id
stringlengths 36
36
| question
stringlengths 243
1.57k
| opa
stringlengths 1
265
| opb
stringlengths 1
247
| opc
stringlengths 1
240
| opd
stringlengths 1
195
| cop
class label 4
classes | choice_type
stringclasses 2
values | exp
stringlengths 8
8.48k
⌀ | subject_name
stringclasses 21
values | topic_name
stringclasses 263
values | token_count
int64 101
359
| data
dict | Context
stringlengths 1
1.35k
| Question_formatted
stringlengths 2
1.39k
| Options
dict | Final_answer
stringlengths 4
250
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
e529be7c-f360-4dba-b313-7f3fc240697a
|
Which of the following statements are True/False? 1. Hirsutism, which is defined as androgen-dependent excessive male pattern hair growth, affects approximately 25% of women. 2. Virilization refers to a condition in which androgen levels are sufficiently high to cause additional signs and symptoms. 3. Frequently, patients with growth hormone excess (i.e., acromegaly) present with hirsutism. 4. A simple and commonly used method to grade hair growth is the modified scale of Ferriman and Gallwey. 5. Scores above 8 suggest excess androgen-mediated hair growth.
|
1, 2, 3 True & 4, 5 false
|
1, 3, 5 True & 2, 4 false
|
2, 4, 5 True & 1, 3 false
|
1, 2, 3, 4 True & 5 false
| 2c
|
multi
|
Here statement 1 & 3 are wrong. It is actually a direct pick from harrison, an impoant topic for entrance examinations hirsutism is seen in 10% of woman. Acromegaly rarely causes hirsutism. Ref: Harrisons Principles of Medicine, 18th Edition, Pages 380-382
|
Medicine
| null | 132 |
{
"Correct Answer": "2, 4, 5 True & 1, 3 false",
"Correct Option": "C",
"Options": {
"A": "1, 2, 3 True & 4, 5 false",
"B": "1, 3, 5 True & 2, 4 false",
"C": "2, 4, 5 True & 1, 3 false",
"D": "1, 2, 3, 4 True & 5 false"
},
"Question": "Which of the following statements are True/False? 1. Hirsutism, which is defined as androgen-dependent excessive male pattern hair growth, affects approximately 25% of women. 2. Virilization refers to a condition in which androgen levels are sufficiently high to cause additional signs and symptoms. 3. Frequently, patients with growth hormone excess (i.e., acromegaly) present with hirsutism. 4. A simple and commonly used method to grade hair growth is the modified scale of Ferriman and Gallwey. 5. Scores above 8 suggest excess androgen-mediated hair growth."
}
|
Which of the following statements are True/False? 1. Hirsutism, which is defined as androgen-dependent excessive male pattern hair growth, affects approximately 25% of women. 2. Virilization refers to a condition in which androgen levels are sufficiently high to cause additional signs and symptoms. 3. Frequently, patients with growth hormone excess (i.e., acromegaly) present with hirsutism. 4. A simple and commonly used method to grade hair growth is the modified scale of Ferriman and Gallwey. 5.
|
Scores above 8 suggest excess androgen-mediated hair growth.
|
{
"A": "1, 2, 3 True & 4, 5 false",
"B": "1, 3, 5 True & 2, 4 false",
"C": "2, 4, 5 True & 1, 3 false",
"D": "1, 2, 3, 4 True & 5 false"
}
|
C. 2, 4, 5 True & 1, 3 false
|
31868f6c-233a-40ee-880e-9c668509a8b1
|
An ill 16 days old baby girl is brought to the emergency. On examination pallor and dyspnoea present with a respiratory rate of 85 per minute. Her HR is 200 bpm, hea sounds are distant and a gallop is heard. X-ray showed cardiomegaly. An echocardiogram shows dilated ventricles and dilation of the left atrium. An ECG shows ventricular depolarization complexes that have low voltage. Which of the following is the most likely diagnosis?
|
CHF
|
Glycogen storage disease
|
Pericarditis
|
Aberrant left coronary aery arising from pulmonary aery
| 0a
|
multi
|
In CHF pallor, dyspnoea, tachypnoea, tachycardia and cardiomegaly are common regardless of the cause.The most common causes of CHF in children include myocarditis caused by adenovirus and coxsackievirus B.The echocardiogram shows ventricular and left atrial dilatation as well as poor ventricular function. With glycogen storage disease of the hea muscle thickening would be expected. With pericarditis- pericardial effusion is seen. On ECG, the voltages of the ventricular complexes seen with aberrant origin of the left coronary aery are not diminished, and a pattern of myocardial infarction can be seen. *
|
Pediatrics
|
Impoant Viral Diseases in Children
| 110 |
{
"Correct Answer": "CHF",
"Correct Option": "A",
"Options": {
"A": "CHF",
"B": "Glycogen storage disease",
"C": "Pericarditis",
"D": "Aberrant left coronary aery arising from pulmonary aery"
},
"Question": "An ill 16 days old baby girl is brought to the emergency. On examination pallor and dyspnoea present with a respiratory rate of 85 per minute. Her HR is 200 bpm, hea sounds are distant and a gallop is heard. X-ray showed cardiomegaly. An echocardiogram shows dilated ventricles and dilation of the left atrium. An ECG shows ventricular depolarization complexes that have low voltage. Which of the following is the most likely diagnosis?"
}
|
An ill 16 days old baby girl is brought to the emergency. On examination pallor and dyspnoea present with a respiratory rate of 85 per minute. Her HR is 200 bpm, hea sounds are distant and a gallop is heard. X-ray showed cardiomegaly. An echocardiogram shows dilated ventricles and dilation of the left atrium. An ECG shows ventricular depolarization complexes that have low voltage.
|
Which of the following is the most likely diagnosis?
|
{
"A": "CHF",
"B": "Glycogen storage disease",
"C": "Pericarditis",
"D": "Aberrant left coronary aery arising from pulmonary aery"
}
|
A. CHF
|
090f4f67-eab2-4ffc-a9d0-d03da739bf9f
|
A 19 year old female presents with pain in the neck for 5 days. She is not able to wear tie for her job because of neck pain. H/O fatigue and lethargy for 10 days. She had flu like symptoms 20 days ago which resolved spontaneously. BP 110/80 mmHg, Pulse 48/min. Extremities are cold and dry. Neck is very tender. ECG normal. TSH is elevated. ESR 30 mm/hr. Next appropriate step
|
Atropine injection
|
Levothyroxine administration
|
Aspirin
|
Increase iodine intake in food
| 2c
|
multi
|
Answer: c) Aspirin (SCHWARTZ 19TH ED, P-1525; SABISTON 19TH ED, P-895)Granulomatous or Subacute or De Quervain's thyroiditisMost commonly occurs in 30- 40 year-old womenStrong association with the HLA-B35Fever with Sudden or gradual onset of neck painH/o preceding URI; Viral etiologyGland - enlarged, tender, firmClassically progresses through four stages: Hyperthyroid-Euthyroid-Hypothyroid-EuthyroidA few patients develop recurrent diseaseEarly stages: | ESR, Tg, T4, and T3 levels are elevated, TSH decreasedDuring Hypothyroid stage: elevated TSHLow radio-iodine uptakeFNAC - multinucleated giant cells of an epithelioid foreign body type and aggregates of lymphocytes activated macrophages, and plasma cellsSelf-limiting diseaseAspirin and NSAIDs are used for pain reliefPrednisolone for severe casesShort-term thyroid replacement may be needed and may shorten the duration of symptoms
|
Surgery
|
Thyroid Gland
| 112 |
{
"Correct Answer": "Aspirin",
"Correct Option": "C",
"Options": {
"A": "Atropine injection",
"B": "Levothyroxine administration",
"C": "Aspirin",
"D": "Increase iodine intake in food"
},
"Question": "A 19 year old female presents with pain in the neck for 5 days. She is not able to wear tie for her job because of neck pain. H/O fatigue and lethargy for 10 days. She had flu like symptoms 20 days ago which resolved spontaneously. BP 110/80 mmHg, Pulse 48/min. Extremities are cold and dry. Neck is very tender. ECG normal. TSH is elevated. ESR 30 mm/hr. Next appropriate step"
}
|
A 19 year old female presents with pain in the neck for 5 days. She is not able to wear tie for her job because of neck pain. H/O fatigue and lethargy for 10 days. She had flu like symptoms 20 days ago which resolved spontaneously. BP 110/80 mmHg, Pulse 48/min. Extremities are cold and dry. Neck is very tender. ECG normal. TSH is elevated. ESR 30 mm/hr.
|
Next appropriate step
|
{
"A": "Atropine injection",
"B": "Levothyroxine administration",
"C": "Aspirin",
"D": "Increase iodine intake in food"
}
|
C. Aspirin
|
cbd91783-e901-4672-9ec1-7f58bce041da
|
A 74-year-old woman develops occipital headache, vomiting, and dizziness. She looks unwell, her blood pressure is 180/100 mm Hg, pulse is 70/min, and respirations are 30/min. She is unable to sit or walk because of unsteadiness. Over the next few hours, she develops a decline in her level of consciousness.For the above patient with altered level of consciousness, select the most likely diagnosis.
|
basal ganglia hemorrhage
|
cerebellar hemorrhage
|
pontine hemorrhage
|
lobar intracerebral hemorrhage
| 1b
|
multi
|
Cerebellar hemorrhage, when mild, may present with only headache, vomiting, and ataxia of gait. Patients may complain of dizziness or vertigo. The eyes may be deviated to the side opposite the hemorrhage. Nystagmus is not common, but an ipsilateral sixth nerve palsy can occur. This is the only type of intracerebral hemorrhage that commonly benefits from surgical intervention.
|
Medicine
|
C.N.S.
| 101 |
{
"Correct Answer": "cerebellar hemorrhage",
"Correct Option": "B",
"Options": {
"A": "basal ganglia hemorrhage",
"B": "cerebellar hemorrhage",
"C": "pontine hemorrhage",
"D": "lobar intracerebral hemorrhage"
},
"Question": "A 74-year-old woman develops occipital headache, vomiting, and dizziness. She looks unwell, her blood pressure is 180/100 mm Hg, pulse is 70/min, and respirations are 30/min. She is unable to sit or walk because of unsteadiness. Over the next few hours, she develops a decline in her level of consciousness.For the above patient with altered level of consciousness, select the most likely diagnosis."
}
|
A 74-year-old woman develops occipital headache, vomiting, and dizziness. She looks unwell, her blood pressure is 180/100 mm Hg, pulse is 70/min, and respirations are 30/min. She is unable to sit or walk because of unsteadiness.
|
Over the next few hours, she develops a decline in her level of consciousness.For the above patient with altered level of consciousness, select the most likely diagnosis.
|
{
"A": "basal ganglia hemorrhage",
"B": "cerebellar hemorrhage",
"C": "pontine hemorrhage",
"D": "lobar intracerebral hemorrhage"
}
|
B. cerebellar hemorrhage
|
d5d03cd8-055b-49bf-9b2d-4b8dc3fd6b4d
|
A 68-year-old man is admitted to the coronary care unit with an acute myocardial infarction. His postinfarction course is marked by congestive hea failure and intermittent hypotension. On the fouh day in hospital, he develops severe midabdominal pain. On physical examination, blood pressure is 90/60 mm Hg and pulse is 110 beats per minute and regular; the abdomen is soft with mild generalized tenderness and distention. Bowel sounds are hypoactive; stool Hematest is positive. Which of the following is the most appropriate next step in this patient's management?
|
Barium enema
|
Upper gastrointestinal series
|
Angiography
|
Ultrasonography
| 2c
|
multi
|
In the absence of peritoneal signs, angiography is the diagnostic test of choice for acute mesenteric ischemia. Patients with peritoneal signs should undergo emergent laparotomy. Acute mesenteric ischemia may be difficult to diagnose. The condition should be suspected in patients with either systemic manifestations of aeriosclerotic vascular disease or low cardiac-output states associated with a sudden development of abdominal pain that is out of propoion to the physical findings. Because of the risk of progression to small-bowel infarction, acute mesenteric ischemia is an emergency and timely diagnosis is essential. Although patients may have lactic acidosis or leukocytosis, these are late findings. Abdominal films are generally unhelpful and may show a nonspecific ileus pattern. Since the pathology involves the small bowel, a barium enema is not indicated. Upper gastrointestinal series and ultrasonography are also of limited value. CT scanning is a good initial test, but should still be followed by angiography in a patient with clinically suspected acute mesenteric ischemia, even in the absence of findings on the CT scan. In addition to establishing the diagnosis in this stable patient, angiography may also assist with operative planning and elucidation of the etiology of the acute mesenteric ischemia. The cause may be embolic occlusion or thrombosis of the superior mesenteric aery, primary mesenteric venous occlusion, or nonocclusive mesenteric ischemia secondary to low-cardiac output states. A moality of 50% to 75% is repoed. The majority of affected patients are at high operative risk, but early diagnosis followed by revascularization or resectional surgery or both are the only hope for survival. Celiotomy must be performed once the diagnosis of aerial occlusion or bowel infarction has been made. Initial treatment of nonocclusive mesenteric ischemia includes measures to increase cardiac output and blood pressure. Laparotomy should be performed if peritoneal signs develop
|
Anaesthesia
|
Preoperative assessment and monitoring in anaesthesia
| 132 |
{
"Correct Answer": "Angiography",
"Correct Option": "C",
"Options": {
"A": "Barium enema",
"B": "Upper gastrointestinal series",
"C": "Angiography",
"D": "Ultrasonography"
},
"Question": "A 68-year-old man is admitted to the coronary care unit with an acute myocardial infarction. His postinfarction course is marked by congestive hea failure and intermittent hypotension. On the fouh day in hospital, he develops severe midabdominal pain. On physical examination, blood pressure is 90/60 mm Hg and pulse is 110 beats per minute and regular; the abdomen is soft with mild generalized tenderness and distention. Bowel sounds are hypoactive; stool Hematest is positive. Which of the following is the most appropriate next step in this patient's management?"
}
|
A 68-year-old man is admitted to the coronary care unit with an acute myocardial infarction. His postinfarction course is marked by congestive hea failure and intermittent hypotension. On the fouh day in hospital, he develops severe midabdominal pain. On physical examination, blood pressure is 90/60 mm Hg and pulse is 110 beats per minute and regular; the abdomen is soft with mild generalized tenderness and distention. Bowel sounds are hypoactive; stool Hematest is positive.
|
Which of the following is the most appropriate next step in this patient's management?
|
{
"A": "Barium enema",
"B": "Upper gastrointestinal series",
"C": "Angiography",
"D": "Ultrasonography"
}
|
C. Angiography
|
226c17a9-13fe-4496-bc2e-5aabce4fef1c
|
A 2-week-old baby is irritable and feeding poorly. On physical examination, the infant is irritable, diaphoretic, tachypneic and tachycardic. There is circumoral cyanosis, which is not alleted by nasal oxygen. A systolic thrill and holosystolic murmur are heard along the left sternal border. An echocardiogram reveals a hea defect in which the aoa and pulmonary aery form a single vessel that overrides a ventricular septal defect. What is the appropriate diagnosis?
|
Atrial septal defect
|
Coarctation of aoa, preductal
|
Patent ductus aeriosus
|
Truncus aeriosus
| 3d
|
multi
|
Truncus aeriosus refers to a common trunk for the origin of the aoa, pulmonary aeries and coronary aeries. It results from absent or incomplete paitioning of the truncus aeriosus by the spiral septum during development. Most infants with persistent truncus aeriosus have torrential pulmonary blood flow, which leads to hea failure. None of the other choices are distinguished by a single vessel that carries blood from the hea.
|
Pathology
|
Cardiac disorders
| 115 |
{
"Correct Answer": "Truncus aeriosus",
"Correct Option": "D",
"Options": {
"A": "Atrial septal defect",
"B": "Coarctation of aoa, preductal",
"C": "Patent ductus aeriosus",
"D": "Truncus aeriosus"
},
"Question": "A 2-week-old baby is irritable and feeding poorly. On physical examination, the infant is irritable, diaphoretic, tachypneic and tachycardic. There is circumoral cyanosis, which is not alleted by nasal oxygen. A systolic thrill and holosystolic murmur are heard along the left sternal border. An echocardiogram reveals a hea defect in which the aoa and pulmonary aery form a single vessel that overrides a ventricular septal defect. What is the appropriate diagnosis?"
}
|
A 2-week-old baby is irritable and feeding poorly. On physical examination, the infant is irritable, diaphoretic, tachypneic and tachycardic. There is circumoral cyanosis, which is not alleted by nasal oxygen. A systolic thrill and holosystolic murmur are heard along the left sternal border. An echocardiogram reveals a hea defect in which the aoa and pulmonary aery form a single vessel that overrides a ventricular septal defect.
|
What is the appropriate diagnosis?
|
{
"A": "Atrial septal defect",
"B": "Coarctation of aoa, preductal",
"C": "Patent ductus aeriosus",
"D": "Truncus aeriosus"
}
|
D. Truncus aeriosus
|
66cb240a-b8a0-402c-9a9f-1e0a0ffe3551
|
A 44-year-old businessman presents to a physician because of a markedly inflammed and painful right great toe. He states that he just returned from a convention, and had noticed increasing pain in his right foot during his flight back home. Physical examination is remarkable for swelling and erythema of the right great toe as well as small nodules on the patient's external ear. Aspiration of the metatarsal-phalangeal joint of the affected toe demonstrates needle-shaped negatively birefringent crystals. Which of the following agents would provide the most immediate relief for this patient?
|
Allopurinol
|
Aspirin
|
Colchicine
|
Probenecid
| 2c
|
multi
|
The patient has gout, which is due to precipitation of monosodium urate crystals in joint spaces (notably the great toe) and soft tissues (causing tophi, which are often found on the external ears). Colchicine reduces the inflammation caused by the urate crystals by inhibiting leukocyte migration and phagocytosis secondary to an effect on microtubule assembly. Allopurinol and its metabolite, oxypurinol, inhibit xanthine oxidase, the enzyme that forms uric acid from hypoxanthine. Therapy with this agent should be begun 1-2 weeks after the acute attack has subsided. Aspirin competes with uric acid for tubular secretion, thereby decreasing urinary urate excretion and raising serum uric acid levels. At high doses (more than 2 gm daily) aspirin is a uricosuric. Probenecid and sulfinpyrazone are uricosuric agents, increasing the urinary excretion of uric acid, hence decreasing serum levels of the substance. Therapy with these agents should be begun 1-2 weeks after the acute attack has subsided.
|
Pharmacology
| null | 119 |
{
"Correct Answer": "Colchicine",
"Correct Option": "C",
"Options": {
"A": "Allopurinol",
"B": "Aspirin",
"C": "Colchicine",
"D": "Probenecid"
},
"Question": "A 44-year-old businessman presents to a physician because of a markedly inflammed and painful right great toe. He states that he just returned from a convention, and had noticed increasing pain in his right foot during his flight back home. Physical examination is remarkable for swelling and erythema of the right great toe as well as small nodules on the patient's external ear. Aspiration of the metatarsal-phalangeal joint of the affected toe demonstrates needle-shaped negatively birefringent crystals. Which of the following agents would provide the most immediate relief for this patient?"
}
|
A 44-year-old businessman presents to a physician because of a markedly inflammed and painful right great toe. He states that he just returned from a convention, and had noticed increasing pain in his right foot during his flight back home. Physical examination is remarkable for swelling and erythema of the right great toe as well as small nodules on the patient's external ear. Aspiration of the metatarsal-phalangeal joint of the affected toe demonstrates needle-shaped negatively birefringent crystals.
|
Which of the following agents would provide the most immediate relief for this patient?
|
{
"A": "Allopurinol",
"B": "Aspirin",
"C": "Colchicine",
"D": "Probenecid"
}
|
C. Colchicine
|
9ec100e0-c6b0-4164-b3c6-a2685e2a4cd3
|
A 4-month-old infant has undergone surgical treatment for meningomyeloencephalocele. At bih, an operation was carried out in the posterior cranial fossa to paially replace brain cerebellar contents to an intracranial position. In investigations for progressive hydrocephalus, it is noted that there is herniation of the cerebellar tonsils through the foramen magnum, and a diagnosis of Arnold-Chiari syndrome is established. This syndrome may also include which of the following?
|
Fusion of the frontal lobes
|
Fusion of the temporal, parietal, and occipital lobes
|
Abnormal elongation of the medulla and lower cranial nerves
|
Paial or complete absence of the pituitary gland
| 2c
|
multi
|
Abnormal elongation of the medulla and lower cranial nerves may be evident in Arnold-Chiari syndrome. Additional features include fusion of the corpora quadrigemina, leading to a "beaked" tectum; paial or complete absence of the corpus callosum; and microgyria.
|
Surgery
|
Cerebrovascular Diseases
| 105 |
{
"Correct Answer": "Abnormal elongation of the medulla and lower cranial nerves",
"Correct Option": "C",
"Options": {
"A": "Fusion of the frontal lobes",
"B": "Fusion of the temporal, parietal, and occipital lobes",
"C": "Abnormal elongation of the medulla and lower cranial nerves",
"D": "Paial or complete absence of the pituitary gland"
},
"Question": "A 4-month-old infant has undergone surgical treatment for meningomyeloencephalocele. At bih, an operation was carried out in the posterior cranial fossa to paially replace brain cerebellar contents to an intracranial position. In investigations for progressive hydrocephalus, it is noted that there is herniation of the cerebellar tonsils through the foramen magnum, and a diagnosis of Arnold-Chiari syndrome is established. This syndrome may also include which of the following?"
}
|
A 4-month-old infant has undergone surgical treatment for meningomyeloencephalocele. At bih, an operation was carried out in the posterior cranial fossa to paially replace brain cerebellar contents to an intracranial position. In investigations for progressive hydrocephalus, it is noted that there is herniation of the cerebellar tonsils through the foramen magnum, and a diagnosis of Arnold-Chiari syndrome is established.
|
This syndrome may also include which of the following?
|
{
"A": "Fusion of the frontal lobes",
"B": "Fusion of the temporal, parietal, and occipital lobes",
"C": "Abnormal elongation of the medulla and lower cranial nerves",
"D": "Paial or complete absence of the pituitary gland"
}
|
C. Abnormal elongation of the medulla and lower cranial nerves
|
c2c522e9-595e-4327-a763-7eb93c7fcb88
|
A 68-year-old male is brought to the outpatient by his wife due to increasing forgetfulness. On taking history in details, wife repoed that for around 6 months patient is having trouble in organising the finances and paying bills, something he has done all his life. He has also become withdrawn and has decreased meeting people. The patient also behaved inappropriately with a female neighbour couple of says back, which is much against his usual nature. The patient denies having any problems and seems indifferent to his wife's concern. He has a medical history of hypeension and type 2 diabetes mellitus There is a family history of Alzheimer disease. On MMSE, score came out to be 23. Which of the following is the most likely diagnosis?
|
Alzheimer disease
|
Creutzfeldt-Jakob disease
|
Dementia with Lewy bodies
|
Frontotemporal dementia
| 3d
|
multi
|
The history is suggestive of executive dysfunction (trouble in organising the finances and paying bills), apathy and disinhibition (decreased socialisation and inappropriate behaviour with women), lack of insight (denies having any problem) and memory disturbances. This is suggestive of frontotemporal dementia, in which personality changes are prominent, memory disturbances appear later in frontotemporal dementia. In contrast, in alzheimers disease memory disturbances are prominent early in the disorder and personality changes later. Creutzfeldt-Jakob disease which is caused by a prion manifests with rapidly progressive dementia, myoclonus, and cerebellar dysfunction.
|
Psychiatry
|
Organic Mental Disorders
| 154 |
{
"Correct Answer": "Frontotemporal dementia",
"Correct Option": "D",
"Options": {
"A": "Alzheimer disease",
"B": "Creutzfeldt-Jakob disease",
"C": "Dementia with Lewy bodies",
"D": "Frontotemporal dementia"
},
"Question": "A 68-year-old male is brought to the outpatient by his wife due to increasing forgetfulness. On taking history in details, wife repoed that for around 6 months patient is having trouble in organising the finances and paying bills, something he has done all his life. He has also become withdrawn and has decreased meeting people. The patient also behaved inappropriately with a female neighbour couple of says back, which is much against his usual nature. The patient denies having any problems and seems indifferent to his wife's concern. He has a medical history of hypeension and type 2 diabetes mellitus There is a family history of Alzheimer disease. On MMSE, score came out to be 23. Which of the following is the most likely diagnosis?"
}
|
A 68-year-old male is brought to the outpatient by his wife due to increasing forgetfulness. On taking history in details, wife repoed that for around 6 months patient is having trouble in organising the finances and paying bills, something he has done all his life. He has also become withdrawn and has decreased meeting people. The patient also behaved inappropriately with a female neighbour couple of says back, which is much against his usual nature. The patient denies having any problems and seems indifferent to his wife's concern. He has a medical history of hypeension and type 2 diabetes mellitus There is a family history of Alzheimer disease. On MMSE, score came out to be 23.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Alzheimer disease",
"B": "Creutzfeldt-Jakob disease",
"C": "Dementia with Lewy bodies",
"D": "Frontotemporal dementia"
}
|
D. Frontotemporal dementia
|
6459cbf2-9cb5-4d04-bfc3-f75278df9306
|
A 10-year-old male child with sho stature presented to the pediatric OPD with complaints of frequent headaches over the past 6 months along with slowly progressive loss of vision of the right eye. Lately the child has also staed having trouble in walking along with frequent mood changes and excessive thirst. MRI brain showed a tumour in the sellar region which was resected. HPE examination showed reticular epithelial cells that have appearances reminiscent of the enamel pulp of developing teeth along with calcifications and wet keratin nodules. The gene involved in causing the above condition is also involved in causing which other condition: -
|
Hepatocellular carcinoma
|
Melanoma
|
Neuroblastoma
|
CML
| 0a
|
multi
|
This is a case of Craniopharyngioma. Benign tumour Arise in sellar/suprasellar region Arise from vestigial remnants of Rathke's pouch Bimodal age distribution Presents with headache and visual disturbance May present with sho stature due to GH deficiency (Pituitary hypofunction). Most commonly due to abnormalities in WNT signaling pathway including the activating mutations of the beta-catenin. MRI image shows a mass in the suprasellar region- likely craniopharyngioma OTHER CANCERS DUE TO WNT PATHWAY Mutations in b-catenin are present in: - 50% of hepatoblastomas. 20% of Hepatocellular carcinomas GENES INVOLVED IN: - Melanoma- NRAS, FGF3, HST1 Neuroblastoma- N-MYC, ALK CML- ABL
|
Unknown
|
Integrated QBank
| 128 |
{
"Correct Answer": "Hepatocellular carcinoma",
"Correct Option": "A",
"Options": {
"A": "Hepatocellular carcinoma",
"B": "Melanoma",
"C": "Neuroblastoma",
"D": "CML"
},
"Question": "A 10-year-old male child with sho stature presented to the pediatric OPD with complaints of frequent headaches over the past 6 months along with slowly progressive loss of vision of the right eye. Lately the child has also staed having trouble in walking along with frequent mood changes and excessive thirst. MRI brain showed a tumour in the sellar region which was resected. HPE examination showed reticular epithelial cells that have appearances reminiscent of the enamel pulp of developing teeth along with calcifications and wet keratin nodules. The gene involved in causing the above condition is also involved in causing which other condition: -"
}
|
A 10-year-old male child with sho stature presented to the pediatric OPD with complaints of frequent headaches over the past 6 months along with slowly progressive loss of vision of the right eye. Lately the child has also staed having trouble in walking along with frequent mood changes and excessive thirst. MRI brain showed a tumour in the sellar region which was resected. HPE examination showed reticular epithelial cells that have appearances reminiscent of the enamel pulp of developing teeth along with calcifications and wet keratin nodules.
|
The gene involved in causing the above condition is also involved in causing which other condition: -
|
{
"A": "Hepatocellular carcinoma",
"B": "Melanoma",
"C": "Neuroblastoma",
"D": "CML"
}
|
A. Hepatocellular carcinoma
|
76c1bec9-32e2-4a59-94e6-bb791855bec6
|
A 40-year-old intravenous drug user presents to the emergency depament with a 2 days history of right knee pain with associated swelling and erythema. The patient is febrile with a holosystolic murmur at the right lower sternal border. Complete blood count reveals leukocytosis. Blood and synol fluid cultures are sent, and broad-spectrum antibiotics are staed. Synol fluid analysis is pending. What is the most likely pathogen causing these symptoms
|
Neisseria gonorrhoeae
|
Pseudomonas aeruginosa
|
Borrelia burgdorferi
|
Staphylococcus aureus
| 3d
|
single
|
Gram-positive bacteria remain the most common cause of septic ahritis. Staphylococcus aureus accounts for the majority of culture-positive septic ahritis, especially within ceain patient subgroups such as hemodialysis patients and intravenous drug abusers. The predominance of S. aureus in septic ahritis has remained unchanged for many years.
|
Orthopaedics
|
Thigh, Knee,Leg,Foot & Ankle injuries
| 101 |
{
"Correct Answer": "Staphylococcus aureus",
"Correct Option": "D",
"Options": {
"A": "Neisseria gonorrhoeae",
"B": "Pseudomonas aeruginosa",
"C": "Borrelia burgdorferi",
"D": "Staphylococcus aureus"
},
"Question": "A 40-year-old intravenous drug user presents to the emergency depament with a 2 days history of right knee pain with associated swelling and erythema. The patient is febrile with a holosystolic murmur at the right lower sternal border. Complete blood count reveals leukocytosis. Blood and synol fluid cultures are sent, and broad-spectrum antibiotics are staed. Synol fluid analysis is pending. What is the most likely pathogen causing these symptoms"
}
|
A 40-year-old intravenous drug user presents to the emergency depament with a 2 days history of right knee pain with associated swelling and erythema. The patient is febrile with a holosystolic murmur at the right lower sternal border. Complete blood count reveals leukocytosis. Blood and synol fluid cultures are sent, and broad-spectrum antibiotics are staed. Synol fluid analysis is pending.
|
What is the most likely pathogen causing these symptoms
|
{
"A": "Neisseria gonorrhoeae",
"B": "Pseudomonas aeruginosa",
"C": "Borrelia burgdorferi",
"D": "Staphylococcus aureus"
}
|
D. Staphylococcus aureus
|
daf61c69-6951-485c-b98e-5e85aa3c5120
|
A 25 years old female complains of recurrent rhinitis, nasal discharge and bilateral nasal blockage since one year. She has the history of asthma and allergy. On examination, multiple ethmoidal polyps are noted with mucosal thickening and impacted secretions in both the nasal cavities. A biopsy is taken and the material is cultured which shown the growth of many non pigmented septate hyphae with dichotomous branching typically at 45degrees. Which of the following is the most likely responsible organism
|
Aspergillus fumigatus
|
Rhizopus
|
Mucor
|
Candida
| 0a
|
multi
|
Aspergillus shows typical dichotomous branching at an angle of approximately 45degrees. Candida shows pseudohyphae. Rhizopus and mucor shows nonseptate hyphae. Reference: Textbook of Microbiology; Baveja; 4th edition
|
Microbiology
|
mycology
| 108 |
{
"Correct Answer": "Aspergillus fumigatus",
"Correct Option": "A",
"Options": {
"A": "Aspergillus fumigatus",
"B": "Rhizopus",
"C": "Mucor",
"D": "Candida"
},
"Question": "A 25 years old female complains of recurrent rhinitis, nasal discharge and bilateral nasal blockage since one year. She has the history of asthma and allergy. On examination, multiple ethmoidal polyps are noted with mucosal thickening and impacted secretions in both the nasal cavities. A biopsy is taken and the material is cultured which shown the growth of many non pigmented septate hyphae with dichotomous branching typically at 45degrees. Which of the following is the most likely responsible organism"
}
|
A 25 years old female complains of recurrent rhinitis, nasal discharge and bilateral nasal blockage since one year. She has the history of asthma and allergy. On examination, multiple ethmoidal polyps are noted with mucosal thickening and impacted secretions in both the nasal cavities. A biopsy is taken and the material is cultured which shown the growth of many non pigmented septate hyphae with dichotomous branching typically at 45degrees.
|
Which of the following is the most likely responsible organism
|
{
"A": "Aspergillus fumigatus",
"B": "Rhizopus",
"C": "Mucor",
"D": "Candida"
}
|
A. Aspergillus fumigatus
|
fb22bfc1-6edc-4099-9d59-5ab1aec761e2
|
Ten days after an exploratory laparotomy and lysis of adhesions, a patient, who previously underwent a low anterior resection for rectal cancer followed by postoperative chemoradiation, is noted to have succus draining from the wound. She appears to have adequate source control--she is afebrile with a normal white blood count. The output from the fistula is approximately 150 cc per day. Which of the following factors is most likely to prevent closure of the enterocutaneous fistula?
|
Previous radiation
|
Previous chemotherapy
|
Recent surgery
|
History of malignancy
| 0a
|
single
|
Factors that predispose to fistula formation and may prevent closure include foreign body, radiation, inflammation, epithelialization of the tract, neoplasm, distal obstruction, and steroids.Factors that result in unhealthy or abnormal tissue surrounding the enterocutaneous fistula decrease the likelihood of spontaneous resolution. For example, radiation therapy, such as used for treatment of pelvic gynecologic and rectal malignancies, can result in chronic injury to the small intestine characterized by fibrosis and poor wound healing. High-output fistulas, defined as those with more than 500 cc per day output, are usually proximal and unlikely to close. Treatment consists of source control, nutritional supplementation, wound care, and delayed surgical intervention if the fistula fails to close.
|
Anaesthesia
|
Preoperative assessment and monitoring in anaesthesia
| 110 |
{
"Correct Answer": "Previous radiation",
"Correct Option": "A",
"Options": {
"A": "Previous radiation",
"B": "Previous chemotherapy",
"C": "Recent surgery",
"D": "History of malignancy"
},
"Question": "Ten days after an exploratory laparotomy and lysis of adhesions, a patient, who previously underwent a low anterior resection for rectal cancer followed by postoperative chemoradiation, is noted to have succus draining from the wound. She appears to have adequate source control--she is afebrile with a normal white blood count. The output from the fistula is approximately 150 cc per day. Which of the following factors is most likely to prevent closure of the enterocutaneous fistula?"
