Dataset Viewer
text
stringlengths 645
543k
| pmid
stringlengths 1
8
| accession_id
stringlengths 9
11
| license
stringclasses 8
values | last_updated
stringdate 2021-01-04 15:57:02
2024-12-12 23:16:03
| retracted
stringclasses 1
value | citation
stringlengths 16
77
|
|---|---|---|---|---|---|---|
==== Front
PLoS BiolPLoS BiolplosplosbiolPLoS Biology1544-91731545-7885Public Library of Science San Francisco, USA 1576918310.1371/journal.pbio.0030123Research ArticleBiotechnologyOncologyIn VitroNeutralizing Aptamers from Whole-Cell SELEX Inhibit the RET Receptor Tyrosine Kinase Aptamer Inhibition of RET RTKCerchia Laura
1
Ducongé Frédéric
2
Pestourie Carine
2
Boulay Jocelyne
3
Aissouni Youssef
3
Gombert Karine
2
Tavitian Bertrand
2
*
de Franciscis Vittorio
1
*
Libri Domenico [email protected]
3
1 Istituto per I'Endocrinologia e Oncologia Molecolare “G. Salvatore”, CNR, Naples, Italy2 CEA/DSV/DRM Service Hospitalier Frédéric Joliot, INSERM E-103, Orsay, France3 Centre de Génétique Moléculaire, Centre National de la Recherche Scientifique (CNRS), Gif sur Yvette, FranceJoyce Gerald Academic EditorScripps Research Institute,
United States of America* To whom correspondence should be addressed. E-mail: [email protected] (BT), Email: [email protected] (VD) LC, FD, BT, VdF, and DL conceived and designed the experiments. LC, FD, CP, JB, YA, and KG performed the experiments. LC, FD, BT, VdF, and DL analyzed the data. VdF and DL contributed reagents/materials/analysis tools. BT, VdF, and DL wrote the paper.
A patent application was filed covering the D4 aptamer and its use in diagnostic and therapeutics of cancer.
4 2005 22 3 2005 22 3 2005 3 4 e12327 10 2004 2 2 2005 © 2005 Cerchia et al2005Cerchia et alThis is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly credited.
A Small RNA That Neutralizes a Protein Linked to Tumor Development
Targeting large transmembrane molecules, including receptor tyrosine kinases, is a major pharmacological challenge. Specific oligonucleotide ligands (aptamers) can be generated for a variety of targets through the iterative evolution of a random pool of sequences (SELEX). Nuclease-resistant aptamers that recognize the human receptor tyrosine kinase RET were obtained using RET-expressing cells as targets in a modified SELEX procedure. Remarkably, one of these aptamers blocked RET-dependent intracellular signaling pathways by interfering with receptor dimerization when the latter was induced by the physiological ligand or by an activating mutation. This strategy is generally applicable to transmembrane receptors and opens the way to targeting other members of this class of proteins that are of major biomedical importance.
The strategy used to select aptamers that bind a tyrosine kinase mutated in certain cancers holds promise for targeting other members of this biomedically important class of proteins.
==== Body
Introduction
The identification of tumor-specific molecular markers is a powerful tool in cancer diagnostics, and the targeting of tumor-specific pathways is the best hope for developing nontoxic and efficient anticancer therapies. Targeting of cancer cells relies on the development of molecular beacons, suited for in vivo applications, that are endowed with the required affinity, specificity, and favorable pharmacokinetic properties.
With the systematic evolution of ligands by exponential enrichment (SELEX) technology [1,2], specific macromolecular ligands—aptamers—can be generated by screening very large pools of oligonucleotides containing regions of random base composition with reiterated cycles of enrichment and amplification. At each cycle, the individual oligonucleotides with affinity for the desired target are kept, those with affinity for the sham target are rejected, and the population is enriched in oligonucleotides that distinguish between sham and real target. Aptamers that recognize a wide variety of targets, from small molecules to proteins and nucleic acids, and from cultured cells to whole organisms, have been described [3,4,5,6,7,8,9,10]. These oligonucleotides generally meet the requirements for in vivo diagnostic and/or therapeutic applications: Besides their good specificity and affinity, they are poorly immunogenic, and the SELEX technology can now accept chemically modified nucleotides for improved stability in biological fluids [11]. Conspicuously, less than fifteen years after the first applications of the technique, several lead compounds, including an anti-vascular endothelial growth factor aptamer [12], are currently under clinical trials [13].
Receptor tyrosine kinases (RTKs) are involved in a variety of signaling processes that regulate cell growth and proliferation and in several cancers [14]. RTKs are privileged targets for cancer therapy, which is underscored by the promising outcome of clinical trials with small molecules or antibody inhibitors [14]. In the present study, we validated a general strategy to target transmembrane receptors by SELEX. The RET (rearranged during transfection) RTK is physiologically stimulated by any member of the glial cell line-derived neurotrophic factor (GDNF) family [15,16]. Germline mutations in the RET gene are responsible for constitutive activation of the receptor and for inheritance of multiple endocrine neoplasia (MEN) type 2A and 2B syndromes and of familial medullary thyroid carcinoma [17,18,19,20].
Mutations in the extracellular domain of RET, responsible for MEN2A syndrome, lead to constitutive dimerization of two mutated RET molecules. Conversely, a single point mutation, within the RET catalytic domain, that causes the MEN2B syndrome, involves an intramolecular mechanism to convert RET into a dominant transforming gene. Therefore, RET constitutes a model system of choice [20], in that the transforming mutations located in the extracellular domain simplify the issue of intracellular accessibility for a molecule targeting the receptor mutated in the extracellular domain (in its monomeric or dimeric form) and might provide alternative models (e.g., RET with mutations of the 2B kind) for controls or to elucidate the mode of target recognition.
Here we adopted a whole-cell SELEX strategy to target RET in a complex environment that is expected to expose a native protein to the selection procedure, thus best mimicking in vivo conditions. We obtained aptamers that not only recognize the extracellular domain of RET, but also block RET downstream signaling and subsequent molecular and cellular events. The fact that aptamers with antioncogenic activity were isolated in the absence of a specific selective pressure suggests that our method could be used to identify active macromolecules with potential therapeutic interest against other transmembrane receptors.
Results
A library of 2′-fluoropyrimidine (2′F-Py), nuclease-resistant RNAs was subjected to a differential SELEX protocol against intact cells expressing different forms of the human RET oncogene (Figure 1). For the selection step, PC12 cells were used that express the human RETC634Y mutant receptor (PC12/MEN2A). RETC634Y is mutated in the extracellular domain and forms spontaneously active homodimers on the cell surface, which induces biochemical and morphological changes that mirror the RET-dependent human pheochromocytoma phenotype of MEN2 syndromes [21]. The counterselection necessary to avoid selecting for aptamers that nonspecifically recognized the cell surface included a first step against parental PC12 cells in order to eliminate nonspecific binders of the PC12 cell surface, followed by a second counterselection step against PC12/MEN2B cells that expressed an allele of RET (RETM918T) mutated in the intracellular tyrosine kinase domain. PC12/MEN2B and PC12/MEN2A cells have a similar morphology, but the extracellular domain of the RETM918T receptor is identical to the wild type and, in the absence of the ligand and co-receptor, remains monomeric. This step was originally aimed at selecting aptamers that recognize specifically the dimeric form of the extracellular domain.
10.1371/journal.pbio.0030123.g001Figure 1 Schematic Protocol for the Selection of PC12/MEN2A Cell-Specific Aptamers
A pool of 2′F-Py RNAs was incubated with suspended parental PC12 cells (Counterselection 1). Unbound sequences were recovered by centrifugation and incubated with adherent PC12/MEN2B cells (Counterselection 2). Unbound sequences in the supernatant were recovered and incubated with adherent PC12/MEN2A cells for the selection step (Selection). Unbound sequences were discarded by several washings, and bound sequences were recovered by phenol extraction. Sequences enriched by the selection step were amplified by RT-PCR and in vitro transcription before a new cycle of selection.
After 15 rounds of selection, the pool of remaining sequences bound PC12/MEN 2A cells in a saturable manner with an apparent Kd approximating 100 nM. From this pool, 67 sequences were cloned and analyzed. Two individual sequences (D14 and D12) dominated the selection and constituted together more than 50% of the clones, four other sequences represented together 25% of the clones, and eight sequences were present only once. As is often the case for a selection against a complex target [7,22] (and in contrast to in vitro SELEX on purified proteins) we found almost no similarity among sequences, except for clones D24 and D4, which shared common sequence motifs and structure prediction (Figure 2A).
10.1371/journal.pbio.0030123.g002Figure 2 Predicted Structure and Association Constants of D4 and D24
(A) Comparison of a secondary structure prediction for the D4 and D24 aptamers. Structures were predicted using MFOLD software version 3.1 (available at http://www.bioinfo.rpi.edu/applications/mfold/).
(B) Binding curve of the D4 aptamer on PC12/MEN2A. D4 was 32P-radiolabeled and incubated at different concentrations on cell monolayers. The background binding value for a D4 scrambled sequence is subtracted from every data point. Scatchard analysis (inset) was used for the evaluation of the binding constant.
(C) Binding of the 32P-labeled D4 aptamer to several cell lines expressing (or not) human RET. Binding was performed on the cell lines indicated in the same condition at 50 nM, and the results are expressed relative to the background binding detected with the starting pool of sequences used for selection. Expression of RET could not be detected by Western blot in HeLa, NBTII, PC12wt and NIH3T3 cells, whereas PC12/MEN2A and NIH3T3/MEN2A express RETC634Y and PC12/MEN2B and NIH3T3/MEN2B express RETM918T.
We assessed binding to PC12/MEN2A cells of all individual aptamers that were found more than once and also of some unique sequences (including D4 and D24). Several sequences bound PC12/MEN2A cells with apparent Kd values ranging from 30 to 70 nM (Figure 2B and unpublished data), but not parental PC12, rat-derived bladder carcinoma (NBTII), or human cervical carcinoma (HeLa) cells (Figure 2C and unpublished data). As a first attempt to deconvolute the complex pool of winning aptamers, we first produced a recombinant fragment of RET, EC-RETC634Y [23], but all attempts to identify in the winning pool aptamers binding to EC-RETC634Y were fruitless. Likewise, SELEX against this purified EC-RETC634Y protein gave rise to aptamers unable to recognize the PC12/MEN2A cells, suggesting that they did not bind to the RET protein present in its native conformation on the cell surface. Consequently, we screened the winning pool of aptamers for the ability to interfere with the biological activity of RET. To this end, we used an in vitro cell system in which we assessed the capability of each aptamer to inhibit RETC634Y autophosphorylation and receptor-dependent downstream signaling. Mutant RETC634Y, expressed in PC12/MEN2A cells, forms homodimers on the cell surface that cause constitutive activation of its tyrosine kinase activity [24] and induce several downstream signaling cascades, including the activation of extracellular signal-regulated protein kinase (ERK) [25]. As previously reported [25], levels of phosphorylated RET and ERK were constitutively high in untreated PC12/MEN2A cells due to the presence of the active RETC634Y allele. Surprisingly, some of the tested aptamers inhibited RETC634Y and ERK phosphorylation, compared to the control starting pool and to the other aptamers (Figure 3A and unpublished data). In all experiments, inhibition of phosphorylation was more rapid and quantitative for ERK than for RETC634Y. We believe that this is due to a different sensitivity to changes in RET tyrosine kinase activity of the two processes and/or to differences in the half-lives of the phosphorylated forms of the two proteins [26]. In a dose-response experiment (Figure 3B, left panel), the best inhibitor, D4, was effective at a concentration of 200 nM to inhibit RETC634Y autophosphorylation up to 70% and to drastically reduce ERK phosphorylation. Time-activity studies showed that the treatment of PC12/MEN2A cells at 200 nM for 1 h was sufficient to significantly inhibit RETC634Y autophosphorylation and to drastically reduce ERK phosphorylation (Figure 3B, right panel).
10.1371/journal.pbio.0030123.g003Figure 3 Effect of Selected Aptamers on RETC634Y Activity
(A) PC12/MEN2A cells were either left untreated or treated for 16 h with 150 nM of the indicated RNA aptamer, or the starting RNA pool (pool). Cell lysates were immunoblotted with anti-(phospho)-ERK (pErk), then stripped and reprobed with anti-ERK (Erk) to confirm equal loading. Values below the blots indicate signal levels relative to untreated controls.
(B) PC12/MEN2A cells were treated for 1 h with increasing amounts of D4 (left blots) or with 200 nM D4 for the indicated incubation times (right blots). Cell lysates were immunoblotted with anti-(Tyr-phosphorylated)-RET (pRet) or anti-(phospho)-ERK (pErk) antibodies, as indicated. To confirm equal loading the filters were stripped and reprobed with anti-RET (Ret) or anti-ERK (Erk) antibodies, respectively.
In (A) and (B), “C” indicates mock-treated cells. Quantitations were done on the sum of the two RET- or ERK- specific bands, and values are expressed relative to the control, arbitrarily set to 1. Standard deviations are indicated (n = 4).
Comparison of the predicted structures of D4 and of the related clone D24 (Figure 2A) suggests that a conserved stem-internal loop-stem is crucial for binding. Consistently, we found that replacing the apical loop with a stable tetraloop (UUGC) or deleting nucleotides not included in the conserved structure did not significantly affect binding of D4 to PC12/MEN2A cells (unpublished data). However, only the full-length D4 inhibits RETC634Y signaling, demonstrating that binding is necessary but not sufficient for inhibition. A 2′F-Py RNA oligonucleotide of identical composition but with a scrambled sequence (D4Sc) was ineffective for both binding and inhibition.
The D4 aptamer bound to PC12/MEN2A with an estimated apparent Kd of 35 ± 3 nM (Figure 2B), but also to PC12/MEN2B cells (Figure 2C and unpublished data), suggesting that one of the counterselection steps employed in the SELEX procedure was ineffective in this case. The D4 aptamer bound to transfected NIH3T3 cells expressing at similar levels the two mutant forms (RETC634Y and RETM918T) of the RET receptor (NIH/MEN2A and NIH/MEN2B, respectively [Figure 2C; see also below]). Binding was dependent on expression of human RET, as D4 did not recognize parental untransfected PC12, NIH3T3 cells, or other cell lines, including rat NBTII, human HeLa cells, and mouse MN1 (Figure 2C and unpublished data). Interestingly, the latter, a mouse motor neuron-neuroblastoma fusion cell line, expresses the mouse RETwt, suggesting some species-specificity in RET recognition by D4. Finally, D4 bound a human neuroblastoma cell line (SK-N-BE) that naturally expresses endogenous RET (L. Cerchia et al., personal communication). Consistently with what was observed for the pool of winning aptamers, D4 was unable to bind the purified EC-RETC634Y protein (unpublished data), thus supporting the specificity for the membrane-bound RET.
We next determined whether D4 could inhibit wild-type RET. Cells from a PC12-derived cell line expressing the human wild-type RET (PC12/wt) were stimulated with a mixture containing GDNF and soluble GDNF family receptor α1 (GFRα1), and either treated with the D4 aptamer or with the starting pool of 2′F-Py RNA as a negative control. As shown in Figure 4A, the D4 aptamer, but not the control RNA pool, strongly inhibited GDNF-induced phosphorylation of RET (left panel) and of the downstream effector ERK (middle panel). A similar inhibitory effect was observed in PC12-α1/wt cells, a PC12-derived cell line that stably expresses both human RET and GFRα1 (unpublished data). In contrast, D4 was inactive in inhibiting the signaling triggered by the unrelated nerve growth factor (NGF) receptor tyrosine kinase TrkA, thus indicating that D4-induced inhibition of ERK phosphorylation was specific for RET intracellular signaling (Figure 4A, right pane)
10.1371/journal.pbio.0030123.g004Figure 4 D4 Aptamer Inhibits RETwt but Not RETM918TActivity
(A) PC12/wt cells were treated for 10 min with GDNF (50 ng/ml) and soluble GFRα1 (1.6 nM), or 5 min with NGF (100 ng/ml), together with 200 nM of either the D4 aptamer or the starting RNA pool. “C*” indicates cells treated with GDNF and GFRα1 in the absence of aptamer.
(B) PC12/MEN2B cells were starved for 6 h and then treated for 1 h with 200 nM D4 or the starting RNA pool. Cell lysates were immunoblotted with anti-(Tyr-phosphorylated)-RET or anti-(phospho)-ERK antibodies, as indicated (see Figure 3 legend).
In (A) and (B), “C” indicates mock-treated cells. Quantitations were done as in Figure 3, and relative abundances are expressed relative to controls, arbitrarily set to 1. Standard deviations are indicated (n = 4).
Although the D4 aptamer binds PC12/MEN2B cells, treating these cells with 200 nM D4 for 1 h (Figure 4B) or longer, or at higher D4 concentrations (unpublished data), did not interfere with signaling due to the monomeric RETM918T. This further confirms that inhibition of ERK phosphorylation is not a nonspecific effect of exposing the cells to the D4 aptamer. The kinase and the biological activities of RETM918T, although constitutive, are responsive to GDNF stimulation in the presence of GFRα1 [27,28]. Similarly to the inhibition of RETwt activity, the treatment of PC12/MEN2B cells by D4 abolished the GDNF-dependent overstimulation of RET and ERK phosphorylation (unpublished data). These data strongly suggest that D4 inhibits exclusively the dimerization-dependent RET activation.
We then searched for phenotypic effects of D4 on RET-dependent cell differentiation and transformation. First we measured neurite outgrowth in PC12-α1/wt cells following GDNF stimulation. As shown in Figure 5, cells extended long neurite-like processes in response to a 48-h exposure to GDNF (Figure 5B) with respect to the nonstimulated control cells (Figure 5A). Treatment of the cells with the D4 aptamer (Figure 5C), but not with the D4Sc scrambled control (Figure 5D), significantly decreased the proportion of neurite outgrowth (Figure 5E). To biochemically monitor differentiation, we determined the levels of the nerve growth factor-inducible protein (VGF) in cell extracts following 48 h of treatment. VGF is an early gene that is rapidly induced by both NGF and GDNF in PC12 cells [29]. As expected, in GDNF-treated cells, VGF expression was stimulated and, consistent with the phenotypic effects reported above, treatment with D4, but not with D4Sc, kept the VGF levels close to basal (Figure 5F).
10.1371/journal.pbio.0030123.g005Figure 5 D4 Aptamer Inhibits the GDNF-Induced Differentiation of PC12-α1/wt Cells
Cells were either left unstimulated (A), stimulated with GDNF (B), or with GDNF together with D4 or D4Sc (C and D, respectively). Following 48 h of GDNF treatment, the percentage of neurite outgrowth was calculated. The data represent the average of three independent experiments and are expressed as percentage of neurite-bearing cells/total cells analyzed (E). Following 48 h of treatment, cells were lysed and proteins immunoblotted with anti-VGF antibodies. Equal loading was confirmed by immunoblotting with anti-ERK antibodies as indicated (F).
Upon expression of either RETC634Y or RETM918T, NIH3T3 cells show drastic changes in their morphology [24]. We treated NIH/MEN2A and NIH/MEN2B cells stably expressing the RET mutants with D4 for 72 h, and analyzed the morphological changes induced by the aptamer. As shown in Figure 6, NIH/MEN2A and NIH/MEN2B cells have a spindle shape, long protrusions, and a highly refractive appearance (Figure 6B and 6E, respectively). As expected, D4-treated NIH/MEN2A cells (Figure 6C) reverted to a flat and polygonal morphology similar to the parental NIH3T3, whereas no morphological changes were observed in NIH/MEN2B (Figure 6F), which is consistent with the notion that constitutive signaling from RETC634Y, but not from RETM918, is inhibited by D4. On the other hand, treatment with D4Sc had no effects on any cell line (Figure 6D and unpublished data).
10.1371/journal.pbio.0030123.g006Figure 6 D4 Aptamer Reverts the Transformed Morphology of NIH/MEN2A Cells
NIH3T3-derived cell lines were either left untreated (A, B, and E) or treated with D4 (C and F) or D4Sc (D), and the cells were maintained in culture for 72 h. Each experiment was repeated a minimum of three times.
Discussion
RTKs are involved in a variety of signaling pathways that affect cell growth and differentiation. Targeting specifically RTKs holds potential for dissecting the molecular mechanisms of receptor function, but also for diagnosis and therapeutics of cancer [14].
Here we employed a modified SELEX procedure to target the RET RTK, and we obtained nuclease-resistant RNA ligands capable of binding and inhibiting the protein on the cell surface. Aptamers against recombinant heregulin 3 (HER3) RTK have been recently isolated and shown to inhibit the heregulin-induced activation of the HER3/HER2 dimer [30]. However, finding the most efficient binders and inhibitors is likely to generally rely on the recognition of the target protein in its native state.
In the case of transmembrane receptors, whole-cell SELEX offers the advantage of selecting molecules capable of recognizing the target protein in its natural glycosylation state and presented in its physiological environment. An important drawback of this strategy is the lack of knowledge of the identity and abundance of the effective targets and the possibility that unwanted aptamers may dominate the selection, preventing the emergence of the molecules of interest. However, the abundance of the target protein and an appropriate selection scheme might provide sufficient selective pressure to favor the wanted aptamers [10].
The D4 aptamer binds to different cell types, provided that human RET is expressed on the cell surface, and specifically inhibits both RET and ERK phosphorylation, strongly suggesting that RET is the bona fide target of D4. Interestingly, aptamers isolated by whole-cell SELEX were unable to bind purified EC-RETC634Y and, conversely, aptamers coming from the selection with purified EC-RETC634Y were unable to bind the membrane-bound RET. Thus, it is likely that D4 binding is dependent on the association of RET with the cellular membrane, which might reflect changes in the receptor's conformation/modification state or, alternatively, might imply unidentified molecular components interacting with RET at the cell surface. This latter possibility is supported by a recent report demonstrating that the presence of heparan sulfate glycosaminoglycan on the cell surface is required for RET-dependent GDNF intracellular signaling [31].
