GeneGPT / genehop.json
casey-martin's picture
Upload 2 files
7b7c793 verified
raw
history blame
51.4 kB
{
"sequence gene alias": {
"What are the aliases of the gene that contains this sequnece:GTAGATGGAACTGGTAGTCAGCTGGAGAGCAGCATGGAGGCGTCCTGGGGGAGCTTCAACGCTGAGCGGGGCTGGTATGTCTCTGTCCAGCAGCCTGAAGAAGCGGAGGCCGA. Let's decompose the question to sub-questions and solve them step by step.": [
"SLC38A6",
"NAT-1",
"SNAT6"
],
"What are the aliases of the gene that contains this sequnece:ATTGTGAGAGTAACCAACGTGGGGTTACGGGGGAGAATCTGGAGAGAAGAGAAGAGGTTAACAACCCTCCCACTTCCTGGCCACCCCCCTCCACCTTTTCTGGTAAGGAGCCC. Let's decompose the question to sub-questions and solve them step by step.": [
"FCGR3A",
"CD16",
"FCG3",
"CD16A",
"FCGR3",
"IGFR3",
"IMD20",
"FCR-10",
"FCRIII",
"CD16-II",
"FCGRIII",
"FCRIIIA",
"FcGRIIIA"
],
"What are the aliases of the gene that contains this sequnece:GGAAGAGGCCCCAGCACTGACCTCCGTGGGGGTGGAGATGAGGAGGATGGAAAGGGTGTCTTCCTCCAGCATCTTCCTGAAGGTGAAGGAGGGGCACCTTGGGGTGTCTAAGA. Let's decompose the question to sub-questions and solve them step by step.": [
"FNDC11",
"C20orf195"
],
"What are the aliases of the gene that contains this sequnece:GCACACGTACGTTCCTCATGAAAGGGACGACGGGAGCTGCATGAAAGCCGAAGTTATGGACCGCTAGCATCTGTCACTGGCCACCGGTTTCCGGGAGTAAGCGGCAGCTACCT. Let's decompose the question to sub-questions and solve them step by step.": [
"EOLA2",
"CXorf40B"
],
"What are the aliases of the gene that contains this sequnece:AGACGTGAAGCCTAGCAGAGGACTTTTTAGCTGCTCACTGGCCCCGCTTGTCTGGCCGACTCATCCGCCCGCGACCCCTAATCCCCTCTGCCTGCCCCAAGATGCTGAAGCCA. Let's decompose the question to sub-questions and solve them step by step.": [
"PSMB10",
"LMP10",
"MECL1",
"PRAAS5",
"beta2i"
],
"What are the aliases of the gene that contains this sequnece:ACTTCCAACATGGCGGCGGCCGGGGCGGCGGTGGCGCGCAGCCCGGGAATCGGAGCGGGACCTGCGCTGAGAGCCCGGCGCTCGCCCCCGCCGCGGGCCGCACGGCTGCCGCG. Let's decompose the question to sub-questions and solve them step by step.": [
"QSOX2",
"SOXN",
"QSCN6L1"
],
"What are the aliases of the gene that contains this sequnece:ACTAGCCCCAAGAACAAAAGAGGCACAGGTGGGAACAACTCTCCCAAAACCAGGACTGGGAGCATGGCCAAACTTCATAGTGAGCTTACTTGCCTCTGACACACAAGGCAGCA. Let's decompose the question to sub-questions and solve them step by step.": [
"OR10A2",
"OST363",
"OR10A2P",
"OR11-82",
"OR11-86"
],
"What are the aliases of the gene that contains this sequnece:GCCGGCGCGCTTGCGCAGTAGCTGAACGCGGGCGTTTCTTTCCTCCCTTTTTTTCGAATTGGTTTTGGGGGTAGATTCGAGTTACAAAATGGCCGCCCGGAGCGTGTTCGGCG. Let's decompose the question to sub-questions and solve them step by step.": [
"NUP50",
"NPAP60",
"NPAP60L"
],
"What are the aliases of the gene that contains this sequnece:ATGCTTCATTACACCCTTCATGGAAGCTGGCACACTCGCCCCACCCTCGTTTTCCACGGGCCAGTCTTGGAGGAAAAGGCCAGCAGGTAGGTTCCCAGGGCACGGAGATGATG. Let's decompose the question to sub-questions and solve them step by step.": [
"MLLT10",
"AF10"
],
"What are the aliases of the gene that contains this sequnece:GCTTACGCCACGGCGTCTGCTGGCGGCCGCGGAGACGCAGAGTCTTGAGCAGCGCGGCAGGTGAGTAGCTGTGCGAATTCGGTTCTCTAGGGAGCTCCTTCTTCGCCTGCTGG. Let's decompose the question to sub-questions and solve them step by step.": [
"MRPL57",
"MRP63",
"bMRP63"
],
"What are the aliases of the gene that contains this sequnece:AGAAGAGCCAAAACAGGAACCGAGGTGGCAAATCACTGTGCGAGGGCGAGTGGACCTCCCTCTTTGCCTCCTCCCTGTTCCAGGAGCTGGTGCCCTGGGCTCTGCGCTGTTGT. Let's decompose the question to sub-questions and solve them step by step.": [
"SYT4",
"HsT1192"
],
"What are the aliases of the gene that contains this sequnece:CTTCCAGGCTAAGTCCATCTTCCGGCTTGGGCAGACGCTGCCGCGGAATCCTTGACTCTAGTTTTCTGAGTCGGTGAGTGAGTGCAAAGTAGATTCCTCAGGTGGAGGGTGCC. Let's decompose the question to sub-questions and solve them step by step.": [
"ZBTB6",
"ZID",
"ZNF482"
],
"What are the aliases of the gene that contains this sequnece:CCTTTTAGTATCCAATTATCTGAAACTTAAGAAGAGTGTGCACCGCCCAATGGGTGTGTGTATGTGCTGCTTTGAACCTATAGTTGAGATCCAGAGAATTGGGAGTGACATCA. Let's decompose the question to sub-questions and solve them step by step.": [
"PTH",
"FIH1",
"PTH1"
],
"What are the aliases of the gene that contains this sequnece:AGGCTACCAAAGTCGCTGGTAGCCTGGACCCTGAGTTCACCGATCCTTCCTACTCAGTAATATCTACAGGTAAGTCCAAAGGGAAATTGCTTTGGGAATCTGACAATTTAACT. Let's decompose the question to sub-questions and solve them step by step.": [
"ASIP",
"ASP",
"AGSW",
"AGTI",
"AGTIL",
"SHEP9"
],
"What are the aliases of the gene that contains this sequnece:ATCTGCTCTGACTTCCCCAGGACGTGTCTGTGCTCCTGTGTGTGACCAGGGTGAGTGGCAACCTGGGAGCCAGAGGGCACAGGGGAATGGGAAGATTAAGGGAGGCTTCAGAG. Let's decompose the question to sub-questions and solve them step by step.": [