}
|
Ten days after an exploratory laparotomy and lysis of adhesions, a patient, who previously underwent a low anterior resection for rectal cancer followed by postoperative chemoradiation, is noted to have succus draining from the wound. She appears to have adequate source control--she is afebrile with a normal white blood count. The output from the fistula is approximately 150 cc per day.
|
Which of the following factors is most likely to prevent closure of the enterocutaneous fistula?
|
{
"A": "Previous radiation",
"B": "Previous chemotherapy",
"C": "Recent surgery",
"D": "History of malignancy"
}
|
A. Previous radiation
|
f8d1aab7-88d9-4a6a-982d-8f8ad20ddd8a
|
A 33-year-old male immigrant from Taiwan presents with increasing right upper quadrant (RUQ) pain. The pain is dull, and it does not radiate or change with eating. On examination the abdomen is soft, there is a mass in the RUQ, and no ascites is clinically detected. He has a prior history of hepatitis B. His laboratory investigations reveal hepatitis B surface antigen (HBsAg) positive, hepatitis B surface antibody (HBsAb) negative, aspartate amino transferase (AST) 60 U/L, alanine amino transferase (ALT) 72 U/L, and an elevated alpha-fetoprotein level. Which of the following is the most likely diagnosis?
|
hepatoma
|
hepatocellular carcinoma (HCC)
|
metastatic cancer
|
hepatic hemangioma
| 1b
|
multi
|
(b) Source: (Devita, pp. 533-534) Only the chronic carrier state increases HCC risk, not previous infection. The majority, but not all, of HCC associated with HBV occurs in the setting of cirrhosis (60-90%). Because the latency period of HBV infection is 35 years, before HCC supervenes, early-life infection is strongly correlated with HCC. The chronic carrier state of HBsAg in endemic areas, such as Taiwan, is associated with a relative risk of over 100 for the development of HCC. Over half the chronic carriers of HBsAg in such a population will die of cirrhosis or HCC. In Taiwan, where childhood vaccination was introduced in 1984, the death rate from childhood HCC has already declined.
|
Medicine
|
Oncology
| 147 |
{
"Correct Answer": "hepatocellular carcinoma (HCC)",
"Correct Option": "B",
"Options": {
"A": "hepatoma",
"B": "hepatocellular carcinoma (HCC)",
"C": "metastatic cancer",
"D": "hepatic hemangioma"
},
"Question": "A 33-year-old male immigrant from Taiwan presents with increasing right upper quadrant (RUQ) pain. The pain is dull, and it does not radiate or change with eating. On examination the abdomen is soft, there is a mass in the RUQ, and no ascites is clinically detected. He has a prior history of hepatitis B. His laboratory investigations reveal hepatitis B surface antigen (HBsAg) positive, hepatitis B surface antibody (HBsAb) negative, aspartate amino transferase (AST) 60 U/L, alanine amino transferase (ALT) 72 U/L, and an elevated alpha-fetoprotein level. Which of the following is the most likely diagnosis?"
}
|
A 33-year-old male immigrant from Taiwan presents with increasing right upper quadrant (RUQ) pain. The pain is dull, and it does not radiate or change with eating. On examination the abdomen is soft, there is a mass in the RUQ, and no ascites is clinically detected. He has a prior history of hepatitis B. His laboratory investigations reveal hepatitis B surface antigen (HBsAg) positive, hepatitis B surface antibody (HBsAb) negative, aspartate amino transferase (AST) 60 U/L, alanine amino transferase (ALT) 72 U/L, and an elevated alpha-fetoprotein level.
|
Which of the following is the most likely diagnosis?
|
{
"A": "hepatoma",
"B": "hepatocellular carcinoma (HCC)",
"C": "metastatic cancer",
"D": "hepatic hemangioma"
}
|
B. hepatocellular carcinoma (HCC)
|
8ac9640d-d878-4003-8341-2eea055157f8
|
A 60-year-old man presents to the emergency department with chest pain described as retrosternal chest pressure radiating to the jaw. The symptoms started at rest and coming and going, but never lasting more than 15 minutes. He has a prior history of hypertension and smokes 1 pack/day. He is currently chest-pain free and on physical examination the blood pressure is 156/88 mmHg, pulse 88/min, and O2 saturation 98%. The heart and lung examination is normal.His ECG shows ST-segment depression in leads V1 to V4 that is new, and the first set of cardiac enzymes is negative. He is diagnosed with unstable angina pectoris, admitted to a monitored unit, and started on low molecular weight heparin, aspirin, nitroglycerin, and beta- adrenergic blockers. He continues to have ongoing chest pain symptoms. Which of the following is the most appropriate next step in management?
|
IV streptokinase
|
coronary angiography
|
exercise testing
|
oral aspirin
| 1b
|
multi
|
A period of 24-48 hours is usually allowed to attempt medical therapy. Cardiac catheterization and angiography may be followed by bypass surgery or angioplasty. For those who do settle down, some form of subsequent risk stratification (e.g., exercise ECG) is indicated.
|
Medicine
|
C.V.S.
| 207 |
{
"Correct Answer": "coronary angiography",
"Correct Option": "B",
"Options": {
"A": "IV streptokinase",
"B": "coronary angiography",
"C": "exercise testing",
"D": "oral aspirin"
},
"Question": "A 60-year-old man presents to the emergency department with chest pain described as retrosternal chest pressure radiating to the jaw. The symptoms started at rest and coming and going, but never lasting more than 15 minutes. He has a prior history of hypertension and smokes 1 pack/day. He is currently chest-pain free and on physical examination the blood pressure is 156/88 mmHg, pulse 88/min, and O2 saturation 98%. The heart and lung examination is normal.His ECG shows ST-segment depression in leads V1 to V4 that is new, and the first set of cardiac enzymes is negative. He is diagnosed with unstable angina pectoris, admitted to a monitored unit, and started on low molecular weight heparin, aspirin, nitroglycerin, and beta- adrenergic blockers. He continues to have ongoing chest pain symptoms. Which of the following is the most appropriate next step in management?"
}
|
A 60-year-old man presents to the emergency department with chest pain described as retrosternal chest pressure radiating to the jaw. The symptoms started at rest and coming and going, but never lasting more than 15 minutes. He has a prior history of hypertension and smokes 1 pack/day. He is currently chest-pain free and on physical examination the blood pressure is 156/88 mmHg, pulse 88/min, and O2 saturation 98%. The heart and lung examination is normal.His ECG shows ST-segment depression in leads V1 to V4 that is new, and the first set of cardiac enzymes is negative. He is diagnosed with unstable angina pectoris, admitted to a monitored unit, and started on low molecular weight heparin, aspirin, nitroglycerin, and beta- adrenergic blockers. He continues to have ongoing chest pain symptoms.
|
Which of the following is the most appropriate next step in management?
|
{
"A": "IV streptokinase",
"B": "coronary angiography",
"C": "exercise testing",
"D": "oral aspirin"
}
|
B. coronary angiography
|
9dbfe50d-9f1b-40f7-9d22-086482e85b07
|
A child is taken to a pediatrician because his mother notices that his eyes appear very puffy. The mother said that the boy's eyes appeared normal two days ago, and pa of what caused her concern was that her child seemed to be rapidly becoming ill. On physical examination, the boy is noted to have generalized edema. No hypeension or jaundice is noted. Blood urea nitrogen and serum creatinine are within normal limits. A urine sample is collected, and the nurse notices that the top of the urine has a small amount of foam at the top. Urinalysis is negative for glucose, red cells, white cells, casts, crystals, and bacteria. A 24-hr-urine specimen is collected, which demonstrates proteinuria of 55 mg/h/m2. Which of the following is the most likely diagnosis?
|
Acute renal failure
|
Chronic renal failure
|
Lower urinary tract disease
|
Nephrotic syndrome
| 3d
|
multi
|
Proteinuria greater than 40 mg/h/m2 in a child or 3.5 g/d/1.73 m2 in an adult produces nephrotic syndrome, which is characterized by generalized edema, often most noticeable in the face. The condition develops when large amounts of protein are spilled through the glomeruli into the duct system of the kidneys. In contrast, nephritic syndrome is accompanied by lower levels of proteinuria, together with microscopic or macroscopic hematuria (red cells and blood in urine). Acute and chronic renal failure are characterized by rising serum levels of BUN and creatinine. The findings seen do not suggest lower urinary tract disease, which is typically due to a lower urinary tract infection (which would show bacteria and white cells), calculi (crystals would likely be present), or tumor (which would show abnormal bladder epithelial cells).
|
Pediatrics
| null | 173 |
{
"Correct Answer": "Nephrotic syndrome",
"Correct Option": "D",
"Options": {
"A": "Acute renal failure",
"B": "Chronic renal failure",
"C": "Lower urinary tract disease",
"D": "Nephrotic syndrome"
},
"Question": "A child is taken to a pediatrician because his mother notices that his eyes appear very puffy. The mother said that the boy's eyes appeared normal two days ago, and pa of what caused her concern was that her child seemed to be rapidly becoming ill. On physical examination, the boy is noted to have generalized edema. No hypeension or jaundice is noted. Blood urea nitrogen and serum creatinine are within normal limits. A urine sample is collected, and the nurse notices that the top of the urine has a small amount of foam at the top. Urinalysis is negative for glucose, red cells, white cells, casts, crystals, and bacteria. A 24-hr-urine specimen is collected, which demonstrates proteinuria of 55 mg/h/m2. Which of the following is the most likely diagnosis?"
}
|
A child is taken to a pediatrician because his mother notices that his eyes appear very puffy. The mother said that the boy's eyes appeared normal two days ago, and pa of what caused her concern was that her child seemed to be rapidly becoming ill. On physical examination, the boy is noted to have generalized edema. No hypeension or jaundice is noted. Blood urea nitrogen and serum creatinine are within normal limits. A urine sample is collected, and the nurse notices that the top of the urine has a small amount of foam at the top. Urinalysis is negative for glucose, red cells, white cells, casts, crystals, and bacteria. A 24-hr-urine specimen is collected, which demonstrates proteinuria of 55 mg/h/m2.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Acute renal failure",
"B": "Chronic renal failure",
"C": "Lower urinary tract disease",
"D": "Nephrotic syndrome"
}
|
D. Nephrotic syndrome
|
4db14beb-81b4-4ff3-a091-adf901ae0570
|
A 44-year-old renal transplant patient develops severe cough and shortness of breath on exertion. On examination, he appears dyspneic, respirations 24/min, pulse 110/min, and oxygen saturation 88%. His lungs are clear on auscultation and heart sounds are normal. CXR shows bilateral diffuse perihilar infiltrates. Bronchoscopy and bronchial brushings show clusters of cysts that stain with methenamine silver. Which of the following is the most appropriate next step in management?
|
amphotericin B
|
cephalosporins
|
trimethoprim-sulfamethoxazole
|
aminoglycosides
| 2c
|
multi
|
The patient is infected with Pneumocystis organisms invading an immunocompromised host. The treatment of choice is trimethoprim-sulfamethoxazole. Alternate therapies include pentamidine (highly toxic) and trimetrexate plus folinic acid.
|
Medicine
|
Infection
| 113 |
{
"Correct Answer": "trimethoprim-sulfamethoxazole",
"Correct Option": "C",
"Options": {
"A": "amphotericin B",
"B": "cephalosporins",
"C": "trimethoprim-sulfamethoxazole",
"D": "aminoglycosides"
},
"Question": "A 44-year-old renal transplant patient develops severe cough and shortness of breath on exertion. On examination, he appears dyspneic, respirations 24/min, pulse 110/min, and oxygen saturation 88%. His lungs are clear on auscultation and heart sounds are normal. CXR shows bilateral diffuse perihilar infiltrates. Bronchoscopy and bronchial brushings show clusters of cysts that stain with methenamine silver. Which of the following is the most appropriate next step in management?"
}
|
A 44-year-old renal transplant patient develops severe cough and shortness of breath on exertion. On examination, he appears dyspneic, respirations 24/min, pulse 110/min, and oxygen saturation 88%. His lungs are clear on auscultation and heart sounds are normal. CXR shows bilateral diffuse perihilar infiltrates. Bronchoscopy and bronchial brushings show clusters of cysts that stain with methenamine silver.
|
Which of the following is the most appropriate next step in management?
|
{
"A": "amphotericin B",
"B": "cephalosporins",
"C": "trimethoprim-sulfamethoxazole",
"D": "aminoglycosides"
}
|
C. trimethoprim-sulfamethoxazole
|
079d565e-2a47-4500-96af-30bb792d8137
|
An 8-month-old child presented with reduced appetite, abdominal distension and pain and psychomotor retardation. The child was normal at bih and both parents are normal. O/E: - Hepatosplenomegaly Moderate lymphadenopathy Abnormal posturing of the limbs, trunk, and face Impaired voluntary rapid eye movements Cheery red spot on fundus examination. Bony defects Lymph node-histopathology and electron microscopy. EM findings Which of the following enzymes is most likely deficient in the above disease: -
|
Hexosaminidase A
|
Alpha-galactosidase A
|
Glucocerebrosidase
|
Sphingomyelinase
| 3d
|
multi
|
This is a case of Niemann-pick disease. 1. Autosomal recessive disease 2. Divided into 2 groups depending on deficiency: - Deficiency of acid sphingomyelinase enzyme- Type A and B Impaired intracellular cholesterol trafficking- Type C and D 3. Normal at bih 4. Presents with hepatosplenomegaly, lymphadenopathy and cherry red spot on fundus examination. 5. HPE image shows Niemann-pick cells- These are foam cells with soap suds appearance (Distention of Lysosomes due to sphingomyelin and cholesterol) 6. Electron microscopy shows Zebra bodies - These are concentric lamellated myelin figures (in engorged secondary lysosomes). OTHER ENZYME DEFICIENCIES: - Hexosaminidase A- Tay-sach's disease Alpha-galactosidase A - Fabry's disease Glucocerebrosidase - Gaucher's disease
|
Unknown
|
Integrated QBank
| 109 |
{
"Correct Answer": "Sphingomyelinase",
"Correct Option": "D",
"Options": {
"A": "Hexosaminidase A",
"B": "Alpha-galactosidase A",
"C": "Glucocerebrosidase",
"D": "Sphingomyelinase"
},
"Question": "An 8-month-old child presented with reduced appetite, abdominal distension and pain and psychomotor retardation. The child was normal at bih and both parents are normal. O/E: - Hepatosplenomegaly Moderate lymphadenopathy Abnormal posturing of the limbs, trunk, and face Impaired voluntary rapid eye movements Cheery red spot on fundus examination. Bony defects Lymph node-histopathology and electron microscopy. EM findings Which of the following enzymes is most likely deficient in the above disease: -"
}
|
An 8-month-old child presented with reduced appetite, abdominal distension and pain and psychomotor retardation. The child was normal at bih and both parents are normal. O/E: - Hepatosplenomegaly Moderate lymphadenopathy Abnormal posturing of the limbs, trunk, and face Impaired voluntary rapid eye movements Cheery red spot on fundus examination. Bony defects Lymph node-histopathology and electron microscopy.
|
EM findings Which of the following enzymes is most likely deficient in the above disease: -
|
{
"A": "Hexosaminidase A",
"B": "Alpha-galactosidase A",
"C": "Glucocerebrosidase",
"D": "Sphingomyelinase"
}
|
D. Sphingomyelinase
|
a19c7974-94c0-4955-8fd7-fd4117ba4f46
|
An elderly house wife lost her husband who died suddenly of Myocardial infarction couple of years ago. They had been staying alone for almost a decade with infrequent visits from her son and grandchildren. About a week after the death she heard his voice clearly talking to her as he would in a routine manner from the next room. She went to check but saw nothing. Subsequently she often heard his voice conversing with her and she would also discuss her daily matters with him. This however, provoked anxiety and sadness of mood when she was preoccupied with his thought. She should be treated with:
|
Clornipramine.
|
Aiprazolam
|
Electroconvulsive therapy.
|
Haloperidol.
| 3d
|
single
|
D i.e. HaloperidolThe diagnosis of this lady is morbid grief When there is an exaggeration of one or more symptoms of normal grief or the duration becomes prolonged beyond 6 months without recovery, it is k/a morbid grief.Preoccupation with the memory of deceased is a characteristic featureQ.Idealization of deceased (ignoring his negative qualities).Sense of presence of deceased in the surroundings & misinterpretation of voices or faces of others as that of lost person. Rarely fleeting hallucinations may occur.Treatment - In morbid & complicated grief, medication depends on presenting clinical features.As this lady is mainly having problem of auditory hallucination (1/t sadness & anxiety) - antipsychotic like haloperidol is needed to treat her.
|
Psychiatry
| null | 122 |
{
"Correct Answer": "Haloperidol.",
"Correct Option": "D",
"Options": {
"A": "Clornipramine.",
"B": "Aiprazolam",
"C": "Electroconvulsive therapy.",
"D": "Haloperidol."
},
"Question": "An elderly house wife lost her husband who died suddenly of Myocardial infarction couple of years ago. They had been staying alone for almost a decade with infrequent visits from her son and grandchildren. About a week after the death she heard his voice clearly talking to her as he would in a routine manner from the next room. She went to check but saw nothing. Subsequently she often heard his voice conversing with her and she would also discuss her daily matters with him. This however, provoked anxiety and sadness of mood when she was preoccupied with his thought. She should be treated with:"
}
|
An elderly house wife lost her husband who died suddenly of Myocardial infarction couple of years ago. They had been staying alone for almost a decade with infrequent visits from her son and grandchildren. About a week after the death she heard his voice clearly talking to her as he would in a routine manner from the next room. She went to check but saw nothing. Subsequently she often heard his voice conversing with her and she would also discuss her daily matters with him. This however, provoked anxiety and sadness of mood when she was preoccupied with his thought.
|
She should be treated with:
|
{
"A": "Clornipramine.",
"B": "Aiprazolam",
"C": "Electroconvulsive therapy.",
"D": "Haloperidol."
}
|
D. Haloperidol.
|
cc40d3a2-ae63-4c4f-aa83-32d663267e66
|
A 50-year-old woman presents with easy fatigability, a smooth sore tongue, numbness and tingling of the feet, and weakness of the legs. A complete blood count shows a megaloblastic anemia that is not reversed by folate therapy. Hemoglobin is 5.6 g/dL, WBC count is 5,100/mL, and platelets are 240,000/mL. This patient most likely has a deficiency of which of the following vitamins?
|
Vitamin B1 (thiamine)
|
Vitamin B2 (riboflavin)
|
Vitamin B12
|
Vitamin K
| 2c
|
single
|
Except for a few rare situations, vitamin B12 (cyanocobalamin) deficiency is usually a result of pernicious anemia, an autoimmune disease of the stomach. Vitamin B12 is required for DNA synthesis, and its deficiency results in large (megaloblastic) nuclei.Diagnosis: Vitamin B12 deficiency, pernicious anemia
|
Pathology
|
Environment & Nutritional Pathology
| 107 |
{
"Correct Answer": "Vitamin B12",
"Correct Option": "C",
"Options": {
"A": "Vitamin B1 (thiamine)",
"B": "Vitamin B2 (riboflavin)",
"C": "Vitamin B12",
"D": "Vitamin K"
},
"Question": "A 50-year-old woman presents with easy fatigability, a smooth sore tongue, numbness and tingling of the feet, and weakness of the legs. A complete blood count shows a megaloblastic anemia that is not reversed by folate therapy. Hemoglobin is 5.6 g/dL, WBC count is 5,100/mL, and platelets are 240,000/mL. This patient most likely has a deficiency of which of the following vitamins?"
}
|
A 50-year-old woman presents with easy fatigability, a smooth sore tongue, numbness and tingling of the feet, and weakness of the legs. A complete blood count shows a megaloblastic anemia that is not reversed by folate therapy. Hemoglobin is 5.6 g/dL, WBC count is 5,100/mL, and platelets are 240,000/mL.
|
This patient most likely has a deficiency of which of the following vitamins?
|
{
"A": "Vitamin B1 (thiamine)",
"B": "Vitamin B2 (riboflavin)",
"C": "Vitamin B12",
"D": "Vitamin K"
}
|
C. Vitamin B12
|
b226c32d-02b3-4626-92d3-0aada5d3782b
|
A 25-year-old woman with amenorrhea has never had menarche. On physical examination, she is 145 cm (4 ft 9 in) tall. She has a webbed neck, a broad chest, and widely spaced nipples. Strong pulses are palpable in the upper extremities, but there are only weak pulses in the lower extremities. On abdominal MR imaging, her ovaries are small, elongated, and tubular. Which of the following karyotypes is she most likely to have?
|
45, X/46, XX
|
46, X, X (fra)
|
47, XXY
|
47, XXX
| 0a
|
multi
|
The features described are those of classic Turner syndrome. Individuals who reach adulthood may have mosaic cell lines, with some 45, X cells and some 46, XX cells. A female carrier of the fragile X syndrome, X(fra), is less likely to manifest the disease than a male, but the number of triple repeat sequences (CGG) increases in her male offspring. The 47, XXY karyotype occurs in Klinefelter syndrome; affected individuals appear as phenotypic males. The "superfemale" karyotype (XXX) leads to mild mental retardation. Trisomy 16 is a cause of fetal loss early in pregnancy.
|
Pathology
|
Genetics
| 110 |
{
"Correct Answer": "45, X/46, XX",
"Correct Option": "A",
"Options": {
"A": "45, X/46, XX",
"B": "46, X, X (fra)",
"C": "47, XXY",
"D": "47, XXX"
},
"Question": "A 25-year-old woman with amenorrhea has never had menarche. On physical examination, she is 145 cm (4 ft 9 in) tall. She has a webbed neck, a broad chest, and widely spaced nipples. Strong pulses are palpable in the upper extremities, but there are only weak pulses in the lower extremities. On abdominal MR imaging, her ovaries are small, elongated, and tubular. Which of the following karyotypes is she most likely to have?"
}
|
A 25-year-old woman with amenorrhea has never had menarche. On physical examination, she is 145 cm (4 ft 9 in) tall. She has a webbed neck, a broad chest, and widely spaced nipples. Strong pulses are palpable in the upper extremities, but there are only weak pulses in the lower extremities. On abdominal MR imaging, her ovaries are small, elongated, and tubular.
|
Which of the following karyotypes is she most likely to have?
|
{
"A": "45, X/46, XX",
"B": "46, X, X (fra)",
"C": "47, XXY",
"D": "47, XXX"
}
|
A. 45, X/46, XX
|
05f44b18-2b84-47dc-8607-869781e0559b
|
A 78-year-old woman has an acute anterior wall MI with hypotension and pulmonary congestion. Her blood pressure is 90/70 mm Hg, pulse 110/min, JVP at 8 cm, and the heart sounds are normal. The lungs have bibasilar crackles, and her extremities are cool and diaphoretic. What would central hemodynamic monitoring reveal?For the above patient, select the hemodynamic parameters that are most likely to apply.
|
decreased right atrial pressure (RAP), low cardiac output (CO), and increased systemic vascular resistance (SVR)
|
increased RAP, decreased CO, increased SVR
|
increased RAP, decreased CO, decreased SVR
|
decreased RAP, increased CO, decreased SVR
| 1b
|
multi
|
Cardiogenic shock is characterized by high right atrial pressure (although it can be normal at times), high PA wedge pressure, high systemic vascular resistance, and low cardiac output.
|
Medicine
|
C.V.S.
| 103 |
{
"Correct Answer": "increased RAP, decreased CO, increased SVR",
"Correct Option": "B",
"Options": {
"A": "decreased right atrial pressure (RAP), low cardiac output (CO), and increased systemic vascular resistance (SVR)",
"B": "increased RAP, decreased CO, increased SVR",
"C": "increased RAP, decreased CO, decreased SVR",
"D": "decreased RAP, increased CO, decreased SVR"
},
"Question": "A 78-year-old woman has an acute anterior wall MI with hypotension and pulmonary congestion. Her blood pressure is 90/70 mm Hg, pulse 110/min, JVP at 8 cm, and the heart sounds are normal. The lungs have bibasilar crackles, and her extremities are cool and diaphoretic. What would central hemodynamic monitoring reveal?For the above patient, select the hemodynamic parameters that are most likely to apply."
}
|
A 78-year-old woman has an acute anterior wall MI with hypotension and pulmonary congestion. Her blood pressure is 90/70 mm Hg, pulse 110/min, JVP at 8 cm, and the heart sounds are normal. The lungs have bibasilar crackles, and her extremities are cool and diaphoretic.
|
What would central hemodynamic monitoring reveal?For the above patient, select the hemodynamic parameters that are most likely to apply.
|
{
"A": "decreased right atrial pressure (RAP), low cardiac output (CO), and increased systemic vascular resistance (SVR)",
"B": "increased RAP, decreased CO, increased SVR",
"C": "increased RAP, decreased CO, decreased SVR",
"D": "decreased RAP, increased CO, decreased SVR"
}
|
B. increased RAP, decreased CO, increased SVR
|
ddb2fe1c-105e-4ccf-a740-fe383571d102
|
A 30 year old male was brought for evaluation. The history revealed that the patients 3 year old son died, 5 months back after being hit by a car. At the time of accident, patient was standing nearby and witnessed the accident. For last 5 months, he has been having symptoms of sadness of mood, crying spells, feelings of wohlessness, poor sleep and poor appetite. He has twice thought of killing himself but stopped at the end moment. He has not been attending the office of last 5 months. What is the likely diagnosis:
|
Post traumatic stress disorder
|
Normal grief
|
Major depression
|
Adjustment disorder
| 2c
|
single
|
Depression: A major depressive disorder occurs without a history of a manic, mixed, or hypomanic episode. A major depressive episode must last at least 2 weeks DIAGNOSIS: Major Depressive Disorder The DSM-5 diagnostic criteria for major depression Sadness of mood Diminished interest in pleasure Significant weight loss or gain more than 5% in a month Crying spells Feeling of wohlessness Poor sleep (Insomnia or hypersomnia) Suicidal thoughts Psychomotor retardation Fatigue or loss of energy. Five or more of these symptoms present for 2 weeks or more or either depressed mood or loss of interest or pleasure.
|
Psychiatry
|
Schizophrenia Spectrum and Other Psychotic Disorders
| 116 |
{
"Correct Answer": "Major depression",
"Correct Option": "C",
"Options": {
"A": "Post traumatic stress disorder",
"B": "Normal grief",
"C": "Major depression",
"D": "Adjustment disorder"
},
"Question": "A 30 year old male was brought for evaluation. The history revealed that the patients 3 year old son died, 5 months back after being hit by a car. At the time of accident, patient was standing nearby and witnessed the accident. For last 5 months, he has been having symptoms of sadness of mood, crying spells, feelings of wohlessness, poor sleep and poor appetite. He has twice thought of killing himself but stopped at the end moment. He has not been attending the office of last 5 months. What is the likely diagnosis:"
}
|
A 30 year old male was brought for evaluation. The history revealed that the patients 3 year old son died, 5 months back after being hit by a car. At the time of accident, patient was standing nearby and witnessed the accident. For last 5 months, he has been having symptoms of sadness of mood, crying spells, feelings of wohlessness, poor sleep and poor appetite. He has twice thought of killing himself but stopped at the end moment. He has not been attending the office of last 5 months.
|
What is the likely diagnosis:
|
{
"A": "Post traumatic stress disorder",
"B": "Normal grief",
"C": "Major depression",
"D": "Adjustment disorder"
}
|
C. Major depression
|
071b822d-0b92-4499-bfa3-710331047cae
|
A 23-year-old female maid was making a bed in a hotel bedroom. As she straightened the sheet by running her right hand over the surface with her fingers extended, she caught the end of the index finger in a fold. She experienced a sudden, severe pain over the base of the terminal phalanx. Several hours later when the pain had diminished, she noted that the end of her right index finger was swollen and she could not completely extend the terminal interphalangeal joint. Which one of the following structures within the digit was most likely injured?
|
The proper palmar digital branch of the median nerve
|
The vinculum longa
|
The insertion of the tendon of the extensor digitorum onto the base of the distal phalanx
|
The insertion of the flexor digitorum profundus tendon
| 2c
|
single
|
The contraction of the extensor mechanism produces extension of the distal interphalangeal joint. When it is torn from the distal phalanx, the digit is pulled into flexion by the flexor digitorum profundus. The proper palmar digital branches of the median nerve supply lumbrical muscles and carry sensation from their respective digits. Vincula longa are slender, bandlike connections from the deep flexor tendons to the phalanx that can carry blood supply to the tendons. The insertions of the flexor digitorum superficialis and profundus are on the flexor surface of the middle and distal phalanges, respectively, and act to flex the interphalangeal joints.
|
Anatomy
|
Upper Extremity
| 116 |
{
"Correct Answer": "The insertion of the tendon of the extensor digitorum onto the base of the distal phalanx",
"Correct Option": "C",
"Options": {
"A": "The proper palmar digital branch of the median nerve",
"B": "The vinculum longa",
"C": "The insertion of the tendon of the extensor digitorum onto the base of the distal phalanx",
"D": "The insertion of the flexor digitorum profundus tendon"
},
"Question": "A 23-year-old female maid was making a bed in a hotel bedroom. As she straightened the sheet by running her right hand over the surface with her fingers extended, she caught the end of the index finger in a fold. She experienced a sudden, severe pain over the base of the terminal phalanx. Several hours later when the pain had diminished, she noted that the end of her right index finger was swollen and she could not completely extend the terminal interphalangeal joint. Which one of the following structures within the digit was most likely injured?"
}
|
A 23-year-old female maid was making a bed in a hotel bedroom. As she straightened the sheet by running her right hand over the surface with her fingers extended, she caught the end of the index finger in a fold. She experienced a sudden, severe pain over the base of the terminal phalanx. Several hours later when the pain had diminished, she noted that the end of her right index finger was swollen and she could not completely extend the terminal interphalangeal joint.
|
Which one of the following structures within the digit was most likely injured?
|
{
"A": "The proper palmar digital branch of the median nerve",
"B": "The vinculum longa",
"C": "The insertion of the tendon of the extensor digitorum onto the base of the distal phalanx",
"D": "The insertion of the flexor digitorum profundus tendon"
}
|
C. The insertion of the tendon of the extensor digitorum onto the base of the distal phalanx
|
e4ba25b1-2be8-4d30-b095-c3ddc931cc4c
|
A 26 year old third_gravida mother delivered a male baby weighing 4-2 kg at 37 weeks of gestation through an emergency caesarean section, for obstructed labour. The child developed respiratory distress one hour after bih. He was kept nil per orally (NPO) and given intravenous fluids. He maintained oxygen saturation on room air. No antibiotics were given. Chest radiograph revealed fluid in interlobar fissure. Respiratory distress settled by 24 hours of life. What is the most likely diagnosis ?
|
Transient tachypnea of the newborn
|
Meconium aspiration syndrome
|
Persistent fetal circulation
|
Hyaline membrane disease
| 0a
|
multi
|
Ans. is 'a' i.e., Transient tachypnea of newborn o Respiratory distress, which resolves within 24 hours without any respiratory suppo and fluid in interlobar fissure on chest X-ray suggest the diagnosis of TTN.
|
Pediatrics
| null | 115 |
{
"Correct Answer": "Transient tachypnea of the newborn",
"Correct Option": "A",
"Options": {
"A": "Transient tachypnea of the newborn",
"B": "Meconium aspiration syndrome",
"C": "Persistent fetal circulation",
"D": "Hyaline membrane disease"
},
"Question": "A 26 year old third_gravida mother delivered a male baby weighing 4-2 kg at 37 weeks of gestation through an emergency caesarean section, for obstructed labour. The child developed respiratory distress one hour after bih. He was kept nil per orally (NPO) and given intravenous fluids. He maintained oxygen saturation on room air. No antibiotics were given. Chest radiograph revealed fluid in interlobar fissure. Respiratory distress settled by 24 hours of life. What is the most likely diagnosis ?"
}
|
A 26 year old third_gravida mother delivered a male baby weighing 4-2 kg at 37 weeks of gestation through an emergency caesarean section, for obstructed labour. The child developed respiratory distress one hour after bih. He was kept nil per orally (NPO) and given intravenous fluids. He maintained oxygen saturation on room air. No antibiotics were given. Chest radiograph revealed fluid in interlobar fissure. Respiratory distress settled by 24 hours of life.
|
What is the most likely diagnosis ?
|
{
"A": "Transient tachypnea of the newborn",
"B": "Meconium aspiration syndrome",
"C": "Persistent fetal circulation",
"D": "Hyaline membrane disease"
}
|
A. Transient tachypnea of the newborn
|
d93522e3-8ae1-451e-a688-daec2e5dfe08
|
A 19-year-old man presents to the clinic complaining of early fatigue and muscle cramps while playing sports. He is fine when walking or doing less intense levels of work. On physical examination, he appears well and the vital signs are normal. Muscle bulk, tone and strength in the proximal muscles are normal. There is no muscle fatigue with repetitive arm grip exercises. After an exercise stress test, his serum creatine kinase (CK) is elevated and lactate level is normal. Which of the following is the most likely diagnosis?
|
Gaucher disease
|
Tay-Sachs disease
|
McArdle disease (glycogen storage disease)
|
hemochromatosis
| 2c
|
single
|
There are many types of glycogen storage diseases, each caused by a different enzymatic abnormality. The best-known types of glycogen storage disease are those that have hepatic hypoglycemic pathophysiology (eg, von Gierke disease) or those that have muscle energy pathophysiology (McArdle disease). InMcArdle' symptoms usually develop in adulthood, and it is marked by cramps and muscle injury with strenuous exercise, but not with usual activities. Gaucher and Tay-Sachs disease are lysosomal storage diseases.
|
Medicine
|
Endocrinology
| 109 |
{
"Correct Answer": "McArdle disease (glycogen storage disease)",
"Correct Option": "C",
"Options": {
"A": "Gaucher disease",
"B": "Tay-Sachs disease",
"C": "McArdle disease (glycogen storage disease)",
"D": "hemochromatosis"
},
"Question": "A 19-year-old man presents to the clinic complaining of early fatigue and muscle cramps while playing sports. He is fine when walking or doing less intense levels of work. On physical examination, he appears well and the vital signs are normal. Muscle bulk, tone and strength in the proximal muscles are normal. There is no muscle fatigue with repetitive arm grip exercises. After an exercise stress test, his serum creatine kinase (CK) is elevated and lactate level is normal. Which of the following is the most likely diagnosis?"