Our interpretation of the D4 aptamer's mode of action relies upon three observations: (1) D4 binds with similar affinities to cells expressing RET in a monomeric or dimeric form; (2) D4 inhibits dimerization-dependent RET activation, as a consequence either of GDNF stimulation of RETwt or RETM918T or of constitutive dimerization of the RETC634Y mutant; and (3) D4 does not inhibit a monomeric form of RET that is constitutively activated by a mutation in the intracellular kinase domain (RETM918T). These results taken together are compatible with the notion that D4 acts by interfering with the formation of a stable, active RET dimer, regardless of whether dimerization is caused by the formation of the RET/GDNF/GFRα1 complex or by the direct interaction of two mutated RETC634Y proteins. This might occur either by D4 binding to monomeric RET, which would impede subsequent formation of the dimer, or by binding directly to the dimer.
Differential whole-cell SELEX strategies (this work; see also [5,7,8,10]) can be employed to identify new markers on the surface of a given cell type, define the specificity of a cellular state, and/or allow in vivo targeting for diagnostic and therapeutic applications. The identification of lead compounds by reiterated affinity selection on living cells appears crucial when the molecular target is a membrane-bound or large transmembrane protein for which the conformation is frequently dictated by the interaction with other molecules, including membrane constituents [31]. Given that several of these proteins, as transmembrane receptors, integrins, and adhesion molecules, are involved in cell proliferation, apoptosis, and differentiation, aptamers for these targets could be promising prognostic tools in human therapy for widespread, devastating diseases such as cancer and neurodegeneration.
Materials and Methods
Cell culture and immunoblot analysis
Growth conditions for PC12 cells and derived cell lines were previously described [32]. NIH/MEN2A and NIH/MEN2B cells were obtained from NIH3T3 cells stably transfected with vectors expressing human RETC634Y and RETM918T. To assess the effects of aptamers on RET activity, cells (160,000 cells per 3.5-cm plate) were serum-starved for 2 h and then treated with the indicated amount of RNA aptamers or the starting RNA pool after a short denaturation-renaturation step. When indicated, 2.5S NGF (Upstate Biotechnology, Lake Placid), GDNF (Promega), or recombinant rat GFRα1-Fc chimera (R&D Systems, Minneapolis, Minnesota, United States) were added to the culture medium. Cell extracts and immunoblotting analysis were performed as described [23]. The primary antibodies used were anti-RET (C-19), anti-VGF (R-15), and anti-ERK1 (C-16) (all three, Santa Cruz Biotechnology, Santa Cruz, California, United States); and anti-(Tyr-phosphorylated) RET and anti-phospho-44/42 MAP kinase (also indicated as anti-[phospho]-ERK) monoclonal antibodies (E10) (both from Cell Signaling, Beverly, Massachusetts, United States). Four independent experiments were performed.
Cell transformation and neurite outgrowth bioassay
PC12-α1/wt or NIH3T3 cells were plated at equal density on 12-well culture plates. Aptamers were added at 3 μM final concentration to the growth medium. To ensure the continuous presence of a concentration of at least 200 nM, this treatment was renewed every 24 h, which takes into account the half-life of the D4 aptamer in 10% serum (approximately 6 h, unpublished data). At least 15 random fields were photographed every 24 h with a phase-contrast light microscope. To evaluate the effects of D4 on cell differentiation, cells were pretreated for 6 h with 400 nM D4 or D4Sc and then incubated with 50 ng/ml GDNF together with 3 μM of the appropriate aptamer (see above). At 24 and 48 h of GDNF stimulation, 50 cells per frame were counted and scored as having neurites or not. A neurite was operationally defined as a process outgrowth with a length more than twice the diameter of cell body.
Ex vivo SELEX
The SELEX cycle was performed essentially as described [33]. Transcription was performed in the presence of 1 mM 2′F-Py and a mutant form of T7 RNA polymerase (T7Y639F, kind gift of R. Souza) [11] was used to improve yields. 2′F-Py RNAs were used because of their increased resistance to degradation by seric nucleases. The complexity of the starting pool was roughly 1014. 2′F-Py RNAs (1–5 nmol) were heated at 85 °C for 5 min in 3 ml of RPMI 1640, snap-cooled on ice for 2 min, and allowed to warm up to 37 °C before incubation with the cells. Two counterselection steps were performed per cycle. To avoid selecting for aptamers nonspecifically recognizing the cell surface, the pool was first incubated for 30 min at 37 °C with 107 PC12 cells, and unbound sequences were recovered by centrifugation. These were subsequently incubated with 107 adherent PC12/MEN2B cells, expressing a human RET receptor mutated in the intracellular domain (RETM918T), and unbound sequences were recovered for the selection phase. This step was meant to select sequences recognizing specifically the human RET receptor mutated in the extracellular domain (RETC634Y) expressed on PC12/MEN2A cells. The recovered sequences were incubated with 107 adherent PC12/MEN2A cells for 30 min at 37 °C in the presence of nonspecific competitor RNA (total yeast RNA) and recovered after several washings with 5 ml of RPMI by total RNA extraction (Extract-All, Eurobio, Les Ulis, France).
During the selection process, we progressively increased the selective pressure by increasing the number of washings (from one for the first cycle up to five for the last three cycles) and the amount of nonspecific RNA competitor (100 μg/ml in the last three cycles), and by decreasing the incubation time (from 30 to 15 min from round 5) and the number of cells exposed to the aptamers (5 × 106 in the last three cycles). To follow the evolution of the pool we monitored the appearance of four-base restriction sites in the population, which reveals the emergence of distinct families in the population [34]. After 15 rounds of selection, sequences were cloned with TOPO-TA cloning kit (Invitrogen, Carlsbad, California, United States) and analyzed.
Binding experiments
Binding of individual aptamers (or the starting pool as a control) to PC12 cells and derivatives was performed in 24-well plates in triplicate with 5′-32P-labeled RNA. 105 cells per well were incubated with various concentrations of individual aptamers in 200 μl of RPMI for 10 min at 37 °C in the presence of 100 μg/ml polyinosine as a nonspecific competitor. After extensive washings (5 × 500 μl of RPMI), bound sequences were recovered in 350 μl of SDS 0.6%, and the amount of radioactivity recovered was normalized to the number of cells by measuring the protein content of each well. Binding of individual sequences to different cell lines was performed in the same condition at 50 nM only.
For the binding curve of D4 to PC12/MEN2A cells (see Figure 2B), nonspecific binding was assessed using a 5′-32P-labeled naive pool of 2′F-RNAs (i.e., the starting pool of the selection), and the background values obtained were subtracted from the values obtained with the D4 aptamer. Apparent Kd values for each aptamers were determined by Scatchard analysis according to the equation
[bound aptamer]/[aptamer] = −(1/Kd) × [bound aptamer] + ([T]tot/Kd)
where [T]tot represents the total target concentration.
Supporting Information
Accession Numbers
The Swiss-Prot (http://www.ebi.ac.uk/swissprot/) accession numbers for the proteins discussed in this paper are ERK (P27361), GDNF (P39905), GFRα1 (P56159), NGF (P01138), RET RTK (P07949), TrkA (P04629), and VGF (P20156).
This work was supported by the European Union contract QLG1–2000–00562 (Oligonucleotide Ligands Imaging, OLIM ), the European Molecular Imaging Laboratory (EMIL) network, the CNRS, the Association por la Recherche contre le Cancer (grant 3527) and the MIUR-FIRB (Ministero dell'Istruzione, dell'Università e della Ricerca Fondo per gli Investimenti della Ricerca di Base) grant RBNE0155LB. FD was supported by a Commissariat à l'Energie Atomique (CEA) fellowship. We wish to thank M. Buckingham, E. Brody, M. S. Carlomagno, L. Di Giamberardino, C. Ibanez, C. Mann, S. Tajbakhsh and J.J. Toulmé for critical reading of the manuscript and fruitful discussions, and R. Souza for the gift of a T7Y639F RNA polymerase-expressing plasmid.
Abbreviations
2′F-Py2′-fluoropyrimidine
ERKextracellular signal-regulated protein kinase
GDNFglial cell line-derived neurotrophic factor
GFRGDNF family receptor α1
HERheregulin
MENmultiple endocrine neoplasia
NGFnerve growth factor
RETrearranged during transfection
RTKreceptor tyrosine kinase
SELEXsystematic evolution of ligands by exponential enrichment
VGFnerve growth factor-inducible protein
==== Refs
References
1 Tuerk C Gold L Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990 249 505 510 2200121
2 Ellington AD Szostak JW In vitro selection of RNA molecules that bind specific ligands. Nature 1990 346 818 822 1697402
3 Ulrich H Magdesian MH Alves MJ Colli W In vitro selection of RNA aptamers that bind to cell adhesion receptors of Trypanosoma cruzi and inhibit cell invasion. J Biol Chem 2002 277 20756 20762 11919187
4 Wang J Jiang H Liu F In vitro selection of novel RNA ligands that bind human cytomegalovirus and block viral infection. RNA 2000 6 571 583 10786848
5 Wang C Zhang M Yang G Zhang D Ding H Single-stranded DNA aptamers that bind differentiated but not parental cells: Subtractive systematic evolution of ligands by exponential enrichment. J Biotechnol 2003 102 15 22 12668310
6 Cerchia L Hamm J Libri D Tavitian B de Franciscis V Nucleic acid aptamers in cancer medicine. FEBS Lett 2002 528 12 16 12297271
7 Blank M Weinschenk T Priemer M Schluesener H Systematic evolution of a DNA aptamer binding to rat brain tumor microvessels. Selective targeting of endothelial regulatory protein pigpen. J Biol Chem 2001 276 16464 16468 11279054
8 Daniels DA Chen H Hicke BJ Swiderek KM Gold L A tenascin-C aptamer identified by tumor cell SELEX: Systematic evolution of ligands by exponential enrichment. Proc Natl Acad Sci U S A 2003 100 15416 15421 14676325
9 Wilson DS Szostak JW In vitro selection of functional nucleic acids. Annu Rev Biochem 1999 68 611 647 10872462
10 Hicke BJ Marion C Chang YF Gould T Lynott CK Tenascin-C aptamers are generated using tumor cells and purified protein. J Biol Chem 2001 276 48644 48654 11590140
11 Sousa R Use of T7 RNA polymerase and its mutants for incorporation of nucleoside analogs into RNA. Methods Enzymol 2000 317 65 74 10829272
12 Ruckman J Green LS Beeson J Waugh S Gillette WL 2′-Fluoropyrimidine RNA-based aptamers to the 165-amino acid form of vascular endothelial growth factor (VEGF165). Inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain. J Biol Chem 1998 273 20556 20567 9685413
13 Thiel K Oligo oligarchy—The surprisingly small world of aptamers. Nat Biotechnol 2004 22 649 651 15175673
14 Gschwind A Fischer OM Ullrich A The discovery of receptor tyrosine kinases: Targets for cancer therapy. Nat Rev Cancer 2004 4 361 370 15122207
15 Manie S Santoro M Fusco A Billaud M The RET receptor: F unction in development and dysfunction in congenital malformation. Trends Genet 2001 17 580 589 11585664
16 Takahashi M The GDNF/RET signaling pathway and human diseases. Cytokine Growth Factor Rev 2001 12 361 373 11544105
17 Jhiang SM The RET proto-oncogene in human cancers. Oncogene 2000 19 5590 5597 11114739
18 Ichihara M Murakumo Y Takahashi M RET and neuroendocrine tumors. Cancer Lett 2004 204 197 211 15013219
19 Hansford JR Mulligan LM Multiple endocrine neoplasia type 2 and RET: From neoplasia to neurogenesis. J Med Genet 2000 37 817 827 11073534
20 Putzer BM Drosten M The RET proto-oncogene: A potential target for molecular cancer therapy. Trends Mol Med 2004 10 351 357 15242684
21 Califano D D'Alessio A Colucci-D'Amato GL De Vita G Monaco C A potential pathogenetic mechanism for multiple endocrine neoplasia type 2 syndromes involves ret-induced impairment of terminal differentiation of neuroepithelial cells. Proc Natl Acad Sci U S A 1996 93 7933 7937 8755580
22 Morris KN Jensen KB Julin CM Weil M Gold L High affinity ligands from in vitro selection: Complex targets. Proc Natl Acad Sci U S A 1998 95 2902 2907 9501188
23 Cerchia L Libri D Carlomagno MS de Franciscis V The soluble ectodomain of RetC634Y inhibits both the wild-type and the constitutively active Ret. Biochem J 2003 372 897 903 12630912
24 Santoro M Carlomagno F Romano A Bottaro DP Dathan NA Activation of RET as a dominant transforming gene by germline mutations of MEN2A and MEN2B. Science 1995 267 381 383 7824936
25 Colucci-D'Amato GL D'Alessio A Califano D Cali G Rizzo C Abrogation of nerve growth factor-induced terminal differentiation by ret oncogene involves perturbation of nuclear translocation of ERK. J Biol Chem 2000 275 19306 19314 10858459
26 Bhalla US Ram PT Iyengar R MAP kinase phosphatase as a locus of flexibility in a mitogen-activated protein kinase signaling network. Science 2002 297 1018 1023 12169734
27 Carlomagno F Melillo RM Visconti R Salvatore G De Vita G Glial cell line-derived neurotrophic factor differentially stimulates ret mutants associated with the multiple endocrine neoplasia type 2 syndromes and Hirschsprung's disease. Endocrinology 1998 139 3613 3619 9681515
28 Rizzo C Califano D Colucci-D'Amato GL De Vita G D'Alessio A Ligand stimulation of a Ret chimeric receptor carrying the activating mutation responsible for the multiple endocrine neoplasia type 2B. J Biol Chem 1996 271 29497 29501 8910618
29 Levi A Eldridge JD Paterson BM Molecular cloning of a gene sequence regulated by nerve growth factor. Science 1985 229 393 395 3839317
30 Chen CH Chernis GA Hoang VQ Landgraf R Inhibition of heregulin signaling by an aptamer that preferentially binds to the oligomeric form of human epidermal growth factor receptor-3. Proc Natl Acad Sci U S A 2003 100 9226 9231 12874383
31 Barnett MW Fisher CE Perona-Wright G Davies JA Signalling by glial cell line-derived neurotrophic factor (GDNF) requires heparan sulphate glycosaminoglycan. J Cell Sci 2002 115 4495 4503 12414995
32 D'Alessio A Califano D Incoronato M Santelli G Florio T The tyrosine phosphatase Shp-2 mediates intracellular signaling initiated by Ret mutants. Endocrinology 2003 144 4298 4305 12959980
33 Fitzwater T Polisky B A SELEX primer. Methods Enzymol 1996 267 275 301 8743323
34 Bartel DP Szostak JW Isolation of new ribozymes from a large pool of random sequences. Science 1993 261 1411 1418 7690155 | 15769183 | PMC1065267 | CC BY | 2021-01-05 08:21:22 | yes | PLoS Biol. 2005 Apr 22; 3(4):e123 |
==== Front
Mol CancerMolecular Cancer1476-4598BioMed Central London 1476-4598-4-131581117710.1186/1476-4598-4-13Short CommunicationInactivation of MAP kinase signalling in Myc Transformed Cells and Rescue by LiCl inhibition of GSK3 Al-Assar Osama [email protected] Dorothy H [email protected] Biomedical Research Centre, University of Dundee, Ninewells Hospital and Medical School, Dundee DD1 9SY, UK2 Institute for Cancer Studies, Division of Genomic Medicine, Medical School, University of Sheffield, Beech Hill Road, Sheffield S10 2RX, UK2005 5 4 2005 4 13 13 23 10 2004 5 4 2005 Copyright © 2005 Al-Assar and Crouch; licensee BioMed Central Ltd.2005Al-Assar and Crouch; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
c-Myc oncogene is an important regulator of cell cycle and apoptosis, and its dysregulated expression is associated with many malignancies. Myc is instrumental in directly or indirectly regulating the progression through the G1 phase and G1/S transition, and transformation by Myc results in perturbed cell cycle. Also contributory to the control of G1 is the Ras effector pathway Raf/MEK/ERK MAP kinase. Together with GSK3, ERK plays an important role in the critical hierarchical phosphorylation of S62/T58 controlling Myc protein levels. Therefore, our main aim was to examine the levels of MAPK in Myc transformed cells in light of the roles of ERK in cell cycle and control of Myc protein levels. We found that active forms of ERK were barely detectable in v-Myc (MC29) transformed cells. Furthermore, we could only detect reduced levels of activated ERK in c-Myc transformed cells compared to the non-transformed primary chick embryo fibroblast cells. The addition of LiCl inhibited GSK3 and successfully restored the levels of ERK in v-Myc and c-Myc transformed cells to those found in non-transformed cells. In addition, LiCl stabilised Myc protein in the non-transformed and c-Myc transformed cells but not in v-Myc transformed cells. These results can provide an important insight into the role of MAPK in the mechanism of Myc induced transformation and carcinogenesis.
==== Body
Background
The c-Myc oncogene is one of the most frequently dysregulated genes in human tumours. Myc was originally identified as the cellular homolog of the transforming part of the viral isolate MC29 [1]. The c-Myc oncogene is a member of the basic-helix-loop-helix-leucine-zipper transcription (bHLH-ZIP) factors, which are essential for different cellular processes [2]. Paradoxically, c-Myc promotes both cell cycle progression and apoptosis under low serum condition [3,4]. c-Myc regulates the cellular processes by controlling a large number of target genes [5,6] through heterodimerization with its biological partner Max [7-9]. The abundance of the Myc-Max heterodimer is effectively controlled by the short lived Myc protein [10]. The Myc protein is under tight and complex control mechanisms [11].
Critical phosphorylation events determining the protein half life occur in Myc homology box I (aa45-aa65) [10]. These detrimental events involve the hierarchical phosphorylation of S62 and T58 by ERK1/2 MAPK and GSK3β, respectively [12]. It is widely accepted that these kinases are involved in the phosphorylation events at these residues although other reports question the role of MAPK [13]. These two kinases are part of two different Ras effector pathways. The presence of different Ras isoforms provides for selective activation of specific Ras effector pathway, although this can only be shown in vivo [14]. It has been reported that PI-3 kinase is most effectively activated by M-Ras and R-Ras and to a less extent by H-Ras [15,16]. On the other hand, Raf-1 is most effectively activated by K-Ras [17,18]. This selective activation of different Ras effector pathways has opposing effects on Myc controlled functions. Whereas the activation of Raf fails to suppress Myc induced apoptosis, the activation of PI-3 Kinase can effectively suppress it [19]. A key component of the PI3-kinase/Akt (PKB) pro-survival pathway is GSK3 [20], whereas the active phosphorylated form of ERK1/2 MAPK is a downstream signal in the signalling cascade Ras/Raf/MEK [21].
The ERK1/2 MAPK is one of three major MAPK signalling pathways, which also includes JNK/SAPK and p38 kinase. Constitutive activation of MEK/ERK has been reported in cancer cells [22,23], with a possible role in cell transformation and oncogenesis [24]. The constitutive activation of MAPK ERK1/2 could be linked to the mitogen independence reported for oncogenes like Ras [25], Raf [26], Jun [27] and Myc [4]. Therefore, one of the aims of this study was to examine the status of active ERK2 in Myc transformed chick embryo fibroblasts (CEF), the ideal model for Myc induced transformation.
Our second aim was to examine the possibility of a cross talk between ERK2 and GSK3 in Myc transformed fibroblasts using LiCl to inhibit GSK3. Reports on signalling between GSK3 and ERK1/2 are very scarce. Nonetheless, a recent report has demonstrated that GSK3β was a natural activator of the JNK/SAPK pathway [28]. Furthermore, it has been demonstrated that GSK3β could be phosphorylated on Ser9 and therefore inactivated by ERK1/2 mediated pathways, mainly through p90rsk but also through a novel mechanism downstream of ERK1/2 [29]. These findings need to be verified in transformed phenotype.
Results and Discussion
We have found that v-Myc (MC29) transformed fibroblasts have almost non-detectable active ERK2 (Figure 1A). A control experiment using the SFCV vector without an insert was performed in parallel with every experiment to exclude any effect for the transfection procedure. Cells transfected with the control vector gave identical results to the non-transfected control CEF cells. The addition of 100 mM LiCl was very successful in restoring (not fully) the levels of active ERK2 in v-Myc transformed fibroblasts to those found in non-transformed fibroblasts within the time scale of the experiment. The barely detectable basal levels of phosphorylated ERK2 in v-Myc transformed fibroblasts showed an increase after the addition of LiCl at the earliest time point of 20 minutes (31% of basal levels in non-transformed control CEF). These levels were almost completely restored to the levels found in non-transformed CEF after 80 minutes (83% of basal levels in non-transformed control CEF).
Figure 1 The effect of LiCl on the levels of active ERK in Myc transformed and non transformed fibroblasts. (A) A time course for the effect of LiCl on the levels of active ERK2 in v-Myc transformed fibroblasts (panel 1). Total ERK levels were not affected and were used as a loading control (panel 2). Panel 3 is a graphical representation of the ERK2 levels in Li+ and K+ treated v-Myc cells after normalisation to ERK2 levels in non-transformed control CEF (identical to CEF transfected with empty vector) growing under normal conditions. (B) A time course for the effect of LiCl on the levels of active ERK2 in c-Myc transformed fibroblasts (panel 1). Total ERK levels were not affected and were used as a loading control (panel 2). Panel 3 is a graphical representation of the ERK2 levels in Li+ and K+ treated c-Myc cells after normalisation to ERK2 levels in non-transformed control CEF growing under normal conditions. (C) A time course for the effect of LiCl on the levels of active ERK2 in non-transformed control CEF (panel 1). Total ERK levels were not affected and were used as a loading control (panel 2). Panel 3 is a graphical representation of the ERK2 levels in Li+ and K+ treated cells after normalisation to ERK2 levels in non-transformed control CEF growing under normal conditions. The same pattern of expression was seen in several independent experiments for all the panels.