"LCE2A",
"LEP9"
],
"What are the aliases of the gene that contains this sequnece:AGAGCCCAGCCCAGCACGGTCTCCGGGGATGTAGCTGGTGGGACAGTGAGCAGAGGGCTGGGCCCTGTGCCTGGGGACTGTGGCCTGGAGGCTGAGCAGGAGCTGAGGAGGGG. Let's decompose the question to sub-questions and solve them step by step.": [
"SEPTIN3",
"SEP3",
"SEPT3",
"bK250D10.3"
],
"What are the aliases of the gene that contains this sequnece:GCACAAGCCGGCCTTGAAATCAGAGCCTTTCCAGCAACTCCGAGAGCGTGTGCTCGGCGACCGCGGGCTTGGCCAGCGGCGCGCGCTCGGCGCCCCGGCGCCCCCAGCCCCAC. Let's decompose the question to sub-questions and solve them step by step.": [
"TWIST2",
"AMS",
"FFDD3",
"BBRSAY",
"DERMO1",
"SETLSS",
"bHLHa39"
],
"What are the aliases of the gene that contains this sequnece:AGTTGGCCGCTCCGGCCTGTGGGGCTACATCCCTGCTGCCGGCCAGGCGCGGCCCGCGGGACCCCGAGTGTAGCGCCATGGCCCGGGAGAGGCCGCCCGGGAGGGGCTGCGGC. Let's decompose the question to sub-questions and solve them step by step.": [
"METTL24",
"C6orf186"
],
"What are the aliases of the gene that contains this sequnece:GCATTGTGGGTTCTCCTGGAGCTGTGGAGTTGATCCTGAATGAAAGTGGCGCGCCGCCCCTGACGTTACCCGGATCGGAGAGGTTGGAATTCAGATTACGGCTGCGATTCGGG. Let's decompose the question to sub-questions and solve them step by step.": [
"RNGTT",
"HCE",
"HCE1",
"hCAP",
"CAP1A"
],
"What are the aliases of the gene that contains this sequnece:CTTCCCCAAGCCAACGTCTCCGCCGTCGGCTCCGCGGCGCCGCCATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGGGAGCTCAGGCTCCAAG. Let's decompose the question to sub-questions and solve them step by step.": [
"RNF7",
"SAG",
"ROC2",
"rbx2",
"CKBBP1"
],
"What are the aliases of the gene that contains this sequnece:AAGACTGCGAGCTCCCCGCACCCCCTCGCACTCCCTCTGGCCGGCCCAGGGCGCCTTCAGCCCAACCTCCCCAGCCCCACGGGCGCCACGGAACCCGCTCGATCTCGCCGCCA. Let's decompose the question to sub-questions and solve them step by step.": [
"F3",
"TF",
"TFA",
"CD142"
],
"What are the aliases of the gene that contains this sequnece:AGCTCCCCGCCGGGCTCGCGCCGCAGAGGCCGGTGAGGCGCCGGCGGCCACGCCGCGGAAGGCGCGGGCCGAGCAGAGCCGGGCGTTGGAGCCCGCGCGCGCATGGAGGCGTT. Let's decompose the question to sub-questions and solve them step by step.": [
"SLC25A33",
"PNC1",
"BMSC-MCP"
],
"What are the aliases of the gene that contains this sequnece:AGATCTGCTTCTCCCCGGCTCGGGGCGCCGAGGCGGCGTCCGGGAGGTGTCTTCTGCAAAGGTTGCCTGGCGCTGTCCAACATGGAGGAGGCACCGGCAGCGGGCGTTACCTG. Let's decompose the question to sub-questions and solve them step by step.": [
"PCLO",
"ACZ",
"PCH3"
],
"What are the aliases of the gene that contains this sequnece:CATGGCCACCCCTGCAGCAGTTACAACACTAAGAGCTCGTTCTTTTGCATCCTCTGTAAGTCCCAGGGCCAAGGGAGGGGAGCCTAGGCTATATTGGACCTAGATAGGAAGAG. Let's decompose the question to sub-questions and solve them step by step.": [
"OR56A1",
"OR11-75"
],
"What are the aliases of the gene that contains this sequnece:GGGACTTTGCAGGCAGCGGCGGCCGGGGGCGGAGCGGGATCGAGCCCTCGCCGAGGCCTGCCGCCATGGGCCCGCGCCGCCGCCGCCGCCTGTCACCCGGGCCGCGCGGGCCG. Let's decompose the question to sub-questions and solve them step by step.": [
"E2F1",
"RBP3",
"E2F-1",
"RBAP1",
"RBBP3"
],
"What are the aliases of the gene that contains this sequnece:CTCTTTCTTAAGTCATTCGAAACACTGTCCCTGCGAGTTCTTTAAGTTCCCTGCAATCTGTACACAAGAGAAAGAGGGAGAGAGAGAGGGAGAGAGACAGAGAGAGCAGGGAT. Let's decompose the question to sub-questions and solve them step by step.": [
"ZNF366",
"DCSCRIPT",
"DC-SCRIPT"
],
"What are the aliases of the gene that contains this sequnece:AGAAGGAGCGAAACATCTTTGAGCAAGATGGGTCTCTACCGCATCCGCGTGTCCACTGGGGCCTCGCTCTATGCCGGTTCCAACAACCAGGTGCAGCTGTGGCTGGTCGGCCA. Let's decompose the question to sub-questions and solve them step by step.": [
"ALOX15",
"LOG15",
"12-LOX",
"15-LOX",
"15-LOX-1"
],
"What are the aliases of the gene that contains this sequnece:CCCGCGCGGTAGCAGCCAACGCCGGCCCCAGGCGGGTGCGCTGGGAGCCTGGGCCGGGAGCCGGGTGAGGGCGCCGAGAGGCTCGGTGGGCGCGGGCGGCGAGGTGAGCTGGG. Let's decompose the question to sub-questions and solve them step by step.": [
"LYPD6B",
"CT116",
"LYPD7"
],
"What are the aliases of the gene that contains this sequnece:AGATTTGCTCTGATTCTGACAATGCAGTGGGTATCAGAGCTCAGGTCCAGAGGAAAAGCCTGGAGTGAGTGAGGCTGCGAGCTTCCTCTTCAGAACTCTGCATGCTTATCGGG. Let's decompose the question to sub-questions and solve them step by step.": [
"PRKCH",
"PKCL",
"PKC-L",
"PRKCL",
"uORF2",
"nPKC-eta"
],
"What are the aliases of the gene that contains this sequnece:AGAACTCTGCGCTACTGCCCACGCATCTCACAAAGTCTACTACGCCGCGCGTTCTCGGTTTCAACGCACCTCCAGGATTCAGGGCTTCCTAAGCTGCAATTCAGCAGGGCTCC. Let's decompose the question to sub-questions and solve them step by step.": [