}
|
A 19-year-old man presents to the clinic complaining of early fatigue and muscle cramps while playing sports. He is fine when walking or doing less intense levels of work. On physical examination, he appears well and the vital signs are normal. Muscle bulk, tone and strength in the proximal muscles are normal. There is no muscle fatigue with repetitive arm grip exercises. After an exercise stress test, his serum creatine kinase (CK) is elevated and lactate level is normal.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Gaucher disease",
"B": "Tay-Sachs disease",
"C": "McArdle disease (glycogen storage disease)",
"D": "hemochromatosis"
}
|
C. McArdle disease (glycogen storage disease)
|
819a9b25-36f0-41d0-a409-8289d976f067
|
Kamli Rani, 75-years -old woman present with post myocardial infarction after 6 weeks mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, ECG shows slow atrial fibrillation. Serum Ca2+ 13.0 mg/L and urinary Ca2+ is 300 mg/24 hr. On examination there is small mass in the Para tracheal position behind the right clavicle. Appropriate management at this time is:
|
Repeat neck surgery
|
Treatment with technetium-99
|
Observation and repeat serum Ca2+ in two months
|
Ultrasound-guided alcohol injection of the mass
| 3d
|
multi
|
Patient is a case of recurrent hyperparathyroidism, as she was operated previously for parathyroid adenoma. In the setting of recent myocardial infarction, CHF and atrial fibrillation, any operation carries a high risk. Ultrasound-guided alcohol injection in the mass is preferred in this setting.
|
Surgery
|
Parathyroid and adrenal glands
| 112 |
{
"Correct Answer": "Ultrasound-guided alcohol injection of the mass",
"Correct Option": "D",
"Options": {
"A": "Repeat neck surgery",
"B": "Treatment with technetium-99",
"C": "Observation and repeat serum Ca2+ in two months",
"D": "Ultrasound-guided alcohol injection of the mass"
},
"Question": "Kamli Rani, 75-years -old woman present with post myocardial infarction after 6 weeks mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, ECG shows slow atrial fibrillation. Serum Ca2+ 13.0 mg/L and urinary Ca2+ is 300 mg/24 hr. On examination there is small mass in the Para tracheal position behind the right clavicle. Appropriate management at this time is:"
}
|
Kamli Rani, 75-years -old woman present with post myocardial infarction after 6 weeks mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, ECG shows slow atrial fibrillation. Serum Ca2+ 13.0 mg/L and urinary Ca2+ is 300 mg/24 hr. On examination there is small mass in the Para tracheal position behind the right clavicle.
|
Appropriate management at this time is:
|
{
"A": "Repeat neck surgery",
"B": "Treatment with technetium-99",
"C": "Observation and repeat serum Ca2+ in two months",
"D": "Ultrasound-guided alcohol injection of the mass"
}
|
D. Ultrasound-guided alcohol injection of the mass
|
c7adea89-80f3-4715-950a-4b0b133f8e84
|
A 57-year-old man arrives at the emergency room complaining of weakness, fatigue, and intermittent fever that has recurred for several weeks. The patient had a cardiac valvular prosthesis implanted 5 years ago. Blood cultures grew ceain gram-positive cocci on which catalase and coagulase test were done. The gram-positive organisms failed to ferment mannitol, and their growth was inhibited by novobiocin. CATALASE TEST SLIDE COAGULASE TEST Lesions seen on skin What is the most likely infectious agent?
|
Staphylococcus aureus
|
Staphylococcus epidermidis
|
Staphylococcus saprophyticus
|
Streptococcus viridans
| 1b
|
single
|
Physical examination reveals petechiae (pinpoint, nonraised, purplish red spots caused by intradermal hemorrhage) on the chest and stomach. Catalase-positive and coagulase negative The patient is probably suffering from bacterial endocarditis caused by S. epidermidis infection of the prosthetic hea valve. S. epidermidis Coagulase-negative organism Unable to ferment mannitol Sensitive to novobiocin Resistant to penicillin. Patients with congenital hea malformations, acquired valvular defects (for example, rheumatic hea disease), prosthetic valves, and previous bacterial endocarditis show an increased incidence of bacterial endocarditis. Intravenous drug users also have a high risk for infection. S. viridans can be ruled out, because streptococci are catalase negative, which is a feature that distinguishes them from catalase-positive staphylococci. S. aureus is coagulase positive so it is ruled out. S. saprophyticus is coagulase negative but resistant to novobiocin, hence also ruled out here
|
Unknown
|
Integrated QBank
| 113 |
{
"Correct Answer": "Staphylococcus epidermidis",
"Correct Option": "B",
"Options": {
"A": "Staphylococcus aureus",
"B": "Staphylococcus epidermidis",
"C": "Staphylococcus saprophyticus",
"D": "Streptococcus viridans"
},
"Question": "A 57-year-old man arrives at the emergency room complaining of weakness, fatigue, and intermittent fever that has recurred for several weeks. The patient had a cardiac valvular prosthesis implanted 5 years ago. Blood cultures grew ceain gram-positive cocci on which catalase and coagulase test were done. The gram-positive organisms failed to ferment mannitol, and their growth was inhibited by novobiocin. CATALASE TEST SLIDE COAGULASE TEST Lesions seen on skin What is the most likely infectious agent?"
}
|
A 57-year-old man arrives at the emergency room complaining of weakness, fatigue, and intermittent fever that has recurred for several weeks. The patient had a cardiac valvular prosthesis implanted 5 years ago. Blood cultures grew ceain gram-positive cocci on which catalase and coagulase test were done. The gram-positive organisms failed to ferment mannitol, and their growth was inhibited by novobiocin.
|
CATALASE TEST SLIDE COAGULASE TEST Lesions seen on skin What is the most likely infectious agent?
|
{
"A": "Staphylococcus aureus",
"B": "Staphylococcus epidermidis",
"C": "Staphylococcus saprophyticus",
"D": "Streptococcus viridans"
}
|
B. Staphylococcus epidermidis
|
91d5cae7-c4a1-4d69-b76a-5fd898c29f51
|
A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels. Skin biopsy specimen was taken.
|
Clotting disorder
|
Septic emboli
|
HSP
|
Uicarial vasculitis
| 2c
|
single
|
Perivascular neutrophils, leukocytoclasis and fibrinoid degeneration involving the small dermal blood vessels with subsequent hemorrhage in a skin biopsy of a patient with HSP. Skin biopsy showing positive immunofluorescence of the small blood vessels for IgA. Henoch-Schonlein purpura (HSP) Acute immunoglobulin A (IgA)-mediated Generalized vasculitis involving the small vessels of the skin, the gastrointestinal (GI) tract, the kidneys, the joints, and, rarely, the lungs and the central nervous system (CNS). It is the most frequent vasculitis in childhood, the incidence decreasing with age. Subsequently, symptoms develop, of which the following are the most common: Rash, especially involving the legs; this is the hallmark of the disease Abdominal pain and vomiting Joint pain especially involving the knees and ankles Subcutaneous edema Scrotal edema Bloody stools
|
Anatomy
|
Integrated QBank
| 104 |
{
"Correct Answer": "HSP",
"Correct Option": "C",
"Options": {
"A": "Clotting disorder",
"B": "Septic emboli",
"C": "HSP",
"D": "Uicarial vasculitis"
},
"Question": "A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels. Skin biopsy specimen was taken."
}
|
A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels.
|
Skin biopsy specimen was taken.
|
{
"A": "Clotting disorder",
"B": "Septic emboli",
"C": "HSP",
"D": "Uicarial vasculitis"
}
|
C. HSP
|
0df537bb-a632-489f-ad81-622b19a6b4c1
|
A 52-year-old man presents to the eye clinic with painless vision loss of his right eye. He describes the visual loss as a gradual progression from blurry to total blackout over the past two hours. He has no history of prior visual problems. Past medical history is significant for a myocardial infarction three years ago. The patient takes 70mg of aspirin daily. Vital signs are normal. Physical examination reveals 20/20 vision of the left eye but no vision in the right eye. Extraocular muscles are intact. The neurologic examination is normal. The cardiac examination reveals an S4 hea sound. At the molecular level, which of the following components is essential for the first step of the visual cascade?
|
11-cis-retinal
|
All-cis-retinal
|
All-trans-retinal
|
Meta-rhodopsin ll
| 0a
|
multi
|
The visual cascade: 11-cis-retinal + opsin -> rhodopsin + light -> meta-rhodopsin II. Meta-rhodopsin II dissociates after light exposure to form all-trans-retinal. 11-cis retinal and opsin are essential first steps in generating the photochemical visual cascade. All-cis-retinal is not a pa of the visual cascade. All-trans-retinal, meta-rhodopsin II, rhodopsin is a later pa of the visual cascade: 11-cis-retinal + opsin -> rhodopsin + light -> meta-rhodopsin II. Meta-rhodopsin II dissociates after light exposure to form all-trans-retinal. 11-cis retinal and opsin are essential first steps in generating the photochemical visual cascade.
|
Ophthalmology
| null | 152 |
{
"Correct Answer": "11-cis-retinal",
"Correct Option": "A",
"Options": {
"A": "11-cis-retinal",
"B": "All-cis-retinal",
"C": "All-trans-retinal",
"D": "Meta-rhodopsin ll"
},
"Question": "A 52-year-old man presents to the eye clinic with painless vision loss of his right eye. He describes the visual loss as a gradual progression from blurry to total blackout over the past two hours. He has no history of prior visual problems. Past medical history is significant for a myocardial infarction three years ago. The patient takes 70mg of aspirin daily. Vital signs are normal. Physical examination reveals 20/20 vision of the left eye but no vision in the right eye. Extraocular muscles are intact. The neurologic examination is normal. The cardiac examination reveals an S4 hea sound. At the molecular level, which of the following components is essential for the first step of the visual cascade?"
}
|
A 52-year-old man presents to the eye clinic with painless vision loss of his right eye. He describes the visual loss as a gradual progression from blurry to total blackout over the past two hours. He has no history of prior visual problems. Past medical history is significant for a myocardial infarction three years ago. The patient takes 70mg of aspirin daily. Vital signs are normal. Physical examination reveals 20/20 vision of the left eye but no vision in the right eye. Extraocular muscles are intact. The neurologic examination is normal. The cardiac examination reveals an S4 hea sound.
|
At the molecular level, which of the following components is essential for the first step of the visual cascade?
|
{
"A": "11-cis-retinal",
"B": "All-cis-retinal",
"C": "All-trans-retinal",
"D": "Meta-rhodopsin ll"
}
|
A. 11-cis-retinal
|
6bce4733-0e59-4afe-baf4-c159a236caca
|
Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?
|
A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain
|
A mutation in the stop codon resulted in elongation of the b-chain
|
A point mutation resulted in the inseion of a stop codon in the b-chain
|
A two base pair addition resulted in the elimination of a stop codon in the b-chain
| 3d
|
single
|
Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC UAU UAA 1 2 3 4 5 6 7 8 etc etc The inseion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids is wrong, since such a mutation would have inseed a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation is the result of a single base pair change, which is not the case here. A point mutation resulting in the inseion of a new stop codon is called a nonsense mutation, and it would result in a shoer-than-normal protein. Ref: Weil P. (2011). Chapter 37. Protein Synthesis & the Genetic Code. In D.A. Bender, K.M. Botham, P.A. Weil, P.J. Kennelly, R.K. Murray, V.W. Rodwell (Eds), Harper's Illustrated Biochemistry, 29e.
|
Biochemistry
| null | 140 |
{
"Correct Answer": "A two base pair addition resulted in the elimination of a stop codon in the b-chain",
"Correct Option": "D",
"Options": {
"A": "A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain",
"B": "A mutation in the stop codon resulted in elongation of the b-chain",
"C": "A point mutation resulted in the inseion of a stop codon in the b-chain",
"D": "A two base pair addition resulted in the elimination of a stop codon in the b-chain"
},
"Question": "Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?"
}
|
Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below.
|
HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?
|
{
"A": "A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain",
"B": "A mutation in the stop codon resulted in elongation of the b-chain",
"C": "A point mutation resulted in the inseion of a stop codon in the b-chain",
"D": "A two base pair addition resulted in the elimination of a stop codon in the b-chain"
}
|
D. A two base pair addition resulted in the elimination of a stop codon in the b-chain
|
2f272bd1-36d2-4982-9bf5-c24136a3552b
|
A 24-year-old P2+0 woman presents to the emergency department complaining of pain in her right breast. The patient is postpartum day 10 from an uncomplicated spontaneous vaginal delivery at 42 weeks. She reports no difficulty breast-feeding for the first several days postpartum, but states that for the past week her daughter has had difficulty latching on. Three days ago her right nipple became dry and cracked, and since yesterday it has become increasingly swollen and painful. Her temperature is 38.3°C (101°F). Her right nipple and areola are warm, swollen, red, and tender. There is no fluctuance or induration, and no pus can be expressed from the nipple.
|
Continue breast feeding from both the breasts
|
Breastfeed from unaffected breast only
|
Immediately start antibiotics and breastfeed only when antibiotics are discontinued.
|
Pump and discard breastmilk till infection is over and then continue breatfedding
| 0a
|
multi
|
A postpartum lady coming with H/o pain in breast and fever and nipples being warm, red, swollen, with no induration, fluctuance and no pus extruding from them - leaves no doubt that the patient is having mastitis. As discussed in question 9, mastitis is not a contraindication for breast feeding. She should continue feeding from both the breasts.
|
Gynaecology & Obstetrics
| null | 153 |
{
"Correct Answer": "Continue breast feeding from both the breasts",
"Correct Option": "A",
"Options": {
"A": "Continue breast feeding from both the breasts",
"B": "Breastfeed from unaffected breast only",
"C": "Immediately start antibiotics and breastfeed only when antibiotics are discontinued.",
"D": "Pump and discard breastmilk till infection is over and then continue breatfedding"
},
"Question": "A 24-year-old P2+0 woman presents to the emergency department complaining of pain in her right breast. The patient is postpartum day 10 from an uncomplicated spontaneous vaginal delivery at 42 weeks. She reports no difficulty breast-feeding for the first several days postpartum, but states that for the past week her daughter has had difficulty latching on. Three days ago her right nipple became dry and cracked, and since yesterday it has become increasingly swollen and painful. Her temperature is 38.3°C (101°F). Her right nipple and areola are warm, swollen, red, and tender. There is no fluctuance or induration, and no pus can be expressed from the nipple."
}
|
A 24-year-old P2+0 woman presents to the emergency department complaining of pain in her right breast. The patient is postpartum day 10 from an uncomplicated spontaneous vaginal delivery at 42 weeks. She reports no difficulty breast-feeding for the first several days postpartum, but states that for the past week her daughter has had difficulty latching on. Three days ago her right nipple became dry and cracked, and since yesterday it has become increasingly swollen and painful. Her temperature is 38.3°C (101°F). Her right nipple and areola are warm, swollen, red, and tender.
|
There is no fluctuance or induration, and no pus can be expressed from the nipple.
|
{
"A": "Continue breast feeding from both the breasts",
"B": "Breastfeed from unaffected breast only",
"C": "Immediately start antibiotics and breastfeed only when antibiotics are discontinued.",
"D": "Pump and discard breastmilk till infection is over and then continue breatfedding"
}
|
A. Continue breast feeding from both the breasts
|
a21b7844-9dae-4ab5-a61e-ab3da03efa83
|
A 57-year-old man presents with hemoptysis and generalized weakness. His symptoms began with small-volume hemoptysis 4 weeks ago. Over the past 2 weeks, he has become weak and feels "out of it." His appetite has diminished, and he has lost 10 lb of weight. He has a 45-pack-year history of cigarette smoking. Physical examination is unremarkable. Laboratory studies reveal a mild anemia and a serum sodium value of 118 mEq/L. Chest x-ray shows a 5-cm left, mid-lung field mass with widening of the mediastinum suggesting mediastinal lymphadenopathy. MR scan of the brain is unremarkable. What is the most likely cause of his symptoms?
|
Bronchial carcinoid
|
Adenocarcinoma of the lung
|
Small cell carcinoma of the lung
|
Lung abscess
| 2c
|
multi
|
Hyponatremia in association with a lung mass usually indicates small cell lung cancer (SCLC) with inappropriate antidiuretic hormone (ADH) production by the tumor. About 10% of lung cancers present with a paraneoplastic syndrome. Tumors producing ADH or adrenocorticotropic hormone (ACTH) are overwhelmingly SCLCs, which arise from hormonally active neuroendocrine cells. SCLC is a rapidly growing neoplasm; early mediastinal involvement, as in this case, is common. Tumor staging for SCLC differs from non-small cell cancers. SCLCs are simply classified as limited (confined to one hemithorax) or extensive. Limited tumors are usually managed with combination radiation and chemotherapy, with approximately 20% cure rate. Extensive tumors are treated with palliative chemotherapy alone; durable remissions are rare. Surgery is not curative in SCLC.Bronchial carcinoids are usually benign. Although they can produce ACTH, mediastinal involvement and hyponatremia would not be expected. Adenocarcinoma of the lung, although common, rarely causes a paraneoplastic syndrome. Localized benign lung infections (especially lung abscess) can cause syndrome of inappropriate antidiuretic hormone (SIADH) but would not account for this patient's mediastinal adenopathy. Lung abscess usually causes fever and fetid sputum. Pulmonary aspergilloma (a fungus ball growing in an old cavitary lesion) can cause hemoptysis but not this patient's hyponatremia or mediastinal lymphadenopathy.
|
Medicine
|
Respiratory
| 158 |
{
"Correct Answer": "Small cell carcinoma of the lung",
"Correct Option": "C",
"Options": {
"A": "Bronchial carcinoid",
"B": "Adenocarcinoma of the lung",
"C": "Small cell carcinoma of the lung",
"D": "Lung abscess"
},
"Question": "A 57-year-old man presents with hemoptysis and generalized weakness. His symptoms began with small-volume hemoptysis 4 weeks ago. Over the past 2 weeks, he has become weak and feels \"out of it.\" His appetite has diminished, and he has lost 10 lb of weight. He has a 45-pack-year history of cigarette smoking. Physical examination is unremarkable. Laboratory studies reveal a mild anemia and a serum sodium value of 118 mEq/L. Chest x-ray shows a 5-cm left, mid-lung field mass with widening of the mediastinum suggesting mediastinal lymphadenopathy. MR scan of the brain is unremarkable. What is the most likely cause of his symptoms?"
}
|
A 57-year-old man presents with hemoptysis and generalized weakness. His symptoms began with small-volume hemoptysis 4 weeks ago. Over the past 2 weeks, he has become weak and feels "out of it." His appetite has diminished, and he has lost 10 lb of weight. He has a 45-pack-year history of cigarette smoking. Physical examination is unremarkable. Laboratory studies reveal a mild anemia and a serum sodium value of 118 mEq/L. Chest x-ray shows a 5-cm left, mid-lung field mass with widening of the mediastinum suggesting mediastinal lymphadenopathy. MR scan of the brain is unremarkable.
|
What is the most likely cause of his symptoms?
|
{
"A": "Bronchial carcinoid",
"B": "Adenocarcinoma of the lung",
"C": "Small cell carcinoma of the lung",
"D": "Lung abscess"
}
|
C. Small cell carcinoma of the lung
|
0c5ee077-1330-4d61-9ab9-d9a3b46ac389
|
A 23-year-old, sexually active man has been treated for Neisseria gonorrhoeae infection 6 times during the past 5 years. He now comes to the physician because of the increasing number and size of warty lesions slowly enlarging on his external genitalia during the past year. On physical examination, there are multiple 1- to 3-mm sessile, nonulcerated, papillary excrescences over the inner surface of the penile prepuce. These lesions are excised, but 2 years later, similar lesions appear. Which of the following conditions most likely predisposed him to the development of these recurrent lesions?
|
Candida albicans infection
|
Circumcision
|
Human papillomavirus infection
|
Neisseria gonorrhoeae infection
| 2c
|
multi
|
Condyloma acuminatum is a benign, recurrent squamous epithelial proliferation resulting from infection with human papillomavirus (HPV) infection, one of many sexually transmitted diseases that can occur in sexually active individuals. Koilocytosis is particularly characteristic of HPV infection. Candidiasis can be associated with inflammation, such as balanoposthitis, but not condylomata. Recurrent gonococcal infection indicates that the patient is sexually active and at risk for additional infections, but is not the cause for the condylomata. The gonococcal infection causes suppurative lesions in which there may be liquefactive necrosis and a neutrophilic exudate or mixed inflammatory infiltrate. Circumcision generally reduces risks for infections. Phimosis is a nonretractile prepuce, and paraphimosis refers to forcible retraction of the prepuce that produces pain and urinary obstruction.
|
Pathology
|
Male Genital Tract
| 137 |
{
"Correct Answer": "Human papillomavirus infection",
"Correct Option": "C",
"Options": {
"A": "Candida albicans infection",
"B": "Circumcision",
"C": "Human papillomavirus infection",
"D": "Neisseria gonorrhoeae infection"
},
"Question": "A 23-year-old, sexually active man has been treated for Neisseria gonorrhoeae infection 6 times during the past 5 years. He now comes to the physician because of the increasing number and size of warty lesions slowly enlarging on his external genitalia during the past year. On physical examination, there are multiple 1- to 3-mm sessile, nonulcerated, papillary excrescences over the inner surface of the penile prepuce. These lesions are excised, but 2 years later, similar lesions appear. Which of the following conditions most likely predisposed him to the development of these recurrent lesions?"
}
|
A 23-year-old, sexually active man has been treated for Neisseria gonorrhoeae infection 6 times during the past 5 years. He now comes to the physician because of the increasing number and size of warty lesions slowly enlarging on his external genitalia during the past year. On physical examination, there are multiple 1- to 3-mm sessile, nonulcerated, papillary excrescences over the inner surface of the penile prepuce. These lesions are excised, but 2 years later, similar lesions appear.
|
Which of the following conditions most likely predisposed him to the development of these recurrent lesions?
|
{
"A": "Candida albicans infection",
"B": "Circumcision",
"C": "Human papillomavirus infection",
"D": "Neisseria gonorrhoeae infection"
}
|
C. Human papillomavirus infection
|
d387c2b9-3e1c-4d75-9155-9424475cb31d
|
A 23-year-old woman has noticed that she develops a skin rash if she spends prolonged periods outdoors. She has a malar skin rash on physical examination. Laboratory studies include a positive ANA test result with a titer of 1 :1024 and a "rim" pattern. An anti-double-stranded DNA test result also is positive. The hemoglobin concentration is 12.1 g/dL, hematocrit is 35.5%, MCV is 89 mm3, platelet count is 109,000/mm3, and WBC count is 4500/mm3. Which of the following findings is most likely to be shown by a WBC differential count?
|
Basophilia
|
Eosinophilia
|
Monocytosis
|
Neutrophilia
| 2c
|
single
|
An autoimmune disease, most likely systemic lupus erythematosus (SLE) in this patient, can be accompanied by monocytosis. Cytopenias also can occur in SLE because of autoantibodies against blood elements, a form of type II hypersensitivity. Basophilia occurs infrequently, but also can be seen in chronic myelogenous leukemia (CML). Eosinophilia is a feature more often seen in allergic conditions, tissue parasitic infestations, and CML. Neutrophilia is seen in acute infectious and inflammatory conditions. Thrombocytosis usually occurs in neoplastic disorders of myeloid stem cells, such as the myeloproliferative disorders that include CML and essential thrombocytosis.
|
Pathology
|
Blood
| 153 |
{
"Correct Answer": "Monocytosis",
"Correct Option": "C",
"Options": {
"A": "Basophilia",
"B": "Eosinophilia",
"C": "Monocytosis",
"D": "Neutrophilia"
},
"Question": "A 23-year-old woman has noticed that she develops a skin rash if she spends prolonged periods outdoors. She has a malar skin rash on physical examination. Laboratory studies include a positive ANA test result with a titer of 1 :1024 and a \"rim\" pattern. An anti-double-stranded DNA test result also is positive. The hemoglobin concentration is 12.1 g/dL, hematocrit is 35.5%, MCV is 89 mm3, platelet count is 109,000/mm3, and WBC count is 4500/mm3. Which of the following findings is most likely to be shown by a WBC differential count?"
}
|
A 23-year-old woman has noticed that she develops a skin rash if she spends prolonged periods outdoors. She has a malar skin rash on physical examination. Laboratory studies include a positive ANA test result with a titer of 1 :1024 and a "rim" pattern. An anti-double-stranded DNA test result also is positive. The hemoglobin concentration is 12.1 g/dL, hematocrit is 35.5%, MCV is 89 mm3, platelet count is 109,000/mm3, and WBC count is 4500/mm3.
|
Which of the following findings is most likely to be shown by a WBC differential count?
|
{
"A": "Basophilia",
"B": "Eosinophilia",
"C": "Monocytosis",
"D": "Neutrophilia"
}
|
C. Monocytosis
|
f03b37d6-8334-4a73-9007-56327bb663fd
|
A neonate within 4 hours of bih presented with severe respiratory distress. He appears to be dyspneic, tachypneic, and cyanotic with severe retractions of the chest. On examination, grunting is present along with use of the accessory muscles. Neonate also appears to have scaphoid abdomen and increased chest wall diameter. There is evidence of shift of the point of maximal cardiac impulse from its original location to the right side. Chest x ray of the neonate Defect in development of which pa of the responsible structure is causing this condition of the baby?
|
PA C
|
PA A
|
PA D
|
PA B
| 2c
|
multi
|
This is a case of congenital diaphragmatic hernia (bochdalek or posterolateral hernia) Chest radiograph shows a stomach, nasogastric tube, and small bowel contents in the thoracic cavity, consistent with a CDH. Development of Diaphragm: PA A: Body wall: Peripheral muscular pa PA B: Oesophageal Mesentery: Crura PA C: Septum Transversum: Central Tendon. PA D: Pleuroperitoneal membrane: Small intermediate muscular pa. More common mechanism for the origin of diaphragmatic hernias occurs when muscle cells fail to populate a region of the pleuroperitoneal membranes. This results in a weakened area and subsequent herniation of abdominal organs into the thoracic cavity. The primary cause for the muscle deficiency appears to reside in fibroblasts in the pleuroperitoneal membranes These fibroblasts fail to provide the appropriate scaffolding and/or guidance cues for migrating myoblasts.
|
Unknown
|
Integrated QBank
| 121 |
{
"Correct Answer": "PA D",
"Correct Option": "C",
"Options": {
"A": "PA C",
"B": "PA A",
"C": "PA D",
"D": "PA B"
},
"Question": "A neonate within 4 hours of bih presented with severe respiratory distress. He appears to be dyspneic, tachypneic, and cyanotic with severe retractions of the chest. On examination, grunting is present along with use of the accessory muscles. Neonate also appears to have scaphoid abdomen and increased chest wall diameter. There is evidence of shift of the point of maximal cardiac impulse from its original location to the right side. Chest x ray of the neonate Defect in development of which pa of the responsible structure is causing this condition of the baby?"
}
|
A neonate within 4 hours of bih presented with severe respiratory distress. He appears to be dyspneic, tachypneic, and cyanotic with severe retractions of the chest. On examination, grunting is present along with use of the accessory muscles. Neonate also appears to have scaphoid abdomen and increased chest wall diameter. There is evidence of shift of the point of maximal cardiac impulse from its original location to the right side.
|
Chest x ray of the neonate Defect in development of which pa of the responsible structure is causing this condition of the baby?
|
{
"A": "PA C",
"B": "PA A",
"C": "PA D",
"D": "PA B"
}
|
C. PA D
|
810f38cb-3f85-42be-a9ba-71610e4fd911
|
Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 minutes child shows features of breathlessness,on CXR-mediastinal shift was there, possible causes –
a) Bilateral choanal atresiab) Pneumothoraxc) Congenital diaphragmatic herniad) Hyaline membrane disease
|
a
|
bc
|
ac
|
ad
| 1b
|
single
|
Congenital diaphragmatic hernia and pneumothorax cause respiratory distress with mediastinal shift to contralateral side.
Bilateral choanal atresia and HMD cause respiratory distress, but no mediastinal shift.
|
Radiology
| null | 102 |
{
"Correct Answer": "bc",
"Correct Option": "B",
"Options": {
"A": "a",
"B": "bc",
"C": "ac",
"D": "ad"
},
"Question": "Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 minutes child shows features of breathlessness,on CXR-mediastinal shift was there, possible causes – \na) Bilateral choanal atresiab) Pneumothoraxc) Congenital diaphragmatic herniad) Hyaline membrane disease"
}
|
Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 Apgar scores were 3, and 6 at 1 and 5 minutes.
|
At 10 minutes child shows features of breathlessness,on CXR-mediastinal shift was there, possible causes –
a) Bilateral choanal atresiab) Pneumothoraxc) Congenital diaphragmatic herniad) Hyaline membrane disease
|
{
"A": "a",
"B": "bc",
"C": "ac",
"D": "ad"
}
|
B. bc
|
c4d050b6-9c49-4370-9e33-cf93a6c99b95
|
An epidemiologic study observes increased numbers of respiratory tract infections among children living in a community in which most families are at the poverty level. The infectious agents include Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae. Most of the children have had pneumonitis and rubeola infection. The study documents increased rates of keratomalacia, urinary tract calculi, and generalized papular dermatosis in these children as they reach adulthood. These children are most likely to have a deficiency of which of the following vitamins?
|
Vitamin A
|
Vitamin B1
|
Vitamin E
|
Vitamin D
| 0a
|
single
|
Vitamin A is important in maintaining epithelial surfaces. Deficiency of this vitamin can lead to squamous metaplasia of respiratory epithelium, predisposing to infection. Increased keratin buildup leads to follicular plugging and papular dermatosis. Desquamated keratinaceous debris in the urinary tract forms the nidus for stones. Ocular complications of vitamin A deficiency include xerophthalmia and corneal scarring, which can lead to blindness. Vitamin B1 (thiamine) deficiency causes problems such as Wernicke disease, neuropathy, and cardiomyopathy. Vitamin D deficiency in children causes rickets, characterized by bone deformities. Vitamin E deficiency occurs rarely; it causes neurologic symptoms related to degeneration of the axons in the posterior columns of the spinal cord. Vitamin K deficiency can result in a bleeding diathesis.
|
Pathology
|
Environment & Nutritional Pathology
| 115 |
{
"Correct Answer": "Vitamin A",
"Correct Option": "A",
"Options": {
"A": "Vitamin A",
"B": "Vitamin B1",
"C": "Vitamin E",
"D": "Vitamin D"
},
"Question": "An epidemiologic study observes increased numbers of respiratory tract infections among children living in a community in which most families are at the poverty level. The infectious agents include Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae. Most of the children have had pneumonitis and rubeola infection. The study documents increased rates of keratomalacia, urinary tract calculi, and generalized papular dermatosis in these children as they reach adulthood. These children are most likely to have a deficiency of which of the following vitamins?"
}
|
An epidemiologic study observes increased numbers of respiratory tract infections among children living in a community in which most families are at the poverty level. The infectious agents include Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae. Most of the children have had pneumonitis and rubeola infection. The study documents increased rates of keratomalacia, urinary tract calculi, and generalized papular dermatosis in these children as they reach adulthood.
|
These children are most likely to have a deficiency of which of the following vitamins?
|
{
"A": "Vitamin A",
"B": "Vitamin B1",
"C": "Vitamin E",
"D": "Vitamin D"
}
|
A. Vitamin A
|
44efcde8-dadc-4ad5-9072-142f27d84768
|
A 30-year-old man has had cramping abdominal pain and bloody diarrhea for the past 4 days. On physical examination, there is diffuse tenderness on palpation of the abdomen. Bowel sounds are present. There are no masses and no organomegaly. A stool culture is positive for Shigella flexneri. The episode resolves spontaneously within 1 week after onset. Six weeks later, he has increasingly severe lower back pain. Physical examination now shows stiffness of the lumbar spine and tenderness of the sacroiliac joints. He is treated with nonsteroidal anti-inflammatory agents. Two months later, the back pain recurs, and he complains of redness of the right eye and blurred vision. Serologic testing for which of the following is most likely to be positive in this patient?
|
Borrelia burgdorferi
|
Chlamydia trachomatis
|
Epstein-Barr virus
|
HLA-B27
| 3d
|
single
|
This patient developed enteritis-associated arthritis affecting the lumbar and sacroiliac joints several weeks after Shigella dysentery. He subsequently developed conjunctivitis and, most likely, uveitis. This symptom complex is a classic representation of a cluster of related disorders called seronegative spondyloarthropathies. This cluster includes ankylosing spondylitis, reactive arthritis, psoriatic arthritis, and enteropathic arthritis (as in this case). A common feature is a very strong association with the HLA-B27 genotype. Despite some similarities with rheumatoid arthritis, these patients invariably have a negative test result for rheumatoid factor. Urethritis caused by Chlamydia trachomatis can trigger reactive arthritis, another form of seronegative spondyloarthropathy. Such infection precedes the onset of arthritis, however. There is no relationship between infection with Borrelia burgdorferi, the causative agent of Lyme disease, and reactive arthritis in individuals testing positive for HLA-B27. Similarly, Epstein-Barr virus infection is not a trigger for these disorders.
|
Pathology
|
Osteology
| 166 |
{
"Correct Answer": "HLA-B27",
"Correct Option": "D",
"Options": {
"A": "Borrelia burgdorferi",
"B": "Chlamydia trachomatis",
"C": "Epstein-Barr virus",
"D": "HLA-B27"
},
"Question": "A 30-year-old man has had cramping abdominal pain and bloody diarrhea for the past 4 days. On physical examination, there is diffuse tenderness on palpation of the abdomen. Bowel sounds are present. There are no masses and no organomegaly. A stool culture is positive for Shigella flexneri. The episode resolves spontaneously within 1 week after onset. Six weeks later, he has increasingly severe lower back pain. Physical examination now shows stiffness of the lumbar spine and tenderness of the sacroiliac joints. He is treated with nonsteroidal anti-inflammatory agents. Two months later, the back pain recurs, and he complains of redness of the right eye and blurred vision. Serologic testing for which of the following is most likely to be positive in this patient?"
}
|
A 30-year-old man has had cramping abdominal pain and bloody diarrhea for the past 4 days. On physical examination, there is diffuse tenderness on palpation of the abdomen. Bowel sounds are present. There are no masses and no organomegaly. A stool culture is positive for Shigella flexneri. The episode resolves spontaneously within 1 week after onset. Six weeks later, he has increasingly severe lower back pain. Physical examination now shows stiffness of the lumbar spine and tenderness of the sacroiliac joints. He is treated with nonsteroidal anti-inflammatory agents. Two months later, the back pain recurs, and he complains of redness of the right eye and blurred vision.
|
Serologic testing for which of the following is most likely to be positive in this patient?
|
{
"A": "Borrelia burgdorferi",
"B": "Chlamydia trachomatis",
"C": "Epstein-Barr virus",
"D": "HLA-B27"
}
|
D. HLA-B27
|
eacec070-a402-4eb3-845e-8452e0ee972d
|
A 40-year-old man without a significant medical history comes to the emergency room with a 3-day history of fever and shaking chills, and a 15-minute episode of rigor. He also reports a cough productive of yellow-green sputum, anorexia, and the development of right-sided pleuritic chest pain. Shortness of breath has been present for the past 12 hours. Chest x-ray reveals a consolidated right middle lobe infiltrate, and CBC shows an elevated neutrophil count with many band forms present. Which feature would most strongly support inpatient admission and IV antibiotic treatment for this patient?
|
Recent exposure to a family member with influenza
|
Respiratory rate of 36/min
|
Recent sexual exposure to an HIV-positive patient
|
Purulent sputum with gram-positive diplococci on Gram stain
| 1b
|
single
|
Because of the development of effective oral antibiotics (respiratory fluoroquinolones, extended spectrum macrolides), many patients with community-acquired pneumonia (CAP) can be managed as an outpatient as long as compliance and close follow-up are assured. The CURB-65 score is a validated instrument for determining if inpatient admission (either observation or full admission) is indicated. Factors predicting increased severity of infection include confusion, urea above 19 mg/dL, respiratory rate above 30, BP below 90 systolic (or 60 diastolic), and age 65 or above. If more than one of these factors is present, hospitalization should be considered.This patient's presentation (lobar pneumonia, pleuritic pain, purulent sputum) suggests pneumococcal pneumonia. The pneumococcus is the commonest organism isolated from patients with CAP. Fortunately, Spneumoniae is almost always sensitive to oral antibiotics such as clarithromycin/azithromycin and the respiratory fluoroquinolones. A Gram stain suggestive of pneumococci would therefore only confirm the clinical diagnosis. Exposure to influenza is an important historical finding. Patients with influenza often have a prodrome (upper respiratory symptoms, myalgias, prostrating weakness), but influenza would not cause a lobar infiltrate. Staphylococcus aureus pneumonia can sometimes follow influenza. Acute lobar pneumonia, even in an HIV-positive patient, is usually due to the pneumococcus and can often be treated as an outpatient. Pneumocystis jiroveci pneumonia is usually insidious in onset, causes diffuse parenchymal infiltrates, and does not cause pleurisy or pleural effusion. Physical examination signs of consolidation confirm the CXR finding of a lobar pneumonia (as opposed to a patchy bronchopneumonia) and would simply affirm the importance of coverage for classic bacterial pathogens (i.e., pneumococci, H influenzae). Atypical pneumonias (due to Mycoplasma, Chlamydia, or Legionella) are usually patchy and do not usually cause pleural effusion. Currently recommended treatment regimens for CAP cover both typical and atypical pathogens.
|
Medicine
|
Respiratory
| 130 |
{
"Correct Answer": "Respiratory rate of 36/min",
"Correct Option": "B",
"Options": {
"A": "Recent exposure to a family member with influenza",
"B": "Respiratory rate of 36/min",
"C": "Recent sexual exposure to an HIV-positive patient",
"D": "Purulent sputum with gram-positive diplococci on Gram stain"
},
"Question": "A 40-year-old man without a significant medical history comes to the emergency room with a 3-day history of fever and shaking chills, and a 15-minute episode of rigor. He also reports a cough productive of yellow-green sputum, anorexia, and the development of right-sided pleuritic chest pain. Shortness of breath has been present for the past 12 hours. Chest x-ray reveals a consolidated right middle lobe infiltrate, and CBC shows an elevated neutrophil count with many band forms present. Which feature would most strongly support inpatient admission and IV antibiotic treatment for this patient?"