On the other hand, c-Myc transformed fibroblasts have shown attenuated but detectable active ERK2 levels compared to the non-transformed CEF. The addition of 100 mM LiCl fully restored the levels of active ERK2 to those found in non-transformed CEF (Figure 1B). The reduced basal levels of ERK2 in c-Myc transformed fibroblasts showed an increase at the earliest time point of 20 minutes (88% of basal levels in non-transformed control CEF) after the addition of LiCl and were comparable to the levels seen in the non-transformed CEF after 60 minutes. In the non-transformed CEF, the addition of LiCl enhanced the levels of active ERK2 considerably (Figure 1C). The increase in the levels of active ERK2 in CEF after the addition of LiCl was detectable after 20 minutes (153% of basal levels in non-transformed control CEF) and peaked after 40 minutes (350% of basal levels in non-transformed control CEF).
In addition, adding 100 mM of LiCl increased the levels of inactive phosphorylated GSK3 α/β in a time dependent manner (Figure 2) in agreement with the pattern seen for the restored levels of active ERK2. We confirmed the activation of the pro-survival pathway PI3K signalling pathway after the addition of LiCl by the inhibition of apoptosis in Myc transformed fibroblasts (Figure 3). Compared to the KCl control, LiCl treatment resulted in 2.1, 3.6 and 2.4 fold reduced apoptosis in v-Myc, c-Myc and non-transformed control fibroblast cells, respectively. The different cell populations showed variable number of apoptotic cells after serum starvation. This is expected since v-Myc is a stronger inducer of proliferation and apoptosis than c-Myc [30,31]. Other researchers have also demonstrated that inhibition of GSK3 using LiCl was contributory to apoptosis inhibition[32]. Other GSK3 inhibitors can be used to further support these findings.
Figure 2 The effect of LiCl on the levels of GSK3 in non-transformed fibroblasts. (A) A western blot showing the levels of inactive or phosphorylated GSK3 α/β in non-transformed fibroblasts after the addition of Li+ or K+ salt control for the time points indicated. (B) A western blot showing the levels of phosphorylated and non-phosphorylated GSK3 α/β of the same samples in (A) above after stripping and re-probing of the blot with the appropriate antibody.
Figure 3 The effect of LiCl on the apoptosis levels of serum starved Myc transformed and non-transformed fibroblasts. (A) A graphical representation of the percentage of apoptotic v/c-Myc transformed and non transformed fibroblasts 17 hours after serum deprivation and addition of Li+ or K+. The error bars are the standard error of three independent experiments. The total number of cells counted for each experiment was 50 cells. (B) &(C) Representative sections of Hoeschst 33258 stained c-Myc cells after K+ and Li+ treatment, respectively.
Similar to what we have observed in our Myc transformed cells, previous researchers have demonstrated that ERK1/2 activity was repressed in c-Raf-1 (Raf22W), v-Ha-Ras, and v-Src transformed cells by a single-specificity tyrosine phosphatase [33]. A more recent report has also demonstrated attenuated levels of ERK2 in v-Jun transformed CEF cells, which was attributed to inefficient signalling between Ras and Raf, and increased levels of MAPK phosphatase [34].
In light of the roles of ERK and GSK3 in Myc protein phosphorylation and stability, we investigated the effect of LiCl addition on Myc protein half life in c-/v-Myc transformed fibroblasts. Figures 4A and 4B show that the addition of LiCl results in dramatic stabilisation of Myc in the non-transformed and c-Myc transformed cells, respectively. Surprisingly, although endogenous Myc is hardly detectable in non-transformed CEF (t1/2 < 1 minute), it was 30 fold more stable after the addition of LiCl (Figure 4A). We verified this using immunoprecipitation (data not shown). In comparison, c-Myc protein was 4 fold more stable after LiCl treatment. Not surprisingly, both endogenous Myc in non-transformed control fibroblasts and exogenously expressed Myc in c-Myc transformed fibroblasts had similar half life values after the addition of LiCl (30 and 32 minutes, respectively). However, LiCl failed to further stabilise Myc in v-Myc transformed fibroblasts (Figure 4C). Myc protein half life was 40 minutes compared to 38 minutes in the control cells. Since MC29 v-Myc has T58>M (T61>M in chicken), we did not expect any effect for LiCl on Myc protein half life in these cells, although it was a necessary control. Other researchers documented a small effect for LiCl on Myc stability (2 fold) in immortalised cell lines [35]..
Figure 4 Myc protein turnover after the addition of LiCl in Myc transformed and non transformed fibroblasts. (A) Endogenous Myc protein in Li+ and K+ treated non-transformed fibroblasts. This was identical to fibroblasts transfected with empty vector. Panel 1 is the scanned image of a western blot autoradiograph. Panel 2 shows the half life values of the Myc protein under the different conditions. CEF represents the non-transformed control fibroblasts (B) Turnover of the Myc protein in Li+ and K+ treated c-Myc transformed fibroblasts. Panel 1 is the scanned image of a western blot autoradiograph. Panel 2 shows the half life values of the Myc protein under the different conditions. CEF represents the non-transformed control fibroblasts (C) Turnover of the Myc protein in Li+ and K+ treated v-Myc transformed fibroblasts. Panel 1 is the scanned image of a western blot autoradiograph. Panel 2 shows the half life values of the Myc protein under the different conditions. CEF represents the non-transformed control fibroblasts. The experiments were independently repeated three times and one representative experiment is shown.
We can conclude that LiCl has direct effects on the hierarchical phosphorylation of S62 and T58 (S65 and T61 in chicken) by controlling the levels of active ERK2 and GSK3, respectively. The results in this study show that this is important for the Myc half life in the non-transformed and c-Myc transformed fibroblasts but not in the v-Myc transformed cells. In this context, other researchers have found that S62 phosphorylation was necessary for Myc stabilization following Ras activation or serum stimulation[36].
Conclusion
In this short communication we provided important findings about Myc induced transformation. The abrogation of active MAPK in Myc transformed cells can potentially provide an insight into the mechanism of Myc induced transformation. Clarification of the mechanism of ERK2 inactivation in Myc transformed CEF is needed. Furthermore, it is critical to examine the implications of the differences in active ERK2 levels between v-Myc and c-Myc transformed cells and the possible role this has in Myc induced transformation and protein stability. Last, we need to elucidate on the possibility of a cross-talk between GSK3 and ERK, as this could be a very important mechanism for controlling the Myc protein.
Methods
Cell Culture, Transfection and Inhibition Studies
Cell culture and transfection of the appropriate SFCV-Myc construct (10 μg) together with RCAN(A) helper (4 μg) into secondary CEF were performed as described previously [37]. A control experiment using the SFCV vector without an insert was used with every experiment as a transfection control. After G418 Neomycin selection (BDH, UK), cultures were expanded and used for the subsequent studies. At this stage, cells transfected with vectors containing either c-Myc or v-Myc were fully transformed as determined by anchorage independent growth and visible transformation characteristics, such as metamorphosis (data not shown). LiCl was added for 30 minutes at a final concentration of 100 mM to exponentially growing CEF, c-Myc or v-Myc cells before harvesting for western blotting. KCl was used in all the experiments as a salt control. For the Myc protein turnover studies, a protein synthesis inhibitor (emetine from Sigma, UK) was added 30 minute after the addition of either LiCl or KCL at a final concentration of 0.1 mM [38] for the indicated times shown in the figure.
Apoptosis Induction and Measurement
Apoptosis was induced by incubating the cells in a medium containing 0.2% serum for 17 hours. Serum starvation for longer periods of time resulted in apoptosis in almost all of the v-Myc cell population. To measure the percentage of the apoptotic cells, the cell population was divided into adherent and suspended cells. The adherent cells were trypsinised, washed in 1× phosphate buffered saline (PBS) and fixated in ice cold 3:1 glacial acetic acid/methanol solution. Then, the cells were permealised at room temperature using a solution of 1× PBS/0.1% triton X-100 for 5 minutes. The cells were then stained in a solution of 2.5 μg/μl Hoeschst 33258 (Sigma, UK) in 1× PBS/0.1 % triton X-100 on ice and protected from light. After that, the cells were washed twice in 1× PBS/0.1% triton X-100, made adherent onto a slide using a cytospin, and viewed and counted under an epi-fluorescent microscope using a DAPI filter. We treated the suspended cells in exactly the same way with the exception that they did not need trypsinisation. To calculate the total number of apoptotic cells in both adherent and suspended cells, we used the following formula:
SDS PAGE Western Blotting and Protein Half Life Measurement
Cell lysates were prepared by lysing cultures in SDS-sample buffer containing 1% SDS without bromophenol blue or mercaptoethanol. Protein concentration was measured using Micro BCA reagent (Pierce, UK) before loading onto 7.5% SDS-PAGE gels. Transfer to nitrocellulose and western blotting was performed essentially as described previously [37], except that incubation with the primary antibody was performed in 2.5% BSA in TBS-Tween20 for ERK western blots. Active phosphorylated ERK was detected using rabbit polyclonal antibodies (catalogue number 9101, New England Biolabs, UK) and total phosphorylated and non-phosphorylated ERK levels were detected using rabbit polyclonal antibody (catalogue number 71–1800, Zymed, UK). Inactive phosphorylated GSK3 α/β (Ser21/9) protein was detected using a rabbit polyclonal antibody (catalogue number 9331S, Cell Signaling Technology, UK) and phosphorylated and non-phosphorylated GSK3 α/β levels were detected using a rabbit polyclonal antibody raised against GSK3 β but detected both GSK3 α and β (catalogue number 9332, Cell Signaling Technology, UK). Full length Myc protein was expressed in our laboratory and was used to raise rabbit polyclonal antibodies against. To re-probe a blot, it was first submerged in a solution containing 100 mM 2-mercaptoethanol, 2% SDS and 62.5 mM Tris HCl pH 6.7 at 50°C for 1 hour, with agitation. Then, the blot was washed in a solution containing TBS/0.1% Tween20 for 10 minutes three times at room temperature. Last, the blot was blocked and probed as above with the appropriate antibody. Equal loading of lanes was determined by staining the polyacrylamide gel after transfer onto a nitrocellulose membrane in coomassie blue solution for 2 hours (50% methanol, 10% acetic acid, 0.25% coomassie blue R-250) and de-staining in a solution containing 10% methanol and 5% acetic acid for 4 hours. The different band intensities were analysed using the Kodak 1D image analysis software and then they were plotted on a linear graph for the ERK levels. For the calculation of the Myc protein half life, the densitometric values were plotted on a semi-logarithmic graph against time and then fitted to an exponential line. The half life of the protein was calculated from the equation:
==== Refs
Levens DL Reconstructing MYC Genes Dev 2003 17 1071 1077 12730130 10.1101/gad.1095203
Nesbit CE Tersak JM Prochownik EV MYC oncogenes and human neoplastic disease Oncogene 1999 18 3004 3016 10378696 10.1038/sj.onc.1202746
Hunter T Oncoprotein networks Cell 1997 88 333 346 9039260 10.1016/S0092-8674(00)81872-3
Bouchard C Staller P Eilers M Control of cell proliferation by Myc Trends Cell Biol 1998 8 202 206 9695840 10.1016/S0962-8924(98)01251-3
Watson JD Oster SK Shago M Khosravi F Penn LZ Identifying genes regulated in a Myc-dependent manner J Biol Chem 2002 277 36921 36930 12145275 10.1074/jbc.M201493200
Menssen A Hermeking H Characterization of the c-MYC-regulated transcriptome by SAGE: identification and analysis of c-MYC target genes Proc Natl Acad Sci U S A 2002 99 6274 6279 11983916 10.1073/pnas.082005599
Blackwood EM Eisenman RN Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc Science 1991 251 1211 1217 2006410
Amati B Dalton S Brooks MW Littlewood TD Evan GI Land H Transcriptional activation by the human c-Myc oncoprotein in yeast requires interaction with Max Nature 1992 359 423 426 1406955 10.1038/359423a0
Prendergast GC Lawe D Ziff EB Association of Myn, the murine homolog of max, with c-Myc stimulates methylation-sensitive DNA binding and ras cotransformation Cell 1991 65 395 407 1840505 10.1016/0092-8674(91)90457-A
Flinn EM Busch CM Wright AP myc boxes, which are conserved in myc family proteins, are signals for protein degradation via the proteasome Mol Cell Biol 1998 18 5961 5969 9742113
Dang CV c-Myc target genes involved in cell growth, apoptosis, and metabolism Mol Cell Biol 1999 19 1 11 9858526
Lutterbach B Hann SR Hierarchical phosphorylation at N-terminal transformation-sensitive sites in c-Myc protein is regulated by mitogens and in mitosis Mol Cell Biol 1994 14 5510 5522 8035827
Lutterbach B Hann SR c-Myc transactivation domain-associated kinases: questionable role for map kinases in c-Myc phosphorylation J Cell Biochem 1999 72 483 491 10022608 10.1002/(SICI)1097-4644(19990315)72:4<483::AID-JCB4>3.0.CO;2-I
Hancock JF Ras proteins: different signals from different locations Nat Rev Mol Cell Biol 2003 4 373 384 12728271 10.1038/nrm1105
Kimmelman AC Osada M Chan AM R-Ras3, a brain-specific Ras-related protein, activates Akt and promotes cell survival in PC12 cells Oncogene 2000 19 2014 2022 10803462 10.1038/sj.onc.1203530
Yan J Roy S Apolloni A Lane A Hancock JF Ras isoforms vary in their ability to activate Raf-1 and phosphoinositide 3-kinase J Biol Chem 1998 273 24052 24056 9727023 10.1074/jbc.273.37.24052
Voice JK Klemke RL Le A Jackson JH Four human ras homologs differ in their abilities to activate Raf-1, induce transformation, and stimulate cell motility J Biol Chem 1999 274 17164 17170 10358073 10.1074/jbc.274.24.17164
Self AJ Caron E Paterson HF Hall A Analysis of R-Ras signalling pathways J Cell Sci 2001 114 1357 1366 11257001
Kauffmann-Zeh A Rodriguez-Viciana P Ulrich E Gilbert C Coffer P Downward J Evan G Suppression of c-Myc-induced apoptosis by Ras signalling through PI(3)K and PKB Nature 1997 385 544 548 9020362 10.1038/385544a0
Lee HY Srinivas H Xia D Lu Y Superty R LaPushin R Gomez-Manzano C Gal AM Walsh GL Force T Ueki K Mills GB Kurie JM Evidence That Phosphatidylinositol 3-Kinase- and Mitogen-activated Protein Kinase Kinase-4/c-Jun NH2-terminal Kinase-dependent Pathways Cooperate to Maintain Lung Cancer Cell Survival J Biol Chem 2003 278 23630 23638 12714585 10.1074/jbc.M300997200
Chang L Karin M Mammalian MAP kinase signalling cascades Nature 2001 410 37 40 11242034 10.1038/35065000
Morgan MA Dolp O Reuter CW Cell-cycle-dependent activation of mitogen-activated protein kinase kinase (MEK-1/2) in myeloid leukemia cell lines and induction of growth inhibition and apoptosis by inhibitors of RAS signaling Blood 2001 97 1823 1834 11238126 10.1182/blood.V97.6.1823
Zheng B Fiumara P Li YV Georgakis G Snell V Younes M Vauthey JN Carbone A Younes A MEK/ERK pathway is aberrantly active in Hodgkin disease: a signaling pathway shared by CD30, CD40, and RANK that regulates cell proliferation and survival Blood 2003 102 1019 1027 12689928 10.1182/blood-2002-11-3507
Fincham VJ James M Frame MC Winder SJ Active ERK/MAP kinase is targeted to newly forming cell-matrix adhesions by integrin engagement and v-Src Embo J 2000 19 2911 2923 10856236 10.1093/emboj/19.12.2911
Treinies I Paterson HF Hooper S Wilson R Marshall CJ Activated MEK stimulates expression of AP-1 components independently of phosphatidylinositol 3-kinase (PI3-kinase) but requires a PI3-kinase signal To stimulate DNA synthesis Mol Cell Biol 1999 19 321 329 9858556
McCarthy SA Samuels ML Pritchard CA Abraham JA McMahon M Rapid induction of heparin-binding epidermal growth factor/diphtheria toxin receptor expression by Raf and Ras oncogenes Genes Dev 1995 9 1953 1964 7649477
Clark W Black EJ MacLaren A Kruse U LaThangue N Vogt PK Gillespie DA v-Jun overrides the mitogen dependence of S-phase entry by deregulating retinoblastoma protein phosphorylation and E2F-pocket protein interactions as a consequence of enhanced cyclin E-cdk2 catalytic activity Mol Cell Biol 2000 20 2529 2542 10713176 10.1128/MCB.20.7.2529-2542.2000
Kim JW Lee JE Kim MJ Cho EG Cho SG Choi EJ Glycogen synthase kinase 3 beta is a natural activator of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase 1 (MEKK1) J Biol Chem 2003 278 13995 14001 12584189 10.1074/jbc.M300253200
Hetman M Hsuan SL Habas A Higgins MJ Xia Z ERK1/2 antagonizes glycogen synthase kinase-3beta-induced apoptosis in cortical neurons J Biol Chem 2002 277 49577 49584 12393899 10.1074/jbc.M111227200
Petropoulos CJ Givol I Hughes SH Comparative analysis of the structure and function of the chicken c-myc and v-myc genes: v-myc is a more potent inducer of cell proliferation and apoptosis than c-myc Oncogene 1996 12 2611 2621 8700520
Lee CM Reddy EP The v-myc oncogene Oncogene 1999 18 2997 3003 10378695 10.1038/sj.onc.1202786
Bijur GN De Sarno P Jope RS Glycogen synthase kinase-3beta facilitates staurosporine- and heat shock-induced apoptosis. Protection by lithium J Biol Chem 2000 275 7583 7590 10713065 10.1074/jbc.275.11.7583
Gopalbhai K Meloche S Repression of mitogen-activated protein kinases ERK1/ERK2 activity by a protein tyrosine phosphatase in rat fibroblasts transformed by upstream oncoproteins J Cell Physiol 1998 174 35 47 9397154 10.1002/(SICI)1097-4652(199801)174:1<35::AID-JCP5>3.0.CO;2-H
Black EJ Walker M Clark W MacLaren A Gillespie DA Cell transformation by v-Jun deactivates ERK MAP kinase signalling Oncogene 2002 21 6540 6548 12226757 10.1038/sj.onc.1205851
Gregory MA Qi Y Hann SR Phosphorylation by glycogen synthase kinase-3 controls c-myc proteolysis and subnuclear localization J Biol Chem 2003 278 51606 51612 14563837 10.1074/jbc.M310722200
Sears R Nuckolls F Haura E Taya Y Tamai K Nevins JR Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability Genes Dev 2000 14 2501 2514 11018017 10.1101/gad.836800
La Rocca SA Crouch DH Gillespie DA c-Myc inhibits myogenic differentiation and myoD expression by a mechanism which can be dissociated from cell transformation Oncogene 1994 9 3499 3508 7970710
Gavine PR Neil JC Crouch DH Protein stabilization: a common consequence of mutations in independently derived v-Myc alleles Oncogene 1999 18 7552 7558 10602514 10.1038/sj.onc.1203102 | 15811177 | PMC1083420 | CC BY | 2021-01-04 16:36:35 | yes | Mol Cancer. 2005 Apr 5; 4:13 |
==== Front
Environ Health PerspectEnviron. Health PerspectEnvironmental Health Perspectives0091-67651552-9924National Institue of Environmental Health Sciences 10.1289/ehp.7783ehp0113-00070815929893ResearchArticlesSustained Exposure to the Widely Used Herbicide Atrazine: Altered Function and Loss of Neurons in Brain Monoamine Systems Rodriguez Veronica M. Thiruchelvam Mona Cory-Slechta Deborah A. Environmental and Occupational Health Sciences Institute, and Department of Environmental and Occupational Medicine, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey, USAAddress correspondence to D.A. Cory-Slechta, Environmental and Occupational Health Sciences Institute, 170 Frelinghuysen Rd., Piscataway, NJ 08854 USA. Telephone: (732) 445-0205. Fax: (732) 445-0131. E-mail:
[email protected] express our appreciation to R. Reeves and M. Virgolini for their input.
This work was supported by grant ES10791 from the National Institute of Environmental Health Sciences.
The authors declare they have no competing financial interests.
6 2005 24 2 2005 113 6 708 715 22 11 2004 24 2 2005 Publication of EHP lies in the public domain and is therefore without copyright. All text from EHP may be reprinted freely. Use of materials published in EHP should be acknowledged (for example, ?Reproduced with permission from Environmental Health Perspectives?); pertinent reference information should be provided for the article from which the material was reproduced. Articles from EHP, especially the News section, may contain photographs or illustrations copyrighted by other commercial organizations or individuals that may not be used without obtaining prior approval from the holder of the copyright. The widespread use of atrazine (ATR) and its persistence in the environment have resulted in documented human exposure. Alterations in hypothalamic catecholamines have been suggested as the mechanistic basis of the toxicity of ATR to hormonal systems in females and the reproductive tract in males. Because multiple catecholamine systems are present in the brain, however, ATR could have far broader effects than are currently understood. Catecholaminergic systems such as the two major long-length dopaminergic tracts of the central nervous system play key roles in mediating a wide array of critical behavioral functions. In this study we examined the hypothesis that ATR would adversely affect these brain dopaminergic systems. Male rats chronically exposed to 5 or 10 mg/kg ATR in the diet for 6 months exhibited persistent hyperactivity and altered behavioral responsivity to amphetamine. Moreover, when measured 2 weeks after the end of exposure, the levels of various monoamines and the numbers of tyrosine hydroxylase-positive (TH+) and -negative (TH−) cells measured using unbiased stereology were reduced in both dopaminergic tracts. Acute exposures to 100 or 200 mg/kg ATR given intraperitoneally to evaluate potential mechanisms reduced both basal and potassium-evoked striatal dopamine release. Collectively, these studies demonstrate that ATR can produce neurotoxicity in dopaminergic systems that are critical to the mediation of movement as well as cognition and executive function. Therefore, ATR may be an environmental risk factor contributing to dopaminergic system disorders, underscoring the need for further investigation of its mechanism(s) of action and corresponding assessment of its associated human health risks.
atrazinedopaminehypothalamuslocomotor activitymicrodialysisprefrontal cortexstriatumsubstantia nigraunbiased stereology
==== Body
Atrazine (ATR; 2-chloro-4-ethylamino-6-isopropylamino-s-triazine), a chlorinated member of the family of s-substituted triazines, is one of the most widely employed herbicides in the world, with an estimated 76.4 million pounds used annually in the United States alone. It acts to suppress photosynthesis by inhibiting electron transfer at the reducing site of chloroplast complex II (Eldridge et al. 1999). Although it has limited solubility in water, ATR is frequently detected in ground and surface waters in agricultural regions (Colborn and Short 1999). Studies also reveal that ATR can be transported into the home, presumably tracked by soil (Lioy et al. 2000).