"ARHGEF26",
"SGEF",
"CSGEF",
"HMFN1864"
],
"What are the aliases of the gene that contains this sequnece:AGCGGGAAGACCATCTCTGCAAGTGCAGCATAGCCTCGGCCTAGGACAGCGGGAGTGCGTGGCCAAAGCTGTGAGCAGAGGCACAGGTGGTGGCAGACAGTAGAGGCGCCCCA. Let's decompose the question to sub-questions and solve them step by step.": [
"AGAP9",
"AGAP-9",
"CTGLF6",
"bA301J7.2"
],
"What are the aliases of the gene that contains this sequnece:GTCGGCCCTGCGGGCCTCTCTCCGTCGCCATGGAAACGAAAGCGGCCAAGTAGAGCTCCGTCCTGACGCGCCGCCTCCCGTGGGCTCCGGCCGGCTAAGCCGCGGCGGACAAC. Let's decompose the question to sub-questions and solve them step by step.": [
"IFT22",
"FAP9",
"CFAP9",
"RABL5"
],
"What are the aliases of the gene that contains this sequnece:AGTCAAGTGACGCGAAGCGGCCGGCCTGGGCGCCGACTGCAGAGCCGGGAGGCTGGTGGTCATGCCGGGGTTCCTGGTTCGCATCCTCCCTCTGTTGCTGGTTCTGCTGCTTC. Let's decompose the question to sub-questions and solve them step by step.": [
"GLB1",
"EBP",
"ELNR1",
"MPS4B"
],
"What are the aliases of the gene that contains this sequnece:GTTTTTCAGCTCACTTCAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTTCTAGCTTCACCTTCACGATGTTTCCCTTGGTCAAAAGCGCACTA. Let's decompose the question to sub-questions and solve them step by step.": [
"COX7B",
"APLCC",
"LSDMCA2"
],
"What are the aliases of the gene that contains this sequnece:AGAGCGGCCCCGGAGCGGCCGCAGCGCGGTGGTCTCGGCCCGGCTGCGCCAGAGTCCGCGCGATGGAGCCCCGGCCGCGGCGGCGGCGCAGGAGTCGCCCCCTGGTCGCCGCC. Let's decompose the question to sub-questions and solve them step by step.": [
"PLK5",
"PLK-5",
"PLK5P",
"SgK384ps"
],
"What are the aliases of the gene that contains this sequnece:ATGACGCGCGGCCGCGCCTGGGGGATGCGGCGGGCGGCGGCGGGGGCGGGCGGAGCGCGGGCGGCGGGGCCAACTGGGGGCGCCTCTCGCCTGCACCCCAATGCGGGACGCAG. Let's decompose the question to sub-questions and solve them step by step.": [
"ANKRD60",
"C20orf86",
"bA196N14.3"
],
"What are the aliases of the gene that contains this sequnece:ATCGATCACAGGCTCACAACGCCCTTCCATTCATCGCTCTTATTCCAGTCCTGGTTACTACCCCACTTCCTGACATCAAACCAGGGAGAACGCGAGTGTTAGTTAACATGGCT. Let's decompose the question to sub-questions and solve them step by step.": [
"POC1B-GALNT4",
"GALNT4",
"GalNAc-T4"
],
"What are the aliases of the gene that contains this sequnece:GCCATTTTGGATTGTGTGAGTTTCCGGGACGTTCGGAGGGTGGCCTCTCTCCCACCGGGTTCCGCATACCCCAGGCACCGGCCCGCATCCAAGTGTCAGGTTGGAGCCGGGAA. Let's decompose the question to sub-questions and solve them step by step.": [
"INTS8",
"INT8",
"NEDCHS",
"C8orf52"
],
"What are the aliases of the gene that contains this sequnece:GTTGTACAGAAAATTGCTGTTGGGATGAAGCTTTGCAGCCTTGCAGTCCTTGTACCCATTGTTCTCTTCTGTGAGCAGCATGTCTTCGCGTTTCAGAGGTAACCCAATAGAA. Let's decompose the question to sub-questions and solve them step by step.": [
"CPB2",
"CPU",
"PCPB",
"TAFI"
],
"What are the aliases of the gene that contains this sequnece:ATTACTCAGCTTTTCATCTGCTGTGTTGAAAGCCAACTTATCATTTTTCACATTATTGTATACATCTAAAAGACATCATAAACGAAGACTGGAAGTGAAAACTGAAAAACTGA. Let's decompose the question to sub-questions and solve them step by step.": [
"VBP1",
"PFD3",
"PFDN3",
"VBP-1",
"HIBBJ46"
],
"What are the aliases of the gene that contains this sequnece:GTTTGTTTACTTGGCGAGACTTGGAGCTGAGGTCATTTGGAGCTGTTTAATACTGAAGAGCTGTTGAGCACTGGAAAGTGCTGTGTAACCCTGGAAAAGAACCGTGTAACGCT. Let's decompose the question to sub-questions and solve them step by step.": [
"H2BC1",
"STBP",
"TH2B",
"H2BFU",
"TSH2B",
"hTSH2B",
"TSH2B.1",
"HIST1H2BA",
"bA317E16.3"
],
"What are the aliases of the gene that contains this sequnece:AGCTGCCAGCACGCGCAGAAGGCGGACGCAGGCGGGGCGGAAGTGGGCCCGGCGGGCTGGGGCGGCGGGAGTGCGGGTGGGCGTTTAAAGGGGCCTTCGGCACCCAGGTCGGT. Let's decompose the question to sub-questions and solve them step by step.": [
"CPLANE2",
"RSG1",
"C1orf89"
],
"What are the aliases of the gene that contains this sequnece:AGATGTGAGTCCTCAATGAGCTATAACCACAGCCATAAATATCTCTCAAAGATGAGGAACATTCTCATGATGTTGACACTGCAATTTTTTGACAATTTCCCAACACTCTTAAG. Let's decompose the question to sub-questions and solve them step by step.": [
"ADAMDEC1",
"M12.219"
],
"What are the aliases of the gene that contains this sequnece:TCTTCCTCCAGCTGTTCCCACAGGCTCCATTATTCAAACTTTGGGGGAGGAAATCAGGGCTGGACAGATCATCAACTGCTGCTGCTGACAGACTGTGTTCCTGCCATGATGGG. Let's decompose the question to sub-questions and solve them step by step.": [
"B3GNT8",
"B3GALT7",
"BGALT15",
"beta3Gn-T8"
],