}
|
A 40-year-old man without a significant medical history comes to the emergency room with a 3-day history of fever and shaking chills, and a 15-minute episode of rigor. He also reports a cough productive of yellow-green sputum, anorexia, and the development of right-sided pleuritic chest pain. Shortness of breath has been present for the past 12 hours. Chest x-ray reveals a consolidated right middle lobe infiltrate, and CBC shows an elevated neutrophil count with many band forms present.
|
Which feature would most strongly support inpatient admission and IV antibiotic treatment for this patient?
|
{
"A": "Recent exposure to a family member with influenza",
"B": "Respiratory rate of 36/min",
"C": "Recent sexual exposure to an HIV-positive patient",
"D": "Purulent sputum with gram-positive diplococci on Gram stain"
}
|
B. Respiratory rate of 36/min
|
c3d09d72-c744-453d-b9a4-675f321fb655
|
The 27-year-old male triathlon competitor complained that he frequently experienced deep pains in one calf that almost caused him to drop out of a regional track-and-field event. Doppler ultrasound studies indicated, and surgical exposure confirmed, the existence of an accessory portion of the medial head of the gastrocnemius that was constricting the popliteal artery. Above the medial head of the gastrocnemius, the superior medial border of the popliteal fossa could be seen. Which of the following structures forms this border?
|
Tendon of biceps femoris
|
Tendons of semitendinosus and semimembranosus
|
Tendon of plantaris
|
Tendinous hiatus of adductor magnus
| 1b
|
multi
|
The tendons of the semitendinosus and semimembranosus provide the superior medial border of the popliteal fossa. The semitendinosus inserts with the pes anserinus on the proximal, medial tibia. The semimembranosus inserts on the tibia posteriorly. The biceps femoris forms the superior lateral border of the fossa, as the tendon passes to insertion on the fibula. The plantaris arises from the femur just above the lateral head of the gastrocnemius, passing distally to insert on the calcaneus via the tendo Achilles. The popliteus arises from the tibia and passes superiorly and laterally to insert on the lateral condyle of the femur, with a connection to the lateral meniscus.
|
Anatomy
|
Lower Extremity
| 109 |
{
"Correct Answer": "Tendons of semitendinosus and semimembranosus",
"Correct Option": "B",
"Options": {
"A": "Tendon of biceps femoris",
"B": "Tendons of semitendinosus and semimembranosus",
"C": "Tendon of plantaris",
"D": "Tendinous hiatus of adductor magnus"
},
"Question": "The 27-year-old male triathlon competitor complained that he frequently experienced deep pains in one calf that almost caused him to drop out of a regional track-and-field event. Doppler ultrasound studies indicated, and surgical exposure confirmed, the existence of an accessory portion of the medial head of the gastrocnemius that was constricting the popliteal artery. Above the medial head of the gastrocnemius, the superior medial border of the popliteal fossa could be seen. Which of the following structures forms this border?"
}
|
The 27-year-old male triathlon competitor complained that he frequently experienced deep pains in one calf that almost caused him to drop out of a regional track-and-field event. Doppler ultrasound studies indicated, and surgical exposure confirmed, the existence of an accessory portion of the medial head of the gastrocnemius that was constricting the popliteal artery. Above the medial head of the gastrocnemius, the superior medial border of the popliteal fossa could be seen.
|
Which of the following structures forms this border?
|
{
"A": "Tendon of biceps femoris",
"B": "Tendons of semitendinosus and semimembranosus",
"C": "Tendon of plantaris",
"D": "Tendinous hiatus of adductor magnus"
}
|
B. Tendons of semitendinosus and semimembranosus
|
371ac31c-1a40-4504-9606-186ebb9e2820
|
A 56 year old man has been having bloody bowel movements on and off for the past several weeks. He repos that the blood is bright red, it coats the outside of the stools, and he can see it in the toilet bowl even before he wipes himself. When he does so, there is also blood on the toilet paper. After fuher questioning, it is asceained that he has been constipated for the past 2 months and that the caliber of the stools has changed. They are now pencil thin, rather the usual diameter of an inch or so that was customary for him. He has no pain. Which of the following is the most likely diagnosis?
|
Anal fissure
|
Cancer of the cecum
|
Cancer of the rectum
|
External hemorrhoids
| 2c
|
single
|
The combination of red blood coating the stools and a change in bowel habit and stool caliber spells out cancer of the rectum in someone in this age group. Anal fissure is typically seen in young women who have very painful bowel movements with streaks of blood. Pain is the dominant symptom in this condition. Cancer of the cecum leads to anemia and occult blood in the stools, but the blood is rarely seen. If it is, the entire stool is bloody. Fuhermore, there is no change in bowel habit or stool caliber when the tumor is so proximal in the colon. External hemorrhoids hu and itch, but they rarely bleed. Ref: Chang G.J., Shelton A.A., Welton M.L. (2010). Chapter 30. Large Intestine. In G.M. Dohey (Ed), CURRENT Diagnosis & Treatment: Surgery, 13e.
|
Surgery
| null | 137 |
{
"Correct Answer": "Cancer of the rectum",
"Correct Option": "C",
"Options": {
"A": "Anal fissure",
"B": "Cancer of the cecum",
"C": "Cancer of the rectum",
"D": "External hemorrhoids"
},
"Question": "A 56 year old man has been having bloody bowel movements on and off for the past several weeks. He repos that the blood is bright red, it coats the outside of the stools, and he can see it in the toilet bowl even before he wipes himself. When he does so, there is also blood on the toilet paper. After fuher questioning, it is asceained that he has been constipated for the past 2 months and that the caliber of the stools has changed. They are now pencil thin, rather the usual diameter of an inch or so that was customary for him. He has no pain. Which of the following is the most likely diagnosis?"
}
|
A 56 year old man has been having bloody bowel movements on and off for the past several weeks. He repos that the blood is bright red, it coats the outside of the stools, and he can see it in the toilet bowl even before he wipes himself. When he does so, there is also blood on the toilet paper. After fuher questioning, it is asceained that he has been constipated for the past 2 months and that the caliber of the stools has changed. They are now pencil thin, rather the usual diameter of an inch or so that was customary for him. He has no pain.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Anal fissure",
"B": "Cancer of the cecum",
"C": "Cancer of the rectum",
"D": "External hemorrhoids"
}
|
C. Cancer of the rectum
|
87b19c10-d3b3-4357-af21-51019d1f77a8
|
A 64-year-old man, who is a chronic alcoholic, presents with fever, chills and increasing shoness of breath. The patient appears in acute respiratory distress and complains of pleuritic chest pain. Physical examination shows crackles and decreased breath sounds over both lung fields. The patient exhibits tachypnea, with flaring of the nares. The sputum is thick, mucoidy and blood-tinged. Which of the following pathogens is the most common cause of this patient's pulmonary infection?
|
Legionella pneumophila
|
Klebsiella pneumoniae
|
Mycoplasma pneumoniae
|
Streptococcus pneumoniae
| 1b
|
multi
|
Klebsiella pneumoniae is the most frequent cause of gram-negative bacterial pneumonia. It commonly afflicts debilitated and malnourished people, paicularly chronic alcoholics. Thick, mucoid (often blood-tinged) sputum is characteristic because the organism produces an abundant viscid capsular polysac-charide, which the patient may have difficulty expectorating.
|
Pathology
|
Infectious Lung Disease: Pneumonia
| 108 |
{
"Correct Answer": "Klebsiella pneumoniae",
"Correct Option": "B",
"Options": {
"A": "Legionella pneumophila",
"B": "Klebsiella pneumoniae",
"C": "Mycoplasma pneumoniae",
"D": "Streptococcus pneumoniae"
},
"Question": "A 64-year-old man, who is a chronic alcoholic, presents with fever, chills and increasing shoness of breath. The patient appears in acute respiratory distress and complains of pleuritic chest pain. Physical examination shows crackles and decreased breath sounds over both lung fields. The patient exhibits tachypnea, with flaring of the nares. The sputum is thick, mucoidy and blood-tinged. Which of the following pathogens is the most common cause of this patient's pulmonary infection?"
}
|
A 64-year-old man, who is a chronic alcoholic, presents with fever, chills and increasing shoness of breath. The patient appears in acute respiratory distress and complains of pleuritic chest pain. Physical examination shows crackles and decreased breath sounds over both lung fields. The patient exhibits tachypnea, with flaring of the nares. The sputum is thick, mucoidy and blood-tinged.
|
Which of the following pathogens is the most common cause of this patient's pulmonary infection?
|
{
"A": "Legionella pneumophila",
"B": "Klebsiella pneumoniae",
"C": "Mycoplasma pneumoniae",
"D": "Streptococcus pneumoniae"
}
|
B. Klebsiella pneumoniae
|
3d38919b-c151-4f05-97e2-8bb90e4ee93d
|
A 29-year-old woman on oral contraceptives presents with abdominal pain. A computed tomography (CT) scan of the abdomen demonstrates a large hematoma of the right liver with the suggestion of an underlying liver lesion. Her hemoglobin is 6, and she is transfused 2 units of packed red blood cells and 2 units of fresh frozen plasma. Two hours after staing the transfusion, she develops respiratory distress and requires intubation. She is not volume overloaded clinically, but her chest x-ray shows bilateral pulmonary infiltrates. Which of the following is the management strategy of choice?
|
Continue the transfusion and administer an antihistamine
|
Stop the transfusion and administer a diuretic
|
Stop the transfusion, perform bronchoscopy, and sta broad-spectrum empiric antibiotics
|
Stop the transfusion and continue suppoive respiratory care
| 3d
|
multi
|
The patient has TRALI or transfusion-related acute lung injury which manifests as respiratory distress, hypoxemia, and bilateral pulmonary infiltrates not due to volume overload. The treatment of choice is respiratory suppo, including mechanical ventilation, as needed. The major risk factor for TRALI is transfusion of any plasma-containing blood products from multiparous female donors. Other complications of transfusions and their treatments include: (1) allergic reactions such as rash and fever--mild reactions are treated with an antihistamine; (2) transfusion-associated circulation overload (TACO) which occurs in patients with underlying hea failure who receive large volume transfusions--the treatment is administration of diuretics; and hemolytic reactions--diagnosis is made by a positive Coombs test and treatment is to stop the transfusion and identify the responsible antigen to prevent future reactions. There is no evidence that the patient has pneumonia or any other indication to perform bronchoscopy or to sta antibiotics.
|
Anaesthesia
|
Miscellaneous
| 124 |
{
"Correct Answer": "Stop the transfusion and continue suppoive respiratory care",
"Correct Option": "D",
"Options": {
"A": "Continue the transfusion and administer an antihistamine",
"B": "Stop the transfusion and administer a diuretic",
"C": "Stop the transfusion, perform bronchoscopy, and sta broad-spectrum empiric antibiotics",
"D": "Stop the transfusion and continue suppoive respiratory care"
},
"Question": "A 29-year-old woman on oral contraceptives presents with abdominal pain. A computed tomography (CT) scan of the abdomen demonstrates a large hematoma of the right liver with the suggestion of an underlying liver lesion. Her hemoglobin is 6, and she is transfused 2 units of packed red blood cells and 2 units of fresh frozen plasma. Two hours after staing the transfusion, she develops respiratory distress and requires intubation. She is not volume overloaded clinically, but her chest x-ray shows bilateral pulmonary infiltrates. Which of the following is the management strategy of choice?"
}
|
A 29-year-old woman on oral contraceptives presents with abdominal pain. A computed tomography (CT) scan of the abdomen demonstrates a large hematoma of the right liver with the suggestion of an underlying liver lesion. Her hemoglobin is 6, and she is transfused 2 units of packed red blood cells and 2 units of fresh frozen plasma. Two hours after staing the transfusion, she develops respiratory distress and requires intubation. She is not volume overloaded clinically, but her chest x-ray shows bilateral pulmonary infiltrates.
|
Which of the following is the management strategy of choice?
|
{
"A": "Continue the transfusion and administer an antihistamine",
"B": "Stop the transfusion and administer a diuretic",
"C": "Stop the transfusion, perform bronchoscopy, and sta broad-spectrum empiric antibiotics",
"D": "Stop the transfusion and continue suppoive respiratory care"
}
|
D. Stop the transfusion and continue suppoive respiratory care
|
5585da3c-5132-4b3d-89f5-cd27c8172713
|
A 67-year-old man with an 18-year history of type 2 diabetes mellitus presents for a routine physical examination. His temperature is 36.9 C (98.5 F), his blood pressure is 158/98 mm Hg and his pulse is 82/minute and regular. On examination, the physician notes a non tender, pulsatile, mass in the mid-abdomen. A plain abdominal x-ray film with the patient in the lateral position reveals spotty calcification of a markedly dilated abdominal aoic walI. Following surgery, the patient is placed on a low-fat diet to reduce the risk of continued progression of his atherosclerotic disease. A bile acid sequestrant is added to interrupt enterohepatic circulation of bile acids. Which of the following agents was MOST likely prescribed?
|
Atorvastatin
|
Cholestyramine
|
Clofibrate
|
Gemfibrozil
| 1b
|
single
|
Cholestyramine and colestipol are bile acid sequestrants that bind bile acids in the intestine, thereby interrupting enterohepatic circulation of bile acids. This has an indirect effect to enhance LDL clearance and lower lipids in the blood. Atorvastatin and lovastatin are lipid-lowering drugs that competitively inhibit HMG-CoA reductase, an early step in cholesterol biosynthesis. Clofibrate and gemfibrozil are fibric acid derivatives that may increase the activity of lipoprotein lipase. Ref: Bersot T.P. (2011). Chapter 31. Drug Therapy for Hypercholesterolemia and Dyslipidemia. In L.L. Brunton, B.A. Chabner, B.C. Knollmann (Eds), Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12e.
|
Pharmacology
| null | 180 |
{
"Correct Answer": "Cholestyramine",
"Correct Option": "B",
"Options": {
"A": "Atorvastatin",
"B": "Cholestyramine",
"C": "Clofibrate",
"D": "Gemfibrozil"
},
"Question": "A 67-year-old man with an 18-year history of type 2 diabetes mellitus presents for a routine physical examination. His temperature is 36.9 C (98.5 F), his blood pressure is 158/98 mm Hg and his pulse is 82/minute and regular. On examination, the physician notes a non tender, pulsatile, mass in the mid-abdomen. A plain abdominal x-ray film with the patient in the lateral position reveals spotty calcification of a markedly dilated abdominal aoic walI. Following surgery, the patient is placed on a low-fat diet to reduce the risk of continued progression of his atherosclerotic disease. A bile acid sequestrant is added to interrupt enterohepatic circulation of bile acids. Which of the following agents was MOST likely prescribed?"
}
|
A 67-year-old man with an 18-year history of type 2 diabetes mellitus presents for a routine physical examination. His temperature is 36.9 C (98.5 F), his blood pressure is 158/98 mm Hg and his pulse is 82/minute and regular. On examination, the physician notes a non tender, pulsatile, mass in the mid-abdomen. A plain abdominal x-ray film with the patient in the lateral position reveals spotty calcification of a markedly dilated abdominal aoic walI. Following surgery, the patient is placed on a low-fat diet to reduce the risk of continued progression of his atherosclerotic disease. A bile acid sequestrant is added to interrupt enterohepatic circulation of bile acids.
|
Which of the following agents was MOST likely prescribed?
|
{
"A": "Atorvastatin",
"B": "Cholestyramine",
"C": "Clofibrate",
"D": "Gemfibrozil"
}
|
B. Cholestyramine
|
3a6b4569-defb-49b4-8430-ff9ea210a929
|
A 69 year old male presents with an episode of slurring of speech which lasted for 12 hours and then resolved.He is heavy smoker having smoked 60 cigarettes per day for 40 years. He had a single episode of haemoptysis 4 weeks previously and has underlying lung cancer with brain metastases and is referred for an urgent CT chest. An ECG was performed which showed new AF. All blood tests including cardiac biomarkers were normal. Chest CT is shown. Which of the following is most probable diagnosis?
|
Left atrial myxoma
|
Left atrial thrombus
|
Infective endocarditis
|
Rhabdomyoma
| 1b
|
multi
|
The axial image from a contrast enhanced CT scan, in aerial phase, shows a filling defect in the left atrial appendage layered along the anterior wall. Given the clinical history and the CT appearance, the most likely diagnosis is of thrombus in the LA as a consequence of AF. Myxomas generally arise from interatrial septum projecting into the left atrium Vegetation, abscess and new dehiscence of a prosthetic valve are the three major echocardiographic criteria for the diagnosis of infective endocarditis.
|
Radiology
|
Cardiovascular Radiology
| 111 |
{
"Correct Answer": "Left atrial thrombus",
"Correct Option": "B",
"Options": {
"A": "Left atrial myxoma",
"B": "Left atrial thrombus",
"C": "Infective endocarditis",
"D": "Rhabdomyoma"
},
"Question": "A 69 year old male presents with an episode of slurring of speech which lasted for 12 hours and then resolved.He is heavy smoker having smoked 60 cigarettes per day for 40 years. He had a single episode of haemoptysis 4 weeks previously and has underlying lung cancer with brain metastases and is referred for an urgent CT chest. An ECG was performed which showed new AF. All blood tests including cardiac biomarkers were normal. Chest CT is shown. Which of the following is most probable diagnosis?"
}
|
A 69 year old male presents with an episode of slurring of speech which lasted for 12 hours and then resolved.He is heavy smoker having smoked 60 cigarettes per day for 40 years. He had a single episode of haemoptysis 4 weeks previously and has underlying lung cancer with brain metastases and is referred for an urgent CT chest. An ECG was performed which showed new AF. All blood tests including cardiac biomarkers were normal. Chest CT is shown.
|
Which of the following is most probable diagnosis?
|
{
"A": "Left atrial myxoma",
"B": "Left atrial thrombus",
"C": "Infective endocarditis",
"D": "Rhabdomyoma"
}
|
B. Left atrial thrombus
|
d2c083fb-c7d7-40a9-8802-59bf29188590
|
A 30 year old G1P1001 patient comes to see you In office at 37 weeks gestational age for her routine OB visit. Her 1st pregnancy resulted in a vaginal delivery of a 9-lb, 8-02 baby boy after 30 minutes of pushing. On doing Leopold maneuvers during this office visit codetermine ttwt the fetus is breech. Vaginal exam demonstrate that the cervix is 50% effaced and 1-2 cm dilated. The presenting breech is high out of pelvis. The estimated fetal weight, is about 7 lb. yn the patient- for a USG, which confirms a fetus frank breech prestation. There is a normal am &; amniotic fluid present, and the head is well-felt the patient&;s obstetrician, you offer all the following possible mgmt plans except
|
Allow the patient to undergo a vaginal breech delivery whenever she goes into labor
|
Send the patient to labor and delivery immediately for an emergen CS
|
Schedule a CS at or after 39 weeks gestation a
|
Schedule an ext cephalic version In next few days
| 1b
|
multi
|
definite indications for elective Caesarean section all complicated breech pregnancy Contracted or borderline pelvis Large babies Severe IUGR Hyper extension of fetal head Footling or knee presentation Previous Caesarean section Lack of an obstetrician experienced in assisted breech delivery can also be considered an indication for for elective Caesarean section (refer pgno:378 sheila textbook of obstetrics 2 nd edition)
|
Gynaecology & Obstetrics
|
Abnormal labor
| 192 |
{
"Correct Answer": "Send the patient to labor and delivery immediately for an emergen CS",
"Correct Option": "B",
"Options": {
"A": "Allow the patient to undergo a vaginal breech delivery whenever she goes into labor",
"B": "Send the patient to labor and delivery immediately for an emergen CS",
"C": "Schedule a CS at or after 39 weeks gestation a",
"D": "Schedule an ext cephalic version In next few days"
},
"Question": "A 30 year old G1P1001 patient comes to see you In office at 37 weeks gestational age for her routine OB visit. Her 1st pregnancy resulted in a vaginal delivery of a 9-lb, 8-02 baby boy after 30 minutes of pushing. On doing Leopold maneuvers during this office visit codetermine ttwt the fetus is breech. Vaginal exam demonstrate that the cervix is 50% effaced and 1-2 cm dilated. The presenting breech is high out of pelvis. The estimated fetal weight, is about 7 lb. yn the patient- for a USG, which confirms a fetus frank breech prestation. There is a normal am &; amniotic fluid present, and the head is well-felt the patient&;s obstetrician, you offer all the following possible mgmt plans except"
}
|
A 30 year old G1P1001 patient comes to see you In office at 37 weeks gestational age for her routine OB visit. Her 1st pregnancy resulted in a vaginal delivery of a 9-lb, 8-02 baby boy after 30 minutes of pushing. On doing Leopold maneuvers during this office visit codetermine ttwt the fetus is breech. Vaginal exam demonstrate that the cervix is 50% effaced and 1-2 cm dilated. The presenting breech is high out of pelvis. The estimated fetal weight, is about 7 lb. yn the patient- for a USG, which confirms a fetus frank breech prestation.
|
There is a normal am &; amniotic fluid present, and the head is well-felt the patient&;s obstetrician, you offer all the following possible mgmt plans except
|
{
"A": "Allow the patient to undergo a vaginal breech delivery whenever she goes into labor",
"B": "Send the patient to labor and delivery immediately for an emergen CS",
"C": "Schedule a CS at or after 39 weeks gestation a",
"D": "Schedule an ext cephalic version In next few days"
}
|
B. Send the patient to labor and delivery immediately for an emergen CS
|
b6f6520e-b4a8-4acd-9621-bda51a06f76f
|
A study was conducted to test if use of herbal tea played any role in prevention of common cold. Data was collected on the number of people who developed cold and those who did not develop cold and this data was tabulated in relation to whether they consumed Herbal tea or not.\r\n\r\n\r\n\r\n Herbal tea \r\nConsumed\r\nNot consumed\r\n\r\n\r\n Had cold \r\n12\r\n 23\r\n\r\n\r\n Did not have a cold \r\n 34\r\n38\r\n\r\n\r\n\r\n In order to study this above given test, which of the following analytical test can be used?
|
'Z' test
|
Chi square test
|
Student -1 test (paired)
|
Student -1 test (unpaired)
| 1b
|
multi
|
According to the question, the data that has to assessed is the nominal data which has been arranged in qualified categories and thus by using a non-parametric test, the Chi square test is used for the analytical study of the test. The student t-test (unpaired and paired t test) and the 'z' test are parametric tests that are used to test hypothesis for quantitative data (not qualitative data) Ref: Park's Texbook of Preventive and Social Medicine 19th edition; pages 705; High Yield Biostatistics by Anthony N. Glaser 2nd Edition, Pages 46 - 47; Methods in Biostatistics By Mahajan6th Edition, Pages 168 - 185
|
Social & Preventive Medicine
| null | 141 |
{
"Correct Answer": "Chi square test",
"Correct Option": "B",
"Options": {
"A": "'Z' test",
"B": "Chi square test",
"C": "Student -1 test (paired)",
"D": "Student -1 test (unpaired)"
},
"Question": "A study was conducted to test if use of herbal tea played any role in prevention of common cold. Data was collected on the number of people who developed cold and those who did not develop cold and this data was tabulated in relation to whether they consumed Herbal tea or not.\\r\\n\\r\\n\\r\\n\\r\\n Herbal tea \\r\\nConsumed\\r\\nNot consumed\\r\\n\\r\\n\\r\\n Had cold \\r\\n12\\r\\n 23\\r\\n\\r\\n\\r\\n Did not have a cold \\r\\n 34\\r\\n38\\r\\n\\r\\n\\r\\n\\r\\n In order to study this above given test, which of the following analytical test can be used?"
}
|
A study was conducted to test if use of herbal tea played any role in prevention of common cold.
|
Data was collected on the number of people who developed cold and those who did not develop cold and this data was tabulated in relation to whether they consumed Herbal tea or not.\r\n\r\n\r\n\r\n Herbal tea \r\nConsumed\r\nNot consumed\r\n\r\n\r\n Had cold \r\n12\r\n 23\r\n\r\n\r\n Did not have a cold \r\n 34\r\n38\r\n\r\n\r\n\r\n In order to study this above given test, which of the following analytical test can be used?
|
{
"A": "'Z' test",
"B": "Chi square test",
"C": "Student -1 test (paired)",
"D": "Student -1 test (unpaired)"
}
|
B. Chi square test
|
cd6ef7dd-345d-44f7-8c57-193e747f7bb1
|
An epidemiologic study evaluates the rate of dental caries and tooth abscesses among children living in communities within a metropolitan area. Investigators discover that the rate is high among children living in an upper-middle-class community but low in children living in a community below the poverty level. The levels of trace elements in the water supplies for those communities are measured. A higher level of which of the following minerals in the water is most likely to be associated with a lower rate of dental decay among the children living in the poor community?
|
Copper
|
Fluoride
|
Iodine
|
Selenium
| 1b
|
single
|
Water in some areas naturally contains fluoride, and dental problems in children are fewer in these areas because tooth enamel is strengthened. Fluoride can be added to drinking water, but opposition to this practice, from ignorance or fear, is common. Copper deficiency can produce neurologic defects. Iodine deficiency can predispose to thyroid goiter. Selenium is a trace mineral that forms a component of glutathione peroxidase; deficiency may be associated with myopathy and heart disease. Serious illnesses from trace element deficiencies are rare. Zinc is a trace mineral that aids in wound healing; a deficiency state can lead to stunted growth in children and a vesicular, erythematous rash.
|
Pathology
|
Environment & Nutritional Pathology
| 105 |
{
"Correct Answer": "Fluoride",
"Correct Option": "B",
"Options": {
"A": "Copper",
"B": "Fluoride",
"C": "Iodine",
"D": "Selenium"
},
"Question": "An epidemiologic study evaluates the rate of dental caries and tooth abscesses among children living in communities within a metropolitan area. Investigators discover that the rate is high among children living in an upper-middle-class community but low in children living in a community below the poverty level. The levels of trace elements in the water supplies for those communities are measured. A higher level of which of the following minerals in the water is most likely to be associated with a lower rate of dental decay among the children living in the poor community?"
}
|
An epidemiologic study evaluates the rate of dental caries and tooth abscesses among children living in communities within a metropolitan area. Investigators discover that the rate is high among children living in an upper-middle-class community but low in children living in a community below the poverty level. The levels of trace elements in the water supplies for those communities are measured.
|
A higher level of which of the following minerals in the water is most likely to be associated with a lower rate of dental decay among the children living in the poor community?
|
{
"A": "Copper",
"B": "Fluoride",
"C": "Iodine",
"D": "Selenium"
}
|
B. Fluoride
|
8add0ee7-5f96-4f91-ba5f-fc34ca99d3cd
|
A 65 year old white male in previously good health sta to notice blood in his urine. He develops pain with urination. He also thinks that the stream of his urine is weakened. He goes to his family doctor because of his symptoms. Laboratory findings show an anemia. His urinalysis is positive for red cells, white cells and gram negative rods are seen. A cystogram is done and shows a tumor. A transurethral biopsy is done and confirms a malignant bladder tumor. Which of the following is true of this patient's tumor?
|
It is likely to be an adenocarcinoma
|
More commonly presents with a palpable abdominal mass
|
Likely to cause an elevated serum acid phosphatase
|
Is likely to recur after treatment
| 3d
|
multi
|
Is likely to recur after treatment * Even after treatment, transitional cell cancers of the bladder tend to recur. * Choice (a) is incorrect because about 90% of bladder cancers are transitional cell carcinomas. * The classic triad: hematuria, flank pain, and a palpable abdominal mass is associated with renal cell carcinoma, not bladder cancer. * Elevated serum acid phosphatase is seen with prostate cancer, not bladder cancer.
|
Surgery
| null | 114 |
{
"Correct Answer": "Is likely to recur after treatment",
"Correct Option": "D",
"Options": {
"A": "It is likely to be an adenocarcinoma",
"B": "More commonly presents with a palpable abdominal mass",
"C": "Likely to cause an elevated serum acid phosphatase",
"D": "Is likely to recur after treatment"
},
"Question": "A 65 year old white male in previously good health sta to notice blood in his urine. He develops pain with urination. He also thinks that the stream of his urine is weakened. He goes to his family doctor because of his symptoms. Laboratory findings show an anemia. His urinalysis is positive for red cells, white cells and gram negative rods are seen. A cystogram is done and shows a tumor. A transurethral biopsy is done and confirms a malignant bladder tumor. Which of the following is true of this patient's tumor?"
}
|
A 65 year old white male in previously good health sta to notice blood in his urine. He develops pain with urination. He also thinks that the stream of his urine is weakened. He goes to his family doctor because of his symptoms. Laboratory findings show an anemia. His urinalysis is positive for red cells, white cells and gram negative rods are seen. A cystogram is done and shows a tumor. A transurethral biopsy is done and confirms a malignant bladder tumor.
|
Which of the following is true of this patient's tumor?
|
{
"A": "It is likely to be an adenocarcinoma",
"B": "More commonly presents with a palpable abdominal mass",
"C": "Likely to cause an elevated serum acid phosphatase",
"D": "Is likely to recur after treatment"
}
|
D. Is likely to recur after treatment
|
b50294a0-bf80-4042-9ed9-87a6ef5e2e10
|
A 49-year-old woman has experienced increasing weakness and chest pain over the past 6 months. On physical examination, she is afebrile and normotensive. Motor strength is 5/5 in all extremities, but diminishes to 4/5 with repetitive movement. There is no muscle pain or tenderness. Laboratory studies show hemoglobin, 14 g/dL; hematocrit, 42%; platelet count, 246,000/mm3; and WBC count, 6480/mm3. A chest CT scan shows an irregular 10x12 cm anterior mediastinal mass. The surgeon has difficulty removing the mass because it infiltrates surrounding structures. Microscopically, the mass is composed of large, spindled, atypical epithelial cells mixed with lymphoid cells. Which of the following is the most likely cause of this mass lesion?
|
Extrapulmonary tuberculosis
|
Hodgkin lymphoma
|
Lymphoblastic lymphoma
|
Malignant thymoma
| 3d
|
multi
|
Thymomas are rare neoplasms that can be benign or malignant. In one third to one half of cases, thymomas are associated with myasthenia gravis as an initial presentation (as in this case). Benign thymomas have a mixed population of lymphocytes and epithelial cells and are circumscribed, whereas malignant thymomas are invasive and have atypical cells. Thymic carcinomas resemble squamous cell carcinomas. Granulomas can have epithelioid macrophages and lymphocytes, but the thymus is an unusual location for them. Hodgkin lymphoma involves lymph nodes in the middle or posterior mediastinum, with a component of Reed-Sternberg cells. Lymphoblastic lymphoma of the T-cell variety is seen in the mediastinal region, including thymus, in children, but it has no epithelial component. Metastases to the thymus are quite unusual. An organizing abscess could have granulation tissue at its edge, with a mixture of inflammatory cell types, but not atypical cells.
|
Pathology
|
Blood
| 194 |
{
"Correct Answer": "Malignant thymoma",
"Correct Option": "D",
"Options": {
"A": "Extrapulmonary tuberculosis",
"B": "Hodgkin lymphoma",
"C": "Lymphoblastic lymphoma",
"D": "Malignant thymoma"
},
"Question": "A 49-year-old woman has experienced increasing weakness and chest pain over the past 6 months. On physical examination, she is afebrile and normotensive. Motor strength is 5/5 in all extremities, but diminishes to 4/5 with repetitive movement. There is no muscle pain or tenderness. Laboratory studies show hemoglobin, 14 g/dL; hematocrit, 42%; platelet count, 246,000/mm3; and WBC count, 6480/mm3. A chest CT scan shows an irregular 10x12 cm anterior mediastinal mass. The surgeon has difficulty removing the mass because it infiltrates surrounding structures. Microscopically, the mass is composed of large, spindled, atypical epithelial cells mixed with lymphoid cells. Which of the following is the most likely cause of this mass lesion?"
}
|
A 49-year-old woman has experienced increasing weakness and chest pain over the past 6 months. On physical examination, she is afebrile and normotensive. Motor strength is 5/5 in all extremities, but diminishes to 4/5 with repetitive movement. There is no muscle pain or tenderness. Laboratory studies show hemoglobin, 14 g/dL; hematocrit, 42%; platelet count, 246,000/mm3; and WBC count, 6480/mm3. A chest CT scan shows an irregular 10x12 cm anterior mediastinal mass. The surgeon has difficulty removing the mass because it infiltrates surrounding structures. Microscopically, the mass is composed of large, spindled, atypical epithelial cells mixed with lymphoid cells.
|
Which of the following is the most likely cause of this mass lesion?
|
{
"A": "Extrapulmonary tuberculosis",
"B": "Hodgkin lymphoma",
"C": "Lymphoblastic lymphoma",
"D": "Malignant thymoma"
}
|
D. Malignant thymoma
|
c07322bc-4b43-4c1a-839e-154aefcc3aa5
|
A 25-year-old woman rushes to an emergency depament because she is afraid she is dying. She is experiencing chest pain, a sensation of choking, nausea, and tingling sensations up and down her arms. When the screening nurse examines the patient, her face is flushed and sweating. Her pulse is 140/min and respirations are 25/min. When the emergency depament physician examines her 15 minutes later, her symptoms are dissipating; her pulse is 100/min, and respirations are 20/min. The ECG is normal, except for some residual tachycardia. Which of the following is the most likely diagnosis?
|
Angina
|
Heaburn
|
Myocardial infarction
|
Panic attack
| 3d
|
multi
|
This woman had a panic attack. These are common, affecting more than one third of the general population each year. The etiology appears to be a combination of both biological and psychological dysfunction. The sensations and physiologic changes can be very dramatic and, in addition to the features cited in the question stem, can include dizziness, fear of going crazy, feelings of unreality, chills, abdominal distress, palpitations, shoness of breath, and trembling or shaking. Many patients who experience a panic attack are concerned that they may have a dangerous hea, lung, or brain disorder. Although the diagnosis is fairly straightforward in a younger individual with no known serious disease, the diagnostic dilemma is more difficult in an older patient, who may potentially have a true disease of these organ systems. Whereas isolated panic attacks are common, less than 1% of the population has "panic disorder," characterized by frequent panic attacks, severe anticipation anxiety about recurrent attacks, and avoidance of places in which attacks had previously been experienced. Individuals with isolated panic attacks usually need no more therapy than reassurance; those with panic disorder may be helped with antidepressants, benzodiazepines, and behavior therapy.Angina and myocardial infarction would not be expected in a 25-year-old woman, and the ischemic changes would be apparent on the ECG. Heaburn can produce chest pain, but does not usually produce increased pulse and respiratory rate. Ref: Lee T.H. (2012). Chapter 12. Chest Discomfo. In D.L. Longo, A.S. Fauci, D.L. Kasper, S.L. Hauser, J.L. Jameson, J. Loscalzo (Eds), Harrison's Principles of Internal Medicine, 18e.
|
Psychiatry
| null | 141 |
{
"Correct Answer": "Panic attack",
"Correct Option": "D",
"Options": {
"A": "Angina",
"B": "Heaburn",
"C": "Myocardial infarction",
"D": "Panic attack"
},
"Question": "A 25-year-old woman rushes to an emergency depament because she is afraid she is dying. She is experiencing chest pain, a sensation of choking, nausea, and tingling sensations up and down her arms. When the screening nurse examines the patient, her face is flushed and sweating. Her pulse is 140/min and respirations are 25/min. When the emergency depament physician examines her 15 minutes later, her symptoms are dissipating; her pulse is 100/min, and respirations are 20/min. The ECG is normal, except for some residual tachycardia. Which of the following is the most likely diagnosis?"