Human exposure has been confirmed (Adgate et al. 2001; Clayton et al. 2003), and, in fact, approximately 60% of the U.S. population is exposed to ATR (Birnbaum and Fenton 2003). Recent reports indicate that acute dietary exposures range from 0.234 to 0.857 μg/kg/day, and corresponding figures for chronic dietary exposure are 0.046 to 0.286 μg/kg/day, considering all commodities with U.S. Environmental Protection Agency (EPA) tolerances and drinking water (Gammon et al. 2005). Occupational exposure to ATR, as measured in mixer-loader-tender applicators, was reported to be approximately 2.8 mg ATR/day of work, with an absorbed dose of 1.8–6.1 μg/kg/day based on a 5.6% dermal absorption rate (Gammon et al. 2005). An earlier study of manufacturing workers reported a total ATR exposure of 10–700 μmol (~ 2.157–151.004 mg) per work shift (Catenacci et al. 1993).
The understanding of the potential of ATR to serve as a contributing factor to human disease and dysfunction is currently extremely limited. Epidemiologic studies have linked environmental and/or occupational ATR exposure to increased mortality (Sathiakumar et al. 1996), and to non-Hodgkin’s lymphoma (MacLennan et al. 2003; Sathiakumar and Delzell 1997).
In experimental models, however, a growing experimental literature documents deleterious hormonal and reproductive system effects of ATR. In rodents, reported effects include reductions in testosterone levels; increases in tri-iodothyronine (Friedmann 2002; Stoker et al. 2000, 2002); suppression of immune function (Rooney et al. 2003), of luteinizing hormone (LH), and of prolactin surges (Cooper et al. 2000); the appearance of mammary gland tumors; a disruption of regular ovarian cycles; and the induction of pseudopregnancies (Cooper et al. 1996; Laws et al. 2000).
The effects of ATR on ovarian function in female rats have been ascribed to changes in function of catecholamines in the hypothalamus, specifically decreases in norepinephrine (NE) and increases in dopamine (DA) in this region (Cooper et al. 1998). In correspondence with this observation, in vitro studies in PC12 cells show concentration-dependent decreases in intracellular DA after exposure to 12.5–200 μM ATR for 6, 12, 18, and 24 hr and decreases in NE release and intracellular NE concentrations after exposures to 100 and 200 μM ATR for 12, 18, and 24 hr (Das et al. 2000, 2003). In addition, reductions in the expression of DA β-hydroxylase [but not of tyrosine hydroxylase (TH)] were observed. The inhibitory effects of ATR on intracellular NE content and NE release, but not on DA intracellular content, were reversed when PC12 cells were co-incubated with ATR and agents known to enhance transcription, phosphorylation, or activity of TH and DA β-hydroxylase, such as 8-bromo-cAMP, forskolin, or dexamethasone (Das et al. 2003). These findings suggest that ATR could disrupt catecholamine metabolism by altering its biosynthetic enzymes.
The fact that ATR can adversely affect hypothalamic catecholamine systems has notable implications because such effects would be unlikely to be restricted to this particular region, but could affect brain catecholamine systems more generally and thus affect pathways critical to the control of movement (nigrostriatal dopaminergic systems) and of complex cognitive functions (mesocorticolimbic dopaminergic systems). If so, then ATR exposures may also serve as a risk factor for neurodegenerative diseases and/or dysfunctions associated with these systems, which include Parkinson’s disease, schizophrenia, and attention deficit disorder, among others (Crossman 2000; Epstein et al. 1999; Viggiano et al. 2003). Indeed, epidemiologic studies have linked pesticides to an increased odds ratio for Parkinson’s disease (Breysse et al. 2002), and various pesticides that affect catecholaminergic systems have been shown to produce characteristics of Parkinson’s disease in experimental models (Betarbet et al. 2000; Reeves et al. 2003; Thiruchelvam et al. 2000b).
The potential for neurotoxic effects of ATR in vivo, however, particularly chronic effects, has received almost no experimental attention. Oral exposure of rats to 1,000 mg/kg ATR for 4–11 days decreased rearing in the open field (Ugazio et al. 1991), whereas acute exposure of rats to 100 mg/kg decreased spontaneous Purkinje cell firing rate and cerebellar potentials evoked by electrical stimulation (Podda et al. 1997).
The objective of the present study was to evaluate the potential for sustained low-level ATR exposure to affect two critical catecholamine pathways of the brain: the nigrostriatal DA pathway, involved in the mediation of movement (Crossman 2000), and the mesocorticolimbic DA pathway critical to complex cognitive functions (Clark et al. 2004; Remy and Samson 2003). For this purpose, we evaluated locomotor activity across the course of exposure, whereas monoamine levels in striatum, prefrontal cortex, nucleus accumbens, and hypothalamus and stereologic cell counts of TH-positive (TH+) and TH-negative (TH−) cells in the midbrain were evaluated 2 weeks after cessation of exposure. Further, this study sought to determine mechanisms by which any changes in dopaminergic function in these pathways might be produced by examining the acute effects of ATR on striatal DA release using microdialysis.
Materials and Methods
Chronic ATR Exposure
Subjects, exposure, and experimental design.
Thirty male Long-Evans rats purchased from Taconic Farms (Germantown, NY) were housed individually in plastic cages in a temperature- and humidity-controlled vivarium room with a 12-hr dark/light cycle (lights on 0600 hr). Food intake was restricted to maintain body weights at 300 g, and water was available ad libitum during the entire experiment. In our experience, this protocol sustains health and viability to a greater degree than does ad libitum feeding. At 9 months of age, exposure to 0, 5, or 10 mg/kg ATR mixed in food was initiated with continuation of ad libitum access to distilled drinking water. These doses of ATR were chosen based on reports for the rat of an oral median lethal dose (LD50) of 1,869 mg/kg (U.S. EPA 2001), a no observed adverse effect level (NOAEL) of 3.3 mg/kg/day, and a lowest observed adverse effect level (LOAEL) of 34.5 mg/kg/day for this route of administration measured as body weight loss. A chronic dietary NOAEL of 1.8 mg/kg/day and LOAEL of 3.65 mg/kg/day were also reported (U.S. EPA 2001). We recorded body weights and food consumption periodically over the entire duration of the experiment. All procedures were carried out in accord with National Institutes of Health and University of Medicine and Dentistry of New Jersey Animal Use and Care Committee Guidelines (Institute of Laboratory Animal Resources 1996). The experimental design is summarized in Figure 1A.
We recorded locomotor activity at 2, 3, and 6 months of ATR exposure and 2 weeks after cessation of exposure. At the 2-month time point, we measured locomotor activity on 3 consecutive days, with animals receiving an intraperitoneal (ip) injection of saline 5 min before the session during the first 2 days, and an injection of d-amphetamine sulfate (1 mg/kg) on day 3. Only a single locomotor activity session was carried out at the 3-and 6-month time points and at 2 weeks after the termination of ATR exposure. Locomotor activity was recorded during the light phase (from 0900 hr to 1300 hr) of the light/dark cycle using methods described below.
Two weeks after cessation of ATR exposure, rats were sacrificed by decapitation, brains were removed, and hypothalamus, prefrontal cortex, nucleus accumbens, and striatum were dissected on ice and frozen for HPLC analysis. The remaining tissue was postfixed in 4% paraformaldehyde for immunohistochemistry and stereologic counts.
Locomotor activity measurement.
Each rat was individually placed in an automated locomotor activity chamber equipped with infrared photobeams (Opto-Varimex Minor; Columbus Instruments International Corporation, Columbus, OH). Horizontal, vertical, and ambulatory activities were simultaneously measured and data were collected over the course of a 45-min session.
Measurement of monoamine levels.
Tissues were sonicated in 0.1N perchloric acid and centrifuged. Supernatants were stored at −80°C until analyzed for monoamine content. Pellets were digested in 0.5 M sodium hydroxide for measurements of protein concentration using reagents from Bio-Rad (Hercules, CA).
We measured monoamines and their metabolites using HPLC with electrochemical detection as described elsewhere (Thiruchelvam et al. 2000a). Briefly, a Waters pump 515 plus autosampler (Waters Corporation, Milford, MA) was joined to a chromatographic column (Alltech Associates Inc, Deerfield, IL). The amperometric potential was set at 600 mV relative to the silver/silver chloride, and the sensitivity of the detector was set at 100 ρA (microdialysates) or 1 ηA (tissue samples). The mobile phase was an isocratic 0.1 M monobasic phosphate solution containing 0.5 mM sodium octyl sulfate, 0.03 mM EDTA, and 12–14% vol/vol methanol. Results generated by these determinations were analyzed with the Empower Pro program (Empower Software, Waters Corporation) and are expressed in picograms per milliliter of microdialysate or nanograms per milligram of protein of tissue. DA turnover was expressed as the ratio of dihydroxyphenylacetic acid (DOPAC) to DA.
Tyrosine hydroxylase immunohistochemistry.
Five randomly selected paraformaldehyde-fixed brains from each treatment group were cut into 30-μm sections, collected in cryoprotectant, and stored at −20°C for immunolabeling studies. Sections were rinsed with 0.1 M phosphate buffer (PB), blocked with 10% normal goat serum for nonspecific binding, and incubated in TH primary antibody (Chemicon, Tamecula, CA) for 48 hr at a dilution of 1:3,500 in PB with 0.3% Triton X-100 and 10% normal goat serum. Sections were then incubated with a secondary antibody 1:200 (Vector Laboratories Inc., Burlingame, CA) overnight. Sections were washed and incubated with avidinbiotin solution from Vectastain ABC reagents (Vector Laboratories) for 1 hr and developed in 3–3′-diaminobenzidine tetrachloride and H2O2 in 0.05 M Tris buffer. Sections were counterstained with cresyl violet after TH staining. We counted total numbers of TH+ and Nissl-stained neurons (TH−) in substantia nigra pars compacta (SNpc) and the ventral tegmental area (VTA) using the optical fractionator method as described below.
Stereologic analysis.
After delineation of the SNpc and VTA at low magnification (4× objective), one side of every fourth section from the entire midbrain region was sampled at higher magnification (100× objective) using the stereology module of the Stereo Investigator imaging program (MicroBrightField Inc., Williston, VT) with an Olympus Provis microscope (Olympus America, Melville, NY). We used the optical fractionator method, an unbiased quantitative technique, for counting TH+ (TH+ and cresyl violet+ neurons) and TH− (cresyl violet+ only) cells. Criteria for TH+ and TH− neurons were determined as previously described (Barlow et al. 2004; Thiruchelvam et al. 2004). We determined the mean thickness by measuring two fields from five sections per sample, and the entire depth of field was sampled, ignoring the upper and lower 0.5 μm. All samples were evaluated by one experimenter without knowledge of treatment status.
Chemicals.
ATR at 98% purity was purchased from Chem Services Inc. (West Chester, PA). Reagents for microdialysis, HPLC analysis, methylcellulose, and cresyl violet were purchased from Sigma (St. Louis, MO).
Acute ATR Exposure
Subjects, exposure, and experimental design.
Thirty male Long Evans rats weighing between 270 and 320 g purchased from Taconic Farms were habituated to constant standard laboratory conditions of humidity, temperature, and dark/light cycle (lights on 0600 hr) as described above. As shown in Figure 1B, we used microdialysis to evaluate changes in striatal DA release after acute intraperitoneal (ip) exposures to ATR in sessions lasting 7 hr.
Surgery.
After a habituation period of at least 1 week, rats were anesthetized with pentobarbital (30–40 mg/kg ip) and every 30 min thereafter received an injection of atropine sulfate (0.3 mg/kg ip) to avoid respiratory failure during the cannula implantation. Once anesthetized (assessed by absence of corneal reflex), the rat was placed in a stereotaxic apparatus (Kopf Instruments, Tujunga, CA), the skull was exposed, and a hole was drilled for placement of a guide cannula (MD-2250; Bioanalytical Systems Inc., West Lafayette, IN) over the right striatum, using stereotaxic coordinates (anterior-posterior, +1.0 mm, medio-lateral, −2.0 mm with reference to bregma, dorso-ventral, −3.4 mm from flat skull) according to the atlas of Paxinos and Watson (1986). The cannula was fixed to the skull with anchor screws and acrylic cement. After surgery, rats were individually housed for a recovery period of 5–7 days with food restricted to keep body weight at 300 g and water was available ad libitum.
Microdialysis.
A probe of concentric design (MD-2262, tip 2 mm; Bioanalytical Systems, Inc.) was inserted into the guide cannula. The dialysis probe was continuously perfused at a flow rate of 2.5 μL/min through a liquid swivel from an automated system (Bioanalytical Systems Inc.) with a physiologic Ringer’s solution containing 147 mM NaCl, 4.0 mM KCl, 1.2 mM CaCl2, and 1 mM MgCl2, pH 6.0–6.5. Sample collection occurred every 30 min. The first hour of sampling was discarded to avoid erroneous data due to probe insertion. After three baseline samples, rats received an ip injection of vehicle (1% methyl-cellulose) or ATR (100 or 200 mg/kg), and five subsequent samples of perfusate were collected. In order to probe characteristics of DA release, a high potassium solution (91 mM NaCl, 60 mM KCl, 1.2 mM CaCl2, and 1 mM MgCl2, pH 6.0–6.5) replaced the normal Ringer’s solution, and two samples were collected under these conditions. Normal Ringer’s solution was subsequently restored, and two additional samples of perfusate were collected. Collection vials contained 3.75 μL 0.1 M HClO4 solution. Collected samples were immediately frozen at −80°C until monoamine quantification by HPLC as described above.
Histology.
At the completion of micro-dialysis sampling, rats were overdosed with sodium pentobarbital and transcardially perfused with an isotonic saline solution followed by 10% formaldehyde. Brains were postfixed in 10% formalin overnight and then transferred to 30% sucrose. Brains were sectioned in 50 μm coronal slices, mounted, stained with cresyl violet, and coverslipped. Cannula placement for the microdialysis study was confirmed under microscopic analyses.
Statistical Analyses
We analyzed total locomotor activity counts, body weight, and food consumption using repeated-measures analysis of variance (RMANOVA; treatment × time) followed by post hoc tests as appropriate. Responsivity to d-amphetamine and changes in neurotransmitter levels in various brain regions were evaluated by one-way ANOVA with post hoc assessments in the event of main effects of treatment. To provide a more conservative analysis of changes in cell counts, because counts in both regions were derived from the same animals (brains), RMANOVA was carried out based on changes in TH+ and TH− cells in both SN and VTA (but not total counts because that was the sum of the TH+ and TH− cells), followed by post hoc testing as appropriate. We evaluated the effects of ATR on microdialysis by RMANOVAs with treatment and time as factors, followed by post hoc evaluation in the case of main effects or interactions. In all cases, statistical significance was defined as p ≤ 0.05.
Results
Chronic ATR Exposure
Gross effects of treatment.
No treatment-related changes in body weight or food consumption were detected at any point during the course of the exposure (data not shown), nor did any other signs of overt toxicity manifest at any point.
Locomotor activity.
In contrast to the other time points of measurement, the assessment of locomotor activity after 2 months of ATR exposure actually involved three sessions, the first two of which were preceded by an ip injection of saline and the third by 1 mg/kg d-amphetamine sulfate. No treatment-related changes in locomotor activity were seen in either of the sessions preceded by saline. However, in the third session, the administration of d-amphetamine increased locomotor activity of all three groups relative to levels of activity after saline administration [session 2; F(2,26) = 3.63, p < 0.041]. Additionally, these increases were modified by ATR treatment in that the 10-mg/kg dose further enhanced locomotor activity by an additional 70% (Figure 2A) relative to the increases in the 0- and 5-mg/kg groups, as confirmed in post hoc analyses.
At the remaining time points of measurement, single locomotor activity sessions were carried out in the absence of drug administration. Under these conditions, after 3 months of ATR exposure, we found pronounced increases in locomotor activity again at the 10-mg/kg dose of ATR [F(2,26) = 3.62, p = 0.041], with levels of horizontal activity that exceeded those of controls and the 5-mg/kg group by approximately 50% (Figure 2B). These treatment-related effects were also evident in the measurement of locomotor activity at the 6-month time point [F(2,24) = 3.45, p = 0.048] and again when measured 2 weeks after the termination of ATR treatment [F(2,24) = 4.42, p = 0.024], when levels remained at 40% above control.
Changes in monoamine levels.
Measured 2 weeks after the termination of ATR exposure, changes in DA content (Figure 3A) were significant in striatum [F(2,23) = 3.61, p = 0.044] as well as in frontal cortex [F(2,21) = 3.82, p = 0.039]. Statistical analysis confirmed decreased levels of DA (~ 20%) in relation to treatment in striatum, with post hoc assessments indicating efficacy at the 10-mg/kg ATR dose with a similar but nonsignificant trend at 5 mg/kg. In contrast, levels of DA were increased in prefrontal cortex in an inverse U-shaped fashion, with post hoc assessment confirming a significant increase at 5 mg/kg (by 30–40%), with levels declining back toward control values at 10 mg/kg. Both doses of ATR reduced serotonin (5-HT) levels in hypothalamus [Figure 3B; F(2,21) = 5.19, p = 0.015] by 10–15%. Chronic ATR exposure also decreased levels of NE in frontal cortex [Figure 3C; F(2,21) = 3.84, p = 0.038], with post hoc assessments showing the effect with the 10-mg/kg dose producing reductions of approximately 15–20%. Although a trend toward increases in NE in nucleus accumbens was suggested, it was associated with significant variability and therefore not statistically significant.
We observed no changes in levels of the metabolites of either 5-HT (5-hydroxyindole acetic acid) or DA [DOPAC, homovanillic acid (HVA)] or DA turnover (DOPAC:DA) in any region.
Unbiased stereologic counts of cells in the midbrain.
Changes in numbers of cells in the regions of the cell bodies of the two major DA pathways are shown in Figure 4 for a sample of five randomly selected animals from each treatment group; numbers are shown for TH+, TH−, and total cells in SNpc and for corresponding data for the VTA. Because these regions were from the same brains, we performed a more conservative statistical analysis based on RMANOVA to examine the impact of treatment on numbers of cells using counts of TH+ and TH− from each region (not including total counts). That analysis confirmed a significant main effect of treatment [F(2,36) = 5.53, p = 0.02] and no interaction of treatment by region, indicating that cell loss occurred in both regions and, moreover, in both TH+ and TH− cells. These effects were primarily attributable to the 10-mg/kg dose of ATR, as confirmed in subsequent post hoc tests; the mean reductions in cell numbers ranged from 9 to 13% in the 10-mg/kg dose group, whereas those in the 5-mg/kg group ranged from 0 to 3%.
Acute ATR Exposure
That systemic administration of ATR can indeed directly affect brain dopaminergic systems was further confirmed in microdialysis experiments. The impact of acute ip administration of ATR (100 or 200 mg/kg) on levels of DA in striatum, as assessed via microdialysis, is presented in Figure 5A. Acutely, ATR significantly decreased basal DA release, as shown in the inset in Figure 5A [main effects: treatment, F(2,19) = 4.88, p = 0.02; sampling time: F(9,18) = 26.77, p < 0.0001; treatment by time interaction: F(18,171) = 2.77, p = 0.0003]. Post hoc tests confirmed decreases as measured at 90, 120, 150, and 180 min postadministration of ATR. By 150 min, the decrements averaged approximately 40% and were seen in both the 100-mg/kg and the 200-mg/kg treatment groups.
We also observed a dose-dependent decrease in DA release when the system was challenged with 60 mM high potassium solution for 60 min [F(2,19) = 3.717, p = 0.0434]. Although the control group showed a 1,256% increase from baseline in response to potassium (210 min time point), corresponding values for the 100-mg/kg and 200-mg/kg ATR groups were 729 and 427%, respectively, from baseline. After high potassium perfusion, the system was flushed again with normal Ringer’s solution; levels of DA declined in all groups, and no treatment-related differences were evident during the remaining 60 min of sampling. The increase in DA seen in the first sample (240 min time point) after high potassium infusion was due to dead volume of the microdialysis sample collection system.
Analysis of striatal DOPAC levels in the dialysates revealed only a significant effect of sampling time [F(9,18) = 13.735, p < 0.0001]. One-way ANOVA at each time point did not show any difference among groups in DOPAC concentration during the course of the experiment (Figure 5B). Similarly, analysis of HVA levels showed a significant effect of sampling time [F(9,18) = 6.074, p < 0.0001] but no effect of group or group × sampling time interaction (Figure 5C).
Administration of vehicle (1% methyl-cellulose) or 100 mg/kg ATR did not result in acute observable effects in these rats, but some rats injected with 200 mg/kg ATR exhibited hypoactivity during the first 2 hr after injection, after which levels appeared normal. Histologic analysis confirmed that cannula placement was appropriately located in dorsal striatum for all rats.