"What are the aliases of the gene that contains this sequnece:CATTTCACCAGCCCAGGCTGGCTTCTGCTGTTGACTGGCTGTGGCACCTCAAGCAGCCCCTTTCCCCTCTAGCCTCAGTTTATCACCGCAAGAGCTACCATTCATCTAGCACA. Let's decompose the question to sub-questions and solve them step by step.": [
"SRC",
"ASV",
"SRC1",
"THC6",
"c-SRC",
"p60-Src"
],
"What are the aliases of the gene that contains this sequnece:ATGGCTTTGCCTAGAAGCCAAGGCCATTGGTCCAACAAAGACATCTTGAGGTTACTGGAATGCATGGAGAATAATCGCCCATCTGATGACAACAGCACGTTTAGCTCAACTCA. Let's decompose the question to sub-questions and solve them step by step.": [
"UBTFL1",
"HMGPI",
"C11orf27"
],
"What are the aliases of the gene that contains this sequnece:GCAGGCGCTGGCTGGCAGGTGTCGCTAACCGGACGGTGGTCGCCAGGGCGAGAGGCGGGAGCCGGAGAGGTGAGGCAGGACCCGGGCTCCACTGCCGCCTCTCCGAGCTCTTG. Let's decompose the question to sub-questions and solve them step by step.": [
"MOGS",
"DER7",
"GCS1",
"CDG2B",
"CWH41"
],
"What are the aliases of the gene that contains this sequnece:ACGTGGCCGGGGTGGGACCTCAGGCGACCTGCGACCATCACTTTGTCTCCTCCTTCCTCCTTTGGGGCCGCCACCGCCAATCAGAGCCAGCGGATCCTGGTTGGAGTGCGACC. Let's decompose the question to sub-questions and solve them step by step.": [
"ATOSB",
"FAM214B",
"KIAA1539"
],
"What are the aliases of the gene that contains this sequnece:AGGATTCCTGGAGTCTCCGGAGGGTGCCTTTGGCCTCTGGGATTCACCCGAGCCGTTGGCTTTTGCTCCCCCCACCCCACCCCCTGGCTTTTCTTGGCTTGGAGGGCAGCTGG. Let's decompose the question to sub-questions and solve them step by step.": [
"SHANK2",
"SHANK",
"AUTS17",
"CORTBP1",
"CTTNBP1",
"ProSAP1",
"SPANK-3"
],
"What are the aliases of the gene that contains this sequnece:ATGCTCAGTAGCCGCGGCGCTGCTGCTGGGCTGCTGGGCTGGCGCGGAGTCCACCCTGCCGTCTCCGCCTTGGCTTCTGGGCGTCCAGAAGGCCAGGCATTTGCCGCCTCTGA. Let's decompose the question to sub-questions and solve them step by step.": [
"PTPRR",
"PTPRQ",
"EC-PTP",
"PCPTP1",
"PTP-SL",
"PTPBR7"
]
},
"Disease gene location": {
"List chromosome locations of the genes related to Hemolytic anemia due to phosphofructokinase deficiency. Let's decompose the question to sub-questions and solve them step by step.": [
"21q22.3"
],
"List chromosome locations of the genes related to Distal renal tubular acidosis. Let's decompose the question to sub-questions and solve them step by step.": [
"17q21.31",
"7q34"
],
"List chromosome locations of the genes related to Pseudohypoparathyroidism Ic. Let's decompose the question to sub-questions and solve them step by step.": [
"20q13.32"
],
"List chromosome locations of the genes related to Glycine N-methyltransferase deficiency. Let's decompose the question to sub-questions and solve them step by step.": [
"6p21.1"
],
"List chromosome locations of the genes related to Meesmann corneal dystrophy. Let's decompose the question to sub-questions and solve them step by step.": [
"17q21.2",
"12q13.13"
],
"List chromosome locations of the genes related to Chronic atrial and intestinal dysrhythmia. Let's decompose the question to sub-questions and solve them step by step.": [
"3p24.3"
],
"List chromosome locations of the genes related to Sensorineural deafness with mild renal dysfunction. Let's decompose the question to sub-questions and solve them step by step.": [
"1p32.3"
],
"List chromosome locations of the genes related to Bile acid malabsorption. Let's decompose the question to sub-questions and solve them step by step.": [
"13q33.1",
"15q22.31"
],
"List chromosome locations of the genes related to Immunodeficiency due to defect in MAPBP-interacting protein. Let's decompose the question to sub-questions and solve them step by step.": [
"1q22"
],
"List chromosome locations of the genes related to Currarino syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"7q36.3"
],
"List chromosome locations of the genes related to Intervertebral disc disease. Let's decompose the question to sub-questions and solve them step by step.": [
"20q13.33"
],
"List chromosome locations of the genes related to Otofaciocervical syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"8q13.3",
"20p11.22"
],
"List chromosome locations of the genes related to Brody myopathy. Let's decompose the question to sub-questions and solve them step by step.": [
"16p11.2"
],
"List chromosome locations of the genes related to Neurodevelopmental disorder with gait disturbance. Let's decompose the question to sub-questions and solve them step by step.": [
"Xq22.2"
],
"List chromosome locations of the genes related to Mitochondrial DNA depletion syndrome 4A Alpers type. Let's decompose the question to sub-questions and solve them step by step.": [
"15q26.1"
],
