 1.87 & 1.15§§ 20.31 $\pm$ & 24.41 $\pm$ 1.68 & 20.91 $\pm$ 1.74§§** \\ \hline \textbf{C}18:0 & 16.54 $\pm$ 3.30 & 1.26§ 22.96 $\pm$ & 19.78 $\pm$ 1.89* & 20.94 $\pm$ 0.96* & 20.58 $\pm$ 2.03* & 15.37 $\pm$ 1.34 & 19.27 $\pm$ 1.24 & 20.80 $\pm$ 3.50* \\ \hline \textbf{C}20:0 & 0.20 $\pm$ 0.04 & 0.09§§ 0.36 $\pm$ & 0.21 $\pm$ 0.06 & 0.19 $\pm$ 0.08 & 0.08§§ 0.41 $\pm$ & 0.22 $\pm$ 0.05 & 0.21 $\pm$ 0.12 & 0.05§§ 0.39 $\pm$ \\ \hline \textbf{C}22:0 & 1.04 $\pm$ 0.24 & 0.47§ 1.65 $\pm$ & 0.86 $\pm$ 0.21** & 1.21 $\pm$ 0.32 & 1.24 $\pm$ 0.40 & 1.14 $\pm$ 0.26 & 1.53 $\pm$ 0.38 & 1.16 $\pm$ 0.15 \\ \hline \textbf{C}24:0 & 0.94 $\pm$ 0.26 & 1.11 $\pm$ 0.36 & 0.92 $\pm$ 0.37 & 0.54 $\pm$ 0.21* & 1.13 $\pm$ 0.44 & 0.95 $\pm$ 0.42 & 0.21§** 0.47 $\pm$ & 1.12 $\pm$ 0.63 \\ \hline ΣSFA & 46.98 $\pm$ 4.48 & 3.26§ 54.71 $\pm$ & 46.19 $\pm$ 4.49* & 50.21 $\pm$ 3.75* & 49.79 $\pm$ 3.32 & 2.69§** 40.22 $\pm$ & 47.83 $\pm$ 3.76* & 46.31 $\pm$ 4.05* \\ \hline \textbf{C}14:1 & 0.55 $\pm$ 0.14 & 0.71 $\pm$ 0.15 & 0.76 $\pm$ 0.16 & 0.74 $\pm$ 0.11 & 0.54 $\pm$ 0.12 & 0.73 $\pm$ 0.09 & 0.55 $\pm$ 0.12 & 0.64 $\pm$ 0.10 \\ \hline \textbf{C}16:1 & 0.40 $\pm$ 0.06 & 0.33 $\pm$ 0.07 & 0.07§** 0.63 $\pm$ & 0.53 $\pm$ 0.09* & 0.38 $\pm$ 0.05 & 0.05§ 0.57 $\pm$ & 0.51 $\pm$ 0.05 & 0.34 $\pm$ 0.06 \\ \hline \textbf{C}18:1 & 17.15 $\pm$ 0.19 & 15.67 $\pm$ 1.10 & 19.64 $\pm$ 1.33* & 15.54 $\pm$ 1.17 & 16.08 $\pm$ 1.35 & 0.96§§** 21.88 $\pm$ & 17.74 $\pm$ 0.37 & 1.14§* 19.30 $\pm$ \\ \hline \textbf{C}20:1 & 0.23 $\pm$ 0.07 & 0.20 $\pm$ 0.06 & 0.18§§** 1.06 $\pm$ & 0.12§* 0.40 $\pm$ & 0.22 $\pm$ 0.08 & 0.12§* 0.42 $\pm$ & 0.40§§** 1.35 $\pm$ & 0.05§* 0.38 $\pm$ \\ \hline \textbf{C}22:1 & 0.18 $\pm$ 0.04 & 0.03§ 0.09 $\pm$ & 0.23§ 1.13 $\pm$ & 0.11§§ 0.46 $\pm$ & 0.20 $\pm$ 0.03 & 0.87 $\pm$ 0.24 & 0.24§§ 1.5 $\pm$ & 0.56§* 1.67 $\pm$ \\ \hline \textbf{C}24:1 & 1.62 $\pm$ 0.16 & 0.25§ 0.89 $\pm$ & 1.97 $\pm$ 0.56* & 1.44 $\pm$ 0.39 & 1.37 $\pm$ 0.39 & 2.27 $\pm$ 0.46* & 1.27 $\pm$ 0.28 & 1.66 $\pm$ 0.73 \\ \hline ΣMUFA & 20.13 $\pm$ 2.89 & 0.66§ 17.89 $\pm$ & 25.19 $\pm$ 0.40§ & 19.11 $\pm$ 1.60 & 18.79 $\pm$ 1.76 & 26.74 $\pm$ 1.28§§ & 22.92 $\pm$ 0.65 & 23.99 $\pm$ 1.63§ \\ \hline \textbf{C}18:2 ω6 & 11.76 $\pm$ 0.84 & 11.19 $\pm$ 0.82 & 11.41 $\pm$ 0.74 & 11.53 $\pm$ 0.48 & 11.50 $\pm$ 0.21 & 11.58 $\pm$ 0.66 & 11.83 $\pm$ 1.32 & 11.44 $\pm$ 0.39 \\ \hline \textbf{C}18:3w3ALA & 0.36 $\pm$ 0.09 & 0.39 $\pm$ 0.1 & 0.48 $\pm$ 0.04 & 0.39 $\pm$ 0.05 & 0.49 $\pm$ 0.04 & 0.43 $\pm$ 0.09 & 0.40 $\pm$ 0.18 & 0.14§§* 0.65 $\pm$ \\ \hline \textbf{C}20:2 ω6 & 0.29 $\pm$ 0.10 & 0.20§ 0.52 $\pm$ & 0.36 $\pm$ 0.13 & 0.30 $\pm$ 0.10* & 0.18§§* 0.79 $\pm$ & 0.36 $\pm$ 0.10 & 0.34 $\pm$ 0.11 & 0.17§§ 0.57 $\pm$ \\ \hline \textbf{C}20:3 ω6 & 0.40 $\pm$ 0.14 & 0.24 $\pm$ 0.07 & 0.41 $\pm$ 0.17 & 0.29 $\pm$ 0.10 & 0.60 $\pm$ 0.24* & 0.56 $\pm$ 0.25* & 0.52 $\pm$ 0.14* & 0.63 $\pm$ 0.37* \\ \hline \textbf{C}20:4 ω6 & 14.39 $\pm$ 2.03 & 14.45 $\pm$ 1.81 & 11.35 $\pm$ 1.70§§ & 13.57 $\pm$ 1.85 & 12.81 $\pm$ 1.47 & 1.48§§ 11.20 $\pm$ & 14.17 $\pm$ 1.82 & 12.76 $\pm$ 1.51 \\ \hline \textbf{C}20:5w3EPA & 0.31 $\pm$ 0.16 & 0.35 $\pm$ 0.19 & 0.39 $\pm$ 0.02 & 0.46 $\pm$ 0.12 & 0.33 $\pm$ 0.14 & 0.12§§* 0.73 $\pm$ & 0.12§§* 0.63 $\pm$ & 0.14§§* 0.73 $\pm$ \\ \hline ω6 \textbf{C}22:4 & 0.82 $\pm$ 0.19 & 0.08§§ 0.32 $\pm$ & 0.67 $\pm$ 0.05 & 0.15§ 1.08 $\pm$ & 0.19§** 1.21 $\pm$ & 1.05 $\pm$ 0.30* & 0.68 $\pm$ 0.16* & 0.23§ 1.25 $\pm$ \\ \hline \textbf{C}22:5w3\textbf{D}PA & 0.67 $\pm$ 0.24 & 0.07§§ 0.18 $\pm$ & 0.80 $\pm$ 0.15 & 0.17§ 0.30 $\pm$ & 0.14§ 0.23 $\pm$ & 0.27§ 1.03 $\pm$ & 0.16§ 0.29 $\pm$ & 0.15§ 0.29 $\pm$ \\ \hline \textbf{C}22:6w3\textbf{D}HA & 1.34 $\pm$ 0.31 & 0.07§§ 0.20 $\pm$ & 0.94 $\pm$ 0.20 & 0.46§ 1.98 $\pm$ & 1.48 $\pm$ 0.43 & 1.84 $\pm$ 0.42 & 1.36 $\pm$ 0.25 & 1.05 $\pm$ 0.26** \\ \hline ΣPUFA & 30.34 $\pm$ 3.14 & 27.84 $\pm$ 0.81 & 1.93§ 26.81 $\pm$ & 29.90 $\pm$ 1.85 & 29.44 $\pm$ 0.97 & 28.78 $\pm$ 0.75 & 30.22 $\pm$ 1.73* & 29.37 $\pm$ 0.74 \\ \hline ΣUFA & 41.77 $\pm$ 1.07 & 35.29 $\pm$ 