Discussion
The present study demonstrates that sustained low-level ATR exposure in diet can adversely affect both major long-length dopaminergic tracts of the central nervous system, resulting in persistent increases in locomotor activity, alterations in responsivity to the indirect DA agonist amphetamine, changes in monoamine levels, and, ultimately, loss of neurons in the midbrain. Thus, adverse effects of ATR are not restricted to endocrine and reproductive systems or to hypothalamic regions of brain. The effects observed here cannot be ascribed to acute toxicity because the half-life of ATR in tissue ranges from 31.3 to 38.6 hr, and 95% of the ATR administered is excreted within 7 days of dosing, whereas changes in monoamines and numbers of neurons were measured 2 weeks posttreatment. Moreover, the doses used here did not produce any changes in body weight or food consumption or any signs of overt toxicity.
The observations of protracted changes in neurotransmitter levels coupled with neuronal loss have particular significance, given the critical roles of the nigrostriatal and mesocorticolimbic dopaminergic systems in controlling fine motor behavior and complex cognitive function, respectively (Clark et al. 2004; Crossman 2000; Remy and Samson 2003). Dysfunctions of dopaminergic systems include Parkinson’s disease, schizophrenia, attention deficit disorder, and learning and memory impairments. Collectively, the present findings raise the possibility that ATR exposure could be a contributory risk factor for such disorders.
Chronic ATR exposure caused cell loss not only to TH+ immunoreactive cells but also to TH− cells in the VTA and SNpc. The non-dopaminergic neuronal subpopulation in these regions includes GABAergic (Deniau et al. 1978), calbindin (Gerfen et al. 1985), and cholecystokinin-like immunoreactive neurons (Seroogy and Fallon 1989). The lack of selectivity of effects makes it likely that ATR will exhibit neurotoxicity, including cytotoxicity to other neuronal populations in other brain regions, although other regions were not examined in the present study. Additionally, ATR may exert neurotoxic effects on other cell types of the brain as well, such as glial cells. The specificity and mechanism(s) of ATR effects within the central nervous system remain to be determined, and such assessments are clearly warranted based on the findings presented here.
Chronic ATR increased locomotor activity, an effect present after 3 months of exposure, persisted for 6 months and was still evident even 2 weeks after cessation of exposure. Moreover, rats treated for 2 months with 10 mg/kg ATR exhibited an enhanced locomotor activity response to a d-amphetamine challenge. Amphetamine is known to promote the release of DA and a decrease in its re-uptake into the presynaptic terminal (Cooper et al. 2003). Thus, the increases in locomotor activity could reflect ATR-induced up-regulation of striatal DA receptors, as might be expected to occur in response to the corresponding reduction in basal DA levels (Figure 3A) or DA release produced by ATR (Figure 5A). Placement in a novel environment such as the locomotor activity chamber could increase DA, activating up-regulated DA receptors and thereby producing hyperactivity (Badiani et al. 1998), a hypothesis in agreement with the increases in locomotor activity induced by amphetamine sulfate (Mao et al. 2001).
The locomotor hyperactivity observed here differs from findings of a previous study in which 1,000 mg/kg ATR administered for 4–11 days decreased rearing in the open field (Ugazio et al. 1991). Such decreases could reflect acute toxicity of a high dose of ATR because the chemical was administered immediately before the behavioral evaluation in that study, coupled with a decline in DA release that would accompany its administration and be expected to reduce activity levels, as was observed.
The reductions noted here in levels of DA, NE, and 5-HT observed, respectively, in striatum, prefrontal cortex, and hypothalamus at the 10-mg/kg ATR dose could be due to inhibitory effects on synthesis in these monoamine pathways. Precursors of DA and NE (tyrosine) and of 5-HT (tryptophan) undergo the same hydroxylation process via TH or tryptophan hydroxylase, respectively. Both enzymes are pteridin-dependent aromatic amino acid hydroxylases and are highly homologous, reflecting a common evolutionary origin from a single genetic locus (Cooper et al. 2003). In an in vitro study using PC12 cells in which NE and DA were decreased by ATR, the NE effect was reversed when cells were co-incubated with agents known to enhance transcription and phosphorylation of dopamine β-hydroxylase and TH (Das et al. 2003), consistent with the possibility that ATR may have inhibitory effects on these enzymes.
Previous studies have reported changes in hypothalamic DA and/or NE levels after acute ATR administration at 100 mg/kg by gavage to male rats (Cooper et al. 1998). We did not observe such changes in the chronic exposure paradigm used here, a difference that could reflect initiation of compensatory mechanisms to maintain a constant production of these neurotransmitters under conditions of chronic exposure. Alternatively, catecholamine levels were determined in specific hypothalamic nuclei in that study, whereas here we examined the hypothalamus in its entirety, thus possibly diluting any regional changes (Cooper et al. 1998).
Chronic ATR exposure did decrease hypothalamic 5-HT levels, effects consistent with its known alterations of neuroendocrine systems, including the release of LH and prolactin. Serotonergic neurons from the dorsal and medial raphe nuclei project to hypothalamus, activating the hypothalamo–pituitary–adenocortical (HPA) and the hypothalamo–pituitary–gonadal (HPG) axes in the rat (Fuller 1996; Jorgensen et al. 1998). Agents that disrupt 5-HT transmission are known to alter the HPA and HPG axes (Fuller 1996; Fuller and Snoddy 1990). Furthermore, selective degeneration of the midbrain dorsal and ventromedial region of the hypothalamus induced by 5,7-dihydroxytryptamine reduces LH levels (van de Kar et al. 1980). Taken together, it can be inferred that reductions in hypothalamic 5-HT resulting from ATR could affect both the HPA and HPG axes and thereby alter other organ systems of the body with which these systems interact.
DA and NE alterations in prefrontal cortex are also notable given the critical role of this structure in mediating executive function, including working memory (Dreher et al. 2002). Dysfunction of this region is also involved in cognitive deficits, altered stress responsivity, hyperactivity disorder, and schizophrenia (Mostofsky et al. 2002; Tam and Roth 1997; Viggiano et al. 2003). An increase in cortical DA levels, such as observed at 5 mg/kg, could be due to an increase in DA synthesis, decreased degradation, or altered re-uptake. It is worth noting that autoreceptors on DA terminals in the prefrontal cortex regulate release but not synthesis of DA (Cooper et al. 2003), which may explain why augmented DA concentrations in this region are not corrected after ATR exposure.
Findings from the microdialysis component of these experiments are consistent with such an assertion and show alterations in the dynamics of DA in striatum after acute ATR treatment. A dose-dependent decrease in striatal DA release as observed here would normally trigger compensatory mechanisms such as decreased re-uptake rate and increased production and release of DA. As is evident from Figure 5, none of these compensatory mechanisms appears to be operative, at least within the time frame encompassed by these experiments.
The observed decline in both basal and stimulated DA release could have several explanations. First, it could reflect a generalized inhibition of DA synthesis, given the absence of group differences at the end of the experiment. DA is distributed mainly in two functional presynaptic compartments, a cytoplasmic pool and a vesicular pool. Potassium-induced release is Ca2+ dependent and occurs from the vesicular pool (Du et al. 1999), which is the newly synthesized pool (Lamensdorf et al. 1996). Another possibility is that ATR decreases the firing rate of striatal and/or SN neurons, decreasing DA release. Additionally, TH exists in two kinetic forms, with differential affinities for tetrahydrobiopterin (cofactor for TH). The proportion of TH in the high-affinity state appears to be a function of neuronal firing rate (Cooper et al. 2003). A dose of 100 mg/kg ATR decreased cerebellar cell firing rate after 60 and 90 min, with rates returning to normal by 180 min; this inhibitory effect lasted up to 180 min after exposure to 200 mg/kg ATR (Podda et al. 1997). ATR could also be acting on ionotropic GABA receptors. Binding of RO15-4513 (an inverse agonist of the GABAA receptor benzodiazepine site) was inhibited when cortical membranes were incubated with ATR (Shafer et al. 1999). This would increase the influx of chloride ions, leading to hyperpolarization of cells, preventing depolarization that would, in turn, decrease DA release.
No changes in levels of the DA metabolites DOPAC and HVA were observed in the microdialysis component of this study, although DA levels were altered. DA is converted to DOPAC intraneuronally after re-uptake, whereas extraneuronal DA is converted to HVA by the enzymes catechol-O-methyltransferase and monoamine oxidase. The lack of change in DOPAC and HVA could reflect the relatively modest nature of the changes in DA, leaving a sufficiently high concentration of DA in the intracellular space to maintain constant levels of DOPAC and HVA production. Further, DA re-uptake was not impaired. The decreases in DOPAC and reductions in extracellular DOPAC and HVA after potassium stimulation across sampling time in the microdialysis component of this study agree with results of other such studies (Holson et al. 1998; Robinson and Camp 1991; Stanford et al. 2000; Westerink and Tuinte 1986) and may reflect initial damage caused by the probe insertion, which recovers after several hours. The decrease in DOPAC levels that occurs with the increase in extracellular DA after potassium perfusion is thought to reflect a decrease in intracellular DA metabolism by monoamine oxidase (Camarero et al. 2002).
At the present time, the health-related impacts that ATR exposures may exert in human populations remain unknown. Assessments of occupational exposures have been limited, and systematic studies of environmental exposures have not been undertaken. Although the doses of ATR used in these studies are higher than those estimated for human exposures, additional considerations must be applied to such comparisons. First, data projecting human exposure are always limited because they are dependent upon when exposures occurred relative to the time of measurement and do not provide measurement of the tissue of interest (i.e., the brain) in such cases. Second, the doses used here are low for the experimental species (rat), being consistent with previously reported NOAEL and LOAEL levels. Furthermore, even at these levels, the doses may not have been as high as administered because probably not all the ATR ingested would have been absorbed; a portion of it could have been easily eliminated through the feces, suggesting that lower actually absorbed doses could underlie the deleterious effects observed in this study.
In summary, the collective findings from this study demonstrate that ATR may have broad effects on brain monoamine systems and thereby influence a wide range of behavioral functions. Clearly, additional studies are needed to unravel the targets of ATR and the mechanism(s) of its effects, as well as the ultimate human health consequences of such exposures for behavioral and/or neurologic dysfunctions.
Figure 1 Experimental designs for the chronic ATR exposure component of the study (A) and for acute ATR exposure for microdialysis studies (B). Abbreviations: MC, methylcellulose; SNpc, substantia nigra pars compacta.
Figure 2 Horizontal locomotor activity (group mean as percentage of control ± SEM). (A) Effect of a 1-mg/kg dose of amphetamine sulfate administration on locomotor activity after 2 months of ATR exposure. (B) Spontaneous locomotor activity measured at 3 months and 6 months of ATR exposure, and 2 weeks after cessation of ATR exposure. RMANOVA was followed by Fisher’s post hoc test. Absolute values (total counts ± SEM) for control animals are 8094.44 ± 1822.95 (amphetamine sulfate challenge after 2 months of ATR exposure); 3860.56 ± 703.66 (3 months of ATR exposure); 3168.60 ± 550.36 (6 months of ATR exposure), and 4257.00 ± 588.45 (2 weeks after cessation of ATR). TX, treatment.
*Significantly different from control group, p < 0.05 (n = 8–10 rats per treatment group).
Figure 3 Levels of DA (A), 5-HT (B), and NE (C; presented as the group mean as a percentage of control ± SEM) in striatum, prefrontal cortex, nucleus accumbens, and hypothalamus 2 weeks after cessation of ATR exposure (6 months). One-way ANOVAs for each region were followed by Fisher’s post hoc test. Absolute values (ng/mg protein ± SEM) for control animals are, for DA: 122.25 ± 8.54 (striatum), 2.83 ± 0.21 (prefrontal cortex), 6.09 ± 0.55 (hypothalamus), 78.70 ± 7.12 (nucleus accumbens); for 5-HT: 2.46 ± 0.27 (striatum), 15.45 ± 1.31 (prefrontal cortex), 14.44 ± 0.46 (hypothalamus), 8.22 ± 0.68 (nucleus accumbens); and for NE: 11.44 ± 0.77 (prefrontal cortex), 34.65 ± 1.67 (hypothalamus), 1.63 ± 0.14 (nucleus accumbens).
*Significantly different from control group, p < 0.05 (n = 7–10 rats per treatment group).
Figure 4 Numbers of TH+, TH−, or total cells in SNpc (top row) or in VTA (bottom row) measured using unbiased stereology and determined 2 weeks after termination of ATR treatment. Each point represents the value for an individual animal, with n = 5 randomly selected per treatment group counted. Black bars represent group medians.
Figure 5 Time course (group mean as percentage of basal release ± SEM) of striatal release of DA (A; baseline DA release shown in inset), DOPAC (B), and HVA (C) over the course of microdialysis. Microdialysates were collected every 30 min; high potassium infusion (60 mM K+) lasted 1 hr, after which normal Ringer’s solution was restored for 1 hr longer. The presence of response in the first sample after high potassium was due to the dead volume of the microdialysis sample collection system. +100-mg and *200-mg groups significantly different from control group, p < 0.05 (n = 7–8 rats per treatment group).
==== Refs
References
Adgate JL Barr DB Clayton CA Eberly LE Freeman NC Lioy PJ 2001 Measurement of children’s exposure to pesticides: analysis of urinary metabolite levels in a probability-based sample Environ Health Perspect 109 583 590 11445512
Badiani A Oates MM Day HE Watson SJ Akil H Robinson TE 1998 Amphetamine-induced behavior, dopamine release, and c-fos mRNA expression: modulation by environmental novelty J Neurosci 18 10579 10593 9852594
Barlow BK Richfield EK Cory-Slechta DA Thiruchelvam M 2004 A fetal risk factor for Parkinson’s disease Dev Neurosci 26 11 23 15509894
Betarbet R Sherer TB MacKenzie G Garcia-Osuna M Panov AV Greenamyre JT 2000 Chronic systemic pesticide exposure reproduces features of Parkinson’s disease Nat Neurosci 3 1301 1306 11100151
Birnbaum LS Fenton SE 2003 Cancer and developmental exposure to endocrine disruptors Environ Health Perspect 111 389 394 12676588
Breysse N Baunez C Spooren W Gasparini F Amalric M 2002 Chronic but not acute treatment with a metabotropic glutamate 5 receptor antagonist reverses the akinetic deficits in a rat model of parkinsonism J Neurosci 22 5669 5678 12097518
Camarero J Sanchez V O’Shea E Green AR Colado MI 2002 Studies, using in vivo microdialysis, on the effect of the dopamine uptake inhibitor GBR 12909 on 3,4-methylene-dioxymethamphetamine (‘ecstasy’)-induced dopamine release and free radical formation in the mouse striatum J Neurochem 81 961 972 12065608
Catenacci G Barbieri F Bersani M Ferioli A Cottica D Maroni M 1993 Biological monitoring of human exposure to atrazine Toxicol Lett 69 217 222 8212063
Clark L Cools R Robbins TW 2004 The neuropsychology of ventral prefrontal cortex: decision-making and reversal learning Brain Cogn 55 41 53 15134842
Clayton CA Pellizzari ED Whitmore RW Quackenboss JJ Adgate J Sefton K 2003 Distributions, associations, and partial aggregate exposure of pesticides and polynuclear aromatic hydrocarbons in the Minnesota Children’s Pesticide Exposure Study (MNCPES) J Expo Anal Environ Epidemiol 13 100 111 12679790
Colborn T Short P 1999 Pesticide use in the U.S. and policy implications: a focus on herbicides Toxicol Ind Health 15 240 275 10188206
Cooper JR Bloom FE Roth RH 2003. The Biochemical Basis of Neuropharmacology. 8th ed. New York:Oxford University Press.
Cooper RL Stoker TE Goldman JM Parrish MB Tyrey L 1996 Effect of atrazine on ovarian function in the rat Reprod Toxicol 10 257 264 8829248
Cooper RL Stoker TE McElroy WK Heien J 1998 Atrazine (ATR) disrupts hypothalamic catecholamines and pituitary function [Abstract] Toxicol Sci 42 160
Cooper RL Stoker TE Tyrey L Goldman JM McElroy WK 2000 Atrazine disrupts the hypothalamic control of pituitary-ovarian function Toxicol Sci 53 297 307 10696778
Crossman AR 2000 Functional anatomy of movement disorders J Anat 196 519 525 10923984
Das PC McElroy WK Cooper RL 2000 Differential modulation of catecholamines by chlorotriazine herbicides in pheochromocytoma (PC12) cells in vitro Toxicol Sci 56 324 331 10910990
Das PC McElroy WK Cooper RL 2003 Potential mechanisms responsible for chlorotriazine-induced alterations in catecholamines in pheochromocytoma (PC12) cells Life Sci 73 3123 3138 14550852
Deniau JM Hammond C Riszk A Feger J 1978 Electrophysiological properties of identified output neurons of the rat substantia nigra (pars compacta and pars reticulata): evidences for the existence of branched neurons Exp Brain Res 32 409 422 680048
Dreher JC Guigon E Burnod Y 2002 A model of prefrontal cortex dopaminergic modulation during the delayed alternation task J Cogn Neurosci 14 853 865 12191453
Du W Aloyo VJ Pazdelski PS Harvey JA 1999 Effects of prenatal cocaine exposure on amphetamine-induced dopamine release in the caudate nucleus of the adult rabbit Brain Res 836 194 198 10415418
Eldridge JC Wetzel LT Stevens JT Simpkins JW 1999 The mammary tumor response in triazine-treated female rats: a threshold-mediated interaction with strain and species-specific reproductive senescence Steroids 64 672 678 10503727
Epstein J Stern E Silbersweig D 1999 Mesolimbic activity associated with psychosis in schizophrenia. Symptom-specific PET studies Ann NY Acad Sci 877 562 574 10415671
Friedmann AS 2002 Atrazine inhibition of testosterone production in rat males following peripubertal exposure Reprod Toxicol 16 275 279 12128101
Fuller RW 1996 Serotonin receptors involved in regulation of pituitary-adrenocortical function in rats Behav Brain Res 73 215 219 8788505
Fuller RW Snoddy HD 1990 Serotonin receptor subtypes involved in the elevation of serum corticosterone concentration in rats by direct- and indirect-acting serotonin agonists Neuroendocrinology 52 206 211 2148812
Gammon DW Aldous CN Carr WC JrSanborn JR Pfeifer KF 2005 A risk assessment of atrazine use in California: human health and ecological aspects Pest Manag Sci 61 331 355 10.1002/ps.1000.15655806
Gerfen CR Baimbridge KG Miller JJ 1985 The neostriatal mosaic: compartmental distribution of calcium-binding protein and parvalbumin in the basal ganglia of the rat and monkey Proc Natl Acad Sci USA 82 8780 8784 3909155
Holson RR Gazzara RA Gough B 1998 Declines in stimulated striatal dopamine release over the first 32 h following microdialysis probe insertion: generalization across releasing mechanisms Brain Res 808 182 189 9767162
Institute of Laboratory Animal Resources 1996. Guide for the Care and Use of Laboratory Animals. Washington, DC:National Academy Press. Available: http://oacu.od.nih.gov/regs/guide/guidex.htm [accessed 20 April 2005].
Jorgensen H Knigge U Kjaer A Vadsholt T Warberg J 1998 Serotonergic involvement in stress-induced ACTH release Brain Res 811 10 20 9804868
Lamensdorf I Youdim MB Finberg JP 1996 Effect of long-term treatment with selective monoamine oxidase A and B inhibitors on dopamine release from rat striatum in vivo J Neurochem 67 1532 1539 8858937
Laws SC Ferrell JM Stoker TE Schmid J Cooper RL 2000 The effects of atrazine on female wistar rats: an evaluation of the protocol for assessing pubertal development and thyroid function Toxicol Sci 58 366 376 11099648
Lioy PJ Edwards RD Freeman N Gurunathan S Pellizzari ED Adgate JL 2000 House dust levels of selected insecticides and a herbicide measured by the EL and LWW samplers and comparisons to hand rinses and urine metabolites J Expo Anal Environ Epidemiol 10 327 340 10981727
MacLennan PA Delzell E Sathiakumar N Myers SL 2003 Mortality among triazine herbicide manufacturing workers J Toxicol Environ Health A 66 501 517 12712593
Mao L Conquet F Wang JQ 2001 Augmented motor activity and reduced striatal preprodynorphin mRNA induction in response to acute amphetamine administration in metabotropic glutamate receptor 1 knockout mice Neuroscience 106 303 312 11566502
Mostofsky SH Cooper KL Kates WR Denckla MB Kaufmann WE 2002 Smaller prefrontal and premotor volumes in boys with attention-deficit/hyperactivity disorder Biol Psychiatry 52 785 794 12372650
Paxinos G Watson C 1986. The Brain Stereotaxic Coordinates. 2nd ed. New York:Academic Press.