}
|
A 25-year-old woman rushes to an emergency depament because she is afraid she is dying. She is experiencing chest pain, a sensation of choking, nausea, and tingling sensations up and down her arms. When the screening nurse examines the patient, her face is flushed and sweating. Her pulse is 140/min and respirations are 25/min. When the emergency depament physician examines her 15 minutes later, her symptoms are dissipating; her pulse is 100/min, and respirations are 20/min. The ECG is normal, except for some residual tachycardia.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Angina",
"B": "Heaburn",
"C": "Myocardial infarction",
"D": "Panic attack"
}
|
D. Panic attack
|
234c6833-b1e3-4452-88bf-cfd490dc5bad
|
A 69-year-old man comes to the physician because of the gradual onset of pain, tingling and hyperesthesia in the medial aspect of his right arm. Shortly thereafter, he develops erythema and then an outbreak of vesicles on the medial aspect of his right arm extending from his medial epicondyle to the wrist. After several days. the lesions crust over and eventually resolve. However, he is left with a residual “burning” pain in the same distribution as the lesions with occasional episodes of sharp.1O/1O pain that is provoked by touch. He uses ice packs to suppress the pain at night but it has persisted despite this.
The infectious agent responsible for this condition resides in which part of the neuraxis?
|
Brainstem
|
Dorsal root ganglion
|
Sensory nerve axon
|
Sensory nerve root
| 1b
|
multi
| null |
Medicine
| null | 153 |
{
"Correct Answer": "Dorsal root ganglion",
"Correct Option": "B",
"Options": {
"A": "Brainstem",
"B": "Dorsal root ganglion",
"C": "Sensory nerve axon",
"D": "Sensory nerve root"
},
"Question": "A 69-year-old man comes to the physician because of the gradual onset of pain, tingling and hyperesthesia in the medial aspect of his right arm. Shortly thereafter, he develops erythema and then an outbreak of vesicles on the medial aspect of his right arm extending from his medial epicondyle to the wrist. After several days. the lesions crust over and eventually resolve. However, he is left with a residual “burning” pain in the same distribution as the lesions with occasional episodes of sharp.1O/1O pain that is provoked by touch. He uses ice packs to suppress the pain at night but it has persisted despite this. \n\nThe infectious agent responsible for this condition resides in which part of the neuraxis?"
}
|
A 69-year-old man comes to the physician because of the gradual onset of pain, tingling and hyperesthesia in the medial aspect of his right arm. Shortly thereafter, he develops erythema and then an outbreak of vesicles on the medial aspect of his right arm extending from his medial epicondyle to the wrist. After several days. the lesions crust over and eventually resolve. However, he is left with a residual “burning” pain in the same distribution as the lesions with occasional episodes of sharp.1O/1O pain that is provoked by touch. He uses ice packs to suppress the pain at night but it has persisted despite this.
|
The infectious agent responsible for this condition resides in which part of the neuraxis?
|
{
"A": "Brainstem",
"B": "Dorsal root ganglion",
"C": "Sensory nerve axon",
"D": "Sensory nerve root"
}
|
B. Dorsal root ganglion
|
153eb6d2-2430-4054-8c7a-5c0f3da4c493
|
A 45 year old male presented with palpitations, tachycardia & anxiety. His BP is 158/90 mmHg. The patient also has mild depression and is presently taking citalopram, labetalol & amlodipine to control his blood pressure. 24-hour urine total metanephrines are ordered and show an elevation of 1.5 times the upper limit of normal. What is the next best step?
|
Hold labetalol for 1 week and repeat testing
|
Hold citalopram for 1 week and repeat testing
|
Refer immediately for surgical evaluation
|
Measure 24-hour urine vanillylmandelic acid level
| 0a
|
multi
|
Investigations done in pheochromocytoma 24 hour urinary fractionated metanephrine 24 hour urinary catecholamines 24 hour urinary vanillylmandelic acid level IOC- Plasma fractionated metanephrine levels 24-hour urine total metanephrines has high sensitivity & value of three times the upper limit of normal is highly suggestive of pheochromocytoma. Borderline elevation- likely to be false positives. Drugs related- include levodopa, sympathomimetics, diuretics, TCA, and a- and b-blockers (Labetalol) Therefore, hold labetalol for 1 week and repeat testing is the best next step
|
Medicine
|
Disorders of Adrenal Gland
| 101 |
{
"Correct Answer": "Hold labetalol for 1 week and repeat testing",
"Correct Option": "A",
"Options": {
"A": "Hold labetalol for 1 week and repeat testing",
"B": "Hold citalopram for 1 week and repeat testing",
"C": "Refer immediately for surgical evaluation",
"D": "Measure 24-hour urine vanillylmandelic acid level"
},
"Question": "A 45 year old male presented with palpitations, tachycardia & anxiety. His BP is 158/90 mmHg. The patient also has mild depression and is presently taking citalopram, labetalol & amlodipine to control his blood pressure. 24-hour urine total metanephrines are ordered and show an elevation of 1.5 times the upper limit of normal. What is the next best step?"
}
|
A 45 year old male presented with palpitations, tachycardia & anxiety. His BP is 158/90 mmHg. The patient also has mild depression and is presently taking citalopram, labetalol & amlodipine to control his blood pressure. 24-hour urine total metanephrines are ordered and show an elevation of 1.5 times the upper limit of normal.
|
What is the next best step?
|
{
"A": "Hold labetalol for 1 week and repeat testing",
"B": "Hold citalopram for 1 week and repeat testing",
"C": "Refer immediately for surgical evaluation",
"D": "Measure 24-hour urine vanillylmandelic acid level"
}
|
A. Hold labetalol for 1 week and repeat testing
|
5bedaef6-8d34-446e-b094-f42fca1dbd12
|
A pharmaceutical company develops a new antihypertensive drug. Samples of 24 hypertensive patients, randomly selected from a large population of hypertensive people, are randomly divided into 2 groups of 12. One group is given the new drug over a period of 1 month; the other group is given a placebo according to the same schedule. Neither the patients nor the treating physicians are aware of which patients are in which group. At the end of the month, measurements are made of the patient’s blood pressures. This study
|
Is a randomized controlled clinical trial
|
Uses a crossover design
|
Is a single blind experiment
|
Is a prospective study
| 0a
|
single
|
Here, a pharmaceutical company develops a new anti-hypertensive drug; samples of 24 hypertensive patients, randomly selected from a large population of hypertensive people, are randomly divided into 2 groups of 12, and one group is given the new drug over a period of 1 month & the other group is given a placebo according to the same schedule,
Since a new drug (intervention) is given it is an experimental/ interventional study (not a prospective study which is only observational in design)
Also, there are 2 groups, i.e. experimental group (Intervention – new drug is given) and reference group (no intervention is given – only placebo is given) which are compared concurrently, thus it is a ‘Concurrent parallel design of RCT’ (there is no cross-over)
Also, neither the patients nor the treating physicians are aware of which patients are in which group, thus it is a ‘double blinded RCT’.
|
Social & Preventive Medicine
| null | 110 |
{
"Correct Answer": "Is a randomized controlled clinical trial",
"Correct Option": "A",
"Options": {
"A": "Is a randomized controlled clinical trial",
"B": "Uses a crossover design",
"C": "Is a single blind experiment",
"D": "Is a prospective study"
},
"Question": "A pharmaceutical company develops a new antihypertensive drug. Samples of 24 hypertensive patients, randomly selected from a large population of hypertensive people, are randomly divided into 2 groups of 12. One group is given the new drug over a period of 1 month; the other group is given a placebo according to the same schedule. Neither the patients nor the treating physicians are aware of which patients are in which group. At the end of the month, measurements are made of the patient’s blood pressures. This study"
}
|
A pharmaceutical company develops a new antihypertensive drug. Samples of 24 hypertensive patients, randomly selected from a large population of hypertensive people, are randomly divided into 2 groups of 12. One group is given the new drug over a period of 1 month; the other group is given a placebo according to the same schedule. Neither the patients nor the treating physicians are aware of which patients are in which group. At the end of the month, measurements are made of the patient’s blood pressures.
|
This study
|
{
"A": "Is a randomized controlled clinical trial",
"B": "Uses a crossover design",
"C": "Is a single blind experiment",
"D": "Is a prospective study"
}
|
A. Is a randomized controlled clinical trial
|
d9e3512a-cb34-460b-8045-60083ae8387c
|
A 30 year old person met with a roadside accident. On admision his pulse rate was 120/minute, BP was 100/60 mmHg. Ultrasonagraphy examination revealed laceration of the lower pole of spleen and haemoperitoneum. He was resuscitated with blood and fluid. Two hours later, his pulse was 84/minute and BP was 120/70 mm Hg. The most appropriate course of management in this case would be-
|
Exploring the patient followed by splenectomy
|
Exploring the patient followed by excision of the lower pole of spleen
|
Splenorrhaphy
|
Continuation of conservative treatment under close monitoring system and subsequent surgery if further indicated
| 3d
|
single
| null |
Surgery
| null | 112 |
{
"Correct Answer": "Continuation of conservative treatment under close monitoring system and subsequent surgery if further indicated",
"Correct Option": "D",
"Options": {
"A": "Exploring the patient followed by splenectomy",
"B": "Exploring the patient followed by excision of the lower pole of spleen",
"C": "Splenorrhaphy",
"D": "Continuation of conservative treatment under close monitoring system and subsequent surgery if further indicated"
},
"Question": "A 30 year old person met with a roadside accident. On admision his pulse rate was 120/minute, BP was 100/60 mmHg. Ultrasonagraphy examination revealed laceration of the lower pole of spleen and haemoperitoneum. He was resuscitated with blood and fluid. Two hours later, his pulse was 84/minute and BP was 120/70 mm Hg. The most appropriate course of management in this case would be-"
}
|
A 30 year old person met with a roadside accident. On admision his pulse rate was 120/minute, BP was 100/60 mmHg. Ultrasonagraphy examination revealed laceration of the lower pole of spleen and haemoperitoneum. He was resuscitated with blood and fluid. Two hours later, his pulse was 84/minute and BP was 120/70 mm Hg.
|
The most appropriate course of management in this case would be-
|
{
"A": "Exploring the patient followed by splenectomy",
"B": "Exploring the patient followed by excision of the lower pole of spleen",
"C": "Splenorrhaphy",
"D": "Continuation of conservative treatment under close monitoring system and subsequent surgery if further indicated"
}
|
D. Continuation of conservative treatment under close monitoring system and subsequent surgery if further indicated
|
24e6e46a-91bb-4c8d-9047-170fe6250e05
|
Several weeks after surgical dissection of her left axilla for the removal of lymph nodes for staging and treatment of her breast cancer, a 32-year-old woman was told by her general physician that she had "winging" of her left scapula when she pushed against resistance during her physical examination. She told the physician that she had also experienced difficulty lately in raising her right arm above her head when she was combing her hair. In a subsequent consult visit with her surgeon, she was told that a nerve was accidentally injured during the diagnostic surgical procedure and that this produced her scapular abnormality and inability to raise her arm normally. What was the origin of this nerve?
|
The upper trunk of her brachial plexus
|
The posterior division of the middle trunk
|
Roots of the brachial plexus
|
The posterior cord of the brachial plexus
| 2c
|
multi
|
The long thoracic nerve was injured during the axillary dissection, resulting in paralysis of the serratus anterior. The serratus anterior is important in rotation of the scapula in raising the arm above the level of the shoulder. Its loss results in protrusion of the inferior angle ("winging" of the scapula), which is more obvious when one pushes against resistance. The long thoracic nerve arises from brachial plexus roots C5, C6, and C7. The upper trunk (C5,C6) supplies rotator and abductor muscles of the shoulder and elbow flexors. The posterior division of the middle trunk contains C7 fibers for distribution to extensor muscles; likewise, the posterior cord supplies extensors of the arm, forearm, and hand. The lateral cord (C5, C6, and C7) gives origin to the lateral pectoral nerve, the musculocutaneous nerve, and the lateral root of the median nerve. There is no sensory loss in the limb in this patient; injury to any of the other nerve elements listed here would be associated with specific dermatome losses.
|
Anatomy
|
Upper Extremity
| 139 |
{
"Correct Answer": "Roots of the brachial plexus",
"Correct Option": "C",
"Options": {
"A": "The upper trunk of her brachial plexus",
"B": "The posterior division of the middle trunk",
"C": "Roots of the brachial plexus",
"D": "The posterior cord of the brachial plexus"
},
"Question": "Several weeks after surgical dissection of her left axilla for the removal of lymph nodes for staging and treatment of her breast cancer, a 32-year-old woman was told by her general physician that she had \"winging\" of her left scapula when she pushed against resistance during her physical examination. She told the physician that she had also experienced difficulty lately in raising her right arm above her head when she was combing her hair. In a subsequent consult visit with her surgeon, she was told that a nerve was accidentally injured during the diagnostic surgical procedure and that this produced her scapular abnormality and inability to raise her arm normally. What was the origin of this nerve?"
}
|
Several weeks after surgical dissection of her left axilla for the removal of lymph nodes for staging and treatment of her breast cancer, a 32-year-old woman was told by her general physician that she had "winging" of her left scapula when she pushed against resistance during her physical examination. She told the physician that she had also experienced difficulty lately in raising her right arm above her head when she was combing her hair. In a subsequent consult visit with her surgeon, she was told that a nerve was accidentally injured during the diagnostic surgical procedure and that this produced her scapular abnormality and inability to raise her arm normally.
|
What was the origin of this nerve?
|
{
"A": "The upper trunk of her brachial plexus",
"B": "The posterior division of the middle trunk",
"C": "Roots of the brachial plexus",
"D": "The posterior cord of the brachial plexus"
}
|
C. Roots of the brachial plexus
|
f0db5ac0-ee6e-413f-82ab-0ccbff11eab1
|
A 19-year-old man is brought to the emergency department with a stab wound at the base of the neck (zone I) (Figure below). The most important concern for patients with such injuries is which of the following?For the purpose of evaluating penetrating injuries, the neck is divided into three zones. Zone I is below the clavicles and is also known and the thoracic outlet. Zone II is located between the clavicles and hyoid bone, and Zone III is above the hyoid.
|
Upper extremity ischemia
|
Cerebral infarction
|
Exsanguinating hemorrhage
|
Mediastinitis
| 2c
|
multi
|
Exsanguinating hemorrhage is the predominant risk, because bleeding may not be easily recognized, given that bleeding into the pleural cavity and mediastinum can occur. The abundant collateral blood supply generally protects against upper extremities or cerebrovascular compromise.
|
Surgery
|
Trauma
| 104 |
{
"Correct Answer": "Exsanguinating hemorrhage",
"Correct Option": "C",
"Options": {
"A": "Upper extremity ischemia",
"B": "Cerebral infarction",
"C": "Exsanguinating hemorrhage",
"D": "Mediastinitis"
},
"Question": "A 19-year-old man is brought to the emergency department with a stab wound at the base of the neck (zone I) (Figure below). The most important concern for patients with such injuries is which of the following?For the purpose of evaluating penetrating injuries, the neck is divided into three zones. Zone I is below the clavicles and is also known and the thoracic outlet. Zone II is located between the clavicles and hyoid bone, and Zone III is above the hyoid."
}
|
A 19-year-old man is brought to the emergency department with a stab wound at the base of the neck (zone I) (Figure below). The most important concern for patients with such injuries is which of the following?For the purpose of evaluating penetrating injuries, the neck is divided into three zones. Zone I is below the clavicles and is also known and the thoracic outlet.
|
Zone II is located between the clavicles and hyoid bone, and Zone III is above the hyoid.
|
{
"A": "Upper extremity ischemia",
"B": "Cerebral infarction",
"C": "Exsanguinating hemorrhage",
"D": "Mediastinitis"
}
|
C. Exsanguinating hemorrhage
|
11fa2143-7c6e-4564-921b-e42ce2eba143
|
A 40-year-old male patient presented to the dermatology OPD with complaints of a characteristic rash over the face along with fever, ahralgia and moderate chest pain. Patient gave history of using some drug for 3 months. On examination, there was no CNS involvement. Lab findings revealed normal urine r/m studies and normal RFTs. ANA and anti-histone antibody titres were found to be raised. Which of the following mechanisms is most likely implicated in the above disease: -
|
<img style="max-width: 100%" src=" />
|
<img style="max-width: 100%" src=" />
|
<img style="max-width: 100%" src=" />
|
<img style="max-width: 100%" src=" />
| 3d
|
multi
|
This is a case of Drug induced Lupus. More common in females. Presents with the characteristic malar skin rash. Along with serositis, most commonly pleuritis. Kidney and CNS are rarely involved. Titres of anti-histone Abs are increased. It is a type 3 hypersensitivity reaction. It is associated with HLA-DR2 Image A shows Type 1 hypersensitivity reaction Image B shows Type 2 hypersensitivity reaction Image C shows Type 4 hypersensitivity reaction
|
Unknown
|
Integrated QBank
| 103 |
{
"Correct Answer": "<img style=\"max-width: 100%\" src=\" />",
"Correct Option": "D",
"Options": {
"A": "<img style=\"max-width: 100%\" src=\" />",
"B": "<img style=\"max-width: 100%\" src=\" />",
"C": "<img style=\"max-width: 100%\" src=\" />",
"D": "<img style=\"max-width: 100%\" src=\" />"
},
"Question": "A 40-year-old male patient presented to the dermatology OPD with complaints of a characteristic rash over the face along with fever, ahralgia and moderate chest pain. Patient gave history of using some drug for 3 months. On examination, there was no CNS involvement. Lab findings revealed normal urine r/m studies and normal RFTs. ANA and anti-histone antibody titres were found to be raised. Which of the following mechanisms is most likely implicated in the above disease: -"
}
|
A 40-year-old male patient presented to the dermatology OPD with complaints of a characteristic rash over the face along with fever, ahralgia and moderate chest pain. Patient gave history of using some drug for 3 months. On examination, there was no CNS involvement. Lab findings revealed normal urine r/m studies and normal RFTs. ANA and anti-histone antibody titres were found to be raised.
|
Which of the following mechanisms is most likely implicated in the above disease: -
|
{
"A": "<img style=\"max-width: 100%\" src=\" />",
"B": "<img style=\"max-width: 100%\" src=\" />",
"C": "<img style=\"max-width: 100%\" src=\" />",
"D": "<img style=\"max-width: 100%\" src=\" />"
}
|
D. <img style="max-width: 100%" src=" />
|
874e45c8-1b40-41c2-9fe5-3e9329a84653
|
Many rashes and skin lesions can be found first in the newborn period. For each of the descriptions listed below, select the most likely diagnosis. Each lettered option may be used once, more than once, or not at all. An adolescent boy complains of a splotchy red rash on the nape of his neck, discovered when he had his head shaved for football season.The rash seems to become more prominent with exercise or emotion. His mother notes that he has had the rash since infancy, but that it became invisible as hair grew. He had a similar rash on his eyelids that resolved in the newborn period.
|
Sebaceous nevus
|
Salmon patch
|
Neonatal acne
|
Pustular melanosis
| 1b
|
multi
|
Salmon patches (aka nevus simplex or nevus flammeus) are flat vascular lesions that occur in the listed regions and appear more prominent during crying. The lesions on the face fade over the first few years of life. Lesions found over the nuchal and occipital areas often persist. No therapy is indicated.
|
Pediatrics
|
Growth, Development, and Behavior
| 126 |
{
"Correct Answer": "Salmon patch",
"Correct Option": "B",
"Options": {
"A": "Sebaceous nevus",
"B": "Salmon patch",
"C": "Neonatal acne",
"D": "Pustular melanosis"
},
"Question": "Many rashes and skin lesions can be found first in the newborn period. For each of the descriptions listed below, select the most likely diagnosis. Each lettered option may be used once, more than once, or not at all. An adolescent boy complains of a splotchy red rash on the nape of his neck, discovered when he had his head shaved for football season.The rash seems to become more prominent with exercise or emotion. His mother notes that he has had the rash since infancy, but that it became invisible as hair grew. He had a similar rash on his eyelids that resolved in the newborn period."
}
|
Many rashes and skin lesions can be found first in the newborn period. For each of the descriptions listed below, select the most likely diagnosis. Each lettered option may be used once, more than once, or not at all. An adolescent boy complains of a splotchy red rash on the nape of his neck, discovered when he had his head shaved for football season.The rash seems to become more prominent with exercise or emotion. His mother notes that he has had the rash since infancy, but that it became invisible as hair grew.
|
He had a similar rash on his eyelids that resolved in the newborn period.
|
{
"A": "Sebaceous nevus",
"B": "Salmon patch",
"C": "Neonatal acne",
"D": "Pustular melanosis"
}
|
B. Salmon patch
|
d12e78d3-6249-49de-8d70-680af7a2e738
|
A 42-year old female presents with the complaint of bleeding gums for the past 20 days. Intra-oral examination shows thickened and friable gums. Also, she has hepatosplenomegaly with generalized non tender lymphadenopathy. The blood count reveals: Hemoglobin 11.4 g/dl, Platelet count 90,000/mm3, WBC count 4600/mm3. The bone marrow biopsy shows 100% cellularity, with many large blasts that are peroxidase negative and nonspecific esterase positive. Which of the following is the most likely diagnosis for this patient?
|
Acute lymphoblastic leukemia
|
Acute megakaryocytic leukemia
|
Acute promyelocytic leukemia
|
Acute monocytic leukemia
| 3d
|
single
|
Patient has an “aleukemic” leukemia in which leukemic blasts fill the marrow, but the peripheral blood count of leukocytes is not high. The staining of the blasts suggests the presence of monoblasts (peroxidase negative and nonspecific esterase positive). So, the likely diagnosis for her is M5 leukemia, which is characterized by increased chances of tissue infiltration and organomegaly.
Other options:
Acute lymphoblastic leukemia is typically seen in children and young adults.
Acute megakaryocytic leukemia is typically accompanied by myelofibrosis and is rare. The blasts react with platelet-specific antibodies.
Acute promyelocytic leukemia (M3-AML) has many promyelocytes filled with azurophilic granules, making them strongly peroxidase positive.
|
Pathology
| null | 146 |
{
"Correct Answer": "Acute monocytic leukemia",
"Correct Option": "D",
"Options": {
"A": "Acute lymphoblastic leukemia",
"B": "Acute megakaryocytic leukemia",
"C": "Acute promyelocytic leukemia",
"D": "Acute monocytic leukemia"
},
"Question": "A 42-year old female presents with the complaint of bleeding gums for the past 20 days. Intra-oral examination shows thickened and friable gums. Also, she has hepatosplenomegaly with generalized non tender lymphadenopathy. The blood count reveals: Hemoglobin 11.4 g/dl, Platelet count 90,000/mm3, WBC count 4600/mm3. The bone marrow biopsy shows 100% cellularity, with many large blasts that are peroxidase negative and nonspecific esterase positive. Which of the following is the most likely diagnosis for this patient?"
}
|
A 42-year old female presents with the complaint of bleeding gums for the past 20 days. Intra-oral examination shows thickened and friable gums. Also, she has hepatosplenomegaly with generalized non tender lymphadenopathy. The blood count reveals: Hemoglobin 11.4 g/dl, Platelet count 90,000/mm3, WBC count 4600/mm3. The bone marrow biopsy shows 100% cellularity, with many large blasts that are peroxidase negative and nonspecific esterase positive.
|
Which of the following is the most likely diagnosis for this patient?
|
{
"A": "Acute lymphoblastic leukemia",
"B": "Acute megakaryocytic leukemia",
"C": "Acute promyelocytic leukemia",
"D": "Acute monocytic leukemia"
}
|
D. Acute monocytic leukemia
|
c43f4178-abb7-40c6-a1ab-dbb3cc44dd94
|
An 18 years old male reported with chief complaint of sensitivity and deep, dull, radiating pain during chewing. Intra-oral examination showed sparase plague and dental calculus deposits, distolabial migration of the maxillary incisors with diastema formation, mobility of maxillary and mandibular incisors and first molars. Prescribed radiographs showed an arch shaped loss of alveolar bone extending from the distal surface of the mandibular second premolar to the mesial surface of the second molar. There was vertical bone loss in the maxillary incisor region.
The host modulation therapy that may be used as adjunctive therapy for this disease is
|
Subantimicrobial-dose clindamycin
|
Subantimicrobial-dose metronidazole
|
Subantimicrobial-dose doxycycline
|
Subantimicrobial-dose ciproftoxacin
| 2c
|
single
| null |
Dental
| null | 139 |
{
"Correct Answer": "Subantimicrobial-dose doxycycline",
"Correct Option": "C",
"Options": {
"A": "Subantimicrobial-dose clindamycin",
"B": "Subantimicrobial-dose metronidazole",
"C": "Subantimicrobial-dose doxycycline",
"D": "Subantimicrobial-dose ciproftoxacin"
},
"Question": "An 18 years old male reported with chief complaint of sensitivity and deep, dull, radiating pain during chewing. Intra-oral examination showed sparase plague and dental calculus deposits, distolabial migration of the maxillary incisors with diastema formation, mobility of maxillary and mandibular incisors and first molars. Prescribed radiographs showed an arch shaped loss of alveolar bone extending from the distal surface of the mandibular second premolar to the mesial surface of the second molar. There was vertical bone loss in the maxillary incisor region.\n\nThe host modulation therapy that may be used as adjunctive therapy for this disease is"
}
|
An 18 years old male reported with chief complaint of sensitivity and deep, dull, radiating pain during chewing. Intra-oral examination showed sparase plague and dental calculus deposits, distolabial migration of the maxillary incisors with diastema formation, mobility of maxillary and mandibular incisors and first molars. Prescribed radiographs showed an arch shaped loss of alveolar bone extending from the distal surface of the mandibular second premolar to the mesial surface of the second molar.
|
There was vertical bone loss in the maxillary incisor region.
The host modulation therapy that may be used as adjunctive therapy for this disease is
|
{
"A": "Subantimicrobial-dose clindamycin",
"B": "Subantimicrobial-dose metronidazole",
"C": "Subantimicrobial-dose doxycycline",
"D": "Subantimicrobial-dose ciproftoxacin"
}
|
C. Subantimicrobial-dose doxycycline
|
680bd402-d4fb-4398-997b-34f8248a73e3
|
A 56-year-old woman with diabetes, hypertension, and hyperlipidemia is found to have an A1C of 11 despite her best attempts at diet and faithfully taking her metformin and glyburide. The patient mentions that she has been unable to exercise much, partially due to severe fatigue and sleepiness in the daytime. On examination she is obese, has a full appearing posterior pharynx, clear lungs, a normal heart examination, and trace bilateral edema. Reflexes and skin are normal. Her TSH is 2.0 m/L (normal). The patient asks if there is anything else that can be done before adding another oral agent or switching to insulin. What is the best next step?
|
Educate the patient on sleep hygiene to ensure better rest and more energy.
|
Prescribe zolpidem as a sleep aid to help her sleep and increase her energy to exercise during the day.
|
Explore for possible depression as a contributor to the fatigue which is keeping her from exercising.
|
Arrange for a sleep study to check the patient for obstructive sleep apnea.
| 3d
|
multi
|
Obstructive sleep apnea (OSA) that has gone untreated contributes to increased insulin resistance. This appears to have an additional effect even beyond the common cooccurrence of obesity as in this patient. Treatment of OSA can lead to improvement in glucose control. This patient is obese, has a crowded oropharynx on examination, and has daytime somnolence. Although overnight oxygen saturation monitor may be performed at home as screening, this patient is at high risk of complications of OSA should proceed directly to formal overnight polysomnography. Sleep hygiene is important for patients with sleep disturbance but is not likely to help in this patient with probable severe OSA. Similarly, sedative hypnotic agents such as zolpidem are widely prescribed for sleep but could exacerbate the OSA. Depression should always be explored but there are no clues beyond fatigue to suggest this diagnosis. Low vitamin D levels are generally asymptomatic unless the condition is severe and prolonged and would not affect sleep apnea or glucose control specifically.
|
Medicine
|
Endocrinology
| 150 |
{
"Correct Answer": "Arrange for a sleep study to check the patient for obstructive sleep apnea.",
"Correct Option": "D",
"Options": {
"A": "Educate the patient on sleep hygiene to ensure better rest and more energy.",
"B": "Prescribe zolpidem as a sleep aid to help her sleep and increase her energy to exercise during the day.",
"C": "Explore for possible depression as a contributor to the fatigue which is keeping her from exercising.",
"D": "Arrange for a sleep study to check the patient for obstructive sleep apnea."
},
"Question": "A 56-year-old woman with diabetes, hypertension, and hyperlipidemia is found to have an A1C of 11 despite her best attempts at diet and faithfully taking her metformin and glyburide. The patient mentions that she has been unable to exercise much, partially due to severe fatigue and sleepiness in the daytime. On examination she is obese, has a full appearing posterior pharynx, clear lungs, a normal heart examination, and trace bilateral edema. Reflexes and skin are normal. Her TSH is 2.0 m/L (normal). The patient asks if there is anything else that can be done before adding another oral agent or switching to insulin. What is the best next step?"
}
|
A 56-year-old woman with diabetes, hypertension, and hyperlipidemia is found to have an A1C of 11 despite her best attempts at diet and faithfully taking her metformin and glyburide. The patient mentions that she has been unable to exercise much, partially due to severe fatigue and sleepiness in the daytime. On examination she is obese, has a full appearing posterior pharynx, clear lungs, a normal heart examination, and trace bilateral edema. Reflexes and skin are normal. Her TSH is 2.0 m/L (normal). The patient asks if there is anything else that can be done before adding another oral agent or switching to insulin.
|
What is the best next step?
|
{
"A": "Educate the patient on sleep hygiene to ensure better rest and more energy.",
"B": "Prescribe zolpidem as a sleep aid to help her sleep and increase her energy to exercise during the day.",
"C": "Explore for possible depression as a contributor to the fatigue which is keeping her from exercising.",
"D": "Arrange for a sleep study to check the patient for obstructive sleep apnea."
}
|
D. Arrange for a sleep study to check the patient for obstructive sleep apnea.
|
ccb2241d-793e-402b-a02b-163370198d06
|
A patient with long standing constipation enters a clinical research study. After a complete physical examination,a small intraluminal balloon is inseed through the anus to the rectum. Transducers are also inseed to measure internal and external anal sphincter pressures. Inflation of the rectal balloon causes the external anal sphincter to contract, but the internal anal sphincter, which exhibits normal tone, fails to relax and the urge to defecate is not sensed. Which of the following structures is most likely damaged?
|
Internal anal sphincter
|
External anal sphincter
|
Pelvic nerve
|
Pudendal nerve
| 2c
|
multi
|
The defecation reflex that is evoked when the rectum is distended involves three responses: 1) the internal anal sphincter relaxes, 2) the external anal sphincter contracts, and 3) a conscious urge to defecate is perceived. This neural reflex involves the pelvic nerve, which provides the parasympathetic preganglionic innervation to the internal anal sphincter (composed of smooth muscle) and also carries the sensory afferent information from the rectum to the spinal cord, and the pudendal nerve, which carries the somatic efferent inputs to the external anal sphincter (composed of skeletal muscle). In the patient described above, the pelvic nerve is most likely damaged since neither the reflex relaxation of the internal anal sphincter nor the urge to defecate is evoked by rectal distention. Damage to the internal anal sphincter would most likely cause resting tone to be low and, if anything, lead to fecal incontinence rather than constipation. Fuhermore, damage to the internal anal sphincter could not explain the failure of the appearance of the urge to defecate. The external anal sphincter appears to function normally since distention of the rectum evokes the expected contraction. The normal contraction of the external anal sphincter also suggests that the pudendal nerve is intact. Ref: Moon D.A., Foreman K.B., Albeine K.H. (2011). Chapter 12. Pelvis and Perineum. In D.A. Moon, K.B. Foreman, K.H. Albeine (Eds), The Big Picture: Gross Anatomy.
|
Anatomy
| null | 108 |
{
"Correct Answer": "Pelvic nerve",
"Correct Option": "C",
"Options": {
"A": "Internal anal sphincter",
"B": "External anal sphincter",
"C": "Pelvic nerve",
"D": "Pudendal nerve"
},
"Question": "A patient with long standing constipation enters a clinical research study. After a complete physical examination,a small intraluminal balloon is inseed through the anus to the rectum. Transducers are also inseed to measure internal and external anal sphincter pressures. Inflation of the rectal balloon causes the external anal sphincter to contract, but the internal anal sphincter, which exhibits normal tone, fails to relax and the urge to defecate is not sensed. Which of the following structures is most likely damaged?"
}
|
A patient with long standing constipation enters a clinical research study. After a complete physical examination,a small intraluminal balloon is inseed through the anus to the rectum. Transducers are also inseed to measure internal and external anal sphincter pressures. Inflation of the rectal balloon causes the external anal sphincter to contract, but the internal anal sphincter, which exhibits normal tone, fails to relax and the urge to defecate is not sensed.
|
Which of the following structures is most likely damaged?
|
{
"A": "Internal anal sphincter",
"B": "External anal sphincter",
"C": "Pelvic nerve",
"D": "Pudendal nerve"
}
|
C. Pelvic nerve
|
18269b74-4837-43b7-96ed-d191f63e35d2
|
A 30-year-old male, Rajinder presents to your office with fatigue, muscle weakness and headache. His blood pressure is 170/120 mm Hg and his hea rate is 100/min. Laboratory evaluation reveals hypokalemia, metabolic alkalosis and decreased plasma renin activity. On CT scan, a mass was noted on left suprarenal gland. Patient was prescribed a drug for few weeks and the symptoms subsided. Laboratory values and blood pressure returned to normal values. The likely drug given to this patient is?
|
Clonidine
|
Propanolol
|
Hydrochlorothiazide
|
Spironolactone
| 3d
|
single
|
Mosty likely diagnosis in this patient is aldosterone secreting tumor (adenoma) leading to primary hyperaldosteronism (Conn's Syndrome). Aldosterone excess will cause hypeension, hypokalemia, metabolic alkalosis and depressed renin. Aldosterone antagonists such as spironolactone or eplerenone can be used as medical therapy for Conn's syndrome.
|
Pharmacology
|
Kidney
| 117 |
{
"Correct Answer": "Spironolactone",
"Correct Option": "D",
"Options": {
"A": "Clonidine",
"B": "Propanolol",
"C": "Hydrochlorothiazide",
"D": "Spironolactone"
},
"Question": "A 30-year-old male, Rajinder presents to your office with fatigue, muscle weakness and headache. His blood pressure is 170/120 mm Hg and his hea rate is 100/min. Laboratory evaluation reveals hypokalemia, metabolic alkalosis and decreased plasma renin activity. On CT scan, a mass was noted on left suprarenal gland. Patient was prescribed a drug for few weeks and the symptoms subsided. Laboratory values and blood pressure returned to normal values. The likely drug given to this patient is?"