"List chromosome locations of the genes related to Nephropathy due to CFHR5 deficiency. Let's decompose the question to sub-questions and solve them step by step.": [
"1q31.3"
],
"List chromosome locations of the genes related to Achromatopsia. Let's decompose the question to sub-questions and solve them step by step.": [
"2q11.2",
"8q21.3",
"1p13.3",
"12p12.3",
"1q23.3"
],
"List chromosome locations of the genes related to Hyperphenylalaninemia. Let's decompose the question to sub-questions and solve them step by step.": [
"11q23.1",
"14q22.2",
"4p15.32",
"10q22.1",
"10q21.3",
"12q23.2"
],
"List chromosome locations of the genes related to EDICT syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"15q25.1"
],
"List chromosome locations of the genes related to Gastrointestinal defects and immunodeficiency syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"22q11.21",
"2p21"
],
"List chromosome locations of the genes related to Cleft palate with ankyloglossia. Let's decompose the question to sub-questions and solve them step by step.": [
"Xq21.1"
],
"List chromosome locations of the genes related to Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures. Let's decompose the question to sub-questions and solve them step by step.": [
"6q27"
],
"List chromosome locations of the genes related to Spondylocarpotarsal synostosis syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"3p14.3"
],
"List chromosome locations of the genes related to Haim-Munk syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"11q14.2"
],
"List chromosome locations of the genes related to Sialidosis. Let's decompose the question to sub-questions and solve them step by step.": [
"6p21.33"
],
"List chromosome locations of the genes related to Siddiqi syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"20q13.12"
],
"List chromosome locations of the genes related to Corneal fleck dystrophy. Let's decompose the question to sub-questions and solve them step by step.": [
"2q34"
],
"List chromosome locations of the genes related to Liver failure. Let's decompose the question to sub-questions and solve them step by step.": [
"22q13.31"
],
"List chromosome locations of the genes related to Proteasome-associated autoinflammatory syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"6p21.32",
"18p11.21",
"13q12.3",
"16q22.1"
],
"List chromosome locations of the genes related to Orofaciodigital syndrome XIV. Let's decompose the question to sub-questions and solve them step by step.": [
"11q13.4"
],
"List chromosome locations of the genes related to Trichoepithelioma. Let's decompose the question to sub-questions and solve them step by step.": [
"16q12.1"
],
"List chromosome locations of the genes related to Medullary thyroid carcinoma. Let's decompose the question to sub-questions and solve them step by step.": [
"10q11.21"
],
"List chromosome locations of the genes related to Type diabetes mellitus. Let's decompose the question to sub-questions and solve them step by step.": [
"17q12",
"7p15.3",
"2q24.1",
"6p21.31",
"2q36.3",
"2q31.3",
"7p15.3"
],
"List chromosome locations of the genes related to Buschke-Ollendorff syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"12q14.3"
],
"List chromosome locations of the genes related to Vascular malformation. Let's decompose the question to sub-questions and solve them step by step.": [
"20q13.12"
],
"List chromosome locations of the genes related to Acrocallosal syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"15q26.1"
],
"List chromosome locations of the genes related to Congenital disorder of deglycosylation. Let's decompose the question to sub-questions and solve them step by step.": [
"3p24.2",
"15q24.2"
],
"List chromosome locations of the genes related to Spinal muscular atrophy with congenital bone fractures. Let's decompose the question to sub-questions and solve them step by step.": [
"15q22.31",
"10q22.1"
],
"List chromosome locations of the genes related to B-cell immunodeficiency. Let's decompose the question to sub-questions and solve them step by step.": [
"3p24.2"
],
"List chromosome locations of the genes related to Immunodeficiency with inflammatory disease and congenital thrombocytopenia. Let's decompose the question to sub-questions and solve them step by step.": [
"7q22.1"
],
"List chromosome locations of the genes related to Split-foot malformation with mesoaxial polydactyly. Let's decompose the question to sub-questions and solve them step by step.": [