Podda MV Deriu F Solinas A Demontis MP Varoni MV Spissu A 1997 Effect of atrazine administration on spontaneous and evoked cerebellar activity in the rat Pharmacol Res 36 199 202 9367664
Reeves R Thiruchelvam M Baggs RB Cory-Slechta DA 2003 Interactions of paraquat and triadimefon: behavioral and neurochemical effects Neurotoxicology 24 839 850 14637379
Remy P Samson Y 2003 The role of dopamine in cognition: evidence from functional imaging studies Curr Opin Neurol 16 suppl S37 S41 15129849
Robinson TE Camp DM 1991 The effects of four days of continuous striatal microdialysis on indices of dopamine and serotonin neurotransmission in rats J Neurosci Methods 40 211 222 1724788
Rooney AA Matulka RA Luebke RW 2003 Developmental atrazine exposure suppresses immune function in male, but not female Sprague-Dawley rats Toxicol Sci 76 366 375 14514952
Sathiakumar N Delzell E 1997 A review of epidemiologic studies of triazine herbicides and cancer Crit Rev Toxicol 27 599 612 9408733
Sathiakumar N Delzell E Cole P 1996 Mortality among workers at two triazine herbicide manufacturing plants Am J Ind Med 29 143 151 8821357
Seroogy KB Fallon JH 1989 Forebrain projections from cholecystokininlike-immunoreactive neurons in the rat midbrain J Comp Neurol 279 415 435 2918078
Shafer TJ Ward TR Meacham CA Cooper RL 1999 Effects of the chlorotriazine herbicide, cyanazine, on GABA(A) receptors in cortical tissue from rat brain Toxicology 142 57 68 10647918
Stanford JA Giardina K Gerhardt GA 2000 In vivo micro-dialysis studies of age-related alterations in potassium-evoked overflow of dopamine in the dorsal striatum of Fischer 344 rats Int J Dev Neurosci 18 411 416 10817924
Stoker TE Guidici DL Laws SC Cooper RL 2002 The effects of atrazine metabolites on puberty and thyroid function in the male Wistar rat Toxicol Sci 67 198 206 12011479
Stoker TE Laws SC Guidici DL Cooper RL 2000 The effect of atrazine on puberty in male Wistar rats: an evaluation in the protocol for the assessment of pubertal development and thyroid function Toxicol Sci 58 50 59 11053540
Tam SY Roth RH 1997 Mesoprefrontal dopaminergic neurons: can tyrosine availability influence their functions? Biochem Pharmacol 53 441 453 9105394
Thiruchelvam M Brockel BJ Richfield EK Baggs RB Cory-Slechta DA 2000a Potentiated and preferential effects of combined paraquat and maneb on nigrostriatal dopamine systems: environmental risk factors for Parkinson’s disease? Brain Res 873 225 234 10930548
Thiruchelvam MJ Powers JM Cory-Slechta DA Richfield EK 2004 Risk factors for dopaminergic neuron loss in human alpha-synuclein transgenic mice Eur J Neurosci 19 845 854 15009131
Thiruchelvam M Richfield EK Baggs RB Tank AW Cory-Slechta DA 2000b The nigrostriatal dopaminergic system as a preferential target of repeated exposures to combined paraquat and maneb: implications for Parkinson’s disease J Neurosci 20 9207 9214 11124998
Ugazio G Bosio A Burdino E Ghigo L Nebbia C 1991 Lethality, hexobarbital narcosis and behavior in rats exposed to atrazine, bentazon or molinate Res Commun Chem Pathol Pharmacol 74 349 361 1775725
U.S. EPA 2001. Atrazine: Toxicology Chapter of the Reregistration Eligibility Decision. Revised. ed. Washington, DC:Office of Prevention, Pesticides and Toxic Substances, U.S. Environmental Protection Agency. Available: http://www.epa.gov/oppsrrd1/reregistration/atrazine/tox_chapter.pdf [accessed 11 July 2003].
van de Kar LD Lorens SA Vodraska A Allers G Green M Van Orden DE 1980 Effect of selective midbrain and diencephalic 5,7-dihydroxytryptamine lesions on serotonin content in individual preopticohypothalamic nuclei and on serum luteinizing hormone level Neuroendocrinology 31 309 315 7442933
Viggiano D Vallone D Ruocco LA Sadile AG 2003 Behavioural, pharmacological, morpho-functional molecular studies reveal a hyperfunctioning mesocortical dopamine system in an animal model of attention deficit and hyperactivity disorder Neurosci Biobehav Rev 27 683 689 14624812
Westerink BH Tuinte MH 1986 Chronic use of intracerebral dialysis for the in vivo measurement of 3,4-dihydroxyphenylethylamine and its metabolite 3,4- dihydroxyphenylacetic acid J Neurochem 46 181 185 3940279 | 15929893 | PMC1257595 | CC0 | 2021-01-04 23:41:02 | yes | Environ Health Perspect. 2005 Jun 24; 113(6):708-715 |
==== Front
BMC MicrobiolBMC Microbiology1471-2180BioMed Central London 1471-2180-6-261652448010.1186/1471-2180-6-26Research ArticleTemporal activation of anti- and pro-apoptotic factors in human gingival fibroblasts infected with the periodontal pathogen, Porphyromonas gingivalis: potential role of bacterial proteases in host signalling Urnowey Sonya [email protected] Toshihiro [email protected] Vira [email protected] Koji [email protected] Tadamichi [email protected] Sailen [email protected] Department of Biochemistry and Molecular Biology, University of South Alabama, College of Medicine, 307 University Blvd., Mobile, Alabama 36688-0002, USA2 Department of Preventive Dentistry, Kyushu Dental College, Kitakyushu 803-8580, Japan3 Division of Microbiology and Oral Infection, Nagasaki University Graduate School of Biomedical Sciences, Sakamoto 1-7-1, Nagasaki 852-8588, Japan2006 8 3 2006 6 26 26 21 11 2005 8 3 2006 Copyright © 2006 Urnowey et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Background
Porphyromonas gingivalis is the foremost oral pathogen of adult periodontitis in humans. However, the mechanisms of bacterial invasion and the resultant destruction of the gingival tissue remain largely undefined.
Results
We report host-P. gingivalis interactions in primary human gingival fibroblast (HGF) cells. Quantitative immunostaining revealed the need for a high multiplicity of infection for optimal infection. Early in infection (2–12 h), P. gingivalis activated the proinflammatory transcription factor NF-kappa B, partly via the PI3 kinase/AKT pathway. This was accompanied by the induction of cellular anti-apoptotic genes, including Bfl-1, Boo, Bcl-XL, Bcl2, Mcl-1, Bcl-w and Survivin. Late in infection (24–36 h) the anti-apoptotic genes largely shut down and the pro-apoptotic genes, including Nip3, Hrk, Bak, Bik, Bok, Bax, Bad, Bim and Moap-1, were activated. Apoptosis was characterized by nuclear DNA degradation and activation of caspases-3, -6, -7 and -9 via the intrinsic mitochondrial pathway. Use of inhibitors revealed an anti-apoptotic function of NF-kappa B and PI3 kinase in P. gingivalis-infected HGF cells. Use of a triple protease mutant P. gingivalis lacking three major gingipains (rgpA rgpB kgp) suggested a role of some or all these proteases in myriad aspects of bacteria-gingival interaction.
Conclusion
The pathology of the gingival fibroblast in P. gingivalis infection is affected by a temporal shift from cellular survival response to apoptosis, regulated by a number of anti- and pro-apoptotic molecules. The gingipain group of proteases affects bacteria-host interactions and may directly promote apoptosis by intracellular proteolytic activation of caspase-3.
==== Body
Background
Porphyromonas gingivalis, a gram-negative anaerobe, is a major colonizer of gingival tissues, causing severe forms of adult periodontitis, in which the gingival fibroblast suffers extensive damage [1]. As replication inside mammalian cells is a common strategy adopted by many pathogenic bacteria, P. gingivalis infection has served as an important study model. A flurry of recent research has unraveled various pathways of interaction between oral cells and P. gingivalis [2]. Infection of various cell types by P. gingivalis activated cytokines and chemokines of potential importance in pathology, such as TNF-α, IL-1β, IL-6 and IL-8, the exact roles of which in adult periodontitis remain to be determined [3-7].
P. gingivalis encodes a number of proteases, collectively known as 'gingipains', which have received considerable attention due to their multiplicity and potent activity [8,9]. The major members of this family include two Arg gingipains (RgpA and RgpB), and a Lys gingipain (Kgp) that are trypsin-like cysteine proteinases, specific for -Arg-Xaa- and -Lys-Xaa- peptide bonds, respectively. The gingipains were shown to regulate P. gingivalis adhesion and invasion positively as well as negatively depending on the cell type [10-12]. In a murine model of periodontitis, all contributed to virulence [13]. Recently, we and others have characterized a new protease of P. gingivalis, named endopeptidase O (PepO), and provided evidence for its importance in invasion and growth in human gum epithelial (HGE) and human lung epithelial (HEp-2) cells in culture [14,15].
A number of intracellular pathogens, including bacteria, viruses and parasites, either cause or suppress apoptosis of the infected mammalian cell by regulating a battery of pro- and anti-apoptotic genes [16-18]. Interestingly, various P. gingivalis protease preparations have been demonstrated to promote apoptosis when exogenously added to cells in culture [19-25]. The exact mechanism of this 'extrinsic' apoptosis is unknown but is believed to be triggered by the degradation of cell adhesion molecules such as neural cadherins and integrins by the proteases [25-28], which also causes detachment of the target cell from the tissue. It has been postulated that in periodontitis, apoptotic signals may overwhelm the normal anti-apoptotic forces that maintain periodontal vessels [29]. In contrast, P. gingivalis infection of human gingival epithelial (HGE) cells led to an anti-apoptotic response that paralleled the induction of mitochondrial anti-apoptotic Bcl-2 protein [30]. In a recent study externalization of membrane phosphotidylserine (PS) was noted immediately after P. gingivalis infection of HGE cells, suggesting an apoptosis-like response [31]. However, this was reversible, as the PS was internalized after 1 day of infection, and activation of the protein kinase AKT resulted in an anti-apoptotic response. Clearly, it is important to determine whether different gingival cell types respond differently to P. gingivalis and whether the gingipains play multiple regulatory roles in growth and pathogenesis.
Although the fibroblast layer constitutes bulk of the gingival tissue, the molecular details of its interaction with P. gingivalis remain poorly understood. We decided to use primary human gingival fibroblast (HGF) cells in our studies for their obvious physiological relevance. In this communication, we analyze the status of programmed cell death or apoptosis in P. gingivalis-infected primary HGF cells and show that apoptosis is regulated in a stage-specific manner through the activation of an array of intracellular anti- and pro-apoptotic signalling molecules.
Results
Optimal infection of HGF cells by P. gingivalis requires a high m.o.i
Previous studies in which mammalian cells were infected with P. gingivalis in tissue culture typically used high multiplicities of infection (m.o.i.) – about 100–200 bacteria per human cell. It was not clear why such large number of bacteria were apparently needed for infection. A few studies that addressed the quantitative aspects of infection paid attention to the percentage of infecting bacterial cells but not to the percentage of infected mammalian cells. For example, in one study tests of m.o.i. 10, 100, 1000 and 10000 showed that the highest percentage of bacteria invaded HGE cells at 100 m.o.i. [32]. In another study using KB oral epidermoid carcinoma epithelial cells (likely to be HeLa cells), only about 2% bacteria attached to the cell monolayer at 50 m.o.i. of added P. gingivalis [11]. Single mutants lacking either protease RgpA or RgpB showed similar efficiency; however, when the rgpA rgpB double mutant was tested, about 60% bacteria attached to the epithelial cells. To explain this unexpected result, it was postulated that the Arg-gingipains may play a negative role in cell attachment by digesting the cellular receptors [11]. In all these experiments the percentage of infected KB cells remained undetermined. Role of KgP was also not tested. As attachment and invasion are the obligatory first steps in infection, we considered it important to determine the optimal efficiency of infection of HGF cells before proceeding to study the subsequent events.
To achieve this, we first quantified the efficiency of invasion. Washed wild type and triple gingipain mutant (rgpA rgpB kgp) P. gingivalis [33] were added to HGF monolayers and the infected HGF cells were counted by fluorescence staining with P. gingivalis antibody. A representative set of results (Fig. 1) show that there was a modest increase in the percentage of HGF cells infected with increasing m.o.i. Invasion reached a plateau at about 200 m.o.i., when roughly half of the cells were infected (Fig. 2). The triple protease mutant P. gingivalis fared worse, infecting only about a third of all cells at the same m.o.i. Although it is possible that some cells were infected at levels below the threshold of visible fluorescence, and therefore, were scored as uninfected, we can conclude that infection of HGF by P. gingivalis is a relatively inefficient process and that the Arg- and Lys-gingipains are not absolutely essential for invasion but improve the efficiency. Based on these findings (Fig. 2) and to achieve equal invasion we used an m.o.i. of 200 for the triple mutant and 80 for the wild type P. gingivalis in all subsequent experiments.
Next, to determine the optimal time of release of progeny P. gingivalis from the infected cells, we assayed for bacterial colony forming units (cfu) in the HGF growth media at different times post-infection. This was done by plating serial dilutions of the media on agar plates as described in Materials and Methods. Maximal release of progeny bacteria occurred at 72 h post-infection coinciding with significant lysis of the monolayer (data not shown). Thus, we carried out all of our signalling experiments at earlier time points, usually not exceeding 48 h post-infection.
P. gingivalis causes late apoptosis in infected HGF cells
At various times post-infection P. gingivalis-infected HGF cell monolayers were fixed and multiparametric staining including TUNEL staining for apoptosis was performed. Representative data (Fig. 3) show little apoptosis at early time point but significant apoptosis from 24 h onwards. Apoptosis was confirmed by propidium iodide-Annexin V staining (data not shown). The triple gingipain-mutant P. gingivalis also caused apoptosis but appeared to be slower and less effective.
As TUNEL is largely qualitative, we extended these studies with more detailed analyses (Fig. 4). A quantitative estimate of apoptotic nucleosome release was conducted, which supported the TUNEL kinetics and revealed that apoptosis by P. gingivalis is indeed a relatively late process in infection and that the mutant is less proficient in this regard (Fig. 4A). The DNA fragmentation paralleled activation of caspase-3, a major executioner caspase, using a synthetic fluorogenic substrate (Fig. 4B). We then investigated the activation of seven strategic caspases, including caspase-3, by immunoblot detection of their cleaved, active fragments, and the results (Fig. 4C) showed activation of caspase-6, caspase-7 and caspase-9 in addition to caspase-3, but not caspase-8, -10, or -12. Activation of caspases was found to occur late in infection, starting at around 24 h, coincident to apoptotic DNA damage. These results strongly suggested a role of specific caspases in P. gingivalis-induced apoptosis of HGF cells.
For a direct measure of the intracellular caspase activity, we attempted to detect the breakdown products of αII-spectrin (also known as non-erythroid α-spectrin or α-fodrin). In apoptotic cells, the 240 kDa αII-spectrin undergoes a series of caspase-mediated cleavage to generate a major 120 kDa fragment, although a 150 kDa intermediate is sometimes detected as well [34]. Immunoblot analysis of P. gingivalis-infected HGF cell lysate (Fig. 4D) revealed the 120 kDa product, but only at late stages of infection, between 36 h and 48 h. The wild type P. gingivalis and the triple protease mutant produced essentially identical breakdown products that appeared much later in mutant-infected cells (48 h instead of 36 h). These results supported a caspase-induced breakdown of αII-spectrin and also matched the late-stage apoptosis and the slower kinetics of apoptosis by the mutant.
P. gingivalis protease(s) directly cleave and activate procaspase-3 in vitro
Although the full impact of gingipains in host-bacterial interaction is still under investigation, their role in invasion is well-documented. As mentioned, exogenously added gingipains trigger extrinsic cell death, at least one mechanism of which involves the cleavage of external cell adhesion molecules such as cadherins and integrins [23,25]. Whether they have a role in the intrinsic pathways of apoptosis remains unknown. Although activated caspases are hallmark effectors of apoptosis, recent evidence suggests that non-caspase proteases such as cathepsins, calpains, granzymes, and the proteasome complex may have a direct caspase-like role in mediating apoptosis, but perhaps only in specific cell types or under specific signals [35,36]. Because P. gingivalis is a known producer of highly active proteases in the infected cells, it was worth testing whether these proteases might directly process and thereby activate an executioner caspase. To this end, we incubated purified recombinant procaspase-3 with P. gingivalis culture supernatant, and tested for cleavage. Results (Fig. 5A) show that the 34 kDa procaspase-3 was indeed cleaved to characteristic 17 kDa and 12 kDa fragments. The product sizes roughly matched with those produced by caspase-8-mediated cleavage of procaspase-3. Enzymatic activity of caspase-3 was confirmed by using the specific substrate peptide, DEVD (Fig. 5B). Similar amounts of culture supernatant made from the triple gingipain mutant exhibited little processing activity. Finally, the processing activity was destroyed by heat, in agreement with its protease nature. These results raise the interesting possibility that the Arg- and Lys-gingipains have the potential to directly contribute to apoptosis by activating intracellular caspase-3.
P. gingivalis infection of HGF cells leads to early activation of NF-kappa B
The proinflammatory transcription factor NF-kappa B (NF-κB) is generally responsible for suppression of apoptosis, although there are exceptions where it promotes apoptosis or has no apparent role in apoptosis [37]. In a number of obligatory parasites, infected cells are protected from apoptotic signals, mainly as a result of activation of NF-κB. In light of the apparent lag in apoptosis in the early stages of P. gingivalis infection it was important to determine whether NF-κB is activated in these cells. For a preliminary test, we first used an engineered HEK293 (hamster embryonic kidney fibroblasts) cell line that contained a chromosomal reporter luciferase gene under the control of NF-κB enhancers. Because of the convenience of luciferase assay, these cells are commonly used for rapid initial screening of NF-κB activating agents before detailed studies are done in more relevant cells. For example, we have shown previously that infection of these cells with respiratory syncytial virus leads to activation of NF-κB and hence, luciferase activity [38]. Conversely, inhibitors of NF-κB reduced the luciferase activity back to basal levels. As shown (Fig. 6A), a surge of luciferase activity was also detected at around 15 h following P. gingivalis infection of HEK293 cells. The levels gradually subsided from 24 h onward, suggesting loss of NF-κB activity. The gingipain-deficient strain also activated NF-κB albeit substantially weakly. SN50, a cell-permeable peptide inhibitor of NF-κB [39], strongly reduced luciferase activity, demonstrating specificity.
Having obtained positive results in luciferase assay, we proceeded to the physiologically relevant HGF cells and investigated NF-κB activation by direct measurement of the nuclear levels of the p65 subunit of NF-κB. In unstimulated cells, p65 is held back in the cytoplasm in complex with the inhibitors of κB, such as IκBα. Various signals including infection by many pathogens lead to the phosphorylation of IκBα via IκB kinase (IKK), followed by degradation of phospho-IκBα, allowing the nuclear import of p65 via its nuclear localization signal, where it activates transcription of NF-κB-dependent genes [40]. Thus, the appearance of NF-κB in the cell nucleus is indicative of its activation. It is seen (Fig. 6B) that P. gingivalis infection of HGF cells led to nuclear translocation of p65 early in infection that started to decline around 24 h. Phosphorylation of IκB was also detectable as early as 3 h p.i. (Fig. 6C), suggesting a correlation. A common upstream pathway leading to activation of NF-κB in many cells involves phosphoinositol-3 kinase, PI3K, and curiously, an inhibitor of PI3K (LY294002) inhibited IκB phosphorylation in these cells (Fig. 6C). This led us to study the potential role of PI3K in P. gingivalis-mediated activation of the NF-κB signalling, described next.
P. gingivalis infection activates the PI3K-AKT pathway
In mammalian cells, the PI3K/AKT pathway generally acts in a pro-survival, anti-apoptotic role [31,41]. A multitude of external stimuli activate intracellular PI3K that catalyzes the conversion of phosphatidylinositol 4,5-bisphosphate into the 3,4,5-triphosphate. The latter activates protein kinase PDK, which then phosphorylates AKT (also known as protein kinase B or PKB), thereby activating AKT. The activated AKT phosphorylates a large number of substrates such as Forkhead transcription factor (FKHR), IKK, Bad, caspase-9, and GSK-3. Together, these events inactivate the pro-apoptotic players such as Bad, and activate anti-apoptotic players such as NF-κB, leading to a net suppression of apoptosis.
We, therefore, determined the phosphorylation status of these signalling molecules in HGF cells during P. gingivalis growth using phosphospecific antibodies, and the results are presented in Fig. 7. It can be seen that all the major players of the pathway, namely PDK, AKT, Forkhead and GSK-3 were phosphorylated at comparable kinetics, early in infection. Total AKT protein levels did not change, confirming that the effect was truly on the phosphorylation status and not on protein synthesis. These anti-apoptotic phosphorylations occurred relatively early (≤ 6 h) and appeared to reach maximal levels by 6 h. In fact, at later times (between 12 and 24 h) phosphorylations reverted back to near pre-induction levels. The gingipain-deficient mutant also activated the same pathways with a similar kinetics. In all cases, the PI3K inhibitor, LY294002, abolished the phosphorylation, demonstrating that PI3K is indeed the most upstream kinase in this P. gingivalis-activated pathway. The same inhibitor also strongly inhibited the activation of NF-κB by P. gingivalis (Fig. 6A, striped bar), further supporting a role of PI3K in survival. Together, these results strongly support our premise that the early cellular response in P. gingivalis-infected HGF is anti-apoptotic whereas the late response is pro-apoptotic.
Temporal transcriptional induction of anti- and pro-apoptotic family genes by P. gingivalis
Studies over the last two decades have enlisted a large family of cellular genes that take part in either preventing or promoting apoptosis [42]. As the decision between cellular life and death is a net resultant of these two opposing forces, we decided to obtain a comprehensive view of expression of both families in P. gingivalis-infected HGF cells. The steady-state mRNA levels of major members of the two families were determined by reverse transcription and quantitative real-time PCR, and the results are presented in Fig. 8 as fold-induction over uninfected levels. The top two rows represent anti-apoptotic genes, and the rest are pro-apoptotic. The general trend that emerged from these results is that the two families were induced differently. The anti-apoptotic genes were induced early in infection, generally reaching their maximal levels by 12 h and then diminishing to variable extents over the rest of the infection period. The induction of a number of anti-apoptotic genes was sharply inhibited by the PI3K inhibitor, LY294002, as well as by the NF-κB inhibitor, SN50, further correlating the anti-apoptotic gene profile with the survival pathway. A representative example is Bfl1, the most robustly activated anti-apoptotic gene (Fig. 8, first box); both inhibitors caused 60–70% reduction of its induction. Similar inhibitory effect was also seen for three other genes tested, namely, Boo, Bcl-2, Survivin (data not shown).
In sharp contrast, the vast majority of the pro-apoptotic genes reached their maximum expression in later periods of infection, peaking between 24 and 36 h. Most were expressed poorly or not at all until about 12 h p.i. As in other pathways, the gingipain-deficient mutant activated these genes with similar overall kinetics. For the majority of the genes the mutant was weaker than the wild type although there were a few exceptions, such as the expression of Bcl-w, Bik, Bax, MOAP-1 was comparable in wild type and mutant-infected cells, and the induction of Bfl-1 and Bcl-XL expression was somewhat stronger in mutant-infected cells (Fig. 8). We carried out immunoblot (Western) analysis of selected representative proteins, namely Bcl-XL, Survivin, Bax and Bad, and the results essentially paralleled those of the transcript levels (data not shown). In conclusion, the general trend was that the expression of anti-apoptotic and pro-apoptotic genes was turned on early and late in infection, respectively, in a mutually exclusive chronological order.