}
|
A 30-year-old male, Rajinder presents to your office with fatigue, muscle weakness and headache. His blood pressure is 170/120 mm Hg and his hea rate is 100/min. Laboratory evaluation reveals hypokalemia, metabolic alkalosis and decreased plasma renin activity. On CT scan, a mass was noted on left suprarenal gland. Patient was prescribed a drug for few weeks and the symptoms subsided. Laboratory values and blood pressure returned to normal values.
|
The likely drug given to this patient is?
|
{
"A": "Clonidine",
"B": "Propanolol",
"C": "Hydrochlorothiazide",
"D": "Spironolactone"
}
|
D. Spironolactone
|
59c99be2-a96b-4c90-9df1-da874789d53a
|
Following several days of 12-hour daily rehearsals of the symphony orchestra for a performance of a Wagnerian opera, the 52-year-old male conductor experienced such excruciating pain in the posterior aspect of his right forearm that he could no longer direct the musicians. When the maestro's forearm was palpated 2 cm distal to, and posteromedial to, the lateral epicondyle, the resulting excruciating pain caused the conductor to weep. Injections of steroids and rest were recommended to ease the pain. Which of the following injuries is most likely?
|
Compression of the median nerve by the pronator teres
|
Compression of the median nerve by the flexor digitorum superficialis
|
Compression of the superficial radial nerve by the brachioradialis
|
Compression of the deep radial nerve by the supinator
| 3d
|
single
|
The Deep radial nerve courses between the two heads of the supinator and is located just medial and distal to the lateral epicondyle. It can be compressed by hyperophy of the supinator causing pain and weakness. The Median nerve passes into the forearm flexor compament. Superficial radial nerve courses down the lateral aspect of the posterior forearm and would not cause pain due to pressure applied to the posterior forearm.
|
Anatomy
|
Nerve Lesions
| 121 |
{
"Correct Answer": "Compression of the deep radial nerve by the supinator",
"Correct Option": "D",
"Options": {
"A": "Compression of the median nerve by the pronator teres",
"B": "Compression of the median nerve by the flexor digitorum superficialis",
"C": "Compression of the superficial radial nerve by the brachioradialis",
"D": "Compression of the deep radial nerve by the supinator"
},
"Question": "Following several days of 12-hour daily rehearsals of the symphony orchestra for a performance of a Wagnerian opera, the 52-year-old male conductor experienced such excruciating pain in the posterior aspect of his right forearm that he could no longer direct the musicians. When the maestro's forearm was palpated 2 cm distal to, and posteromedial to, the lateral epicondyle, the resulting excruciating pain caused the conductor to weep. Injections of steroids and rest were recommended to ease the pain. Which of the following injuries is most likely?"
}
|
Following several days of 12-hour daily rehearsals of the symphony orchestra for a performance of a Wagnerian opera, the 52-year-old male conductor experienced such excruciating pain in the posterior aspect of his right forearm that he could no longer direct the musicians. When the maestro's forearm was palpated 2 cm distal to, and posteromedial to, the lateral epicondyle, the resulting excruciating pain caused the conductor to weep. Injections of steroids and rest were recommended to ease the pain.
|
Which of the following injuries is most likely?
|
{
"A": "Compression of the median nerve by the pronator teres",
"B": "Compression of the median nerve by the flexor digitorum superficialis",
"C": "Compression of the superficial radial nerve by the brachioradialis",
"D": "Compression of the deep radial nerve by the supinator"
}
|
D. Compression of the deep radial nerve by the supinator
|
44341437-ae7e-4870-abcb-f00512b464b8
|
A young woman is evaluated by a neurosurgeon because of injuries she received in an explosion. She has numerous lacerations of the front and back torso and bruising of the craniofacial region. Neurological examination shows lack of movement in her right lower extremity with hyperreflexia, and loss of proprioception and fine touch in this extremity, but pain and temperature sensation are intact. Pain and temperature sensation are absent in the left lower limb. Movement and reflexes are normal in the left lower extremity and upper extremities.
A lesion in which of the following locations can explain her neurological examination?
|
Hemisection of the left side of the spinal cord at the level of the first lumbar segment of the cord
|
Hemisection of the left side of the spinal cord at the level of the fourth sacral segment of the cord
|
Hemisection of the right side of the spinal cord at the level of the first lumbar segment of the cord
|
Hemisection of the right side of the spinal cord at the level of the fourth sacral segment of the cord
| 2c
|
single
| null |
Medicine
| null | 128 |
{
"Correct Answer": "Hemisection of the right side of the spinal cord at the level of the first lumbar segment of the cord",
"Correct Option": "C",
"Options": {
"A": "Hemisection of the left side of the spinal cord at the level of the first lumbar segment of the cord",
"B": "Hemisection of the left side of the spinal cord at the level of the fourth sacral segment of the cord",
"C": "Hemisection of the right side of the spinal cord at the level of the first lumbar segment of the cord",
"D": "Hemisection of the right side of the spinal cord at the level of the fourth sacral segment of the cord"
},
"Question": "A young woman is evaluated by a neurosurgeon because of injuries she received in an explosion. She has numerous lacerations of the front and back torso and bruising of the craniofacial region. Neurological examination shows lack of movement in her right lower extremity with hyperreflexia, and loss of proprioception and fine touch in this extremity, but pain and temperature sensation are intact. Pain and temperature sensation are absent in the left lower limb. Movement and reflexes are normal in the left lower extremity and upper extremities. \nA lesion in which of the following locations can explain her neurological examination?"
}
|
A young woman is evaluated by a neurosurgeon because of injuries she received in an explosion. She has numerous lacerations of the front and back torso and bruising of the craniofacial region. Neurological examination shows lack of movement in her right lower extremity with hyperreflexia, and loss of proprioception and fine touch in this extremity, but pain and temperature sensation are intact. Pain and temperature sensation are absent in the left lower limb. Movement and reflexes are normal in the left lower extremity and upper extremities.
|
A lesion in which of the following locations can explain her neurological examination?
|
{
"A": "Hemisection of the left side of the spinal cord at the level of the first lumbar segment of the cord",
"B": "Hemisection of the left side of the spinal cord at the level of the fourth sacral segment of the cord",
"C": "Hemisection of the right side of the spinal cord at the level of the first lumbar segment of the cord",
"D": "Hemisection of the right side of the spinal cord at the level of the fourth sacral segment of the cord"
}
|
C. Hemisection of the right side of the spinal cord at the level of the first lumbar segment of the cord
|
b8e7a175-ee98-40bd-b8ce-80e5e9b84fc3
|
A 67-year-old, 60-kg homeless man has been in the intensive care unit (ICU) for a week after an emergency laparotomy and sigmoid resection for perforated diverticulitis. His serum albumin is 1.1 g/dL. He was just weaned from mechanical ventilation. His colostomy is not functioning. You start total parenteral nutrition (TPN) to deliver 1800 kcal/24 h. Two days later, the patient is in respiratory distress and requires reintubation and mechanical ventilation. You should check the level of serum
|
Phosphate
|
Magnesium
|
Calcium
|
Selenium
| 0a
|
single
|
Rapid institution of full nutritional support can cause "refeeding syndrome" in malnourished patients. The hall mark of this condition is hypophosphatemia. Phosphate is taken up by phosphate-depleted cells trying to metabolize the nutrition and levels of ATP fall precipitously. This leads to respiratory failure. Refeeding syndrome can be avoided by starting nutritional support at low levels and increasing slowly. The other substances listed are not associated with respiratory failure after starting nutritional support.
|
Surgery
|
Fluid & Electrolyte
| 126 |
{
"Correct Answer": "Phosphate",
"Correct Option": "A",
"Options": {
"A": "Phosphate",
"B": "Magnesium",
"C": "Calcium",
"D": "Selenium"
},
"Question": "A 67-year-old, 60-kg homeless man has been in the intensive care unit (ICU) for a week after an emergency laparotomy and sigmoid resection for perforated diverticulitis. His serum albumin is 1.1 g/dL. He was just weaned from mechanical ventilation. His colostomy is not functioning. You start total parenteral nutrition (TPN) to deliver 1800 kcal/24 h. Two days later, the patient is in respiratory distress and requires reintubation and mechanical ventilation. You should check the level of serum"
}
|
A 67-year-old, 60-kg homeless man has been in the intensive care unit (ICU) for a week after an emergency laparotomy and sigmoid resection for perforated diverticulitis. His serum albumin is 1.1 g/dL. He was just weaned from mechanical ventilation. His colostomy is not functioning. You start total parenteral nutrition (TPN) to deliver 1800 kcal/24 h. Two days later, the patient is in respiratory distress and requires reintubation and mechanical ventilation.
|
You should check the level of serum
|
{
"A": "Phosphate",
"B": "Magnesium",
"C": "Calcium",
"D": "Selenium"
}
|
A. Phosphate
|
dd571745-7c8a-4f30-a25d-dce43aaa56f5
|
A 28-year-old previously healthy woman arrives in the emergency room complaining of 24 h of anorexia and nausea and lower abdominal pain that is more intense in the right lower quadrant than elsewhere. On examination she has peritoneal signs of the right lower quadrant and a rectal temperature of 38.38degC (101.8degF). At exploration through incision of the right lower quadrant, she is found to have a small, contained perforation of a cecal diverticulum. Which of the following statements regarding this situation is true?
|
Cecal diverticula are acquired disorders
|
Cecal diverticula are usually multiple
|
Cecal diverticula are mucosal herniations through the muscularis propria
|
Diverticulectomy, closure of the cecal defect, and appendectomy may be indicated
| 3d
|
multi
|
Cecal diverticula must be differentiated from the more common variety of diverticula that are usually found in the left colon. Cecal diverticula are thought to be a congenital entity. The cecal diverticulum is often solitary and involves all layers of the bowel wall; therefore, cecal diverticula are true diverticula. Diverticula elsewhere in the colon are almost always multiple and are thought to be an acquired disorder. These acquired diverticula are really herniations of mucosa through weakened areas of the muscularis propria of the colon wall. The preoperative diagnosis in the case of cecal diverticulitis is "acute appendicitis" about 80% of the time. If there is extensive inflammation involving much of the cecum, an ileocolectomy is indicated. If the inflammation is well localized to the area of the diverticulum, a simple diverticulectomy with closure of the defect is the procedure of choice. To avoid diagnostic confusion in the future, the appendix should be removed whenever an incision is made in the right lower quadrant, unless operatively contraindicated.
|
Surgery
|
Liver
| 120 |
{
"Correct Answer": "Diverticulectomy, closure of the cecal defect, and appendectomy may be indicated",
"Correct Option": "D",
"Options": {
"A": "Cecal diverticula are acquired disorders",
"B": "Cecal diverticula are usually multiple",
"C": "Cecal diverticula are mucosal herniations through the muscularis propria",
"D": "Diverticulectomy, closure of the cecal defect, and appendectomy may be indicated"
},
"Question": "A 28-year-old previously healthy woman arrives in the emergency room complaining of 24 h of anorexia and nausea and lower abdominal pain that is more intense in the right lower quadrant than elsewhere. On examination she has peritoneal signs of the right lower quadrant and a rectal temperature of 38.38degC (101.8degF). At exploration through incision of the right lower quadrant, she is found to have a small, contained perforation of a cecal diverticulum. Which of the following statements regarding this situation is true?"
}
|
A 28-year-old previously healthy woman arrives in the emergency room complaining of 24 h of anorexia and nausea and lower abdominal pain that is more intense in the right lower quadrant than elsewhere. On examination she has peritoneal signs of the right lower quadrant and a rectal temperature of 38.38degC (101.8degF). At exploration through incision of the right lower quadrant, she is found to have a small, contained perforation of a cecal diverticulum.
|
Which of the following statements regarding this situation is true?
|
{
"A": "Cecal diverticula are acquired disorders",
"B": "Cecal diverticula are usually multiple",
"C": "Cecal diverticula are mucosal herniations through the muscularis propria",
"D": "Diverticulectomy, closure of the cecal defect, and appendectomy may be indicated"
}
|
D. Diverticulectomy, closure of the cecal defect, and appendectomy may be indicated
|
a523a8a3-e953-4451-bf4b-1446d5ecb310
|
Arrange the following statements in order: Regarding slit skin smear steps: 1. Clean the site with methyl alcohol and pinch the skin tightly using thumb and index finger. 2. Fix the smear by moving the slide briefly over flame. 3. Make a cut on the skin fold using a scalpel and scrape out the fragments of tissue and fluid. 4. Spread the material obtained on a clean slide to make a smear of 8-10mm diameter. 5. Mark the slide with patient's identification number.
|
5-1-3-4-2
|
2-4-3-5-1
|
5-1-3-2-4
|
4-3-5-2-1
| 0a
|
multi
|
Steps of slit skin smear: 1. Mark the slide with patient's identification number. 2. Clean the site with methyl alcohol and pinch the skin tightly using thumb and index finger. 3. Make a cut on the skin fold using a scalpel and scrape out the fragments of tissue and fluid. 4. Spread the material obtained on a clean slide to make a smear of 8-10mm diameter. 5. Fix the smear by moving the slide briefly over flame.
|
Dental
|
Mycobacterial Infections
| 108 |
{
"Correct Answer": "5-1-3-4-2",
"Correct Option": "A",
"Options": {
"A": "5-1-3-4-2",
"B": "2-4-3-5-1",
"C": "5-1-3-2-4",
"D": "4-3-5-2-1"
},
"Question": "Arrange the following statements in order: Regarding slit skin smear steps: 1. Clean the site with methyl alcohol and pinch the skin tightly using thumb and index finger. 2. Fix the smear by moving the slide briefly over flame. 3. Make a cut on the skin fold using a scalpel and scrape out the fragments of tissue and fluid. 4. Spread the material obtained on a clean slide to make a smear of 8-10mm diameter. 5. Mark the slide with patient's identification number."
}
|
Arrange the following statements in order: Regarding slit skin smear steps: 1. Clean the site with methyl alcohol and pinch the skin tightly using thumb and index finger. 2. Fix the smear by moving the slide briefly over flame. 3. Make a cut on the skin fold using a scalpel and scrape out the fragments of tissue and fluid. 4. Spread the material obtained on a clean slide to make a smear of 8-10mm diameter. 5.
|
Mark the slide with patient's identification number.
|
{
"A": "5-1-3-4-2",
"B": "2-4-3-5-1",
"C": "5-1-3-2-4",
"D": "4-3-5-2-1"
}
|
A. 5-1-3-4-2
|
3b1b7c05-cf02-4660-b171-b0a5bd9989d2
|
A 1.5 year-old girl is admitted to Pediatric ward with cough, fever, and mild hypoxia. At the time of her admission, on CXR left upper lobe consolidation is seen. Staphylococcus aureus is seen on blood culture within 24 hours. Suddenly the child's condition acutely worsened over the past few minutes, with markedly increased work of breathing, increasing oxygen requirement, and hypotension. On examination there was decreased air entry in left hemithorax and hea sounds were more audible on the right side of chest as compared to left. What could be the possible reason?
|
Empyema
|
Tension pneumothorax
|
ARDS
|
Pleural effusion
| 1b
|
single
|
Above clinical scenario suggestive of the diagnosis of Tension Pneumothorax In Tension pneumothorax, continuing leak causes increasing positive pressure in the pleural space, leading to compression of the lung, shift of mediastinal structures toward the contralateral side like kinking of Superior vena cava which cause decreases in venous return and cardiac output leading to hemodynamic instability like Hypotension. Staph is responsible for causing pneumatocele; so rupture ;ends to pneumothorax Treatment:- Immediate decompression + wide bore needle into 5th ICS - mid axillary line
|
Pediatrics
|
Neonatal Resuscitation
| 130 |
{
"Correct Answer": "Tension pneumothorax",
"Correct Option": "B",
"Options": {
"A": "Empyema",
"B": "Tension pneumothorax",
"C": "ARDS",
"D": "Pleural effusion"
},
"Question": "A 1.5 year-old girl is admitted to Pediatric ward with cough, fever, and mild hypoxia. At the time of her admission, on CXR left upper lobe consolidation is seen. Staphylococcus aureus is seen on blood culture within 24 hours. Suddenly the child's condition acutely worsened over the past few minutes, with markedly increased work of breathing, increasing oxygen requirement, and hypotension. On examination there was decreased air entry in left hemithorax and hea sounds were more audible on the right side of chest as compared to left. What could be the possible reason?"
}
|
A 1.5 year-old girl is admitted to Pediatric ward with cough, fever, and mild hypoxia. At the time of her admission, on CXR left upper lobe consolidation is seen. Staphylococcus aureus is seen on blood culture within 24 hours. Suddenly the child's condition acutely worsened over the past few minutes, with markedly increased work of breathing, increasing oxygen requirement, and hypotension. On examination there was decreased air entry in left hemithorax and hea sounds were more audible on the right side of chest as compared to left.
|
What could be the possible reason?
|
{
"A": "Empyema",
"B": "Tension pneumothorax",
"C": "ARDS",
"D": "Pleural effusion"
}
|
B. Tension pneumothorax
|
3dcc2d48-f678-4bcf-adbf-102ccb0e4514
|
A 70-year-old man is evaluated in emergency department for symptoms of dyspnea, orthopnea, and paroxysmal nocturnal dyspnea. His past medical history is significant for hypertension, type 2 diabetes, chronic kidney disease, and hypothyroidism. Medications are furosemide, enalapril, atorvastatin, metformin, and insulin.On physical examination he has generalized cardiomegaly and pulmonary and systemic venous hypertension. The ECG is shown in Figure below. What is the cardiac rhythm seen on the ECG?
|
ectopic atrial tachycardia
|
atrial flutter with 2 :1 AV conduction
|
sinus tachycardia
|
supraventricular tachycardia
| 1b
|
single
|
The cardiac rhythm is atrial flutter with 2:1 AV conduction. QRS complexes occur with perfect regularity at a rate of about 150/min. Their normal contour and duration indicate that ventricular activation occurs normally via the AV junction-His-Purkinje system. Flutter waves, regular ventricular rate at 150/min make the diagnosis of atrial flutter, rather than atrial fibrillation, sinus tachycardia, or ectopic atrial tachycardia.
|
Medicine
|
C.V.S.
| 122 |
{
"Correct Answer": "atrial flutter with 2 :1 AV conduction",
"Correct Option": "B",
"Options": {
"A": "ectopic atrial tachycardia",
"B": "atrial flutter with 2 :1 AV conduction",
"C": "sinus tachycardia",
"D": "supraventricular tachycardia"
},
"Question": "A 70-year-old man is evaluated in emergency department for symptoms of dyspnea, orthopnea, and paroxysmal nocturnal dyspnea. His past medical history is significant for hypertension, type 2 diabetes, chronic kidney disease, and hypothyroidism. Medications are furosemide, enalapril, atorvastatin, metformin, and insulin.On physical examination he has generalized cardiomegaly and pulmonary and systemic venous hypertension. The ECG is shown in Figure below. What is the cardiac rhythm seen on the ECG?"
}
|
A 70-year-old man is evaluated in emergency department for symptoms of dyspnea, orthopnea, and paroxysmal nocturnal dyspnea. His past medical history is significant for hypertension, type 2 diabetes, chronic kidney disease, and hypothyroidism. Medications are furosemide, enalapril, atorvastatin, metformin, and insulin.On physical examination he has generalized cardiomegaly and pulmonary and systemic venous hypertension. The ECG is shown in Figure below.
|
What is the cardiac rhythm seen on the ECG?
|
{
"A": "ectopic atrial tachycardia",
"B": "atrial flutter with 2 :1 AV conduction",
"C": "sinus tachycardia",
"D": "supraventricular tachycardia"
}
|
B. atrial flutter with 2 :1 AV conduction
|
6da06b47-d357-4214-9bbe-d3639538e09f
|
A 45-year-old woman with Crohn disease and a small intestinal fistula develops tetany during the second week of parenteral nutrition. The laboratory findings include Na: 135 mEq/L K: 3.2 mEq/L Cl: 103 mEq/L HCO3 : 25 mEq/L Ca: 8.2 mEq/L Mg: 1.2 mEq/L PO4 : 2.4 mEq/L Albumin: 2.4 An aerial blood gas sample reveals a pH of 7.42, PCO2 of 38 mm Hg, and PO2 of 84 mm Hg. Which of the following is the most likely cause of the patient's tetany?
|
Hyperventilation
|
Hypocalcemia
|
Hypomagnesemia
|
Essential fatty acid deficiency
| 2c
|
multi
|
Magnesium deficiency is common in malnourished patients and patients with large gastrointestinal fluid losses. The neuromuscular effects resemble those of calcium deficiency--namely, paresthesia, hyperreflexia, muscle spasm, and, ultimately, tetany. The cardiac effects are more like those of hypercalcemia. An electrocardiogram therefore provides a rapid means of differentiating between hypocalcemia (prolonged QT interval, T-wave inversion, hea blocks) and hypomagnesemia (prolonged QT and PR intervals, ST segment depression, flattening or inversion of p waves, torsade de pointes). Hypomagnesemia also causes potassium wasting by the kidney. Many hospital patients with refractory hypocalcemia will be found to be magnesium deficient. Often this deficiency becomes manifest during the response to parenteral nutrition when normal cellular ionic gradients are restored. A normal blood pH and aerial PCO2 rule out hyperventilation. The serum calcium in this patient is normal when adjusted for the low albumin (add 0.8 mg/dL per 1 g/dL decrease in albumin). Hypomagnesemia causes functional hypoparathyroidism, which can lower serum calcium and thus result in a combined defect.
|
Anaesthesia
|
Preoperative assessment and monitoring in anaesthesia
| 159 |
{
"Correct Answer": "Hypomagnesemia",
"Correct Option": "C",
"Options": {
"A": "Hyperventilation",
"B": "Hypocalcemia",
"C": "Hypomagnesemia",
"D": "Essential fatty acid deficiency"
},
"Question": "A 45-year-old woman with Crohn disease and a small intestinal fistula develops tetany during the second week of parenteral nutrition. The laboratory findings include Na: 135 mEq/L K: 3.2 mEq/L Cl: 103 mEq/L HCO3 : 25 mEq/L Ca: 8.2 mEq/L Mg: 1.2 mEq/L PO4 : 2.4 mEq/L Albumin: 2.4 An aerial blood gas sample reveals a pH of 7.42, PCO2 of 38 mm Hg, and PO2 of 84 mm Hg. Which of the following is the most likely cause of the patient's tetany?"
}
|
A 45-year-old woman with Crohn disease and a small intestinal fistula develops tetany during the second week of parenteral nutrition. The laboratory findings include Na: 135 mEq/L K: 3.2 mEq/L Cl: 103 mEq/L HCO3 : 25 mEq/L Ca: 8.2 mEq/L Mg: 1.2 mEq/L PO4 : 2.4 mEq/L Albumin: 2.4 An aerial blood gas sample reveals a pH of 7.42, PCO2 of 38 mm Hg, and PO2 of 84 mm Hg.
|
Which of the following is the most likely cause of the patient's tetany?
|
{
"A": "Hyperventilation",
"B": "Hypocalcemia",
"C": "Hypomagnesemia",
"D": "Essential fatty acid deficiency"
}
|
C. Hypomagnesemia
|
951c6beb-03a6-4058-b00f-fad392c27f9c
|
A 25-year-old man presents 1 week after discovering that his left testicle is twice the normal size. Physical examination reveals a nontender, testicular mass that cannot be transilluminated. Serum levels of alpha-fetoprotein and human chorionic gonadotropin are normal. A hemiorchiectomy is performed, and histologic examination of the surgical specimen shows the cells grow inalveolar or tubular patterns, the neoplastic cells have an epithelial appearance,exhibit hyperchromatic nuclei with prominent nucleoli.. Compared to normal adult somatic cells, this germ cell neoplasm would most likely show high levels of expression of which of the following proteins?
|
Desmin
|
Dystrophin
|
Cytochrome c
|
Telomerase
| 3d
|
single
|
The given histological examination is indicative of embryonal carcinoma. The tumor cells are large and have basophilic cytoplasm, indistinct cell borders, large nuclei, and prominent nucleoli.The neoplastic cells may be arrayed in undifferentiated, solid sheets or may form primitive glandular pattern. Somatic cells do not normally express telomerase,(enzyme that adds repetitive sequences to maintain the length of the telomere) Thus, with each round of somatic cell replication, the telomere shoens. The length of telomeres may act as a "molecular clock" and govern the lifespan of replicating cells. Cancer cells and embryonic cells express high levels of telomerase Embryonal carcinoma with papillary growth -The other choices are not involved in malignant transformation.
|
Pathology
|
General Concepts
| 144 |
{
"Correct Answer": "Telomerase",
"Correct Option": "D",
"Options": {
"A": "Desmin",
"B": "Dystrophin",
"C": "Cytochrome c",
"D": "Telomerase"
},
"Question": "A 25-year-old man presents 1 week after discovering that his left testicle is twice the normal size. Physical examination reveals a nontender, testicular mass that cannot be transilluminated. Serum levels of alpha-fetoprotein and human chorionic gonadotropin are normal. A hemiorchiectomy is performed, and histologic examination of the surgical specimen shows the cells grow inalveolar or tubular patterns, the neoplastic cells have an epithelial appearance,exhibit hyperchromatic nuclei with prominent nucleoli.. Compared to normal adult somatic cells, this germ cell neoplasm would most likely show high levels of expression of which of the following proteins?"
}
|
A 25-year-old man presents 1 week after discovering that his left testicle is twice the normal size. Physical examination reveals a nontender, testicular mass that cannot be transilluminated. Serum levels of alpha-fetoprotein and human chorionic gonadotropin are normal. A hemiorchiectomy is performed, and histologic examination of the surgical specimen shows the cells grow inalveolar or tubular patterns, the neoplastic cells have an epithelial appearance,exhibit hyperchromatic nuclei with prominent nucleoli..
|
Compared to normal adult somatic cells, this germ cell neoplasm would most likely show high levels of expression of which of the following proteins?
|
{
"A": "Desmin",
"B": "Dystrophin",
"C": "Cytochrome c",
"D": "Telomerase"
}
|
D. Telomerase
|
571e5a1f-e1f3-4afa-89a1-351bc6d1f2d2
|
A 48-year-old male complains of abdominal pain that began about 6 months previously which is constant in nature, especially after meals and is located in the upper mid abdomen superior to the umbilicus. He also repos some heaburn that occurred during the previous year. He has been under significant stress and has been self-medicating himself with over-the-counter antacids, with some relief. He states that his stools have changed in colour over the previous 2 months and now are intermittently dark and tarry in consistency. The physician tests the patient's stool and finds following result. What organs are likely to be affected?
|
NONE
|
C
|
A
|
B
| 2c
|
multi
|
A- Stomach B- Gallbladder C- Distal Ileum and caecum This patient has a history typical for peptic ulcer disease, that is, constant mid epigastric pain after meals. The patient also has symptoms consistent with gastro-esophageal reflux disease. The dark and tarry stools reflect blood in the stools; that is, hemoglobin has been conveed to melena. This is suggestive of an upper gastrointestinal bleeding disorder. The next step would be an upper endoscopy to visualize the suspected ulcer. If the stomach is the site, a biopsy is usually performed to assess concurrent malignancy. Treatment includes a histamine-blocking agent, proton pump inhibitor, and antibiotic therapy. The bacterium Helicobacter pylori has been implicated in most cases of peptic ulcer disease. If an ulcer occurs in the duodenum, the posterior wall of the ampulla of the duodenum (duodenal cap) is the usual site. The gastro-duodenal aery lies posterior to the duodenum at this point and is at risk in the event of ulcer perforation.
|
Unknown
|
Integrated QBank
| 130 |
{
"Correct Answer": "A",
"Correct Option": "C",
"Options": {
"A": "NONE",
"B": "C",
"C": "A",
"D": "B"
},
"Question": "A 48-year-old male complains of abdominal pain that began about 6 months previously which is constant in nature, especially after meals and is located in the upper mid abdomen superior to the umbilicus. He also repos some heaburn that occurred during the previous year. He has been under significant stress and has been self-medicating himself with over-the-counter antacids, with some relief. He states that his stools have changed in colour over the previous 2 months and now are intermittently dark and tarry in consistency. The physician tests the patient's stool and finds following result. What organs are likely to be affected?"
}
|
A 48-year-old male complains of abdominal pain that began about 6 months previously which is constant in nature, especially after meals and is located in the upper mid abdomen superior to the umbilicus. He also repos some heaburn that occurred during the previous year. He has been under significant stress and has been self-medicating himself with over-the-counter antacids, with some relief. He states that his stools have changed in colour over the previous 2 months and now are intermittently dark and tarry in consistency. The physician tests the patient's stool and finds following result.
|
What organs are likely to be affected?
|
{
"A": "NONE",
"B": "C",
"C": "A",
"D": "B"
}
|
C. A
|
bf199fef-d8ed-48de-b510-837e5dc8cadf
|
Kamli Rath 75 yrs old woman present with post-myocardial infarction after 6 weeks with mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, EKG shows slow atrial fibrillation. Serum Ca+2 13.0 mg/L and urinary Ca2+ is 300 mg/ 24 hr. On examination, there is small mass in the Para tracheal position behind the right clavicle. Appropriate management at this time is -
|
Repeat neck surgery
|
Treatment with technetium - 99
|
Observation and repeat serum Ca+2 in two months
|
Ultrasound-guided alcohol injection of the mass
| 3d
|
multi
|
This patient operated previously for parathyroid adenoma, is having recurrent hyperparathyroidism.
In the setting of recent myocardial infarction, CHF and atrial fibrillation, any operation carries a high risk. Furthermore, an operation on a previously operated neck is quite difficult.
Alcohol ablation of the mass with ultrasound guidance or angiographic embolization is preferred in this setting.
|
Surgery
| null | 114 |
{
"Correct Answer": "Ultrasound-guided alcohol injection of the mass",
"Correct Option": "D",
"Options": {
"A": "Repeat neck surgery",
"B": "Treatment with technetium - 99",
"C": "Observation and repeat serum Ca+2 in two months",
"D": "Ultrasound-guided alcohol injection of the mass"
},
"Question": "Kamli Rath 75 yrs old woman present with post-myocardial infarction after 6 weeks with mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, EKG shows slow atrial fibrillation. Serum Ca+2 13.0 mg/L and urinary Ca2+ is 300 mg/ 24 hr. On examination, there is small mass in the Para tracheal position behind the right clavicle. Appropriate management at this time is -"
}
|
Kamli Rath 75 yrs old woman present with post-myocardial infarction after 6 weeks with mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, EKG shows slow atrial fibrillation. Serum Ca+2 13.0 mg/L and urinary Ca2+ is 300 mg/ 24 hr. On examination, there is small mass in the Para tracheal position behind the right clavicle.
|
Appropriate management at this time is -
|
{
"A": "Repeat neck surgery",
"B": "Treatment with technetium - 99",
"C": "Observation and repeat serum Ca+2 in two months",
"D": "Ultrasound-guided alcohol injection of the mass"
}
|
D. Ultrasound-guided alcohol injection of the mass
|
a5b933d5-3c15-4e19-8d5f-5c814440c9f0
|
An 18-year-old pregnant woman receives no prenatal care, eats a diet containing mostly carbohydrates and fats, and does not take prenatal vitamins with iron. She feels increasingly tired and weak during the third trimester. The infant is born at 35 weeks' gestation and is listless during the first week of life. Laboratory studies show markedly decreased serum ferritin levels in the infant and the mother. Which of the following findings from a nutritional deficiency is most likely to be present in both the infant and the mother?
|
Dermatitis
|
Diffuse goiter
|
Microcytic anemia
|
Peripheral neuropathy
| 2c
|
multi
|
Iron deficiency, which gives rise to microcytic anemia, is common in women of reproductive age because of menstrual blood loss and in children with a poor diet. During pregnancy, women have greatly increased iron needs. Low serum ferritin is indicative of iron deficiency. Dermatitis can be seen in pellagra (niacin deficiency). A goiter results from iodine deficiency, but this is a rare occurrence today because of newborn testing and widely available foods with iodine. Peripheral neuropathy is more characteristic of beriberi (thiamine deficiency) and deficiencies in riboflavin (vitamin B2 ) and pyridoxine (vitamin B6 ). Bowing of the long bones and epiphyseal widening can be seen in rickets (vitamin D deficiency). Soft tissue hemorrhages can be seen in scurvy (vitamin C deficiency).
|
Pathology
|
Environment & Nutritional Pathology
| 106 |
{
"Correct Answer": "Microcytic anemia",
"Correct Option": "C",
"Options": {
"A": "Dermatitis",
"B": "Diffuse goiter",
"C": "Microcytic anemia",
"D": "Peripheral neuropathy"
},
"Question": "An 18-year-old pregnant woman receives no prenatal care, eats a diet containing mostly carbohydrates and fats, and does not take prenatal vitamins with iron. She feels increasingly tired and weak during the third trimester. The infant is born at 35 weeks' gestation and is listless during the first week of life. Laboratory studies show markedly decreased serum ferritin levels in the infant and the mother. Which of the following findings from a nutritional deficiency is most likely to be present in both the infant and the mother?"
}
|
An 18-year-old pregnant woman receives no prenatal care, eats a diet containing mostly carbohydrates and fats, and does not take prenatal vitamins with iron. She feels increasingly tired and weak during the third trimester. The infant is born at 35 weeks' gestation and is listless during the first week of life. Laboratory studies show markedly decreased serum ferritin levels in the infant and the mother.
|
Which of the following findings from a nutritional deficiency is most likely to be present in both the infant and the mother?
|
{
"A": "Dermatitis",
"B": "Diffuse goiter",
"C": "Microcytic anemia",
"D": "Peripheral neuropathy"
}
|
C. Microcytic anemia
|
69495835-836b-4fd7-ad1b-f7ababe71493
|
A 25-year-old man presents to the outpatient clinic complaining of feeling sleepy all the time, even during the daytime. The symptoms have persisted for years and are now brought to medical attention after falling asleep at work on multiple occasions. He is concerned that he might lose his job. He has no past medical history and is not taking any sedative medications. On physical examination, he is slender and the heart and lung exams are normal. Neurologic assessment reveals normal orientation, memory, concentration, and no focal deficits. Which of the following symptoms might he also complain about?
|
excessive snoring (wife's report)
|
automatic behavior (wife's report)
|
restless sleep (wife's report)
|
paresthesia
| 1b
|
multi
|
The early age of onset and otherwise good health suggest a diagnosis of narcolepsy, which is usually accompanied by other symptomatology. Hypnagogic hallucinations are almost always visual. They occur most frequently at the onset of sleep, either during the day or at night. They are generally very vivid. Cataplexy is a brief loss of muscle power without loss of consciousness. The patient is fully aware of what is going on. The paralysis may be complete or partial. Automatic behavior with amnesia is a common manifestation of the narcolepsy cataplexy syndromes, occurring in 50% of cases. Automatic behavior can be confused with complex partial seizures. Paresthesia are not part of narcolepsy syndrome. Snoring, restless sleep, and morning headache suggest sleep apnea.
|
Medicine
|
C.N.S.
| 116 |
{
"Correct Answer": "automatic behavior (wife's report)",
"Correct Option": "B",
"Options": {
"A": "excessive snoring (wife's report)",
"B": "automatic behavior (wife's report)",
"C": "restless sleep (wife's report)",
"D": "paresthesia"
},
"Question": "A 25-year-old man presents to the outpatient clinic complaining of feeling sleepy all the time, even during the daytime. The symptoms have persisted for years and are now brought to medical attention after falling asleep at work on multiple occasions. He is concerned that he might lose his job. He has no past medical history and is not taking any sedative medications. On physical examination, he is slender and the heart and lung exams are normal. Neurologic assessment reveals normal orientation, memory, concentration, and no focal deficits. Which of the following symptoms might he also complain about?"