"2q31.1"
],
"List chromosome locations of the genes related to Pigmented nodular adrenocortical disease. Let's decompose the question to sub-questions and solve them step by step.": [
"17q24.2",
"2q31.2",
"5q13.3"
],
"List chromosome locations of the genes related to Superoxide dismutase. Let's decompose the question to sub-questions and solve them step by step.": [
"4p15.2"
],
"List chromosome locations of the genes related to Leukoencephalopathy with dystonia and motor neuropathy. Let's decompose the question to sub-questions and solve them step by step.": [
"1p32.3"
],
"List chromosome locations of the genes related to Intracranial hemorrhage in brain cerebrovascular malformations. Let's decompose the question to sub-questions and solve them step by step.": [
"7p15.3"
],
"List chromosome locations of the genes related to Multiple system atrophy. Let's decompose the question to sub-questions and solve them step by step.": [
"4q21.23"
],
"List chromosome locations of the genes related to Cone dystrophy. Let's decompose the question to sub-questions and solve them step by step.": [
"10q23.33",
"6p21.1"
],
"List chromosome locations of the genes related to Holt-Oram syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"12q24.21"
],
"List chromosome locations of the genes related to Lichtenstein-Knorr syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"1p36.11"
],
"List chromosome locations of the genes related to Ablepharon-macrostomia syndrome. Let's decompose the question to sub-questions and solve them step by step.": [
"2q37.3"
]
},
"SNP gene function": {
"What is the function of the gene associated with SNP rs1217074595? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs1241371358? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to be active in cytosol.",
"What is the function of the gene associated with SNP rs1481036795? Let's decompose the question to sub-questions and solve them step by step.": "SEPT11 belongs to the conserved septin family of filament-forming cytoskeletal GTPases that are involved in a variety of cellular functions including cytokinesis and vesicle trafficking (Hanai et al., 2004 [PubMed 15196925]; Nagata et al., 2004 [PubMed 15485874]).",
"What is the function of the gene associated with SNP rs1318850293? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in Rho protein signal transduction.",
"What is the function of the gene associated with SNP rs996319727? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable thiol-dependent deubiquitinase and zinc ion binding activity. Involved in spliceosomal complex assembly. Located in nucleoplasm. Part of U4/U6 x U5 tri-snRNP complex.",
"What is the function of the gene associated with SNP rs577757681? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable oxidoreductase activity. Predicted to be involved in response to oxidative stress. Predicted to act upstream of or within several processes, including adult walking behavior; negative regulation of neuron death; and negative regulation of peptidyl-cysteine S-nitrosylation. Predicted to be located in mitochondrion and nucleolus. Predicted to be active in nucleus. Implicated in cerebellar hyplasia/atrophy, epilepsy, and global developmental delay.",
"What is the function of the gene associated with SNP rs1294482311? Let's decompose the question to sub-questions and solve them step by step.": "The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants.",
"What is the function of the gene associated with SNP rs979970652? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable mRNA binding activity and poly(A) binding activity. Predicted to be involved in regulation of alternative mRNA splicing, via spliceosome. Predicted to be located in nucleoplasm. Predicted to be active in nucleus.",
"What is the function of the gene associated with SNP rs1029002401? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable DNA binding activity. Predicted to be involved in homologous chromosome pairing at meiosis and meiotic attachment of telomere to nuclear envelope. Predicted to be located in chromosome, telomeric region. Predicted to be integral component of nuclear inner membrane.",