Discussion
One major finding in our study is the inefficient invasion by P. gingivalis, at least in cell culture, explaining the high m.o.i. traditionally used by all investigators. Although the exact mechanism needs further research, bacterial fimbriae, which are proteinaceous appendages extending from the bacterial cell surface, are known to play specific and important roles in bacterial adhesion and invasion, likely through an interaction with integrin and fibronectin of the host cell [43-45]. It is possible that these interactions are relatively inefficient and slow. Our results support the previous demonstration that Arg-gingipains enhance fimbriae-fibronectin binding, leading to the suggestion that the functional epitopes of cellular receptors of P. gingivalis are cryptic and that the Arg-gingipains expose them [46]. This is also consistent with our finding that the protease-deficient mutant P. gingivalis is a generally poor invader (Fig. 2).
The second major finding here is that infection of primary gingival fibroblast cells by P. gingivalis, an important gum pathogen, leads to apoptosis, which may in part underlie the extensive tissue damage seen in gingivitis. Interestingly, early in infection, cellular anti-apoptotic genes are induced and postpone apoptosis; at later times, they give way to pro-apoptotic genes, and apoptosis ensues. As apoptosis is an exceedingly complex process involving a large variety of signalling molecules, we have focused our attention to selective major players.
The anti-apoptotic early phase in P. gingivalis-infected HGF cells is characterized by the activation of PI3K/AKT pathway. Our results (Fig. 7) strongly suggest that this pathway is largely responsible for the activation of pro-survival transcription factor NF-κB. The anti-apoptotic function(s) most likely facilitates P. gingivalis growth by thwarting premature dismantling of the host cell. The response of HGF and HGE cells to P. gingivalis infection, therefore, has interesting similarities and differences. Like HGF cells, infection of HGE cells resulted in suppression of apoptosis, which required phosphorylation-mediated activation of AKT and was inhibited by LY294002 [31]. However, HGF cells eventually became apoptotic whereas HGE cells appeared to remain anti-apoptotic. Thus, the fibroblasts and epithelial cells of the same tissue may differently regulate the apoptotic modulators, the mechanism of which must await further study.
Caspases are a class of cysteine proteases that includes several representatives involved in apoptosis [42]. They are activated via a proteolytic cascade, cleaving and activating other caspases, eventually degrading downstream targets and promoting cell death (Fig. 9). The main "initiator" caspases at the upper end of the cascade are caspase-8 and caspase-9. Caspase-8 is activated in response to death receptors (such as Fas) whereas caspase-9 is activated by the release of cytochrome c via the intrinsic mitochondrial stress pathway. Activation of caspase-9 but not caspase-8 in P. gingivalis-infected HGF cells (Fig. 4) strongly points to the activation of the mitochondrial pathway. Clearly, caspase-9 then activates the downstream "executioner" caspases, namely caspase-3, -6 and -7. Spectrin fragments serve to distinguish between caspase-3 and calpain; while caspase-3 cleavage generates the 120 kDa fragment calpain produces 150 and 145 kDa fragments [34,47]. Our results, therefore, confirms caspase-3 activation (Fig. 4) and rules out a role of calpain in P. gingivalis-mediated apoptosis. A novel apoptotic pathway has been discovered recently, in which an endoplasmic reticulum (ER) resident caspase, namely caspase-12, is activated by ER stress that may be triggered by heavy traffic of glycoproteins through the ER. For example, we have shown that infection by respiratory syncytial virus, a cytoplasmic RNA virus expressing three glycoproteins that traffic through the ER, causes late apoptosis in lung epithelial cells by activating ER-stress and caspase-12 [16]. Together, results presented here suggest that P. gingivalis activates apoptosis through the mitochondrial pathway and not the ER or Fas pathway.
Based on these findings, we present a working hypothesis of P. gingivalis-activated apoptosis in HGF cells in Fig. 9. We emphasize that it is not a comprehensive list and that we have provided experimental evidence only for the key players in each major branch. In the anti-apoptotic early phase, we have demonstrated activation of PDK, AKT / PKB, the AKT substrates (GSK-3 and FKHR) and the IKK substrate (IκB-α) (Fig. 7). The involvement of PI3K and NF-κB was also uncovered by the use of specific inhibitors. Transcriptional activation of a battery of anti-apoptotic genes is also indicated (Figs. 8, 9), which was abrogated by inhibitors of either PI3K or NF-κB. The pro-survival role of the PI3K/NF-κB pathway is explained by the recent demonstrations that transcription of these anti-apoptotic genes is NF-κB-dependent [48].
In the pro-apoptotic late phase of infection, we surmise a major role for the mitochondria. One of the best characterized mechanisms used by mitochondria to induce cell death is the release of pro-apoptotic proteins into the cytosol [49]. Cytochrome c, the first molecule shown to be released, complexes with apoptosis protease-activating factor 1 (Apaf-1) and exposes domains of Apaf-1 that activate caspase-9. A proteolytic cascade ensues that eventually activates caspases-3, -7 and -6 (Fig. 9), and our results show activation of all these caspases (Fig. 4). Nucleosomal DNA degradation (Figs. 3, 4) suggested the activation of DNA-fragmentation factor (DFF), although the involvement of AIF and endonuclease G, released from stressed mitochondria (Fig. 9) cannot be ruled out. Most importantly, the kinetics of activation of these proteins was in accord with the shift from an anti- to a pro-apoptotic response.
Further evidence for the shift came from transcriptional data of anti- and pro-apoptotic genes. The mitochondrial Bcl-2 family [49] comprises of both kinds, such as the anti-apoptotic members Bcl-2, Bcl-XL, Bcl-w, Mcl-1 and the pro-apoptotic members Bax, Bak, Bok, Bid, Bad, Puma, Bmf, Bim, Bok, Noxa and Hrk/DP5. Some of the most highly activated genes in Fig. 8 indeed belong to these two families and their functions match with the temporal shift from survival to death. However, the relative contribution of each of these proteins in regulating apoptosis is currently unknown.
The direct processing of procaspase-3 by P. gingivalis protease(s) (Fig. 5) adds a novel dimension to 'intrinsic' apoptosis by bacteria. Interestingly, structural analysis of the catalytic subunit of Rgp revealed a caspase-like fold, suggesting a common ancestor [50]. Moreover, homology mapping suggested that a single protease clan, named CD [51] or the caspase-hemoglobinase fold [52], encompasses gingipains and caspases as well as bacterial clostripain and legumains (processing proteases) [53,54]. As the processing by gingipains generated enzymatically active caspase-3 (Fig. 5), it is reasonable to conjecture that the cleavage occurred at or close to the natural processing site. The processing defect of the rgpA rgpB kgp mutant suggests that the cleaved peptide bond would be next to either an Arg or a Lys. The natural processing in procasapse-3 is known to occur next to the Asp175, shown here in bold within the substrate motif IETD: CR164GTELDCGIETD175SGVDDDMACHK186. We noticed Arg164 and Lys186 nearby (as underlined in the sequence), 11 residues upstream and downstream of the Asp175, respectively. We speculate that one or more of the gingipains cleave the procasapse-3 at either or both of these sites to produce the activated caspase-3. This is currently being tested. The physiological significance of this activation also needs to be resolved. It is possible that the anti-apoptotic functions antagonize this activation and prevents it from happening too early in infection. Moreover, note that the mutant strain is not completely defective in activating apoptosis and caspase-3 in HGF cells (Fig. 4). Thus, the three gingipains, although not absolutely essential, seem to be needed for optimal apoptotic response.
We note here that the gingipains may be partially sequestered by serum proteins; human [55] and bovine (our unpublished results) serum albumin, for example, are excellent substrates for gingipains. It is also possible that serum will contain unidentified inhibitors of gingipains [55]. On the other hand, the presence of serum likely approximates the physiological infection of the gum and provides an optimal nutrient level for intracellular replication of the bacteria. For the best compromise, therefore, we allowed the bacteria to invade initially for 90 min in the absence of serum, and then replaced it with serum-supplemented medium for further growth (Materials and Methods).
It is tempting to speculate that the delayed apoptosis of the host cell most likely allows P. gingivalis extra time to replicate intracellularly to a higher yield and at the same time offers early protection to the infected cells against cytotoxic mediators of the host immune system. An extended period of nuclear DNA integrity may also allow the cell to transcriptionally activate genes that modulate immune or inflammatory response. Apoptosis then occurs at the late stage of infection when the replicated bacteria must destroy the host cell anyway in order to egress and infect neighboring cells for fresh nutrients and continued growth. Clearly, a detailed knowledge of how P. gingivalis regulates the balance between multiple apoptotic signalling molecules in chronological order will shed important light on the mechanism of tissue damage in gingivitis and may provide a pharmacological regimen to control the infection.
Conclusion
P. gingivalis infection of human gingival epithelial cells initially triggers a survival response through the activation of PI3K/AKT pathway, resulting in the activation of NF-κB and a family of anti-apoptotic proteins. This likely allows optimal growth of the bacteria. At later stages of infection the anti-apoptotic proteins subside and pro-apoptotic ones are turned on, leading to apoptosis of the infected cell. Bacterial proteases of the gingipain family play important roles in various aspects of infection, including proteolytic activation of caspases by processing, which may directly contribute to the observed apoptosis. Thus, P. gingivalis and the host gingival cell interact via a variety of pathways that are relevant in the pathology and degradation of the gingiva.
Materials and methods
Materials
Antibodies against the following antigens were obtained from commercial sources: p65, Sp1 (Santa Cruz Biotechnology); phospho-AKT, caspases-3, -6, -7, -8, -9 (Cell Signaling Technology); caspase-10 (Oncogene); caspase-12 (Sigma); IκB-α (Biomol); nonerythroid alpha-spectrin (Chemicon International); Bcl-XL, Survivin, Bax and Bad (Sigma-Aldrich). Other phosphospecific antibodies were from New England Biolabs. The phosphatase inhibitor cocktail set II (final concentration of 1 M imidazole, 0.1 M sodium fluoride, 0.115 M sodium molybdate, 0.2 M sodium orthovanadate, and 0.4 M sodium tartrate) and the inhibitors LY294002, SN50 and staurosporine were from Calbiochem (San Diego, CA). "Complete protein inhibitor cocktail" was from Roche, one mini tablet of which was added per 10 ml of buffer (final concentration) as prescribed by the manufacturer.
Bacteria and culture conditions
Wild-type P. gingivalis (ATCC 33277) and the isogenic mutant strain (rgpA rgpB kgp) [33] were grown anaerobically (85% N2, 10% H2, and 5% CO2) at 37°C in brain-heart infusion broth supplemented with yeast extract (0.5%), hemin (5 μg/ml), and menadione (0.5 μg/ml), essentially as described [56]. Bacteria were grown to mid-log phase (A600 in the range of 0.6–0.8), harvested by centrifugation, washed with phosphate-buffered saline (PBS) and resuspended in DMEM supplemented with 2 mM L-glutamine. For each experiment the final concentration of the suspension was determined by measurement of A600 and appropriate dilutions were made to achieve the desired m.o.i. The bacterial number was confirmed retroactively by viable counting of colony forming units (cfu) on agar plates supplemented with hemin and menadione [32,56].
Culture of HGF cells
Primary cultures of HGF cells were made from biopsies of healthy human gingival obtained from dental clinics. The tissues were washed several times in PBS and DMEM, then cut into small pieces and placed in a T-25 cm2 flask with complete medium containing DMEM supplemented with 10% FBS, 2 mM L-glutamine, 2.5 μg/ml fungizone, and 5000 U/ml penicillin/ streptomycin. When ready for passage, the fibroblast cells were cultured as monolayers in the same complete media without fungizone at 37°C in a standard 5% CO2 incubator.
Infection of HGF cells with P. gingivalis
HGF cells were used at 80 to 90% confluency for all experiments. Before infecting with P. gingivalis, the monolayers were washed three times with PBS. P. gingivalis, resuspended in DMEM without FBS or antibiotics, was added to the HGF monolayer at the desired m.o.i. and incubated for 90 min at 37°C in 5% CO2. The monolayer was then washed twice with PBS to remove unbound bacteria, DMEM supplemented 10% FBS and 2 mM L-glutamine was added, and growth continued at 37°C in 5% CO2.
Assessment of bacterial invasion was done by an antibiotic protection assay essentially as described previously with minor changes [11,14,32]. HGF cells were first infected with washed P. gingivalis and external, nonadherent bacteria were removed as described above. The cultures were then incubated for an additional 2 h at 37°C in fresh medium containing 300 μg gentamicin and 200 μg of metronidazole per ml to kill the remaining extracellular bacteria [32]. We confirmed that the antibiotics did not affect the morphology of the HGF cells or alter their ability to exclude trypan blue. Following invasion, the HGF cells were fixed and stained as described below.
Immunofluorescence studies and assays of cell death and NF-κB
For multiparametric staining, HGF cells were grown on coverslips in 6-well plates to 80–90% confluency. The cells were then infected with washed P. gingivalis as above. Coverslips were washed three times with PBS and fixed in 10% trichloroacetic acid for 20 min on ice. Successive washes were then performed with 70%, 90% and 100% ethanol, and finally with PBS containing 0.2% Triton X-100. The coverslips were incubated with a rabbit antibody against P. gingivalis Fim A and then with secondary mouse antibody (TRITC-conjugated). Finally, the coverslips are mounted on a slide with DAPI-DABCO solution and observed by fluorescence microscopy in an Olympus BMAX Epifluorescence microscope [16]
For routine detection of apoptosis, we used the DeadEnd Fluorometric TUNEL System (Promega) that measures apoptosis by the integrating fluorescein-12-dUTP at 3'-OH DNA ends of fragmented DNA of apoptotic cells. The fluorescein-12-dUTP-labeled DNA was visualized directly by fluorescence microscopy. Cells are grown to confluency on coverslips in 6-well plates and stained as per the manufacturer's instructions. Annexin V, conjugated with fluorescein isothiocyanate (FITC) (Sigma), was used to label phosphatidylserine on the apoptotic membrane surface, and propidium iodide (PI) to stain the nuclei (if necrotic).
Quantitative assay of apoptosis was performed with a new procedure termed "Cell Death Detection ELISA" (Roche) which involves photometric enzymatic immunoassay of mono- and oligo-nucleosomes in the cytoplasmic fraction of apoptotic cell lysates.
Luciferase reporter assay for NF-B was performed as described [38]. Briefly, cells in monolayer were transfected with pNFκB-Luc using Lipofectin® (Gibco Life Technologies), and infected with washed P. gingivalis cells 24 hr later. When used, inhibitors were added at the same time as the bacteria. The cells were lysed at indicated times thereafter and cleared extracts subjected to luciferase assay in a Turners Design luminometer [38].
Data acquisition and analysis
In invasion assay as well as in apoptosis detection, the fluorescent HGF cells were visually counted using a subjective baseline that corresponded to uninfected controls. Changes were analyzed by one-way ANOVA and then by Student's t-test with Bonferroni correction. All numerical data were collected from at least three separate experiments. Results were expressed as mean ± SEM (error bars in graphs). Differences were considered to be significant at P < 0.05.
Quantitative real-time PCR
HGF cells were grown in T-25 flasks and infected with wild-type and mutant P. gingivalis as described. At different time points, mRNA from infected cells was purified using a Trizol method (Ambion). First-strand cDNA was made using the GeneAmp RNA PCR Core kit (Perkin Elmer-Applied Biosystems). Primers were designed by the Beacon Designer software v 2.13 from Premier Biosoft essentially as described previously [57], and are listed in Table 1. Real Time PCR was performed on the iCycler iQ Quantitative PCR system from BioRad Laboratories (Hercules, CA) using the iQ Sybr Green SuperMix. Gene expression measurements were calculated using the manufacturer's software; GAPDH was used as an internal control.
Immunoblot (Western) analysis
The infected monolayer and any control samples were washed twice in PBS containing the protease inhibitor cocktail described under Materials. When phosphoproteins were to be detected, all buffers additionally contained the phosphatase inhibitor cocktail. The cells were scraped off in PBS containing the inhibitors and centrifuged at 5,000 × g for 10 min to remove cell debris. The pellets were boiled in standard SDS sample buffer, and proteins separated by 12% SDS-PAGE and transferred to nitrocellulose [58]. Blots were probed with the appropriate antibody followed by corresponding secondary antibody coupled to horseradish peroxidase, and developed using the ECL kit (Pierce). The chemiluminescence was detected in LAS-1000 plus imaging system (Fuji Film).
For NF-κB, the infected monolayer in 6-well plates was washed twice with PBS containing the protease inhibitor cocktail. Fifty microliters lysis buffer (50 mM Tris-HCl [pH 8.0], 50 mM NaCl, 0.1 mM EDTA, 0.1% Tween 20, 1x protease inhibitor cocktail) was then added to the cells in each well. The cells were scraped in the buffer and centrifuged at 15,000 × g for 15 min at 4°C. The resulting supernatant was used as the cytosolic extract; the pellet was washed twice with the same buffer (5,000 × g for 10 min at 4°C) and used as the nuclear fraction.
Caspase cleavage and assay
Overnight grown P. gingivalis cells were collected by centrifugation at 10,000 × g and washed three times with PBS. Pellets were resuspended in DMEM (without serum or antibiotic) and incubated for 4 h anaerobically (85% N2, 10% H2, and 5% CO2) at 37°C. Supernatant was collected by centrifugation (14,000 × g) and protein concentration determined by Bradford assay (Bio-Rad).
To test for the cleavage activity, pre-determined amounts of the supernatant were incubated with 5 μg of purified procasapase-3 (Biomol) at 37°C in a 50 μl reaction in the following buffer: 50 mM Hepes (pH 7.5), 50 mM NaCl, 20% glycerol, 0.1% CHAPS, 1 mM DTT. The supernatant was substituted with purified caspase-8 (Biomol) in a positive control reaction and with same volume of buffer in a negative control. Portions of the reaction were analyzed by SDS-PAGE and immunoblot [57]. The rest of the reaction was assayed for caspase-3 activity using the colorimetric substrate, DEVD-pNA, which upon cleavage exhibits increased absorption at 405 nm (Calbiochem). Reactions were incubated at 30°C and followed with time in a spectrophotometer to ensure linearity.
Authors' contributions
SU did the major experiments; TA performed initial assays of invasion in the SB laboratory; VB carried out additional invasion studies and caspase assays; KN constructed the mutant strains; TT offered expertise and guidance to TA; SB conceived and guided the project, and wrote the paper with help from SU. All authors read and approved the final manuscript.
Acknowledgements
Research in the SB lab was supported in part by grants AI045803 and EY013826 from National Institute of Health (NIH), USA, and was conducted in a facility constructed with support of a Research Facilities Improvement Program Grant (C06 RR11174) from the National Center for Research Resources, NIH.
Figures and Tables
Figure 1 Infection of HGF cells by P. gingivalis. Wild type (WT) or triple gingipain mutant (MT) P. gingivalis was added to monolayers of HGF cells at the indicated bacteria-to-cell ratios (m.o.i). Only a few representative multiplicities are shown. Invasion was determined after killing of the external bacteria with antibiotics and staining the cells with DAPI (Blue) and P. gingivalis Fim A antibody (Pg; Red) as described under Experimental Procedures. Visually detectable red cells in the 'Pg' fields were counted in three independent observations and expressed as percentage of all the blue cells in the 'DAPI' fields.
Figure 2 Multiplicity-dependent increase of HGF invasion by P. gingivalis. Invasion results obtained by staining (from Fig. 1) are plotted here. Error bars from three experiments are shown.
Figure 3 Apoptosis in HGF cells by P. gingivalis infection. Infection of HGF monolayers and staining for all nuclei (DAPI, Blue) or only the apoptotic ones (TUNEL, Green) were carried out as described under Experimental Procedures. Cells were infected by wild type (WT) or the triple gingipain mutant (MT), and stained at the indicated time of infection (5 h, 24 h, 48 h). For positive control of apoptosis, uninfected HGF cells were treated with staurosporine for 5 h.
Figure 4 Kinetics of apoptosis and caspase activation following P. gingivalis infection. HGF monolayers were infected with wild type (WT) or triple gingipain mutant P. gingivalis and harvested at indicated times for the following assays as described under Experimental Procedures. (A) DNA fragmentation assay using the "Cell Death Detection ELISA" (Roche); (B) Caspase-3 activity assay in cell lysates; (C) Immunoblot detection of activated (cleaved) caspases in HGF cells infected with WT, with Sp1 serving as a control for equal protein loading; note the absence of activated caspases-8, -10, -12. (D) Immunoblot detection of α-spectrin fragments in infected HGF cells; the full-length 240 kDa spectrin and the caspase-specific 120 kDa product bands are so marked. In A and B, the standard error bars are from three experiments.
Figure 5 Cleavage (A) and activation (B) of procaspase-3 by P. gingivalis-excreted gingipains. (A) Incubation of pure procaspase-3 with caspase-8 (4 or 8 ng) or culture supernatants ('sup') of wild type (WT) or triple gingipain mutant (MT) P. gingivalis (20 or 40 ng protein content, labeled over lanes) were done as described under Experimental Procedures. The products were analyzed by SDS-PAGE and silver-staining. The full-length procaspase-3 (34 kDa) and the processed active fragments (17 and 12 kDa) are marked by open and closed arrowheads, respectively. (B) Activity of the processed caspase-3 generated in Panel A was measured using a colorimetric peptide substrate described under Experimental Procedures. The enzymes used to cleave procsapase-3 are: 20 ng of wild type P. gingivalis sup (Triangle); 4 ng caspase-8 (Squares); 20 ng of gingipain mutant P. gingivalis sup (Open circles); 20 ng of wild type P. gingivalis sup, preheated at 65°C for 15 min (Diamonds); none (Closed circles). The error bars are derived from three independent experiments.