0.64§§ & 1.49§* 38.99 $\pm$ & 39.96 $\pm$ 0.89§§ & 35.96 $\pm$ 1.77§§ & 41.85 $\pm$ 1.41 & 36.95 $\pm$ 1.13§§ & 44.22 $\pm$ 1.87 \\ \hline PUFA/MUFA & 1.50 $\pm$ 0.10 & 1.55 $\pm$ 0.11 & 0.12§§ 1.06 $\pm$ & 1.56 $\pm$ 0.15 & 1.56 $\pm$ 0.13 & 0.10§§ 1.07 $\pm$ & 1.31 $\pm$ 0.04 & 0.07§§ 1.22 $\pm$ \\ \hline PUFA/SFA & 0.64 $\pm$ 0.05 & 0.05§§ 0.50 $\pm$ & 0.05§ 0.58 $\pm$ & 0.59 $\pm$ 0.03 & 0.59 $\pm$ 0.04* & 0.03§ 0.71 $\pm$ & 0.63 $\pm$ 0.04 & 0.63 $\pm$ 0.07** \\ \hline UFA/SFA & 0.88 $\pm$ 0.06 & 0.05§§ 0.64 $\pm$ & 0.84 $\pm$ 0.08* & 0.79 $\pm$ 0.04 & 0.72 $\pm$ 0.10 & 0.18§ 1.04 $\pm$ & 0.77 $\pm$ 0.08 & 0.95 $\pm$ 0.05 \\ \hline \end{tabular} \end{table}	PMC2936360_table_3
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Antigen} & \textbf{Host species} & \textbf{Dilution} & \textbf{Source and code} \\ \hline SLURP-1 & Rabbit & 1:200 & Moriwaki et al. [16] \\ \hline Rhodopsin & Mouse & 1:200 & Millipore, MAB5316 \\ \hline OPN1SW (S-opsin) & Goat & 1:50 & Santa Cruz Biotechnology, sc- 14363 \\ \hline ChAT & Goat & 1:10 & Millipore, AB144P \\ \hline CHT1 & Rabbit & mg/ml 80 & Misawa et al. [20] \\ \hline \end{tabular} \end{table}	PMC3411837_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|} \hline & \textbf{Eligible women (4009)} \\ \hline Age (years) \\ \hline Mean(SD) & 39.88 (9.011) \\ \hline Median (range) & 40 (25–55) \\ \hline Ethnic Origin \\ \hline White & 4006 \\ \hline Black & 3 \\ \hline Post menopausal & 555 (13.8\%) \\ \hline HPV vaccinated & 160 (4\%) \\ \hline Smoking history \\ \hline Non smoker & 904 (22.55\%) \\ \hline Present smoker & 3105 (77.45\%) \\ \hline Pap test in past 5 years & 3605 (90\%) \\ \hline HPV test in past 5 years & 200 (5\%) \\ \hline Colposcopy in past 5 years & 361 (9\%) \\ \hline Study Cytology \\ \hline NILM & 3785 (94.7\%) \\ \hline ASCUS or worse & 211 (5.3\%) \\ \hline ASCUS & 119 (3\%) \\ \hline LSIL & 77 (1.9\%) \\ \hline HSIL & 15 (0.4\%) \\ \hline Pap result not available & 13 (0.3\%) \\ \hline HPV test results \\ \hline Valid & 4006 (99.9\%) \\ \hline Invalid & 3 (0.1\%) \\ \hline \end{tabular} \end{table}	PMC4368762_table_0