}
|
A 25-year-old man presents to the outpatient clinic complaining of feeling sleepy all the time, even during the daytime. The symptoms have persisted for years and are now brought to medical attention after falling asleep at work on multiple occasions. He is concerned that he might lose his job. He has no past medical history and is not taking any sedative medications. On physical examination, he is slender and the heart and lung exams are normal. Neurologic assessment reveals normal orientation, memory, concentration, and no focal deficits.
|
Which of the following symptoms might he also complain about?
|
{
"A": "excessive snoring (wife's report)",
"B": "automatic behavior (wife's report)",
"C": "restless sleep (wife's report)",
"D": "paresthesia"
}
|
B. automatic behavior (wife's report)
|
8ee4f02b-6692-40dc-8e30-f789d351771c
|
A 50-year-old man with muscle pain and fever for a month now notes darker colored urine for the past 2 weeks. On physical examination, he has palpable purpuric lesions of his skin. Urinalysis shows hematuria and proteinuria. Serum laboratory findings include mixed cryoglobulinemia with a polyclonal increase in IgG, as well as a high titer of anti-neutrophil cytoplasmic autoantibodies, mainly antimyeloperoxidase (MPO-ANCA, or P-ANCA. A skin biopsy is performed. What pathologic finding is most likely to be observed in this biopsy?
|
Giant cells and macrophages
|
Medial fibrinoid necrosis
|
Micro abscesses
|
Mycotic aneurysms
| 1b
|
single
|
Microscopic polyangiitis involves small vessels, typically capillaries. Kidneys and lungs are commonly involved, but many organs can be affected. There may be an underlying immune disease, chronic infection, or drug reaction. Giant cell arteritis typically involves arterial branches of the external carotid, most often the temporal artery. Micro abscesses may be present with an infectious process, or with thromboangiitis obliterans (Buerger disease), which typically involves lower extremities. Mycotic aneurysms occur when a focus of infection, often from a septic embolus, weakens an arterial wall so that it bulges out. Perivascular eosinophilic infiltrates may be seen with Churg-Strauss syndrome, which typically involves the lungs.
|
Pathology
|
Blood Vessels
| 137 |
{
"Correct Answer": "Medial fibrinoid necrosis",
"Correct Option": "B",
"Options": {
"A": "Giant cells and macrophages",
"B": "Medial fibrinoid necrosis",
"C": "Micro abscesses",
"D": "Mycotic aneurysms"
},
"Question": "A 50-year-old man with muscle pain and fever for a month now notes darker colored urine for the past 2 weeks. On physical examination, he has palpable purpuric lesions of his skin. Urinalysis shows hematuria and proteinuria. Serum laboratory findings include mixed cryoglobulinemia with a polyclonal increase in IgG, as well as a high titer of anti-neutrophil cytoplasmic autoantibodies, mainly antimyeloperoxidase (MPO-ANCA, or P-ANCA. A skin biopsy is performed. What pathologic finding is most likely to be observed in this biopsy?"
}
|
A 50-year-old man with muscle pain and fever for a month now notes darker colored urine for the past 2 weeks. On physical examination, he has palpable purpuric lesions of his skin. Urinalysis shows hematuria and proteinuria. Serum laboratory findings include mixed cryoglobulinemia with a polyclonal increase in IgG, as well as a high titer of anti-neutrophil cytoplasmic autoantibodies, mainly antimyeloperoxidase (MPO-ANCA, or P-ANCA. A skin biopsy is performed.
|
What pathologic finding is most likely to be observed in this biopsy?
|
{
"A": "Giant cells and macrophages",
"B": "Medial fibrinoid necrosis",
"C": "Micro abscesses",
"D": "Mycotic aneurysms"
}
|
B. Medial fibrinoid necrosis
|
267c2917-6ae6-4833-bd21-00bf62b9821d
|
An individual has been determined to have hypertriglyceridemia, with a triglyceride level of 350 mg/dL (normal is <150 mg/dL). The patient decides to reduce this level by keeping his caloric intake the same, but switching to a low-fat, low-protein, high-carbohydrate diet. Three months later, after sticking faithfully to his diet, his triglyceride level was 375 mg/dL. This increase in lipid content is being caused by which component of his new diet?
|
Phospholipids
|
Triglycerides
|
Amino acids
|
Carbohydrates
| 3d
|
single
|
Dietary glucose is the major source of carbon for synthesizing fatty acids in humans. In a high-carbohydrate diet, excess carbohydrates are converted to fat (fatty acids and glycerol) in the liver, packaged as VLDL, and sent into the circulation for storage in the fat cells. The new diet has reduced dietary lipids, which lower chylomicron levels, but the excess carbohydrate in the diet is leading to increased VLDL synthesis and elevated triglyceride levels. Dietary amino acids are usually incorporated into proteins, particularly in a low-protein diet.
|
Biochemistry
|
Lipids
| 114 |
{
"Correct Answer": "Carbohydrates",
"Correct Option": "D",
"Options": {
"A": "Phospholipids",
"B": "Triglycerides",
"C": "Amino acids",
"D": "Carbohydrates"
},
"Question": "An individual has been determined to have hypertriglyceridemia, with a triglyceride level of 350 mg/dL (normal is <150 mg/dL). The patient decides to reduce this level by keeping his caloric intake the same, but switching to a low-fat, low-protein, high-carbohydrate diet. Three months later, after sticking faithfully to his diet, his triglyceride level was 375 mg/dL. This increase in lipid content is being caused by which component of his new diet?"
}
|
An individual has been determined to have hypertriglyceridemia, with a triglyceride level of 350 mg/dL (normal is <150 mg/dL). The patient decides to reduce this level by keeping his caloric intake the same, but switching to a low-fat, low-protein, high-carbohydrate diet. Three months later, after sticking faithfully to his diet, his triglyceride level was 375 mg/dL.
|
This increase in lipid content is being caused by which component of his new diet?
|
{
"A": "Phospholipids",
"B": "Triglycerides",
"C": "Amino acids",
"D": "Carbohydrates"
}
|
D. Carbohydrates
|
e8a59d75-6f7a-4df1-ae1e-454f8df1a4b4
|
A case-control study is conducted to assess the relationship between poor diet and coronary artery disease. They enroll cases from cardiac floors in hospitals and controls from primary care physician offices in a single metropolitan area, Diet for the past 10 years was recorded using an in-person interview. On average, the dietary interview with cases lasted 30 minutes longer than the interview with controls. In addition, the information collected from cases was much more detailed.
Which of the following type of bias most likely occurred?
|
Berkson’s bias
|
Loss to follow-up
|
Observer bias
|
Recall bias
| 2c
|
multi
| null |
Social & Preventive Medicine
| null | 101 |
{
"Correct Answer": "Observer bias",
"Correct Option": "C",
"Options": {
"A": "Berkson’s bias",
"B": "Loss to follow-up",
"C": "Observer bias",
"D": "Recall bias"
},
"Question": "A case-control study is conducted to assess the relationship between poor diet and coronary artery disease. They enroll cases from cardiac floors in hospitals and controls from primary care physician offices in a single metropolitan area, Diet for the past 10 years was recorded using an in-person interview. On average, the dietary interview with cases lasted 30 minutes longer than the interview with controls. In addition, the information collected from cases was much more detailed. \nWhich of the following type of bias most likely occurred?"
}
|
A case-control study is conducted to assess the relationship between poor diet and coronary artery disease. They enroll cases from cardiac floors in hospitals and controls from primary care physician offices in a single metropolitan area, Diet for the past 10 years was recorded using an in-person interview. On average, the dietary interview with cases lasted 30 minutes longer than the interview with controls. In addition, the information collected from cases was much more detailed.
|
Which of the following type of bias most likely occurred?
|
{
"A": "Berkson’s bias",
"B": "Loss to follow-up",
"C": "Observer bias",
"D": "Recall bias"
}
|
C. Observer bias
|
bb2da234-b6f2-4782-9156-99c748cf4b6e
|
A 75-year-old male patient is a known case of a pulmonary disease and is being treated with inhalational coicosteroids and daily theophylline.The patient was admitted to a hospital for urinary retention few days back and catheterization was done. However, the condition got complicated with urinary tract infection and the patient was put on an antibiotic for the same. Now the patient is presenting with symptoms such as nausea, vomiting, abdominal pain, headache and a fine hand tremor. The patient also appears to have tachycardia. According to the doctor, the symptoms may be due to increased serum levels of the drugs taken by the patient. Which of the following drug may be responsible for the patient's condition?
|
Amoxicillin
|
Ceftriaxone
|
Nitrofurantoin
|
Ciprofloxacin
| 3d
|
single
|
Theophylline is metabolized mainly by CYP1A2 hepatic microsomal enzyme. Inhibitors of CYP1A2: Cimetidine Ciprofloxacin Erythromycin Others are: - Aemisinin Atazanavir Enoxacin Ethinyl estradiol Fluvoxamine Furafylline Galangin Mexiletene Tacrine Thiabendazole Zileuton All these drugs inhibit the metabolism of theophylline and therefore may result in its toxicity. Nausea is a common side effect; tachycardia and tremors are also seen. Monitoring of blood theophylline levels is required to minimize toxicity.
|
Unknown
|
Integrated QBank
| 148 |
{
"Correct Answer": "Ciprofloxacin",
"Correct Option": "D",
"Options": {
"A": "Amoxicillin",
"B": "Ceftriaxone",
"C": "Nitrofurantoin",
"D": "Ciprofloxacin"
},
"Question": "A 75-year-old male patient is a known case of a pulmonary disease and is being treated with inhalational coicosteroids and daily theophylline.The patient was admitted to a hospital for urinary retention few days back and catheterization was done. However, the condition got complicated with urinary tract infection and the patient was put on an antibiotic for the same. Now the patient is presenting with symptoms such as nausea, vomiting, abdominal pain, headache and a fine hand tremor. The patient also appears to have tachycardia. According to the doctor, the symptoms may be due to increased serum levels of the drugs taken by the patient. Which of the following drug may be responsible for the patient's condition?"
}
|
A 75-year-old male patient is a known case of a pulmonary disease and is being treated with inhalational coicosteroids and daily theophylline.The patient was admitted to a hospital for urinary retention few days back and catheterization was done. However, the condition got complicated with urinary tract infection and the patient was put on an antibiotic for the same. Now the patient is presenting with symptoms such as nausea, vomiting, abdominal pain, headache and a fine hand tremor. The patient also appears to have tachycardia. According to the doctor, the symptoms may be due to increased serum levels of the drugs taken by the patient.
|
Which of the following drug may be responsible for the patient's condition?
|
{
"A": "Amoxicillin",
"B": "Ceftriaxone",
"C": "Nitrofurantoin",
"D": "Ciprofloxacin"
}
|
D. Ciprofloxacin
|
3458f971-59ef-4497-ab93-01e7e5b570bc
|
A 45 year old woman develops abdominal and pelvic discomfo. Physical examination reveals a large mass in the right lower quadrant, which is surgically resected. The mass consists of a large (25 cm) cystic sac containing thick mucinous fluid within a thin wall. On careful inspection, the pathologist finds an area of increased thickness in the cyst wall, which is sampled for histology. Microscopically, the tumor appears to be composed mostly of a single layer of nonciliated columnar cells arranged in papillary projections. The thickened area, however, displays stratification of epithelial cells, increased cytologic atypia, and high mitotic activity. Neveheless, no stromal invasion is found. Which of the following is the most likely diagnosis?
|
Borderline mucinous tumor
|
Mucinous cystadenocarcinoma
|
Mucinous cystadenoma
|
Serous cystadenocarcinoma
| 0a
|
multi
|
Classification of ovarian tumors, like testicular tumors, is based on putative cell of origin. Thus, ovarian tumors can be divided into neoplasms of germ cells,surface epithelium, or stromal origin. Two thirds of all ovarian neoplasms derive from the surface (coelomic) epithelium. These cystic tumors may contain clear serous fluid or turbid mucinous fluid. Depending on whether a tumor is benign or malignant, surface epithelium tumors can be differentiated into serous cystadenoma or cystadenocarcinoma, and mucinous cystadenoma or cystadenocarcinoma. Borderline tumors are intermediate cases in which the epithelial lining shows malignant features (cytologic atypia and architectural disorganization) in the absence of stromal invasion. Thus, microscopic features of the ovarian tumor in this case are consistent with a borderline mucinous tumor. Mucinous cystadenocarcinoma shows obvious signs of malignancy, including foci of invasion of the stroma within the cystic wall. Mucinous cystadenoma is a cystic tumor with a mucin-rich fluid content. The epithelial lining is similar to intestinal or cervical epithelium, ie, a single layer of columnar cells with apical mucin and no cilia. Serous cystadenocarcinoma is the most frequent malignant ovarian tumor. Its epithelial lining is composed of columnar cells showing atypia and crowding. By definition, stromal invasion is present. Ref: Levy G., Purcell K. (2013). Chapter 50. Premalignant & Malignant Disorders of the Ovaries & Oviducts. In A.H. DeCherney, L. Nathan, N. Laufer, A.S. Roman (Eds), CURRENT Diagnosis & Treatment: Obstetrics & Gynecology, 11e.
|
Gynaecology & Obstetrics
| null | 165 |
{
"Correct Answer": "Borderline mucinous tumor",
"Correct Option": "A",
"Options": {
"A": "Borderline mucinous tumor",
"B": "Mucinous cystadenocarcinoma",
"C": "Mucinous cystadenoma",
"D": "Serous cystadenocarcinoma"
},
"Question": "A 45 year old woman develops abdominal and pelvic discomfo. Physical examination reveals a large mass in the right lower quadrant, which is surgically resected. The mass consists of a large (25 cm) cystic sac containing thick mucinous fluid within a thin wall. On careful inspection, the pathologist finds an area of increased thickness in the cyst wall, which is sampled for histology. Microscopically, the tumor appears to be composed mostly of a single layer of nonciliated columnar cells arranged in papillary projections. The thickened area, however, displays stratification of epithelial cells, increased cytologic atypia, and high mitotic activity. Neveheless, no stromal invasion is found. Which of the following is the most likely diagnosis?"
}
|
A 45 year old woman develops abdominal and pelvic discomfo. Physical examination reveals a large mass in the right lower quadrant, which is surgically resected. The mass consists of a large (25 cm) cystic sac containing thick mucinous fluid within a thin wall. On careful inspection, the pathologist finds an area of increased thickness in the cyst wall, which is sampled for histology. Microscopically, the tumor appears to be composed mostly of a single layer of nonciliated columnar cells arranged in papillary projections. The thickened area, however, displays stratification of epithelial cells, increased cytologic atypia, and high mitotic activity. Neveheless, no stromal invasion is found.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Borderline mucinous tumor",
"B": "Mucinous cystadenocarcinoma",
"C": "Mucinous cystadenoma",
"D": "Serous cystadenocarcinoma"
}
|
A. Borderline mucinous tumor
|
669ac0aa-46c0-4b8c-803f-922d2065eaa5
|
A 22-year-old woman is admitted to the hospital because of right-hand anaesthesia, that developed after an argument with her brother. She is in good spirits and seems unconcerned about her problem. There is no history of physical trauma. The neurologic examination is negative EXCEPT for reduced sensitivity to pain in a glove-like distribution over the right hand. Her entire family is in attendance and is expressing great concern and attentiveness. She ignores her brother and seems unaware of the chronic jealousy and rivalry described by her family. The most likely diagnosis is
|
Body dysmorphic disorder
|
Histrionic personality disorder
|
Parietal brain tumor
|
Conversion disorder
| 3d
|
multi
|
(D) Conversion disorder # Conversion disorder is characterized by symptoms or deficits of die voluntary motor or sensory functions dial cannot be explained by neurological or other medical conditions.> These symptoms are precipitated by psychological conflicts.> Term 'Hysteria' was used in die nineteenth century (and die first versions of die DSM) to describe syndromes similar to conversion disorder.> It is not a legitimate diagnostic term anymore and it has a negative connotation in general use.> Patients with body dysmorphic disorder are preoccupied wide in-existent or wry minor physical imperfections, often at a delusional level.> Patients with brain tumors present with motor, behavioral and neuropsychiatry symptoms dial vary depending on the localization of die tumors.> Patient's lack of anxiety and apparent lack of awareness of the conflicts with her brother are classic findings In conversion disorder and they are described as called "Primary gains."> This term refers to the use of physical symptoms to express a conflict, emotion, or desire with-in allowing it to enter the patient's consciousness.> Patient's enjoyment other family's attention is a form of "Secondary gain." Secondary gains, being experienced as plea sur- able, reinforce the symptoms.> There is no such dying as "Tertiary gain."> Suppression is a mature defense mechanism and consists of a voluntary decision to put a disturbing thought temporarily o.it of the conscious mind.> "indifference reaction" is associated with right hemispheric lesions and consists of symptoms of indifference toward failures and physical difficulties and lack of interest in family and friends.
|
Pharmacology
|
Miscellaneous (Pharmacology)
| 112 |
{
"Correct Answer": "Conversion disorder",
"Correct Option": "D",
"Options": {
"A": "Body dysmorphic disorder",
"B": "Histrionic personality disorder",
"C": "Parietal brain tumor",
"D": "Conversion disorder"
},
"Question": "A 22-year-old woman is admitted to the hospital because of right-hand anaesthesia, that developed after an argument with her brother. She is in good spirits and seems unconcerned about her problem. There is no history of physical trauma. The neurologic examination is negative EXCEPT for reduced sensitivity to pain in a glove-like distribution over the right hand. Her entire family is in attendance and is expressing great concern and attentiveness. She ignores her brother and seems unaware of the chronic jealousy and rivalry described by her family. The most likely diagnosis is"
}
|
A 22-year-old woman is admitted to the hospital because of right-hand anaesthesia, that developed after an argument with her brother. She is in good spirits and seems unconcerned about her problem. There is no history of physical trauma. The neurologic examination is negative EXCEPT for reduced sensitivity to pain in a glove-like distribution over the right hand. Her entire family is in attendance and is expressing great concern and attentiveness. She ignores her brother and seems unaware of the chronic jealousy and rivalry described by her family.
|
The most likely diagnosis is
|
{
"A": "Body dysmorphic disorder",
"B": "Histrionic personality disorder",
"C": "Parietal brain tumor",
"D": "Conversion disorder"
}
|
D. Conversion disorder
|
c1a49e19-4984-4a6a-8acb-c927b5a920b6
|
A 54-year-old male nonsmoker is seen with complaints of a flulike illness. Initial symptomatic treatment is provided. Two days later, he returns, as he is still not feeling well. His primary physician prescribes a macrolide along with the symptomatic treatment. After 5 days of this treatment, the patient says he is running a fever and has increasing fatigue, weakness, and cough. He also complains of pain in the right wrist with some difficulty in motion. He has left groin pain and is unable to walk more than a few steps. On physical exam, vital signs are: pulse 110 bpm; temperature 102degF; respirations 24/min; blood pressure 10/68 mm Hg. He looks weak and says he has lost about 8 lb in the last 10 days. Peinent findings: lung exam reveals area of egophony, and E to A changes in the left anterior and posterior lung field. The patient has swelling with some areas of skin sloughing in the right wrist and tenderness with limitation of movement in the left groin area. Laboratory data: Hb 11 g/dL; Hct 33%; WBCs 16.0/uL; differential 90% segmented neutrophils; BUN 42 mg/dL; creatinine 1.1 mg/dL; sodium 142 mEq/L; potassium 3.4 mEq/L. ABGs on room air: pH 7.45, PCO2 34 mm Hg; PO2 65 mm Hg. CXR is shown.Associated findings may include all of the following except?
|
Septic ahritis
|
Endocarditis
|
Brain abscess
|
Reye syndrome
| 3d
|
multi
|
This x-ray shows a nonhomogeneous airspace density in the left middle and lower zones with areas of incomplete consolidation and evolving pneumatocele formation. The left diaphragm is raised and the trachea appears shifted to the left, suggesting loss of volume of the left lung. There is minimal blunting of the left costophrenic angle, suggesting a left pleural effu-sion. This CXR is consistent with the left lower lobe necrotizing pneumonia with loss of volume, which can be seen in staphylococcal pneumonia. The prodrome of a flulike illness and the development of pneumonia along with multisystem involvement suggest a bacteremic process. Both staphylococcal and pneumococcal pneumonia can produce this picture. However, the signs of the loss of volume in the left lung along with the necrotizing airspace disease or pneumatoceles suggest that this is more likely staphylococcal pneumonia. Associated conditions include septic ahritis, endocarditis, and brain abscess. Reye syndrome is unlikely in an adult and is not an applicable choice here.
|
Radiology
|
Respiratory system
| 359 |
{
"Correct Answer": "Reye syndrome",
"Correct Option": "D",
"Options": {
"A": "Septic ahritis",
"B": "Endocarditis",
"C": "Brain abscess",
"D": "Reye syndrome"
},
"Question": "A 54-year-old male nonsmoker is seen with complaints of a flulike illness. Initial symptomatic treatment is provided. Two days later, he returns, as he is still not feeling well. His primary physician prescribes a macrolide along with the symptomatic treatment. After 5 days of this treatment, the patient says he is running a fever and has increasing fatigue, weakness, and cough. He also complains of pain in the right wrist with some difficulty in motion. He has left groin pain and is unable to walk more than a few steps. On physical exam, vital signs are: pulse 110 bpm; temperature 102degF; respirations 24/min; blood pressure 10/68 mm Hg. He looks weak and says he has lost about 8 lb in the last 10 days. Peinent findings: lung exam reveals area of egophony, and E to A changes in the left anterior and posterior lung field. The patient has swelling with some areas of skin sloughing in the right wrist and tenderness with limitation of movement in the left groin area. Laboratory data: Hb 11 g/dL; Hct 33%; WBCs 16.0/uL; differential 90% segmented neutrophils; BUN 42 mg/dL; creatinine 1.1 mg/dL; sodium 142 mEq/L; potassium 3.4 mEq/L. ABGs on room air: pH 7.45, PCO2 34 mm Hg; PO2 65 mm Hg. CXR is shown.Associated findings may include all of the following except?"
}
|
A 54-year-old male nonsmoker is seen with complaints of a flulike illness. Initial symptomatic treatment is provided. Two days later, he returns, as he is still not feeling well. His primary physician prescribes a macrolide along with the symptomatic treatment. After 5 days of this treatment, the patient says he is running a fever and has increasing fatigue, weakness, and cough. He also complains of pain in the right wrist with some difficulty in motion. He has left groin pain and is unable to walk more than a few steps. On physical exam, vital signs are: pulse 110 bpm; temperature 102degF; respirations 24/min; blood pressure 10/68 mm Hg. He looks weak and says he has lost about 8 lb in the last 10 days. Peinent findings: lung exam reveals area of egophony, and E to A changes in the left anterior and posterior lung field. The patient has swelling with some areas of skin sloughing in the right wrist and tenderness with limitation of movement in the left groin area. Laboratory data: Hb 11 g/dL; Hct 33%; WBCs 16.0/uL; differential 90% segmented neutrophils; BUN 42 mg/dL; creatinine 1.1 mg/dL; sodium 142 mEq/L; potassium 3.4 mEq/L. ABGs on room air: pH 7.45, PCO2 34 mm Hg; PO2 65 mm Hg.
|
CXR is shown.Associated findings may include all of the following except?
|
{
"A": "Septic ahritis",
"B": "Endocarditis",
"C": "Brain abscess",
"D": "Reye syndrome"
}
|
D. Reye syndrome
|
19585c4a-70e7-4b96-9518-db97780b16d2
|
A 3 year old boy was admitted to the hospital for high fever and difficulty in breathing. He had been well until 4 days before admission, when he developed sneezing and a runny and stuffy nose followed by a non-productive cough on next day. This was followed by appearance of characteristic rash on face, trunk, extremities and back along with fever. O/E, Shotty anterior cervical and supraclavicular lymph nodes. Hyperaemic conjunctiva Ceain spots on buccal mucosa The white blood cell count was 3,100/ml, with a differential of 70 % polymorphonuclear leukocytes. All of the following are complications of the above disease EXCEPT?
|
Hecht Giant cell pneumonia
|
SSPE
|
Orchitis
|
Otitis media
| 2c
|
multi
|
This is a case of measles. The face is completely erythematous and there is an erythematous maculopapular rash on the trunk and extremities, with large confluent areas on the back. 3RD image shows the classical appearance of the Koplik spots, an exanthem (mucosal rash) that is felt to be pathognomonic (distinctly characteristic) of measles. Complications of measles: - Diarrhoea Otitis media Giant cell pneumonia Croup Malnutrition Mouth ulcers Retrobulbar neuritis SSPE Myocarditis Appendicitis Pneumothorax and Pneumomediastinum
|
Unknown
|
Integrated QBank
| 149 |
{
"Correct Answer": "Orchitis",
"Correct Option": "C",
"Options": {
"A": "Hecht Giant cell pneumonia",
"B": "SSPE",
"C": "Orchitis",
"D": "Otitis media"
},
"Question": "A 3 year old boy was admitted to the hospital for high fever and difficulty in breathing. He had been well until 4 days before admission, when he developed sneezing and a runny and stuffy nose followed by a non-productive cough on next day. This was followed by appearance of characteristic rash on face, trunk, extremities and back along with fever. O/E, Shotty anterior cervical and supraclavicular lymph nodes. Hyperaemic conjunctiva Ceain spots on buccal mucosa The white blood cell count was 3,100/ml, with a differential of 70 % polymorphonuclear leukocytes. All of the following are complications of the above disease EXCEPT?"
}
|
A 3 year old boy was admitted to the hospital for high fever and difficulty in breathing. He had been well until 4 days before admission, when he developed sneezing and a runny and stuffy nose followed by a non-productive cough on next day. This was followed by appearance of characteristic rash on face, trunk, extremities and back along with fever. O/E, Shotty anterior cervical and supraclavicular lymph nodes. Hyperaemic conjunctiva Ceain spots on buccal mucosa The white blood cell count was 3,100/ml, with a differential of 70 % polymorphonuclear leukocytes.
|
All of the following are complications of the above disease EXCEPT?
|
{
"A": "Hecht Giant cell pneumonia",
"B": "SSPE",
"C": "Orchitis",
"D": "Otitis media"
}
|
C. Orchitis
|
c5f701a2-e5e4-41de-8ef1-5cda236f40b2
|
A 1-year-old female infant is hospitalized for pneumonia. Bacterial cultures of the sputum have grown Pseudomonas aeruginosa. She has had two prior hospitalizations for severe respiratory infections. Her mother has noted that when she kisses her child, the child tastes "salty." The child has had weight loss that the mother attributes to frequent vomiting and diarrhea with bulky, foul-smelling fatty stools. The child is small for her age. Which of the following critical proteins is altered in this condition?
|
Cystic fibrosis transmembrane conductance regulator
|
Dystrophin
|
a-1,4-Glucosidase
|
a-L-Iduronidase
| 0a
|
multi
|
Cystic fibrosis, Most common lethal genetic disease in Caucasian populations. Defect in the cystic fibrosis transmembrane conductance regulator (CFTR) protein Deletion of phenylalanine in position 508 (DF508 mutation). Affected patients often have multiple pulmonary infections and pancreatic insufficiency with steatorrhea and failure to thrive. Death is often due to respiratory failure secondary to repeated pulmonary infections, facilitated by the buildup of thick, tenacious mucus in the airways. Increased concentration of chloride in sweat and tears is characteristic
|
Pathology
|
Genetics
| 105 |
{
"Correct Answer": "Cystic fibrosis transmembrane conductance regulator",
"Correct Option": "A",
"Options": {
"A": "Cystic fibrosis transmembrane conductance regulator",
"B": "Dystrophin",
"C": "a-1,4-Glucosidase",
"D": "a-L-Iduronidase"
},
"Question": "A 1-year-old female infant is hospitalized for pneumonia. Bacterial cultures of the sputum have grown Pseudomonas aeruginosa. She has had two prior hospitalizations for severe respiratory infections. Her mother has noted that when she kisses her child, the child tastes \"salty.\" The child has had weight loss that the mother attributes to frequent vomiting and diarrhea with bulky, foul-smelling fatty stools. The child is small for her age. Which of the following critical proteins is altered in this condition?"
}
|
A 1-year-old female infant is hospitalized for pneumonia. Bacterial cultures of the sputum have grown Pseudomonas aeruginosa. She has had two prior hospitalizations for severe respiratory infections. Her mother has noted that when she kisses her child, the child tastes "salty." The child has had weight loss that the mother attributes to frequent vomiting and diarrhea with bulky, foul-smelling fatty stools. The child is small for her age.
|
Which of the following critical proteins is altered in this condition?
|
{
"A": "Cystic fibrosis transmembrane conductance regulator",
"B": "Dystrophin",
"C": "a-1,4-Glucosidase",
"D": "a-L-Iduronidase"
}
|
A. Cystic fibrosis transmembrane conductance regulator
|
6c160be8-fcf3-4fd5-9de8-150039853a5f
|
A 35-year-old man is taken to the emergency depament because he is coughing up large volumes of blood. He does not have any history suggestive of exposure to tuberculosis, and a chest x-ray film does not show a mass lesion. Chest x-ray films performed on the day of admission and daily for the next several days show asymmetric densities in both lungs that vary in shape and position from film to film. Urinary screening shows hematuria and proteinuria, and the urinary sediment contains cellular and granular casts. Renal biopsy shows rapidly progressive glomerulonephritis with prominent epithelial cell crescents. The mechanism causing this patient's disease is closest to the mechanism underlying which of the following diseases?
|
Bullous pemphigoid
|
Graves disease
|
Hereditary angioedema
|
Rheumatoid ahritis
| 0a
|
multi
|
This patient has Goodpasture syndrome, which is a rare, severe autoimmune disease in which antibodies directed against the basement membrane in pulmonary alveoli and renal glomeruli predispose for hemoptysis and progressive renal disease. These patients can die because of exsanguination, asphyxiation by blood, or renal failure. Aggressive immunosuppression coupled with management of complications may be lifesaving. Goodpasture disease is often cited as an example of a Type II hypersensitivity reaction, and a very similar pathologic mechanism produces the blistering disease bullous pemphigoid, in which antibodies are directed against the basement membrane region of the skin. The immunologic basis of Graves disease is stimulation of TSH receptors by anti-receptor antibodies. The immunologic basis of hereditary angioedema is inadequate C1 esterase inhibitor activity. The immunologic basis of rheumatoid ahritis is the presence of immune complexes within joints.
|
Medicine
| null | 146 |
{
"Correct Answer": "Bullous pemphigoid",
"Correct Option": "A",
"Options": {
"A": "Bullous pemphigoid",
"B": "Graves disease",
"C": "Hereditary angioedema",
"D": "Rheumatoid ahritis"
},
"Question": "A 35-year-old man is taken to the emergency depament because he is coughing up large volumes of blood. He does not have any history suggestive of exposure to tuberculosis, and a chest x-ray film does not show a mass lesion. Chest x-ray films performed on the day of admission and daily for the next several days show asymmetric densities in both lungs that vary in shape and position from film to film. Urinary screening shows hematuria and proteinuria, and the urinary sediment contains cellular and granular casts. Renal biopsy shows rapidly progressive glomerulonephritis with prominent epithelial cell crescents. The mechanism causing this patient's disease is closest to the mechanism underlying which of the following diseases?"
}
|
A 35-year-old man is taken to the emergency depament because he is coughing up large volumes of blood. He does not have any history suggestive of exposure to tuberculosis, and a chest x-ray film does not show a mass lesion. Chest x-ray films performed on the day of admission and daily for the next several days show asymmetric densities in both lungs that vary in shape and position from film to film. Urinary screening shows hematuria and proteinuria, and the urinary sediment contains cellular and granular casts. Renal biopsy shows rapidly progressive glomerulonephritis with prominent epithelial cell crescents.
|
The mechanism causing this patient's disease is closest to the mechanism underlying which of the following diseases?
|
{
"A": "Bullous pemphigoid",
"B": "Graves disease",
"C": "Hereditary angioedema",
"D": "Rheumatoid ahritis"
}
|
A. Bullous pemphigoid
|
dc98be1c-09bb-4063-b2f1-690f2c2ea3e9
|
A 71-year-old woman comes to the office with a history of headaches, fatigue, and weight loss for 3 months. The headaches are new for her, and usually not very severe. Her jaw also hurts when she is chewing food. Two days prior, she had briefly lost partial vision in her left eye. There were no other neurologic symptoms at the time. On examination, her neck is supple to flexion, fundi and neurologic examinations are normal. She is started on prednisone 60 mg/day and a biopsy is performed to confirm the diagnosis. Which of the following is the most likely change seen on the biopsy to confirm the diagnosis?
|
immune complex deposition
|
arteritis with giant cells
|
lymphocytic infiltration
|
type II muscle fiber atrophy
| 1b
|
multi
|
Temporal artery biopsy is required for definitive diagnosis of giant cell arteritis, because of the relatively nonspecific nature of the presenting symptoms, signs, and routine laboratory tests. The arteritis can be segmental, however, and great care must be taken in the pathologic assessment.
|
Medicine
|
C.N.S.
| 138 |
{
"Correct Answer": "arteritis with giant cells",
"Correct Option": "B",
"Options": {
"A": "immune complex deposition",
"B": "arteritis with giant cells",
"C": "lymphocytic infiltration",
"D": "type II muscle fiber atrophy"
},
"Question": "A 71-year-old woman comes to the office with a history of headaches, fatigue, and weight loss for 3 months. The headaches are new for her, and usually not very severe. Her jaw also hurts when she is chewing food. Two days prior, she had briefly lost partial vision in her left eye. There were no other neurologic symptoms at the time. On examination, her neck is supple to flexion, fundi and neurologic examinations are normal. She is started on prednisone 60 mg/day and a biopsy is performed to confirm the diagnosis. Which of the following is the most likely change seen on the biopsy to confirm the diagnosis?"