Figure 6 PI3K-dependent activation of NF-κB by P. gingivalis. (A) Activation of NF-κB-dependent luciferase in HEK cells. Monolayers were infected with wild type P. gingivalis in the presence of no drug (Open bars), 20 μM SN50 (Speckled bars), 20 μM LY294002 (Striped bar), or with the triple gingipain mutant (Closed bars), and luciferase assay carried out as described in Materials and Methods. Error bars represent average of three experiments. (B) Nuclear import of NF-κB p65 subunit. HGF cells were infected with P. gingivalis (wild type = WT; gingipain mutant = MT), and nuclear extracts (40 μg protein) of infected cells (or uninfected controls = U) were analyzed for p65 by immunoblot [54]. Sp1 serves as an unchanged control. (C) Phosphorylated IκB-α, an indicator of NF-κB activation, was detected by immunoblot of the total infected HGF cell extract using a specific antibody [54]. This phosphorylation was undetectable when 20 μM LY294002 (PI3K inhibitor) was included in the culture medium (+I).
Figure 7 Activation of members of the PI3K/AKT pathway. HGF monolayer was infected with wild type P. gingivalis (WT) or its triple gingipain mutant (MT), and the infected cells grown in the presence (+I) or absence of 20 μM LY294002 (PI3K inhibitor). Total cell extracts (50 μg) were probed in immunoblot for the presence of total AKT or specific phosphorylated proteins of the AKT pathway as named. The two species of phospho-FKHR are indicated by closed circle and triangle. Note the early (6–12 h) activation of phosphorylation and its inhibition by the inhibitor.
Figure 8 Induction of apoptosis-related gene mRNAs in HGF cells infected with wild type P. gingivalis (Triangles) or its triple gingipain mutant (Circles). Total mRNA from infected cells at different times p.i. were subjected to quantitative Real Time RT-PCR as described under Materials and Methods, using primers described in Table 1. The relative amounts of RNA were expressed as the ratio of uninfected control value (fold induction). Each box represents a specific gene as named and its generally accepted nature as anti-apoptotic ('anti') or pro-apoptotic ('pro'). Each data point is derived from three independent infection experiments with the error bar as shown. Note the general trend of early activation of anti-apoptotic genes (upper rows) and late activation of the pro-apoptotic ones (lower rows). Treatment with LY294002 (Closed circles) and SN50 (Closed triangles) inhibited activation of anti-apoptotic genes, as exemplified by Bfl-1.
Figure 9 A working model for P. gingivalis-activated apoptosis in HGF cells. Note that this is a highly reductive and simplified model showing only the major signaling events and that the intermediate steps are mostly omitted for space (details in Results and Discussion). In general, the P. gingivalis-activated molecules shown in this paper are displayed more prominently. The ER stress and Fas pathways were not activated. Whether the gingipains activate caspase-3 in vivo remains a question. The box on the left lists the major anti-apoptotic molecules activated early in infection, and the box on the right shows the pro-apoptotic molecules activated later. The two sets of forces are mutually antagonistic and thus, the balance shifts from anti- to pro-apoptosis as infection progresses.
Table 1 The apoptosis family genes and their PCR primers
Gene, Accession # Sense Antisense
Bfl-1, NM_004049 TTACAGGCTGGCTCAGGACT CCCAGTTAATGATGCCGTCT
Boo, NM_020396 GAAGAAGTGGGGCTTCCAG GAAAGGGGGTCCTGAAGAAG
Bcl-XL, NM_138578 GTAAACTGGGGTCGCATTGT TGGATCCAAGGCTCTAGGTG
Bcl-2, NM_000633 ATGTGTGTGGAGAGCGTCAA ACAGTTCCACAAAGGCATCC
Mcl-1, NM_021960 TAAGGACAAAACGGGACTGG ACCAGCTCCTACTCCAGCAA
Survivin, NM_001168 GGACCACCGCATCTCTACAT GACAGAAAGGAAAGCGCAAC
Bcl-w, NM_004050 GCTGAGGCAGAAGGGTTATG CACCAGTGGTTCCATCTCCT
Nip3, NM_004052 CTGGACGGAGTAGCTCCAAG TCTTCATGACGCTCGTGTTC
Hrk, NM_003806 CTAGGCGACGAGCTGCAC ACAGCCAAGGCCAGTAGGT
Bak, NM_001188 TTTTCCGCAGCTACGTTTTT GGTGGCAATCTTGGTGAAGT
Bik, NM_001197 TCTTGATGGAGACCCTCCTG GTCCTCCATAGGGTCCAGGT
Bok, NM_032515 AGATCATGGACGCCTTTGAC TCAGACTGCAGGGAGATGTG
Bax, NM_004324 TCTGACGGCAACTTCAACTG CACTGTGACCTGCTCCAGAA
Bad, NM_004322 CGGAGGATGAGTGACGAGTT CCACCAGGACTGGAAGACTC
Bim, NM_207003 TGGCAAAGCAACCTTCTGAT TCTTGGGCGATCCATATCTC
Moap-1, NM_022151 CAGTGGGTGAGTTGAGCAGA GAAACATCCAGCGTCCAAAT
The common names of the anti- and pro-apoptotic genes and their RefSeq accession numbers (GenBank) are shown here. The sense and antisense sequences correspond to the RT-PCR primers used for amplification of the transcripts by real-time PCR (Fig. 8). All sequences are written 5' to 3'.
==== Refs
Bosshardt DD Lang NP The junctional epithelium: from health to disease J Dent Res 2005 84 9 20 15615869
Amano A Molecular interaction of Porphyromonas gingivalis with host cells: implication for the microbial pathogenesis of periodontal disease J Periodontol 2003 74 90 96 12593602 10.1902/jop.2003.74.1.90
Bodet C Chandad F Grenier D Modulation of cytokine production by Porphyromonas gingivalis in a macrophage and epithelial cell co-culture model Microbes Infect 2005 7 448 456 15811635 10.1016/j.micinf.2004.11.021
Huang GT Zhang HB Dang HN Haake SK Differential regulation of cytokine genes in gingival epithelial cells challenged by Fusobacterium nucleatum and Porphyromonas gingivalis Microb Pathog 2004 37 303 312 15619426 10.1016/j.micpath.2004.10.003
Huang GTJ Kim D Lee JKH Kuramitsu HK Haake SK Interleukin-8 and intercellular adhesion molecule 1 regulation in oral epithelial cells by selected periodontal bacteria: multiple effects of Porphyromonas gingivalis via antagonistic mechanisms Infect Immun 2001 69 1364 1372 11179300 10.1128/IAI.69.3.1364-1372.2001
Kusumoto Y Hirano H Saitoh K Yamada S Takedachi M Nozaki T Ozawa Y Nakahira Y Saho T Ogo H Shimabukuro Y Okada H Murakami S Human gingival epithelial cells produce chemotactic factors interleukin-8 and monocyte chemoattractant protein-1 after stimulation with Porphyromonas gingivalis via toll-like receptor 2 J Periodontol 2004 75 370 379 15088874 10.1902/jop.2004.75.3.370
Sugano N Ikeda K Oshikawa M Sawamoto Y Tanaka H Ito K Differential cytokine induction by two types of Porphyromonas gingivalis Oral Microbiol Immunol 2004 19 121 123 14871353 10.1046/j.0902-0055.2003.00119.x
Nakayama K Molecular genetics of Porphyromonas gingivalis: gingipains and other virulence factors Curr Protein Pept Sci 2003 4 389 395 14683425 10.2174/1389203033486983
Potempa J Sroka A Imamura T Travis J Gingipains, the major cysteine proteinases and virulence factors of Porphyromonas gingivalis: structure, function and assembly of multidomain protein complexes Curr Protein Pept Sci 2003 4 397 407 14683426 10.2174/1389203033487036
Andrian E Grenier D Rouabhia M In vitro models of tissue penetration and destruction by Porphyromonas gingivalis Infect Immun 2004 72 4689 4698 15271930 10.1128/IAI.72.8.4689-4698.2004
Chen T Nakayama K Belliveau L Duncan MJ Porphyromonas gingivalis gingipains and adhesion to epithelial cells Infect Immun 2001 69 3048 3056 11292723 10.1128/IAI.69.5.3048-3056.2001
Grenier D Roy S Chandad F Plamondon P Yoshioka M Nakayama K Mayrand D Effect of inactivation of the Arg- and/or Lys-gingipain gene on selected virulence and physiological properties of Porphyromonas gingivalis Infect Immun 2003 71 4742 4748 12874356 10.1128/IAI.71.8.4742-4748.2003
O'Brien-Simpson NM Paolini RA Hoffmann B Slakeski N Dashper SG Reynolds EC Role of RgpA, RgpB, and Kgp proteinases in virulence of Porphyromonas gingivalis W50 in a murine lesion model Infect Immun 2001 69 7527 7534 11705929 10.1128/IAI.69.12.7527-7534.2001
Ansai T Yu W Urnowey S Barik S Takehara T Construction of a pepO gene-deficient mutant of Porphyromonas gingivalis : potential role of endopeptidase O in the invasion of host cells Oral Microbiol Immunol 2003 18 398 400 14622347 10.1046/j.0902-0055.2003.00080.x
Park Y Yilmaz O Jung IY Lamont RJ Identification of Porphyromonas gingivalis genes specifically expressed in human gingival epithelial cells by using differential display reverse transcription-PCR Infect Immun 2004 72 3752 3758 15213115 10.1128/IAI.72.7.3752-3758.2004
Bitko V Barik S An endoplasmic reticulum-specific stress-activated caspase (caspase-12) is implicated in the apoptosis of A549 epithelial cells by respiratory syncytial virus J Cell Biochem 2001 80 441 454 11135374 10.1002/1097-4644(20010301)80:3<441::AID-JCB170>3.0.CO;2-C
Guiney DG The role of host cell death in Salmonella infections Curr Top Microbiol Immunol 2005 289 131 150 15791954
Sinai AP Payne TM Carmen JC Hardi L Watson SJ Molestina RE Mechanisms underlying the manipulation of host apoptotic pathways by Toxoplasma gondii Int J Parasitol 2004 34 381 391 15003498 10.1016/j.ijpara.2003.11.009
Chen Z Casiano CA Fletcher HM Protease-active extracellular protein preparations from Porphyromonas gingivalis W83 induce N-cadherin proteolysis, loss of cell adhesion, and apoptosis in human epithelial cells J Periodontol 2001 72 641 650 11394400 10.1902/jop.2001.72.5.641
Johansson A Kalfas S Characterization of the proteinase-dependent cytotoxicity of Porphyromonas gingivalis Eur J Oral Sci 1998 106 863 871 9708689 10.1046/j.0909-8836.1998.eos106405.x
Morioka M Hinode D Nagata A Hayashi H Ichimiya S Ueda M Kido R Nakamura R Cytotoxicity of Porphyromonas gingivalis toward cultured human gingival fibroblasts Oral Microbiol Immunol 1993 8 203 207 8247606
Shah HN Gharbia SE O'Toole CM Assessment of the relative cytotoxicity of Porphyromonas gingivalis cells, products, and components on human epithelial cell lines J Periodontol 1992 63 44 51 1313102
Sheets SM Potempa J Travis J Casiano CA Fletcher HM Gingipains from Porphyromonas gingivalis W83 induce cell adhesion molecule cleavage and apoptosis in endothelial cells Infect Immun 2005 73 1543 1552 15731052 10.1128/IAI.73.3.1543-1552.2005
Wang PL Shirasu S Shinohara M Daito M Oido M Kowashi Y Ohura K Induction of apoptosis in human gingival fibroblasts by a Porphyromonas gingivalis protease preparation Arch Oral Biol 1999 44 337 342 10348360 10.1016/S0003-9969(99)00002-3
Baba A Abe N Kadowaki T Nakanishi H Ohishi M Asao T Yamamoto K Arg-gingipain is responsible for the degradation of cell adhesion molecules of human gingival fibroblasts and their death induced by Porphyromonas gingivalis Biol Chem 2001 382 817 824 11517936 10.1515/BC.2001.099
Hintermann E Haake SK Christen U Sharabi A Quaranta V Discrete proteolysis of focal contact and adherens junction components in Porphyromonas gingivalis-infected oral keratinocytes: a strategy for cell adhesion and migration disabling Infect Immun 2002 70 5846 5856 12228316 10.1128/IAI.70.10.5846-5856.2002
Katz J Yang QB Zhang P Potempa J Travis J Michalek SM Balkovetz DF Hydrolysis of epithelial junctional proteins by Porphyromonas gingivalis gingipains Infect Immun 2002 70 2512 2518 11953390 10.1128/IAI.70.5.2512-2518.2002
Tada H Sugawara S Nemoto E Imamura T Potempa J Travis J Shimauchi H Takada H Proteolysis of ICAM-1 on human oral epithelial cells by gingipains J Dent Res 2003 82 796 801 14514759
Zoellner H Chapple CC Hunter N Microvasculature in gingivitis and chronic periodontitis: disruption of vascular networks with protracted inflammation Microsc Res Tech 2002 56 15 31 11810703 10.1002/jemt.10009
Nakhjiri SF Park Y Yilmaz O Chung WO Watanabe K El-Sabaeny A Park K Lamont RJ Inhibition of epithelial cell apoptosis by Porphyromonas gingivalis FEMS Microbiol Lett 2001 200 145 149 11425466
Yilmaz O Jungas T Verbeke P Ojcius DM Activation of the phosphatidylinositol 3-kinase/Akt pathway contributes to survival of primary epithelial cells infected with the periodontal pathogen Porphyromonas gingivalis Infect Immun 2004 72 3743 3751 15213114 10.1128/IAI.72.7.3743-3751.2004
Lamont RJ Chan A Belton CM Izutsu KT Vasel D Weinberg A Porphyromonas gingivalis invasion of gingival epithelial cells Infect Immun 1995 63 3878 3885 7558295
Shi Y Ratnayake DB Okamoto K Abe N Yamamoto K Nakayama K Genetic analyses of proteolysis, hemoglobin binding, and hemagglutination of Porphyromonas gingivalis: construction of mutants with a combination of rgpA, rgpB, kgp, and hagA J Biol Chem 1999 274 17955 17960 10364243 10.1074/jbc.274.25.17955
Nath R Raser KJ Stafford D Hajimohammadreza I Posner A Allen H Talanian RV Yuen P Gilbertsen RB Wang KK Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis Biochem J 1996 319 683 690 8920967
Johnson DE Noncaspase proteases in apoptosis Leukemia 2000 14 1695 1703 10995018 10.1038/sj.leu.2401879
Neumar RW Xu YA Gada H Guttmann RP Siman R Cross-talk between calpain and caspase proteolytic systems during neuronal apoptosis J Biol Chem 2003 278 14162 14167 12576481 10.1074/jbc.M212255200
Kucharczak J Simmons MJ Fan Y Gelinas C To be, or not to be: NF-kappaB is the answer – role of Rel/NF-kappaB in the regulation of apoptosis Oncogene 2003 22 8961 8982 Erratum in: Oncogene 2004, 23:8858 14663476 10.1038/sj.onc.1207230
Bitko V Velazquez A Yang L Yang YC Barik S Transcriptional induction of multiple cytokines by human respiratory syncytial virus requires activation of NF-kappa B and is inhibited by sodium salicylate and aspirin Virology 1997 232 369 378 9191851 10.1006/viro.1997.8582
Lin YZ Yao SY Veach RA Torgerson TR Hawiger J Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence J Biol Chem 1995 270 14255 14258 7782278 10.1074/jbc.270.24.14255
Hayden MS Ghosh S Signaling to NF-kappaB Genes Dev 2004 18 2195 2224 15371334 10.1101/gad.1228704
Downward J PI 3-kinase, Akt and cell survival Semin Cell Dev Biol 2004 15 177 182 15209377 10.1016/j.semcdb.2004.01.002
Riedl SJ Shi Y Molecular mechanisms of caspase regulation during apoptosis Nat Rev Mol Cell Biol 2004 5 897 907 15520809 10.1038/nrm1496
Njoroge T Genco RJ Sojar HT Hamada N Genco CA A role for fimbriae in Porphyromonas gingivalis invasion of oral epithelial cells Infect Immun 1997 65 1980 1984 9125593
Yilmaz O Watanabe K Lamont RJ Involvement of integrins in fimbriae-mediated binding and invasion by Porphyromonas gingivalis Cell Microbiol 2002 4 305 314 12027958 10.1046/j.1462-5822.2002.00192.x
Umemoto T Hamada N Characterization of biologically active cell surface components of a periodontal pathogen. The roles of major and minor fimbriae of Porphyromonas gingivalis J Periodontol 2003 74 119 122 12593606 10.1902/jop.2003.74.1.119
Kontani M Kimura S Nakagawa I Hamada S Adherence of Porphyromonas gingivalis to matrix proteins via a fimbrial cryptic receptor exposed by its own arginine-specific protease Mol Microbiol 1997 24 1179 1187 9218767 10.1046/j.1365-2958.1997.4321788.x
Newcomb JK Pike BR Zhao X Hayes RL Concurrent assessment of calpain and caspase-3 activity by means of Western blots of protease-specific spectrin breakdown products Methods Mol Biol 2000 144 219 223 10818766
Ichikawa H Takada Y Murakami A Aggarwal BB Identification of a novel blocker of I-kappa B alpha kinase that enhances cellular apoptosis and inhibits cellular invasion through suppression of NF-kappa B-regulated gene products J Immunol 2005 174 7383 7392 15905586
Green DR Kroemer G The pathophysiology of mitochondrial cell death Science 2004 305 626 629 15286356 10.1126/science.1099320
Eichinger A Beisel HG Jacob U Huber R Medrano FJ Banbula A Potempa J Travis J Bode W Crystal structure of gingipain R: an Arg-specific bacterial cysteine proteinase with a caspase-like fold EMBO J 1999 18 5453 5462 10523290 10.1093/emboj/18.20.5453
Barrett AJ Rawlings ND Evolutionary lines of cysteine peptidases Biol Chem 2001 382 727 733 11517925 10.1515/BC.2001.088
Aravind L Koonin EV Classification of the caspase-hemoglobinase fold: detection of new families and implications for the origin of the eukaryotic separins Proteins 2002 46 355 367 11835511 10.1002/prot.10060
Chen JM Rawlings ND Stevens RA Barrett AJ Identification of the active site of legumain links it to caspases, clostripain and gingipains in a new clan of cysteine endopeptidases FEBS Lett 1998 441 361 365 9891971 10.1016/S0014-5793(98)01574-9
Mikolajczyk J Boatright KM Stennicke HR Nazif T Potempa J Bogyo M Salvesen GS Sequential autolytic processing activates the zymogen of Arg-gingipain J Biol Chem 2003 278 10458 10464 12533545 10.1074/jbc.M210564200
Fishburn CS Slaney JM Carman RJ Curtis MA Degradation of plasma proteins by the trypsin-like enzyme of Porphyromonas gingivalis and inhibition of protease activity by a serine protease inhibitor of human plasma Oral Microbiol Immunol 1991 6 209 215 1667433
Ansai T Yamashita Y Awano S Shibata Y Wachi M Nagai K Takehara T A murC gene in Porphyromonas gingivalis 381 Microbiology 1995 141 2047 2052 7496515
Bitko V Garmon NE Cao T Estrada B Oakes JE Lausch RN Barik S Activation of cytokines and NF-kappa B in corneal epithelial cells infected by respiratory syncytial virus: potential relevance in ocular inflammation and respiratory infection BMC Microbiol 2004 4 28 15256003 10.1186/1471-2180-4-28
Bitko V Barik S Persistent activation of RelA by respiratory syncytial virus involves protein kinase C, underphosphorylated IkappaB-beta, and sequestration of protein phosphatase 2A by the viral phosphoprotein J Virol 1998 72 5610 5618 9621019 | 16524480 | PMC1431544 | CC BY | 2021-01-04 16:10:55 | yes | BMC Microbiol. 2006 Mar 8; 6:26 |
"==== Front\nPLoS PathogPLoS PathogppatplpaplospathPLoS Pathogens1553-73661553-7374Public Library of(...TRUNCATED) | 16609730 | PMC1434790 | CC BY | 2021-01-05 12:38:12 | yes | PLoS Pathog. 2006 Mar 31; 2(3):e25 |
"==== Front\nMol CancerMolecular Cancer1476-4598BioMed Central London 1476-4598-5-111655632010.1186/(...TRUNCATED) | 16556320 | PMC1448188 | CC BY | 2021-01-04 16:23:43 | yes | Mol Cancer. 2006 Mar 23; 5:11 |
"==== Front\nRetrovirologyRetrovirology1742-4690BioMed Central London 1742-4690-3-221660308510.1186/(...TRUNCATED) | 16603085 | PMC1483830 | CC BY | 2021-01-04 16:25:06 | yes | Retrovirology. 2006 Apr 9; 3:22 |
"==== Front\nIndian Pacing Electrophysiol JIndian Pacing Electrophysiol JIndian Pacing and Electroph(...TRUNCATED) | 16943966 | PMC1513529 | CC BY | 2021-01-04 19:38:23 | yes | Indian Pacing Electrophysiol J. 2006 Jul 1; 6(3):163-172 |
"==== Front\nCardiovasc UltrasoundCardiovascular Ultrasound1476-7120BioMed Central London 1476-7120-(...TRUNCATED) | 17042945 | PMC1618858 | CC BY | 2021-01-04 16:25:12 | yes | Cardiovasc Ultrasound. 2006 Oct 16; 4:37 |
"==== Front\nJ Orthop SurgJournal of Orthopaedic Surgery and Research1749-799XBioMed Central London (...TRUNCATED) | 17150117 | PMC1636628 | CC BY | 2021-01-04 16:25:31 | yes | J Orthop Surg. 2006 Nov 2; 1:10 |
End of preview. Expand
in Data Studio
README.md exists but content is empty.
- Downloads last month
- 25