"What is the function of the gene associated with SNP rs1015227? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs1278530438? Let's decompose the question to sub-questions and solve them step by step.": "Enables R-SMAD binding activity. Involved in negative regulation of cell migration; negative regulation of epithelial to mesenchymal transition; and negative regulation of transmembrane receptor protein serine/threonine kinase signaling pathway. Located in early endosome membrane.",
"What is the function of the gene associated with SNP rs745325402? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants.",
"What is the function of the gene associated with SNP rs4704888? Let's decompose the question to sub-questions and solve them step by step.": "The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.",
"What is the function of the gene associated with SNP rs1201372088? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable DNA-binding transcription repressor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Located in nucleoplasm.",
"What is the function of the gene associated with SNP rs1324451169? Let's decompose the question to sub-questions and solve them step by step.": "The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors.",
"What is the function of the gene associated with SNP rs983419152? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs745940901? Let's decompose the question to sub-questions and solve them step by step.": "The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants.",
"What is the function of the gene associated with SNP rs1303680136? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable phospholipid scramblase activity. Predicted to be involved in apoptotic process involved in development; engulfment of apoptotic cell; and phosphatidylserine exposure on apoptotic cell surface. Predicted to be integral component of membrane. Predicted to be active in plasma membrane.",
"What is the function of the gene associated with SNP rs1053827498? Let's decompose the question to sub-questions and solve them step by step.": "Enables protein dimerization activity and ubiquitin protein ligase activity. Involved in positive regulation of response to DNA damage stimulus. Located in nucleoplasm. Part of Smc5-Smc6 complex.",
"What is the function of the gene associated with SNP rs1350154096? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs1037441458? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs900408143? Let's decompose the question to sub-questions and solve them step by step.": "The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene.",
"What is the function of the gene associated with SNP rs900532834? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Mutations in this gene have been associated with macrocephaly, seizures, and speech delay. Overexpression of this gene is also reported in many cancer types, and particularly in breast cancer. Alternative splicing results in multiple transcript variants.",
"What is the function of the gene associated with SNP rs1281200566? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to enable unfolded protein binding activity. Predicted to be involved in protein folding. Predicted to be part of chaperonin-containing T-complex.",
"What is the function of the gene associated with SNP rs1431266687? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described.",
"What is the function of the gene associated with SNP rs900745020? Let's decompose the question to sub-questions and solve them step by step.": "The product of this gene belongs to the CRE (cAMP response element)-binding protein family. Members of this family contain zinc-finger and bZIP DNA-binding domains. The encoded protein specifically binds to CRE as a homodimer or a heterodimer with c-Jun or CRE-BP1, and functions as a CRE-dependent trans-activator. Alternatively spliced transcript variants encoding different isoforms have been identified.",
"What is the function of the gene associated with SNP rs1188606225? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene.",
"What is the function of the gene associated with SNP rs902730377? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs1044115387? Let's decompose the question to sub-questions and solve them step by step.": "This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein with five C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the development of pancreatic beta cells, the thyroid, eye, liver and kidney. Mutations in this gene have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only two have been determined.",