}
|
A 71-year-old woman comes to the office with a history of headaches, fatigue, and weight loss for 3 months. The headaches are new for her, and usually not very severe. Her jaw also hurts when she is chewing food. Two days prior, she had briefly lost partial vision in her left eye. There were no other neurologic symptoms at the time. On examination, her neck is supple to flexion, fundi and neurologic examinations are normal. She is started on prednisone 60 mg/day and a biopsy is performed to confirm the diagnosis.
|
Which of the following is the most likely change seen on the biopsy to confirm the diagnosis?
|
{
"A": "immune complex deposition",
"B": "arteritis with giant cells",
"C": "lymphocytic infiltration",
"D": "type II muscle fiber atrophy"
}
|
B. arteritis with giant cells
|
b7074fe0-aa45-4419-b2cf-e6449f94eb39
|
A 9 1/2 -year-old girl presents to your office with an approximately 1 1/4 -cm nodule in her neck, just to the left of the midline and below her cricoid cartilage. It is nontender and moves when she swallows. It has been enlarging over the last several months and was not seen by the pediatrician at her 9-year-old check-up. There is no family history of endocrine disorders. The most likely diagnosis is
|
Reactive viral lymphadenopathy
|
Papillary thyroid cancer
|
A brachial cleft cyst
|
A follicular adenoma of the thyroid
| 1b
|
multi
|
While reactive lymphadenopathy is by far the most common cause of neck masses in children; a lymph node should not move with deglutition and is more likely to be tender. A branchial cleft syst should be more lateral and the thyroglossal duct cyst should be higher and in the midline (although they can sometimes present off the midline). One might also have expected some prior evidence of both of these congenital cysts, although that is not always the case. The location and characteristics strongly suggest a thyroid nodule. While follicular adenomas are much more common in adults than cancers they are rarer in children and a rapidly growing solitary nodule is likely to be a papillary carcinoma, the most common thyroid cancer in children.
|
Surgery
|
Plastic & Reconstructive Surgery
| 104 |
{
"Correct Answer": "Papillary thyroid cancer",
"Correct Option": "B",
"Options": {
"A": "Reactive viral lymphadenopathy",
"B": "Papillary thyroid cancer",
"C": "A brachial cleft cyst",
"D": "A follicular adenoma of the thyroid"
},
"Question": "A 9 1/2 -year-old girl presents to your office with an approximately 1 1/4 -cm nodule in her neck, just to the left of the midline and below her cricoid cartilage. It is nontender and moves when she swallows. It has been enlarging over the last several months and was not seen by the pediatrician at her 9-year-old check-up. There is no family history of endocrine disorders. The most likely diagnosis is"
}
|
A 9 1/2 -year-old girl presents to your office with an approximately 1 1/4 -cm nodule in her neck, just to the left of the midline and below her cricoid cartilage. It is nontender and moves when she swallows. It has been enlarging over the last several months and was not seen by the pediatrician at her 9-year-old check-up. There is no family history of endocrine disorders.
|
The most likely diagnosis is
|
{
"A": "Reactive viral lymphadenopathy",
"B": "Papillary thyroid cancer",
"C": "A brachial cleft cyst",
"D": "A follicular adenoma of the thyroid"
}
|
B. Papillary thyroid cancer
|
b9581080-6726-41da-95d7-a695d9bc071b
|
A mother is holding her newborn baby in the hospital bed just a few hours after giving bih. The mother becomes alarmed when her baby begins to have a difficulty in breathing and she rings for help. You arrive at the bedside and observe that the baby is in severe respiratory distress. A quick physical examination reveals that the baby has a barrel-shaped chest, a scaphoid-shaped abdomen, and absence of breath sounds on the left side. A chest radiograph reveals air/fluid containing bowel in the left-side hemithorax, no visible aerated lung on the left side, contralateral displacement of the hea and other mediastinal structures, compression of the contralateral lung, and reduced size of the abdomen. Which of the following is the most likely diagnosis?
|
Esophageal Hiatal hernia
|
Infantile Hyperophic Pyloric Stenosis
|
Tracheoesophageal fistula (TEF)
|
Congenital Diaphragmatic Hernia
| 3d
|
single
|
This is a case of Congenital Diaphragmatic (Bochdalek) Hernia. Herniation of abdominal contents into the pleural cavity (usually left). Caused by a failure of the pleuroperitoneal membrane to develop or fuse with other components of the diaphragm. Affected neonates usually present in the first few hours of life with respiratory distress that may be mild or so severe as to be incompatible with life. Symptoms : Difficulty in breathing (neo-natal emergency) O/E -Barrel-shaped chest, Scaphoid-shaped abdomen, and absence of breath sounds on the left side CXR -Air/fluid containing bowel in the left-side hemithorax
|
Anatomy
|
Umblicial cord and diaphragm
| 157 |
{
"Correct Answer": "Congenital Diaphragmatic Hernia",
"Correct Option": "D",
"Options": {
"A": "Esophageal Hiatal hernia",
"B": "Infantile Hyperophic Pyloric Stenosis",
"C": "Tracheoesophageal fistula (TEF)",
"D": "Congenital Diaphragmatic Hernia"
},
"Question": "A mother is holding her newborn baby in the hospital bed just a few hours after giving bih. The mother becomes alarmed when her baby begins to have a difficulty in breathing and she rings for help. You arrive at the bedside and observe that the baby is in severe respiratory distress. A quick physical examination reveals that the baby has a barrel-shaped chest, a scaphoid-shaped abdomen, and absence of breath sounds on the left side. A chest radiograph reveals air/fluid containing bowel in the left-side hemithorax, no visible aerated lung on the left side, contralateral displacement of the hea and other mediastinal structures, compression of the contralateral lung, and reduced size of the abdomen. Which of the following is the most likely diagnosis?"
}
|
A mother is holding her newborn baby in the hospital bed just a few hours after giving bih. The mother becomes alarmed when her baby begins to have a difficulty in breathing and she rings for help. You arrive at the bedside and observe that the baby is in severe respiratory distress. A quick physical examination reveals that the baby has a barrel-shaped chest, a scaphoid-shaped abdomen, and absence of breath sounds on the left side. A chest radiograph reveals air/fluid containing bowel in the left-side hemithorax, no visible aerated lung on the left side, contralateral displacement of the hea and other mediastinal structures, compression of the contralateral lung, and reduced size of the abdomen.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Esophageal Hiatal hernia",
"B": "Infantile Hyperophic Pyloric Stenosis",
"C": "Tracheoesophageal fistula (TEF)",
"D": "Congenital Diaphragmatic Hernia"
}
|
D. Congenital Diaphragmatic Hernia
|
193bb7c1-ba4e-4928-bcbf-9be0f7878eba
|
An 83-year-old man with Parkinson's disease presents with low-grade fever and cough for several weeks. Lately, he has been experiencing more rigidity and difficulty with his walking. He is on a levodopa/carbidopa combination for treatment for the past 5 years. On examination, his gait is shuffling and slow. He has a tremor in his left hand at rest, and there is cogwheel rigidity of the forearm. There are crackles in the left lower lung field. CXR reveals a lung abscess in the left lower lobe. Which of the following is the most likely bacteriologic diagnosis for the lung abscess?
|
oropharyngeal flora
|
tuberculosis
|
Staphylococcus aureus
|
Pseudomonas aeruginosa
| 0a
|
single
|
Most lung abscesses and all anaerobic abscesses involve the normal flora of the oropharynx. Septic embolic usually contain S. aureus. Factors that predispose to Gram-negative colonization of the oropharynx include hospitalization, debility, severe underlying diseases, alcoholism, diabetes, and advanced age. Impaired consciousness, neurologic disease, swallowing disorders, and nasogastric or endotracheal tubes all increase the likelihood of aspiration.
|
Medicine
|
Respiratory
| 137 |
{
"Correct Answer": "oropharyngeal flora",
"Correct Option": "A",
"Options": {
"A": "oropharyngeal flora",
"B": "tuberculosis",
"C": "Staphylococcus aureus",
"D": "Pseudomonas aeruginosa"
},
"Question": "An 83-year-old man with Parkinson's disease presents with low-grade fever and cough for several weeks. Lately, he has been experiencing more rigidity and difficulty with his walking. He is on a levodopa/carbidopa combination for treatment for the past 5 years. On examination, his gait is shuffling and slow. He has a tremor in his left hand at rest, and there is cogwheel rigidity of the forearm. There are crackles in the left lower lung field. CXR reveals a lung abscess in the left lower lobe. Which of the following is the most likely bacteriologic diagnosis for the lung abscess?"
}
|
An 83-year-old man with Parkinson's disease presents with low-grade fever and cough for several weeks. Lately, he has been experiencing more rigidity and difficulty with his walking. He is on a levodopa/carbidopa combination for treatment for the past 5 years. On examination, his gait is shuffling and slow. He has a tremor in his left hand at rest, and there is cogwheel rigidity of the forearm. There are crackles in the left lower lung field. CXR reveals a lung abscess in the left lower lobe.
|
Which of the following is the most likely bacteriologic diagnosis for the lung abscess?
|
{
"A": "oropharyngeal flora",
"B": "tuberculosis",
"C": "Staphylococcus aureus",
"D": "Pseudomonas aeruginosa"
}
|
A. oropharyngeal flora
|
a87d6592-2063-49e1-bbbc-dea8027ccb50
|
A 22-year-old woman experiences a sudden onset of severe lower abdominal pain. Physical examination shows no masses, but there is severe tenderness in the right lower quadrant. A pelvic examination shows no lesions of the cervix or vagina. Bowel sounds are detected. An abdominal ultrasound scan shows a 4-cm focal enlargement of the proximal right fallopian tube. A dilation and curettage procedure shows the only decidua from the endometrial cavity. Which of the following laboratory findings is most likely to be reported for this patient?
|
Cervical culture positive for Neisseria gonorrhoeae
|
Detection of human chorionic gonadotropin in serum
|
69, XXY karyotype on decidual tissue cells
|
Pap smear showing pseudo hyphae of Candida
| 1b
|
multi
|
Conditions predisposing to ectopic pregnancy include chronic salpingitis (which may be caused by gonorrhea, but a culture would be positive only with acute infection), intrauterine tumors, and endometriosis. In about half of the cases, there is no identifiable cause. Gestational trophoblastic disease associated with a triploid karyotype with partial mole developing outside the uterus is rare. Candida produces cervicitis and vaginitis and is rarely invasive or extensive in immunocompetent patients. Syphilis is not likely to produce a tubal mass with acute symptoms (a gumma is a rare finding).
|
Pathology
|
Female Genital Tract
| 112 |
{
"Correct Answer": "Detection of human chorionic gonadotropin in serum",
"Correct Option": "B",
"Options": {
"A": "Cervical culture positive for Neisseria gonorrhoeae",
"B": "Detection of human chorionic gonadotropin in serum",
"C": "69, XXY karyotype on decidual tissue cells",
"D": "Pap smear showing pseudo hyphae of Candida"
},
"Question": "A 22-year-old woman experiences a sudden onset of severe lower abdominal pain. Physical examination shows no masses, but there is severe tenderness in the right lower quadrant. A pelvic examination shows no lesions of the cervix or vagina. Bowel sounds are detected. An abdominal ultrasound scan shows a 4-cm focal enlargement of the proximal right fallopian tube. A dilation and curettage procedure shows the only decidua from the endometrial cavity. Which of the following laboratory findings is most likely to be reported for this patient?"
}
|
A 22-year-old woman experiences a sudden onset of severe lower abdominal pain. Physical examination shows no masses, but there is severe tenderness in the right lower quadrant. A pelvic examination shows no lesions of the cervix or vagina. Bowel sounds are detected. An abdominal ultrasound scan shows a 4-cm focal enlargement of the proximal right fallopian tube. A dilation and curettage procedure shows the only decidua from the endometrial cavity.
|
Which of the following laboratory findings is most likely to be reported for this patient?
|
{
"A": "Cervical culture positive for Neisseria gonorrhoeae",
"B": "Detection of human chorionic gonadotropin in serum",
"C": "69, XXY karyotype on decidual tissue cells",
"D": "Pap smear showing pseudo hyphae of Candida"
}
|
B. Detection of human chorionic gonadotropin in serum
|
b75249fa-cad3-4620-a558-89265009270e
|
A 71-year-old woman is receiving a drug to lower her serum cholesterol. Over the past week, she has developed muscle pain and weakness unrelated to physical activity. On examination, she has diffuse but mild muscle tenderness. Laboratory studies show her serum creatine kinase is 2049 U/L and creatinine is 2 mg/dL. Urine dipstick analysis is positive for blood, without RBCs on urine microscopy. Which of the following drugs is most likely to produce her findings?
|
Cholestyramine
|
Clofibrate
|
Ezetimibe
|
Lovastatin
| 3d
|
single
|
She has a statin-induced myopathy, with a creatine kinase level more than 10 times normal from rhabdomyolysis (myoglobin released from muscle can be detected by the urine dipstick). Statins are HMG-CoA reductase inhibitors that reduce endogenous cholesterol synthesis in the liver. Cholestyramine binds bile acids in the intestine and disrupts enterohepatic bile acid circulation to increase the conversion of cholesterol to bile acids in the liver. Clofibrate enhances uptake and oxidation of free fatty acids in muscle. Ezetimibe interferes with intestinal lipid absorption. Nicotinic acid inhibits the mobilization of peripheral free fatty acids to reduce hepatic triglyceride synthesis and secretion of VLDL.
|
Pathology
|
Peripheral Nerve & Skeletal Muscles
| 104 |
{
"Correct Answer": "Lovastatin",
"Correct Option": "D",
"Options": {
"A": "Cholestyramine",
"B": "Clofibrate",
"C": "Ezetimibe",
"D": "Lovastatin"
},
"Question": "A 71-year-old woman is receiving a drug to lower her serum cholesterol. Over the past week, she has developed muscle pain and weakness unrelated to physical activity. On examination, she has diffuse but mild muscle tenderness. Laboratory studies show her serum creatine kinase is 2049 U/L and creatinine is 2 mg/dL. Urine dipstick analysis is positive for blood, without RBCs on urine microscopy. Which of the following drugs is most likely to produce her findings?"
}
|
A 71-year-old woman is receiving a drug to lower her serum cholesterol. Over the past week, she has developed muscle pain and weakness unrelated to physical activity. On examination, she has diffuse but mild muscle tenderness. Laboratory studies show her serum creatine kinase is 2049 U/L and creatinine is 2 mg/dL. Urine dipstick analysis is positive for blood, without RBCs on urine microscopy.
|
Which of the following drugs is most likely to produce her findings?
|
{
"A": "Cholestyramine",
"B": "Clofibrate",
"C": "Ezetimibe",
"D": "Lovastatin"
}
|
D. Lovastatin
|
232792cb-b1de-4aab-84f7-ef28f7110972
|
A 36-year-old woman has a cough and fever for 1 week. On physical examination, her temperature is 38.3deg C. She has diffuse crackles in all lung fields. A chest radiograph shows bilateral extensive infiltrates. CBC shows hemoglobin, 13.9 g/ dL; hematocrit, 42%; MCV, 89 mm3; platelet count, 210,000/mm3; and WBC count, 56,000/mm3 with 63% segmented neutrophils, 16% bands, 7% metamyelocytes, 3% myelocytes, 1% blasts, 8% lymphocytes, and 2% monocytes. A bone marrow biopsy is obtained and shows normal maturation of myeloid cells. Which of the following is the most likely diagnosis?
|
Chronic myelogenous leukemia
|
Hairy cell leukemia
|
Hodgkin lymphoma, lymphocyte depletion type
|
Leukemoid reaction
| 3d
|
multi
|
Marked leukocytosis and immature myeloid cells in the peripheral blood can represent an exaggerated response to infection (leukemoid reaction), or it can be a manifestation of chronic myelogenous leukemia (CML). Normal maturation of myeloid cells in the marrow rules out CML. Although not provided in this case, a leukocyte alkaline phosphatase (LAP) score is high in the more differentiated cell population of reactive leukocytosis, whereas in CML, the LAP score is low. The Philadelphia chromosome (present in most CML cases) is lacking in patients with leukemoid reactions. Hairy cell leukemia is accompanied by peripheral blood leukocytes that mark with tartrate-resistant acid phosphatase. Hodgkin lymphoma is not characterized by an increased WBC count. A myelodysplastic syndrome is a stem cell maturation disorder involving all nonlymphoid cell lineages, not just granulocytes.
|
Pathology
|
Blood
| 190 |
{
"Correct Answer": "Leukemoid reaction",
"Correct Option": "D",
"Options": {
"A": "Chronic myelogenous leukemia",
"B": "Hairy cell leukemia",
"C": "Hodgkin lymphoma, lymphocyte depletion type",
"D": "Leukemoid reaction"
},
"Question": "A 36-year-old woman has a cough and fever for 1 week. On physical examination, her temperature is 38.3deg C. She has diffuse crackles in all lung fields. A chest radiograph shows bilateral extensive infiltrates. CBC shows hemoglobin, 13.9 g/ dL; hematocrit, 42%; MCV, 89 mm3; platelet count, 210,000/mm3; and WBC count, 56,000/mm3 with 63% segmented neutrophils, 16% bands, 7% metamyelocytes, 3% myelocytes, 1% blasts, 8% lymphocytes, and 2% monocytes. A bone marrow biopsy is obtained and shows normal maturation of myeloid cells. Which of the following is the most likely diagnosis?"
}
|
A 36-year-old woman has a cough and fever for 1 week. On physical examination, her temperature is 38.3deg C. She has diffuse crackles in all lung fields. A chest radiograph shows bilateral extensive infiltrates. CBC shows hemoglobin, 13.9 g/ dL; hematocrit, 42%; MCV, 89 mm3; platelet count, 210,000/mm3; and WBC count, 56,000/mm3 with 63% segmented neutrophils, 16% bands, 7% metamyelocytes, 3% myelocytes, 1% blasts, 8% lymphocytes, and 2% monocytes. A bone marrow biopsy is obtained and shows normal maturation of myeloid cells.
|
Which of the following is the most likely diagnosis?
|
{
"A": "Chronic myelogenous leukemia",
"B": "Hairy cell leukemia",
"C": "Hodgkin lymphoma, lymphocyte depletion type",
"D": "Leukemoid reaction"
}
|
D. Leukemoid reaction
|
cc01e2e0-6470-4a6a-8834-a4eabfa4f3aa
|
A 5-year-old child is brought to the emergency room with massive, painless bleeding from the rectum. Colonoscopy fails to demonstrate a lesion in the colon or anus. Upper endoscopy fails to demonstrate esophagitis, gastric ulcer or duodenal ulcer. A 99mTc (technetium) scan demonstrates an abnormality in the lower half of the abdomen. Failure of a normal developmental process involving which of the following structures is the most likely cause of this child's bleeding?
|
Appendix
|
Cecum
|
Duodenum
|
Ileum
| 3d
|
single
|
A Meckel's diveiculum is caused by failure of obliteration of the vitello-intestinal duct. It is classically located in the distal ileum within 30 cm of the ileocecal valve, and the structure is a true diveiculum with mucosa, submucosa, and muscularis propria. Many Meckel's diveicula contain ectopic pancreatic tissue or gastric mucosa, and the acid production from the gastric mucosa may be sufficient to produce a small peptic ulcer in adjacent intestinal mucosa. Such small peptic ulcers are occasional sources of mysterious appendicitis-like pain or intestinal bleeding. Peptic ulceration adjacent to a Meckel's diveiculum should be suspected in any child who presents with massive, painless rectal bleeding. Technetium concentrates in gastric mucosa, and the scan in this patient demonstrated a small amount of ectopic gastric mucosa located in the diveiculum.Acute appendicitis is usually very painful and does not typically cause rectal bleeding. A lesion of the cecum would have been revealed by thorough colonoscopy. Failure of upper endoscopy to demonstrate a peptic ulcer of the duodenum makes duodenal disease unlikely.
|
Anatomy
| null | 106 |
{
"Correct Answer": "Ileum",
"Correct Option": "D",
"Options": {
"A": "Appendix",
"B": "Cecum",
"C": "Duodenum",
"D": "Ileum"
},
"Question": "A 5-year-old child is brought to the emergency room with massive, painless bleeding from the rectum. Colonoscopy fails to demonstrate a lesion in the colon or anus. Upper endoscopy fails to demonstrate esophagitis, gastric ulcer or duodenal ulcer. A 99mTc (technetium) scan demonstrates an abnormality in the lower half of the abdomen. Failure of a normal developmental process involving which of the following structures is the most likely cause of this child's bleeding?"
}
|
A 5-year-old child is brought to the emergency room with massive, painless bleeding from the rectum. Colonoscopy fails to demonstrate a lesion in the colon or anus. Upper endoscopy fails to demonstrate esophagitis, gastric ulcer or duodenal ulcer. A 99mTc (technetium) scan demonstrates an abnormality in the lower half of the abdomen.
|
Failure of a normal developmental process involving which of the following structures is the most likely cause of this child's bleeding?
|
{
"A": "Appendix",
"B": "Cecum",
"C": "Duodenum",
"D": "Ileum"
}
|
D. Ileum
|
037cebd2-3585-4aa5-a3f3-98a08ccd98f9
|
A 40-year-old woman admitted with fever, chills, and changing mental status is transferred to the ICU with a clinical suspicion of sepsis. Examination shows sinus tachycardia, no murmur, and clear lung fields. The patient is given IV fluids aggressively for hydration. Blood cultures are drawn and the patient is placed on antibiotics. Subcutaneous heparin is given for thromboembolic prophylaxis. As the patient does not improve satisfactorily, a procedure is performed. One hour after this procedure, the patient suddenly develops moderate hemoptysis. A CXR is done.The next step should be
|
Perform an urgent echocardiogram
|
Administer protamine sulfate
|
Sta inotropic agents
|
Withdraw the catheter
| 3d
|
multi
|
This chest x-ray shows a pulmonary aery catheter inseed through the internal jugular vein. The PA catheter extends peripherally beyond the right ventricular shadow and past the main pulmonary aery branches into the subsegmental vessels. The patient presents with sepsis and septic shock. It is impoant to determine the fluid status of the patient, especially if no improvement is noted with initial fluid challenge. The procedure performed was a placement of a pulmonary aery catheter to determine the capillary wedge pressure. The PA catheter in this case extended peripherally into the small vessels and thereby caused pulmonary infarction. The hemoptysis represents that complication, and withdrawal of the catheter is of utmost priority. Other options outlined are inappropriate or inapplicable.
|
Radiology
|
Fundamentals in Radiology
| 130 |
{
"Correct Answer": "Withdraw the catheter",
"Correct Option": "D",
"Options": {
"A": "Perform an urgent echocardiogram",
"B": "Administer protamine sulfate",
"C": "Sta inotropic agents",
"D": "Withdraw the catheter"
},
"Question": "A 40-year-old woman admitted with fever, chills, and changing mental status is transferred to the ICU with a clinical suspicion of sepsis. Examination shows sinus tachycardia, no murmur, and clear lung fields. The patient is given IV fluids aggressively for hydration. Blood cultures are drawn and the patient is placed on antibiotics. Subcutaneous heparin is given for thromboembolic prophylaxis. As the patient does not improve satisfactorily, a procedure is performed. One hour after this procedure, the patient suddenly develops moderate hemoptysis. A CXR is done.The next step should be"
}
|
A 40-year-old woman admitted with fever, chills, and changing mental status is transferred to the ICU with a clinical suspicion of sepsis. Examination shows sinus tachycardia, no murmur, and clear lung fields. The patient is given IV fluids aggressively for hydration. Blood cultures are drawn and the patient is placed on antibiotics. Subcutaneous heparin is given for thromboembolic prophylaxis. As the patient does not improve satisfactorily, a procedure is performed. One hour after this procedure, the patient suddenly develops moderate hemoptysis.
|
A CXR is done.The next step should be
|
{
"A": "Perform an urgent echocardiogram",
"B": "Administer protamine sulfate",
"C": "Sta inotropic agents",
"D": "Withdraw the catheter"
}
|
D. Withdraw the catheter
|
3969b60c-4c8b-40ee-9347-e3905c9b0199
|
A 55-year-old man presented to his general physician with pain and swelling of his right great toe. He repoed he has had this pain for approximately 2 days and it is getting worse. He also stated that he had a similar episode of this 4 years ago, but in the interim, he has been symptom free. He was given something for the prior episode, but does not recall the name. He denied trauma, fever, chills or sweats, and has been afebrile. On physical examination, he was afebrile and his right great toe is swollen at the metatarsophalangeal joint. There was decreased range of motion. X-ray films are unrevealing. He had no other joint involvement. A joint aspiration is performed. Which of the following types of crystals in the joint aspirate would confirm the likely diagnosis?
|
Negatively-birefringent needle-shaped crystals.
|
Negatively-birefringent oval crystals.
|
Negatively-birefringent rhomboidal shaped crystals.
|
Positively-birefringent needle-shaped crystals.
| 0a
|
multi
|
Negatively-birefringent needle-shaped crystals are classically found in the diagnosis of gout. Positively-birefringent rhomboidal crystals are diagnostic for pseudogout, or calcium pyrophosphate crystal deposition. The other choices are not diagnostic or commonly occurring combinations.
|
Surgery
| null | 178 |
{
"Correct Answer": "Negatively-birefringent needle-shaped crystals.",
"Correct Option": "A",
"Options": {
"A": "Negatively-birefringent needle-shaped crystals.",
"B": "Negatively-birefringent oval crystals.",
"C": "Negatively-birefringent rhomboidal shaped crystals.",
"D": "Positively-birefringent needle-shaped crystals."
},
"Question": "A 55-year-old man presented to his general physician with pain and swelling of his right great toe. He repoed he has had this pain for approximately 2 days and it is getting worse. He also stated that he had a similar episode of this 4 years ago, but in the interim, he has been symptom free. He was given something for the prior episode, but does not recall the name. He denied trauma, fever, chills or sweats, and has been afebrile. On physical examination, he was afebrile and his right great toe is swollen at the metatarsophalangeal joint. There was decreased range of motion. X-ray films are unrevealing. He had no other joint involvement. A joint aspiration is performed. Which of the following types of crystals in the joint aspirate would confirm the likely diagnosis?"
}
|
A 55-year-old man presented to his general physician with pain and swelling of his right great toe. He repoed he has had this pain for approximately 2 days and it is getting worse. He also stated that he had a similar episode of this 4 years ago, but in the interim, he has been symptom free. He was given something for the prior episode, but does not recall the name. He denied trauma, fever, chills or sweats, and has been afebrile. On physical examination, he was afebrile and his right great toe is swollen at the metatarsophalangeal joint. There was decreased range of motion. X-ray films are unrevealing. He had no other joint involvement. A joint aspiration is performed.
|
Which of the following types of crystals in the joint aspirate would confirm the likely diagnosis?
|
{
"A": "Negatively-birefringent needle-shaped crystals.",
"B": "Negatively-birefringent oval crystals.",
"C": "Negatively-birefringent rhomboidal shaped crystals.",
"D": "Positively-birefringent needle-shaped crystals."
}
|
A. Negatively-birefringent needle-shaped crystals.
|
25b34e89-459b-4d24-9269-20e25af6d454
|
A 63-year-old man who has been previously healthy is admitted to the hospital with a 2-day history of cough, rigors, fever, and right-sided pleuritic chest pain. Chest x-ray shows consolidation of the right lower lobe (RLL) and a free-flowing right pleural effusion. Thoracentesis is performed, and the pleural fluid has the following characteristics:Cell count=1110/mm3Glucose=75 mg/dL (serum glucose=85 mg/dL)Protein=4.0 g/dL (serum protein=7.0 g/dL)LDH=400 U/Lserum LDH=200 U/L, normal=100-200 U/LpH=7.35What is the pathogenesis of the pleural effusion?
|
Increase in hydrostatic pressure
|
Decrease in oncotic pressure
|
Increased permeability of visceral pleural membrane capillaries
|
Bacterial infection in the pleural space
| 2c
|
single
|
Clinical conditions associated with either an increase in hydrostatic pressure (such as congestive heart failure) or a decrease in oncotic pressure (such as nephrotic syndrome) are associated with transudative pleural effusions. This patient's pleural fluid is exudative by all three of the Light criteria: pleural fluid/serum protein ratio is greater than 0.5, pleural fluid LDH/serum LDH ratio is greater than 0.6, and pleural fluid LDH is greater than two-thirds the upper limits of the normal serum LDH. The most likely explanation for an exudative pleural effusion in the setting of an acute pneumonia is a parapneumonic effusion. Parapneumonic effusions occur in about 40% of patients with bacterial pneumonia. Parapneumonic effusions are exudative due to the fact that there is increased permeability of the visceral pleural membrane capillaries, and interstitial fluid moves across the visceral pleura into the pleural space. Parapneumonic effusions may be simple or complicated. Simple parapneumonic effusions are sterile and free flowing. If bacteria invade the pleural space, neutrophils move into the pleural space and anaerobic metabolism of glucose results in a low pleural fluid pH (<7.20) and glucose (<60). The characteristics of this patient's pleural fluid suggest that bacterial invasion of the pleural space has not occurred, and that this is a simple parapneumonic effusion. Hemorrhage into the pleural space occurs with trauma, cancer, and pulmonary embolism, but rarely with pneumonia.
|
Medicine
|
Respiratory
| 181 |
{
"Correct Answer": "Increased permeability of visceral pleural membrane capillaries",
"Correct Option": "C",
"Options": {
"A": "Increase in hydrostatic pressure",
"B": "Decrease in oncotic pressure",
"C": "Increased permeability of visceral pleural membrane capillaries",
"D": "Bacterial infection in the pleural space"
},
"Question": "A 63-year-old man who has been previously healthy is admitted to the hospital with a 2-day history of cough, rigors, fever, and right-sided pleuritic chest pain. Chest x-ray shows consolidation of the right lower lobe (RLL) and a free-flowing right pleural effusion. Thoracentesis is performed, and the pleural fluid has the following characteristics:Cell count=1110/mm3Glucose=75 mg/dL (serum glucose=85 mg/dL)Protein=4.0 g/dL (serum protein=7.0 g/dL)LDH=400 U/Lserum LDH=200 U/L, normal=100-200 U/LpH=7.35What is the pathogenesis of the pleural effusion?"
}
|
A 63-year-old man who has been previously healthy is admitted to the hospital with a 2-day history of cough, rigors, fever, and right-sided pleuritic chest pain. Chest x-ray shows consolidation of the right lower lobe (RLL) and a free-flowing right pleural effusion.
|
Thoracentesis is performed, and the pleural fluid has the following characteristics:Cell count=1110/mm3Glucose=75 mg/dL (serum glucose=85 mg/dL)Protein=4.0 g/dL (serum protein=7.0 g/dL)LDH=400 U/Lserum LDH=200 U/L, normal=100-200 U/LpH=7.35What is the pathogenesis of the pleural effusion?
|
{
"A": "Increase in hydrostatic pressure",
"B": "Decrease in oncotic pressure",
"C": "Increased permeability of visceral pleural membrane capillaries",
"D": "Bacterial infection in the pleural space"
}
|
C. Increased permeability of visceral pleural membrane capillaries
|
a1734ce5-c736-4dc9-b9da-b42e37f4597b
|
A 48 year old woman was admitted with a history of weakness for two months. On examination, cervical lymph nodes were found enlarged and spleen was palpable 2 cm below the costal margin. Her hemoglobin was 10.5 g/dl, platelet count 2.7 X 1091 L and total leukocyte count 40 X 109/ L, which included 80% mature lymphoid cells with coarse clumped chromatin. Bone marrow revealed a nodular lymphoid infiltrate. The peripheral blood lymphoid cells were positive for CD 19, CD5, CD20 and CD23 and were negative for CD 79 B and FMC-7. The histopathological examination of the lymph node in this patient will most likely exhibit effacement of lymph node arachitecture by -
|
A pseudofollicular pattern with proliferation centers
|
A monomorphic lymphoid proliferation with a nodular pattern
|
A predominantly follicular pattern
|
A diffuse proliferation of medium to large lymphoid cells with high mitotic rate
| 3d
|
single
|
Ans is 'd' i.e., A diffuse proliferation of medium to large lymphoid cells with high mitotic rate o Lymphocytes postive for CD 19, CD20, CD23, CD5 suggest the diagnosis of chronic lymphocytic leukemia/small lymphcytic lymphoma. o In CLL/SLL larger lymphocytes show high mitotic activity and form proliferation centre. Chronic lymphocytic leukemia (CLL). small lymphocytic lymphoma (SLL). o CLL and SLL are identical neoplasms/arise due to an abnormal neoplastic proliferation of B cells. o CLL involves primarily bone marrow and blood, while SLL involves lymph nodes Morphology of CLL/SLL o The tumor cells of CLL are small B lymphocytes. o Leukemic cells have the morphological appearance of normal small to medium sized lymphocytes with clumped chromatin, inconspicuous nuclei and a small ring of cytoplasm. o The lymph node architecture is diffusely effaced by these tumor cells. o These cells are mixed with variable numbers of larger cells called prolymphocytes. o In many cases, prolymphyocytes gather together focally to form as proliferation centers, so called because they contain relatively large number of mitotic activity. o When present proliferation centers are pathognomonic for CLL/SLL. o In CLL, the peripheral blood contains increased numbers of small, round lymphocytes with scant frequently disrupted in the process of making smears, producing So called smudge cells.. Markers of CLL tumor cells o CLL is a tumor of mature B-cells, therefore it expresses the B-cell markers such as CD19, CD20 and surface IgM and IgD. o In addition CD23 and CD5 are also present (In contrast to mantle cell lymphoma which is positive for CD5 but negative for CD23).
|
Pathology
| null | 179 |
{
"Correct Answer": "A diffuse proliferation of medium to large lymphoid cells with high mitotic rate",
"Correct Option": "D",
"Options": {
"A": "A pseudofollicular pattern with proliferation centers",
"B": "A monomorphic lymphoid proliferation with a nodular pattern",
"C": "A predominantly follicular pattern",
"D": "A diffuse proliferation of medium to large lymphoid cells with high mitotic rate"
},
"Question": "A 48 year old woman was admitted with a history of weakness for two months. On examination, cervical lymph nodes were found enlarged and spleen was palpable 2 cm below the costal margin. Her hemoglobin was 10.5 g/dl, platelet count 2.7 X 1091 L and total leukocyte count 40 X 109/ L, which included 80% mature lymphoid cells with coarse clumped chromatin. Bone marrow revealed a nodular lymphoid infiltrate. The peripheral blood lymphoid cells were positive for CD 19, CD5, CD20 and CD23 and were negative for CD 79 B and FMC-7. The histopathological examination of the lymph node in this patient will most likely exhibit effacement of lymph node arachitecture by -"
}
|
A 48 year old woman was admitted with a history of weakness for two months. On examination, cervical lymph nodes were found enlarged and spleen was palpable 2 cm below the costal margin. Her hemoglobin was 10.5 g/dl, platelet count 2.7 X 1091 L and total leukocyte count 40 X 109/ L, which included 80% mature lymphoid cells with coarse clumped chromatin. Bone marrow revealed a nodular lymphoid infiltrate. The peripheral blood lymphoid cells were positive for CD 19, CD5, CD20 and CD23 and were negative for CD 79 B and FMC-7.
|
The histopathological examination of the lymph node in this patient will most likely exhibit effacement of lymph node arachitecture by -
|
{
"A": "A pseudofollicular pattern with proliferation centers",
"B": "A monomorphic lymphoid proliferation with a nodular pattern",
"C": "A predominantly follicular pattern",
"D": "A diffuse proliferation of medium to large lymphoid cells with high mitotic rate"
}
|
D. A diffuse proliferation of medium to large lymphoid cells with high mitotic rate
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.