	\begin{table} \centering \label{tab:tablelabel} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{ncRNA} & \textbf{Method} & \textbf{Z $\geq$ 2} & \textbf{Z $\geq$ 1.5} & \textbf{Z $\geq$1} & \textbf{Z $\geq$ 0.5} \\ \hline \multirow{2}{}{Hh1} & TRIPLE & 6.67 & 33.33 & 53.33 & 73.33 \\ \hline NUPACK & 0.00 & 0.00 & 20.00 & 60.00 \\ \hline \multirow{2}{}{sno_guide} & TRIPLE & 14.91 & 25.43 & 41.10 & 57.95 \\ \hline NUPACK & 0.98 & 9.05 & 28.85 & 45.72 \\ \hline \multirow{2}{}{sn_splice} & TRIPLE & 31.65 & 43.04 & 56.96 & 65.82 \\ \hline NUPACK & 5.06 & 26.58 & 51.90 & 69.62 \\ \hline \multirow{2}{}{SRP} & TRIPLE & 32.47 & 45.45 & 55.84 & 68.83 \\ \hline NUPACK & 3.90 & 37.66 & 72.73 & 87.01 \\ \hline \multirow{2}{}{tRNA} & TRIPLE & 24.07 & 45.31 & 64.25 & 79.47 \\ \hline NUPACK & 0.00 & 2.12 & 14.69 & 33.45 \\ \hline \multirow{2}{}{intron} & TRIPLE & 59.81 & 68.22 & 74.77 & 84.11 \\ \hline NUPACK & 1.87 & 22.43 & 66.36 & 85.98 \\ \hline \multirow{2}{}{riboswitch} & TRIPLE & 32.03 & 44.44 & 56.86 & 71.90 \\ \hline NUPACK & 1.96 & 21.57 & 46.41 & 69.28 \\ \hline \multirow{2}{}{miRNA} & TRIPLE & 75.56 & 81.48 & 90.37 & 93.33 \\ \hline NUPACK & 0.00 & 9.63 & 70.37 & 98.52 \\ \hline \multirow{2}{}{telomerase} & TRIPLE & 23.53 & 29.41 & 41.18 & 58.82 \\ \hline NUPACK & 5.88 & 29.41 & 29.41 & 52.94 \\ \hline \multirow{2}{}{RNase} & TRIPLE & 38.03 & 56.34 & 72.54 & 87.32 \\ \hline NUPACK & 10.56 & 26.06 & 52.11 & 76.06 \\ \hline \multirow{2}{}{regulatory} & TRIPLE & 18.97 & 25.86 & 31.03 & 51.72 \\ \hline NUPACK & 0.00 & 1.72 & 24.14 & 50.00 \\ \hline \multirow{2}{}{tmRNA} & TRIPLE & 15.25 & 27.12 & 38.98 & 57.63 \\ \hline NUPACK & 3.39 & 6.78 & 27.12 & 42.37 \\ \hline \multirow{2}{*}{rRNA} & TRIPLE & 34.09 & 47.31 & 64.88 & 79.96 \\ \hline NUPACK & 6.40 & 21.69 & 43.19 & 60.74 \\ \hline \end{tabular} \end{table}	PMC3358654_table_1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.