"What is the function of the gene associated with SNP rs979980368? Let's decompose the question to sub-questions and solve them step by step.": "Involved in positive regulation of canonical Wnt signaling pathway. Located in nucleus.",
"What is the function of the gene associated with SNP rs1161130206? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs910422326? Let's decompose the question to sub-questions and solve them step by step.": "Predicted to be involved in establishment of mitotic spindle orientation and regulation of establishment of bipolar cell polarity. Predicted to act upstream of or within behavioral fear response; equilibrioception; and locomotor rhythm. Predicted to be active in spindle.",
"What is the function of the gene associated with SNP rs1035892430? Let's decompose the question to sub-questions and solve them step by step.": "The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene.",
"What is the function of the gene associated with SNP rs1255093658? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes a member of the teneurin transmembrane protein family. The encoded protein may be involved in the regulation of neuronal development including development of the visual pathway. Mutations in this gene have been associated with microphthalmia and developmental dysplasia of the hip.",
"What is the function of the gene associated with SNP rs1257276516? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs563369098? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs1032834815? Let's decompose the question to sub-questions and solve them step by step.": "Enables RNA binding activity. Predicted to act upstream of or within several processes, including negative regulation of osteoblast differentiation; substrate adhesion-dependent cell spreading; and type II pneumocyte differentiation. Predicted to be located in endoplasmic reticulum.",
"What is the function of the gene associated with SNP rs552952471? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants.",
"What is the function of the gene associated with SNP rs1452964195? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs949202492? Let's decompose the question to sub-questions and solve them step by step.": "The protein encoded by this gene is a neuronal calcium-binding protein that binds to and modulates the function of at least two receptors, adenosine A(2A) receptor and metabotropic glutamate receptor type 5.",
"What is the function of the gene associated with SNP rs1218214598? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs1022906840? Let's decompose the question to sub-questions and solve them step by step.": "Located in ciliary basal body.",
"What is the function of the gene associated with SNP rs1199372758? Let's decompose the question to sub-questions and solve them step by step.": "The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.",
"What is the function of the gene associated with SNP rs1396355441? Let's decompose the question to sub-questions and solve them step by step.": "The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene.",
"What is the function of the gene associated with SNP rs1432624213? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants.",
"What is the function of the gene associated with SNP rs937944577? Let's decompose the question to sub-questions and solve them step by step.": "This gene is a member of the intermediate filament family. Intermediate filaments are proteins which are primordial components of the cytoskeleton and nuclear envelope. The proteins encoded by the members of this gene family are evolutionarily and structurally related but have limited sequence homology, with the exception of the central rod domain. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.",
"What is the function of the gene associated with SNP rs1450106117? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator.",
"What is the function of the gene associated with SNP rs34083046? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described.",
"What is the function of the gene associated with SNP rs149916046? Let's decompose the question to sub-questions and solve them step by step.": "ncRNA",
"What is the function of the gene associated with SNP rs1385096481? Let's decompose the question to sub-questions and solve them step by step.": "This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation."
}
}