Update app.py

app.py

@@ -124,18 +124,19 @@ css = """
 footer { display: none !important; }
 """
 
-example_dna = "ATGCATGCATGCATGC"
+example_dna = "TCTCAGGCCCACACTCCCCCGGGGAGGACCGGTTTGAAGCGCAGCCTCCTACGACTCGATGCGCAAATACTGTACTCGGAGTCCCCGGGGATGACACGTCACGGTCCAGTCAAGGCCGGTAGGTGACATGTTCGTCTCCCGAGCCGGACATGCGGATTAACGTTTCATAGTTCCCGAACTTCCCTTGAGGCGGTAATCCCCAATCGTGAAGAGGGTCTCACCCGTCGCTTGCTTACTTTGCACGTACCTGTACGAGCGTGAATGGGACTACAGCCCGTGTTGACGGCTTACTGGATCCCTTGTAATTAATCGTCGAGAGATGAGCGATGCAATGCGGCCAGACATGACTACAATTCTGTTGTAGACTCTGTGCTAAGGCCATCTTTCTAGATGAACCAGCATGGTTGAGATTCGCCCGGCTTAGCGAGGTACTGGCATGCACGCGGCCCACATACCGGCCATTGGGGGAAAATTTTATTAAACTCTCAAGGTCGGAATTCTGTCTATCAGAC"
 example_question = "Does this sequence <DNA> contain a donor splice site?"
 
 with gr.Blocks(css=css) as demo:
-    gr.Markdown("# 🧬 ChatNT: A Multimodal Conversational Agent for DNA, RNA and Protein Tasks")
     gr.Markdown(
-        "[ChatNT]{https://www.nature.com/articles/s42256-025-01047-1} is the first multimodal conversational agent designed with a deep understanding of biological sequences (DNA, RNA, proteins). It enables users — even those with no coding background — to interact with biological data through natural language and it generalizes across multiple biological tasks and modalities.\n"
-        "This Hugging Face Space is powered by a [ZeroGPU](https://huggingface.co/docs/hub/en/spaces-zerogpu), which is free but **limited to 5 minutes per day per user**.\n"
+        """
+        # 🧬 ChatNT: A Multimodal Conversational Agent for DNA, RNA and Protein Tasks
+        [ChatNT](https://www.nature.com/articles/s42256-025-01047-1) is the first multimodal conversational agent designed with a deep understanding of biological sequences (DNA, RNA, proteins). It enables users — even those with no coding background — to interact with biological data through natural language and it generalizes across multiple biological tasks and modalities
+        
+        This Hugging Face Space is powered by a [ZeroGPU](https://huggingface.co/docs/hub/en/spaces-zerogpu), which is free but **limited to 5 minutes per day per user**.
+        """
     )
 
-    gr.Image("https://media.springernature.com/w440/springer-static/cover-hires/journal/42256/7/6")
-
     with gr.Row():
         with gr.Column(scale=1):
             dna_text = gr.Textbox(
@@ -180,9 +181,12 @@ with gr.Blocks(css=css) as demo:
         outputs=[dna_text, fasta_file, custom_question]
     )
 
-    gr.Markdown(
-        """
-You must use **exactly one `<DNA>` token** if you want the model to see your sequence. It is also possible to use the model without any DNA sequence (in this case, the `<DNA>` token must not be present in the question).
+    with gr.Row():
+        with gr.Column(scale=3):
+            gr.Markdown(
+                """
+You must use **exactly one `<DNA>` token** if you want the model to see your sequence. 
+It is also possible to use the model without any DNA sequence (in this case, the `<DNA>` token must not be present in the question).
 You can either paste a sequence or upload a FASTA file.  
 
 ---
@@ -195,9 +199,11 @@ You can either paste a sequence or upload a FASTA file.
 ### ❌ What will not work properly
 - "What is the length of this sequence `<DNA>`?"
 
-For more examples, you can refer to the [training dataset]{https://huggingface.co/datasets/InstaDeepAI/ChatNT_training_data}.
-        """
-    )
+For more examples, you can refer to the [training dataset](https://huggingface.co/datasets/InstaDeepAI/ChatNT_training_data).
+                """
+            )
+        with gr.Column(scale=1):
+            gr.Image("https://media.springernature.com/w440/springer-static/cover-hires/journal/42256/7/6")
 
     gr.Markdown("""
 ### 📚 Citation